WO2022005023A1 - 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법 - Google Patents

중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법 Download PDF

Info

Publication number
WO2022005023A1
WO2022005023A1 PCT/KR2021/006590 KR2021006590W WO2022005023A1 WO 2022005023 A1 WO2022005023 A1 WO 2022005023A1 KR 2021006590 W KR2021006590 W KR 2021006590W WO 2022005023 A1 WO2022005023 A1 WO 2022005023A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell aggregate
dimensional
midbrain
dimensional cell
differentiation
Prior art date
Application number
PCT/KR2021/006590
Other languages
English (en)
French (fr)
Inventor
한동욱
Original Assignee
주식회사 오간팩토리
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210010149A external-priority patent/KR102346243B1/ko
Application filed by 주식회사 오간팩토리 filed Critical 주식회사 오간팩토리
Priority to CN202180046126.0A priority Critical patent/CN115885037A/zh
Publication of WO2022005023A1 publication Critical patent/WO2022005023A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0619—Neurons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells

Definitions

  • the present invention relates to a method for high-speed and mass production of midbrain organoids, a screening method for neurotoxic substances using the same, and a drug screening method for dopaminergic neuron-related diseases, and more particularly, to the production of midbrain organoids. It relates to a method for high-speed and mass production of high-quality midbrain organoids with low inter-individual variation by controlling the required initial starting cell number and culture format.
  • Organoid is a new stem that reproduces the cell composition and structure similar to an organ in the body through three-dimensional culture by utilizing the differentiation, self-renewal, and self-organization of stem cells.
  • As a cell differentiation technique it is a technology that can be used for disease simulation research and therapeutic drug screening research for various diseases by simulating an environment similar to an internal organ. Furthermore, through the production of patient-specific organoids, it is being evaluated as a future technology that can produce customized therapeutics for various diseases at low cost and in a short period of time.
  • iPSCs induced pluripotent stem cells
  • organoids including brain organoids
  • problems which must be solved for practical or industrialization of organoid research.
  • organoid production is costly and time consuming.
  • differentiation and maturation into organoids it is necessary to supply oxygen and nutrients to the inside of the organoid.
  • continuous shaking in a CO 2 incubator using a shaking bioreactor In most cases, continuous shaking in a CO 2 incubator using a shaking bioreactor.
  • differentiation is essential, and for differentiation into organ-specific organoids, it is necessary to process expensive differentiation promoters for a long period of time. Therefore, a lot of cost is consumed for the production of organ-specific organoids ( FIG. 1 ).
  • organoid-based high-throughput screening it is necessary to develop an organoid mass production system suitable for the HTS format.
  • the whole cycle one-step organoid production and drug development system development that can be carried out by unifying organoid production and drug screening in the HTS format is a necessary part for establishing a practical basis through automated production of organoids in the future.
  • midbrain organoids for high-speed/mass production of midbrain organoids, the present inventors used micro-well plates such as 96 or 384 wells instead of a general shaking bioreactor for high-throughput mass screening of midbrain organoids (high throughput screening; HTS) was intended to be produced as a platform.
  • HTS high throughput screening
  • FIG. 3 midbrain organoids were produced on the HTS platform, as well as high-speed and mass production of midbrain organoids with low standardized level of inter-individual variation and suppressed abnormal differentiation and dead core.
  • the produced midbrain organoids showed significantly improved homogeneity and functionality compared to the midbrain organoids produced by the existing method. Furthermore, it was confirmed that the time and cost required for the production of midbrain organoids could be reduced.
  • an object of the present invention is a method for high-speed culturing of a three-dimensional cell aggregate from human stem cells
  • the step of inducing the maturation of the three-dimensional cell aggregate from the step of forming the embryoid body is to provide a method for high-speed mass culture of the three-dimensional cell aggregate, characterized in that the culture is continuously performed in the same micro-well plate.
  • Another object of the present invention is to provide a three-dimensional cell aggregate prepared by a high-speed mass culture method of the three-dimensional cell aggregate.
  • Another object of the present invention is a concave culture unit containing a three-dimensional cell aggregate
  • Another object of the present invention is a three-dimensional midbrain cell aggregate cultured from any one of human embryonic stem cells, human induced pluripotent stem cells, and adult stem cells,
  • the three-dimensional midbrain cell aggregate which forms neuromelanin, is to provide a three-dimensional midbrain cell aggregate.
  • Another object of the present invention is a high-speed culture method of a three-dimensional cell aggregate from human stem cells
  • the step of inducing the maturation of the three-dimensional cell aggregate from the step of forming the embryoid body includes continuous non-shake culture in the same micro-well plate,
  • the high-speed culturing method is to provide a high-speed culturing method of a three-dimensional cell aggregate, characterized in that it is performed in an automated manner including a pipetting robot, automated handling, and plate transport means.
  • Another object of the present invention is a method for screening dopaminergic neuron-related disease drugs
  • It is to provide a screening method for a dopaminergic neuron-related disease drug comprising the step of determining the survival rate of dopaminergic neurons from the three-dimensional cell aggregate.
  • Another object of the present invention comprises the steps of culturing a three-dimensional cell aggregate from cells derived from a patient with a dopaminergic neuron-related disease;
  • Another object of the present invention is a method for determining a three-dimensional cell aggregate for drug testing
  • the contacting of the candidate material is performed in any one or more steps included in the high-speed mass culture method of a three-dimensional cell aggregate, and
  • Another object of the present invention is an in vitro toxicity screening method of a drug using a three-dimensional cell aggregate
  • An object of the present invention is to provide an in vitro toxicity screening method of a drug using a three-dimensional cell aggregate.
  • the present invention relates to a method for high-speed and mass production of midbrain organoids, a method for screening a neurotoxic substance using the same, and a drug screening method for a drug screening method for a dopaminergic neuron-related disease, and the method for producing an organoid according to the present invention
  • High-speed and mass production of organoids enables rapid drug screening, blocks out-growth, minimizes the dead core phenomenon, reduces the deviation between organoids, and improves the It induces excellent functionality through rapid maturation.
  • the present inventors derive the result of reducing the time required for organoid production from 3 to 6 months or more to up to 30 days by applying the initial starting cell number to 50 to 3,000 in manufacturing the organoid did
  • One aspect of the present invention is a method for high-speed culturing of a three-dimensional cell aggregate from human stem cells
  • the step of inducing the maturation of the three-dimensional cell aggregate from the step of forming the embryoid body is a high-speed mass culture method of a three-dimensional cell aggregate, characterized in that it is continuously cultured in the same micro-well plate.
  • the cells isolated from humans may be any one of human embryonic stem cells (hESCs), induced pluripotent stem cells, and adult stem cells.
  • hESCs human embryonic stem cells
  • induced pluripotent stem cells induced pluripotent stem cells
  • adult stem cells adult stem cells
  • stem cell refers to a cell having the ability to differentiate into two or more cells while having self-replicating ability, and includes a totipotent stem cell, a pluripotent stem cell, and a pluripotent cell. It can be classified into stem cells (multipotent stem cells) and dedifferentiated stem cells.
  • the three-dimensional cell aggregate may be an organoid, for example, a brain organoid.
  • organoid refers to a cell aggregate made by aggregation or recombination of cells isolated from stem cells or organ origin cells again by 3D culture method, and may include organoids or cell clusters formed from suspension cell culture.
  • the organoid may also be referred to as a small-like organ, an organ-like organ, or an organ-like organ.
  • the organoid specifically includes one or more cell types among various types of cells constituting an organ or tissue, and should be able to reproduce the structure and function of the tissue or organ.
  • the prepared brain organoids were mostly homogeneous in shape and size with a diameter of about 0.9 to 1.4 mm, showing little variation between individuals and showing a constant quality.
  • the three-dimensional cell aggregate may be formed within 20 to 50 days, or 20 to 40 days, for example, may be formed within 20 to 30 days, but is not limited thereto.
  • midbrain gene activation of the midbrain gene was confirmed when cultured for 7 days according to the method of the present invention.
  • midbrain dopaminergic neurons mDA neurons
  • the number of mDA neurons increased.
  • the present invention after the formation of a three-dimensional cell aggregate, it may be to additionally perform shaking culture. Long-term culture may be possible through the additional shaking culture.
  • the three-dimensional cell aggregate was cultured by performing shaking culture for at least 300 days after the formation of the three-dimensional cell aggregate.
  • the micro-well plate may be a multi-well plate having a concave portion.
  • the multi-well plate having the concave portion may be a 96-well plate, a 384-well plate, or a 1,536 well plate.
  • the initial starting number of cells isolated from humans may be 50 to 3,000.
  • the initial starting cell number when using a 96-well plate, is preferably 300 to 3,000, more preferably 300 to 1,000, and most preferably 500, but is not limited thereto.
  • the initial starting cell number is preferably 50 to 500, more preferably 50 to 200, and most preferably 100, when using a 384 well plate, but is not limited thereto.
  • the high-speed mass culture method may not use a bioreactor throughout the entire process of forming a three-dimensional cell aggregate, for example, may not perform a shaking process.
  • the three-dimensional cell aggregate may be a midbrain cell aggregate.
  • the three-dimensional cell aggregate may be a digestive organ selected from the group consisting of liver, heart, and lung.
  • the step of forming a three-dimensional cell aggregate may include an ectoderm formation step or a midbrain tissue differentiation step.
  • the ectoderm formation step may be performed in a medium containing CHIR99021, Dorsomorphin and A83-01 (dual SMAD inhibitors).
  • the midbrain tissue differentiation step may be performed in a medium containing CHIR99021, Dorsmorphin, A83-01, IWP, SAG and FGF-8b.
  • the step of inducing the maturation of the three-dimensional cell aggregate is performed in a medium containing SAG, FGF-8b, insulin, laminin, and additionally containing soluble matrigel in which growth factors are inhibited. it may be
  • a method of culturing by directly adding Matrigel to the medium was used.
  • a method of culturing cells by embedding them in matrigel on a plate is usually performed.
  • the step of forming the three-dimensional cell aggregate may be one in which the ectoderm forming factor is expressed without activation of the mesendodermal marker within 7 days after the induction of tissue differentiation.
  • the ectoderm forming factor may be any one or more selected from the group consisting of N-CAD, PLZF, SOX1, SOX2 and NESTIN, but is not limited thereto.
  • the step of forming a three-dimensional cell aggregate may be one in which midbrain markers are expressed without expression of forebrain or hindbrain markers within 14 days after induction of tissue differentiation.
  • the midbrain marker may be at least one selected from the group consisting of LMX1B, ASCL1 and TH, but is not limited thereto.
  • the step of inducing the maturation of the three-dimensional cell aggregate may be one in which a marker of midbrain dopaminergic cells is expressed after performing.
  • the midbrain marker is activated on or before day 14, but the expression level of the marker at day 21 is higher. After the step of inducing the maturation of the three-dimensional cell aggregate, it was found that the midbrain dopaminergic cell marker TH, etc., was expressed at a high level.
  • the step of forming the embryoid body to the step of inducing the maturation of the three-dimensional cell aggregate it was continuously performed in the same micro-well plate without moving the well plate, and within 30 days using the multi-micro-well plate of high-speed mass culture was possible.
  • Another aspect of the present invention is a three-dimensional cell aggregate prepared by a high-speed mass culture method of a three-dimensional cell aggregate.
  • Another aspect of the present invention is a concave culture unit containing a three-dimensional cell aggregate
  • It is a three-dimensional cell aggregate culture kit comprising a cover part covering the concave culture part.
  • the three-dimensional cell aggregate culture kit may include a preservation solution.
  • Another aspect of the present invention is a three-dimensional midbrain cell aggregate cultured from any one of human embryonic stem cells, human induced pluripotent stem cells, and adult stem cells,
  • the three-dimensional midbrain cell aggregate which forms neuromelanin, is a three-dimensional midbrain cell aggregate.
  • the three-dimensional midbrain cell aggregate may form neuromelanin after 20 to 50 days, 20 to 40 days, 20 to 35 days, 25 to 50 days, or 25 to 40 days after culture, for example, from 25 to It may be to form neuromelanin after 35 days, but is not limited thereto.
  • the three-dimensional midbrain cell aggregate may not include any brain tissue other than the midbrain.
  • the three-dimensional midbrain cell aggregate may have an abnormal differentiation (out growth) occurrence rate of 5% or less.
  • the three-dimensional midbrain cell aggregate may have a rate of occurrence of deep apoptosis of 40% or less of the total area of the cell aggregate.
  • the three-dimensional midbrain cell aggregate may have a uniform size and a homogeneous shape with a diameter of 0.9 to 1.4 mm.
  • the three-dimensional midbrain cell aggregate may include 10% or more of midbrain dopamine cells.
  • the three-dimensional midbrain cell aggregate may include 30% or more of midbrain dopaminergic cells, or 50% or more of midbrain dopaminergic cells. In the initial stage, about 80% of midbrain dopaminergic cells may be included, but in the case of a mature three-dimensional midbrain cell aggregate, various midbrain cells are formed, so the content of midbrain dopaminergic cells in the entire cell aggregate may decrease.
  • the three-dimensional midbrain cell aggregate may be homogeneously formed with a mutation rate of gene expression of 10% or less.
  • the three-dimensional midbrain cell aggregate has very good gene expression quality, and exhibits homogeneity of about 90% or more. In the case of the remaining about 10% of the three-dimensional cell aggregate, homogeneity of gene expression comparable to or superior to that produced by the conventional method was observed.
  • the three-dimensional midbrain cell aggregate may include an inhibitory nerve and an excitatory nerve.
  • the three-dimensional midbrain cell aggregate includes inhibitory nerves and excitatory nerves, which was found to be 10 to 30% or more of the total cell aggregate. This can be confirmed from the experimental results of the tissue staining data of FIGS. 11 and 15A in the present specification.
  • the three-dimensional midbrain cell aggregate may be one in which electrophysiological activity can be observed from 15 days after cell differentiation.
  • electrophysiological activity appears several months after cell differentiation, it can be demonstrated that the method of the present invention, in which the maturation pattern appears very quickly, is superiorly superior.
  • the three-dimensional midbrain cell aggregate may include any one selected from the group consisting of substantia nigra, blue spots, red nuclei, central gray matter, medial follicle follicles, middle nerve nuclei, and trochlear ganglion nuclei.
  • the three-dimensional midbrain cell aggregate may include glial cells and oligodendrocytes, and the three-dimensional midbrain cell aggregate may include 1 to 10% of glial cells and oligodendrocytes.
  • the extent to which the three-dimensional midbrain cell aggregate includes glial cells and oligodendrocytes can be confirmed from the experimental results of the tissue staining data of FIGS. 11 and 15A herein.
  • Another aspect of the present invention is a high-speed culture method of a three-dimensional cell aggregate from human stem cells
  • the step of inducing the maturation of the three-dimensional cell aggregate from the step of forming the embryoid body includes continuous non-shake culture in the same micro-well plate,
  • the high-speed culture method is a high-speed culture method of a three-dimensional cell aggregate, characterized in that it is performed in an automated manner including a pipetting robot, automated handling, and plate transport means.
  • Another aspect of the present invention is a method for screening dopaminergic neuron-related disease drugs
  • dopaminergic neuron-related diseases include Parkinson's disease, Alzheimer's disease, stroke, stroke, Huntington's disease, Pick's disease, Creutzfeldt-Jakob disease, autism and brain developmental disorder syndrome. It may be any one, but is not limited thereto.
  • the information provision method can be used as a method of evaluating the toxicity and efficacy of a drug by applying a three-dimensional cell aggregate to the screening purpose of a drug for a dopaminergic neuron-related disease.
  • the candidate substance When the onset of a dopaminergic neuron-related disease is prevented, treated, or the prognosis is improved compared to the control substance by the candidate substance, it can be determined that the candidate substance has efficacy as a therapeutic agent for a dopaminergic neuron-related disease.
  • Another aspect of the present invention comprises the steps of culturing a three-dimensional cell aggregate from cells derived from a patient with a dopaminergic neuron-related disease;
  • the candidate material may be any one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacterial or fungal metabolites and bioactive molecules.
  • the present invention is not limited thereto.
  • Another aspect of the present invention is a method for determining a three-dimensional cell aggregate for drug testing
  • the contacting of the candidate material is performed in any one or more steps included in the high-speed mass culture method of a three-dimensional cell aggregate, and
  • Another aspect of the present invention is an in vitro toxicity screening method of a drug using a three-dimensional cell aggregate
  • screening refers to selecting a substance having a specific desired property from a candidate group consisting of several substances by a specific manipulation or evaluation method.
  • the in vitro toxicity screening method may be used as a platform for drug toxicity evaluation for the purpose of verifying whether a toxic substance or a new drug candidate is neurotoxic.
  • the present invention relates to a midbrain organoid, a method for producing the same, a method for screening a neurotoxic substance using the same, and a method for screening a drug for a dopaminergic neuron-related disease, wherein the production method is capable of producing the organoid at a high speed and thus rapid drug screening This is possible, blocking abnormal differentiation (out-growth), minimizing the dead core phenomenon, reducing the deviation between organoids, and inducing high functionality of midbrain organoids, thereby effectively producing organoids is available for
  • FIG. 1 is a schematic diagram illustrating the production and organoid differentiation process of Induced Pluripotent Stem Cells (iPSCs) for the production of patient-specific organoids.
  • iPSCs Induced Pluripotent Stem Cells
  • FIG. 2 is a schematic diagram showing various problems of organoid production.
  • FIG. 3 is a schematic diagram showing the organoid production strategy of the present invention compared to the existing technology.
  • FIG. 4 is a photograph showing the morphology of midbrain organoids on the 7th day of differentiation produced in a 96-well plate according to an embodiment of the present invention (top), a graph showing differentiation rate and morphological classification (middle), and morphological criteria It is a photo (bottom).
  • 5A is a graph showing the expression pattern of pluripotency marker genes in midbrain organoids on the 7th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • Figure 5b is a graph showing the expression pattern of mesoendoderm (Mesoendoderm) marker gene in the midbrain organoids on the 7th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • Figure 5c is a graph showing the expression pattern of the neuroectoderm (Neuroectoderm) marker gene in the midbrain organoid on the 7th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • FIG. 6 is a photograph showing the morphology of midbrain organoids on the 14th day of differentiation produced in a 96-well plate according to an embodiment of the present invention (top), a graph showing differentiation rate and morphological classification (middle), and morphological criteria It is a photo (bottom).
  • FIG. 7A is a graph showing the expression pattern of apoptosis marker genes in midbrain organoids on the 14th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • Figure 7b is a graph showing the expression pattern of the forebrain marker gene of the midbrain organoid on the 14th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • 7c is a graph showing the expression pattern of the midbrain marker gene of the midbrain organoid on the 14th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • 7D is a graph showing the hindbrain marker gene expression patterns of midbrain organoids on the 14th day of differentiation produced in a 96-well plate according to an embodiment of the present invention.
  • FIG. 8 is a photograph showing the morphology of midbrain organoids on the 14th day of differentiation produced in a 96-well plate under the condition of an initial starting cell number of 500 or less according to an embodiment of the present invention (top), differentiation rate and morphological classification. It is a graph (middle) and a photograph (bottom) showing the shape criteria.
  • Figure 9a is a graph showing the neuroectoderm marker gene expression pattern in the midbrain organoids on the 7th day of differentiation produced in a 96-well plate under the condition of an initial starting cell number of 500 or less according to an embodiment of the present invention.
  • Figure 9b is a graph showing the midbrain marker gene expression pattern in the midbrain organoids on the 14th day of differentiation produced in a 96-well plate under the condition of an initial starting cell number of 500 or less according to an embodiment of the present invention.
  • Figure 9c is a graph showing the hindbrain marker gene expression pattern in the midbrain organoids on the 14th day of differentiation produced in a 96-well plate under the condition of an initial starting cell number of 500 or less according to an embodiment of the present invention.
  • 10A is a photograph comparing the size of midbrain organoids formed by varying the number of initial starting cells in a 384-well plate according to an embodiment of the present invention.
  • Figure 10b is a graph showing the midbrain marker gene expression patterns of the midbrain organoids derived from a 384-well plate according to an embodiment of the present invention.
  • mDA neurons midbrain dopaminergic neurons
  • TH tyrosine hydroxylase
  • FIG. 12 is a photograph showing the morphology of midbrain organoids on the 21st day of differentiation according to an embodiment of the present invention (top), a graph showing the differentiation rate and morphological classification (middle), and a photograph showing the morphology criteria (bottom).
  • Figure 13a is a graph showing the expression pattern of apoptosis marker gene on the 21st day of differentiation according to an embodiment of the present invention.
  • 13B is a graph showing the pattern of forebrain marker gene expression on the 21st day of differentiation according to an embodiment of the present invention.
  • 13c is a graph showing the midbrain marker gene expression pattern on the 21st day of differentiation according to an embodiment of the present invention.
  • 13D is a graph showing the pattern of hindbrain marker gene expression on the 21st day of differentiation according to an embodiment of the present invention.
  • 14A is a photograph comparing the sizes of midbrain organoids formed by varying the number of initial starting cells according to an embodiment of the present invention by date.
  • 14B is a graph comparing the size of midbrain organoids formed by varying the number of initial starting cells according to an embodiment of the present invention by date.
  • 15A is a photograph of the results of immunostaining analysis showing midbrain-specific dopaminergic neurons in the midbrain organoids on day 21 of differentiation formed by varying the number of initial starting cells according to an embodiment of the present invention as TH.
  • 15B is a graph showing the results of immunostaining analysis showing the ratio of midbrain-specific dopaminergic neurons in midbrain organoids on day 21 of differentiation formed by varying the number of initial starting cells according to an embodiment of the present invention.
  • Figure 16a is a photograph showing the results of immunostaining analysis showing the size of the dead core in the midbrain organoids on the 21st day of differentiation formed by varying the number of initial starting cells according to an embodiment of the present invention.
  • Figure 16b is a graph showing the results of immunostaining analysis showing the size of the dead core in the midbrain organoid on the 21st day of differentiation formed by varying the number of initial starting cells according to an embodiment of the present invention.
  • 17 is a photograph showing the results of immunostaining analysis confirming the neuron types and other cell compositions of midbrain organoids produced under the condition of an initial starting cell number of 500 according to an embodiment of the present invention.
  • HCI high content imaging
  • HTS high throughput screening
  • 19 is a photograph and result graph showing the shape (top) and size (bottom) of midbrain organoids and high-speed, mass-produced midbrain organoids produced by the conventional method according to an embodiment of the present invention.
  • 20 is a graph comparing gene expression patterns between individual midbrain organoids in order to confirm inter-individual variation of high-speed, mass-produced midbrain organoids according to an embodiment of the present invention.
  • 21 is a photograph analyzing the results of neuromelanin production in high-speed, mass-produced midbrain organoids according to an embodiment of the present invention.
  • FIG. 22 is a photograph confirming the generation of neuromelanin in high-speed, mass-produced midbrain organoids according to an embodiment of the present invention through the Fontana-Masson staining technique.
  • FIG. 24 is a photograph (top) and graph (bottom) showing changes in the shape and size of high-speed, mass-produced midbrain organoids treated with the neurotoxic substances 6-OHDA and MPTP according to an embodiment of the present invention.
  • 25 is a high-speed, mass-produced midbrain organoid treated with neurotoxic substances 6-OHDA and MPTP according to an embodiment of the present invention showing the expression patterns of apoptosis marker (top) and midbrain marker (bottom) genes; It is a graph.
  • 26 is a view showing the construction of an organoid drug development platform for HTS drug efficacy and toxicity evaluation according to an embodiment of the present invention.
  • % used to indicate the concentration of a specific substance is (weight/weight)% solid/solid, (weight/volume)%, and (weight/volume)% for solid/solid, and Liquid/liquid is (vol/vol) %.
  • Organoids were prepared according to the following procedure.
  • COB1 100x N2 Supplement (Gibco), 50x B27 w/o Vitamin A (Gibco), 1% Penicillin/streptomycin (PS) (Gibco), 1% GlutaMAX TM (Gibco), 1% NEAA ( Gibco), a 1:1 mixture of DMEM/F12 (Corning) and Neurobasal Medium (Gibco) supplemented with 55 uM ⁇ -mercaptoethanol (Gibco), 1 ⁇ g/ml heparin (Sigma))
  • Matrigel was dissolved on ice for about 4 hours. A medium containing 100 ng/ml FGF8, 2 ug/ml SAG, 2.5 ug/ml insulin, and 200 ng/ml laminin was prepared along with COB1. The dissolved Matrigel was added to the medium. The medium of the organoids was then changed.
  • BDNF brain-derived neurotrophic factor
  • GDNF glial cell line-derived neurotrophic factor
  • the medium was replaced with BMM containing acid, and 125 uM cAMP. The medium was changed every two days.
  • a high throughput screening (HTS) platform that is, as a first step for unification of applied research such as EB formation in 96 wells, differentiation into midbrain organoid induction, maturation, and drug development, various initial starting cell numbers ( starting cell number) was tested.
  • HTS high throughput screening
  • hESCs dissociated into single cells were plated in a 96-well plate at 500, 1,000, 3,000, 5,000, 7,000 and 10,000 per well, and then the differentiation pattern was observed, and the results are shown in FIG. 4 .
  • the quality of the organoids was classified into Class 1 (neural rosette development), Class 2 (bright, round EB) and Class 3 (ruptured EB).
  • OCT4 and NANOG as pluripotency markers
  • EOMES, MXL1 and T as mesoendoderm markers
  • N-CAD, PLZF neuroectoderm markers
  • SOX1, SOX2 and NESTIN were selected. Expression levels of the above markers were confirmed in organoids, and the results are shown in FIGS. 5A to 5C .
  • the primer sequences used for qPCR are shown in Table 1 below.
  • the expression pattern of the gene also showed a generally similar pattern.
  • the organoids on the 14th day of differentiation prepared according to the method of Example 1 showed different patterns according to the number of initial starting cells in terms of viability and morphology.
  • the quality of the organoids was classified into Class 1 (neural rosette and light border), Class 2 (formation of abnormal differentiation), Class 3 (covered with abnormal differentiation) and Class 4 (dark and dark EB). The results are shown in Table 2 and FIG. 6 .
  • BAX, BAD and PMA1P1 as markers of apoptosis
  • FOXG1, LHX2 and SIX3 as forebrain markers
  • LMX1B, ASCL1 and TH as midbrain markers
  • HA1, HB4 and HC9 were selected as hindbrain markers to confirm the expression levels in organoids, and the results are shown in FIGS. 7a to 7d, respectively.
  • the primer sequences used for qPCR are shown in Table 3 below.
  • the organoids on the 14th day of differentiation had no significant difference in morphology compared to the organoids on the 7th day of differentiation.
  • the expression of the early (7 days) neuroectoderm markers N-CAD, SOX2 and PLZF and the midbrain markers LMX1B, ASCL1 and TH on the 14th day were rather low in 100 and 250 cases.
  • the expression of hindbrain markers HC9, HA1, HB4 and KROX20 was increased. Therefore, the above results indicated that midbrain organoid production was most efficient when 500 cells were used.
  • midbrain organoids For mass production of midbrain organoids, 384-well plate-based midbrain organoid production conditions were confirmed. For midbrain organoid production in 384 wells ( ⁇ 90 ul), which has a smaller well volume compared to 96 wells ( ⁇ 330 ul), the number of starting cells was divided by 50, 100, 200, 300 and 500 to confirm the effect. , the results are shown in FIGS. 10a and 10b.
  • Midbrain dopaminergic neurons were observed in the midbrain organoids on the 14th day of differentiation, and the results are shown in FIG. 11 .
  • the survival rate and quality of the midbrain organoids on the 21st day of differentiation prepared according to the method of Example 1 were investigated.
  • the quality of the organoids was classified into Class 1 (neural rosette development), Class 2 (smooth organoids), Class 3 (covered with abnormal differentiation) and Class 4 (ruptured organoids).
  • Class 1 neural rosette development
  • Class 2 smooth organoids
  • Class 3 covered with abnormal differentiation
  • Class 4 ruptured organoids
  • BAX, BAD, and PMA1P1 as apoptosis markers were selected as the markers of apoptosis to investigate the gene expression pattern. to confirm the expression level in the organoid, and the results are shown in FIGS. 13a to 13d, respectively.
  • the primer sequences used for qPCR were utilized in Table 3.
  • the initial starting cell number plays a very important role in the production of midbrain organoids in the HTS platform.
  • FIGS. 15a and 15b it was confirmed that in the case of 500 and 1,000, the midbrain-specific dopaminergic neurons were more numerous and homogeneously present. This indicated that 500 and 1,000 were optimal as the initial starting cell number in the HTS platform.
  • the midbrain organoids produced from 500 early starter cells homogeneously contain TH-positive mDA neurons, and mature to express GIRK2 (G protein-activated inward rectifier potassium channel 2).
  • GIRK2 G protein-activated inward rectifier potassium channel 2.
  • A9 type mDA neurons were also present.
  • astrocytes, oligodendrocytes, and various subtypes of neurons were also present.
  • the gene expression patterns of midbrain organoids on high-speed, mass-produced 96-well plates were confirmed in individual midbrain organoids. It was observed that about 10% of the remaining cases showed a gene expression pattern similar to that of the midbrain organoids produced by the existing technology. This means that high-speed, mass-produced midbrain organoids have very homogeneous properties without inter-individual variation. Therefore, the midbrain organoid high-speed, mass production technology can be utilized as a standardization technology for industrialization of the midbrain organoid technology in the future.
  • electrophysiological analysis was performed by measuring the firing rate of neural signals.
  • Example 6 High-speed, mass-produced midbrain organoid-based in vitro drug toxicity evaluation

Abstract

본 발명은 중뇌 오가노이드, 이의 제조방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 (drug screening) 방법에 관한 것으로서, 상기 제조방법은 오가노이드를 고속 생산할 수 있어 신속한 약물 스크리닝이 가능하고, 비정상적 분화 (out-growth)을 차단하며, 데드 코어 (dead core) 현상을 최소화하고, 오가노이드 간의 편차를 감소시키므로, 이를 효과적으로 오가노이드의 제조에 이용할 수 있다.

Description

중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법
본 발명은 중뇌 (Midbrain) 오가노이드의 고속 및 대량 제조방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 (drug screening) 방법에 관한 것으로서, 더욱 상세하게는 중뇌 오가노이드 제작에 필요한 초기 시작 세포 수 (starting cell number)와 배양방식 (culture format)을 조절함으로써 품질이 우수하고 개체간 변이가 적은 중뇌 오가노이드를 고속 및 대량 생산할 수 있는 방법에 관한 것이다.
오가노이드란 줄기 세포의 분화능 (differentiation), 자기 재생능 (self-renewal), 자가 조직화능 (self-organization)을 활용하여 3차원 배양을 통해 체내 장기와 유사한 세포조성 및 구조를 재현해 내는 새로운 줄기 세포 분화기법으로, 체내 장기와 유사한 환경을 모사함으로써 다양한 질환의 질환 모사 연구 및 치료 약물 스크리닝 연구에 활용 가능한 기술이다. 나아가 환자 맞춤형 오가노이드 생산을 통해, 다양한 질환에 대한 환자 맞춤형 치료제를 저비용, 단기간에 생산할 수 있는 미래 기술로 평가받고 있다.
최근 다양한 뇌 부위 특성을 반영하는 뇌 오가노이드 생산이 보고되고 있으며, 뇌 오가노이드를 이용한 지카 바이러스(ZIKA virus) 연구 혹은 환자 유래 뇌 오가노이드를 이용한 질환 모사 및 신약개발 연구가 활발히 진행되고 있는 상황이다.
그러나, 환자 맞춤형 오가노이드 생산에는 많은 비용과 오랜 시간이 소요된다. 도 1과 같이, 실제 환자 유래 유도만능줄기 세포 (induced pluripotent stem cell; iPSCs) 생산에는 보통 6 내지 8주 이상이 소요되며, 그 효율도 보통 0.02% 정도로 매우 낮다. 나아가 오가노이드 생산에 걸리는 시간은 각 장기별 오가노이드에 따라 상이하지만 대부분 3 내지 6개월 이상이 소요된다. 따라서, 환자의 연령이 높은 퇴행성 뇌질환 및 기타 시급한 약물 치료가 요구되는 환자의 경우 환자 맞춤형 신약개발 등이 현실적으로 어려운 상황이다.
또한, 뇌 오가노이드를 포함한 대부분의 오가노이드 생산에는 아래와 같은 문제점들이 있으며, 이는 오가노이드 연구의 실용화 또는 산업화를 위해 반드시 해결되어야 하는 문제점들이다.
첫째, 오가노이드 생산에는 많은 비용과 시간이 소요된다. 오가노이드로의 분화 및 성숙화를 위해 오가노이드 내부까지 산소 및 영양분의 공급이 필요하고, 이를 위해 대부분의 경우 진탕 생물반응기 (shaking bioreactor)를 활용한 CO2 인큐베이터 (incubator) 내에서 지속적인 진탕 (shaking) 및 분화가 필수적이며 장기 특이적 오가노이드로의 분화를 위해서 장기간 고가의 분화촉진인자를 처리해야 한다. 따라서 장기 특이적 오가노이드 생산을 위해서는 많은 비용이 소모된다 (도 1).
둘째, 오가노이드 간 개체간 변이 (batch variation)가 매우 심하며 (도 2), 따라서, 오가노이드를 활용한 질환 모사 연구 및 신약 스크리닝 연구에서 부정확한 결과를 야기할 수 있다.
셋째, 오가노이드 분화시 "비정상적 분화 (out-growth)"라는 비정상적인 조직이 만들어지며, 이는 오가노이드의 품질과 기능성 등을 저해하는 심각한 문제점이다 (도 2).
넷째, 현재 오가노이드 내부에는 혈관이 없고, 따라서 오가노이드의 코어까지 산소 및 영양분이 제대로 전달되지 못해 내부 세포들이 죽어나가는 "데드 코어 (dead core)" 현상이 일반적이며 이는 오가노이드의 성숙화를 저해하기 때문에 반드시 해결되어야 하는 문제점이다 (도 2).
다섯째, 오가노이드 기반 고속 대량 스크리닝 (high throughput screening; HTS)을 통한 약물 스크리닝 (drug screening) 혹은 약물 재창출 (drug repositioning) 연구를 위해서는 HTS 포맷 (format)에 맞는 오가노이드 대량 생산 시스템 개발이 필요하다. 또한, HTS 포맷에서 오가노이드의 생산과 약물 스크리닝을 일원화하여 진행 가능한 전주기적 one-step 오가노이드 생산 및 신약개발 시스템 개발은 향후 오가노이드의 자동화 생산을 통한 실용화 기반구축에 반드시 필요한 부분이다.
이에 본 발명자들은 중뇌 오가노이드의 고속/대량 생산을 위하여 일반적인 진탕 생물반응기 (shaking bioreactor)가 아닌 96 또는 384 웰 (well) 등 마이크로 웰 플레이트를 사용하여 중뇌 오가노이드를 고속 대량 스크리닝 (high throughput screening; HTS) 플랫폼 (platform)으로 생산하고자 하였다. 이를 통해 도 3과 같이 중뇌 오가노이드를 HTS 플랫폼에서 생산할 뿐만 아니라, 표준화된 수준의 개체간 변이가 적으며 비정상적 분화 및 데드코어가 억제된 중뇌 오가노이드의 고속, 대량 생산 실현이 가능하였고 고속, 대량 생산 중뇌 오가노이드의 경우 기존 방법으로 생산된 중뇌 오가노이드에 비해 월등히 향상된 균질성과 기능성을 보였다. 나아가 중뇌 오가노이드 생산에 소요되는 시간과 비용을 절감할 수 있음을 확인하였다.
이에, 본 발명의 목적은 인간 줄기세포로부터 3차원 세포집합체를 고속 배양하는 방법으로,
인간으로부터 분리된 세포로부터 배아체(Embryoid body)를 형성하는 단계;
상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 배양하는 것을 특징으로 하는, 3차원 세포집합체의 고속 대량 배양 방법을 제공하는 것이다.
본 발명의 다른 목적은 3차원 세포집합체의 고속 대량 배양 방법에 의해 제조된, 3차원 세포집합체를 제공하는 것이다.
본 발명의 또 다른 목적은 3차원 세포집합체를 함유하는 오목 배양부; 및
상기 오목 배양부를 커버하는 커버부를 포함하는, 3차원 세포집합체 배양 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 인간배아줄기세포, 인간 유도만능줄기세포, 및 성체줄기세포 중 어느 하나로부터 배양된 3차원 중뇌 세포집합체로,
상기 3차원 중뇌 세포집합체는, 뉴로멜라닌을 형성하는 것인, 3차원 중뇌 세포집합체를 제공하는 것이다.
본 발명의 또 다른 목적은 인간 줄기세포로부터 3차원 세포집합체의 고속 배양 방법으로,
인간으로부터 분리된 세포로부터 배아체를 형성하는 단계;
상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 비진탕 배양하며,
상기 고속 배양 방법은, 피펫팅 로봇, 자동화된 핸들링, 플레이트 운송 수단을 포함하는 자동화 방식으로 수행되는 것을 특징으로 하는 것인, 3차원 세포집합체의 고속 배양 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 도파민성 신경세포 관련 질환 약물의 스크리닝 방법에 있어서,
도파민성 신경세포 관련 질환 환자-유래 유도만능줄기세포로부터 3차원 세포집합체를 생성하는 단계;
상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
상기 3차원 세포집합체로부터 도파민성 신경세포의 생존율을 판별하는 단계를 포함하는, 도파민성 신경세포 관련 질환 약물의 스크리닝 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 도파민성 신경세포 관련 질환 환자 유래 세포로부터 3차원 세포집합체를 배양하는 단계;
상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
상기 3차원 세포집합체로부터 도파민성 신경세포 생존율을 판별하는 단계를 포함하고,
상기 도파민성 신경세포 생존율에 기초하여 환자에게 적합한 치료제의 정보를 제공하는 단계를 포함하는, 도파민성 신경세포 관련 질환 치료를 위한 정보제공방법을 제공하는 것이다.
본 발명의 또 다른 목적은 약물 테스트용 3차원 세포집합체의 판별 방법으로,
(i) 3차원 세포집합체에 후보물질을 접촉시키는 단계:
상기 후보물질의 접촉은, 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 수행되고, 및
(ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하는 단계를 포함하는, 약물 테스트용 3차원 세포집합체의 판별 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법으로,
(i) 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 3차원 세포집합체에 후보물질을 접촉시키고,
(ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하고,
(iii) 상기 3차원 세포집합체 내에 존재하는 세포의 사멸 여부를 판별하는 단계를 포함하는,
3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법을 제공하는 것이다.
본 발명은 중뇌 (Midbrain) 오가노이드의 고속 및 대량 제조방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 (drug screening) 방법에 관한 것으로, 본 발명에 따른 오가노이드 제조방법은 오가노이드를 고속, 대량 생산할 수 있어 신속한 약물 스크리닝이 가능하고, 비정상적 분화(out-growth)을 차단하며, 데드 코어(dead core) 현상을 최소화하고, 오가노이드 간의 편차를 감소시키며, 중뇌 오가노이드의 신속한 성숙화를 통해 우수한 기능성을 유도한다.
본 발명자들은 오가노이드를 제조함에 있어서 초기 시작 세포 수 (starting cell number)를 50 내지 3,000개로 적용함으로써 오가노이드 제조에 소요되는 시간을 기존의 3 내지 6개월 이상에서 최대 30일 이내로 단축하는 성과를 도출하였다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 인간 줄기세포로부터 3차원 세포집합체를 고속 배양하는 방법으로,
인간으로부터 분리된 세포로부터 배아체(Embryoid body)를 형성하는 단계;
상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 배양하는 것을 특징으로 하는, 3차원 세포집합체의 고속 대량 배양 방법이다.
본 발명에 있어서 인간으로부터 분리된 세포는, 인간 배아 줄기 세포(human embryonic stem cell; hESC), 역분화 줄기 세포(induced pluripotent stem cell), 및 성체 줄기 세포 중 어느 하나인 것일 수 있다.
본 명세서상의 용어 "줄기 세포"는 자기 복제 능력을 가지면서 두 개 이상의 세포로 분화하는 능력을 갖는 세포를 말하며, 만능 줄기 세포 (totipotent stem cell), 전분화능 줄기 세포 (pluripotent stem cell), 다분화능 줄기 세포 (multipotent stem cell) 및 역분화 줄기 세포로 분류할 수 있다.
본 발명에 있어서 3차원 세포집합체는 오가노이드인 것일 수 있고, 예를 들어, 뇌 오가노이드인 것일 수 있다.
본 명세서상의 용어 "오가노이드"는 줄기 세포나 장기 기원 세포로부터 분리한 세포를 3D 배양법으로 다시 응집 또는 재조합하여 만들어진 세포집합체를 의미하는 것으로, 서스펜션 세포 배양물로부터 형성된 오가노이드 또는 세포 클러스터를 포함할 수 있다. 상기 오가노이드는 소형 유사 장기, 장기 유사체, 유사 장기로도 명명될 수 있다. 상기 오가노이드는 구체적으로 기관 또는 조직을 구성하는 여러 종류의 세포들 중 하나 이상의 세포 종류를 포함하며, 조직 또는 기관의 구조와 기능을 재현할 수 있어야 한다.
본 발명의 일 구현예에서, 제조된 뇌 오가노이드는 대부분 지름 0.9 내지 1.4 mm 내외의 범위로 형태 및 크기가 균질하여 개체간 변이가 적고 일정한 품질을 나타내는 것으로 판단되었다.
본 발명에 있어서 3차원 세포집합체는, 20 내지 50일, 또는 20일 내지 40일 내에 형성되는 것일 수 있고, 예를 들어, 20일 내지 30일 내에 형성되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에서, 본 발명의 방법에 따라 7일 동안 배양한 경우 중뇌 유전자의 활성화가 확인되었다. 14일 동안 배양한 경우 중뇌 특이적 도파민 작동성 뉴런 (midbrain dopaminergic neuron; mDA neuron)을 관찰할 수 있었으며, 21일 동안 배양한 경우 상기 mDA 뉴런의 개수가 증가하였다.
본 발명에 있어서 3차원 세포집합체 형성 후, 추가적으로 진탕배양을 수행하는 것일 수 있다. 상기 추가적인 진탕배양을 통하여 장기간 배양이 가능해질 수 있다.
본 발명의 일 구현예에서, 3차원 세포집합체 형성 후 300일 이상 진탕배양을 수행함으로써 3차원 세포집합체를 배양하였다.
본 발명에 있어서 마이크로 웰 플레이트는, 오목부를 갖는 멀티 웰 플레이트인 것일 수 있다. 상기 오목부를 갖는 멀티 웰 플레이트는 96 웰 플레이트, 384 웰 플레이트 또는 1,536 웰 플레이트인 것일 수 있다.
본 발명에 있어서 인간으로부터 분리된 세포의 초기 시작 세포수는, 50개 내지 3,000개인 것일 수 있다.
상기 초기 시작 세포수는, 96 웰 플레이트를 이용하는 경우 300 내지 3,000개인 것이 바람직하고, 300 내지 1,000개인 것이 더욱 바람직하며, 500개인 것이 가장 바람직하나, 이에 한정되는 것은 아니다.
상기 초기 시작 세포수는, 384 웰 플레이트를 이용하는 경우 50 내지 500개인 것이 바람직하고, 50 내지 200개인 것이 더욱 바람직하며, 100개인 것이 가장 바람직하나, 이에 한정되는 것은 아니다.
본 발명에 있어서 고속 대량 배양 방법은, 3차원 세포집합체 형성 전 과정에 걸쳐 바이오리액터를 이용하지 않는 것일 수 있고, 예를 들어, 진탕(shaking) 과정을 수행하지 않는 것일 수 있다.
본 발명에 있어서 3차원 세포집합체는 중뇌 세포집합체인 것일 수 있다.
본 발명에 있어서 3차원 세포집합체는 간, 심장 및 폐로 이루어진 군으로부터 선택되는 소화기계 장기인 것일 수 있다.
본 발명에 있어서 3차원 세포집합체를 형성하는 단계는, 외배엽 형성 단계 또는 중뇌 조직 분화 단계를 포함하는 것일 수 있다.
상기 외배엽 형성 단계는, CHIR99021, Dorsomorphin 및 A83-01(dual SMAD inhibitors)를 포함하는 배지에서 수행되는 것일 수 있다.
상기 중뇌 조직 분화 단계는, CHIR99021, Dorsmorphin, A83-01, IWP, SAG 및 FGF-8b를 포함하는 배지에서 수행되는 것일 수 있다.
본 발명에 있어서 3차원 세포집합체의 성숙화를 유도하는 단계는, SAG, FGF-8b, 인슐린(Insulin), 라미닌(Laminin)을 포함하고, 성장인자가 억제된 용해성 마트리젤을 추가적으로 포함하는 배지에서 수행되는 것일 수 있다.
본 발명의 일 구현예에서, 3차원 세포집합체의 성숙화를 유도하는 단계를 수행함에 있어서 배지에 마트리젤을 직접 첨가하여 배양하는 방법을 사용하였다. 그러나 기존의 알려진 방법에 따르면, 통상적으로 플레이트 상의 마트리젤에 세포를 임베딩하여 배양하는 방법이 수행된다는 점이 상이하다.
본 발명에 있어서 3차원 세포집합체를 형성하는 단계는, 조직 분화 유도 후 7일 이내에 중내배엽 마커의 활성화 없이 외배엽 형성 인자가 발현되는 것일 수 있다. 상기 외배엽 형성 인자는 N-CAD, PLZF, SOX1, SOX2 및 NESTIN으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 3차원 세포집합체를 형성하는 단계는, 조직 분화 유도 후 14일 이내 전뇌 또는 후뇌 마커의 발현 없이 중뇌 마커가 발현되는 것일 수 있다. 상기 중뇌 마커는 LMX1B, ASCL1 및 TH로 이루어진 군으로부터 선택되는 어느 하나 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 3차원 세포집합체의 성숙화를 유도하는 단계는, 수행 이후 중뇌 도파민성 세포의 마커가 발현되는 것일 수 있다.
본 발명의 일 구현예에서, 중뇌 마커는 14일째 또는 그 이전에 활성화되나, 21일째 마커의 발현 수준이 더 높았다. 3차원 세포집합체의 성숙화를 유도하는 단계 후 중뇌 도파민성 세포 마커인 TH 등이 높은 수준으로 발현된다는 점을 알 수 있었다.
본 발명의 일 구현예에서, 배아체를 형성하는 단계로부터 3차원 세포집합체의 성숙화를 유도하는 단계까지 웰 플레이트의 이동 없이 동일한 마이크로 웰 플레이트에서 연속적으로 수행하였으며, 멀티 마이크로 웰 플레이트를 이용한 30일 이내의 고속 대량 배양이 가능하였다.
본 발명의 다른 양태는 3차원 세포집합체의 고속 대량 배양 방법에 의해 제조된, 3차원 세포집합체이다.
본 발명의 또 다른 양태는 3차원 세포집합체를 함유하는 오목 배양부; 및
상기 오목 배양부를 커버하는 커버부를 포함하는, 3차원 세포집합체 배양 키트이다.
본 발명에 있어서 3차원 세포집합체 배양 키트는, 보존액을 포함하는 것일 수 있다.
본 발명의 또 다른 양태는 인간배아줄기세포, 인간 유도만능줄기세포, 및 성체줄기세포 중 어느 하나로부터 배양된 3차원 중뇌 세포집합체로,
상기 3차원 중뇌 세포집합체는, 뉴로멜라닌을 형성하는 것인, 3차원 중뇌 세포집합체이다.
상기 3차원 중뇌 세포집합체는 배양 후 20 내지 50일, 20 내지 40일, 20 내지 35일, 25 내지 50일, 또는 25 내지 40일 후에 뉴로멜라닌을 형성하는 것일 수 있고, 예를 들어, 25 내지 35일 후에 뉴로멜라닌을 형성하는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 중뇌 이외의 다른 뇌 조직을 포함하지 않는 것일 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 비정상 분화(out growth) 발생율이 5% 이하인 것일 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 심부세포사멸 현상 발생율이 상기 세포집합체 전체 면적의 40% 이하인 것일 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 직경이 0.9 내지 1.4 mm의 균일한 사이즈와 균질의 형태를 갖는 것일 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 중뇌 도파민 세포를 10% 이상 포함하는 것일 수 있다.
상기 3차원 중뇌 세포집합체는 30% 이상의 중뇌 도파민 세포를 포함할 수 있고, 또는 50% 이상의 중뇌 도파민 세포를 포함할 수 있다. 초기 단계의 경우, 약 80%의 중뇌 도파민 세포를 포함할 수 있으나, 성숙된 3차원 중뇌 세포집합체의 경우, 다양한 중뇌 세포가 형성되므로, 전체 세포집합체 내의 중뇌 도파민 세포의 함량이 감소할 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 유전자 발현의 변이율이 10% 이하로 균질하게 형성되는 것일 수 있다.
본 발명의 일 구현예에서, 3차원 중뇌 세포집합체는 유전자 발현 퀄리티가 매우 우수하여, 약 90% 이상의 균질성을 나타내었다. 3차원 세포집합체 중 나머지 약 10%의 경우도, 종래의 방법에 의해 제조하는 경우보다 대등한, 혹은 우수한 유전자 발현의 균질성이 관찰되었다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 억제성 신경 및 흥분성 신경을 포함하는 것일 수 있다.
본 발명의 일 구현예에서, 3차원 중뇌 세포집합체는 억제성 신경 및 흥분성 신경을 포함하고, 이는 전체 세포집합체의 10 내지 30% 이상인 것으로 확인되었다. 이는 본 명세서상의 도 11 및 15a의 조직염색 데이터의 실험결과로부터 확인될 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 세포 분화 후 15일부터 전기생리활성이 관찰 가능한 것일 수 있다. 종래의 방법의 경우, 세포 분화 후 수 개월 후부터 전기생리활성이 나타난다는 점에서, 성숙화 양상이 매우 빠르게 나타나는 본 발명의 방법이 월등히 우세함을 입증할 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 흑질, 청색반점, 적핵, 중심회백질, 내측모대, 동안신경핵 및 활차신경핵으로 이루어진 군으로부터 선택되는 어느 하나를 포함하는 것일 수 있다.
본 발명에 있어서 3차원 중뇌 세포집합체는, 신경아교세포 및 희소돌기신경교세포를 포함하는 것일 수 있고, 상기 3차원 중뇌 세포집합체는 신경아교세포 및 희소돌기신경교세포를 1 내지 10% 포함하는 것일 수 있다.
본 발명의 일 구현예에서, 3차원 중뇌 세포집합체가 신경아교세포 및 희소돌기신경교세포를 포함하는 정도는 본 명세서상의 도 11 및 15a의 조직염색 데이터의 실험결과로부터 확인될 수 있다.
본 발명의 또 다른 양태는 인간 줄기세포로부터 3차원 세포집합체의 고속 배양 방법으로,
인간으로부터 분리된 세포로부터 배아체를 형성하는 단계;
상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 비진탕 배양하며,
상기 고속 배양 방법은, 피펫팅 로봇, 자동화된 핸들링, 플레이트 운송 수단을 포함하는 자동화 방식으로 수행되는 것을 특징으로 하는 것인, 3차원 세포집합체의 고속 배양 방법이다.
본 발명의 또 다른 양태는 도파민성 신경세포 관련 질환 약물의 스크리닝 방법에 있어서,
도파민성 신경세포 관련 질환 환자-유래 유도만능줄기세포로부터 3차원 세포집합체를 생성하는 단계;
상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
상기 3차원 세포집합체로부터 도파민성 신경세포의 생존율을 판별하는 단계를 포함하는, 도파민성 신경세포 관련 질환 약물의 스크리닝 방법이다.
본 발명에 있어서 도파민성 신경세포 관련 질환은, 파킨슨병 (Parkinson's disease), 알츠하이머 (Alzheimer's disease), 뇌졸중, 중풍,　헌팅턴병 (Huntington's disease), 피크병, 크로이츠펠트-야콥병, 자폐증 및 뇌 발달장애 증후군 중 어느 하나인 것일 수 있으나, 이에 한정되는 것은 아니다.
상기 정보제공 방법은 3차원 세포집합체를 도파민성 신경세포 관련 질환 약물의 스크리닝 용도로 적용함으로써 약물의 독성 및 효능을 평가하는 방법으로 사용될 수 있다.
상기 후보물질에 의하여 도파민성 신경세포 관련 질환의 발병이 예방되거나, 치료되거나, 대조군 물질에 비하여 예후가 증진된 경우에 상기 후보물질을 도파민성 신경세포 관련 질환 치료제로서 효능을 갖는다고 결정할 수 있다.
본 발명의 또 다른 양태는 도파민성 신경세포 관련 질환 환자 유래 세포로부터 3차원 세포집합체를 배양하는 단계;
상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
상기 3차원 세포집합체로부터 도파민성 신경세포 생존율을 판별하는 단계를 포함하고,
상기 도파민성 신경세포 생존율에 기초하여 환자에게 적합한 치료제의 정보를 제공하는 단계를 포함하는, 도파민성 신경세포 관련 질환 치료를 위한 정보제공방법이다.
본 발명에 있어서 후보물질은 천연 화합물, 합성 화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또는 진균의 대사 산물 및 생활성 분자로 이루어진 군으로부터 선택되는 어느 하나인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 양태는 약물 테스트용 3차원 세포집합체의 판별 방법으로,
(i) 3차원 세포집합체에 후보물질을 접촉시키는 단계:
상기 후보물질의 접촉은, 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 수행되고, 및
(ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하는 단계를 포함하는, 약물 테스트용 3차원 세포집합체의 판별 방법이다.
본 발명의 또 다른 양태는 3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법으로,
(i) 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 3차원 세포집합체에 후보물질을 접촉시키고,
(ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하고,
(iii) 상기 3차원 세포집합체 내에 존재하는 세포의 사멸 여부를 판별하는 단계를 포함하는,
3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법이다.
본 명세서상의 용어 "스크리닝"이란, 여러 물질로 이루어진 후보군으로부터 목적으로 하는 어떤 특정한 성질을 갖는 물질을 특정한 조작 또는 평가 방법으로 선별하는 것이다.
상기 체외 독성 스크리닝 방법은, 독성 물질의 확인 또는 신약 후보물질의 신경 독성 여부를 검증하는 용도의 약물 독성 평가용 플랫폼으로 사용될 수 있다.
본 발명은 중뇌 오가노이드, 이의 제조방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 (drug screening) 방법에 관한 것으로서, 상기 제조방법은 오가노이드를 고속 생산할 수 있어 신속한 약물 스크리닝이 가능하고, 비정상적 분화 (out-growth)을 차단하며, 데드 코어 (dead core) 현상을 최소화하고, 오가노이드 간의 편차를 감소시키며, 중뇌 오가노이드의 높은 기능성을 유도함으로, 이를 효과적으로 오가노이드의 제조에 이용할 수 있다.
도 1은 환자 맞춤형 오가노이드 생산을 위한 유도 만능 줄기 세포 (Induced Pluripotent Stem Cells; iPSCs)의 제작 및 오가노이드 분화 과정을 나타낸 모식도이다.
도 2는 오가노이드 생산의 다양한 문제점들을 나타낸 모식도이다.
도 3은 기존 기술 대비 본 발명의 오가노이드 생산 전략을 나타낸 모식도이다.
도 4는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 7일째의 중뇌 오가노이드의 형태를 나타낸 사진(상), 분화율 및 형태상 분류를 나타낸 그래프(중) 및 형태 기준을 나타낸 사진(하)이다.
도 5a는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 7일째의 중뇌 오가노이드에서의 전분화능 (Pluripotency) 마커 유전자 발현양상을 나타낸 그래프이다.
도 5b는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 7일째의 중뇌 오가노이드에서의 중내배엽 (Mesoendoderm) 마커 유전자 발현양상을 나타낸 그래프이다.
도 5c는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 7일째의 중뇌 오가노이드에서의 신경외배엽 (Neuroectoderm) 마커 유전자 발현양상을 나타낸 그래프이다.
도 6은 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 형태를 나타낸 사진(상), 분화율 및 형태상 분류를 나타낸 그래프(중) 및 형태 기준을 나타낸 사진(하)이다.
도 7a는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 세포자연사 마커 유전자 발현양상을 나타낸 그래프이다.
도 7b는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 전뇌 (Forebrain) 마커 유전자 발현양상을 나타낸 그래프이다.
도 7c는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 중뇌 (Midbrain) 마커 유전자 발현양상을 나타낸 그래프이다.
도 7d는 본 발명의 일 실시예에 따른 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 후뇌 (Hindbrain) 마커 유전자 발현양상을 나타낸 그래프이다.
도 8은 본 발명의 일 실시예에 따른 500개 이하의 초기 시작 세포 수 조건에서 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드의 형태를 나타낸 사진(상), 분화율 및 형태상 분류를 나타낸 그래프(중) 및 형태 기준을 나타낸 사진(하)이다.
도 9a는 본 발명의 일 실시예에 따른 500개 이하의 초기 시작 세포 수 조건에서 96웰 플레이트에서 생산된 분화 7일째의 중뇌 오가노이드에서의 신경외배엽 마커 유전자 발현양상을 나타낸 그래프이다.
도 9b는 본 발명의 일 실시예에 따른 500개 이하의 초기 시작 세포 수 조건에서 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드에서의 중뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 9c는 본 발명의 일 실시예에 따른 500개 이하의 초기 시작 세포 수 조건에서 96웰 플레이트에서 생산된 분화 14일째의 중뇌 오가노이드에서의 후뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 10a는 본 발명의 일 실시예에 따른 384웰 플레이트에서 초기 시작 세포 수를 달리하여 형성된 중뇌 오가노이드의 크기를 비교한 사진이다.
도 10b는 본 발명의 실시예에 따른 384웰 플레이트 유래 중뇌 오가노이드의 중뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 11은 본 발명의 일 실시예에 따른 분화 14일째의 중뇌 오가노이드에서의 중뇌 특이적 도파민 작동성 뉴런 (midbrain dopaminergic neuron; mDA neuron)을 티로신 수산화효소 (tyrosine hydroxylase; TH)로 나타낸 면역염색분석 결과 사진이다.
도 12는 본 발명의 일 실시예에 따른 분화 21일째의 중뇌 오가노이드의 형태를 나타낸 사진(상), 분화율 및 형태상 분류를 나타낸 그래프(중) 및 형태 기준을 나타낸 사진(하)이다.
도 13a는 본 발명의 일 실시예에 따른 분화 21일째의 세포자연사 마커 유전자 발현양상을 나타낸 그래프이다.
도 13b는 본 발명의 일 실시예에 따른 분화 21일째의 전뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 13c는 본 발명의 일 실시예에 따른 분화 21일째의 중뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 13d는 본 발명의 일 실시예에 따른 분화 21일째의 후뇌 마커 유전자 발현양상을 나타낸 그래프이다.
도 14a는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 중뇌 오가노이드의 크기를 날짜별로 비교한 사진이다.
도 14b는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 중뇌 오가노이드의 크기를 날짜별로 비교한 그래프이다.
도 15a는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 분화 21일째의 중뇌 오가노이드에서의 중뇌 특이적 도파민 작동성 뉴런을 TH로 나타낸 면역염색분석 결과 사진이다.
도 15b는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 분화 21일째의 중뇌 오가노이드에서의 중뇌 특이적 도파민 작동성 뉴런의 비율을 나타낸 면역염색분석 결과 그래프이다.
도 16a는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 분화 21일째의 중뇌 오가노이드에서의 데드코어의 크기를 나타낸 면역염색분석 결과 사진이다.
도 16b는 본 발명의 일 실시예에 따른 초기 시작 세포 수를 달리하여 형성된 분화 21일째의 중뇌 오가노이드에서의 데드코어의 크기를 나타낸 면역염색분석 결과 그래프이다.
도 17은 본 발명의 일 실시예에 따른 초기 시작 세포 수 500개 조건에서 생산된 중뇌 오가노이드의 뉴런 타입과 그 외 세포조성을 확인한 면역염색분석 결과 사진이다.
도 18은 본 발명의 일 실시예에 따른 96, 384 웰 고속 대량 스크리닝 (high throughput screening; HTS) 플랫폼에서 생산된 중뇌 오가노이드의 고용량 이미징 (high content imaging; HCI) 분석 결과를 나타낸 사진이다.
도 19는 본 발명의 일 실시예에 따른 기존 방법으로 생산한 중뇌 오가노이드와 고속, 대량 생산된 중뇌 오가노이드의 형태 (상) 및 크기 (하)를 나타낸 사진 및 결과 그래프이다.
도 20은 본 발명의 일 실시예에 따른 고속, 대량 생산된 중뇌 오가노이드의 개체간 변이를 확인하기 위해 각 중뇌 오가노이드 개체간 유전자 발현양상을 비교한 그래프이다.
도 21은 본 발명의 일 실시예에 따른 고속, 대량 생산된 중뇌 오가노이드에서 뉴로멜라닌의 생성 결과를 분석한 사진이다.
도 22는 본 발명의 일 실시예에 따른 고속, 대량 생산된 중뇌 오가노이드에서 뉴로멜라닌의 생성을 Fontana-Masson 염색기법을 통해 확인한 사진이다.
도 23은 본 발명의 일 실시예에 따른 기존 방법으로 생산한 중뇌 오가노이드와 고속, 대량 생산된 중뇌 오가노이드의 전기생리학적 활성을 비교한 결과이다.
도 24는 본 발명의 일 실시예에 따른 신경독성물질인 6-OHDA와 MPTP를 처리한 고속, 대량 생산된 중뇌 오가노이드의 형태와 크기 변화를 나타내는 사진 (상) 및 그래프 (하)이다.
도 25는 본 발명의 일 실시예에 따른 신경독성물질인 6-OHDA와 MPTP를 처리한 고속, 대량 생산된 중뇌 오가노이드에서 세포사멸 마커 (상)와 중뇌 마커 (하) 유전자의 발현 양상을 나타내는 그래프이다.
도 26은 본 발명의 일 실시예에 따른 HTS 약물 효능 및 독성평가를 위한 오가노이드 신약개발 플랫폼 구축을 나타낸 도면이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량)%, 고체/액체는 (중량/부피)%, 그리고 액체/액체는 (부피/부피)%이다.
실시예 1. 오가노이드의 제조
하기와 같은 과정에 따라 오가노이드를 제조하였다.
(Day 0) 5x101, 1x102, 2.5x102, 5x102, 1x103, 3x103, 5x103, 7x103, 1x104 단일-세포로 해리된 인간 배아 줄기 세포 (human embryonic stem cell; hESC)를 COB1과 함께 50 uM Y-27632 및 4ng/ml 기본 섬유 모세포 성장 인자 (bfgf)을 갖는 u-bottom 96-웰 (well) 플레이트 상에 플레이팅하였다. (COB1: 100x N2 보충제(Gibco), 50x B27 w/o 비타민 A (Gibco), 1% 페니실린/스트렙토마이신 (penicillin/streptomycin; PS)(Gibco), 1% GlutaMAXTM (Gibco), 1% NEAA(Gibco), 55 uM β-머캅토에탄올 (mercaptoethanol)(Gibco), 1 μg/ml 헤파린 (Sigma)이 보충된 DMEM/F12 (Corning) 및 Neurobasal Medium (Gibco)의 1:1 혼합물)
(Day 1~4) 배양체 (embryoid body; EB)의 형성을 확인하고 COB1과 함께 3 uM CHIR99021, 2 uM 도르소모르핀, 2 uM A83-01, 1 uM WNT 신호전달체계 억제제 IWP2을 함유하는 배지를 첨가하였다. 이 시기 처리기간은 day 2, day 3 내지 day 4으로 한정하였다.
(Day 4~7) COB1과 함께 3 uM CHIR99021, 2 uM 도르소모르핀, 2 uM A83-01, 1 uM WNT 신호전달체계 억제제 IWP2, 2 μg/ml SAG (statoacoustic ganglion) 및 100 ng/ml FGF8 (Fibroblast growth factor 8)을 포함하는 배지로 교체하였다. 이후 7일까지 배지를 교체하였다. 이 시기 처리기간은 day 5, day 6 내지 day 7로 한정하였다.
(Day 7) 얼음에 마트리겔을 약 4시간 동안 용해시켰다. COB1과 함께 100 ng/ml FGF8, 2 ug/ml SAG, 2.5 ug/ml 인슐린 (Insulin), 200 ng/ml 라미닌 (Laminin) 포함 배지를 만들었다. 용해된 마트리겔 (Matrigel)을 배지에 넣었다. 그 다음 오가노이드의 배지를 변경하였다.
(Day 9) COB2와 함께 10 ng/ml 뇌-유래 신경성장 인자 (Brain-derived neurotrophic factor; BDNF), 10 ng/ml 교세포 신경성장인자 (Glial cell line-derived neurotrophic factor; GDNF), 200 uM 아스코르브산, 및 125 uM cAMP를 함유하는 BMM으로 배지로 교체하였다. 이틀마다 배지를 교체하였다. (COB2: 100x N2 보충제 (Gibco), 50x B27 w/o (Gibco), 1% PS (Gibco), 1% GlutaMAXTM (Gibco), 1% NEAA (Gibco), 55 uM β-머캅토에탄올 (Gibco), 1 μg/ml 헤파린 (Sigma)이 보충된 DMEM/F12 (Corning) 및 Neurobasal Medium (Gibco)의 1:1 혼합물)
실시예 2. 분화 7일째의 오가노이드 특성 확인
2-1. 오가노이드의 생존율 및 품질 확인
고속 대량 스크리닝 (high throughput screening; HTS) 플랫폼 (platform), 즉 96 웰에서 EB 형성, 중뇌 오가노이드로 분화 유도, 성숙화, 그리고 신약개발 등 응용연구의 일원화를 위한 첫 단계로 다양한 초기 시작 세포 수 (starting cell number)를 테스트하였다. 이를 위하여, 단일 세포로 해리된 hESC를 웰 별로 500, 1,000, 3,000, 5,000, 7,000 및 10,000 개씩 96웰 플레이트에 플레이팅한 후, 분화양상을 관찰하여, 그 결과를 도 4에 나타내었다. 오가노이드의 품질은 Class 1 (신경 로젯 발달), Class 2 (밝고 둥근 EB) 및 Class 3 (파열된 EB)으로 구분하였다.
도 4에서 확인할 수 있듯이, 7일째의 생존율 및 EB 품질을 비교한 결과, 500, 1,000 및 3,000개의 단일 세포를 플레이팅한 경우 오가노이드의 크기는 다소 작지만 Class 2로 전반적인 품질이 우수하였고 5,000 이상의 단일 세포를 플레이팅한 경우 Class 1로 가장 우수하였다.
2-2. 오가노이드의 유전자 발현 양상 확인
오가노이드의 유전자의 발현 양상을 알아보기 위하여 전분화능 (Pluripotency) 마커로는 OCT4 및 NANOG, 중내배엽 (mesoendoderm) 마커로는 EOMES, MXL1 및 T, 신경외배엽 (neuroectoderm) 마커로는 N-CAD, PLZF, SOX1, SOX2 및 NESTIN을 선택하였다. 상기 마커들에 대하여 오가노이드에서의 발현량을 확인하고, 그 결과를 도 5a 내지 도 5c에 나타내었다. qPCR에 사용한 프라이머 서열은 하기 표 1과 같다.
서열번호 명칭 서열(5'→3')
1 Oct4_F primer GACAGGGGGAGGGGAGGAGCTAGG
2 Oct4_R primer CTTCCCTCCAACCAGTTGCCCCAAAC
3 Nanog_F primer TGCAACCTGAAGACGTGTGA
4 Nanog _R primer CTATGAGGGATGGGAGGA
5 Eomes_F primer CTCAAAAGGCATGGGAGGGTA
6 Eomes_R primer CACCACCAAGTCCATCTGCAA
7 MXL1 F primer ACAACGCTCTTGAACGACGAA
8 MXL1 R primer CGGCAACATCAACTGACAAC
9 T_F primer CGCCTCATAGCCTCATGGAC
10 T_R primer CACTGGCTGCCACGACAAA
11 NCAD-F primer TGATGAAGAAGGTGGAGGAGAAGA
12 NCAD-R primer ATTCGTCGGATTCCCACAGG
13 PLZF-F primer TCCCGCCCGACTGGAGGATA
14 PLZF-R primer TTCTTTCCTGGCTCCCCGCTC
15 SOX1-F primer GCCGAGTGGAAGGTCATGTC
16 SOX1-R primer TTCTTGAGCAGCGTCTTGGTC
17 SOX2-F primer AGACTGCACATGAGCCAGCA
18 SOX2-R primer CGTCTCCAGCCAGCTTCAAC
19 NESTIN-F primer AGGAAAAGACCATCTGCCCG
20 NESTIN-R primer GCCTCTCAGCCAGAAACCAT
도 5a 내지 5c에서 확인할 수 있듯이, 유전자의 발현 양상도 대체적으로 비슷한 패턴을 보였다. 전분화능 및 중내배엽 마커는 발현하지 않고, 신경외배엽 마커만 발현하여, HTS 플랫폼에서 생산된 중뇌 오가노이드에서 초기 신경분화가 제대로 이루어짐을 확인하였다.
실시예 3. 분화 14일째의 오가노이드 특성 확인
3-1. 오가노이드의 생존율 및 품질 확인
실시예 1의 방법에 따라 제조된 분화 14일째의 오가노이드는 생존율 및 형태 측면에서 초기 시작 세포 수 별 상이한 양상을 보였다. 오가노이드의 품질은 Class 1 (신경 로젯과 밝은 테두리), Class 2 (비정상적 분화 형성), Class 3 (비정상적 분화로 덮임) 및 Class 4 (진하고 어두운 EB)로 구분하였다. 그 결과를 표 2, 도 6에 나타내었다.
세포수 500 1,000 3,000 5,000 7,000 10,000
Class 1(개) 30 25 26 16 15 15
Class 2(개) 0 5 1 1 3 1
Class 3(개) 0 0 3 11 12 11
Class 4(개) 0 0 0 2 0 3
총합(개) 30 30 30 30 30 30
표 1, 도 6에서 확인할 수 있듯이, 세포가 5,000개 이상 사용된 경우 중뇌 오가노이드 표면에 비정상적 분화 (out-growth)이 많이 나타났지만 500 내지 3,000개 사용된 경우 비정상적 분화 없이 높은 품질의 중뇌 오가노이드가 생산되었다.
3-2. 오가노이드의 유전자 발현 양상 확인
또한, 유전자의 발현 양상을 알아보기 위하여 세포자연사 (Apoptosis) 마커로는 BAX, BAD 및 PMA1P1, 전뇌(Forebrain) 마커로는 FOXG1, LHX2 및 SIX3, 중뇌(Midbrain) 마커로는 LMX1B, ASCL1 및 TH, 및 후뇌(Hindbrain) 마커로는 HA1, HB4 및 HC9를 선택하여 오가노이드에서의 발현량을 확인하여, 그 결과를 각각 도 7a 내지 도 7d에 나타내었다. qPCR에 사용한 프라이머 서열은 하기 표 3과 같다.
서열번호 명칭 서열(5'→3')
21 BAX-F primer TGCTGACGTGGACACGGACT
22 BAX-R primer CCAGCCACCCTGGTCTTGGA
23 BAD-F primer TCGGAGTCGCCACAGTTCGT
24 BAD-R primer GCGCTCTTTGGGCGAGGAAG
25 PMAIP1-F primer GGGAAGAAGGCGCGCAAGAA
26 PMAIP1-R primer AGTTTCTGCCGGAAGTTCAGTTTGT
27 FOXG1-F primer GCGGGCCAGAACAGTTACTT
28 FOXG2-R primer CCCAGACAGTCCCGTCGTAA
29 LHX2-F primer ACTTCTGTGCCTGGCAACCTG
30 LHX2-R primer TCTGTTTCCAGGCGAGATCCT
31 SIX3-F primer AACCTCCAGCGACTCGGAAT
32 SIX3-R primer TTCGGTTTGTTCTGGGGATG
33 LMX1B-F primer GGCATCAAGATGGAGGAGCA
34 LMX1B-R primer TGGTGAGGGCTTGCTGACAC
35 ASCL1-F primer GGTGATCGCACAACCTGCAT
36 ASCL1-R primer GTTCTGAGCGCTTCCCGTT
37 TH-F primer CTGAGATTCGGGCCTTCGAC
38 TH-R primer TGCACCTAGCCAATGGCACT
39 HA1-F primer AGATCAACACATACCGGAGCC
40 HA1-R primer AGCGCACGAAGGAATTGCAG
41 HB4-F primer AGCTGGCAGTGGCATTGGCTA
42 HB4-R primer TGCTGCTCTAGGAACCGAACC
43 HC9-F primer TTGCTGTACATTGGCTGGGA
44 HC9-R primer ACACAGCTGCAGCGCTATTA
도 7에서 확인할 수 있듯이, 모든 경우 중뇌 마커만 특이적으로 활성화되었으며, 초기 시작 세포 수가 증가할수록 세포자연사 마커의 발현이 증가함을 확인하였다.
3-3. 초기 시작 세포 수에 따른 오가노이드 형성에 미치는 영향 확인
500개 이하의 세포를 사용할 경우, 중뇌 오가노이드 형성에 미치는 영향을 조사하기 위하여 상기 실험을 100, 250 및 500개를 사용하여 다시 실시하여, 그 결과를 도 8, 9a 내지 9c에 나타내었다. qPCR에 사용한 프라이머 서열은 표 1, 3 및 하기 표 4에서 활용하였다.
서열번호 명칭 서열(5'→3')
45 KROX20-F primer ACCGCCTCCTCCTCCTTATT
46 KROX20-R primer GGGTAGGCCAGAGAGGAAGA
도 8에서 확인할 수 있듯이, 분화 14일째의 오가노이드는 분화 7일째의 오가노이드에 대비하여 형태상의 큰 차이가 없었다. 그러나 도 9a 내지 9c에서 확인할 수 있듯이, 100개 및 250개의 경우 초기(7일) 신경외배엽 마커 N-CAD, SOX2 및 PLZF의 발현과, 14일째 중뇌 마커 LMX1B, ASCL1 및 TH의 발현이 다소 낮았으며, 오히려 후뇌 마커 HC9, HA1, HB4 및 KROX20의 발현이 증가된 양상을 보였다. 따라서, 상기 결과는 500개 세포를 사용한 경우 중뇌 오가노이드 생산이 가장 효율적임을 나타내었다.
3-4. 384웰 플레이트에서 초기 시작 세포 수가 오가노이드 형성에 미치는 영향 확인
중뇌 오가노이드 대량생산을 위해 384웰 플레이트 기반 중뇌 오가노이드 생산 조건을 확인하였다. 웰의 부피가 96웰 (~330 ul)에 비해 적은 384웰 (~90 ul)에서의 중뇌 오가노이드 생산을 위해 시작 세포의 수를 50, 100, 200, 300 및 500으로 나누어서 그 효과를 확인하여, 그 결과를 도 10a과 10b에 나타내었다.
도 10a에서 확인할 수 있듯이, 분화 30일째의 중뇌 오가노이드가 시작 세포의 수와 상관없이 유사한 형태와 크기를 보이는 것을 확인하였다.
그러나 도 10b에서 확인할 수 있듯이, 시작 세포 수 50, 100 및 200개의 경우 500개인 경우에 비해 중뇌 마커인 TH, ACSL1, LMX1B의 발현이 더 높았다. 따라서, 상기 결과는 384웰 플레이트를 이용하여 중뇌 오가노이드를 생산할 경우, 50, 100 및 200개의 시작 세포의 사용이 가장 효율적임을 나타낸다.
3-5. 오가노이드의 중뇌 특이적 도파민 신경세포 수 확인
분화 14일째의 중뇌 오가노이드에서 중뇌 특이적 도파민 작동성 뉴런(midbrain dopaminergic neuron; mDA neuron)을 관찰하여, 그 결과를 도 11에 나타내었다.
도 11에서 확인할 수 있듯이, 500개의 초기 시작 세포를 사용한 경우 티로신 수산화효소(tyrosine hydroxylase; TH)를 발현하는 mDA 뉴런이 가장 균질하게 존재함을 확인하였다.
실시예 4: 분화 21일째의 오가노이드 특성 확인
4-1. 오가노이드의 생존율 및 품질 확인
실시예 1의 방법에 따라 제조된 분화 21일째의 중뇌 오가노이드의 생존율과 품질 (quality)을 조사하였다. 오가노이드의 품질은 Class 1 (신경 로젯 발달), Class 2 (매끄러운 오가노이드), Class 3 (비정상적 분화로 덮임) 및 Class 4 (파열된 오가노이드)로 구분하였다. 그 결과를 표 5 및 도 12에 나타내었다.
세포수 500 1,000 3,000 5,000 7,000 10,000
Class 1(개) 24 8 0 0 0 0
Class 2(개) 6 17 10 10 11 16
Class 3(개) 0 5 20 15 14 8
Class 4(개) 0 0 0 5 5 6
총합(개) 30 30 30 30 30 30
표 5 및 도 12에서 확인할 수 있듯이, 500개 또는 1,000개가 사용된 경우 비정상적 분화의 가능성을 완벽히 차단하고 신경상피세포층 형성이 관찰되는 중뇌 오가노이드가 생성되는 반면, 3,000개 이상을 사용한 경우 비정상적 분화 현상이 매우 심해져 낮은 품질의 중뇌 오가노이드만 생성되었다.
4-2. 오가노이드의 유전자 발현 양상 확인
유전자의 발현 양상을 알아보기 위하여 세포자연사 마커로는 BAX, BAD 및 PMA1P1, 전뇌 마커로는 FOXG1, LHX2 및 SIX3, 중뇌 마커로는 LMX1B, ASCL1 및 TH, 후뇌 마커로는 HA1, HB4 및 HC9를 선택하여 오가노이드에서의 발현량을 확인하여, 그 결과를 각각 도 13a 내지 도 13d에 나타내었다. qPCR에 사용한 프라이머 서열은 표 3에서 활용하였다.
도 13a 내지 도 13d에서 확인할 수 있듯이, 3,000개 이상의 세포가 사용된 경우 세포자연사 마커의 발현이 증가되었으며, 3,000 내지 10,000개의 세포가 사용된 경우 일부 중뇌 유전자에서 그 발현양이 다소 감소함을 확인하였다.
이에 따라 HTS 플랫폼에서 중뇌 오가노이드 생산 시 초기 시작 세포 수가 매우 중요하게 작용한다는 점을 확인하였다.
4-3. 오가노이드의 크기 비교
분화 7, 14 및 21일째의 500 내지 10,000개 세포가 사용된 중뇌 오가노이드의 크기를 비교하여, 그 결과를 도 14a 및 14b에 나타내었다.
도 14a 및 14b에서 확인할 수 있듯이, 500 내지 10,000개까지의 모든 조건에서 유사한 크기를 보였으며 이는 500 내지 1,000개의 초기 시작 세포 수로도 충분히 중뇌 오가노이드 생산이 가능함을 시사하였다.
4-4. 오가노이드의 중뇌 특이적 도파민 신경세포 수 확인
분화 21일째의 중뇌 오가노이드에서 중뇌 특이적 도파민 신경세포의 수를 확인하여, 그 결과를 표 6, 도 15a 및 15b에 나타내었다.
세포수 500 1,000 3,000 5,000 7,000 10,000
세포 내 비율(%) 12.6 7.0 4.9 3.0 3.9 1.4
표 6, 도 15a 및 15b에서 확인할 수 있듯이, 500, 1,000개의 경우 중뇌 특이적 도파민 신경세포가 보다 많고 균질 하게 존재함을 확인하였다. 이는 HTS 플랫폼에서 초기 시작 세포 수로 500, 1,000개가 최적임을 나타내었다.
특히, 도 16a 및 16b에서 확인할 수 있듯이, 오가노이드에서 발생하는 공통된 문제점인 "데드 코어" 현상이 초기 시작 세포 수 1,000개 이하의 경우 매우 효율적으로 억제되는 것을 확인하였다.
또한, 도 17에서 확인할 수 있듯이, 500개의 초기 시작 세포에서 생산된 중뇌 오가노이드는 TH 양성의 mDA 뉴런을 균질하게 함유하고 있고, GIRK2 (G protein-activated inward rectifier potassium channel 2)를 발현하는 성숙화된 A9 타입 (type) mDA 뉴런들도 존재하였다. 나아가 성상세포 (astrocyte), 희돌기교세포 (oligodendrocyte)와 여러가지 서브타입 (subtype) 신경세포들도 존재하는 것을 확인하였다.
4-5. 오가노이드의 형태 확인
최종적으로 500개의 세포를 사용하여 96, 384 웰 HTS 플랫폼에서 생산된 오가노이드의 형태를 고용량 이미징 (high content imaging; HCI) 장비로 관찰하여 도 18과 같이 나타내었다.
도 19에서 확인할 수 있듯이, 분화 30일째 96 웰 플레이트 상의 모든 오가노이드가 대부분 지름 0.9 내지 1.4 mm 범위에서 매우 균질하게 동일한 양상의 중뇌 오가노이드를 생산하였다. 반면, 마이크로 웰 플레이트를 사용하지 않고 일반적인 방법으로 생산한 중뇌 오가노이드의 경우 형태와 크기가 매우 비균질한 양상을 보이는 것을 확인하였다. 다른 종류의 인간 배아줄기세포 또는 인간 역분화줄기세포에서도 유사한 결과를 얻을 수 있었다.
도 20에서 확인할 수 있듯이, 고속, 대량 생산된 96 웰 플레이트 상의 중뇌 오가노이드의 유전자 발현양상을 개개의 중뇌 오가노이드에서 확인한 결과, 90% 이상의 중뇌 오가노이드는 기존 기술로 생산한 중뇌 오가노이드보다 우수한 양상을 나타내고, 나머지 약 10%의 경우도 기존 기술로 생산한 중뇌 오가노이드와 유사한 수준의 유전자 발현양상을 보이는 것이 관찰되었다. 이는 고속, 대량 생산된 중뇌 오가노이드가 개체간 변이 없이 매우 균질한 특성을 가지고 있음을 의미한다. 따라서, 중뇌 오가노이드 고속, 대량 생산 기술은 향후 중뇌 오가노이드 기술의 산업화를 위한 표준화기술로 활용 가능하다.
실시예 5: 고속, 대량 생산 중뇌 오가노이드의 기능성 검증
고속, 대량 생산 중뇌 오가노이드의 기능성 검증을 위해 뉴로멜라닌 생성과 전기생리 분석을 실시하였고 그 결과를 도 21 및 22와 같이 나타내었다.
도 21에서 확인할 수 있듯이, 고속, 대량 생산 중뇌 오가노이드의 경우 분화 30일째 뉴로멜라닌을 생성함을 확인하였다. 일반적인 방법으로 생산한 중뇌 오가노이드에서 뉴로멜라닌 형성은 분화를 100일 이상 유도할 경우 관찰되는 점을 고려할 때, 고속, 대량 생산 중뇌 오가노이드는 30일 이내에 수개월 이상 분화 유도한 중뇌 오가노이드와 유사한 기능성을 가지고 있음을 확인하였다.
도 22에서 확인할 수 있듯이, 고속, 대량 생산된 중뇌 오가노이드 내 뉴로멜라닌 형성은 Fontana-Masson 염색을 통해 다시 확인하였다.
고속, 대량 생산된 중뇌 오가노이드의 기능성 검증의 일환으로 신경 신호 발화율 측정을 통한 전기생리분석을 실시하였다.
그 결과, 도 23에서 확인할 수 있듯이, 일반적인 방법으로 생산된 중뇌 오가노이드의 경우, 분화 70일째까지 전기생리적 활성을 보이지 않았으나 고속, 대량 생산 중뇌 오가노이드의 경우 분화 20일째부터 유의적으로 높은 수준의 신경 발화율을 보였으며 분화 30일째에 신경 발화율이 급격히 증가됨을 확인할 수 있었다.
이는 기존 방법에 비해 본 기술을 통해 생산된 고속, 대량 생산 중뇌 오가노이드의 기능적 성숙화 양상이 매우 빠르게 이뤄짐을 의미하며 따라서, 본 기술을 통해서 분화 30일째에 기능적으로 성숙한 중뇌 오가노이드 생산이 가능함을 의미한다.
실시예 6: 고속, 대량 생산 중뇌 오가노이드 기반 체외 약물 독성 평가
약물 효능 및 독성 평가 플랫폼으로써 고속, 대량 생산 중뇌 오가노이드의 활용 가능성을 검증하기 위해 고속, 대량 생산 중뇌 오가노이드 기반 체외 약물 독성 평가 연구를 수행하였고 그 결과를 도 24 및 25와 같이 나타내었다.
구체적으로, 고속, 대량 생산 중뇌 오가노이드에 도파민 신경세포의 사멸을 유도하는 신경독성 물질인 6-OHDA (6-hydroxydopamine)와 MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine)를 100, 250, 500 uM 농도로 10일간 처리 후 중뇌 오가노이드의 면적을 측정하였다.
도 24에서 확인할 수 있듯이, 각 신경독성물질의 농도에 비례하여 중뇌 오가노이드의 크기가 감소함을 확인하였다.
또한 도 25에서 확인할 수 있듯이, 신경독성물질이 처리된 중뇌 오가노이드의 경우 독성물질의 농도에 비례하여 세포사멸관련 마커의 발현은 증가하고 중뇌 마커의 발현은 감소하는 것을 확인하였다. 상기 결과는 체외 약물 효능 및 독성 평가를 위한 신약개발 플랫폼으로써 중뇌 오가노이드가 그 활용 가능성을 가짐을 시사한다.
결론적으로 도 26과 같이 중뇌 오가노이드 초고속, 대량생산 및 표준화 기술을 기반으로 약물의 효능 및 독성을 평가하기 위한 신약개발 플랫폼 개발 등 다양한 중뇌 오가노이드 기술 기반 산업화 연계 기술 개발이 가능하다.
<110> Organ Factory, Inc.
<120> Midbrain organoids, high-speed and large-scale manufacturing
method thereof, neurotoxic screening methods, and drug screening
methods for dopaminergic neuron-related diseases
<130> FPC-2021-0102PCT
<150> KR 10-2020-0079093
<151> 2020-06-29
<150> KR 10-2021-0010149
<151> 2021-01-25
<160> 46
<170> KoPatentIn 3.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Oct4_F primer
<400> 1
gacaggggga ggggaggagc tagg 24
<210> 2
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Oct4_R primer
<400> 2
cttccctcca accagttgcc ccaaac 26
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Nanog_F primer
<400> 3
tgcaacctga agacgtgtga 20
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Nanog _R primer
<400> 4
ctatgaggga tgggagga 18
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Eomes_F primer
<400> 5
ctcaaaaggc atgggagggt a 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Eomes_R primer
<400> 6
caccaccaag tccatctgca a 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> MXL1 F primer
<400> 7
acaacgctct tgaacgacga a 21
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> MXL1 R primer
<400> 8
cggcaacatc aactgacaac 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> T_F primer
<400> 9
cgcctcatag cctcatggac 20
<210> 10
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> T_R primer
<400> 10
cactggctgc cacgacaaa 19
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> NCAD-F primer
<400> 11
tgatgaagaa ggtggaggag aaga 24
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NCAD-R primer
<400> 12
attcgtcgga ttcccacagg 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PLZF-F primer
<400> 13
tcccgcccga ctggaggata 20
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> PLZF-R primer
<400> 14
ttctttcctg gctccccgct c 21
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SOX1-F primer
<400> 15
gccgagtgga aggtcatgtc 20
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> SOX1-R primer
<400> 16
ttcttgagca gcgtcttggt c 21
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SOX2-F primer
<400> 17
agactgcaca tgagccagca 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SOX2-R primer
<400> 18
cgtctccagc cagcttcaac 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NESTIN-F primer
<400> 19
aggaaaagac catctgcccg 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> NESTIN-R primer
<400> 20
gcctctcagc cagaaaccat 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> BAX-F primer
<400> 21
tgctgacgtg gacacggact 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> BAX-R primer
<400> 22
ccagccaccc tggtcttgga 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> BAD-F primer
<400> 23
tcggagtcgc cacagttcgt 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> BAD-R primer
<400> 24
gcgctctttg ggcgaggaag 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> PMAIP1-F primer
<400> 25
gggaagaagg cgcgcaagaa 20
<210> 26
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> PMAIP1-R primer
<400> 26
agtttctgcc ggaagttcag tttgt 25
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> FOXG1-F primer
<400> 27
gcgggccaga acagttactt 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> FOXG2-R primer
<400> 28
cccagacagt cccgtcgtaa 20
<210> 29
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> LHX2-F primer
<400> 29
acttctgtgc ctggcaacct g 21
<210> 30
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> LHX2-R primer
<400> 30
tctgtttcca ggcgagatcc t 21
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SIX3-F primer
<400> 31
aacctccagc gactcggaat 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> SIX3-R primer
<400> 32
ttcggtttgt tctggggatg 20
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> LMX1B-F primer
<400> 33
ggcatcaaga tggaggagca 20
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> LMX1B-R primer
<400> 34
tggtgagggc ttgctgacac 20
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> ASCL1-F primer
<400> 35
ggtgatcgca caacctgcat 20
<210> 36
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> ASCL1-R primer
<400> 36
gttctgagcg cttcccgtt 19
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> TH-F primer
<400> 37
ctgagattcg ggccttcgac 20
<210> 38
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> TH-R primer
<400> 38
tgcacctagc caatggcact 20
<210> 39
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> HA1-F primer
<400> 39
agatcaacac ataccggagc c 21
<210> 40
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> HA1-R primer
<400> 40
agcgcacgaa ggaattgcag 20
<210> 41
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> HB4-F primer
<400> 41
agctggcagt ggcattggct a 21
<210> 42
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> HB4-R primer
<400> 42
tgctgctcta ggaaccgaac c 21
<210> 43
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> HC9-F primer
<400> 43
ttgctgtaca ttggctggga 20
<210> 44
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> HC9-R primer
<400> 44
acacagctgc agcgctatta 20
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> KROX20-F primer
<400> 45
accgcctcct cctccttatt 20
<210> 46
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> KROX20-R primer
<400> 46
gggtaggcca gagaggaaga 20

Claims (36)

  1. 인간 줄기세포로부터 3차원 세포집합체를 고속 배양하는 방법으로,
    인간으로부터 분리된 세포로부터 배아체(Embryoid body)를 형성하는 단계;
    상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
    상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
    상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 배양하는 것을 특징으로 하는, 3차원 세포집합체의 고속 대량 배양 방법.
  2. 제1항에 있어서, 상기 인간으로부터 분리된 세포는, 인간 배아 줄기 세포(human embryonic stem cell; hESC), 역분화 줄기 세포(induced pluripotent stem cell), 및 성체 줄기 세포 중 어느 하나인 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  3. 제1항에 있어서, 상기 3차원 세포집합체는, 20 내지 50일 내에 형성되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  4. 제1항에 있어서, 상기 3차원 세포집합체 형성 후, 추가적으로 진탕배양을 수행하는 경우 장기간 배양이 가능한 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  5. 제1항에 있어서, 상기 마이크로 웰 플레이트는, 오목부를 갖는 멀티 웰 플레이트인 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  6. 제1항에 있어서, 상기 인간으로부터 분리된 세포의 초기 시작 세포수는, 50개 내지 3,000개인 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  7. 제1항에 있어서, 상기 고속 대량 배양 방법은, 3차원 세포집합체 형성 전 과정에 걸쳐 바이오리액터를 이용하지 않는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  8. 제1항에 있어서, 상기 3차원 세포집합체는 중뇌 세포집합체인 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  9. 제1항에 있어서, 상기 3차원 세포집합체는 간, 심장 및 폐로 이루어진 군으로부터 선택되는 소화기계 장기인 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  10. 제1항에 있어서, 상기 3차원 세포집합체를 형성하는 단계는, 외배엽 형성 단계 또는 중뇌 조직 분화 단계를 포함하는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  11. 제10항에 있어서, 상기 외배엽 형성 단계는, CHIR99021, Dorsomorphin 및 A83-01(dual SMAD inhibitors)를 포함하는 배지에서 수행되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  12. 제10항에 있어서, 상기 중뇌 조직 분화 단계는, CHIR99021, Dorsmorphin, A83-01, IWP, SAG 및 FGF-8b를 포함하는 배지에서 수행되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  13. 제1항에 있어서, 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, SAG, FGF-8b, 인슐린(Insulin), 라미닌(Laminin)을 포함하고, 성장인자가 억제된 용해성 마트리젤을 추가적으로 포함하는 배지에서 수행되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  14. 제1항에 있어서, 상기 3차원 세포집합체를 형성하는 단계는, 조직 분화 유도 후 7일 이내에 중내배엽 마커의 활성화 없이 외배엽 형성 인자가 발현되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  15. 제1항에 있어서, 상기 3차원 세포집합체를 형성하는 단계는, 조직 분화 유도 후 14일 이내 전뇌 또는 후뇌 마커의 발현 없이 중뇌 마커가 발현되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  16. 제1항에 있어서, 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 수행 이후 중뇌 도파민성 세포의 마커가 발현되는 것인, 3차원 세포집합체의 고속 대량 배양 방법.
  17. 제1항의 3차원 세포집합체의 고속 대량 배양 방법에 의해 제조된, 3차원 세포집합체.
  18. 제17항의 3차원 세포집합체를 함유하는 오목 배양부; 및
    상기 오목 배양부를 커버하는 커버부를 포함하는, 3차원 세포집합체 배양 키트.
  19. 제18항에 있어서, 상기 3차원 세포집합체 배양 키트는, 보존액을 포함하는 것인, 3차원 세포집합체 배양 키트.
  20. 인간배아줄기세포, 인간 유도만능줄기세포, 및 성체줄기세포 중 어느 하나로부터 배양된 3차원 중뇌 세포집합체로,
    상기 3차원 중뇌 세포집합체는, 뉴로멜라닌을 형성하는 것인, 3차원 중뇌 세포집합체.
  21. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 중뇌 이외의 다른 뇌 조직을 포함하지 않는 것인, 3차원 중뇌 세포집합체.
  22. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 비정상 분화(out growth) 발생율이 5% 이하인 것인, 3차원 중뇌 세포집합체.
  23. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 심부세포사멸 현상 발생율이 상기 세포집합체 전체 면적의 40% 이하인 것인, 3차원 중뇌 세포집합체.
  24. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 직경이 0.9 내지 1.4 mm의 균일한 사이즈와 균질의 형태를 갖는 것인, 3차원 중뇌 세포집합체.
  25. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 중뇌 도파민 세포를 10% 이상 포함하는 것인, 3차원 중뇌 세포집합체.
  26. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 유전자 발현의 변이율이 10% 이하로 균질하게 형성되는 것인, 3차원 중뇌 세포집합체.
  27. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 억제성 신경 및 흥분성 신경을 포함하는 것인, 3차원 중뇌 세포집합체.
  28. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 세포 분화 후 15일부터 전기생리활성이 관찰 가능한 것인, 3차원 중뇌 세포집합체.
  29. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 흑질, 청색반점, 적핵, 중심회백질, 내측모대, 동안신경핵 및 활차신경핵으로 이루어진 군으로부터 선택되는 어느 하나를 포함하는 것인, 3차원 중뇌 세포집합체.
  30. 제20항에 있어서, 상기 3차원 중뇌 세포집합체는, 신경아교세포 및 희소돌기신경교세포를 포함하는 것인, 3차원 중뇌 세포집합체.
  31. 인간 줄기세포로부터 3차원 세포집합체의 고속 배양 방법으로,
    인간으로부터 분리된 세포로부터 배아체(Embryoid body)를 형성하는 단계;
    상기 배아체로부터 특정 조직으로 분화를 유도하여 3차원 세포집합체를 형성하는 단계; 및
    상기 3차원 세포집합체의 성숙화를 유도하는 단계를 포함하고,
    상기 배아체를 형성하는 단계부터 상기 3차원 세포집합체의 성숙화를 유도하는 단계는, 동일한 마이크로 웰 플레이트에서 연속적으로 비진탕 배양하며,
    상기 고속 배양 방법은, 피펫팅 로봇, 자동화된 핸들링, 플레이트 운송 수단을 포함하는 자동화 방식으로 수행되는 것을 특징으로 하는 것인, 3차원 세포집합체의 고속 배양 방법.
  32. 도파민성 신경세포 관련 질환 약물의 스크리닝 방법에 있어서,
    도파민성 신경세포 관련 질환 환자-유래 유도만능줄기세포로부터 3차원 세포집합체를 생성하는 단계;
    상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
    상기 3차원 세포집합체로부터 도파민성 신경세포의 생존율을 판별하는 단계를 포함하는, 도파민성 신경세포 관련 질환 약물의 스크리닝 방법.
  33. 제32항에 있어서, 상기 도파민성 신경세포 관련 질환은, 파킨슨병, 알츠하이머, 뇌졸중, 중풍, 헌팅턴병, 피크병, 크로이츠펠트-야콥병, 자폐증 및 뇌 발달장애 증후군 중 어느 하나인 것인, 도파민성 신경세포 관련 질환 약물의 스크리닝 방법.
  34. 도파민성 신경세포 관련 질환 환자 유래 세포로부터 제1항의 3차원 세포집합체를 배양하는 단계;
    상기 3차원 세포집합체에 후보물질을 접촉시키는 단계; 및
    상기 3차원 세포집합체로부터 도파민성 신경세포 생존율을 판별하는 단계를 포함하고,
    상기 도파민성 신경세포 생존율에 기초하여 환자에게 적합한 치료제의 정보를 제공하는 단계를 포함하는, 도파민성 신경세포 관련 질환 치료를 위한 정보제공방법.
  35. 약물 테스트용 3차원 세포집합체의 판별 방법으로,
    (i) 3차원 세포집합체에 후보물질을 접촉시키는 단계:
    상기 후보물질의 접촉은, 제1항의 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 수행되고, 및
    (ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하는 단계를 포함하는, 약물 테스트용 3차원 세포집합체의 판별 방법.
  36. 3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법으로,
    (i) 제1항의 3차원 세포집합체의 고속 대량 배양 방법에 포함되는 어느 하나 이상의 단계에서 3차원 세포집합체에 후보물질을 접촉시키고,
    (ii) 상기 각 단계에서의 3차원 세포집합체에 대하여 후보물질의 존재 및 부존재에 따른 반응을 비교하고,
    (iii) 상기 3차원 세포집합체 내에 존재하는 세포의 사멸 여부를 판별하는 단계를 포함하는,
    3차원 세포집합체를 이용한 약물의 체외 독성 스크리닝 방법.
PCT/KR2021/006590 2020-06-29 2021-05-27 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법 WO2022005023A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202180046126.0A CN115885037A (zh) 2020-06-29 2021-05-27 中脑类器官及其高速大规模制造方法、利用它筛选神经毒性物质和筛选多巴胺能神经元相关疾病药物的方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200079093 2020-06-29
KR10-2020-0079093 2020-06-29
KR1020210010149A KR102346243B1 (ko) 2020-06-29 2021-01-25 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법
KR10-2021-0010149 2021-01-25

Publications (1)

Publication Number Publication Date
WO2022005023A1 true WO2022005023A1 (ko) 2022-01-06

Family

ID=79316420

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006590 WO2022005023A1 (ko) 2020-06-29 2021-05-27 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법

Country Status (3)

Country Link
KR (1) KR20220001503A (ko)
CN (1) CN115885037A (ko)
WO (1) WO2022005023A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024020587A2 (en) 2022-07-22 2024-01-25 Tome Biosciences, Inc. Pleiopluripotent stem cell programmable gene insertion

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120121910A (ko) * 2010-02-03 2012-11-06 우니베르지태트 라이치히 세포 변화, 특히 세포-스페로이드의 발생 및 특징화를 무라벨 검출 및 분류하기 위한 일체형 배양 및 측정 장치, 그의 부품 및 용도
WO2017160234A1 (en) * 2016-03-14 2017-09-21 Agency For Science, Technology And Research Generation of midbrain-specific organoids from human pluripotent stem cells
US20170313976A1 (en) * 2014-10-24 2017-11-02 Sumitomo Dainippon Pharma Co., Ltd. Production method for nerve tissue
JP2018531011A (ja) * 2015-10-08 2018-10-25 ウニベルジテ・デュ・ルクセンブルクＵｎｉｖｅｒｓｉｔｅ Ｄｕ Ｌｕｘｅｍｂｏｕｒｇ 中脳オルガノイドを作製するための手段及び方法
WO2019066059A1 (ja) * 2017-09-29 2019-04-04 国立大学法人東京医科歯科大学 臓器オルガノイド及びその製造方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120121910A (ko) * 2010-02-03 2012-11-06 우니베르지태트 라이치히 세포 변화, 특히 세포-스페로이드의 발생 및 특징화를 무라벨 검출 및 분류하기 위한 일체형 배양 및 측정 장치, 그의 부품 및 용도
US20170313976A1 (en) * 2014-10-24 2017-11-02 Sumitomo Dainippon Pharma Co., Ltd. Production method for nerve tissue
JP2018531011A (ja) * 2015-10-08 2018-10-25 ウニベルジテ・デュ・ルクセンブルクＵｎｉｖｅｒｓｉｔｅ Ｄｕ Ｌｕｘｅｍｂｏｕｒｇ 中脳オルガノイドを作製するための手段及び方法
WO2017160234A1 (en) * 2016-03-14 2017-09-21 Agency For Science, Technology And Research Generation of midbrain-specific organoids from human pluripotent stem cells
WO2019066059A1 (ja) * 2017-09-29 2019-04-04 国立大学法人東京医科歯科大学 臓器オルガノイド及びその製造方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KWAK TAE HWAN, KANG JI HYUN, HALI SAI, KIM JONGHUN, KIM KEE-PYO, PARK CHANHYEOK, LEE JU-HYUN, RYU HA KYUN, NA JI EUN, JO JUNGHYUN,: "Generation of homogeneous midbrain organoids with in vivo - like cellular composition facilitates neurotoxin-based Parkinson's disease modeling", STEM CELLS, vol. 38, no. 6, 1 June 2020 (2020-06-01), pages 727 - 740, XP055883561, ISSN: 1066-5099, DOI: 10.1002/stem.3163 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024020587A2 (en) 2022-07-22 2024-01-25 Tome Biosciences, Inc. Pleiopluripotent stem cell programmable gene insertion

Also Published As

Publication number Publication date
CN115885037A (zh) 2023-03-31
KR20220001503A (ko) 2022-01-05

Similar Documents

Publication Publication Date Title
WO2017179767A1 (ko) 지방줄기세포에서 신경줄기세포, 신경세포 및 가바성 신경세포로의 분화 유도 방법, 및 인간 골수 유래 중간엽 줄기세포로부터 성장인자를 다량 분비하는 인간 줄기세포의 분화 유도 방법
WO2018190656A1 (ko) In vitro에서 성숙된 인간 장관 오가노이드의 제조 방법 및 이의 용도
WO2011043592A2 (en) Compositions for inducing differentiation into retinal cells from retinal progenitor cells or inducing proliferation of retinal cells comprising wnt signaling pathway activators
WO2011043591A2 (en) Method for differentiation into retinal cells from stem cells
WO2016032263A1 (en) Method for differentiation into retinal ganglion cells from stem cells
WO2022005023A1 (ko) 중뇌 오가노이드, 이의 고속 및 대량 제조 방법, 이를 이용한 신경독성물질 스크리닝 방법 및 도파민성 신경세포 관련 질환 치료제 스크리닝 방법
WO2018001258A1 (zh) 一种用于核酸富集捕获的探针及设计方法
WO2014163425A1 (ko) Hmga2를 이용하여 비신경 세포로부터 리프로그래밍된 유도 신경줄기세포를 제조하는 방법
WO2018135902A1 (ko) 줄기 세포로부터 분화 유도된 연골세포의 제조방법
WO2011158998A1 (ko) 비타민 ｋ2 생성능이 높은 바실러스 아미로리퀴파시엔스 균주
WO2018135907A1 (ko) 슈반 세포 전구체 및 이로부터 분화된 슈반 세포의 제조 방법
WO2015199387A2 (ko) 가용성 단백질 발현량 및 활성이 증대된 헬리코박터 파일로리 유래 α-1,3 푸코실 전달효소의 유전자와 단백질 및 α-1,3 푸코실올리고당 생산에의 응용
WO2021045374A1 (ko) 증식 가능한 간 오가노이드 분화용 배지 조성물 및 이를 이용한 간 오가노이드의 제조방법
CN1330666C (zh) 低氧－诱导因子1αHIF－1α变体和鉴定HIF－1α调节剂的方法
WO2021054806A1 (ko) 직접 리프로그래밍을 통한 유도 도파민성 신경세포 전구체의 제조방법
WO2013137567A1 (ko) Ｓｅｌｅｎｉｕｍ을 이용한 인간 만능줄기세포의 혈액전구세포, 혈관전구세포, 내피세포 및 평활근세포로의 분화방법
WO2016178511A1 (ko) Kai1 폴리펩타이드 또는 이를 코딩하는 유전자를 포함하는 혈관신생 억제용 조성물 및 이의 용도
WO2011120398A1 (zh) 白血病融合基因的联合检测方法及其诊断试剂盒
WO2017010790A1 (ko) 나노입자-유리체 기반 단백질 복합체를 유효성분으로 포함하는 혈관신생억제용 조성물 및 이의 용도
WO2023191206A1 (ko) 변수 속성에 기반한 탐색적 데이터 분석 자동화 시스템과 방법
WO2016122058A1 (ko) 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법
WO2022098052A1 (en) Human intestinal epithelium model and method for preparing same
WO2022045824A1 (en) Phenyl alkyl carbamate compounds for use in preventing or treating neurodegenerative disease
WO2023128659A1 (ko) 운동성 신경세포 직접교차 분화용 인자
WO2023140697A1 (ko) Cas 단백질 또는 이의 변이체의 스크리닝 방법, 및 이를 이용하여 제조된 Cas 단백질 또는 이의 변이체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21833801

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21833801

Country of ref document: EP

Kind code of ref document: A1