WO2013163602A1 - Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus - Google Patents

Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus Download PDF

Info

Publication number
WO2013163602A1
WO2013163602A1 PCT/US2013/038497 US2013038497W WO2013163602A1 WO 2013163602 A1 WO2013163602 A1 WO 2013163602A1 US 2013038497 W US2013038497 W US 2013038497W WO 2013163602 A1 WO2013163602 A1 WO 2013163602A1
Authority
WO
WIPO (PCT)
Prior art keywords
eev
library
immunoglobulin
antigen
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2013/038497
Other languages
English (en)
French (fr)
Inventor
Ernest S. Smith
Tracy PANDINA
Leslie A. Croy
Mark Paris
Maurice Zauderer
Angelika MOKSA
Renee KIRK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vaccinex Inc
Original Assignee
Vaccinex Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2871597A priority Critical patent/CA2871597C/en
Priority to EP13780660.0A priority patent/EP2841606B1/en
Priority to NZ630854A priority patent/NZ630854A/en
Priority to JP2015509201A priority patent/JP6498599B2/ja
Priority to PL13780660T priority patent/PL2841606T3/pl
Priority to CN201380033060.7A priority patent/CN104520444B/zh
Priority to KR1020147033046A priority patent/KR102108589B1/ko
Priority to DK13780660.0T priority patent/DK2841606T3/da
Priority to EA201491965A priority patent/EA028164B1/ru
Priority to ES13780660T priority patent/ES2725673T3/es
Application filed by Vaccinex Inc filed Critical Vaccinex Inc
Priority to SG11201406974YA priority patent/SG11201406974YA/en
Priority to AU2013251371A priority patent/AU2013251371B2/en
Publication of WO2013163602A1 publication Critical patent/WO2013163602A1/en
Priority to IL235323A priority patent/IL235323B/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1037Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/005Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/522CH1 domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00Methods of screening libraries
    • C40B30/04Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a high efficiency method of expressing immunoglobulin molecules on vaccinia virus particles, e.g., EEV virions, and/or on host cells, a method of producing immunoglobulin heavy and light chain libraries for expression in vaccinia virus particles, e.g., EEV virions, and/or eukaryotic cells, methods of isolating immunoglobulins which bind specific antigens, and immunoglobulins produced by any of these methods.
  • the invention also relates to fusion proteins used for expressing immunoglobulin molecules on vaccinia virus particles, e.g., EEV virions, or on host cells.
  • Antibodies of defined specificity are being employed in an increasing number of diverse therapeutic applications.
  • a number of methods have been used to obtain useful antibodies for human therapeutic use. These include chimeric and humanized antibodies, and fully human antibodies selected from libraries, e.g., phage display libraries, or from transgenic animals.
  • Immunoglobulin libraries constructed in bacteriophage can derive from antibody producing cells of naive or specifically immunized individuals and could, in principle, include new and diverse pairings of human immunoglobulin heavy and light chains. Although this strategy does not suffer from an intrinsic repertoire limitation, it requires that complementarity determining regions (CDRs) of the expressed immunoglobulin fragment be synthesized and fold properly in bacterial cells.
  • CDRs complementarity determining regions
  • Fully human antibodies can be isolated from libraries in eukaryotic systems, e.g., yeast display, retroviral display, or expression in DNA viruses such as poxviruses. See, e.g., U.S. Patent No. 7,858,559, which is incorporated herein by reference in its entirety.
  • the present invention enables efficient expression of a library of fully human antibodies on the surface of vaccinia virus, an enveloped mammalian virus. Similar to phage display, conditions are utilized wherein each vaccinia virion expresses a single immunoglobulin, e.g., an antibody or scFV, on its surface.
  • a single immunoglobulin e.g., an antibody or scFV
  • the disclosure is directed to fusion protein comprising (a) a first polypeptide segment comprising a heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • fusion protein comprising (a) a first polypeptide segment comprising a heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • EEV extracellular enveloped virus
  • the fusion protein further comprising a third polypeptide segment comprising an immunoglobulin heavy chain variable region or fragment thereof.
  • the vaccinia EEV-specific membrane protein is A56R.
  • the disclosure is directed to a polynucleotide encoding a fusion protein comprising (a) a first polypeptide segment comprising the human heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • the polynucleotide comprises nucleotides of SEQ ID NO: 10 which encodes amino acids 108 to 314 of A56R from Western Reserve Vaccinia virus strain.
  • the polynucleotide encodes amino acids 215 to 421 of SEQ ID NO: 11.
  • the polynucleotide comprises the nucleotides of SEQ ID NO: 10 which encode amino acids 215 to 421 of SEQ ID NO: l l .
  • the disclosure is directed to a vector comprising a polynucleotide encoding a fusion protein comprising (a) a first polypeptide segment comprising the human heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • a fusion protein comprising (a) a first polypeptide segment comprising the human heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • EEV extracellular enveloped virus
  • the disclosure is directed to a recombinant vaccinia virus comprising a polynucleotide encoding a fusion protein comprising (a) a first polypeptide segment comprising the human heavy chain CHI domain and (b) a second polypeptide segment comprising the transmembrane domain of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • EEV extracellular enveloped virus
  • the disclosure is directed to a host cell infected with the recombinant vaccinia virus.
  • the disclosure is directed to recombinant vaccinia library comprising a first library of polynucleotides constructed in a vaccinia virus vector encoding a plurality of immunoglobulin fusion polypeptides, wherein the vaccinia virus vector comprises (a) a first polynucleotide encoding a first polypeptide segment comprising a heavy chain CHI domain (b) a second polynucleotide encoding a second polypeptide segment comprising the transmembrane domain of a vaccinia virus EEV-specific membrane protein situated downstream of the CHI domain, and (c) a third polynucleotide encoding an immunoglobulin heavy chain variable region or fragment thereof situated upstream of the CHI domain.
  • the first library further comprising a signal peptide for facilitating expression of the fusion polypeptides on the surface of EEV.
  • the EEV-specific membrane protein is A56R.
  • the vaccinia EEV-specific membrane protein is A56R.
  • the second polypeptide segment further comprises the extracellular domain of the EEV-specific membrane protein, or a portion thereof.
  • the second polypeptide segment further comprises the intracellular domain of the EEV-specific membrane protein, or a portion thereof.
  • the fusion protein comprises amino acids of SEQ ID NO: 11 which correspond to the polypeptide sequence amino acids 108 to 314 of A56R from Western Reserve Vaccinia virus strain.
  • the fusion protein comprises amino acids 215 to 421 of SEQ ID NO: 11. In certain embodiments, the fusion protein comprises amino acids 215 to 421 of SEQ ID NO: 1 1 , which is the polypeptide sequence amino acids 108 to 314 of A56R from Western Reserve Vaccinia virus strain.
  • the disclosure is directed to methods for selecting polynucleotides which encode an antigen-specific immunoglobulin heavy chain variable region or antigen-binding fragment thereof, comprising: (a) introducing the first library of any one of claims 13 to 18 encoding immunoglobulin fusion proteins into a population of host cells permissive for vaccinia virus infectivity; (b) introducing one or more polynucleotides encoding an immunoglobulin light chain into the population of host cells, wherein an immunoglobulin fusion protein is capable of combining with an immunoglobulin light chain to form an antigen-binding domain of an immunoglobulin molecule; (c) permitting release of extracellular enveloped virus (EEV) from the host cells; (d) collecting the released EEV from the supernatant; (e) contacting the released EEV with an antigen; and (f) recovering the polynucleotides of the first library which encode the immunoglobulin fusion polypeptides expressed on the membrane surface of E
  • EEV extracellular envelope
  • to methods for selecting polynucleotides which encode an antigen-specific immunoglobulin heavy chain variable region or antigen-binding fragment thereof further comprises: (g) introducing the polynucleotides recovered in (f) into a second population of host cells permissive for vaccinia virus infectivity; (h) introducing one or more polynucleotides encoding an immunoglobulin light chain into the population of host cells; (i) permitting release of extracellular enveloped virus (EEV) from the host cells; (j) collecting the released EEV from the supernatant; (k) contacting the released EEV with an antigen; and (1) recovering the polynucleotides of the first library which encode the immunoglobulin fusion polypeptides expressed on the membrane surface of EEV and specific for the antigen.
  • EEV extracellular enveloped virus
  • steps (g)-(l) are repeated one or more times, thereby enriching for polynucleotides of the first library which encode immunoglobulin heavy chain variable regions or antigen-specific fragments thereof, as part of an immunoglobulin fusion polypeptide that specifically binds the antigen.
  • the polynucleotides recovered from the first library are isolated.
  • the disclosure is directed to a method for selecting polynucleotides which encode an antigen-specific immunoglobulin molecule or antigen-specific fragment thereof, comprising: (a) introducing the first library into a population of host cells permissive for vaccinia virus infectivity; (b) introducing a second library into the population of host cells, where in the second library comprises a plurality of polynucleotides encoding an immunoglobulin light chain, [0019] Wherein the immunoglobulin fusion polypeptide is capable of combining with the immunoglobulin light chain to form an immunoglobulin molecule or antigen-specific fragment thereof; (c) permitting expression of the immunoglobulin fusion polypeptide from the host cells; (d) collecting the immunoglobulin fusion polypeptide from the host cells; (e) contacting the collected immunoglobulin fusion polypeptide with an antigen; and (f) recovering the polynucleotides of the first library which encode the immunoglobulin fusion
  • the method for selecting polynucleotides which encode an antigen-specific immunoglobulin molecule or antigen-specific fragment thereof further comprises: (g) introducing the polynucleotides recovered in (f) into a second population of host cells permissive for vaccinia virus infectivity; (h) introducing into the second population of host cells the second library of polynucleotides; (i) permitting expression of the immunoglobulin fusion polypeptide from the host cells; (j) collecting the immunoglobulin fusion polypeptide from the host cells; (k) contacting the collected immunoglobulin fusion polypeptide with an antigen; and (1) recovering the polynucleotides of the first library which encode the immunoglobulin fusion polypeptides that are specific for the antigen.
  • steps steps (g)-(I) are repeated one or more times, thereby enriching for polynucleotides of the first library which encode immunoglobulin heavy chain variable regions or antigen-specific fragments thereof, as part of an immunoglobulin fusion polypeptide that specifically binds the antigen.
  • the a method for selecting polynucleotides which encode an antigen-specific immunoglobulin molecule or antigen-specific fragment thereof further comprises isolating the third polynucleotides recovered from the first library.
  • FIG. 1 Shows the pJEMl plasmid elements and their respective sequences (SEQ ID NO: 1;
  • FIG. 2. Shows an illustration of the general strategy for library selection using recombinant vaccinia virus.
  • FIG. 3A-C. Show Fluorescence Activated Cell Sorting (FACS) analysis data for
  • FIG. 4A-B Show ELISA binding results for EEV containing the C35 specific fusion protein (labeled "A56R EEV”), a control ("L517+G7000-A56R EEV”), and C35 specific antibody in standard membrane bound IgGl format (“mbg EEV”) with C35/Anti-Vac HRP (A) and C35/Anti-Fab (B).
  • FIG. 5A-D Show plaque assay plate results for C35 binding after 2 hours (A) and overnight (B), and VEGF binding after 2 hours (C) and overnight (D).
  • FIG. 6. Shows an illustration of the CD 100 antibody selection strategy.
  • FIG. 7 Shows an alignment of the VH sequence of CD 100 clone C20 (SEQ ID NO:
  • FIG. 8 Shows flow cytometry C35 and Her2 staining results for Her2.3.2 and
  • FIG. 9. Shows an illustration of the Her2 antibody selection strategy.
  • FIG. 10 Shows flow cytometry results for C35 + anti-His and Her2 + anti-His for for Her2.3.2 and Her2.3.3 selection.
  • FIG. 1 Shows an alignment of the VH sequence of Her2 clone B10 (SEQ ID NO: 1
  • FIG.12. Shows a diagram of "Fab”, “TR”, and "IgG-gamma heavy chain” constructs.
  • FIG. 13 Shows Fluorescence Activated Cell Sorting (FACS) analysis data for C35 staining and Her2 staining of HeLa cells infected with EEV recombinant vaccinia virus expressing 8000-Fab L8000.
  • FIG. 14 Shows Fluorescence Activated Cell Sorting (FACS) analysis data for
  • FIG. 15 Shows Fluorescence Activated Cell Sorting (FACS) analysis data for
  • FIG. 16 Shows controls for CD! 00 Lib 10.3 FLOW analysis. Fluorescence
  • FACS Activated Cell Sorting
  • FIG. 17 Shows results for Tosyl selected CD 100 Lib 10.3 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 18 Shows results for Tosyl selected GDI 00 Lib 10.3 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 19 Shows results for Tosyl selected CD 100 Lib 10.3 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 20 Shows results for ProG selected CD100 Lib 10.3 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 21 Shows results for ProG selected CD100 Lib 10.3 FLOW analysis.
  • FIG. 22 Shows results for ProG selected CD 100 Lib 10.3 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 23 Shows controls for CD100 Lib 10.3/L3-1 FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 24 Shows results for CD 100 Lib 10.3Tosyl/L3-l FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 25 Shows results for CD100 Lib 10.3ProtG/L3-l FLOW analysis.
  • FACS Fluorescence Activated Cell Sorting
  • FIG. 26 Shows flow cytometry results showing specificity to CD 100 on Jurkat cells (CD100+) and BxPC3 cells for mAbs 2050, 2063, and 2110.
  • FIG. 27 Shows ELISA results on (A) huCDl 00-His coated and (B) Hemoglobin coated plates with three CD 100 specific antibodies (Mab2050, MabC2063, and MabC21 10) compared to positive and negative controls.
  • FIG. 28 Shows a schematic for identification of specific Ig-H/Ig-L following vaccinia display methods.
  • FIG. 29 Fluorescence Activated Cell Sorting (FACS) analysis data for C35 and
  • FIG. 30 Shows ELISA results for three Her2 specific antibodies (Mab8287,
  • FIG. 31 Shows flow cytometry results showing specificity to Her2 on SKBR3 cells
  • the present invention is broadly directed to methods of identifying and/or producing functional, antigen-specific immunoglobulin molecules, or antigen-specific fragments (i.e., antigen-binding fragments) thereof, in a eukaryotic system displayed on the surface of extracellular enveloped vaccinia virus (EEV), as a fusion with a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein.
  • EEV extracellular enveloped vaccinia virus
  • the invention is directed to methods of identifying polynucleotides which encode an antigen-specific immunoglobulin molecule, or an antigen-specific fragment thereof, from complex expression libraries of polynucleotides encoding such immunoglobulin molecules or fragments, where the libraries are constructed and screened in a eukaryotic system displayed on the surface of extracellular enveloped vaccinia virus (EEV), as a fusion with a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein.
  • EEV extracellular enveloped vaccinia virus
  • fusion protein comprising (a) a first polypeptide segment comprising the human heavy chain CHI domain (b) a second polypeptide segment comprising the extracellular and transmembrane domains of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein.
  • a fusion protein as disclosed herein can include a binding molecule, e.g., an antigen-specific portion of an immunoglobulin or portion thereof, e.g., a heavy chain variable region, which, when paired with a suitable immunoglobulin light chain, binds to an antigen of interest.
  • One aspect of the present invention is the construction of complex immunoglobulin libraries in a eukaryotic system displayed on the surface of extracellular enveloped vaccinia virus (EEV), as a fusion with a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein.
  • EEV extracellular enveloped vaccinia virus
  • a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein.
  • eukaryote or "eukaryotic organism” is intended to encompass all organisms in the animal, plant, and protist kingdoms, including protozoa, fungi, yeasts, green algae, single celled plants, multi celled plants, and all animals, both vertebrates and invertebrates. The term does not encompass bacteria or viruses.
  • a "eukaryotic cell” is intended to encompass a singular “eukaryotic cell” as well as plural “eukaryotic cells,” and comprises cells derived from a eukaryote.
  • verbrate is intended to encompass a singular “vertebrate” as well as plural “vertebrates,” and comprises mammals and birds, as well as fish, reptiles, and amphibians.
  • mammal includes, but is not limited to humans; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras, food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and bears.
  • the mammal is a human subject.
  • tissue culture or “cell culture” or “culture” or “culturing” refer to the maintenance or growth of plant or animal tissue or cells in vitro under conditions that allow preservation of cell architecture, preservation of cell function, further differentiation, or all three.
  • Primary tissue cells are those taken directly from tissue, i.e. , a population of cells of the same kind performing the same function in an organism. Treating such tissue cells with the proteolytic enzyme trypsin, for example, dissociates them into individual primary tissue cells that grow or maintain cell architecture when seeded onto culture plates.
  • polynucleotide refers to any one or more nucleic acid segments, or nucleic acid molecules, e.g., DNA or RNA fragments, present in a nucleic acid or construct.
  • a "polynucleotide encoding an immunoglobulin subunit polypeptide” refers to a polynucleotide which comprises the coding region for such a polypeptide.
  • a polynucleotide can encode a regulatory element such as a promoter or a transcription terminator, or can encode a specific element of a polypeptide or protein, such as a secretory signal peptide or a functional domain.
  • the term "identify” refers to methods in which desired molecules, e.g., polynucleotides encoding immunoglobulin molecules with a desired specificity or function, are differentiated from a plurality or library of such molecules. Identification methods include “selection” and “screening.” As used herein, “selection” methods are those in which the desired molecules can be directly separated from the library. For example, in one selection method described herein, host cells comprising the desired polynucleotides are directly separated from the host cells comprising the remainder of the library by undergoing a lytic event and thereby being released from the substrate to which the remainder of the host cells are attached.
  • screening methods are those in which pools comprising the desired molecules are subjected to an assay in which the desired molecule can be detected. Aliquots of the pools in which the molecule is detected are then divided into successively smaller pools which are likewise assayed, until a pool which is highly enriched from the desired molecule is achieved.
  • Immunoglobulins As used herein, an "immunoglobulin molecule" is defined as a complete, bi-molecular immunoglobulin, i.e. , generally comprising four "subunit polypeptides," i.e., two identical heavy chains and two identical light chains. In some instances, e.g., immunoglobulin molecules derived from camelid species or engineered based on camelid immunglobulins, a complete immunoglobulin molecule can consist of heavy chains only, with no light chains. See, e.g., Hamers-Casterman et al., Nature 3(55:446-448 (1993).
  • immunoglobulin subunit polypeptide a single heavy chain polypeptide or a single light chain polypeptide.
  • Immunoglobulin molecules are also referred to as “antibodies,” and the terms are used interchangeably herein.
  • An “isolated immunoglobulin” refers to an immunoglobulin molecule, or two or more immunoglobulin molecules, which are substantially removed from the milieu of proteins and other substances, and which bind a specific antigen.
  • the heavy chain which determines the "class” of the immunoglobulin molecule, is the larger of the two subunit polypeptides, and comprises a variable region and a constant region.
  • “heavy chain” is meant either a full-length secreted heavy chain form, i. e. , one that is released from the cell, or a membrane bound heavy chain form, i. e. , comprising a membrane spanning domain, e.g., fusions with a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein.
  • Immunoglobulin "classes” refer to the broad groups of immunoglobulins which serve different functions in the host.
  • human immunoglobulins are divided into five classes, i.e., IgG, comprising a ⁇ heavy chain, IgM, comprising a ⁇ heavy chain, IgA, comprising an a heavy chain, IgE, comprising an ⁇ heavy chain, and IgD, comprising a ⁇ heavy chain.
  • IgG comprising a ⁇ heavy chain
  • IgM comprising a ⁇ heavy chain
  • IgA comprising an a heavy chain
  • IgE comprising an ⁇ heavy chain
  • IgD comprising a ⁇ heavy chain.
  • light chain is meant the smaller immunoglobulin subunit which associates with the amino terminal region of a heavy chain.
  • a light chain comprises a variable region and a constant region.
  • Immunoglobulin subunit polypeptides typically comprise a constant region and a variable region.
  • the heavy chain variable region, or VH domain, and the light chain variable region, or VL domain combine to form a "complementarity determining region" or CDR, the portion of an immunoglobulin molecule which specifically recognizes an antigenic epitope.
  • CDR complementarity determining region
  • an "antigen-specific fragment" of an immunoglobulin molecule is any fragment or variant of an immunoglobulin molecule which remains capable of binding an antigen.
  • Antigen-specific fragments include, but are not limited to, Fab, Fab' and F(ab') 2 , Fd, single-chain Fvs (scFv), single-chain immunoglobulins (e.g., wherein a heavy chain, or portion thereof, and light chain, or portion thereof, are fused), disulfide-linked Fvs (sdFv), diabodies, triabodies, tetrabodies, scFv minibodies, Fab minibodies, and dimeric scFv and any other fragments comprising a VL and a VH domain in a conformation such that a specific CDR is formed.
  • Antigen-specific immunoglobulin fragments can comprise the variable region(s) alone or in combination with the entire or partial constant region, e.g. , a CHI , CH2, CH3 domain on the heavy chain, and a light chain constant domain, e.g. , a C K or C ⁇ domain, or portion thereof on the light chain.
  • a fusion protein as disclosed herein comprises a heavy chain variable domain fused to a CHI constant domain fused to a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, e.g., A56R.
  • the present invention is drawn to methods to identify, i.e. , select or alternatively screen for, polynucleotides which singly or collectively encode antigen-specific immunoglobulin molecules or antigen-specific fragments thereof.
  • a method of selecting an immunoglobulin molecule with an antigen specificity of interest is provided, where the immunoglobulin or antibody is displayed on the surface of an EEV, the EEV is isolated, and the polynucleotide encoding a portion of the immunoglobulin, e.g., the VH region, is isolated.
  • a method for selecting polynucleotides which encode an antigen-specific immunoglobulin molecule comprises: (1 ) introducing a first library of polynucleotides into a population of host cells permissive for vaccinia virus infectivity.
  • the library can be constructed in a vaccinia virus vector, e.g., an EEV vector, encoding a plurality of immunoglobulin fusion polypeptides, where the vaccinia virus vector comprises (a) a first polynucleotide encoding a first polypeptide segment comprising the human heavy chain CHI domain, e.g., a CHI-gamma domain, (b) a second polynucleotide encoding a second polypeptide segment comprising the extracellular and transmembrane domains of a vaccinia membrane protein, e.g., a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, e.g., A56R, and (c) a third polynucleotide encoding an immunoglobulin heavy chain variable region or fragment thereof.
  • a vaccinia virus vector e.g., an EEV vector
  • the vaccinia virus vector comprises (a) a
  • the method further comprises (2) introducing into the population of host cells a polynucleotide encoding a light chain, e.g., a known light chain or a second library comprising a plurality of polynucleotides each encoding an immunoglobulin light chain.
  • a polynucleotide encoding a light chain e.g., a known light chain or a second library comprising a plurality of polynucleotides each encoding an immunoglobulin light chain.
  • the immunoglobulin fusion polypeptide can combine with the immunoglobulin light chain to form an antigen-binding portion of an immunoglobulin molecule, where the molecule can be expressed or "displayed" on the surface of a selectable particle, e.g., an EEV virion produced and released by the host cells into the surrounding medium.
  • the method further provides selecting EEV released from the host cells that bind to an antigen of interest, e.g., by antigen- specific attachment to a plate or to beads, e.g., protein G beads, streptavidin beads, or tosylated beads.
  • EEV expressing the antigen-binding domain of interest can then be recovered, and used to reinfect new host cells, thereby enriching for EEV containing polynucleotides which encode the heavy chain of immunoglobulin binding to the antigen of interest.
  • the polynucleotides can then be recovered.
  • the method can be repeated thereby enriching for polynucleotides encoding heavy chain fusion proteins of interest.
  • Isolated polynucleotides encoding the immunoglobulin heavy chain polypeptide fusion proteins binding to an antigen of interest can then be transferred into and expressed in host cells (either as an EEV fusion protein or not) in which a library of polynucleotides encoding immunoglobulin light chain variable regions fused to a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, thereby allowing identification of a polynucleotide encoding a light chain variable region which, when combined with the heavy chain variable region identified in the first step, forms a functional immunoglobulin molecule, or fragment thereof, which recognizes a specific antigen.
  • a "library” is a representative genus of polynucleotides, . e. , a group of polynucleotides related through, for example, their origin from a single animal species, tissue type, organ, or cell type, where the library collectively comprises at least two different species within a given genus of polynucleotides.
  • a library of polynucleotides can comprise at least 10, 100, 10 3 , 1() 4 , 10 5 , 10 6 , 10 7 , 10 8 , or 10 9 different species within a given genus of polynucleotides.
  • the genus can be relaxed molecules, e.g., immunoglobulin variable regions, e.g., human immunoglobulin VH domains or VL domains.
  • the VH and VL domains can represent an entire repertoire of variable domains, or can already be antigen-specific, e.g., specific for the same antigen.
  • a library can encode a plurality of a immunoglobulin subunit polypeptides, i.e., either heavy chain subunit polypeptides or light chain subunit polypeptides.
  • a "library” can comprise polynucleotides of a common genus, the genus being polynucleotides encoding an immunoglobulin subunit polypeptide of a certain type and class e.g., a library might encode a human ⁇ , ⁇ -1, ⁇ -2, ⁇ -3, ⁇ -4, ⁇ -1, ⁇ -2, ⁇ , or ⁇ heavy chain, or a human ⁇ or ⁇ light chain.
  • each member of any one library can encode the same heavy or light chain constant region
  • the library can collectively comprise at least two, or at least 10, 100, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , or 10 9 different variable regions i.e., a "plurality" of variable regions associated with the common constant region.
  • the library can encode a plurality of immunoglobulin single-chain fragments which comprise a variable region, such as a light chain variable region or a heavy chain variable region, or can comprise both a light chain variable region and a heavy chain variable region.
  • a variable region such as a light chain variable region or a heavy chain variable region
  • kits to produce libraries of polynucleotides encoding immunoglobulin subunit polypeptides.
  • libraries of immunoglobulin subunit polypeptides constructed as fusion proteins in eukaryotic expression vectors, e.g., EEV, where the immunoglobulin subunit polypeptide is fused to a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, e.g., A56R.
  • a recipient cell or "host cell” or “cell” is meant a cell or population of cells into which polynucleotide libraries as described herein are introduced.
  • Suitable host cells for libraries described herein are eukaryotic cells permissive for vaccinia virus infection.
  • Suitable cell lines can be vertebrate, mammalian, rodent, mouse, primate, or human cell or cell lines.
  • a population of host cells is meant a group of cultured cells into which a
  • Host cells for EEV libraries as described herein can be permissive for vaccinia virus infection.
  • Host cells of the present invention can be adherent, . e. , host cells which grow attached to a solid substrate, or, alternatively, the host cells can be in suspension.
  • certain methods to identify immunoglobulin molecules comprise the introduction of a "first" library of polynucleotides (encoding, e.g., a VH-CH1-A56R fusion protein) into a population of host cells, as well as a "second" library of polynucleotides (e.g., encoding a VL region) into the same population of host cells.
  • the first and second libraries are complementary, i.e.
  • the "second” library will encode immunoglobulin light chain variable domains, thereby allowing assembly of immunoglobulin molecules, or antigen-specific fragments thereof, in the population of host cells, such that the immunoglobulins are expressed, or displayed, on the surface of EEV.
  • Polynucleotides contained in libraries described herein can encode immunoglobulin subunit polypeptides through "operable association with a transcriptional control region.”
  • One or more nucleic acid molecules in a given polynucleotide are "operably associated” when they are placed into a functional relationship. This relationship can be between a coding region for a polypeptide and a regulatory sequence(s) which are connected in such a way as to permit expression of the coding region when the appropriate molecules (e.g. , transcriptional activator proteins, polymerases, etc.) are bound to the regulatory sequences(s).
  • Transcriptional control regions include, but are not limited to promoters, enhancers, operators, and transcription termination signals, and are included with the polynucleotide to direct its transcription.
  • a promoter would be operably associated with a nucleic acid molecule encoding an immunoglobulin subunit polypeptide if the promoter was capable of effecting transcription of that nucleic acid molecule.
  • operably associated means that the DNA sequences are contiguous or closely connected in a polynucleotide.
  • control sequences or “control regions” is meant DNA sequences necessary for the expression of an operably associated coding sequence in a particular host organism. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and/or enhancers.
  • transcriptional control regions are known to those skilled in the art. As will be discussed in more detail below, suitable transcriptional control regions include promoters capable of functioning in the cytoplasm of poxvirus-infected cells.
  • a fusion protein as described herein can comprise a linker, e.g., connecting the immunoglobulin variable domain to a constant domain, e.g., a CHI, C-kappa, or C-lambda domain, and/or connecting the constant domain to a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, e.g., A56R.
  • a linker can comprise, e.g., at least about5, at least about 10, or at least about 15 amino acids. Suitable linkers can be identified by a person of ordinary skill in the art.
  • a fusion protein described herein comprises a heavy chain constant region, e.g., a CHI domain
  • any heavy chain constant region can be utilized, including, but not limited to immunoglobulin heavy chains from vertebrates such as birds, fish, or mammals, e.g.,, human immunoglobulin heavy chains.
  • a human immunoglobulin heavy chains or portion thereof, e.g., a CHI domain can be a ⁇ heavy chain or fragment thereof, i.e.
  • the heavy chain of an IgM immunoglobulin, a ⁇ -l heavy chain or fragment thereof i.e., the heavy chain of an IgGl immunoglobulin, a ⁇ -2 heavy chain or fragment thereof, i.e., the heavy chain of an IgG2 immunoglobulin, a ⁇ -3 heavy chain or fragment thereof, i. e.
  • Membrane bound fusion proteins as described herein can be anchored to the surface of a particle, e.g., a vaccinia virus particle (or virion), e.g., an EEV particle (or virion) by a transmembrane domain fused to the heavy chain polypeptide.
  • the transmembrane domain is part of a polypeptide segment comprising the transmembrane domain of an EEV-specific membrane protein, i.e., a protein which is expressed on the surface of an extracellular enveloped vaccinia virus, but NOT on intracellular vaccinia virus particles.
  • the EEV-specific membrane protein is A56R, the vaccinia HA protein.
  • any immunoglobulin light chain from any animal species, can be used, e.g., immunoglobulin light chains from vertebrates such as birds, fish, or mammals e.g., human light chains, e.g., human ⁇ and ⁇ light chains.
  • a light chain can associate with a heavy chain to produce an antigen-binding protein of an immunoglobulin molecule.
  • Each member of a library of polynucleotides encoding heavy chain fusion proteins as described herein can comprise (a) a first nucleic acid molecule encoding a first polypeptide segment comprising an immunoglobulin constant region common to all members of the library, e.g., a CHI domain, e.g., a gamma or mu CHI domain, (b) a second nucleic acid molecule encoding a second polypeptide segment comprising the extracellular and transmembrane domains of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein (e.g., A56R), where the second nucleic acid molecule is directly downstream and in-frame with the first nucleic acid molecule (either directly fused or connected by a linker), and (c) an a third nucleic acid molecule encoding a third polypeptide segment comprising an immunoglobulin heavy chain variable region, where the third nucleic acid molecule is directly upstream of
  • Each member of a library of polynucleotides encoding light chain fusion proteins as described herein can comprise (a) a first nucleic acid molecule encoding a first polypeptide segment comprising an immunoglobulin constant region common to all members of the library, e.g., a C-kappa or C-lambda domain, (b) a second nucleic acid molecule encoding a second polypeptide segment comprising the extracellular and transmembrane domains of a vaccinia extracellular enveloped virus (EEV)-specific membrane protein (e.g., A56R), where the second nucleic acid molecule is directly downstream and in-frame with the first nucleic acid molecule (either directly fused or connected by a linker), and (c) an a third nucleic acid molecule encoding a third polypeptide segment comprising an immunoglobulin light chain variable region, where the third nucleic acid molecule is directly upstream of and in-frame with the first
  • Libraries of polynucleotides encoding heavy or light chain variable regions can contain a plurality, i.e., at least two, or at least 10, 100, 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , or 10 9 different variable regions.
  • a light chain variable region is encoded by rearranged nucleic acid molecules, each comprising a light chain VL region, specifically a VK region or a ⁇ region, and a light chain J region, specifically a JK region or a J region.
  • a heavy chain variable region is encoded by rearranged nucleic acid molecules, each comprising a heavy chain VR region, a D region and J region.
  • Nucleic acid molecules encoding heavy and light chain variable regions can be derived, for example, by PCR from mature B cells and plasma cells which have terminally differentiated to express an antibody with specificity for a particular epitope. Furthermore, if antibodies to a specific antigen are desired, variable regions can be isolated from mature B cells and plasma cells of an animal who has been immunized with that antigen, and has thereby produced ah expanded repertoire of antibody variable regions which interact with the antigen.
  • variable regions can be isolated from precursor cells, e.g., pre-B cells and immature B cells, which have undergone rearrangement of the immunoglobulin genes, but have not been exposed to antigen, either self or non-self.
  • precursor cells e.g., pre-B cells and immature B cells
  • variable regions can be isolated by RT-PCR from normal human bone marrow pooled from multiple donors.
  • variable regions can be synthetic, for example, made in the laboratory through generation of synthetic oligonucleotides, or can be derived through in vitro manipulations of germ line DNA resulting in rearrangements of the immunoglobulin genes.
  • each member of a library of polynucleotides of the present invention as described above can further comprise an additional nucleic acid molecule encoding a signal peptide directly upstream of and in frame with the nucleic acid molecule encoding the variable region.
  • signal peptide is meant a polypeptide sequence which, for example, directs transport of nascent immunoglobulin polypeptide subunit to the surface of the host cells.
  • Signal peptides are also referred to in the art as “signal sequences,” “leader sequences,” “secretory signal peptides,” or “secretory signal sequences.”
  • Signal peptides are normally expressed as part of a complete or “immature” polypeptide, and are normally situated at the N-terminus.
  • All cells including host cells of the present invention, possess a constitutive secretory pathway, where proteins, including secreted immunoglobulin subunit polypeptides destined for export, are secreted from the cell. These proteins pass through the ER-Golgi processing pathway where modifications can occur. If no further signals are detected on the protein it is directed to the cell's surface for secretion or insertion as an integral membrane component expressed on the surface of the host cell or virus particle, e.g., EEV virion.
  • proteins including secreted immunoglobulin subunit polypeptides destined for export
  • Transmembrane domains are hydrophobic stretches of about 20 amino acid residues that adopt an alpha-helical conformation as they transverse the membrane.
  • Membrane embedded proteins are anchored in the phospholipid bilayer of the plasma membrane. As with secreted proteins, the N-terminal region of transmembrane proteins have a signal peptide that passes through the membrane and is cleaved upon exiting into the lumen of the ER.
  • BiP a chaperone protein
  • Pairing of the heavy chain CHI domain with the CL domain of its partner light chain induces dissociation of BiP, final folding and disulfide bond formation, and egress of the assembled antibody from the ER.
  • the antibody then utilizes the normal secretion pathway of the cell, and traffics through the golgi to the cell surface, where it is either secreted, or retained on the surface (if the antibody has a transmembrane domain). See Daniel et a!., Molecular Cell 34:635-36 (2009).
  • Suitable signal peptides provided herein can be either a naturally-occurring immunoglobulin signal peptides, i.e., encoded by a sequence which is part of a naturally occurring heavy or light chain transcript, or a functional derivative of that sequence that retains the ability to direct the secretion of the immunoglobulin subunit polypeptide that is operably associated with it.
  • a heterologous signal peptide, or a functional derivative thereof can be used.
  • the signal peptide can be that of the vaccinia virus A56R protein, or a functional derivative thereof.
  • members of a library of polynucleotides as described herein can further comprise additional nucleic acid molecules encoding heterologous polypeptides.
  • additional nucleic acid molecules encoding heterologous polypeptides can be upstream of or downstream from the nucleic acid molecules encoding an immunoglobulin variable or constant domain, or the EEV-specific membrane protein.
  • a heterologous polypeptide encoded by an additional nucleic acid molecule can be a rescue sequence.
  • a rescue sequence is a sequence which can be used to purify or isolate either the immunoglobulin or fragment thereof or the polynucleotide encoding it.
  • peptide rescue sequences include purification sequences such as the 6-His tag for use with Ni affinity columns and epitope tags for detection, immunoprecipitation, or FACS (fluorescence-activated cell sorting).
  • Suitable epitope tags include myc (for use with commercially available 9E10 antibody), the BSP biotinylation target sequence of the bacterial enzyme BirA, flu tags, LacZ, and GST.
  • the additional nucleic acid molecule can also encode a peptide linker.
  • the polynucleotides comprised in various libraries described herein can be introduced into suitable host cells.
  • suitable host cells can be characterized by, e.g., being capable of expressing immunoglobulin molecules attached to their surface or by being permissive for vaccinia virus infectivity.
  • Polynucleotides can be introduced into host cells by methods which are well known to those of ordinary skill in the art. Where the polynucleotide is part of a virus vector, e.g., a vaccinia virus, introduction into host cells is conveniently carried out by standard infection.
  • the first and second libraries of polynucleotides can be introduced into host cells in any order, or simultaneously.
  • the vectors can be introduced by simultaneous infection as a mixture, or can be introduced in consecutive infections. If one library is constructed in a vaccinia virus vector, and the other is constructed in a plasmid vector, introduction can be carried out by introduction of one library before the other.
  • host cells and/or vaccinia virions which have been allowed to express immunoglobulin molecules on their surface, or soluble immunoglobulin molecules secreted into the cell medium are then contacted with an antigen.
  • an "antigen” is any molecule that can specifically bind to an antibody, immunoglobulin molecule, or antigen-specific fragment thereof.
  • specifically bind is meant that the antigen binds to the CDR of the antibody.
  • an antigen can comprise a single epitope, but typically, an antigen comprises at least two epitopes, and can include any number of epitopes, depending on the size, conformation, and type of antigen.
  • Antigens are typically peptides or polypeptides, but can be any molecule or compound.
  • an organic compound e.g. , dinitrophenol or DNP, a nucleic acid, a carbohydrate, or a mixture of any of these compounds either with or without a peptide or polypeptide can be a suitable antigen.
  • the minimum size of a peptide or polypeptide epitope is thought to be about four to five amino acids.
  • Peptide or polypeptide epitopes can contain at least seven, at least nine, or between at least about 15 to about 30 amino acids.
  • peptide or polypeptide antigens can contain a sequence of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, and between about 15 to about 30 amino acids.
  • peptides or polypeptides comprising, or alternatively consisting of, antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length.
  • the antigen can be in any form and can be free, for example dissolved in a solution, or can be attached to any substrate. Suitable substrates are disclosed herein.
  • an antigen can be part of an antigen-expressing vaccinia virus, e.g., EEV virion as described in more detail below.
  • antigens are "self antigens, i.e., antigens derived from the same species as the immunoglobulin molecules produced. As an example, it might be desired to produce human antibodies directed to human tumor antigens. Other desired "self antigens include, but are not limited to, cytokines, receptors, ligands, glycoproteins, and hormones.
  • Antibodies directed to antigens on infectious agents can also be identified and selected by the disclosed methods.
  • antigens include, but are not limited to, bacterial antigens, viral antigens, parasite antigens, and fungal antigens.
  • the recombinant EEV virions produced as described are "contacted" with antigen by a method which will allow an antigen, which specifically recognizes a CDR of an immunoglobulin molecule expressed on the surface of the EEV, to bind to the CDR, thereby allowing recombinant EEV virions which specifically bind the antigen to be distinguished from those EEV virions which do not bind the antigen. Any method which allows recombinant EEV virions expressing an antigen-specific binding domain of an antibody to interact with the antigen is included.
  • EEV virions are in suspension, and the antigen is attached to a solid substrate, recombinant EEV virions which specifically bind to the antigen will be trapped on the solid substrate, allowing those virions which do not bind the antigen to be washed away, and the bound recombinant EEV virions to be subsequently recovered.
  • Methods by which to allow recombinant EEV virions to contact antigen are disclosed herein.
  • polynucleotides of the first library can be recovered from those EEV virions.
  • recovery is meant a crude separation of a desired component from those components which are not desired.
  • recombinant EEV virions which bind antigen can be "recovered” based on their attachment to antigen-coated solid substrates, e.g., magnetic beads, which can then be separated with a magnet.
  • Recovery of polynucleotides can be accomplished by any standard method known to those of ordinary skill in the art.
  • the polynucleotides are recovered by harvesting infectious EEV virions which bound antigen.
  • identification of polynucleotides encoding immunoglobulin fusion polypeptides can require two or more rounds of selection as described above, and will necessarily require two or more rounds of screening as described above.
  • a single round of selection may not necessarily result in isolation of a pure set of polynucleotides encoding the desired first immunoglobulin fusion polypeptides; the mixture obtained after a first round can be enriched for the desired polynucleotides but may also be contaminated with non-target insert sequences.
  • the first selection step can, or must be repeated one or more times, thereby enriching for the polynucleotides encoding the desired immunoglobulin fusion polypeptides.
  • EEV comprising those polynucleotides recovered as described above, can be introduced via infection into a population of host cells.
  • the second library of polynucleotides are also introduced into these host cells, e.g, by infection with vaccinia virus capable of expressing the complementary irnrnimog!obuiin molecules (e.g., light chains) encoded by the polynucleotides in the library, and expression of immunoglobulin molecules, or antigen-specific fragments thereof, on the membrane surface of the recombinant EEV virions, is permitted.
  • the recombinant EEV virions are similarly contacted with ant gen, and polynucleotides of the first library are again recovered from EEV virions, which express an immunoglobulin molecule that specifically binds antigen.
  • steps can be repeated one or more times, resulting in enrichment for polynucleotides derived from the first library which encode an immunoglobulin fusion polypeptide which, as part of an immunoglobulin molecule, or antigen-specific fragment thereof, specifically binds the antigen and/or has a desired functional characteristic.
  • those polynucleotides which have been recovered are "isolated," i.e., they are substantially removed from their native environment and are largely separated from polynucleotides in the library which do not encode antigen-specific immunoglobulin fusion polypeptides.
  • isolated polynucleotides contained in a vector are considered isolated. It is understood that two or more different immunoglobulin fusion polypeptides which, when combined with, e.g., a light chain, specifically bind the same antigen can be recovered by the methods described herein.
  • a mixture of polynucleotides which encode polypeptides binding to the same antigen is also considered to be “isolated.
  • Further examples of isolated polynucleotides include those maintained in heterologous host cells, in recombinant vaccinia, e.g. , EEV virions, or purified (partially or substantially) DNA molecules in solution.
  • a polynucleotide contained in a clone that is a member of a mixed library and that has not been isolated from other clones of the library, e.g. , by virtue of encoding an antigen-specific immunoglobulin fusion polypeptide is not “isolated” for the purposes of this invention.
  • a polynucleotide contained in a virus vector is “isolated” after it has been recovered, and optionally plaque purified.
  • an antigen can comprise two or more epitopes, and several different immunoglobulin molecules can bind to any given epitope
  • several suitable polynucleotides e.g., two, three, four, five, ten, 100 or more polynucleotides
  • an immunoglobulin fusion polypeptide which, when combined with a suitable immunoglobulin subunit polypeptide encoded by a preselected polynucleotide or a polynucleotide of the second library, will form an immunoglobulin molecule, or antigen binding fragment thereof, capable of specifically binding the antigen of interest.
  • each different polynucleotide recovered from the first library would be separately isolated.
  • one or more polynucleotides from the first library are isolated, in the second step of this embodiment, one or more polynucleotides are identified in the second library which encode immunoglobulin subunit polypeptides which are capable of associating with the immunoglobulin fusion polypeptide(s) encoded by the polynucleotides isolated from the first library to form an immunoglobulin molecule, or antigen-binding fragment thereof, which specifically binds an antigen of interest.
  • vaccinia virus vectors for expression of antigen-binding molecules, where the antigen binding molecule, e.g., an immunoglobulin heavy chain variable region and CHI , is expressed as a fusion with an EEV-specific membrane protein.
  • the antigen binding molecule e.g., an immunoglobulin heavy chain variable region and CHI
  • heavy chains can be recovered as EEV fusion proteins, and libraries of light chains, or individual pre-selected light chains can be expressed as soluble proteins in vaccinia virus, or other vectors, e.g., plasmid vectors.
  • inactivation of viruses expressing a soluble complementary chain can be carried out with 4'-aminomethyl-trioxsalen (psoralen) and then exposing the virus vector to ultraviolet (UV) light.
  • psoralen 4'-aminomethyl-trioxsalen
  • UV light ultraviolet
  • Psoralen and UV inactivation of viruses is well known to those of ordinary skill in the art. See, e.g. , Tsung, K., et ah, J Virol. 70:165-171 (1996), which is incorporated herein by reference in its entirety.
  • IMV intracellular mature virion
  • IEV intracellular enveloped virion
  • CEV cell-associated enveloped virion
  • EEV extracellular enveloped virion
  • IMV Intracellular Mature Virus
  • IMVs Intracellular Enveloped Virus
  • the IEVs are then transported to the cell surface on microtubules.
  • the outer IEV membrane fuses with the plasma membrane to expose a CEV (Cell Associated Enveloped Virus) at the cell surface.
  • Actin polymerization from the host cell can drive the CEV to infect neighboring cells, or the virus can be released as an EEV. See, e.g., Kim L. Roberts and Geoffrey L. Smith. Trends in Microbiology 16(10):472-479 (2008); Geoffrey L. Smith, et al., Journal of General Virology 83:2915-2931 (2002).
  • At least six virus-encoded proteins have been reported as components of the EEV envelope.
  • four proteins (A33R, A34R, A56R, and B5R) are glycoproteins, one (A36R) is a nonglycosylated transmembrane protein, and one (F13L) is a palmitylated peripheral membrane protein.
  • A33R, A34R, A56R, and B5R glycoproteins
  • A36R is a nonglycosylated transmembrane protein
  • F13L palmitylated peripheral membrane protein.
  • immunoglobulin fusion polypeptides e.g., variable heavy chains are bound to the EEV membrane, e.g., as a fusion protein with an EEV-specific membrane protein, e.g., A56R.
  • EEV fusion proteins as provided herein can be expressed in any suitable vaccinia virus.
  • the DNA encoding an EEV fusion protein can be inserted into a region of the vaccinia virus genome which is non-essential for growth and replication of the vector so that infectious viruses are produced.
  • the most widely used locus for insertion of foreign genes is the thymidine kinase locus, located in the Hindlll J fragment in the genome.
  • Poxvirus transcriptional control regions comprise a promoter and a transcription termination signal. Gene expression in poxviruses is temporally regulated, and promoters for early, intermediate, and late genes possess varying structures. Certain poxvirus genes are expressed constitutively, and promoters for these "early-late" genes bear hybrid structures. Synthetic early-late promoters have also been developed. See Hammond J.M., et al, J, Virol. Methods 66: 135-8 (1997); Chakrabarti S., et al., Biotechniques 25:1094-7 (1997).
  • any poxvirus promoter can be used, but use of early, late, or constitutive promoters can be desirable based on the host cell and/or selection scheme chosen.
  • a constitutive promoters is used.
  • a suitable promoter for use in the methods described herein is the early/late 7.5-kD promoter, or the early/late H5 promoter (or variants thereof).
  • libraries of polynucleotides capable of expressing immunoglobulin fusion polypeptides as described herein can be constructed in poxvirus vectors, e.g., vaccinia virus vectors, by tri-molecular recombination.
  • a transfer plasmid for producing libraries of fusion polypeptides which comprises a polynucleotide encoding an immunoglobulin heavy chain CHI and at least the transmembrane portion of a vaccinia virus A56R protein through operable association with a vaccinia virus H5 promoter.
  • An exemplary vector is promoter is pJEMl, which comprises the sequence:
  • SEQ ID NO: l Various different PCR-amplified heavy chain variable regions can be inserted in-frame into unique BssHII and BstEII sites, which are indicated above in bold italics.
  • Plasmid pJEMl is a derivative of p7.5/tk described in US Patent No. 7,858,559. pJEMl retains the flanking regions of homology to the vaccinia genome which enables recombination as is described in U.S. Patent No. 7,858,559. However, in place of the expression cassette in p7.5/tk (promoter and expressed sequences), pJEMl contains the following elements:
  • the transfer plasmid of the present invention which comprises a polynucleotide encoding an immunoglobulin kappa light chain polypeptide through operable association with a vaccinia virus p7.5 promoter is pVKE, which comprises the sequence:
  • PCR-amplified kappa light chain variable regions can be inserted in-frame into unique ApaLI), and Xhol sites, which are indicated above in bold.
  • pVKE can be used in those embodiments where it is desired to have polynucleotides of the second library in a plasmid vector during the selection of polynucleotides of the first library as described above.
  • the transfer plasmid of the present invention which comprises a polynucleotide encoding an immunoglobulin lambda light chain polypeptide through operable association with a vaccinia virus p7.5 promoter is pVLE, which comprises the sequence:
  • PCR-amplified lambda light chain variable regions can be inserted in-frame into unique ApaLI and Hindlll sites, which are indicated above in bold.
  • pVLE can be used in those embodiments where it is desired to have polynucleotides of the second library in a plasmid vector during the selection of polynucleotides of the first library as described above.
  • Heavy Chain fusion proteins were constructed to facilitate selection of specific immunoglobulin segments expressed on the cell surface of recombinant vaccinia virus.
  • CHI domain of C gamma fused to the extracellular and transmembrane domains of A56R from Western Reserve Vaccinia virus, designated herein as CH1-A56R, as well as a C35-specific VH (H2124) was constructed by the following method.
  • pJ EMI An expression vector comprising a polynucleotide sequence encoding the human gamma immunoglobulin constant region ⁇ C! I ⁇ ). a fragement of vaccinia A56R, and a cassette for insertion of a human heavy chain variable region (e.g., 1-12124), designated herein as "pJEMl" was constructed. In short, p7.5/tk, produced as described in PCX Publication No. WO 00/028016, incorporated herein by reference in its entirety, was converted into pJEMl by the following method.
  • IgG CHI A cDNA coding for the human IgG heavy chain was isolated from bone marrow RNA using SMARTTM RACE cDNA Amplification Kit available from Clontech, Palo Alto, CA. The PCR was carried out using the 5' primer huCyl-5B: 5'
  • the PCR product comprised the following elements: BamHI-BstEII-(nucleotides encoding amino acids 1 1 1-113 of VH)-(nucleotides encoding amino acids 1 14-478 of Cyl)-TGA-SaiI.
  • This product was subcloned into pBluescriptll/KS at BamHI and Sail sites, and a second BstEII site corresponding to amino acids 191 and 192 within the CHI domain of Oyl was removed by site-directed mutagenesis without change to the amino acid sequence.
  • Plasmid pBluescriptll/KS was digested with BstEII and Sail and the smaller DNA fragment of about 1 Kb was gel purified.
  • This smaller fragment was then used as a template in a PCR reaction using forward primer CHl(F)-5'-CAAGGGACCCTGGT CCGTCTCCTCAGCCTCC-3' (SEQ ID NO:6) (BstEII restriction site in italics and underlined) and reverse primer CH1(R) 5 '- AACTTTCTTGTCC ACCTTGGTGTTG-3 ' (SEQ ID NO:7).
  • the resulting PCR product of about 320 base pairs was gel purified.
  • a cDNA coding for the human IgG heavy chain was isolated from bone marrow RNA using SMARTTM RACE cDNA Amplification Kit available from Clontech, Palo Alto, CA. The PCR was carried out using the 5' primer huCyl-5B: (SEQ ID NO:4), and 3' primer huCyl-3S: (SEQ ID NO:5).
  • the PCR product comprised the following elements: BamHI-BstEII-(nucleotides encoding amino acids 1 1 1-113 of VH)-(nucleotides encoding amino acids 114-478 of Cyl)-TGA-SalI.
  • This product was subcloned into pBluescriptll/KS at BamHI and Sail sites, and a second BstEII site corresponding to amino acids 191 and 192 within the CHI domain of Cyl was removed by site-directed mutagenesis without change to the amino acid sequence.
  • Plasmid pBluescriptll/KS was digested with BstEII and Sail and the 993 base pair DNA fragment corresponding to full length IgGl was gel purified.
  • A56R (longer form). A DNA fragment encoding amino acids 108 to 314 of the
  • A56R hemmagglutinin protein from vaccinia virus (Western Reserve), which comprises the stalk, transmembrane, and intracellular domains (Genbank accession No. YP_233063) was amplified from isolated Western Reserve Vaccinia Virus DNA with forward primer A56R(F)
  • A56R (shorter form).
  • A56R hemagglutinin protein from vaccinia virus (Western Reserve), which comprises the stalk, transmembrane, and intracellular domains (Genbank accession No. YP 233063) was amplified from isolated Western Reserve Vaccinia Virus DNA with forward primer A56R(F2):
  • the Fab construct (IgG CHI with A56R longer form).
  • the 320 and 660-base pair fragments were then combined by SOE PCR using forward primer CH1(F) (SEQ ID NO:6) and reverse primer CHI (R2):
  • Plasmid p7.5/tk was also digested with BstEII and Sail, and the larger resulting fragment of about 5.7 Kb was gel purified. These two BstEII/Sall fragments were then ligated to produce the pJEMl plasmid.
  • pJEM 1 retains the flanking regions of homology to the vaccinia genome which enables recombination.
  • pJEMl contains the following elements: Vaccina Virus H5 promoter; Leader peptide; 5' BssHII Cloning site for cloning variable heavy chains; Heavy Variable region; 3' BstEII Cloning site for cloning variable heavy chains; IgG CHI domain; and Vaccinia A56R, the sequence for these elements of pJEMl are shown in Figure 1 and SEQ ID NO:l .
  • VH (H2124)-CH1-A56R fusion construct BssHII and BstEII sites of pJEMl producing a VH (H2124)-CH1-A56R fusion construct.
  • the nucleotide and amino acid sequences for the VH (H2124)-CHl -A56R fusion construct prepared in pJEMl are shown below, respectively.
  • nucleotide sequence encoding the VH (H2124) and CHI domain is underlined, and the nucleotide sequence encoding the A56R domain is double underlined.
  • nucleotide sequence encoding the VH (H2124) and full length Ig domain is underlined, and the nucleotide sequence encoding the shorter form A56R domain is double underlined.
  • amino acid sequence for the VH (H2124) and full length Ig domain is underlined, and the amino acid sequence for the shorter form A56R domain is double underlined.
  • amino acid sequence for the VH (H2124) and full length Ig domain is underlined, and the amino acid sequence for the longer form A56R domain is double underlined.
  • HeLa cells were infected or co-infected with recombinant EEV vaccinia virus expressing immunoglobulin fusion constructs, Variable Heavy (H2124) CH1-A56R (described in the Example above) and Ig-K ("A56R H + L") or scFv-A56R ("A56R scFv").
  • H2124 Variable Heavy
  • CH1-A56R described in the Example above
  • Ig-K A56R H + L
  • scFv-A56R scFv
  • the HeLa cells were co-infected with recombinant vaccinia virus expressing the VH (H2124) CH1-A56R Fusion and recombinant vaccinia virus expressing the Ig-K (A56R H + L) or infected with recombinant vaccinia virus expressing scFv-A56R.
  • Fluorescence Activated Cell Sorting (FACS) analysis for C35 staining and CD 100 staining of cells infected with EEV recombinant vaccinia virus was performed. Briefly, 1 ⁇ g/ml CD 100-His or 1 ⁇ g/ml C35-His were added to the samples and incubated for 30 minutes on ice.
  • FACS Fluorescence Activated Cell Sorting
  • Psoralen-inactivated EEV was then added to the plate, diluted in 1 x PBS/10% FBS/0.05% Tween-20, into designated wells and allowed to bind. Viral paiticles were detected using Rabbit anti-Vaccinia-HRP conjugated antibody (AbCam Catalog # 28250), the antibody was diluted 1 :2000 in 1XPBS/ 10% FBS/0.05% Tween-20. TMB substrate (to detect horseradish peroxidase (HRP) activity) was then added to the plate; color was allowed to develop and then the reaction was terminated with an equal volume of 2N H 2 S0 4 . The plate was read on an ELISA plate reader and the results are shown in Figure 4A.
  • a second ELISA was used to confirm binding by detecting FAb, using the same conditions as above, except the secondary antibody was Goat anti-human IgG F(ab') 2 -HRP conjugated (Jackson ImmunoResearch catalog# 109-036-097) used at a 1 :10,000 dilution of the stock antibody, with 1 X PBS/10% FBS/0.05% Tween-20 as dilution buffer. Results are shown in Figure 4B. Wells that were positive on both plates showed that the antibody construct was expressed in the presence of the vaccinia viral virion.
  • Recombinant vaccinia virus expressing A56R fusions with known C35 and VEGF binding molecules were tested for binding to target molecules using a panning based assay.
  • Recombinant EEV expressing immunoglobulin molecules known to be specific for C35 scFv2408-A56R, H2124-L517-A56R double gene, and L517 + H2124-A56R co-infection
  • VEGF L7000 + H7000-A56R
  • H2124-L517-A56R double gene produced the same antibody as L517 + H2124-A56R, except the Ig-H and Ig-K genes were encoded by the same virus from the double gene and the Ig-H and Ig-K genes were encoded by separate viruses used for the H2124-A56R co-infection.
  • EEV containing supernatant "Neat" was diluted by serial dilution generating 1 : 10 to 1 : 10 6 dilutions. 1 ⁇ of the various virus constructs was added to designated wells and binding was allowed to proceed for 2 hours or overnight at room temperature. The cells were washed 10 times with PBS to remove unbound EEV and then approximately 25,000 BSCl cells were added to each well, and the plates were incubated at 37° C overnight. Plaque formation was detected by staining the wells with crystal violet.
  • Figures 5A-D show the plaque assay plate results for C35 binding after 2 hours and overnight, and VEGF binding after 2 hours and overnight, respectively. These results showed that the A56R fusion proteins were expressed at the surface of the vaccinia virions. Furthermore, the results showed that known binding segments produced using A56R fusions expressed on EEV were able to bind to their specific targets.
  • bead-based selection was performed using Streptavidin beads, Protein G beads or Tosylactivated beads.
  • Stre tavidin (SAV) bead selection Magnetic bead-based selection was tested using recombinant EEV expressing MAb 2408 (H2124-A56R + L517 (C35-specific)) or MAb 7000 (H7000-A56R + L7000 (VEGF-specific)). Hela cells were infected with the various virus constructs in two T175 flasks for 2 days, supernatant was collected, and cells were pelleted. The EEV was pelleted by spinning for 1 hour in a SA-600 rotor at 1 ,000 RPM.
  • the EEV pellet was resuspended in 1 ml DMEM supplemented with 10% FBS.
  • 500 ⁇ 1 supernatant ⁇ 10 A 7 pfu
  • 500 ⁇ 1 DMEM containing ⁇ g biotin-C35 was added to each sample (resulting in a solution of 1 ml volume at ⁇ g/ml concentration).
  • the solution was incubated in a cold room on a rotator for 2 hours.
  • 200 ⁇ 1 M280 Streptavidin (SAV) magnetic beads were added to the EEV/C35 solution (the SAV bead concentration was high enough to bind all of the biotin-C35 so no washing step was required).
  • MAb 2408 C35 -specific antibody, a humanized 1F2 antibody comprising H2124 + L517)
  • MAb 2368 CDlOO-specific antibody, disclosed in U.S. Appl. No. 2010/0285036
  • mAb 7000 VEGF-specific parent antibody of bevacizumab
  • mAb 8000 Her2-specific parent antibody of trastuzumab
  • Protein G bead selection EEV produced in small scale infections of Hela cells in 6 well plates (titer - 5X10 A 5/ml) were used. Protein G bead selection was tested using EEV expressing 2368-A56R (H2090-A56R + L512, both VH and VL expressed in vaccinia): 1 ml virus (-5X10 A 5 pfu) and EEV expressing 2408-A56R (H2124-A56R + L517, both VH and VL expressed in vaccinia): 1 ml virus (5X10 A 5 pfu)).
  • CD100 bound to Protein G beads was prepared as follows: 300 ⁇ 1 magnetic Protein G beads (2X standard amount/sample) were used and pull down was performed with a magnet. 600 ⁇ 1 PBS + 18 ⁇ 1 CDIOO-Fc ( :: 36 ⁇ g) was added to the beads, which were incubated at room temp for 20 minutes (on rotator) to allow CDIOO-Fc to bind to Protein G beads. Beads were pulled down with a magnet and washed IX with 1 ml PBS. Next, the beads were resuspended in 300 ⁇ 1 DMEM supplemented with 10%.
  • CDIOO-Fc/Pro G beads were added to each virus sample (-2X the standard amount of Pro-G beads), which was about 12 ⁇ g/ml CDIOO-Fc.
  • the solution was incubated for 2 hours at room temperature.
  • 550 ⁇ 1 (about 50%) of the beads were removed and unbound was collected following standard 5 X 1ml PBS washes. Beads were removed from the magnet, 1 ml DMEM supplemented with 2.5% was added, and the solution was transferred to a fresh tube ("Bound”). "Unbound” and "Bound” were titered. The remaining 550 ⁇ ! was allowed to continue incubating at room temp for another 1.5 hours (3.5 hours total) and then for 18 hours at 4 degrees before being harvested as described above.
  • CDI OO-His 100 ⁇ g CDI OO-His was conjugated to tosylactivated magnetic beads in PBS for the CD100 antibody selection assay with 2368-A56R (1 ml virus ( ⁇ 5X10 A 5 pfu)) and 2408-A56R (1 ml virus (5 ⁇ 10 ⁇ 5 pfu)) using the same methods described above for the C35 antibody selection assay.
  • a library of polynucleotides encoding immunoglobulin segments was produced as follows.
  • a recombinant vaccinia library referred to as "naive heavy, A56R fusion” was created using bone marrow RNA that was purchased from a commercial supplier (Life Technologies) representing more than 100 donors.
  • Reverse transcription was performed using antisense primers specific for the constant region of either human immunoglobulin gamma or mu.
  • the resulting cDNA was used as template for PCR with one of two sense primers that bound to the beginning of human variable heavy framework region 1 and introduced a BssHII restriction site in combination with a pool of antisense primers that bound to the various germline human J segments and introduced a BstEII restriction site.
  • the sequences of these primers were as follows:
  • Sense VH 3 AATATGCGCGCACTCCGAGGTGCAGCTGGTGGAGTCTGG
  • Sense VH 3a AATATGCGCGCACTCCGAGGTGCAGCTGTTGGAGTCTGG
  • Antisense JH 1 GAGACGGTGACCAGGGTGCCCTGGCCCCA (SEQ ID NO: 1
  • Antisense JH 2 GAGACGGTGACCAGGGTGCCACGGCCCCA (SEQ ID NO:
  • Antisense JH 3 GAGACGGTGACCATTGTCCCTTGGCCCCA (SEQ ID NO: 16)
  • Antisense JH 4/5 GAGACGGTGACCAGGGTTCCCTGGCCCCA (SEQ ID NO:
  • Antisense JH 6 GAGACGGTGACCGTGGTCCCTTGGCCCCA (SEQ ID NO:
  • the resulting PCR products were cloned into the pJEMl plasmid disclosed above for the purpose of creating recombinant vaccinia virus.
  • the human immunoglobulin variable heavy expression cassette described herein was cloned in frame with human immunoglobulin constant domain region CHI and vaccinia virus integral membrane protein A56R cDNA.
  • the resulting proteins created from expression of the library were fusion proteins containing an immunoglobulin heavy chain variable segment, the heavy chain CHI, and a portion of the A56R protein expressed on the surface of vaccinia EEV.
  • T-175 Hela cells were infected with EEV expressing the fusion library + Light chains described above for 2 days after which the supernatant was harvested, pelleted with low speed spins 2X, and the EEV pelleted at 15,000 RPM for 1 hour. EEV was resuspended in 3 ml DMEM supplemented with 10% FBS.
  • EEV expressing 2408-A56R (1 ml virus (5X10 ⁇ 5 pfu)) were used as controls and library 3 (1 ml virus ( ⁇ 10 A 8pfu)) was used for the selection assay.
  • EEV produced in small scale infections of Hela in 6 well plates were used.
  • Library 3.1 A and 3. IB were pooled together into one sample.
  • Library 3.2 gave good amplification on BSC 1 , harvest and titer (-3X10 A 7/ml), and resulted in a small population of positive cells. A third round of selection was performed.
  • Round 3 Selection A third round of selection was performed using the same methods described above using "library 3.2A” (Rounds 1 and 2 :::: CDIOO-Fc/Pro G). Bound library was amplified on BSC1 in T75 (Round 3 selection was termed "CDIOO 3.3 A"). The results of the Round 3 A selection were tested by flow cytometry. A second Round 3 selection was performed with 100 ⁇ g CDIOO-His conjugated to tosylactivated magnetic beads in PBS using the methods disclosed above.
  • CD100 3.3A/B when paired with LI 16. Plaques from 3.3A (n 27) and 3.3B (nTM30) were picked and amplified for 3 days on BSC1 in 24-well plate (1 plaque per well). Hela cells were infected in 24-well plates with 1/3 of each amplified plaque. The cells were co-infected with LI 16 at moi ⁇ ; 1 (controls: 2368, 2408 and uninfected Hela supernatant). EEV was produced for 2 days, harvested, and inactivated with psoralen and irradiation with long-wave UV light (PLWUV). The virus was bound to CD 100 ⁇ g/ml) and C35 ⁇ g/ml) coated plates O/N using 50 ⁇ 1 EEV + 50 ⁇ ELISA blocking buffer per well.
  • PLWUV long-wave UV light
  • A56R fusion library also referred to as "library 3" + light chain clones (L48, LI 16 and L9021) was performed.
  • the library is the same that was used for the CD 100 selections discussed above.
  • Anti-Fab-FITC as then added and the Antigen-anti-His complexes were added to the cells for 30 minutes on ice. The cells were then washed with 2 ml PBS, 0.5% BSA, 2nM EDTA. Anti-his-APC and anti-Fab-FITC were then added for 30 minutes on ice, the cells were then washed, fixed, and flow cytometry assay was run. As shown in Figure 8, all three light chains enriched for Her2 specific antibodies.
  • Antibody binding was detected by adding anti-Fab-HRP. Five positive clones were identified with good binding to Her2 and were sequenced. All 5 clones had the same sequence (see Figure 11). The VH sequence of clone B10 is shown below.
  • A56R fusion library also referred to as "library 3" + light chain clones (L48, LI 16 and L9021) was performed.
  • the library is the same that was used for the CD 100 and Her2 selections discussed above.
  • ⁇ C35 was conjugated to tosylactivated magnetic beads in PBS or ELISA coating buffer (CB). The solution was incubated at 37° C overnight, and blocked for 1 hour at 37° C with PBS, 10% FBS, 0.5% BSA. The beads were washed IX, resuspend in 160 ⁇ 1 DMEM supplemented with 10%. 50 ⁇ 1 of each bead sample was added to each virus sample and incubated at room temp for 3.5 hours. Unbound was collected following standard 5 X 1ml PBS washes. Beads were removed from the magnet, 1 ml DMEM supplemented with 2.5% was added, and he beads were transferred to fresh tube ("Bound”). "Unbound" and "Bound” were titered.
  • Clones will be screened from C35 3.3 as well a possible fourth round selection.
  • Positive clones will be characterized by flow cytometry and tested for specificity, affinity, and function.
  • BSCl cells were seeded out into 15 wells of 6-well plates at 1.25x 10 6 cells per well and at 2.5 ml per well. The next day, a series of dilutions of hygromycin or G418 for selection was created according to Table 9.
  • DMEM-2.5 represents DMEM containing 2.5% FBS.
  • the BSC1 cells were infected with MOI ⁇ 3 of either wild-type vaccinia virus or vaccinia virus containing the respective selectable markers (VHE H5 LX-IRES-HYGRO or VHE H5 HX-A56R NEO). Hygromycin and G418 dilutions were then applied to the plate wells at the same time. DMEM-2.5 containing no antibiotics was added to the control wells. The infection was carried out in a volume of 0.65 ml per well and the cells were incubated at 37°C. After 2 hours, the media volumes were brought up to 2.65 ml per well and additional hygromycin or G418 was supplemented to maintain intended concentrations in the drug-containing wells. Meanwhile, new BSC1 cells were seeded into 12- well plates at 2xl0 5 cells per well for post-infection titer determination.
  • the factor to calculate titer is equal to the total plaque number in 2 duplicate wells divided by 0.66 ml.
  • the infection was incubated for at least 2 hours at 37°C. An additional 1.0 ml of DMEM-2.5 was added to each well after the initial 2 hours of adsorption and infection.
  • 0.08 mg/ml of hygromycin significantly inhibited the amplification of vaccinia virus expressing heavy chain linked to a neomycin resistance marker, but had little or no inhibition effect (except for the 0.04 mg/ml data point) on the amplification of vaccinia virus expressing light chain linked to a hygromycin resistance marker until the hygromycin concentration was increased to 0.1 to 0.2 mg/ml.
  • 0.125 to 2 mg/ml of G418 significantly inhibited the amplification of wild-type vaccinia virus, but had no inhibition effect on the amplification of vaccinia virus expressing heavy chain linked to a neomycin resistance marker.
  • vaccinia viruses expressing immunoglobulin and drug resistance markers linked via an Internal Ribosome Entry Site provide for protection against death of the host cells under treatment with that drug. This allows for chain-specific propagation in virus as well as selection against wild-type vaccinia virus during recombination.
  • HeLa cells were co-infected with recombinant EEV vaccinia virus expressing immunoglobulin fusion constructs, Variable Heavy (H8000) CH1-A56R with L8000 Ig-K which together encode an Fab fragment of antibody ("Fab"), Variable Heavy (H8000) FL-A56R with L8000 Ig-K which together encode full length ("FL") IgG, Variable Heavy (H8000) FL-truncated-A56R with L8000 Ig-K which together encode full length IgG with a shorter A56R (“TR"), Variable Heavy (H2124) FL-A56R with L517 Ig-K (2408 "FL”), and Variable Heavy (H2124) FL-truncated-A56R with L517 Ig-K (2408 "TR”) in 12-well plates.
  • FIG. 12 A diagram showing the "Fab”, “TR” and “IgG” constructs is shown in Figure 12.
  • FACS Fluorescence Activated Cell Sorting
  • the A56R fusion library (also referred to as "library 10") was co-infected into 1X10 A 9 Hela cells along with a cocktail of 9 light chain clones (Kappa Chains: L48, LI 16, L122, L71 10, and L9021 ; and Lambda Chains: L3-1, L151, L214, and L223).
  • the total moi of heavy chain virus was 1, and the total moi of light chain virus was 1 , with each light chain comprising approximately l/9th of the total light chain virus added.
  • Hela-S cells growing in suspension were infected for 2 days, after which the supernatant was harvested, pelleted with low speed spins 2X, and the EEV pelleted at 13,000 RPM for 1 hour in an F16/F250 rotor. EEV were resuspended in 3 ml DMEM supplemented with 10% FBS, and 1 ml was used to select CD 100 specific antibodies.
  • CDIOO-His was conjugated to tosylactivated magnetic beads in PBS. The solution was incubated at 37 °C overnight, and blocked for 1 hour at 37 with PBS, 10% FBS, 0.5% BSA. The beads were washed IX with DMEM, 10% FBS, resuspended in 160 ⁇ 1 DMEM supplemented with 10% FBS. 50 ⁇ 1 of each bead sample was added to each virus sample and incubated at room temperature for 2 hours. Unbound virus was collected in standard 5 X 1ml PBS washes.
  • Table 13A Round 2 Selection for CD100 Ab (Protein G Bead Selection)
  • Table 13B Round 2 Selection for CD100 Ab (Tosylactivated Bead Selection)
  • Table 14A Round 3 Selection for CD100 Ab (Protein G Bead Selection)
  • Table 13B Round 3 Selection for CD100 Ab (Tosylactivated Bead Selection)
  • cells were incubated for 30min with lOug/mL huCDIOO-His in FB on ice, then washed with 2mL of FB and incubated with 1 :50 (2ug/mL) of Mouse anti 6XHis-APC mixed with 1 :500 (2ug/mL) FITC labeled Goat-Fab anti-human-Fab on ice for 30min.
  • the virus was harvested and DNA extracted from an aliquot of the virus using Qiagen DNA blood mini kit (cat# 51 104).
  • the purified DNA was PCR amplified with Heavy chain specific primers 428; 5 ' -G ATAT ATTAA AGTCGAATAAAGTG-3 ' (SEQ ID NO:31) and 430; 5 ' -GAC ATC AC ATAGTTTAGTTGC-3 ' (SEQ ID NO:32).
  • the resulting PCR product was cloned into plasmid vector containing secreted full length human IgGl (EFVH) and then the V gene contained in the resulting colonies was sequenced.
  • a summary of the sequencing results is shown in Table 15. After sequencing 188 clones from 10.3/ProG, 44 unique clones were identified, and after sequencing 188 clones from 10.3/toysl, 46 unique clones were identified.
  • Plasmid DNA for each unique heavy chain was co-transfected along with a plasmid vector encoding VL3-1 into CHO cells using Lipofectamine 2000 for 3 days, and then the antibody contained in the media was tested for specificity for CD 100 by flow cytometry on CD100+ Jurkat cells and by ELISA ( Figures 26 and 27A-B, respectively).
  • the experimental antibody was pre-incubated at lug/mL with 1 :400 or [2.5ug/mL] Gt anti Hu Fc-Dylight 649 secondary in Flow Buffer (1XPBS, 0.5%BSA, 2mM EDTA).
  • Jurkat cells were seeded at 250,000/well in 96 well plate and incubated with preformed Ab complex for 30min on ice. The cells were then washed 2X with 200uL Flow Buffer and incubated for 20min with 0.5% Paraformaldehyde with IX Propidium Iodide (PI). Cells were detected on FACS Canto reading 10,000 events gated on live cell population. In total, at least 75 unique antibodies were shown to be specific for CD 100 by ELISA or Flow Cytometry.
  • a heavy chain library comprised of -3,000,000 clones containing a combination of nai e VH and synthetic VF1 sequences was produced in the A56R-Fab vector as a fusion with IRES-Neomycin.
  • the A56R fusion library also referred to as "library 9" was co-infected along with a library of 1,000 Kappa Light chain clones containing a hygromycin resistance gene into 5X10 A 9 Hela cells.
  • the Light chain library was comprised of VK sequences isolated from human bone marrow (naive). The total moi of heavy chain virus was 1, and the total moi of light chain virus was 1.
  • Hela-S cells growing in suspension were infected for 2 days, after which the supernatant was harvested, pelleted with low speed spins 2X, and the EEV pelleted at 13,000 RPM for 1 hour in a F16/F250 rotor. EEV was resuspended in 3 ml DMEM supplemented with 10% FBS, and 1 ml was used to select Her2/neu specific antibodies.
  • Her2-Fc was added to 600ul the Protein G beads. The solution was incubated at room temperature for 20 minutes (on rotator) to allow Her2-Fc to bind to Protein G beads. Beads were pulled down with magnet, washed IX with 1 ml PBS, and resuspend in 400 ⁇ 1 DMEM supplemented with 10% FBS.
  • Beads recovered from the bound library were amplified on BSC1 in three T175 flaks in the presence of lmg/ml G418. This amplification selected for Heavy chain recombinant virus. (Round 1 selection was termed "Her.9.1 ").
  • the amplified viruses were named Her.9.3/VH and Her 9.3/VK.
  • the cells were again sorted, but this time individual infected cells were sorted into individual wells of a 96 well plate.
  • Each antigen binding sorted cell should contain a fixed antigen specific pairing of specific VH with specific VK.
  • the cells were subjected to freeze/thaw, and then the virus was amplified on BSC1 in a 96 well plate, with virus from one cell being amplified in one recipient well. After 5 days the plates were subjected to freeze/thaw, and then an aliquot of virus in each well was infected into Hela cells in 96 well plate.
  • the virus in each well should contain a mix of VH and VK, and the infection of Hela cells should result in expression of surface IgG and antigen binding. After an overnight binding the cells were harvested and stained for Her2 binding as described above ( Figure 28). [0253] From screening 1 plate, 26 specific clones were identified. Repeat testing of these clones demonstrated that they bind to Her2, but not C35 by flow cytometry. Three representative clones (D5, D8, and H2) are show in Figure 29A-C. DNA was then extracted from the viruses, and the VH and VK genes contained in these viruses was PCR amplified with VH and VK specific primers and cloned into mammalian expression vectors so that they would be expressed as full length IgGl and full length Kappa.
  • VH and VK genes were then determined. By sequencing, these 26 clones contained 15 unique antibodies. These antibodies were then expressed in CHO cells by co-transfection of the IgG and Kappa expression plasmids, and antibody was harvested from the cell supernatant after 3 days. Antibody was quantitated by ELISA, and then tested for specificity by ELISA and flow cytometry on SKBR3 cells (Her2+++). Representative data for antibodies shown to have specificity by ELISA and flow cytometry is shown in Figures 30 and 31, respectively.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2013/038497 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus Ceased WO2013163602A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
EA201491965A EA028164B1 (ru) 2012-04-26 2013-04-26 Слитые белки для облегчения отбора клеток, инфицированных рекомбинантным вирусом осповакцины с геном специфического иммуноглобулина
NZ630854A NZ630854A (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
JP2015509201A JP6498599B2 (ja) 2012-04-26 2013-04-26 特異的免疫グロブリン遺伝子組み換えワクシニアウイルスに感染している細胞の選択を容易にするための融合タンパク質
PL13780660T PL2841606T3 (pl) 2012-04-26 2013-04-26 Białka fuzyjne do ułatwiania selekcji komórek zainfekowanych genem specyficznej immunoglobuliny rekombinowanego wirusa krowianki
CN201380033060.7A CN104520444B (zh) 2012-04-26 2013-04-26 有助于选择被特定免疫球蛋白基因重组牛痘病毒感染的细胞的融合蛋白
KR1020147033046A KR102108589B1 (ko) 2012-04-26 2013-04-26 특이적 면역글로불린 유전자 재조합 백시니아 바이러스로 감염된 세포의 선별을 촉진하는 융합 단백질
DK13780660.0T DK2841606T3 (da) 2012-04-26 2013-04-26 Fusionsproteiner til at lette selektionen af celler inficeret med specifikt immunoglobulingenrekombinant vacciniavirus
CA2871597A CA2871597C (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
EP13780660.0A EP2841606B1 (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
ES13780660T ES2725673T3 (es) 2012-04-26 2013-04-26 Proteínas de fusión para facilitar la selección de células infectadas con virus vaccinia recombinante de gen de inmunoglobulina específica
SG11201406974YA SG11201406974YA (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
AU2013251371A AU2013251371B2 (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant Vaccinia virus
IL235323A IL235323B (en) 2012-04-26 2014-10-23 Chimeric proteins to aid in the selection of cells infected with vaccinia virus having a specific recombinant immunoglobulin gene

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201261639046P 2012-04-26 2012-04-26
US61/639,046 2012-04-26
US201261732776P 2012-12-03 2012-12-03
US61/732,776 2012-12-03
US13/844,388 US9708601B2 (en) 2012-04-26 2013-03-15 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
US13/844,388 2013-03-15

Publications (1)

Publication Number Publication Date
WO2013163602A1 true WO2013163602A1 (en) 2013-10-31

Family

ID=49477810

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/038497 Ceased WO2013163602A1 (en) 2012-04-26 2013-04-26 Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus

Country Status (16)

Country Link
US (3) US9708601B2 (enExample)
EP (1) EP2841606B1 (enExample)
JP (2) JP6498599B2 (enExample)
KR (1) KR102108589B1 (enExample)
CN (1) CN104520444B (enExample)
AU (1) AU2013251371B2 (enExample)
CA (1) CA2871597C (enExample)
DK (1) DK2841606T3 (enExample)
EA (1) EA028164B1 (enExample)
ES (1) ES2725673T3 (enExample)
IL (1) IL235323B (enExample)
NZ (1) NZ630854A (enExample)
PL (1) PL2841606T3 (enExample)
PT (1) PT2841606T (enExample)
SG (1) SG11201406974YA (enExample)
WO (1) WO2013163602A1 (enExample)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9701958B2 (en) 2012-04-26 2017-07-11 Vaccinex, Inc. Method for selecting polynucleotides encoding antigen-specific immunoglobulin subunits
WO2017184951A1 (en) 2016-04-22 2017-10-26 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
US10640765B2 (en) 2016-08-02 2020-05-05 Vaccinex, Inc. Methods for producing polynucleotide libraries in vaccinia virus/eukaryotic cells
WO2021226169A1 (en) * 2020-05-06 2021-11-11 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
RU2847466C1 (ru) * 2020-05-06 2025-10-06 Вакцинекс, Инк. Дисплей интегральных мембранных белков на поксвирусных внеклеточных вирионах в оболочке

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2427212T3 (pl) 2009-05-08 2018-02-28 Vaccinex, Inc. Przeciwciała anty cd-100 i sposoby ich zastosowania
EA029023B1 (ru) 2011-10-11 2018-01-31 Вэксинекс, Инк. Применение молекул, связывающих семафорин-4d, для модуляции проницаемости гематоэнцефалического барьера
US10494440B2 (en) 2012-05-11 2019-12-03 Vaccinex, Inc. Use of semaphorin-4D binding molecules to promote neurogenesis following stroke
SG10201902380SA (en) 2013-06-25 2019-04-29 Vaccinex Inc Use of semaphorin-4d inhibitory molecules in combination with an immune modulating therapy to inhibit tumor growth and metastases
NZ630881A (en) 2013-10-10 2016-03-31 Vaccinex Inc Use of semaphorin-4d binding molecules for treatment of atherosclerosis
NZ630892A (en) 2013-10-21 2016-03-31 Vaccinex Inc Use of semaphorin-4d binding molecules for treating neurodegenerative disorders
EP3107567A4 (en) * 2014-02-19 2017-10-25 Cangene Corporation Methods of modulating an immune response
KR20170019080A (ko) 2015-08-11 2017-02-21 주식회사 엘티전자 플렉시블 사이니지 장치
EP3402520A4 (en) * 2016-01-14 2019-01-02 BPS Bioscience, Inc. Anti-pd-1 antibodies and uses thereof
IL270244B2 (en) 2017-05-05 2025-01-01 Vaccinex Inc Antibody against human semaphorin 4D
US20240148903A1 (en) * 2021-03-08 2024-05-09 Nanjing GenScript Biotech Co., Ltd. Delivery of antibody by using dual viral vector system
KR20250022808A (ko) 2022-06-10 2025-02-17 백시넥스 인코포레이티드 복합 막 항원에 특이적인 항체를 선택하는 방법
WO2025184411A1 (en) 2024-02-27 2025-09-04 Calidi Biotherapeutics (Nevada), Inc. Serum-resistant eev viruses and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1516932A1 (en) 2000-04-14 2005-03-23 Transgene S.A. Poxvirus with targeted infection specificity
US20050266425A1 (en) * 2003-12-31 2005-12-01 Vaccinex, Inc. Methods for producing and identifying multispecific antibodies
US20090304627A1 (en) * 2008-05-28 2009-12-10 Vgx Pharmaceuticals, Inc. Smallpox dna vaccine and the antigens therein that elicit an immune response
US20100081575A1 (en) * 2008-09-22 2010-04-01 Robert Anthony Williamson Methods for creating diversity in libraries and libraries, display vectors and methods, and displayed molecules

Family Cites Families (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5445953A (en) 1991-08-26 1995-08-29 Immuno Aktiengesellschaft Direct molecular cloning of a modified poxvirus genome
AU694519B2 (en) 1994-04-29 1998-07-23 Immuno Aktiengesellschaft Recombinant poxviruses with foreign polynucleotides in essential regions
US6576754B2 (en) 1995-11-09 2003-06-10 Dana-Farber Cancer Institute CD100 antigen and uses therefor
US6872518B2 (en) 1997-09-22 2005-03-29 University Of Rochester Methods for selecting polynucleotides encoding T cell epitopes
ATE407206T1 (de) 1998-11-10 2008-09-15 Univ Rochester Methoden zu herstellung von genbanken
JP2003528605A (ja) 2000-03-28 2003-09-30 ユニヴァーシティー オヴ ロチェスター ライブラリーを作成する方法および目的のポリヌクレオチドを選択する方法
CA2429544C (en) * 2000-11-17 2010-10-19 University Of Rochester In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells
WO2002062822A2 (en) 2001-02-02 2002-08-15 University Of Rochester Methods of identifying regulator molecules
US9809654B2 (en) 2002-09-27 2017-11-07 Vaccinex, Inc. Targeted CD1d molecules
EP1413316A1 (en) 2002-09-27 2004-04-28 Bruno Robert Bifunctional conjugates or fusion proteins
EP1442749A1 (en) 2003-01-31 2004-08-04 Institut National De La Sante Et De La Recherche Medicale (Inserm) Use of anti-CD100 antibodies for the treatment and the diagnosis of inflammatory disorder affecting the central nervous system
CA2548180C (en) 2003-12-04 2014-02-04 Vaccinex, Inc. Methods of killing tumor cells by targeting internal antigens exposed on apoptotic tumor cells
US8022043B2 (en) 2004-08-27 2011-09-20 Albert Einstein College Of Medicine Of Yeshiva University Ceramide derivatives as modulators of immunity and autoimmunity
KR101377116B1 (ko) 2004-08-27 2014-03-24 알버트 아인슈타인 컬리지 오브 메디신 오브 예쉬바 유니버시티 면역 및 자가면역의 조절제로서의 세라마이드 유도체
US7858599B2 (en) 2005-12-30 2010-12-28 Hander Robert W Enhancement of urogenital function
US9382327B2 (en) 2006-10-10 2016-07-05 Vaccinex, Inc. Anti-CD20 antibodies and methods of use
DE602008004296D1 (de) 2007-02-14 2011-02-17 Vaccinex Inc Humanisierte anti-cd100-antikörper
JP5357782B2 (ja) 2007-02-21 2013-12-04 バクシネックス インコーポレーティッド 抗原負荷CD1d分子によるNKT細胞活性の調節
JP5690593B2 (ja) 2007-12-26 2015-03-25 ヴァクシネックス, インコーポレイテッド 抗c35抗体併用療法および方法
AU2010203451B2 (en) 2009-01-08 2016-06-30 Albert Einstein College Of Medicine, Inc. Bacterial vaccines with cell wall-associated ceramide-like glycolipids and uses thereof
PL2427212T3 (pl) 2009-05-08 2018-02-28 Vaccinex, Inc. Przeciwciała anty cd-100 i sposoby ich zastosowania
WO2011110642A2 (en) * 2010-03-10 2011-09-15 Genmab A/S Monoclonal antibodies against c-met
TW201134488A (en) * 2010-03-11 2011-10-16 Ucb Pharma Sa PD-1 antibodies
SMT201900074T1 (it) * 2010-05-04 2019-02-28 Five Prime Therapeutics Inc Anticorpi che legano csf1r
US8481688B2 (en) * 2010-05-11 2013-07-09 Aveo Pharmaceuticals, Inc. Anti-FGFR2 antibodies
AU2011267869A1 (en) 2010-06-14 2013-01-10 Vaccinex, Inc. Anti-VEGF antibodies and uses thereof
EP2404936A1 (en) * 2010-07-06 2012-01-11 Ganymed Pharmaceuticals AG Cancer therapy using CLDN6 target-directed antibodies in vivo
US8603478B2 (en) * 2010-07-06 2013-12-10 Aveo Pharmaceuticals, Inc. Anti-RON antibodies
EP2591090A4 (en) 2010-07-07 2013-12-25 Einstein Coll Med BACTERIAL VACCINES ASSOCIATED WITH CERAMIDE GLYCOLIPIDS AND USES THEREOF
EP2611832B1 (en) 2010-09-02 2017-11-29 Vaccinex, Inc. Anti-cxcl13 antibodies and methods of using the same
PT2711023T (pt) 2011-05-13 2017-10-02 Univ Nat Corp Tokyo Medical & Dental Promotor da osteogénese
EA029023B1 (ru) 2011-10-11 2018-01-31 Вэксинекс, Инк. Применение молекул, связывающих семафорин-4d, для модуляции проницаемости гематоэнцефалического барьера
US8790652B2 (en) 2011-12-06 2014-07-29 Vaccinex, Inc. Use of the combination of semaphorin-4D inhibitory molecules and VEGF inhibitory molecules to inhibit angiogenesis
CN104520323B (zh) 2012-03-02 2018-05-04 瓦西尼斯公司 用于治疗b细胞介导的炎性疾病的方法
US9090709B2 (en) 2012-03-28 2015-07-28 Vaccinex, Inc. Anti-SEMA4D antibodies and epitopes
US9708601B2 (en) 2012-04-26 2017-07-18 Vaccinex, Inc. Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
US10494440B2 (en) 2012-05-11 2019-12-03 Vaccinex, Inc. Use of semaphorin-4D binding molecules to promote neurogenesis following stroke
JP6363623B2 (ja) 2013-01-31 2018-07-25 ヴァクシネックス, インコーポレイテッド 免疫グロブリンaのレベルを増大するための方法
US9371352B2 (en) 2013-02-08 2016-06-21 Vaccinex, Inc. Modified glycolipids and methods of making and using the same
SG10201902380SA (en) 2013-06-25 2019-04-29 Vaccinex Inc Use of semaphorin-4d inhibitory molecules in combination with an immune modulating therapy to inhibit tumor growth and metastases
NZ630881A (en) 2013-10-10 2016-03-31 Vaccinex Inc Use of semaphorin-4d binding molecules for treatment of atherosclerosis
NZ630892A (en) 2013-10-21 2016-03-31 Vaccinex Inc Use of semaphorin-4d binding molecules for treating neurodegenerative disorders
EP4059516A1 (en) 2016-04-22 2022-09-21 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
SG11201900595YA (en) 2016-08-02 2019-02-27 Vaccinex Inc Improved methods for producing polynucleotide libraries in vaccinia virus/eukaryotic cells
WO2018156509A1 (en) 2017-02-22 2018-08-30 Vaccinex, Inc. Early detection of glial cell activation in neurodegenerative or neuroinflammatory diseases
US11572408B2 (en) 2017-03-20 2023-02-07 Vaccinex, Inc. Treatment of cancer with a semaphorin-4D antibody in combination with an epigenetic modulating agent
IL270244B2 (en) 2017-05-05 2025-01-01 Vaccinex Inc Antibody against human semaphorin 4D

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1516932A1 (en) 2000-04-14 2005-03-23 Transgene S.A. Poxvirus with targeted infection specificity
US20050266425A1 (en) * 2003-12-31 2005-12-01 Vaccinex, Inc. Methods for producing and identifying multispecific antibodies
US20090304627A1 (en) * 2008-05-28 2009-12-10 Vgx Pharmaceuticals, Inc. Smallpox dna vaccine and the antigens therein that elicit an immune response
US20100081575A1 (en) * 2008-09-22 2010-04-01 Robert Anthony Williamson Methods for creating diversity in libraries and libraries, display vectors and methods, and displayed molecules

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Immunology", JOHN WILEY & SONS
BURDEN, R., ET AL.: "Laboratory Techniques in Biochemistry and Molecular Biology", vol. 13, 1984, ELSEVERE, article CAMPBELL, A. ET AL.: "Monoclonal Antibody Technology"
CHAKRABARTI S. ET AL., BIOTECHNIQUES, vol. 23, 1997, pages 1094 - 7
GALMICHE ET AL.: "Expression of a functional single chain antibody on the surface of extracellular enveloped vaccinia virus as a step towards selective tumour cell targeting", JOURNAL OF GENERAL VIROLOGY, vol. 78, 1 November 1997 (1997-11-01), pages 3019 - 3027, XP002173264 *
GEOFFREY L. SMITH ET AL., JOURNAL OF GENERAL VIROLOGY, vol. 83, 2002, pages 2915 - 2931
HAMMOND J.M. ET AL., J VIROL. METHODS, vol. 66, 1997, pages 135 - 8
KENNETT, R., ET AL.: "Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analyses", 1980, PLENUM PRESS
KIM L. ROBERTS; GEOFFREY L. SMITH, TRENDS IN MICROBIOLOGY, vol. 16, no. 10, 2008, pages 472 - 479
KLEIN, J.: "Immunology: The Science of Self-Nonself Discrimination", 1982, JOHN WILEY & SONS
MISHELL AND SHIIGI: "Selected Methods in Cellular Immunology", 1980, W.H. FREEMAN AND CO.
See also references of EP2841606A4
SMITH ET AL.: "Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat", JOURNAL OF GENERAL VIROLOGY, vol. 72, 1 June 1991 (1991-06-01), pages 1349 - 1376, XP000974192 *
STITES ET AL.: "Basic and Clinical -Immunology, 8th ed", 1994, APPLETON & LANGE

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10662422B2 (en) 2012-04-26 2020-05-26 Vaccinex, Inc. Method for selecting polynucleotides encoding antigen-specific immunoglobulin subunit
US9708601B2 (en) 2012-04-26 2017-07-18 Vaccinex, Inc. Fusion proteins to facilitate selection of cells infected with specific immunoglobulin gene recombinant vaccinia virus
US9701958B2 (en) 2012-04-26 2017-07-11 Vaccinex, Inc. Method for selecting polynucleotides encoding antigen-specific immunoglobulin subunits
IL262232B1 (en) * 2016-04-22 2024-02-01 Vaccinex Inc Integral membrane protein display on extracellular enveloped smallpox virions
EP3445397A4 (en) * 2016-04-22 2019-12-25 Vaccinex, Inc. INTEGRAL MEMBRANE PROTEIN DISPLAY ON EXTRA-CELLULAR ENVIRONED VIRIONS OF THE POCKET VIRUS
RU2759846C2 (ru) * 2016-04-22 2021-11-18 Вэксинекс, Инк. Дисплей интегрального мембранного белка на внеклеточных оболочечных вирионах поксвируса
EP4059516A1 (en) * 2016-04-22 2022-09-21 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
WO2017184951A1 (en) 2016-04-22 2017-10-26 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
IL262232B2 (en) * 2016-04-22 2024-06-01 Vaccinex Inc Integral membrane protein display on poxvirus extracellular enveloped virions
US10640765B2 (en) 2016-08-02 2020-05-05 Vaccinex, Inc. Methods for producing polynucleotide libraries in vaccinia virus/eukaryotic cells
WO2021226169A1 (en) * 2020-05-06 2021-11-11 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
US11976383B2 (en) 2020-05-06 2024-05-07 Vaccinex, Inc. Integral membrane protein display on poxvirus extracellular enveloped virions
RU2847466C1 (ru) * 2020-05-06 2025-10-06 Вакцинекс, Инк. Дисплей интегральных мембранных белков на поксвирусных внеклеточных вирионах в оболочке

Also Published As

Publication number Publication date
JP2019055956A (ja) 2019-04-11
US9708601B2 (en) 2017-07-18
CA2871597A1 (en) 2013-10-31
DK2841606T3 (da) 2019-05-06
IL235323B (en) 2020-01-30
CA2871597C (en) 2021-04-20
KR102108589B1 (ko) 2020-05-07
EA028164B1 (ru) 2017-10-31
KR20150009560A (ko) 2015-01-26
PT2841606T (pt) 2019-05-17
ES2725673T3 (es) 2019-09-26
JP2015514811A (ja) 2015-05-21
US20170306318A1 (en) 2017-10-26
US9701958B2 (en) 2017-07-11
PL2841606T3 (pl) 2019-07-31
SG11201406974YA (en) 2014-11-27
AU2013251371A1 (en) 2014-11-13
JP6498599B2 (ja) 2019-04-10
US20160152971A1 (en) 2016-06-02
IL235323A0 (en) 2014-12-31
AU2013251371B2 (en) 2018-01-04
EP2841606A4 (en) 2015-12-30
CN104520444B (zh) 2017-12-12
US20130288927A1 (en) 2013-10-31
US10662422B2 (en) 2020-05-26
EA201491965A1 (ru) 2015-03-31
NZ630854A (en) 2017-03-31
EP2841606B1 (en) 2019-01-23
EP2841606A1 (en) 2015-03-04
CN104520444A (zh) 2015-04-15

Similar Documents

Publication Publication Date Title
US10662422B2 (en) Method for selecting polynucleotides encoding antigen-specific immunoglobulin subunit
US10870707B2 (en) Integral membrane protein display on poxvirus extracellular enveloped virions
JP6043431B2 (ja) 特異的な結合タンパク質または機能性タンパク質の遺伝子転位を利用した同定
US20110076722A1 (en) Stable multivalent antibody
JP7470817B2 (ja) ポックスウイルス細胞外エンベロープビリオン上での膜内在性タンパク質の提示
US20240093177A1 (en) Methods to select antibodies specific to complex membrane antigens
RU2847466C1 (ru) Дисплей интегральных мембранных белков на поксвирусных внеклеточных вирионах в оболочке
CN120624489B (zh) 一种嵌合aqp4抗体受体、caar-t细胞及应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13780660

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2871597

Country of ref document: CA

Ref document number: 2015509201

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013780660

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013251371

Country of ref document: AU

Date of ref document: 20130426

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20147033046

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 201491965

Country of ref document: EA