WO2016089178A1 - 에너지를 이용한 다능성 세포 유도 장치 및 방법 - Google Patents

에너지를 이용한 다능성 세포 유도 장치 및 방법 Download PDF

Info

Publication number
WO2016089178A1
WO2016089178A1 PCT/KR2015/013269 KR2015013269W WO2016089178A1 WO 2016089178 A1 WO2016089178 A1 WO 2016089178A1 KR 2015013269 W KR2015013269 W KR 2015013269W WO 2016089178 A1 WO2016089178 A1 WO 2016089178A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
culture
pluripotent
culture medium
physics
Prior art date
Application number
PCT/KR2015/013269
Other languages
English (en)
French (fr)
Inventor
김순학
Original Assignee
가톨릭관동대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭관동대학교산학협력단 filed Critical 가톨릭관동대학교산학협력단
Priority to EP15866086.0A priority Critical patent/EP3241896B1/en
Priority to US15/532,032 priority patent/US11773387B2/en
Priority to CN201580075450.XA priority patent/CN107438668B/zh
Priority to JP2017549154A priority patent/JP6986968B2/ja
Priority claimed from KR1020150172501A external-priority patent/KR101798726B1/ko
Publication of WO2016089178A1 publication Critical patent/WO2016089178A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M1/00—Apparatus for enzymology or microbiology
    • C12M1/42—Apparatus for the treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M3/00—Tissue, human, animal or plant cell, or virus culture apparatus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N13/00—Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
    • H—ELECTRICITY
    • H01—ELECTRIC ELEMENTS
    • H01S—DEVICES USING THE PROCESS OF LIGHT AMPLIFICATION BY STIMULATED EMISSION OF RADIATION [LASER] TO AMPLIFY OR GENERATE LIGHT; DEVICES USING STIMULATED EMISSION OF ELECTROMAGNETIC RADIATION IN WAVE RANGES OTHER THAN OPTICAL
    • H01S3/00—Lasers, i.e. devices using stimulated emission of electromagnetic radiation in the infrared, visible or ultraviolet wave range

Definitions

  • the present invention relates to a pluripotent cell induction apparatus and method using energy that can induce pluripotent cells with pluripotent properties through the provision of energy such as ultrasound, laser or heat treatment.
  • Pluripotency is the ability to differentiate into three types of germ layers: ectoderm, mesoderm and endoderm.
  • Pluripotent stem cells are clinically important in disease models and transplantation because they generate any cell or tissue type in the body.
  • iPSCs induced pluripotent stem cells
  • somatic cells somatic cells
  • patient-derived cells the introduction of foreign genetic material or chemicals or small molecules for clinical applications. It should be simple, fast, effective and safe. Recent studies have demonstrated that the interaction between environment and genotype is closely related to gene expression and phenotypic variation in living organisms.
  • the present inventors express a pluripotent characteristic of expressing and undifferentiating the three-germ marker gene consisting of ectodermal, mesoderm and endoderm by providing energy using cellular environment signals in the absence of genes and chemicals.
  • new multi-functional by cells developed a new method for inducing a so-called Physics (p luripotent sp h ere y ielded by ultra s on ic s timulus) cells with the present invention has been completed.
  • the present invention comprises mixing the culture medium and the differentiated cells, providing energy to the mixture to form a spheroid (spheroid) through a certain period of time,
  • the spheroid has a pluripotency property, and provides a method for reverse differentiation from differentiated cells to pluripotent cells.
  • the present invention also provides a culture chamber capable of containing cells and culture medium; And a device disposed on one side of the culture chamber and capable of providing energy to the cells and the culture medium, mixing the differentiated cells and the culture medium,
  • the spheroid provides a pluripotent cell induction device having a pluripotency property.
  • the present invention differentiates in comparison with known induced pluripotent stem cells, while having pluripotent characteristics in differentiated cells through the provision of energy by appropriate ultrasound, laser, or heat treatment, etc., without the introduction of derivatization inducers and chemicals into differentiated cells. It has the effect of inducing new types of pluripotent cells with strong properties.
  • FIG. 1 is a schematic diagram of human Physics cells having pluripotent properties according to the present invention.
  • Figure 2a shows the effect of the ultrasound intensity on human skin fibroblasts
  • a) is a comparison of HDF morphological changes by ultrasound intensity
  • b) is the number of multicellular spheroids generated by ultrasound intensity.
  • 2B shows the effect of ultrasound intensity on human skin fibroblasts, c) live / dead cell assay of sonicated HDF, d) the percentage of live and damaged cells in c).
  • Figure 3a shows the effect of the ultrasonic exposure time under a fixed intensity of 1 W / cm 2
  • a) is a comparison of HDF morphological changes by ultrasonic exposure time
  • b) is the number of multicellular spheroids generated by the ultrasonic exposure time .
  • Figure 3b shows the effect of ultrasound exposure time under a fixed intensity of 1 W / cm 2 , c) live / dead cell assay of sonicated HDF, d) the percentage of live and damaged cells in c) to be.
  • Figure 4 shows the effect of ultrasound intensity on human ESC culture medium, the top is a comparison of the morphological changes of the ultrasound-treated HDF grown in the sonicated medium, the bottom is the number of multicellular spheroids generated above.
  • Figure 5 shows the effect of the ultrasonic exposure time of human ESC culture medium under a fixed intensity of 5 W / cm 2
  • a) is a comparison of the morphological changes of ultrasonic-treated HDF grown in sonicated medium
  • FIG. 6 shows the effects of sonication conditions and culture conditions for producing multicellular spheroids, a) is suspension culture, b) is monolayer culture.
  • Figure 7a shows the size distribution of multicellular spheroids produced by ultrasonic stimulation stars (UC, UM, UCUM) under floating culture conditions, a) is the total size, b) is the distribution of spheroids of 50-100 ⁇ m size .
  • Figure 7b shows the size distribution of multicellular spheroids produced by ultrasonic stimulation stars (UC, UM, UCUM) under floating culture conditions, c) is 100-200 ⁇ m, d) distribution of spheroids of> 200 ⁇ m size to be.
  • Figure 8a shows the size distribution of multicellular spheroids produced by ultrasonic stimulation stars (UC, UM, UCUM) under monolayer culture conditions, a) is the total size, b) is the distribution of spheroids of 50-100 ⁇ m size .
  • Figure 8b shows the size distribution of multicellular spheroids produced by ultrasonic stimulation stars (UC, UM, UCUM) under monolayer culture conditions, c) is 100-200 ⁇ m, d) distribution of spheroids of> 200 ⁇ m size to be.
  • 9A shows the results of RT-PCR analysis comparing expression levels of pluripotent marker genes, OCT3 / 4 (a) and SOX2 (b), of human Physics cells between suspension culture and monolayer culture conditions.
  • 9B shows the results of RT-PCR analysis comparing expression levels of pluripotent marker genes, NANOG (c) and TDGF1 (d), of human Physics cells between suspension culture and monolayer culture conditions.
  • 10A is a confocal laser microscope image of OCT3 / 4 expression levels in suspension culture.
  • 10B is a confocal laser microscope image of OCT3 / 4 expression levels in monolayer culture.
  • 11 shows RT-PCR analysis of pluripotent marker gene expression for 6 days of culture.
  • 16A shows the results of FACS analysis of human ES (H9) cell surface markers.
  • 16B shows FACS analysis of human HDF cell surface markers.
  • 16C shows FACS analysis of human Physics cell surface markers.
  • Figure 17 shows the results of analysis of protein expression by immunocytochemistry (b) with gene expression RT-PCR (a) of pluripotency markers when co-culture of feeder cells and physics cells.
  • 19 is a result of verification of proliferative capacity of human physics cells, a) shows the expression of Ki67, a proliferation marker, b) stained the increased cells using H33342 and PI, and c) according to the culture time. It shows the size of the spheroid.
  • 21A is an immunocytochemical analysis of the expression of trioderm markers from human ES (H9) cells.
  • 21B is an immunocytochemical analysis of the expression of trioderm markers from human Physics cells.
  • FIG. 22 shows immunocytochemical analysis of expression patterns of OCT3 / 4 and triploid markers for 15 days of culture of human Physics cells.
  • FIG. 23 shows SEM images of human Physics cells according to ultrasonic stimulation conditions.
  • FIG. 24 shows the results of live / dead cell analysis of human Physics cells as seen in fluorescence images after sonication and 2 hours of incubation for each ultrasonic stimulation condition.
  • FIG. 25 shows live / kill cell analysis of human Physics cells after formation of multicellular spheroids.
  • 26 is a change of the Ca 2 + concentration of cells by ultrasonic stimulation.
  • FIG. 28 is a fluorescence image of human Physics cells stained with CM-H2DCFDA to analyze the generation of intracellular H 2 O 2 by sonication in FIG. 27.
  • 29 shows the results of analysis of the release of intracellular ATP by ultrasonic stimulation.
  • FIG. 30 shows expression patterns of P2X and P2Y receptors in human Physics cells.
  • FIG. 31 is a confocal microscopy image demonstrating higher infiltration capacity of human Physics cells using Quantum dot 705.
  • FIG. 31 is a confocal microscopy image demonstrating higher infiltration capacity of human Physics cells using Quantum dot 705.
  • 34 is an immunocytochemical result of the expression of three germline markers of in vitro differentiated human Physics cells.
  • Figure 35 shows the results of RT-PCR analysis of neural line gene expression to confirm in vitro differentiation of human Physics cells.
  • FIG. 41 shows tissue immunofluorescence staining results to confirm in vivo differentiation of human Physics cells in mouse testis.
  • Figure 43 shows the effect of the cell culture medium, a) using the ES medium and HDF culture medium, b) is the result of inducing human Physics cells in ES medium and HDF culture medium and confirming the ES marker.
  • 45 shows the results of deriving human Physics cells from patient skin cells. a) shows the change in cell morphology, and b) shows the result of inducing human Physics cells in other cell lines and identifying ES markers and triplets.
  • FIG. 46 shows the results of heat treatment with different energy sources to induce human Physics cells and to identify ES markers and triploid markers.
  • FIG. 47 shows the results of inducing human Physics cells using a laser as another energy source and identifying ES markers and triploid markers.
  • A is the result of confirming GFP expression in mouse Physics spheroid
  • B Is a tile scan picture that combines a wide range of pictures.
  • FIG. 50 shows the results of analyzing the GFP expression rate in all cells treated with ultrasound using the GFP expression rate graph and the flow cytometry of the spheroid formed by ultrasound.
  • Figure 51 shows the results of analysis of the expression of cell surface undifferentiated marker (SSEA1) in mouse Physics cells using flow cytometry.
  • Fig. 53 shows the results of analysis of pluripotent protein markers in mouse Physics cells by immunocytochemistry.
  • FIG. 55 shows the results of RT-PCR analysis of the expression of trioderm markers from mouse Physics cells.
  • Fig. 56 shows the results of immunocytochemistry analysis on the expression of three germ layer markers from mouse Physics cells.
  • the present invention comprises mixing the culture medium and the differentiated cells, providing energy to the mixture to form a spheroid through a certain time of culture,
  • the spheroid relates to a method for dedifferentiating from differentiated cells to pluripotent cells, which has pluripotency properties.
  • the present invention provides pluripotency characteristics from differentiated cells by providing appropriate energy without introducing dedifferentiation inducers or chemicals into the differentiated cells. It is characterized by being able to induce a new type of pluripotent cells with differentiation properties.
  • the pluripotent cells are distinguished from known induced pluripotent stem cells in that differentiation is well induced according to an external environment, and that the properties of progenitor cells having strong differentiation properties compared to those of stem cells are stronger. .
  • a preparatory step of undergoing a differentiation process is required, which includes a risk factor that can turn into cancer, and a virus for introducing a differentiation inducer.
  • pluripotent cells of the present invention are induced without introducing a differentiation-inducing substance such as a back-differentiation inducer or a chemical for genetic variation, so co-culture with other types of cells
  • a differentiation-inducing substance such as a back-differentiation inducer or a chemical for genetic variation
  • the pluripotent cells of the present invention have the advantage that the induction process is simple and short, so that time can be dramatically reduced until transplantation by treating autologous cells.
  • the present invention is specifically capable of producing spheroids in good yields by providing energy to both culture medium and differentiated cells.
  • the energy can be any one of ultrasound, laser or heat treatment.
  • the pluripotent cells of the present invention are any of the undifferentiated markers of OCT3 / 4, SOX2, NANOG, c-MYC, KLF4, TDGF1, SSEA4, TRA-1-60, PAX6, Nestin, Brachyury, SMA, GATA4, or AFP It is characterized by stably expressing three germ layer marker genes consisting of mesoderm and endoderm.
  • the inventors considered the association with exosomes with respect to the formation of pluripotent cells without introduction of dedifferentiation inducers into differentiated cells. That is, ultrasound, laser, or heat treatment induces temperature rise by energy, induction of reactive oxygen species (ROS), vibration of microbubbles generated by ultrasound, induction of flow generation of liquid, that is, induction of microstream generation along the cell membrane.
  • ROS reactive oxygen species
  • This effect causes fine damage to the cell membrane and induces the formation of pores to increase the uptake of foreign substances, which is demonstrated by confirming the intracellular Ca 2 + concentration change analysis and H 2 O 2 production.
  • ATP was used as a response signal to various cellular stresses and analyzed the ATP concentration in pluripotent cells after sonication, and released ATP at a higher level than the untreated control group.
  • the expression of ion-directed P2X receptor and metabolic P2Y receptor by ATP release was also activated in pluripotent cells compared to the control group.
  • exosomes are known to contain genetic information (DNA, mRNA, microRNA, protein) inside the exosomes through the process of exosomes that escaped out of the cell membrane through the damage to the cell membrane reenters other cells around the inside Genetic information material present in can be delivered. Therefore, as the stimulation by the ultrasonic treatment causes the expression of undifferentiated markers that have been under-expressed or remained in the suppressed state of the cell and damages the cell membrane, the undifferentiated markers in which the expression is induced or promoted are induced. Exosomes inside the containing cells are discharged to the outside and delivered to the surrounding cells.
  • DNA DNA, mRNA, microRNA, protein
  • the culture medium is recovered during the process of pluripotent cell induction, and the exosomes in the medium are extracted to determine whether there are pluripotent cell-related undifferentiated markers inside the exosomes. It is seen and confirmed to support the hypothesis of the present inventors. In addition, such ultrasonic, laser, or heat treatments were found to be normal without karyotyping.
  • pluripotent cell refers to a cell that has obtained pluripotency after energy, laser, or heat treatment in a strict sense.
  • the pluripotency means a state of stably expressing undifferentiated markers expressed in embryonic stem cells. In addition, it means a state expressing three kinds of endoderm, ectoderm and mesoderm three germ layers markers.
  • the pluripotent cells may be used interchangeably with "Physics (p luripotent sp h ere y ielded by ultra s on ic s timulus) cell", or "Physics spheroid". The differentiation method of the differentiated cells into pluripotent cells of the present invention will be described in detail with reference to FIG. 1 as follows.
  • the cell culture medium and the differentiated cells are mixed and the mixture is energized.
  • Energy may be provided to the cell culture medium prior to providing energy to the mixture of differentiated cells to increase the efficiency of reverse differentiation into pluripotent cells.
  • the energy may be any one of ultrasonic wave, laser, or heat treatment.
  • Ultrasonic treatment of the culture medium has an output intensity of 1W / cm 2 1 to 20 minutes to the ultrasound of 20W / cm 2, specifically, the output strength of 2W / cm 2 To 10 W / cm 2 of ultrasound for 5 to 15 minutes, more specifically, output intensity 3 W / cm 2 To 7 W / cm 2 may be performed for 7 to 13 minutes.
  • Laser treatment of the culture medium may be performed from 1 to 20 seconds for pulsed laser beams in the 300 to 900 nm wavelength band, more specifically 3 to 10 seconds for pulsed laser beams in the wavelength band, more specifically to the wavelengths.
  • the pulsed laser beam of the band may be irradiated for 4 to 6 seconds.
  • the wavelength band may use a wavelength of 400 nm, 808 nm, and 880 nm.
  • Heat treatment of the culture medium may be carried out for 5 to 20 minutes at a temperature condition of 40 to 50 °C.
  • culture medium embryonic stem cell culture medium, stem cell differentiation induction medium and the like can be used.
  • fibroblasts derived from mammals Cancer cells, including cervical cancer cells (HeLa cells); Or organ tissue cells, including lung epithelial cells (L132 cell) can be used.
  • Cancer cells including cervical cancer cells (HeLa cells);
  • organ tissue cells including lung epithelial cells (L132 cell)
  • L132 cell lung epithelial cells
  • the sonication of the mixture of culture medium and differentiated cells is performed for 1 to 5 seconds at a power intensity of 0.5 W / cm 2 to 3 W / cm 2 , more specifically, from 0.7 W / cm 2 to 2 W / cm 2.
  • the output strength may be performed for 1 to 5 seconds at 0.8W / cm 2 to 1.5W / cm 2 .
  • Laser treatment of the mixture of the culture medium and the differentiated cells can be performed from 1 second to 20 seconds for a pulsed laser beam in the 300 to 900 nm wavelength band, more specifically 3 seconds to 10 seconds for a pulsed laser beam in the wavelength band, More specifically, the pulsed laser beam of the wavelength band may be irradiated for 4 seconds to 6 seconds.
  • the wavelength band may use a wavelength of 400 nm, 808 nm, and 880 nm.
  • the heat treatment of the mixture of the culture medium and the differentiated cells may be performed by exposing for 1 minute to 10 minutes at a temperature condition of 40 to 50 ° C. and then exposing for 5 to 10 seconds at a temperature condition of 0 ° C. to 4 ° C. .
  • the mixture provided with energy is incubated for a period of time to form a spheroid having pluripotency.
  • Cultivation of the energy-supplied mixture may be performed for a period of 3 to 10 days during which spheroids stably expressing undifferentiated markers are formed through a suspended culture or monolayer culture.
  • the incubation time is different depending on whether the spheroid formation having pluripotency depending on the culture method, cell or culture medium can be appropriately adjusted at the level of those skilled in the art.
  • the suspension culture exhibits higher spheroid formation efficiency compared to monolayer culture.
  • the floating culture has a larger number and size of spheroids than a single layer culture, and shows a constant size distribution.
  • the expression of undifferentiated markers is increased or stabilized from about 3 days in the suspension culture of human dermal fibroblasts subjected to ultrasound or laser treatment, and dedifferentiation starts from this period.
  • the expression of undifferentiated markers increased or stabilized from about 8 days, and it appears that reverse differentiation starts from this time.
  • spheroids have pluripotency through expression of undifferentiated markers such as OCT3 / 4, SOX2, NANOG, c-MYC, KLF4, TDGF1, SSEA4, TRA-1-60, and the like. Identification of undifferentiated markers may be analyzed by RT-PCR or immunocytochemistry, but is not particularly limited thereto.
  • the pluripotent cells of the present invention are characterized by expressing high levels of trioderm markers, ie ectoderm (PAX6, Nestin), mesoderm (Brachyury, SMA), endoderm (GATA4, AFP) markers.
  • trioderm markers ie ectoderm (PAX6, Nestin), mesoderm (Brachyury, SMA), endoderm (GATA4, AFP) markers.
  • the pluripotent cells of the present invention are characterized by having proliferative capacity by expressing the proliferation marker protein Ki-67.
  • the co-culture of the dedifferentiated pluripotent cells with feeder cells increases the proliferation of pluripotent cells and differentiates them into ectoderm / endoderm / mesoderm and neurons / cardiomyocytes after culture in differentiation-inducing medium. have.
  • the invention also relates to the invention.
  • a culture chamber capable of containing cells and culture media
  • Differentiated cells are mixed with the culture medium, and energy is supplied to the mixture to form a spheroid through culturing for a period of time, and the spheroid has a pluripotency property.
  • the culture chamber generally means an incubator used for cell culture.
  • the culture chamber is provided with a temperature control unit and a carbon dioxide control unit, the cell culture conditions in the culture chamber can be appropriately adjusted at the level of those skilled in the art according to the purpose and type of cells.
  • the culture chamber may use a floating culture or a monolayer culture method for reverse differentiation from differentiated cells to pluripotent cells, so that the culture chamber may have such a structure.
  • it may be a culture chamber equipped with a stirrer for suspension culture.
  • the device capable of providing energy may include an ultrasonic generator capable of irradiating ultrasonic waves, a laser generator capable of irradiating laser, or a temperature controller.
  • the ultrasonic generator may be used without limitation as long as it is a known ultrasonic apparatus that generates ultrasonic waves having a frequency of 10 kHz to 100 MHz.
  • the laser generator generates a pulsed laser beam having a wavelength range of 300 to 900 nm, and may use a laser device having a pulse duration of 1 ms to 900 ms and a frequency of 1 to 100 Hz with a 1 to 15 W output. It is not limiting.
  • the temperature control device may use a known temperature control device capable of temperature control in the range of -40 ° C to 99.9 ° C, but is not particularly limited thereto.
  • Pluripotent cell induction apparatus of the present invention is a mixture of the culture medium and the differentiated cells using the ultrasonic wave generator, laser generator, or temperature control device, ultrasonic, laser, or heat treatment and pluripotency through a certain time incubation
  • the culture medium may be subjected to ultrasonic, laser, or heat treatment in advance before mixing the culture medium with the differentiated cells.
  • FIG. 1 is a person in Physics (p luripotent sp h ere y ielded by ultra s on ic s timulus) in cells forming a schematic view, intensity of (embryonic stem) ES sonicated for 10 minutes using a 5W / cm 2 culture medium of the present invention skin fiber
  • the blast cells (HDFa, Cat. No. C-013-5C, GIBCO (Invitrogen cell culture) (1 ⁇ 10 6 ) were mixed, and the mixture containing the cells was treated with ultrasound at a intensity of 1 W / cm 2 for 5 seconds. After viable cells were selected, 2 ⁇ 10 5 HDFs were suspended cultured in human ES culture medium for 6 days in a 35 mm bacterial Petri dish.
  • Spheroids are formed from the first day of culture, and undifferentiated markers are expressed from three days later.
  • the cell culture method is suspended culture cultured in an uncoated dish (bacterial petri dish) and cell culture dish surface (cell culture dish) Monolayer culture was used.
  • the group that was not treated as a control group (Null)
  • the group treated with ultrasonic waves in the medium (UM: Ultrasound treated Media, 5W / cm 2 treated with ultrasonic intensity for 10 minutes)
  • the group treated with ultrasonic waves (UC : Ultrasound treated Cell, treated with ultrasonic intensity of 1W / cm 2 for 5 seconds)
  • UCUM Ultrasound treated Cell, treated with ultrasonic intensity of 1W / cm 2 for 5 seconds
  • UCUM Ultrasound treated Cell, treated with ultrasonic intensity of 1W / cm 2 for 5 seconds
  • the ultrasonic intensity (0, 0.5, 1, 3, 5, 10 W / cm 2 for 5 seconds) was directly exposed to HDF (1 ⁇ 10 6 ). After viable cells were selected, 2 ⁇ 10 5 HDFs were cultured in human ES culture medium for 6 days in a 35 mm bacterial Petri dish.
  • ES medium composition Reagent Name Volume Final concentration Remarks DMEM / F-12 500 mL 500 mL Serum Replacement (KnockOut TM Serum Replacement) 100 mL 20% NEAA (non-Essential Amino Acids) 5 mL One% P / S (Peniciline & Streptomycin) 5 mL One% ⁇ -Mercaptoethanol 0.9 mL 0.1mM Glutamin (L-Glutamine, 200 mM Solution) 2.5mL 1 mM basic human fibroblast growth factor 2 (FGF) (Recombinant Human FGF-Basic) 2mg 4ng / mL Addition after sonication
  • FIG. 2A (b) shows the number of multicellular spheroids generated for each ultrasound intensity in FIG. 2A (a).
  • the ES cell culture medium was treated for 10 minutes with different ultrasonic exposure intensities (0, 1, 5, 10 W / cm 2 ).
  • Ultrasonically exposed 2 ⁇ 10 5 HDF (1 W / cm 2 , 5 sec) in a 35 mm bacterial Petri dish was incubated in these media for 3 days.
  • ESC culture medium was treated with ultrasound (5 W / cm 2 , 10 minutes)
  • HDF (1 ⁇ 10 6 ) was treated with ultrasound ( 1 W / cm 2 , 5 seconds).
  • Live HDF ( ⁇ 10 5 ) was screened and suspended in bacterial petri dishes or monolayer culture in tissue culture dishes.
  • suspended cultured ultrasound-treated HDFs showed higher spheroid formation efficiency compared to monolayer cultures.
  • Ultrasonic stimulation showed higher spheroid formation efficiency when both cells and culture medium were stimulated.
  • sonicated HDF or untreated HDF was sonicated in a bacterial petri dish or tissue culture dish in an ES cultured medium sonicated or untreated. Incubated.
  • the floating culture conditions showed higher efficiency, and the spheroids were larger in number and size (diameter of 200 ⁇ m or more) and showed a constant size distribution than the monolayer culture conditions.
  • Sonicated HDF (UC) grown in untreated ES cell culture media formed spheroids.
  • the number and size of spheroids up to 200 ⁇ m
  • Normal HDF culture (UM) in sonicated ES cell medium resulted in the formation of small amounts of spheroids (less than 100 ⁇ m).
  • UC and UM conditions of monolayer culture using tissue culture dishes were too low for spheroid formation efficiency.
  • Most HDFs were attached to the culture plate surface and the spheroid count was too small.
  • control and ultrasonic treatment groups (Null, UM, UC, UCUM) cells were harvested for each incubation time (1, 2, 3, 4, 5 and 6 days), mRNA was extracted using Dynabeads® mRNA direct kit (ambion), and SuperScrip-II (invtrogen) cDNA was synthesized. It was then amplified by PCR using the primers described in Table 2 and analyzed by electrophoresis.
  • the expression of the undifferentiated marker gene was stably expressed when the HDF and the culture medium were both sonicated (UCUM) in FIG. 9, and the suspension culture was higher than that of the monolayer cultured cells.
  • the expression level of the OCT3 / 4 which is an undifferentiation marker, was compared in the suspension culture or the monolayer culture.
  • cells cultured for 4 hours (0, 1, 2, 3, 4, 5 and 6 days) after sonication were fixed with 4% paraformaldehyde for 30 minutes, and 0.1% to improve the penetration ability of the antibody.
  • blocking was performed for 30 minutes at room temperature with PBS buffer containing 5% non goat serum to prevent nonspecific protein reactions.
  • each of the primary antibodies OCT4; 1: 200, abcam
  • OCT4 was added and reacted at 4 °C overnight, washed three times with PBS buffer added 0.03% Triton X100 secondary antibody (IgG
  • the anti-rabbit conjugate alexa 488) was diluted 1: 1000 with D-PBS buffer and stained at room temperature for 2 hours. Stained cells were washed four times using PBS buffer with 0.03% TritonX100, then covered with slides with DAPI-added mounting sol. Observed by.
  • OCT3 / 4 expression was detected immediately after 1 day of sonication in UCUM conditions. OCT3 / 4 expression gradually increased, and floating culture conditions showed higher expression levels than monolayer culture conditions.
  • OCT3 / 4 six differentiation marker genes, OCT3 / 4, SOX2, NANOG, TDGF1, c-MYC and KLF4, were analyzed by RT-PCR for 6 days of spheroid culture under UCUM in suspension culture.
  • the expression of OCT3 / 4 and NANOG genes increased on day 1 after treatment, and the expression of other genes also increased with incubation time. All marker genes were observed on day 2 but stable expression was observed. Was observed after 3 days.
  • the first OCT3 / 4 expression time point was detected immediately 10 hours after sonication (FIG. 12).
  • the experiment was performed by harvesting physics cells cultured for 5 days, extracting mRNA using Dynabeads® mRNA direct kit (ambion), synthesizing SuperScrip-II (invtrogen) cDNA, and amplifying by PCR using the primers described in Table 2. It was analyzed by electrophoresis.
  • DNA methylation analysis was performed to further confirm the expression of the undifferentiated marker.
  • the promoter portion where the gene expression starts is methylated it can be seen that the gene is not expressed in that portion, which means that the gene of the portion is expressed when demethylated, that is, when the methyl group is separated from the DNA. Therefore, we examined whether the expression of the OCT3 / 4 and NANOG genes, which are the major genes of ES cells, are occurring and whether the promoter portion of the two genes is methylated.
  • DNA amplification primers used in the analysis are as follows.
  • Reverse primer 5'-ATCTATCCCTCCTCCCAAATAATC-3 '
  • Amplification product size 377 bp, Tm: 55, CpGs from product: 6
  • Reverse primer 5 / -AATTACAAAAACCATACCTACAACC-3 '
  • Amplification product size 417bp, Tm: 55, CpGs from product: 4
  • CpG cytosine guanine dinucleotide
  • Ki-67 immunostaining method which is a proliferation marker protein, and time-phase nuclear nuclear staining using pst (Hoechst 33342) and propidium iodide (PI).
  • a live / dead kit was added to the sonicated HDF, and the green / red double-stained HDF was added to the live cell imaging device for 24 hours. was followed.
  • Ultrasound-induced membrane damage and intermittent transmission is also within the intracellular Ca 2 + concentrations and H 2 O 2 respectively increased by using the fluorescent dye Fluo-4 dye and CM-H2DCFDA cells Characterized by production.
  • the Ca + 2 concentration of Physics cells Upon exposure to ultrasonic waves, the Ca + 2 concentration of Physics cells and then abruptly increased, decreased to 150 seconds (FIG. 26).
  • the concentration of intracellular H 2 O 2 in Physics cells was six times higher after 60 minutes of ultrasound exposure compared to untreated control HDF (FIGS. 27 and 28).
  • Ionic oriented P2X receptors and metabolic P2Y receptors are known to be activated by ATP release and compared the expression of these receptors.
  • QD705 Alexa-705 labeled quantum dots
  • exosome RNA was prepared from Physics cell culture medium, and the gene expression pattern of the cell culture environment during the generation of Physics cells by RT-PCR analysis was studied.
  • exosomes include several genetic elements, such as RNA, microRNA, DNA, proteins.
  • the expression profile of genetic elements in exosomes is cell state-dependent.
  • pluripotent marker genes As shown in FIG. 32, high expression of pluripotent marker genes was observed in exosomes purified from Physics cell culture medium. The most prominent gene expressions were OCT3 / 4 and NANOG. As the incubation time progressed, OCT3 / 4 expression increased significantly. NANOG expression dropped after 4 days. c-MYC expression was constant in suspended culture conditions, whereas decreased after 2 days in monolayer culture conditions. Expression of all pluripotent marker genes, such as REX1, TDGF1, FOXD3, UTF1, LIN28, was detected in suspension culture conditions, although their expression levels were low. However, these genes were not detected in monolayer culture conditions. These results suggest the possibility of delivery of genetic elements in sonicated HDF.
  • Type of badge ingredient content Medium 1 (ectoderm / astrocytic differentiation induction medium) DMEMFBSN2 supplementGlutamax-I 1% 1% 1% Medium 2 (mesoderm / cardiomyocyte differentiation induction medium) DMEMFBS2-mercaptoethanolNon essential amino acid Penicillin / streptomycin Ascorbic acid 20% 1% 1% M 100 ⁇ M Medium 3 (endodermal / nerve cell differentiation induction medium) DMEMFBS2-mercaptoethanolNon essential amino acid Penicillin / streptomcin 20% 1% 1%
  • gene 17 (SOX17, endoderm), paired box 6 (PAX6, ectoderm), Nestin (nerve cell marker), microtubule-associated protein 2 (MAP2, Ectoderm), class III beta-tubulin (TuJ1, neuronal marker), msh homeobox 1 (MSX1, mesoderm), Brachyury (mesoderm), myosin light chain 7 (MYL7, cardiomyocytes), NK2 homeobox 5 (NKX2.5, myocardium) Cells), and expression of SRY-box including Troponin T type 2 (TnnT2, cardiomyocytes) was observed by RT-PCR.
  • neuroprogenitor markers (PAX6 and Nestin) were observed in Physics cells grown in astrocytic medium. These differentiated Physics cells expressed expression of oligodendrocyte markers (MAP2 and O4) or neuron markers (MAP2 and Tuj1), respectively, when further differentiation was induced for 2 weeks after changing astrocytic medium to oligodendrocyte or neuronal medium. This was observed. Two weeks of differentiation were sufficient to detect cardiac markers including MHC, SMA, Actinin, NKX2.5 and TnTc. In particular, a typical segmented actin pattern was detected in actinin. However, under the same culture conditions, HDF did not express any nerve or heart markers.
  • MAP2 and O4 oligodendrocyte markers
  • Tuj1 neuron markers
  • Fig. 41 the physics cells injected into the testis were observed in vascular endothelial cells in the testis after 4 weeks, and were confirmed to be proliferated by Ki67 staining. As shown in the cells indicated by the arrows, the vascular endothelial marker CD44 was stained It was confirmed.
  • ES cell culture media were used to generate Physics cells.
  • ES cell culture medium was developed as a restriction medium for maintaining and propagating ES cells in an undifferentiated state.
  • normal HDF culture medium was used to generate Physics cells.
  • morphology and spheroid formation efficiency were quite different compared to ES cell culture media.
  • One day after seeding in sonicated HDF medium small amounts of multicellular spheroids were formed. However, after two days, the majority of spheroids were attached to the surface of the dish. On day 4 of culture all spheroids adhered to the surface of the dish and grew into a typical fibroblast form.
  • Immunohistochemical results also showed different gene expression patterns between the two different culture medium conditions.
  • Typical Physics cells generated using ES cell culture media showed high expression levels of OCT3 / 4, SOX2, NANOG, SSEA-4, and TRA-1-60.
  • DMEM media did not show any effect to induce undifferentiated marker gene and trioderm marker gene expression.
  • two cell lines also formed multicellular spheroids after being cultured in ES cell culture media sonicated in bacterial Petri dishes after direct exposure of ultrasound.
  • the shape and size distribution of the new Physics cells from the two cell lines are quite different.
  • Physics cells derived from HeLa cells were quite inconsistent and too large in size.
  • Physics cells derived from L132 cells were more complex and aggregated. Each spheroid was further fused to form a plate-like structure.
  • pluripotency markers including OCT3 / 4, SOX2, NANOG, SSEA4, and TRA-1-60 and GATA4, AFP, PAX6, Nestin, Brachyury, and from two different Physics cells Expression of trioderm marker genes, including SMA, was confirmed by immunocytochemistry.
  • the skin fibroblasts were exposed to 42 ° C. for 2 minutes and then left on ice for about 5 seconds.
  • both HDF and ES cell culture media successfully developed multicellular spheroids after laser or heat treatment.
  • Laser treated HDF also immediately formed multicellular spheroids after laser induction.
  • the shape of the spheroids was irregular and the size distribution was not uniform, high levels of expression of pluripotency markers and triploid markers were observed.
  • Heat treatment also induced spheroid formation.
  • the efficiency was lower than ultrasonic and laser treatments. More than half of the heat-induced multicellular spheroids adhered to the dish surface for 8 days of maintenance. Despite the lower spheroid formation efficiency, higher expression levels of pluripotency markers and triploid markers were observed.
  • Mouse Physics cells were prepared according to the procedure shown in FIG. 48. To this end, OG2 mouse MEF (Mouse Embryonic Fibroblast cells; mouse embryonic fibroblasts) was mixed with ES medium treated with 20 KHz ultrasound at a intensity of 5 W / cm 2 for 10 minutes, and the ultrasound was directly applied to the cells for 1 second at 5 W / cm 2. Incubated by treatment at the strength of. The cultured cells were observed for morphological changes and expression of GFP fluorescence by fluorescence microscopy at 1, 3, 5, 8 and 10 days intervals. The medium composition for the ultrasonic treatment is shown in Table 1.
  • OG2 mouse MEF Mae Embryonic Fibroblast cells; mouse embryonic fibroblasts
  • the MEF cells are fibroblasts of 13.5-day-old embryos of mice transfected with the GFP gene into which the OCT4 promoter has been inserted. Generally, cells expressing OFP4 do not express GFP.
  • the control group did not show green fluorescence on OG2 MEF cell photographs (no OCT4 expression).
  • OCT4 is a major feature of undifferentiated stem cells, which indicates that OG2 MEF cells are reversely differentiated into stem cells by the ultrasonic treatment.
  • FIG. 49B is a result of showing the ultrasonic treatment effect by combining a wide range of pictures with tile scan photos, and a large number of MEF cells express OCT4-GFP due to the differentiation caused by the ultrasonic treatment, and generated in FIG. 50.
  • the OCT4-GFP expression efficiency was about 93%, and GFP expression was expressed in 85.3% of the cells by using flow cytometry.
  • SSEA1 a cell surface undifferentiated protein marker, expression of about 75.5% was shown (FIG. 51).
  • mPhysics expressed high levels of markers of endoderm (GATA6), ectoderm (Nestin) and mesoderm (Brachyury). Expression of other genes in the germ layers began three days after the production of Physics cells. During 20 days of culture, the expression level of the trioderm markers gradually increased (FIG. 55). In addition, expression of trioderm protein markers was confirmed through immunostaining in FIG. 56.
  • mPhysics cells formed by ultrasound had a normal karyotype (FIG. 57).
  • Pluripotent cells of the invention can be used in the field of cell therapy.

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Sustainable Development (AREA)
  • Electromagnetism (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Optics & Photonics (AREA)
  • Plasma & Fusion (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 에너지를 이용한 다능성 세포 유도 장치 및 방법에 관한 것으로, 보다 상세하게는 분화된 세포에 초음파, 레이저 또는 열 처리 등의 에너지를 가하여 다능성 특성을 가진 새로운 타입의 다능성 세포를 유도하는 효과가 있다.

Description

에너지를 이용한 다능성 세포 유도 장치 및 방법
본 발명은 초음파, 레이저 또는 열 처리 등의 에너지 제공을 통해 다능성 특성을 가진 다능성 세포를 유도할 수 있는 에너지를 이용한 다능성 세포 유도 장치 및 방법에 관한 것이다.
다능성(pluripotency)은 세 종류의 배엽 계통, 즉 외배엽, 중배엽 및 내배엽으로 분화하는 능력이다. 다능성 줄기세포는 그들이 체내에서 임의의 세포 또는 조직 타입을 발생시키기 때문에 질환 모델 및 이식에서 임상적으로 중요하다. 따라서, 배아줄기세포, 유도 만능 줄기세포(induced pluripotent stem cell, iPSC), 체세포 및 환자-유래 세포의 리프로그래밍 또는 분화에서 현재 주요 요구 사항은 임상 적용을 위해 외래 유전 물질 또는 화학물질 또는 소분자의 도입 없이 간단하고, 빠르며, 효과적이고 안전해야 한다는 것이다. 최근 연구들에서 환경과 유전자형 간의 상호작용은 살아있는 유기체의 유전자 발현 및 표현형 변이와 밀접하게 연관되어 있음이 입증되었다. 구조, 기계, 자성, 초음파 신호 같은 환경 자극을 조절함으로써 세포 운명, 증식 및 세포 흡수 효율을 조절할 수 있다. 이들 접근의 정확한 분자 메커니즘은 여전히 불명확하나, 이들 방법은 유전물질, 화학물질 및 소분자의 도입 없이 안전성을 구현할 수 있는 대안으로 받아들여질 만하다..
이러한 측면에서, 본 발명자들은 유전자 및 화학물질이 없는 조건에서 세포환경 신호를 이용한 에너지 제공을 통해 미분화 마커와 외배엽, 중배엽 및 내배엽으로 이루어진 3배엽 마커 유전자를 발현하고 3배엽으로 분화하는 다능성 특성을 갖는 새로운 다능성 세포, 소위 Physics( p luripotent sp h ere y ielded by ultra s on ic s timulus) 세포를 유도하는 새로운 방법을 개발함으로써 본 발명을 완성하였다.
본 발명의 목적은 분화된 세포로의 역분화 유도인자 및 화학물질의 도입 없이 에너지 제공을 통해 분화된 세포로부터 다능성 특성을 갖는 새로운 타입의 다능성 세포를 유도하는 방법 및 이의 유도 장치를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 배양 배지와 분화된 세포를 혼합하고, 상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하는 것을 포함하고,
상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 분화된 세포에서 다능성 세포로의 역분화 방법을 제공한다.
본 발명은 또한 세포 및 배양 배지를 수용할 수 있는 배양챔버; 및 상기 배양챔버의 일측에 배치되고, 상기 세포 및 배양 배지에 에너지를 제공할 수 있는 장치를 포함하고, 분화된 세포와 배양 배지를 혼합하고,
상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하며,
상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 다능성 세포 유도 장치를 제공한다.
본 발명은 분화된 세포로의 역분화 유도인자 및 화학물질의 도입 없이 적절한 초음파, 레이저 또는 열처리 등에 의한 에너지 제공을 통해 분화된 세포에서 다능성 특성을 가지면서, 공지의 유도 만능 줄기세포에 비해 분화속성이 강한 새로운 타입의 다능성 세포를 유도하는 효과가 있다.
도 1은 본 발명에 따른 다능성 특성을 갖는 사람 Physics 세포의 모식도이다.
도 2a는 사람 피부 섬유아세포에 대한 초음파 강도의 효과를 나타낸 것으로, a)는 초음파 강도별 HDF의 형태 변화 비교, b)는 초음파 강도별로 생성된 다세포 스페로이드의 수이다.
도 2b는 사람 피부 섬유아세포에 대한 초음파 강도의 효과를 나타낸 것으로, c)는 초음파 처리된 HDF의 살아있는/죽은 세포 분석 결과, d)는 상기 c)에서 살아있는 및 손상된 세포의 비율이다.
도 3a는 1 W/cm2의 고정된 강도 하에서 초음파 노출시간의 효과를 나타낸 것으로, a)는 초음파 노출시간 별 HDF의 형태 변화 비교, b)는 초음파 노출시간 별로 생성된 다세포 스페로이드의 수이다.
도 3b는 1 W/cm2의 고정된 강도 하에서 초음파 노출시간의 효과를 나타낸 것으로, c)는 초음파 처리된 HDF의 살아있는/죽은 세포 분석 결과, d)는 상기 c)에서 살아있는 및 손상된 세포의 비율이다.
도 4는 사람 ESC 배양배지에 대한 초음파 강도의 효과를 나타낸 것으로, 상단은 초음파 처리된 배지에서 자란 초음파-처리된 HDF의 형태 변화 비교, 하단은 상기에서 생성된 다세포 스페로이드의 수이다.
도 5는 5 W/cm2의 고정된 강도하에서 사람 ESC 배양배지의 초음파 노출시간의 효과를 나타낸 것으로, a)는 초음파 처리된 배지에서 자란 초음파-처리된 HDF의 형태 변화 비교, b)는 상기 a)에서 생성된 다세포 스페로이드의 수이다.
도 6은 다세포 스페로이드를 생성하기 위한 초음파 처리 조건 및 배양 조건의 효과를 나타낸 것으로, a)는 부유 배양, b)는 단층 배양이다.
도 7a는 부유 배양 조건하에서 초음파 자극 별(UC, UM, UCUM)로 생성된 다세포 스페로이드의 크기 분포를 나타낸 것으로, a)는 총 크기, b)는 50-100㎛ 크기의 스페로이드의 분포이다.
도 7b는 부유 배양 조건하에서 초음파 자극 별(UC, UM, UCUM)로 생성된 다세포 스페로이드의 크기 분포를 나타낸 것으로, c)는 100-200㎛, d)는 >200㎛ 크기의 스페로이드의 분포이다.
도 8a는 단층 배양 조건하에서 초음파 자극 별(UC, UM, UCUM)로 생성된 다세포 스페로이드의 크기 분포를 나타낸 것으로, a)는 총 크기, b)는 50-100㎛ 크기의 스페로이드의 분포이다.
도 8b는 단층 배양 조건하에서 초음파 자극 별(UC, UM, UCUM)로 생성된 다세포 스페로이드의 크기 분포를 나타낸 것으로, c)는 100-200㎛, d)는 >200㎛ 크기의 스페로이드의 분포이다.
도 9a는 부유 배양과 단층 배양 조건 간의 사람 Physics 세포의 다능성 마커 유전자, OCT3/4(a) 및 SOX2(b)의 발현 수준을 비교한 RT-PCR 분석 결과이다.
도 9b는 부유 배양과 단층 배양 조건 간의 사람 Physics 세포의 다능성 마커 유전자, NANOG(c) 및 TDGF1(d)의 발현 수준을 비교한 RT-PCR 분석 결과이다.
도 10a는 부유 배양 시 OCT3/4 발현 수준을 분석한 공초점 레이저 현미경 이미지이다.
도 10b는 단층 배양 시 OCT3/4 발현 수준을 분석한 공초점 레이저 현미경 이미지이다.
도 11은 배양 6일 동안 다능성 마커 유전자 발현의 RT-PCR 분석 결과이다.
도 12는 초음파 처리된 HDF 스페로이드에서 OCT3/4 발현 시기를 배양 시간 별로 확인한 RT-PCR 분석 결과이다.
도 13은 대표 미분화 마커의 발현을 ES 세포, HDF 및 사람 Physics 세포에서 확인한 결과이다.
도 14는 다세포 스페로이드의 다능성 상태를 특성규명하기 위한 알칼라인 포스파타아제 염색 결과이다.
도 15는 다능성 마커 발현의 면역세포화학 결과이다.
도 16a는 사람 ES(H9) 세포 표면 마커의 FACS 분석 결과이다.
도 16b는 사람 HDF 세포 표면 마커의 FACS 분석 결과이다.
도 16c는 사람 Physics 세포 표면 마커의 FACS 분석 결과이다.
도 17은 Feeder 세포와 physics 세포의 공동배양 시 다능성 마커의 유전자 발현 RT-PCR(a)로, 단백질 발현을 면역세포화학법(b)으로 분석한 결과이다.
도 18은 COT3/4 및 NANOG 프로모터의 메틸화 상태를 보여주는 바이설파이트 게놈 시퀀싱 결과이다.
도 19는 사람 Physics 세포의 증식능 검증 실험 결과로, a)는 증식마커인 Ki67의 발현을 나타낸 결과, b)는 H33342 와 PI를 이용하여 증가된 세포를 염색한 결과, c)는 배양 시간에 따른 스페로이드의 크기를 나타낸 것이다.
도 20은 사람 Physics 세포의 자기-재생능 검증 실험 결과이다.
도 21a는 사람 ES(H9) 세포로부터 3배엽 마커의 발현에 대한 면역세포화학 분석 결과이다.
도 21b는 사람 Physics 세포로부터 3배엽 마커의 발현에 대한 면역세포화학 분석 결과이다.
도 22은 사람 Physics 세포의 배양 15일 동안 OCT3/4 및 3배엽 마커의 발현 패턴에 대한 면역세포화학 분석 결과이다.
도 23은 초음파 자극 조건 별 사람 Physics 세포의 SEM 이미지를 나타낸 것이다.
도 24는 초음파 자극 조건 별로 초음파 처리 후 및 2시간 배양 후 형광 이미지로 본 사람 Physics 세포의 살아있는/사멸 세포 분석결과이다.
도 25는 다세포 스페로이드의 형성 후 사람 Physics 세포의 살아있는/사멸 세포 분석 결과이다.
도 26은 초음파 자극에 의한 세포내 Ca2 + 농도의 변화이다.
도 27은 초음파 자극에 의한 H2O2의 발생을 분석한 결과이다.
도 28은 도 27에서 초음파 처리에 의한 세포 내 H2O2의 발생을 분석하기 위해 CM-H2DCFDA로 염색된 사람 Physics 세포의 형광 이미지이다.
도 29는 초음파 자극에 의한 세포내 ATP의 방출 분석 결과이다.
도 30은 사람 Physics 세포에서 P2X 및 P2Y 수용체의 발현 패턴을 나타낸 것이다.
도 31은 사람 Physics 세포의 더 높은 침투 능력을 Quantum dot 705를 이용하여 입증하는 공초점 현미경 이미지이다.
도 32는 사람 Physics 세포 배양 배지에서 엑소좀으로부터 다능성 마커 유전자 발현에 대한 RT-PCR 분석 결과이다.
도 33은 사람 Physics 세포에서 방출된 엑소좀 OCT4에 의한 HDF로의 전달 과정을 보여주는 면역세포화학 결과로, 노란색 화살표는 주변 HDF에서 OCT3/4 발현을 나타낸 것이다.
도 34는 인 비트로 분화유도된 사람 Physics 세포의 3 배엽 마커의 발현의 면역세포화학 결과이다.
도 35는 사람 Physics 세포의 인 비트로 분화를 확인하기 위한 신경 계통 유전자 발현의 RT-PCR 분석 결과이다.
도 36은 사람 Physics 세포의 인 비트로 분화를 확인하기 위한 심장 계통 유전자 발현의 RT-PCR 분석 결과이다.
도 37은 사람 Physics 세포의 인 비트로 분화를 확인하기 위한 신경 계통 마커 발현의 면역세포화학 결과이다.
도 38은 사람 Physics 세포의 인 비트로 분화를 확인하기 위한 심장 계통 마커 발현의 면역세포화학 결과이다.
도 39는 액티닌의 면역세포화학 이미지이다.
도 40은 본 발명의 사람 Physics 세포의 핵형 분석 결과이다.
도 41은 사람 Physics 세포의 마우스 정소 내 인 비보 분화를 확인하기 위한 조직면역형광염색 결과이다.
도 42는 사람 Physics 세포의 마우스 허벅지 내 인 비보 근육분화를 확인하기 위한 조직면역형광염색 결과이다.
도 43은 세포배양배지의 효과를 나타낸 것으로, a)는 ES 배지 및 HDF 배양 배지를 이용한 결과, b)는 ES 배지 및 HDF 배양 배지에서 사람 Physics 세포를 유도하고 ES 마커를 확인한 결과이다.
도 44는 다른 세포주에서 사람 Physics 세포를 유도한 결과를 도시한 것이다. a)는 세포 형태의 변화를 나타낸 결과이며, 각각 b와 c는 다른 세포주에서 사람 Physics 세포를 유도하고 b) ES 마커 및 c) 3배엽 마커를 확인한 결과이다.
도 45는 환자 피부 세포로부터 사람 Physics 세포를 유도한 결과를 도시한 것이다. a)는 세포 형태의 변화를 나타낸 결과이며, b)는 다른 세포주에서 사람 Physics 세포를 유도하고 ES 마커와 3배엽 마커를 확인한 결과이다.
도 46은 다른 에너지 제공원으로 열 처리하여 사람 Physics 세포를 유도하고 ES 마커 및 3배엽 마커를 확인한 결과이다.
도 47은 다른 에너지 제공원으로 레이저를 사용하여 사람 Physics 세포를 유도하고 ES 마커 및 3배엽 마커를 확인한 결과이다.
도 48는 마우스 배아 섬유아세포에서 마우스 Physics 세포를 유도하는 과정을 도시한 것이다.
도 49는 형질전환된 마우스 배아 섬유아세포(OG2 MEF 세포)에 초음파 처리 후 배양시간에 대한 세포의 형태 변화와 Oct4 발현을 확인한 결과로, A는 마우스 Physics 스페로이드에서 GFP 발현을 확인한 결과이고, B는 Tile scan 사진으로 넓은 범위를 여러 장의 사진을 찍어 합친 사진도이다.
도 50은 초음파로 형성된 스페로이드의 GFP 발현율 그래프와 플로우 사이토메트리를 이용하여 초음파 처리된 전체 세포 중 GFP 발현율을 분석한 결과이다.
도 51은 마우스 Physics 세포에서의 세포 표면 미분화 마커 (SSEA1)의 발현을 플로우 사이토메트리를 이용하여 분석한 결과이다.
도 52는 마우스 Physics 세포에서 다능성 마커 유전자의 RT-PCR 분석 결과를 나타낸 것이다.
도 53은 마우스 Physics 세포에서 다능성 단백질 마커를 면역세포화학법으로 분석한 결과이다.
도 54는 마우스 Physics 세포의 다능성 상태를 특성규명하기 위한 알칼라인 포스파타아제 염색 결과이다.
도 55는 마우스 Physics 세포로부터 3배엽 마커의 발현에 대한 RT-PCR 분석 결과이다.
도 56은 마우스 Physics 세포로부터 3배엽 마커의 발현에 대한 면역세포화학법으로 분석한 결과이다.
도 57은 마우스 Physics 세포의 핵형 분석 결과이다.
이하, 본 발명의 구성을 구체적으로 설명한다.
본 발명은 배양 배지와 분화된 세포를 혼합하고, 상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하는 것을 포함하고,
상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 분화된 세포에서 다능성 세포로의 역분화 방법에 관한 것이다.
본 발명은 분화된 세포로의 역분화 유도인자, 화학물질 등의 역분화 유도 물질의 도입 없이 적절한 에너지 제공을 통해 분화된 세포로부터 다능성(pluripotency) 특성을 가지면서, 공지의 유도 만능 줄기세포에 비해 분화속성이 강한 새로운 타입의 다능성 세포를 유도할 수 있는 것을 특징으로 한다.
상기 다능성 세포는 외부 환경에 따라 분화 유도가 잘되며, 줄기세포의 속성 대비 분화속성이 강한 전구세포(progenitor cell)의 속성이 더 강하다는 점에서 공지의 유도 만능 줄기세포와 차별화된 특징을 갖는다. 즉, 유도 만능 줄기세포와 같은 배아줄기세포를 세포 치료제로 사용하는 경우, 어느 정도 분화 과정을 거치는 준비 단계가 요구되며, 암으로 변할 수 있는 위험 요소를 내포하고, 역분화 유도인자 도입을 위해 바이러스 벡터를 사용함에 따른 안전성 문제가 대두되나, 본 발명의 다능성 세포는 유전자 변이를 위한 역분화 유도인자 또는 화학물질 등의 역분화 유도 물질을 별도로 도입하지 않고 유도되므로 다른 종류의 세포와 공동 배양을 통한 배양이 필요 없어 세포 오염(다른 세포가 섞이는 문제점) 문제점이 없고 인 비보 실험에서 암세포와 유사한 테라토마를 형성하지 않아 암 발생의 문제점이 없어 안전성이 확보되어 있다. 다시 말해, 본 발명의 다능성 세포는 유도 과정이 단순하고 짧아 자가세포를 처리하여 이식 때까지 시간을 획기적으로 단축할 수 있는 장점을 가진다.
본 발명은 특이적으로, 배양 배지와 분화된 세포 둘 다에 에너지를 제공함으로써 우수한 수율로 스페로이드를 생성할 수 있다.
상기 에너지는 초음파, 레이저 또는 열 처리 중 어느 하나일 수 있다.
본 발명의 다능성 세포는 OCT3/4, SOX2, NANOG, c-MYC, KLF4, TDGF1, SSEA4, TRA-1-60, PAX6, Nestin, Brachyury, SMA, GATA4, 또는 AFP 중 어느 하나의 미분화 마커 또는 중배엽 및 내배엽으로 이루어진 3배엽 마커 유전자를 안정적으로 발현하는 것을 특징으로 한다.
상술한 바와 같이 분화된 세포로의 역분화 유도인자의 도입 없이 다능성 세포가 형성되는 점에 대해 본 발명자들은 엑소좀과의 연관성을 고려하였다. 즉, 초음파, 레이저, 또는 열 처리는 에너지에 의한 온도 상승, ROS(reactive oxygen species) 생성 유도, 초음파에 의해 생성되는 마이크로버블의 진동, 액체의 흐름 생성 유도 즉, 세포막을 따라 마이크로스트림 생성을 유도하여 이러한 효과로 인해 세포막에 미세한 손상을 가하고, 구멍 생성을 유도함으로써 외부 물질의 흡수가 증가하도록 하는데, 이는 세포 내 Ca2 + 농도 변화 분석과 H2O2 생성 여부를 확인함으로써 입증된다. 즉, 세포 내 Ca2 + 농도 변화 분석은 세포막에 손상이나 막의 유동성이 증가될 경우 순간적으로 세포 내(cytosol) Ca2 + 농도가 증가함을 반영하여 세포막 유동성의 증가를 확인하는 것으로, 본 발명의 일 구체예에 따르면, 초음파 처리 직후 Ca2 + 농도가 빠르게 증가하다가 점차 감소하여 초음파를 처리하지 않는 대조군의 수준으로 감소함을 통해 세포막의 손상이 유도된 후 회복됨을 알 수 있었다. 또한, 세포 내 H2O2 생성 여부를 확인한 실험 역시 이와 유사한 패턴으로 초기 초음파 처리 직후에는 H2O2 생성량이 증가하다 점차 대조군 수준으로 감소함을 통해 세포막의 손상이 유도된 후 회복됨을 알 수 있었다. 또한, ATP가 다양한 세포성 스트레스에 대한 반응 신호로 이용되어 초음파 처리 후 다능성 세포에서의 ATP 농도를 분석한 결과, 미처리 대조군에 비해 높은 수준으로 ATP를 방출하였다. 아울러, ATP 방출에 의한 이온향성 P2X 수용체와 대사성 P2Y 수용체의 발현 역시 다능성 세포에서 대조군 대비 활성화되었다.
한편, 엑소좀은 내부에 유전정보 물질(DNA, mRNA, microRNA, protein)을 포함하고 있는 것으로 알려져 있는데, 세포막 손상을 통해 세포막 밖으로 빠져 나온 엑소좀이 주변 다른 세포에 다시 들어가는 과정을 통해 엑소좀 내부에 존재하는 유전정보 물질이 전달될 수 있다. 따라서, 초음파 처리에 의한 자극으로 인해 세포 내 저발현되거나 발현이 억제된 상태로 유지되었던 미분화 마커들의 발현이 유도 내지 촉진됨과 동시에 세포막에 손상이 생김에 따라, 상기 발현이 유도 내지 촉진된 미분화 마커들을 포함하는 세포 내부에 존재하는 엑소좀이 외부로 배출되어 주변 세포에 전달되는데 주변 세포 역시 세포막이 부분적으로 손상된 상태이기 때문에 세포막 유동성이 증가되어 세포 내부로 엑소좀이 들어가는 효율이 정상 상태에 비해 더 높을 것으로 추정되며, 이러한 엑소좀 내부에 존재하는 상기 발현 유도 내지 촉진된 미분화 관련 유전정보가 전달되어 다능성 세포가 만들어지는 것으로 생각되었다. 본 발명의 일구체예에서 다능성 세포 유도 과정 중 배양 배지를 회수하고, 배지 내 엑소좀을 추출하여 엑소좀 내부에 다능성 세포 관련 미분화 마커가 존재하는지 확인한 결과, 알려진 미분화 마커들이 높은 발현 정도를 보이면서 확인되어 본 발명자들의 이러한 가설을 뒷받침하는 것으로 사료된다. 또한, 이러한 초음파, 레이저, 또는 열 처리에도 핵형 기형이 없이 정상인 것으로 나타났다.
이러한 가설은 세포막 손상에 의한 엑소좀 방출 유도를 통해 다능성 세포를 제조할 수 있음을 가능케 한다.
본 명세서에서, 용어 "다능성 세포"는 에너지, 엄격한 의미에서 초음파, 레이저, 또는 열 처리 후 다능성을 획득한 세포를 말한다. 본 명세서에서 상기 다능성은 배아줄기세포에서 발현되는 미분화 마커를 안정적으로 발현하는 상태를 의미한다. 아울러, 세 종류의 내배엽, 외배엽 및 중배엽의 3배엽 마커를 발현하는 상태를 의미한다. 상기 다능성 세포는 "Physics( p luripotent sp h ere y ielded by ultra s on ic s timulus) 세포", 또는 "Physics 스페로이드"와 혼용되어 사용될 수 있다. 본 발명의 분화된 세포에서 다능성 세포로의 역분화 방법을 도면 1을 참조하여 구체적으로 설명하면 다음과 같다.
우선, 세포 배양 배지와 분화된 세포를 혼합하고, 상기의 혼합물에 에너지를 제공한다.
분화된 세포의 혼합물에 에너지를 제공하기 전에 세포 배양 배지에 에너지를 제공하여 다능성 세포로의 역분화 효율을 높일 수 있다.
상기 에너지는 초음파, 레이저 또는 열처리 중 어느 하나일 수 있다.
상기 배양 배지에 대한 초음파 처리는 출력강도 1W/cm2 내지 20W/cm2의 초음파를 1 내지 20 분, 구체적으로, 출력강도 2W/cm2 내지 10W/cm2의 초음파를 5 내지 15 분, 더 구체적으로, 출력강도 3W/cm2 내지 7W/cm2의 초음파를 7 내지 13 분 동안 동안 동안 수행하는 것일 수 있다.
배양 배지에 대한 레이저 처리는 300 내지 900 nm 파장 대역의 펄스형 레이저 빔을 1초 내지 20초, 더 구체적으로, 상기 파장 대역의 펄스형 레이저 빔을 3초 내지 10초, 보다 구체적으로, 상기 파장 대역의 펄스형 레이저 빔을 4초 내지 6초 동안 조사하는 것일 수 있다. 상기 파장 대역은 예를 들어 400 nm, 808 nm, 880 nm의 파장을 사용할 수 있다.
배양 배지에 대한 열 처리는 40 내지 50 ℃의 온도 조건에서 5분 내지 20분 동안 수행할 수 있다.
상기 배양 배지로, 배아 줄기세포 배양 배지, 줄기세포 분화유도 배지 등을 사용할 수 있다.
상기 분화된 세포로, 포유류 유래의 섬유아세포; 자궁경부암세포(HeLa cell)를 포함하는 암세포; 또는 폐 상피세포(L132 cell)를 포함하는 기관 내 조직세포 등을 사용할 수 있다.
분화된 세포에 에너지를 제공할 경우, 일정 세기로 노출시키는 것이 좋고, 이 범위를 벗어날 경우 세포 생존율이 감소할 수 있다.
따라서, 배양 배지와 분화된 세포의 혼합물에 대한 초음파 처리는 출력강도 0.5W/cm2 내지 3W/cm2로 1 내지 5초 동안, 더 구체적으로, 출력강도 0.7W/cm2 내지 2W/cm2로 1 내지 5초 동안, 보다 구체적으로, 출력강도 0.8W/cm2 내지 1.5W/cm2로 1 내지 5초 동안 수행하는 것일 수 있다.
배양 배지와 분화된 세포의 혼합물에 대한 레이저 처리는 300 내지 900 nm 파장 대역의 펄스형 레이저 빔을 1초 내지 20초, 더 구체적으로, 상기 파장 대역의 펄스형 레이저 빔을 3초 내지 10초, 보다 구체적으로, 상기 파장 대역의 펄스형 레이저 빔을 4초 내지 6초 동안 조사하는 것일 수 있다. 상기 파장 대역은 예를 들어 400 nm, 808 nm, 880 nm의 파장을 사용할 수 있다.
배양 배지와 분화된 세포의 혼합물에 대한 열 처리는 40 내지 50 ℃의 온도 조건에서 1분 내지 10분 동안 노출한 후 0℃ 내지 4℃의 온도 조건에서 5 내지 10초간 노출하여 수행하는 것일 수 있다.
다음으로, 에너지가 제공된 혼합물을 일정 시간 동안 배양하여 다능성을 갖는 스페로이드(spheroid)를 형성시킨다.
에너지가 제공된 혼합물의 배양은 부유 배양(suspended culture) 또는 단층 배양(monolayer culture) 방식을 통해 미분화 마커를 안정적으로 발현하는 스페로이드가 형성되는 기간, 즉, 3일 내지 10일 동안 수행하는 것일 수 있다. 다만, 상기 배양 시간은 배양 방식, 세포 또는 배양 배지의 종류에 따라 다능성을 갖는 스페로이드 형성 여부가 달라 당업자 수준에서 적절히 조절될 수 있다.
본 발명의 일 구체예에 따르면, 부유 배양은 단층 배양에 비해 더 높은 스페로이드 형성 효율을 나타낸다. 또한, 부유 배양은 단층 배양에 비해 스페로이드의 수와 크기가 더 크며, 일정한 크기 분포를 나타낸다.
본 발명의 일구체예에 따르면, 초음파 또는 레이저 처리된 사람 피부 섬유아세포의 부유 배양 시 대략 3일째부터 미분화 마커의 발현이 증가하거나 안정화되어 이 시기부터 역분화가 시작되는 것으로 보인다. 또한, 열 처리된 사람 피부 섬유아세포의 부유 배양 시 대략 8일째부터 미분화 마커의 발현이 증가하거나 안정화되어 이 시기부터 역분화가 시작되는 것으로 보인다.
미분화 마커, 예컨대, OCT3/4, SOX2, NANOG, c-MYC, KLF4, TDGF1, SSEA4, TRA-1-60 등이 발현됨을 통해 스페로이드가 다능성을 가짐을 확인할 수 있다. 미분화 마커의 확인은 RT-PCR 또는 면역세포화학법을 통해 분석할 수 있으나, 이에 특별히 제한하는 것은 아니다.
또한, 본 발명의 다능성 세포는 3배엽 마커, 즉 외배엽(PAX6, Nestin), 중배엽(Brachyury, SMA), 내배엽(GATA4, AFP) 마커들을 높은 수준으로 발현하는 특징을 나타낸다.
또한, 본 발명의 다능성 세포는 증식 마커 단백질인 Ki-67를 발현하여 증식능을 가지는 특징이 있다.
또한, 상기의 역분화된 다능성 세포를 영양세포와 공배양할 경우 다능성 세포의 증식이 증가되고, 분화 유도 배지에서 배양 후 외배엽/내배엽/중배엽 및 신경세포/심근세포로 분화되는 것을 확인할 수 있다.
본 발명은 또한
세포 및 배양 배지를 수용할 수 있는 배양챔버; 및
상기 배양챔버의 일측에 배치되고, 상기 세포 및 배양 배지에 에너지를 제공할 수 있는 장치를 포함하고,
분화된 세포와 배양 배지를 혼합하고, 상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하며, 상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 다능성 세포 유도 장치를 제공한다.
상기 배양챔버는 통상 세포 배양에 사용되는 배양기를 의미한다. 예컨대, 배양챔버는 온도 제어부와 이산화탄소 제어부가 구비되어 있고, 배양챔버 내 세포 배양 조건은 목적과 세포의 종류에 따라 당업자 수준에서 적절히 조절될 수 있다.
또한, 상기 배양챔버는 분화된 세포에서 다능성 세포로 역분화시킴에 있어서 부유 배양 또는 단층 배양 방식을 사용할 수 있어, 이러한 배양이 가능한 구조로 되어 있는 것이 좋다. 예컨대 부유 배양을 위한 교반기가 구비된 배양챔버일 수 있다.
상기 에너지를 제공할 수 있는 장치는 초음파를 조사할 수 있는 초음파 발생장치, 레이저를 조사할 수 있는 레이저 발생장치, 또는 온도조절장치를 포함할 수 있다.
상기 초음파 발생장치는 주파수가 10kHz 내지 100MHz인 초음파를 발생하는 공지의 초음파 장치라면 제한 없이 사용할 수 있다.
상기 레이저 발생장치는 300 내지 900 nm 파장 대역의 펄스형 레이저 빔을 발생하고, 1 내지 15W 출력으로, 펄스 지속 시간이 1ms 내지 900ms이고, 주파수가 1 내지 100Hz인 레이저 장치를 사용할 수 있으나, 이에 특별히 제한하는 것은 아니다.
온도조절장치는 -40℃ 내지 99.9℃ 범위의 온도 조절이 가능한 공지의 온도조절장치를 사용할 수 있으나, 이에 특별히 제한하는 것은 아니다.
본 발명의 다능성 세포 유도 장치는 배양 배지와 분화된 세포의 혼합물에 상기 초음파 발생장치, 레이저 발생장치, 또는 온도조절장치를 이용하여 초음파, 레이저, 또는 열 처리하고 일정 시간 배양을 통해 다능성을 갖는 스페로이드(spheroid)를 형성함으로써 분화된 세포에서 다능성 세포로 역분화 시킬 수 있다. 이때, 역분화 효율을 높이기 위해 배양 배지를 분화된 세포와 혼합하기 전에 배양 배지에 초음파, 레이저, 또는 열 처리를 미리 수행할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1> Physics 세포의 제조
도 1은 본 발명의 Physics( p luripotent sp h ere y ielded by ultra s on ic s timulus) 세포 형성 모식도로, 5W/cm2의 강도로 10분간 초음파 처리한 ES(embryonic stem) 배지에 사람 피부 섬유아세포(HDFa, Cat. No. C-013-5C, GIBCO(Invitrogen cell culture))(1×106)를 섞고, 세포를 포함하는 혼합물에 초음파를 5초간 1W/cm2의 강도로 처리하였다. 살아있는 세포를 선별한 후, 35 mm 세균용 페트리 접시에서 2×105의 HDF를 사람 ES 배양 배지에서 6일 동안 부유 배양하였다.
배양 1일째부터 스페로이드(spheroid)가 형성되고, 3일 이후부터 미분화 마커들이 발현된다.
<실험예 1> 스페로이드 형성의 최적 조건 실험
사람 피부 섬유아세포는 초음파 처리 시 스페로이드를 형성하므로 스페로이드 형성 효율을 높이기 위한 최적 조건 확립을 위해 초음파 처리 조건, 세포 배양 방식 등을 달리하여 실험하였다.
세포 배양 방식은 세포 배양 접시 표면이 코팅되지 않은 접시(세균용 페트리 접시)에서 배양하는 부유 배양(Suspended culture)과 세포 배양 접시 표면이 코팅되어 세포가 표면에 잘 붙는 접시(조직 배양 접시)에서 배양하는 단층 배양(Monolayer culture)을 사용하였다.
또한, 대조군으로 아무런 처리를 하지 않은 그룹(Null), 배지에 초음파를 처리한 그룹(UM: Ultrasound treated Media, 5W/cm2의 초음파 강도로 10분간 처리), 세포에 초음파를 처리한 그룹(UC: Ultrasound treated Cell, 1W/cm2의 초음파 강도로 5초간 처리) 및 세포와 배지에 초음파를 모두 처리한 그룹(UCUM: UM+UC)으로 나누고, 배양시간에 따른 세포 형태의 변화를 관찰하고, 스페로이드의 수를 측정하여 배양시간에 따른 스페로이드 수와 크기의 변화를 분석함으로써 스페로이드 형성 효율을 확인하였다. 실험 대상 세포는 사람 피부 섬유아세포이다.
우선, 초음파 강도 조건을 확립하기 위해, 초음파 강도(5초간 0, 0.5, 1, 3, 5, 10 W/cm2) 별로 HDF(1×106)에 직접적으로 노출시켰다. 살아있는 세포를 선별한 후, 35 mm 세균용 페트리 접시에서 2×105의 HDF를 사람 ES 배양 배지에서 6일 동안 배양하였다.
ES 배지 조성
시약명 용량 최종농도 비고
DMEM/F-12 500mL 500mL
Serum Replacement (KnockOut™ Serum Replacement) 100mL 20%
NEAA (non-Essential Amino Acids) 5mL 1%
P/S (Peniciline & Streptomycin) 5mL 1%
β-Mercaptoethanol 0.9mL 0.1mM
Glutamin (L-Glutamine, 200 mM Solution) 2.5mL 1mM
basic human fibroblast growth factor 2 (FGF) (Recombinant Human FGF-Basic) 2mg 4ng/mL 초음파 처리 후 첨가
도 2a의 (a)에 나타난 바와 같이, 0.5, 1 및 3 W/cm2의 초음파 강도에서, 초음파 처리된 대부분의 HDF는 자발적으로 응집되고, 다세포 스페로이드를 형성하였다. 대조군은 접시 표면에 부착되어 있으나, 5 및 10 W/cm2 강도의 초음파가 처리된 HDF는 스페로이드 형성 없이 세포 사멸이 증가되었다.
도 2a의 (b)는 도 2a의 (a)에서 초음파 강도 별로 생성된 다세포 스페로이드의 수를 나타낸 것이다.
1 W/cm2의 초음파 강도에서 살아있는/죽은 세포 분석 및 이미지 분석 결과, 도 2c 및 2d에 나타난 바와 같이, 25%의 세포가 부분적으로 손상을 받았고, 95% 이상의 세포 생존능이 유지되었다. 그러나, 1 W/cm2 보다 높은 초음파 강도에서, HDF는 심각하게 손상을 받아 세포 사멸에 이르렀다.
따라서, 1 W/cm2 의 고정된 초음파 강도 조건에서, 노출 시간(0, 1, 2, 5, 10, 20, 40초)을 달리하고, 35 mm 세균용 페트리 접시에서 사람 ES 세포배양배지에서 3일간 배양하였다.
도 3a 및 3b의 (a)-(d)에 나타난 바와 같이, 초음파에 5초 간 노출시킨 경우, 생성된 스페로이드의 수는 다른 노출 시간에 비해 가장 높았다. 그러나, 10초 이상 노출한 경우, 세포 사멸이 극적으로 증가하였는데, 이는 세포막 손상에서 기인한 것으로 보인다.
다음으로, ES 세포배양배지에 초음파 노출 강도(0, 1, 5, 10 W/cm2)를 달리하여 10분간 처리하였다. 35 mm 세균용 페트리 접시에서 초음파 노출된 2×105 HDF(1 W/cm2, 5초)를 이들 배지에서 3일간 배양하였다.
도 4에 나타난 바와 같이, 1W/cm2 보다 5 W/cm2 의 초음파 처리된 배양배지에서 약 2배의 스페로이드가 발생하였다.
노출시간(0, 5, 10, 20분)의 변화는 스페로이드 형성 효율에 대해 유의적인 효과를 보여주지는 않았다. 일반적으로, 짧은 노출시간이 일정한 크기 범위와 더 많은 수를 야기하였다(도 5).
다음으로, 배양 조건을 달리하였을 때 스페로이드 형성 효과를 조사하기 위해, ESC 배양배지에 초음파를 처리하고(5 W/cm2, 10분), HDF(1×106)에 초음파를 처리하였다(1 W/cm2, 5초). 살아있는 HDF(×105)를 선별한 후 세균용 페트리 접시에서 부유 배양하거나, 조직 배양 접시에서 단층 배양을 수행하였다.
도 6에 나타난 바와 같이, 부유 배양(suspended culture)된 초음파-처리된 HDF는 단층 배양된 것과 비교하여 더 높은 스페로이드 형성 효율을 보여주었다. 그리고 초음파의 자극을 세포와 배양배지 양쪽에 자극을 주었을 때 더 높은 스페로이드 형성 효율을 보여주었다
부유 배양 또는 단층 배양 하에서 초음파 자극별로 생성된 다세포성 스페로이드의 크기 분포를 보기 위해, 초음파 처리된 HDF 또는 비처리 HDF를 세균용 페트리 접시 또는 조직 배양 접시에서 초음파 처리 또는 비처리된 ES 배양배지에서 배양하였다.
도 7 및 도 8에 나타난 바와 같이, 두 배양 접시에서, HDF 및 배양배지 둘 다 초음파 처리될 때(UCUM) 더 높은 스페로이드 형성 효율이 관찰되었다.
또한, 부유 배양 조건은 더 높은 효율을 보여주며, 스페로이드는 수와 크기 면에서 크며(200㎛ 이상의 직경), 단층 배양(monolayer culture) 조건 보다 일정한 크기 분포를 나타냈다.
비처리된 ES 세포배양배지에서 자란 초음파 처리된 HDF(UC)는 스페로이드를 형성하였다. 그러나, UCUM 조건과 비교하여, 스페로이드의 수와 크기(200㎛까지)는 너무 낮다. 초음파 처리된 ES 세포배지에서 정상 HDF 배양(UM) 결과 크기가 작은(100㎛ 이하) 소량의 스페로이드가 형성되었다. 조직배양접시를 이용한 단층 배양의 UC 및 UM 조건은 스페로이드 형성 효율이 너무 낮았다. 대부분의 HDF는 배양접시 표면에 부착되어 있고, 스페로이드 수는 너무 작았다.
그리고 부유 배양 또는 단층 배양 하에서 초음파 자극별로 생성된 다세포성 스페로이드의 배양 시간별 대표적인 미분화 유전자의 발현을 분석하기 위해, 상기 실시예 1의 방법에 따라 대조군 및 초음파 처리된 그룹(Null, UM, UC, UCUM)의 세포를 배양시간(1, 2, 3, 4, 5 및 6일) 별로 회수하여 Dynabeads® mRNA direct kit(ambion)를 이용하여 mRNA를 추출하고, SuperScrip-Ⅱ(invtrogen) cDNA를 합성한 후 표 2 에 기재된 프라이머를 사용하여 PCR로 증폭하고 전기영동하여 분석하였다.
RT-PCR을 통해 분석한 결과 도 9에서 HDF 및 배양배지 둘 다 초음파 처리될 때(UCUM) 미분화 마커 유전자의 발현이 안정적으로 발현되었으며, 특히 부유 배양한 경우가 단층 배양세포에 비해 더 높게 나타났다.
배양 환경에 따른 미분화 속성의 스페로이드 형성 차이를 확인하고자 부유 배양 또는 단층 배양 하에서 미분화 마커인 OCT3/4 발현 수준을 비교하였다. 이를 위해, 초음파 처리 후 배양시간(0, 1, 2, 3, 4, 5 및 6일) 동안 배양된 세포를 4% 파라포름알데히드로 30분간 고정하고, 항체의 침투능력을 향상시키기 위해 0.1% TritonX100이 첨가된 PBS 버퍼에 40분간 노출시킨 후, 비 특이적인 단백질 반응을 막기 위해 5% non goat serum이 첨가된 PBS 버퍼로 30분간 실온에서 블록킹 과정을 수행하였다. 이후 세포를 세척한 후 각각의 1차 항체(OCT4; 1:200, abcam)를 넣고 4℃에서 오버나이트 동안 반응시키고, 0.03% Triton X100이 첨가된 PBS 버퍼로 3회 세척 후 2차 항체(IgG anti-rabbit conjugate alexa 488)를 D-PBS 버퍼로 각각 1:1000으로 희석하여 2시간 동안 실온에서 염색하였다. 염색된 세포는 0.03% TritonX100이 첨가된 PBS 버퍼를 사용하여 4회 세척한 후 슬라이드에 DAPI가 첨가된 마운팅 용액(mounting sol.)을 뿌려 커버 슬립으로 덮고 매니큐어로 모서리를 밀봉한 후 공초점 레이저 현미경으로 관찰하였다.
도 10에 나타난 바와 같이, 흥미롭게도, UCUM 조건에서 초음파 처리 1일 이후 즉시 OCT3/4 발현이 검출되었다. OCT3/4 발현은 점차 증가하고, 부유 배양 조건은 단층 배양 조건보다 더 높은 발현 수준을 보여주었다.
다음으로, 부유배양으로 UCUM 조건하에서 스페로이드 배양 6일 동안, 6가지의 미분화 마커 유전자인 OCT3/4, SOX2, NANOG, TDGF1, c-MYC 및 KLF4를 RT-PCR로 분석한 결과, 도 11에서와 같이 처리 후 1일에 OCT3/4와 NANOG유전자 발현이 증가 하였으며, 이후 다른 유전자의 발현도 배양시간이 지남에 따라 증가되는 것으로 나타났으며, 모든 마커 유전자의 발현이 2일에 관찰되었으나 안정적인 발현은 3일 이후에 관찰되었다. 최초의 OCT3/4 발현 시점은 초음파 처리 10시간 후 즉시 검출되었다(도 12).
Physics 세포의 미분화 능력을 확인하기 위해 4종의 무작위로 선별된 스페로이드에서의 RT-PCR 결과 OCT3/4, SOX2, NANOG, REX1, TDGF1, FOXD3, FGF4, UTF1, ESG1, LIN28a, KLF4, c-MYC를 포함하는 다능성 마커 유전자의 발현을 확인하였고, 사람 H9 ESC 및 정상 HDF와 비교하였다(도 13). 실험은 5일 배양된 physics 세포를 회수 하여 Dynabeads® mRNA direct kit(ambion)를 이용하여 mRNA를 추출하고, SuperScrip-Ⅱ(invtrogen) cDNA를 합성한 후 표 2에 기재된 프라이머를 사용하여 PCR로 증폭하고 전기영동하여 분석하였다.
유전자 명칭 프라이머 서열 (5'->3')
OCT3/4 F GACAGGGGGAGGGGAGGAGCTAGG
R CTTCCCTCCAACCAGTTGCCCCAAAC
SOX-2 F GGGAAATGGGAGGGGTGCAAAAGAGG
R TTGCGTGAGTGTGGATGGGATTGGTG
NANOG F CAGCCCCGATTCTTCCACCAGTCCC
R CGGAAGATTCCCAGTCGGGTTCACC
c-Myc F AAACACAAACTTGAACAGCTAC
R ATTTGAGGCAGTTTACATTATGG
KLF4 F CCCACATGAAGCGACTTCCC
R CAGGTCCAGGAGATCGTTGAA
UTF1 F CCGTCGCTGAACACCGCCCTGCTG
R CGCGCTGCCCAGAATGAAGCCCAC
LIN28 F AGCGCAGATCAAAAGGAGACA
R CCTCTCGAAAGTAGGTTGGCT
REX1 F CAGATCCTAAACAGCTCGCAGAAT
R GCGTACGCAAATTAAAGTCCAGA
FGF4 F CTACAACGCCTACGAGTCCTACA
R GTTGCACCAGAAAAGTCAGAGTTG
FOXD3 F AAGCTGGTCGAGCAAACTCA
R CTCCCATCCCCACGGTACTA
ESG1 F ATATCCCGCCGTGGGTGAAAGTTC
R ACTCAGCCATGGACTGGAGCATCC
TDGF1 F CTGCTGCCTGAATGGGGGAACCTGC
R GCCACGAGGTGCTCATCCATCACAAGG
B-ACTN F CATGTACGTTGCTATCCAGGC
R CTCCTTAATGTCACGCACGAT
알칼라인 포스파타아제(AP) 염색 결과, 다세포 스페로이드의 다능성 상태의 특징을 나타내는 것으로 확인하였다. 부유 배양된 스페로이드는 단층 배양된 스페로이드보다 뚜렷한 붉은색을 나타내었다(도 14).
OCT3/4, SOX2, NANOG, SSEA-4 및 TRA-1-60의 발현은 H9 사람 ES 세포와 유사하였다(도 15). 또한, 다세포 스페로이드의 다능성 특성은 플로우 사이토메트리를 통해 확인하였다(도 16). SSEA4 및 TRA-60의 99.5% 이상이 스페로이드에서 발현되었고, 각 발현 수준은 H9 사람 ES 세포와 유사하였다.
또한, 스페로이드를 옮겨 마우스 배아 섬유아세포(MEF) 영양세포와 젤라틴-코팅된 조직배양 플레이트에서 공배양(coculture)하였을 때, 세포 스프레딩과 성장이 관찰되었다. 또한, 다능성 마커 유전자의 발현이 여전히 유지되었다(도 17).
또한, 미분화 마커의 발현을 추가로 확인하기 위해, DNA 메틸화 분석을 수행하였다. 유전자 발현이 시작되는 프로모터 부분이 메틸화가 되면 그 부분에서 유전자 발현이 되지 않는 것으로 알 수 있고, 탈메틸화된 경우 즉 DNA에서 메틸기가 떨어진 경우 그 부분의 유전자가 발현됨을 의미한다. 따라서, ES 세포의 주요 유전자인 미분화 줄기세포 주요 유전자인 OCT3/4와 NANOG 유전자 발현이 일어나고 있는지 두 유전자의 프로모터 부분의 메틸화 여부를 알아보았다.
이를 위해, Physics 스페로이드에서 DNA를 proteinase K와 페놀을 이용하여 추출한 후, EZ DNA 메틸화 키트(Zymo Reaserch)를 이용하여 Physics 스페로이드의 OCT3/4와 NANOG DNA 메틸화를 분석하였다. 분석에 이용한 DNA 증폭용 프라이머는 아래와 같다.
1) 사람 NANOG 증폭용 프라이머:
정방향 프라이머: 5'-TAGGAGTAGAGTGTAGAGGAGAATGAGTTA-3'
역방향 프라이머: 5'-ATCTATCCCTCCTCCCAAATAATC-3'
증폭 산물의 크기: 377 bp, Tm: 55, 산물에서 CpGs: 6
2) 사람 OCT4 증폭용 프라이머:
정방향 프라이머: 5'-TTTTTTTAAATTAGAAATTTTAATTATTTG-3'
역방향 프라이머: 5/-AATTACAAAAACCATACCTACAACC-3'
증폭 산물의 크기: 417bp, Tm: 55, 산물에서 CpGs: 4
바이설파이트 게놈 시퀀싱에 의해 평가되는 다능성-특이 OCT3/4 및 NANOG 유전자의 프로모터 영역에서 사이토신 구아닌 다이뉴클레오타이드(CpG)의 메틸화는 Physics 세포가 ES 세포와 유사하게 고도로 탈메틸화되나, 오리지널 HDF 세포에서 이 영역의 CpG 다이뉴클레오타이드는 낮은 탈메틸화가 보였다(도 18). 이들 결과는 OCT3/4와 NANOG 프로모터는 초음파 처리에 의해 활성화됨을 시사한다.
<실시예 2> Physics 세포의 증식능 및 다분화 능력
Physics 세포의 증식능은 증식 마커 단백질인 Ki-67 면역염색 방법 및 p스트(Hoechst 33342)와 프로피디움 아이오다이드(PI)을 이용한 시간 차 세포 핵 염색을 통해 평가하였다.
도 19에 나타난 바와 같이, 5일째에, Physics 세포에서 Ki-67의 발현이 검출되었다.
이에 더 확실한 증명을 위해 다음과 같은 방법을 통해 세포 증식을 확인하였다. 침투성이 좋아 살아있는 세포의 핵에 염색이 가능한 Hoechst 33342를 이용하여 5일째 배양된 Physics 세포를 염색하고 염색 시약을 완전히 제거 후 3일간 배양하고 나서, 총 8일간 배양된 Physics 세포를 4% paraformaldehyde로 고정 한 후 추가로 PI로 세포 핵을 염색하였다. 중복되지 않은 붉은색 신호는 5일 이후 세포분열에 의해 새롭게 형성된 Physics 세포를 의미한다. 또한, 동영상을 통해 단일 스페로이드를 5일간 배양하여 스페로이드 직경을 측정한 결과 크기의 증가를 통해 Physics 세포의 증식능을 입증한다.
Physics 세포의 자기-재생 능력을 평가하기 위해, Hoechst 33342로 염색된 Physics 세포를 추가로 5일간 배양하고 나서, 4% paraformaldehyde로 고정한 후 PI 및 OCT3/4로 다시 염색하였다. PI 신호는 Physics 세포 내 핵을 의미한다. Hoechst 33342와 거의 합병된 OCT3/4로 대비 염색된 핵은 Hoechst 33342가 5일 전에 Physics 세포를 염색하였음을 의미한다.
도 20에 나타난 바와 같이, 추가 배양의 5일 동안, 다능성 특성(OCT3/4)이 딸 Physics 세포로 전달되지 않았다. 이들 결과는 Physics 세포가 증식할 수 있으나 5일 이후 자기-재생을 하지 않음을 의미한다.
그리고 Physics 세포의 초기 배양 시기 동안, 각 배엽에서 특이 마커 유전자들의 발현을 발견하였다. 미분화된 및 분화된 마커 둘 다를 발현하는 Physics 세포의 독특한 유전자 발현 패턴은 사람 ESC에서 유래된 EB와 비교할 만 하였다(도 21). 왜냐하면 그들의 형태가 매우 유사하기 때문이다.
면역세포화학 분석 결과, Physics 세포와 EB는 내배엽(GATA4 및 AFP), 외배엽(PAX6 및 Nestin), 중배엽(Brachyury 및 SMA)의 마커들을 높게 발현하였다. OCT3/4 외에도, PAX6의 발현 역시 초음파 처리 후 1일쨰에 바로 검출되었다. 3배엽의 다른 유전자들의 발현은 Physics 세포의 생성 후 3일째에 시작되었다. 배양 15일 동안, 3배엽 마커들의 발현 수준은 점차 증가하였다. 그러나, OCT3/4 발현은 8일 이후 감소하였다(도 22).
<실시예 3> 초음파 자극에 의한 세포 변화
Physics 세포 발생 동안 HDF로의 초음파 자극의 효과를 평가하기 위해 초음파 조건별로 비교하였다. 초음파 처리 후 및 초음파 처리된 HDF의 2시간 배양 후 직접적으로 SEM 분석을 수행하였다.
도 23에 나타난 바와 같이, 몇몇 세포막 기공이 UC 및 UCUM 조건 둘 다에서 생겼다. 아마도 HDF가 초음파에 직접적으로 노출되었기 때문인 것으로 보인다. 그러나, UM 조건에서 HDF는 세포막을 통과하는 어떠한 기공 발생도 보여주지 않았다. 이는 배양배지에만 초음파를 처리하는 것은 세포막 손상에 충분하지 않기 때문이다. 특히, 세포배양의 2시간 후, 생성된 기공은 UC 및 UCUM 조건에서 둘 다 사라졌다. 이들 결과는 초음파 자극은 세포 사멸을 유도할 정도로 심각한 것은 아니나 세포막의 일시적인 투과를 유도하기에는 충분하며, 이후 초기 세포배양시기 동안 손상된 세포막이 회복됨을 시사한다.
손상된 세포막의 회복 과정은 또한 live/dead kit을 이용하여 세포막 손상이 없는 것은 (녹색형광)/죽거나 세포막손상이 있는 세포는(붉은색 형광) 분석에 의해 입증되었다. HDF 세포에 초음파 처리 직후와 2시간이 지난 후 형광시약으로 염색한 결과 2시간 이후 붉은색 형광의 비율이 줄어드는 것으로 보아 SEM 분석 결과와 마찬가지로 2시간 후 초음파로 인한 세포막 손상이 회복되는 것으로 나타났다(도 24).
또한, 시약을 초음파 자극을 받은 세포와 스페로이드 형성의 연관성을 확인하기 위해, 초음파 처리된 HDF에 live/dead kit 를 부가하고 녹색/붉은색 이중 염색된 HDF는 살아있는 세포 이미징 장치를 이용하여 24시간 동안 추적하였다.
도 25에 나타난 바와 같이, HDF는 단지 녹색 또는 붉은색/녹색 이중으로 염색된 다른 HDF와 응집하여 다세포 스페로이드를 형성하였다. 24시간 후 대부분의 약간 손상된 HDF는 안정한 Physics 세포를 형성하였다.
초음파-유도된 세포막 손상 및 일시적인 투과는 또한 각각 형광 염료 Fluo-4 염료 및 CM-H2DCFDA를 사용하여 증가된 세포내 Ca2 + 농도 및 세포내 H2O2 생산에 의해 특징을 나타내었다. 초음파를 노출하자마자, Physics 세포의 Ca2 + 농도가 갑자기 증가하고 나서, 150초에 감소하였다(도 26). Physics 세포에서 세포내 H2O2의 농도는 미처리 대조군 HDF와 비교하여 초음파 노출 60분 후 6배 더 높았다(도 27 및 도 28).
추가로, ATP가 다양한 세포성 스트레스에 대한 반응에서 신호로 이용되기 때문에 세포외로 방출된 ATP의 농도를 분석하였다.
도 29에 나타난 바와 같이, 초음파는 미처리 HDF 대비 Physics 세포에서 ATP의 22배 더 많은 방출을 자극하였다.
이온향성 P2X 수용체 및 대사성 P2Y 수용체는 ATP 방출에 의해 발현이 활성화되는 것으로 알려져있어 이들 수용체의 발현을 비교하였다.
Physics 세포에서 P2X4, P2X7, P2Y1, P2Y2 및 P2Y11의 더 높은 발현이 검출되었다(도 30).
Physics 세포의 향상된 세포 흡수는 추가로 Alexa-705 표지된 양자점(QD705)를 이용하여 확인하였다. QD705를 배양접시에 부가하고 24시간 후 공초점 현미경 이미지를 얻었다.
스페로이드 타입 내 Physics 세포 및 이웃하는 단일 Physics 세포와 응집하지 않은 단일 세포 타입 둘 다, QD705를 흡수하였다. 그러나, 정상 HDF는 QD705를 흡수하지 않았다(도 31). 이는 외부의 요소들의 세포 흡수가 초음파 자극에 의해 향상됨을 입증하는 것이다.
한편, 엑소좀 RNA는 Physics 세포 배양배지로부터 준비되며, RT-PCR 분석을 통해 Physics 세포의 발생 동안 세포배양 환경의 유전자 발현 패턴을 연구하였다. 일반적으로, 엑소좀은 몇몇 유전자 요소들, 예컨대, RNA, microRNA, DNA, 단백질을 포함한다. 또한, 엑소좀에서 유전자 요소들의 발현 프로파일은 세포 상태-의존적이다.
도 32에 나타난 바와 같이, 다능성 마커 유전자들의 높은 발현이 Physics 세포 배양 배지로부터 정제된 엑소좀에서 관찰되었다. 가장 두드러진 유전자 발현은 OCT3/4 및 NANOG 였다. 배양 시간이 진행됨에 따라, OCT3/4 발현은 두드러지게 증가하였다. NANOG 발현은 4일 후에 떨어졌다. c-MYC 발현은 부유 배양 조건에서 일정한 반면, 단층 배양 조건에서 2일 후에 감소하였다. 모든 다능성 마커 유전자들, 예컨대, REX1, TDGF1, FOXD3, UTF1, LIN28의 발현은 비록 그들의 발현 수준이 낮긴 하나 부유 배양 조건에서 검출되었다. 그러나, 이들 유전자들은 단층 배양 조건에서는 검출되지 않았다. 이들 결과는 초음파 처리된 HDF 중 유전자 요소들의 전달 가능성을 시사한다.
이 가설을 입증하기 위해, 초음파-미처리된 HDF를 Physics 세포와 공배양하였다. 이미징 분석을 위해, 리포펙타민에 의해 Cy5.5 붉은색 형광 염료를 HDF에 감염시켰다. Physics 세포는 별도로 생성되었고, 2일 유지 후, Physics 세포를 Cy5.5-감염된 HDF 배양접시에 부가하였다. 공배양 동안, 배양배지에 초음파를 처리하지는 않았다. 이는 UM 조건 역시 다능성 마커 유전자 발현을 유도할 수 있기 때문이다.
공초점 현미경 이미지는 Physics 세포와의 공배양 동안 Cy5.5-감염된 HDF로부터 OCT3/4 발현이 관찰되었다. OCT3/4 발현은 Cy5.5-감염된 HDF 단독 배양에서는 검출되지 않았다. 이들 결과는 Physics 세포의 다능성 특성이 이웃하는 정상 세포로 전달되고, 이후 정상 세포의 Physics 세포로의 리프로그래밍을 강하게 입증한다. 일반적으로, 세포에서 유전자 요소 전달에 엑소좀이 참여한다(도 33).
<실시예 4> Physics 세포의 인 비트로 분화
인 비트로 분화를 위해 5일 배양된 Physics 세포를 젤라틴이 코팅된 조직 배양 접시로 옮겼다. 옮긴 세포는 특이 분화 배지를 이용하여 신경 또는 심장 계통으로의 분화를 유도하였다. 상기 특이 분화 배지는 표 3와 같다. 분화 유도 후 8일된 세포에서 3 배엽 주요 단백질(GATA4, AFP, PAX6, Nestin, Brachyury, SMA)들이 발현되었다(도 34).
배지의 종류 성분 함량
배지1(외배엽/성상세포 분화유도배지) DMEMFBSN2 supplementGlutamax-I 1%1%1%
배지2(중배엽/심근세포 분화유도배지) DMEMFBS2-mercaptoethanolNon essential amino acidPenicillin/streptomycinAscorbic acid 20%1%1%M100 μM
배지3(내배엽/신경세포 분화유도배지) DMEMFBS2-mercaptoethanolNon essential amino acidPenicillin/streptomcin 20%1%1%
유전자 명칭 프라이머 서열 (5'->3')
AFP F GAATGCTGCAAACTGACCACGCTGGAAC
R TGGCATTCAAGAGGGTTTTCAGTCTGGA
FOXA2 F TGGGAGCGGTGAAGATGGAAGGGCAC
R TCATGCCAGCGCCCACGTACGACGAC
Brachyury F GCCCTCTCCCTCCCCTCCACGCACAG
R CGGCGCCGTTGCTCACAGACCACAGG
MSX1 F CGAGAGGACCCCGTGGATGCAGAG
R GGCGGCCATCTTCAGCTTCTCCAG
ACTA2 (a-SMA) F CTATGAGGGCTATGCCTTGCC
R GCTCAGCAGTAGTAACGAAGGA
TnTc F ATGAGCGGGAGAAGGAGCGGCAGAAC
R TCAATGGCCAGCACCTTCCTCCTCTC
GATA4 F CGACACCCCAATCTCGATATG
R GTTGCACAGATAGTGACCCGT
NKX2.5 F CCAAGGACCCTAGAGCCGAA
R ATAGGCGGGGTAGGCGTTAT
Nestin F GAAACAGCCATAGAGGGCAAA
R TGGTTTTCCAGAGTCTTCAGTGA
PAX6 F ACCCATTATCCAGATGTGTTTGCCCGAG
R ATGGTGAAGCTGGGCATAGGCGGCAG
Map2 F CAGGTGGCGGACGTGTGAAAATTGAGAGTG
R CACGCTGGATCTGCCTGGGGACTGTG
GFAP F GGCCCGCCACTTGCAGGAGTACCAGG
R CTTCTGCTCGGGCCCCTCATGAGACG
Sox1 F TACAGCCCCATCTCCAACTC
R GCTCCGACTTCACCAGAGAG
Chat F GGAGGCGTGGAFCTCAGCGACACC
R CGGGGAGCTCGCTGACGGAGTCTG
Aadc F CGCCAGGATCCCCGCTTGAAATCTG
R TCGGCCGCCAGCTCTTTGATGTGTTC
Dat F ACAGAGGGGAGGTGCGCCAGTTCACG
R ACGGGGTGGACCTCGCTGCACAGATC
Th F CTGTGGCCTTTGAGGAGAAG
R GGTGGATTTTGGCTTCAAAC
Tuj1 F GAGCGGATCAGCGTCTACTACAA
R GATACTCCTCACGCACCTTGCT
Vglut1 F CGACGACAGCCTTTTGTGGT
R GCCGAGACGTAGAAAACAGAG
Vmat2 F CTTTGGAGTTGGTTTTGC
R GAGTTGTGGTCCATGAG
도 35 및 도 36에 나타난 바와 같이, 1-2주 분화 시기 동안, 유전자 17(SOX17, 내배엽), paired box 6(PAX6, 외배엽), Nestin(신경세포마커), microtubule-associated protein 2(MAP2, 외배엽), class III beta-tubulin(TuJ1, 신경세포마커), msh homeobox 1(MSX1, 중배엽), Brachyury(중배엽), myosin light chain 7(MYL7, 심근세포), NK2 homeobox 5(NKX2.5, 심근세포), 및 Troponin T type 2(TnnT2, 심근세포)를 포함하는 SRY-box의 발현이 RT-PCR에 의해 관찰되었다.
특히, OCT3/4의 발현이 분화 유도 후 유의하게 감소하였다.
신경 또는 심장세포로의 분화는 또한 면역세포화학에 의해 확인되었다.
도 37 내지 도 39에 나타난 바와 같이, 성상세포 배지에서 자란 Physics 세포에서 신경전구세포 마커(PAX6 및 Nestin)가 관찰되었다. 이들 분화된 Physics 세포는 성상세포 배지를 희돌기교세포 배지 또는 뉴런 배지로 바꾼 후 2주 동안 추가적인 분화가 유도되었을 때, 각각 희돌기교세포 마커(MAP2 및 O4) 또는 뉴런 마커(MAP2 및 Tuj1)의 발현이 관찰되었다. 분화 시기의 2주는 MHC, SMA, Actinin, NKX2.5 및 TnTc를 포함한 심장 마커를 검출하는데 충분하였다. 특히, 전형적인 분절된 액틴 패턴이 액티닌에서 검출되었다. 그러나, 같은 배양 조건 하에서 HDF는 어떠한 신경 또는 심장 마커들을 발현하지 않았다.
<실시예 5> 안정성 검사
초음파는 돌연변이, 유전자 변형, 암 발생 등의 바람직하지 않은 부작용을 유도하지 않았다. Physics 세포는 정상 핵형을 가지고 있었다(도 40),
<실시예 6> Physics 세포의 인 비보 분화능 평가
Physics 세포의 인 비보 분화 능력을 평가하기 위해 5일 배양된 Physics 세포를 4-5주된 면역결핍 마우스(NOD/SCID mouse)의 정소와 허벅지 근육에 1×106 세포를 주입하여 4주간 사육 후 정소와 근육을 회수하여 4% 파라포름알데히드로 고정 후 냉동절편(cryosection)하여 Human Nuclear antigen 염색을 통해 주입한 세포의 위치를 파악하고, 다양한 증식 및 분화관련 단백질 마커들(Ki67, CD44, SMA)을 염색하여 주입된 세포의 분화 유무를 확인하였다.
도 41에서 정소에 주입된 Physics 세포는 4주 후 정소내 혈관 내피세포에서 관찰되었으며, Ki67 염색을 통해 증식되고 있음을 확인하였고, 화살표에서 표시한 세포에서 보듯이 혈관 내피세포 마커인 CD44가 염색된 것을 확인하였다.
마우스 허벅지에 주입된 세포는 근육섬유층 외부인 라미나 층에서 발견되었으며, 근육 단백질 마커인 SMA 염색이 된 것을 확인하였다(도 42). 이와 같은 결과는 체내에 주입된 Physics 세포가 주변 세포와 환경에 맞추어 분화되었음을 시사하는 것이다.
<실시예 7> 세포 배양 배지의 효과
Physics 세포를 발생시키기 위해 사람 ES 세포배양배지를 사용하였다. ES 세포배양배지는 미분화 상태에서 ES 세포를 유지 및 번식하기 위한 제한 배지로서 개발되었다. 세포배양배지의 효과를 조사하기 위해, Physics 세포를 발생시키기 위해 정상 HDF 배양배지를 사용하였다.
도 43a 및 b에 나타난 바와 같이, ES 세포배양배지와 비교하여, 형태 및 스페로이드 형성 효율은 꽤 달랐다. 초음파 처리된 HDF 배지에서 씨딩한 후 1일째에, 다세포 스페로이드는 소량 형성되었다. 그러나, 2일 후, 대다수의 스페로이드는 접시 표면에 부착되어 있었다. 배양 4일째에 모든 스페로이드는 접시 표면에 부착되어 전형적인 섬유아세포 형태로 자랐다. 면역세포화학 결과 또한 두 종류의 다른 배양배지 조건 간의 다른 유전자 발현 패턴을 보여주었다. ES 세포배양배지를 이용하여 발생된 전형적인 Physics 세포는 OCT3/4, SOX2, NANOG, SSEA-4, 및 TRA-1-60의 높은 발현 수준을 보였다. DMEM 배지는 미분화 마커 유전자 및 3배엽 마커 유전자 발현을 유도하기 위한 어떠한 효과도 보이지 않았다. 이들 결과는 스페로이드 형성 및 특이 마커 유전자들의 발현이 세포배양배지의 성분과 밀접하게 연관되어 있음을 시사하는 것이다.
<실시예 8> 세포주의 효과
Physics 세포 발생 방법이 다른 세포주에 적용할 수 있는지 앞으로의 임상 적용에 적용할 수 있는지를 평가하기 위해, HeLa 세포, L132 사람 폐 상피세포 및 환자-유래 피부 섬유아세포 같은 다른 세포주를 이용하여 Physics 세포 발생을 조사하였다.
도 44a-c에 나타난 바와 같이, 2종의 세포주 또한 초음파의 직접적인 노출 후 세균용 페트리 접시에서 초음파 처리된 ES 세포배양배지에서 배양된 후 다세포 스페로이드를 형성하였다. 흥미롭게도 HDF로부터 생기는 Physics 세포와 비교하여, 2종의 세포주로부터 생긴 새로운 Physics 세포의 형태 및 크기 분포는 꽤 다르다. HeLa 세포 유래의 Physics 세포의 크기 분포는 상당히 일관성이 없고 크기는 너무 컸다. L132 세포 유래의 Physics 세포는 더 복잡하고 응집된 형태를 보였다. 각 스페로이드는 추가로 융합되고 판-같은 구조를 형성하였다.
도 44b 및 44c에 나타난 바와 같이, 2종의 다른 Physics 세포로부터 OCT3/4, SOX2, NANOG, SSEA4, 및 TRA-1-60를 포함하는 다능성 마커 및 GATA4, AFP, PAX6, Nestin, Brachyury, 및 SMA를 포함하는 3배엽 마커 유전자들의 발현은 면역세포화학에 의해 확인되었다.
그리고 환자 피부세포를 이용한 실험 결과에서도 Physics 세포와 같은 스페로이드를 형성하였고, 다능성 마커 및 3배엽 마커의 발현이 면역세포화학에 의해 확인되었다(도 45).
이들 결과는 Physics 세포 발생을 유도하는 초음파 자극이 다양한 세포주에 적용될 수 있음을 강하게 입증하며, 환자 세포를 이용한 자가 세포 치료의 가능성을 나타냈다.
<실시예 9> 다른 에너지원 제공의 효과
추가적인 외부 자극을 HDF 및 ES 세포배양배지에 가하여 Physics 세포의 발생 기작을 확인 및 평가하였다.
초음파 처리 대신 레이저 처리를 통해 Physics 세포가 형성되는지를 확인하였다. 이를 위해, 초음파 처리에 사용되었던 사람 피부 섬유아세포를 동일하게 사용하였고, 레이저 처리 조건은 Ocla 치료용 레이저(Ndlux)를 사용하여, 808nm의 레이저를 5초간 조사한 후 배양하였다.
열 처리를 위해, 피부 섬유아세포를 42℃로 2분간 노출시킨 후 아이스에서 약 5초간 정치하였다.
도 46 및 47에 나타난 바와 같이, HDF 및 ES 세포배양배지 둘 다에 레이저 또는 열 처리 후 다세포 스페로이드가 성공적으로 발생하였다. 레이저 처리된 HDF는 또한 레이저 유도 후 다세포 스페로이드를 즉시 형성하였다. 비록 스페로이드의 모양이 불규칙적이고 크기 분포가 균일하지는 않으나, 다능성 마커 및 3배엽 마커들의 높은 수준의 발현이 관찰되었다. 열처리 역시 스페로이드 형성을 유도하였다. 그러나, 효율은 초음파 및 레이저 처리보다 낮았다. 유지 8일 동안 열에 의해 유도된 다세포 스페로이드의 절반 이상이 접시 표면에 부착하였다. 더 낮은 스페로이드 형성 효율에도 불구하고, 다능성 마커 및 3배엽 마커의 높은 발현 수준이 관찰되었다. 이들 결과는 Physics 세포의 발생이 물리적 자극과 밀접하게 연관되어 있음을 강하게 입증하는 것이다.
<실시예 10> 마우스 Physics 세포의 제조
도 48에 도시된 과정에 따라 마우스 Physics 세포를 제조하였다. 이를 위해, 20KHz 초음파를 5W/cm2의 강도로 10분간 처리한 ES 배지에 OG2 마우스 MEF(Mouse Embryonic Fibroblast cell; 마우스 배아 섬유아세포)를 섞고, 그 세포에 직접적으로 초음파를 5초간 1W/cm2의 강도로 처리하여 배양하였다. 배양된 세포는 1, 3, 5, 8 및 10일 간격으로 형광현미경으로 세포의 형태 변화와 GFP 형광의 발현을 관찰하였다. 초음파 처리를 위한 배지 조성은 표 1과 같다.
상기 MEF 세포는 OCT4 프로모터가 삽입된 GFP 유전자를 형질전환 시킨 마우스의 13.5일된 배아의 섬유아세포로 일반적으로는 OCT4가 발현되지 않는 세포이나 만약 OCT4가 발현되면 GFP가 발현되어 녹색 형광이 보인다.
도 49A에서 대조군은 OG2 MEF 세포 사진도로 녹색 형광이 나타나지 않았다(OCT4 발현이 없음). 그러나 초음파를 처리한 OG2 MEF의 경우 배양 시간이 지날 수록 세포 구체의 크기가 증가하고, 녹색 형광의 강도가 강해지는 것을 알 수 있다. 이는 초음파 처리가 OCT4 발현을 유발한 것을 의미하며, OCT4는 미분화 줄기세포의 주요한 특징으로서, 이는 초음파 처리로 인해 OG2 MEF 세포가 줄기세포로 역분화됨을 알 수 있는 결과이다.
도 49B는 Tile scan 사진으로 넓은 범위를 여러 장의 사진을 찍어 합친 사진도로 초음파 처리 효과를 보여주는 결과이며, 많은 수의 MEF 세포가 초음파 처리로 인한 역분화로 OCT4-GFP를 발현하며, 도 50에서 생성된 스페로이드의 GFP 발현 효율을 분석한 결과 약 93% 정도의 OCT4-GFP 발현 효율을 나타났으며, 플로우 사이토메트리를 이용해 전체세포에서의 GFP 발현을 확인한 결과 약 85.3%의 세포에서 GFP가 발현되었으며, 세포표면 미분화 단백질 마커인 SSEA1의 발현을 분석한 결과에서도 약 75.5%의 발현이 나타났다(도 51). 이와 같은 결과는 초음파로 인한 역분화 효율이 상당히 높음을 시사한다.
다음으로, 하기 표 5에 나타난 프라이머 세트를 사용하여 대표적인 마우스 배아 줄기 세포(ESc)의 미분화 마커 유전자와 단백질 마커(OCT4, SOX2, NANOG, SSEA1)들의 발현을 RT-PCR과 세포면역화학법으로 확인하였다.
도 52 및 53에 나타난 바와 같이, 마우스 Physics 세포에서 미분화 마커들이 발현됨을 확인하였다.
또한, 알카라인 포스피테이트 염색을 통해서도 확인하였다(도 54).
마우스 ES 미분화 마커 발현 확인을 위한 RT-PCR용 프라이머
유전자 명칭 프라이머 서열(5'-3')
Oct3/4 F CTGAGGGCCAGGCAGGAGCACGAG
R CTGTAGGGAGGGCTTCGGGCACTT
Sox2 F TAGAGCTAGACTCCGGGCGATGA
R TTGCCTTAAACAAGACCACGAAA
Nanog F CAGGTGTTTGAGGGTAGCTC
R CGGTTCATCATGGTACAGTC
c-Myc F TGACCTAACTCGAGGAGGAGCTGGAATC
R AAGTTTGAGGCAGTTAAAATTATGGCTGAAGC
Klf4 F GCGAACTCACACAGGCGAGAAACC
R TCGCTTCCTCTTCCTCCGACACA
Esg1 F GAAGTCTGGTTCCTTGGCAGGATG
R ACTCGATACACTGGCCTAGC
Rex1 F ACGAGTGGCAGTTTCTTCTTGGGA
R TATGACTCACTTCCAGGGGGCACT
Utf1 F GGATGTCCCGGTGACTACGTCTG
R GGCGGATCTGGTTATCGAAGGGT
TDGF1 F ATGGACGCAACTGTGAACATGATGTTCGCA
R CTTTGAGGTCCTGGTCCATCACGTGACCAT
Esrrb F GTGGCTGAGGGCATCAATG
R AACCGAATGTCGTCCGAAGAC
Sall4 F TGGCAGACGAGAAGTTCTTTC
R TCCAACATTTATCCGAGCACAG
LIN28a F GGCATCTGTAAGTGGTTCAACG
R GCCAGTGACACGGATGGATT
B-actin F CTGGCTGGCCGGGACCTGAC
R ACCGCTCGTTGCCAATAGTGATGA
마우스 분화 마커 발현 확인을 위한 RT-PCR용 프이머
유전자 명칭 프라이머 서열(5'-3')
Tuj1 F ATCCACCTTCATTGGCAACAGCAC
R ACTCGGACACCAGGTCATTCATGT
Map2 F AGCCGCAACGCCAATGGATT
R TTTGTTCCGAGGCTGGCGAT
GATA4 F AACCAGAAAACGGAAGCCCAAG
R TACGCGGTGATTATGTCCCCAT
SOX7 F AACACGCTGCCTGAGAAAAACG
R AATAGGCTGGAGATGGGGGACA
Foxa2 F TACACACACGCCAAACCTCCCT
R GCTTCCTTCAGTGCCAGTTGCT
CER1 F AGGCAGAAGACAAGCCGGATCT
R TCTTCATGGGCAATGGTCTGGT
Brachyury F CCCGGTGCTGAAGGTAAATGTG
R ATGAACTGGGTCTCGGGAAAGC
FLT-1 F TACGAAAAGTCCGTGTCCTCGC
R TTTCAGGTCCTCTCCTTCGGCT
CAD11 F AAGACCCAGATGCTGCCAACAG
R GCATGATTTCAGGGGGTAGGCT
KDR F TTTCCTGGGACTGTGGCGAA
R TGGACTCAATGGGCCTTCCA
Nef1 F CGGAAGACGCCACTAACGAGAA
R CTTCGGCGTTCTGCATGTTCTT
Nestin F GGCATCCCTGAATTACCCAA
R AGCTCATGGGCATCTGTCAA
GATA6 F ACCTTATGGCGTAGAAATGCTGAGGGTG
R CTGAATACTTGAGGTCACTGTTCTCGGG
3배엽 마커를 확인한 결과, mPhysics는 내배엽(GATA6), 외배엽(Nestin), 중배엽(Brachyury)의 마커들을 높게 발현하였다. 3배엽의 다른 유전자들의 발현은 Physics 세포의 생성 후 3일째에 시작되었다. 배양 20일 동안, 3배엽 마커들의 발현 수준은 점차 증가하였다(도 55). 그리고, 도 56에서 면역염색을 통해 3배엽 단백질 마커들의 발현이 확인되었다.
마우스 세포에서도 초음파로 인해 형성된 mPhysics 세포는 정상 핵형을 가지고 있었다(도 57).
본 발명의 다능성 세포는 세포치료제 분야에서 사용될 수 있다.

Claims (18)

  1. 배양 배지와 분화된 세포를 혼합하고, 상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하는 것을 포함하고,
    상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  2. 제1항에 있어서,
    에너지는 초음파, 레이저 또는 열 처리 중 어느 하나인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  3. 제1항에 있어서,
    스페로이드는 OCT3/4, SOX2, NANOG, c-MYC, KLF4, TDGF1, SSEA4, TRA-1-60, PAX6, Nestin, Brachyury, SMA, GATA4, 또는 AFP 중 어느 하나의 미분화 마커 또는 3배엽 마커 유전자를 발현하는 것인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  4. 제1항에 있어서,
    분화된 세포는 포유류 유래의 섬유아세포, 암세포 또는 기관 내 조직세포 중 어느 하나인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  5. 제1항에 있어서,
    배양 배지는 배아 줄기세포 배양 배지 또는 줄기세포 분화유도 배지 중 어느 하나인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  6. 제1항 또는 제2항에 있어서,
    배양배지와 분화된 세포를 혼합하기 전에 배양 배지에 출력강도 1W/cm2 내지 20W/cm2의 초음파를 1 내지 20 분 동안 처리하는 단계를 추가로 포함하는, 분화된 세포에서 다능성 세포로의 역분화 방법.
  7. 제1항 또는 제2항에 있어서,
    배양 배지와 분화된 세포의 혼합물에 대한 초음파 처리는 출력강도 0.5W/cm2 내지 3W/cm2로 1 내지 5초 동안 처리하는 것인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  8. 제1항 또는 제2항에 있어서,
    배양배지와 분화된 세포를 혼합하기 전에 배양 배지에 300 내지 900nm인 파장 대역의 펄스형 레이저 빔을 1초 내지 20초 동안 조사하는 단계를 추가로 포함하는, 분화된 세포에서 다능성 세포로의 역분화 방법.
  9. 제1항 또는 제2항에 있어서,
    배양 배지와 분화된 세포의 혼합물에 대한 레이저 처리는 300 내지 900 nm인 파장 대역의 펄스형 레이저 빔을 1초 내지 10초 동안 조사하는 것인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  10. 제1항 또는 제2항에 있어서,
    배양배지와 분화된 세포를 혼합하기 전에 배양 배지에 40 내지 50 ℃의 온도 조건에서 5분 내지 20분 동안 열 처리하는 단계를 추가로 포함하는, 분화된 세포에서 다능성 세포로의 역분화 방법.
  11. 제1항 또는 제2항에 있어서,
    배양 배지와 분화된 세포의 혼합물에 대한 열 처리는 40 내지 50 ℃의 온도 조건에서 1분 내지 10분 동안 노출한 후 0℃ 내지 4℃의 온도 조건에서 5 내지 10초간 노출하여 수행되는 것인, 분화된 세포에서 다능성 세포로의 역분화 방법.
  12. 제1항에 있어서,
    에너지가 제공된 혼합물은 부유 배양 또는 단층 배양 방식을 통해 3일 내지 10일 동안 배양하는, 분화된 세포에서 다능성 세포로의 역분화 방법.
  13. 세포 및 배양 배지를 수용할 수 있는 배양챔버; 및
    상기 배양챔버의 일측에 배치되고, 상기 세포 및 배양 배지에 에너지를 제공할 수 있는 장치를 포함하고,
    분화된 세포와 배양 배지를 혼합하고, 상기의 혼합물에 에너지를 제공하여 일정 시간 배양을 통해 스페로이드(spheroid)를 형성하며,
    상기 스페로이드는 다능성(pluripotency) 특성을 가진 것인, 다능성 세포 유도 장치.
  14. 제13항에 있어서,
    배양챔버는 부유 배양 또는 단층 배양 방식이 가능한 구조로 되어 있는, 다능성 세포 유도 장치.
  15. 제13항에 있어서,
    에너지를 제공할 수 있는 장치는 초음파를 조사할 수 있는 초음파 발생장치, 레이저를 조사할 수 있는 레이저 발생장치, 또는 온도조절장치를 포함하는, 다능성 세포 유도 장치.
  16. 제15항에 있어서,
    초음파 발생장치는 주파수가 10kHz 내지 100MHz인 초음파를 발생하는 것인, 다능성 세포 유도 장치.
  17. 제15항에 있어서,
    레이저 발생장치는 300 내지 900 nm 파장 대역의 펄스형 레이저 빔을 발생하는 것인, 다능성 세포 유도 장치.
  18. 제15항에 있어서,
    온도조절장치는 -40℃ 내지 99.9℃ 범위의 온도 조절이 가능한 것인, 다능성 세포 유도 장치.
PCT/KR2015/013269 2014-12-04 2015-12-04 에너지를 이용한 다능성 세포 유도 장치 및 방법 WO2016089178A1 (ko)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP15866086.0A EP3241896B1 (en) 2014-12-04 2015-12-04 Device and method for inducing pluripotent cells using energy
US15/532,032 US11773387B2 (en) 2014-12-04 2015-12-04 Device and method for inducing pluripotent cells using energy
CN201580075450.XA CN107438668B (zh) 2014-12-04 2015-12-04 利用能量的多能细胞诱导装置和方法
JP2017549154A JP6986968B2 (ja) 2014-12-04 2015-12-04 エネルギーを利用した多能性細胞誘導装置及び方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2014-0173007 2014-12-04
KR20140173007 2014-12-04
KR10-2015-0172501 2015-12-04
KR1020150172501A KR101798726B1 (ko) 2014-12-04 2015-12-04 에너지를 이용한 다능성 세포 유도 장치 및 방법

Publications (1)

Publication Number Publication Date
WO2016089178A1 true WO2016089178A1 (ko) 2016-06-09

Family

ID=56092038

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/013269 WO2016089178A1 (ko) 2014-12-04 2015-12-04 에너지를 이용한 다능성 세포 유도 장치 및 방법

Country Status (1)

Country Link
WO (1) WO2016089178A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180127738A1 (en) * 2016-11-07 2018-05-10 BiomediStem, LLC Production and therapeutic uses of epinul pluripotent cells and differentiated cells derived therefrom
CN111073881A (zh) * 2018-10-02 2020-04-28 金贤锡 用于毛发再生的含有诱导的外泌体的组合物

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7052720B1 (en) * 1999-06-17 2006-05-30 University Of Wales College Of Medicine Spheroid preparation
WO2013163296A1 (en) * 2012-04-24 2013-10-31 The Brigham And Women's Hospital, Inc. Generating pluripotent cells de novo

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7052720B1 (en) * 1999-06-17 2006-05-30 University Of Wales College Of Medicine Spheroid preparation
WO2013163296A1 (en) * 2012-04-24 2013-10-31 The Brigham And Women's Hospital, Inc. Generating pluripotent cells de novo

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ABRAHAMSE, HEIDE ET AL.: "The Use of Laser Irradiation to Stimulate Adipose derived Stem Cell Proliferation and Differentiation for Use in Autologous Grafts", THE 7TH INTERNATIONAL CONFERENCE ON LASER APPLICATIONS., vol. 1172, 2009, pages 95 - 100, XP055453439 *
CHRISTAKOU, A. E. ET AL.: "Solid Tumor Spheroid Formation by Temperature-Con- trolled High Voltage Ultrasound in a Multi-Well Microdevice''.", 18TH INTERNATIONAL CONFERENCE ON MINIATURIZED SYSTEMS FOR CHEMISTRY AND LIFE SCIENCES, 26 October 2014 (2014-10-26), San Antonio, Texas, USA, pages 573 - 575, XP055453430 *
LIU, JIAN ET AL.: "Functional Three-Dimensional HepG2 Aggregate Cultures Generated From an Ultrasound Trap: Comparison With HepG2 Spheroids", JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 102, no. 5, 2007, pages 1180 - 1189, XP055453432 *
LV , YONGGANG ET AL.: "Effects of Low-Intensity pulsed Ultrasound on Cell Via-Bility, Proliferation and Neural Differentiation of induced Pluripotent Stem Cells-derived Neural Crest Stem Cells", BIOTECHNOLOGY LETTERS, vol. 35, no. 12, 28 September 2013 (2013-09-28), pages 2201 - 2212, XP055453435 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180127738A1 (en) * 2016-11-07 2018-05-10 BiomediStem, LLC Production and therapeutic uses of epinul pluripotent cells and differentiated cells derived therefrom
EP3555262A4 (en) * 2016-11-07 2020-05-13 K2 Research Holdings, LLC PRODUCTION AND THERAPEUTIC USES OF EPINUL PLURIPOTENT CELLS AND DIFFERENTIATED CELLS DERIVED THEREFROM
CN111073881A (zh) * 2018-10-02 2020-04-28 金贤锡 用于毛发再生的含有诱导的外泌体的组合物

Similar Documents

Publication Publication Date Title
JP7252076B2 (ja) エネルギーを利用した多能性細胞誘導装置及び方法
Liu et al. Generation of endoderm‐derived human induced pluripotent stem cells from primary hepatocytes
Medvedev et al. Human induced pluripotent stem cells derived from fetal neural stem cells successfully undergo directed differentiation into cartilage
Si-Tayeb et al. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors
Patel et al. Advances in reprogramming somatic cells to induced pluripotent stem cells
Bao et al. Reprogramming of ovine adult fibroblasts to pluripotency via drug-inducible expression of defined factors
Lu et al. A defined xeno-free and feeder-free culture system for the derivation, expansion and direct differentiation of transgene-free patient-specific induced pluripotent stem cells
WO2017155166A1 (ko) 물리적 자극에 의한 환경유입을 이용한 세포 리프로그래밍 방법
EP2271746B1 (en) Method for reprogramming differentiated cells
WO2010147395A2 (en) Medium composition comprising neuropeptide y for the generation, maintenance, prologned undifferentiated growth of pluripotent stem cells and method of culturing pluripotent stem cell using the same
US11859175B2 (en) Cell reprogramming method using physical stimulation-mediated environmental influx
WO2013180395A1 (ko) 다능성 줄기세포의 제작, 유지, 증식을 증진하는 대사산물 및 이를 포함하는 조성물과 배양방법
Ghasemi‐Dehkordi et al. Comparison between the cultures of human induced pluripotent stem cells (hiPSCs) on feeder‐and serum‐free system (Matrigel matrix), MEF and HDF feeder cell lines
Neri et al. Mouse fibroblasts are reprogrammed to Oct-4 and Rex-1 gene expression and alkaline phosphatase activity by embryonic stem cell extracts
WO2016089178A1 (ko) 에너지를 이용한 다능성 세포 유도 장치 및 방법
Lee et al. Self-reprogramming of spermatogonial stem cells into pluripotent stem cells without microenvironment of feeder cells
Cheng et al. Kinetic analysis of porcine fibroblast reprogramming toward pluripotency by defined factors
Lee et al. An ultra-effective method of generating extramultipotent cells from human fibroblasts by ultrasound
WO2012096552A2 (ko) Ｒｅｘ１을 포함하는 세포 리프로그래밍 조성물 및 이를 이용한 유도 만능줄기세포 제조방법
Pirouz et al. The reciprocal relationship between primordial germ cells and pluripotent stem cells
Tai et al. Generation of Arbas Cashmere goat induced pluripotent stem cells through fibroblast reprogramming
Wan et al. Generation and neuronal differentiation of induced pluripotent stem cells in Cdyl−/− mice
Shi et al. Roles of p53 and ASF1A in the reprogramming of sheep kidney cells to pluripotent cells
Kaini et al. Recombinant xeno-free vitronectin supports self-renewal and pluripotency in protein-induced pluripotent stem cells
WO2016080608A1 (en) Compositions comprising a mitofusin inhibitor for promoting cell reprogramming and a use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15866086

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2017549154

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2015866086

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 15532032

Country of ref document: US