WO2013152051A2 - Improved production of fatty acid derivatives - Google Patents
Improved production of fatty acid derivatives Download PDFInfo
- Publication number
- WO2013152051A2 WO2013152051A2 PCT/US2013/035037 US2013035037W WO2013152051A2 WO 2013152051 A2 WO2013152051 A2 WO 2013152051A2 US 2013035037 W US2013035037 W US 2013035037W WO 2013152051 A2 WO2013152051 A2 WO 2013152051A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- host cell
- fatty acid
- recombinant host
- fatty
- acp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1288—Transferases for other substituted phosphate groups (2.7.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/011—3-Oxoacyl-[acyl-carrier-protein] reductase (1.1.1.100)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
- C12Y103/01—Oxidoreductases acting on the CH-CH group of donors (1.3) with NAD+ or NADP+ as acceptor (1.3.1)
- C12Y103/01009—Enoyl-[acyl-carrier-protein] reductase (NADH) (1.3.1.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
- C12Y103/01—Oxidoreductases acting on the CH-CH group of donors (1.3) with NAD+ or NADP+ as acceptor (1.3.1)
- C12Y103/0101—Enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific)(1.3.1.10)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01039—[Acyl-carrier-protein] S-malonyltransferase (2.3.1.39)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01041—Beta-ketoacyl-acyl-carrier-protein synthase I (2.3.1.41)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01179—Beta-ketoacyl-acyl-carrier-protein synthase II (2.3.1.179)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/0118—Beta-ketoacyl-acyl-carrier-protein synthase III (2.3.1.180)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/08—Transferases for other substituted phosphate groups (2.7.8)
- C12Y207/08007—Holo-[acyl-carrier-protein] synthase (2.7.8.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/01—Hydro-lyases (4.2.1)
- C12Y402/01059—3-Hydroxyacyl-[acyl-carrier-protein] dehydratase (4.2.1.59)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y503/00—Intramolecular oxidoreductases (5.3)
- C12Y503/03—Intramolecular oxidoreductases (5.3) transposing C=C bonds (5.3.3)
- C12Y503/03014—Trans-2-decenoyl-[acyl-carrier-protein] isomerase (5.3.3.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y604/00—Ligases forming carbon-carbon bonds (6.4)
- C12Y604/01—Ligases forming carbon-carbon bonds (6.4.1)
- C12Y604/01002—Acetyl-CoA carboxylase (6.4.1.2)
Definitions
- the disclosure relates to recombinant host cells including strain modifications effective to improve titer, yield and/or productivity of fatty acid derivatives.
- the disclosure further relates to cell cultures including the recombinant host cells for the fermentative production of fatty acid derivatives and compositions thereof.
- Fatty acid derivatives including fatty aldehydes, fatty alcohols, hydrocarbons (alkanes and olefins), fatty esters (e.g., waxes, fatty acid esters, or fatty esters), and ketones denote important categories of industrial chemicals and fuels. These molecules and their derivatives have numerous applications including, but not limited to, use as surfactants, lubricants, plasticizers, solvents, emulsifiers, emollients, thickeners, flavors, fragrances, and fuels. Crude petroleum is currently a primary source of raw materials for producing petrochemicals and fuels.
- the two main classes of raw materials derived from petroleum are short chain olefins (e.g., ethylene and propylene) and aromatics (e.g., benzene and xylene isomers). These raw materials are derived from longer chain hydrocarbons in crude petroleum by cracking it at considerable expense using a variety of methods, such as catalytic cracking, steam cracking, or catalytic reforming. These raw materials can be used to make petrochemicals such as monomers, solvents, detergents, and adhesives, which otherwise cannot be directly refined from crude petroleum. Petrochemicals, in turn, can be used to make specialty chemicals, such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants, gels, and the like. Particular specialty chemicals that can be produced from petrochemical raw materials include, but are not limited to, fatty acids, hydrocarbons, fatty aldehydes, fatty alcohols, esters, and ketones.
- Hydrocarbons for example, have many commercial uses. As such, shorter chain alkanes and alkenes are used in transportation fuels. Longer chain alkenes are used in plastics, lubricants, and synthetic lubricants. In addition, alkenes are used as a feedstock to produce alcohols, esters, plasticizers, surfactants, tertiary amines, enhanced oil recovery agents, fatty acids, thiols, alkenylsuccinic anhydrides, epoxides, chlorinated alkanes, chlorinated alkenes, waxes, fuel additives, and drag flow reducers. Similarly, esters have many commercial uses.
- biodiesel an alternative fuel, is made of esters (e.g., fatty acid methyl ester, fatty acid ethyl esters, etc.).
- esters are volatile with a pleasant odor which makes them useful as fragrances or flavoring agents.
- esters are used as solvents for lacquers, paints, and varnishes.
- some naturally occurring substances such as waxes, fats, and oils are also made of esters.
- Esters are further used as softening agents in resins and plastics, plasticizers, flame retardants, and additives in gasoline and oil.
- esters can be used in the manufacture of polymers, films, textiles, dyes, and pharmaceuticals.
- Aldehydes are used to produce a large number of specialty chemicals. For example, aldehydes are used to produce polymers, resins (e.g., Bakelite), dyes, flavorings, plasticizers, perfumes, pharmaceuticals, and other chemicals, some of which may be used as solvents, preservatives, or disinfectants. In addition, certain natural and synthetic compounds, such as vitamins and compounds used as hormones are aldehydes. Furthermore, many sugars contain aldehyde groups. Fatty aldehydes can be converted to fatty alcohols by chemical or enzymatic reduction. Similarly, fatty alcohols have many commercial uses as well.
- the shorter chain fatty alcohols are used in the cosmetic and food industries as emulsifiers, emollients, and thickeners. Due to their amphiphilic nature, fatty alcohols behave as nonionic surfactants, which are useful in personal care and household products, such as, for example, detergents. In addition, fatty alcohols are used in waxes, gums, resins, pharmaceutical salves and lotions, lubricating oil additives, textile antistatic and finishing agents, plasticizers, cosmetics, industrial solvents, and solvents for fats. Fatty alcohols such as aliphatic alcohols include a chain of 8 to 22 carbon atoms.
- Fatty alcohols usually have an even number of carbon atoms and a single alcohol group (-OH) attached to the terminal carbon. Some are unsaturated and some are branched. They are widely used in industrial chemistry. Most fatty alcohols in nature are found as waxes which are esters with fatty acids and fatty alcohols. They are produced by bacteria, plants and animals. Currently, fatty alcohols are produced via catalytic hydrogenation of fatty acids produced from natural sources, such as coconut oil, palm oil, palm kernel oil, tallow and lard, or by chemical hydration of alpha-olefins produced from petrochemical feedstocks. Fatty alcohols derived from natural sources have varying chain lengths. The chain length of fatty alcohols is important and specific to particular applications. Dehydration of fatty alcohols to alpha-olefins can also be accomplished by chemical catalysis.
- Bioly derived fuels and chemicals offer advantages over petroleum based fuels.
- Biologically derived chemicals such as hydrocarbons (e.g., alkanes, alkenes, or alkynes), fatty alcohols, esters, fatty acids, fatty aldehydes, and ketones are directly converted from biomass to the desired chemical product.
- hydrocarbons e.g., alkanes, alkenes, or alkynes
- fatty alcohols e.g., esters, fatty acids, fatty aldehydes, and ketones
- One aspect of the disclosure provides a recombinant host cell having a genetically engineered polynucleotide sequence, wherein the polynucleotide sequence codes for one or more polypeptides that have a specific enzymatic activity.
- the polynucleotide sequence is exogenous or endogenous to the host cell.
- the disclosure provides a recombinant host cell having a genetically engineered polynucleotide sequence encoding one or more polypeptides, wherein the polypeptides have activity selected from the group including, but not limited to, 3- hydroxydecanoyl-[acp] dehydratase (E.C.
- the recombinant host cell produces the fatty acid derivative composition at a higher titer, yield and/or productivity when the polypeptide is expressed in combination with at least one other polypeptide of the enzymatic activity. In another aspect, the recombinant host cell produces the fatty acid derivative composition at a higher titer, yield or productivity when the polypeptide is expressed in combination with at least five other polypeptides of the enzymatic activity. In yet another aspect, the recombinant host cell produces the fatty acid derivative composition at a higher titer, yield or productivity when expressed in combination with at least two or three or four or five or six or more polypeptides of the enzymatic activity.
- the recombinant host cell includes one or more genetically engineered polynucleotide sequences that further code for a polypeptide that is an acyl carrier protein (ACP).
- ACP can be in expressed in combination with one or more of the polypeptides that code for any of the enzymatic activities, wherein the ACP further increases the titer, yield and/or productivity of the recombinant host cell when cultured under appropriate conditions.
- a genetically engineered polynucleotide sequence further encodes a polypeptide that has accABCD activity (E.C. 6.4.1.2).
- accABCD can be in expressed in combination with one or more of the polypeptides that code for any of the enzymatic activities, wherein the accABCD further increases the titer, yield and/or productivity of the recombinant host cell when cultured under appropriate conditions.
- Another aspect of the disclosure provides a recombinant host cell having a genetically engineered polynucleotide sequence encoding one or more polypeptides, wherein the
- polypeptides have enzymatic activity including, but not limited to, trans-2, cis-3-decenoyl-ACP isomerase activity (fabA or fabM); ⁇ -ketoacyl-ACP synthase I (fabB); malonyl-CoA-ACP transacylase (fabD); ⁇ -ketoacyl-ACP synthase I (fabF or fabB); ⁇ -ketoacyl-ACP reductase (fabG); ⁇ -ketoacyl-ACP synthase III (fabH); enoyl-ACP reductase (fabl or fabL or fabV or fabK); and 3-hydrox-acyl-[acp] dehydratase (fabA or fabZ); trans-2-enoyl-ACP reductase II (fabK).
- fabricA or fabM trans-2, cis-3-decenoyl-ACP isomerase activity
- the polypeptide is selected from fabA, fabB, fabD, fabF, fabG, fabH, fabl, fabL, fabV, fabZ, fabM, and fabK and or combinations thereof.
- the polypeptide is selected from FabA from Salmonella typhimiirhim (NP_460041); FabB from Escherichia coli (NP_416826); FabD from Salmonella typhimiirhim (NP_460164); FabG from Salmonella typhimiirhim (NP_460165); FabH from Salmonella typhimiirhim (NP_460163); FabZ from Salmonella typhimurium (NP_459232); FabM from Streptococcus mutans
- AAN59379 FabK from Streptococcus pneumoniae (AAF98273); FabV from Vibrio cholera (YP_001217283); FabF from Clostridium acetobutylicum (NP_350156); Fabl from Bacillus subtillis subsp. subtilis str. 168 (NP_389054); FabL from Bacillus subtillis subsp. subtilis str. 168 (NP_388745); Fabl from Acinetobacter sp.
- ADP1 (YP_047630); Fabl from Marinobacter aquaeoli VT8 (YP_ 958813); Fabl from Rhodococcus opacus B4 (YP_002784194); FabH from Acinetobacter sp.
- ADP1 (YP_046731); FabH from Marinobacter aquaeoli VT8 (YP_958649); and FabH from Rhodococcus opacus B4 (YP_00278448) or combinations thereof.
- the disclosure further contemplates a recombinant host cell having a genetically engineered polynucleotide sequence encoding an ACP polypeptide, wherein the recombinant host cell produces a fatty acid derivative composition at a higher titer, yield or productivity than a corresponding wild type host cell when cultured in a medium containing a carbon source under conditions effective to express the ACP polypeptide.
- the genetically engineered polynucleotide sequence further encodes a polypeptide that has phosphopantetheinyl transferase (E.C. 2.7.8.7) activity.
- the genetically engineered polynucleotide sequence includes a sfp gene coding encoding a phosphopantetheinyl transferase (E.C. 2.7.8.7).
- a genetically engineered polynucleotide sequence further encodes a polypeptide that has accABCD activity (E.C. 6.4.1.2).
- ACP can be in expressed in combination with accABCD and/or a phosphopantetheinyl transferase, wherein the combination of any of the expressed polypeptides further leads to increases in the titer, yield and/or productivity of the recombinant host cell when cultured under appropriate conditions.
- ACP is derived from the same organism as a terminal pathway enzyme expressed in the recombinant host cell, wherein the terminal enzyme cleaves any acyl-ACP species that is part of the fatty acid biosynthetic pathway.
- the ACP is exogenous or endogenous to the host cell.
- the disclosure further encompasses a recombinant host cell including a genetically engineered polynucleotide sequence including a transposon, wherein insertion of the transposon into ayijP gene affects a second gene flanking the yijP gene, wherein the second gene codes for a polynucleotide that is up- or down regulated, and wherein the up- or down regulated polynucleotide codes for a polypeptide that affects production of a fatty acid derivative composition when the host cell is cultured in a medium containing a carbon source under conditions effective to express the polypeptide.
- the yijP gene can be flanlced by genes on either side.
- the insertion of the transposon into the yijP gene results in inactivation of the yijP gene or a polynucleotide thereof, which affects one or more of the genes flanking the yijP gene, wherein the flanking gene or genes code for a polypeptide that affects production of a fatty acid derivative composition when the host cell is cultured in a medium containing a carbon source under conditions effective to express the polypeptide.
- the flanking gene includes polynucleotides including, but not limited to, ppc, yijO, frwD, pflQ pflD or argE.
- Another aspect of the disclosure provides a recombinant host cell including a genetically engineered polynucleotide sequence encoding a phosphoenolpyruvate carboxylase (ppc) polypeptide, wherein the recombinant host cell produces a fatty acid derivative composition at a higher titer, yield or productivity than a corresponding wild type host cell when cultured in a medium containing a carbon source under conditions effective to express the ppc polypeptide.
- ppc phosphoenolpyruvate carboxylase
- a cell culture that includes any of the recombinant host cells presented herein (supra).
- the recombinant host cell is cultured in a medium such that the recombinant host cell produces fatty acid derivative compositions according to the genetic engineering methods presented herein (supra).
- the fatty acid derivative compositions produced by the recombinant host cells of the present disclosure include, but are not limited to, fatty acids, fatty esters, fatty alcohols, fatty aldehydes, alkanes, terminal olefins, internal olefins, and ketones.
- the fatty acid derivative is a C6, C8, CIO, C12, C13, C14, C15, C16, C17, or C18 fatty acid derivative.
- the fatty acid derivative is a C10:l, C12:l, C14: l, C16:l, or C18: l unsaturated fatty acid derivative.
- the fatty acid derivative composition comprises one or more of C8, CIO, C12, C14, C16, and C18 fatty acid derivatives.
- the fatty acid derivative compositions produced by the cell cultures containing the recombinant host cells of the present disclosure include fatty acids, fatty aldehydes, fatty alcohols, fatty esters, alkanes, terminal olefins, internal olefins, and ketones.
- the disclosure further encompasses fatty acid derivative compositions that include fatty acid derivatives having a double bond at position 7 in the carbon chain between C7 and C8 from the reduced end of the fatty alcohol; fatty acid derivative compositions including unsaturated fatty acid derivatives; fatty acid derivative compositions including saturated fatty acid derivatives; and fatty acid derivative compositions including branched chain fatty acid derivatives.
- the disclosure further contemplates a cell culture containing any of the recombinant host cells presented herein, wherein the recombinant host cells have a titer that is at least about 5% greater than the titer of the corresponding wild type host cells when cultured under the same conditions as the recombinant host cells.
- the recombinant host cells have a titer of from about lg/L to about 250g/L, and more specifically from about 90 g/L to about 120g/L.
- the recombinant host cells have a yield that is at least about 10% to about 40%.
- the recombinant host cells have a yield of about 25%.
- Still encompassed herein is a cell culture containing any one of the recombinant host cells presented herein, wherein the productivity of the cell culture ranges from about 0.7mg/L/hr to about 3g/L/hr or higher.
- Another aspect of the disclosure provides methods of making a recombinant host cell, including genetically engineering the recombinant host cell such that the cell expresses a polypeptide sequence that is encoded by one or more polynucleotide sequences under specific culture conditions, wherein the polynucleotide sequence codes for one or more polypeptides that have a specific enzymatic activity.
- Figure 1 presents an exemplary biosynthetic pathway for use in production of acyl CoA as a precursor to fatty acid derivatives in a recombinant microorganism. The cycle is initiated by condensation of malonyl-ACP and acetyl-CoA.
- Figure 2 presents an exemplary fatty acid biosynthetic cycle, where malonyl-ACP is produced by the transacylation of malonyl-CoA to malonyl-ACP (catalyzed by malonyl- CoA:ACP transacylase (fabD)); then ⁇ -ketoacyl-ACP synthase III (fabH) initiates condensation of malonyl-ACP with acetyl-CoA.
- fabricD malonyl- CoA:ACP transacylase
- fabH ⁇ -ketoacyl-ACP synthase III
- Elongation cycles begin with the condensation of malonyl- ACP and an acyl-ACP catalyzed by ⁇ -ketoacyl-ACP synthase I (fabB) and ⁇ -ketoacyl-ACP synthase II (fabF) to produce a ⁇ -keto-acyl-ACP, then the ⁇ -keto-acyl-ACP is reduced by ⁇ - ketoacyl-ACP reductase (fabG) to produce a ⁇ -hydroxy-acyl-ACP, which is dehydrated to a by ⁇ -hydroxyacyl-ACP dehydratase (fabA or fabZ).
- fabricG ⁇ - ketoacyl-ACP reductase
- FabA can also isomerize /raws ⁇ -enoyl-acyl-ACP to cw-3-enoyl-acyl-ACP, which can bypass fabl and can used by fabB (typically for up to an aliphatic chain length of C16) to produce ⁇ -keto-acyl-ACP.
- the final step in each cycle is catalyzed by enoyl-ACP reductase (fabl) that converts trans-2-enoyl- acyl-ACP to acyl-ACP.
- termination of fatty acid synthesis occurs by thioesterase removal of the acyl group from acyl-ACP to release free fatty acids (FFA).
- Thioesterases e.g., tesA
- hydrolyze thioester bonds which occur between acyl chains and ACP through sulfydryl bonds.
- FIG. 3 illustrates the structure and function of the acetyl-CoA carboxylase (accABCD) enzyme complex.
- BirA biotinylates accB, the biotin carboxyl carrier protein, which is part of the acetyl-CoA carboxylase enzyme complex.
- Figure 4 presents an overview of an exemplary biosynthetic pathway for production of fatty alcohol starting with acyl-ACP, where the production of fatty aldehyde is catalyzed by the enzymatic activity of acyl-ACP reductase (AAR) or thioesterase (TE) and carboxylic acid reductase (Car).
- AAR acyl-ACP reductase
- TE thioesterase
- Car carboxylic acid reductase
- the fatty aldehyde is converted to fatty alcohol by aldehyde reductase (also referred to as alcohol dehydrogenase).
- aldehyde reductase also referred to as alcohol dehydrogenase
- Figure 5 presents an overview of two exemplary biosynthetic pathways for production of fatty esters starting with acyl-ACP, where the production of fatty esters is accomplished by a one-enzyme system or a three-enzyme-system.
- Figure 6 presents an overview of exemplary biosynthetic pathways for production of hydrocarbons starting with acyl-ACP; the production of internal olefins is catalyzed by the enzymatic activity of OleABCD; the production of alkanes is catalyzed by the enzymatic conversion of fatty aldehydes to alkanes by way of aldehyde decarbonylase (ADC); and the production of terminal olefins is catalyzed by the enzymatic conversion of fatty acids to terminal olefins by a decarboxylase.
- ADC aldehyde decarbonylase
- Figure 7 illustrates fatty acid derivative (Total Fatty Species) production by the MG1655 E. coli strain with the fadE gene attenuated ⁇ i.e., deleted) compared to fatty acid derivative production by E. coli MG1655.
- the data presented in Fig. 7 shows that attenuation of the fadE gene did not affect fatty acid derivative production
- Figure 8 shows malonyl-CoA levels in DAMM377 in log phase, expressing eight different C. glutamicum acetyl-CoA carboxylase (Acc) operon constructs.
- Figure 9 shows intracellular short chain-CoA levels in E. coli DAMl_i377 in log phase expressing ptrcl/3_accDACB-birA ⁇ panK operon constructs.
- accDACB+birA is also referred to herein as accD+.
- Figure 10 shows fatty acid methyl ester (FAME) production in E. coli strain DV2 expressing ester synthase 9 from M. hydrocarbonoclastic s and components of an acetyl-CoA carboxylase complex from C. glutamicum.
- FAME fatty acid methyl ester
- Figure 11 shows production of fatty alcohols by E. coli expressing the
- Figures 12A and 12B show data for production of Total Fatty Species (mg/L) from duplicate plate screens when plasmid pCL_P trc _tesA was transformed into each of the iFAB- containing strains shown in the figures and a fermentation was run in FA2 media with 20 hours from induction to harvest at both 32°C ( Figure 12A) and 37°C ( Figure 12B).
- Figure 13 shows FAME production of E. coli DAMlwith plasmid pDS57 and integrated fabHI operons.
- the fabH/I genes are from Marinobacter aquaeoli VT8 or from Acinetobacter baylyi ADP1. See Table 7 for a more details on the fabH/I operons in these strains.
- Figure 14 shows FAME production of E. coli DAMlwith plasmid pDS57 and different configurations of the C. glutamicum acc genes as well as integrated fabHI operons.
- the strains contain the fabH/I genes from Rhodococcus opacus or Acinetobacter baylyi ADP1. See Table 7 for more details on the fabH/I and acc operons.
- Figure 15 shows FAME and FFA titers of two E. coli DAM1 pDS57 strains with integrated fabH/I genes strains selected from figure 13 compared to the control strain E. coli DAM1 pDS57.
- Figure 16 is a diagrammatic depiction of the iFAB138 locus, including a diagram of cat-loxP-Px 5 cassette integrated in front of iFAB138 ( Figure 16 A); and a diagram of the
- Figure 17 shows that strain V668, which has the lph and ilvG genes repaired, produced a higher level of FFA than EG149, which has neither of the genes repaired.
- FIG. 18 is a diagrammatic depiction of a transposon cassette insertion in the yijP gene of strain LC535 (transposon hit 68F11). Promoters internal to the transposon cassette are shown, and may have effects on adjacent gene expression.
- Figure 19 illustrates fatty alcohol production in E. coli DV2 expressing
- AAR Synechococcus elongatus acyl-ACP reductase
- ACPs various cyanobacterial acyl carrier proteins
- Figure 20 illustrates fatty acid production in E. coli DV2 expressing leaderless E. coli thioesterase 'tesA and coexpressing a cyanobacterial acyl carrier protein (cACP) and B. subtilis sfp. DETAILED DESCRIPTION
- the disclosure is based, at least in part, on the discovery that modification of various aspects of the fatty acid biosynthetic pathway in a recombinant host cell facilitates enhanced production of fatty acid derivatives by the host cell.
- the disclosure relates to compositions of fatty acid derivatives having desired characteristics and methods for producing the same.
- the disclosure relates to recombinant host cells (e.g., microorganisms), cultures of recombinant host cells, methods of making and using recombinant host cells, for example, use of cultured recombinant host cells in the fermentative production of fatty acid derivatives having desired characteristics.
- recombinant host cells e.g., microorganisms
- cultures of recombinant host cells e.g., microorganisms
- methods of making and using recombinant host cells for example, use of cultured recombinant host cells in the fermentative production of fatty acid derivatives having desired characteristics.
- a desired fatty acid derivative composition e.g., acyl-CoA, fatty acids, fatty aldehydes, short and long chain alcohols, hydrocarbons, fatty alcohols, esters (e.g., waxes, fatty acid esters, or fatty esters), terminal olefins, internal olefins, and ketones is enhanced by modifying the expression of one or more genes involved in a biosynthetic pathway for fatty acid, fatty ester, alkane, alkene, olefin, or fatty alcohol, production, degradation and/or secretion.
- a desired fatty acid derivative composition e.g., acyl-CoA, fatty acids, fatty aldehydes, short and long chain alcohols, hydrocarbons, fatty alcohols, esters (e.g., waxes, fatty acid esters, or fatty esters), terminal olefins, internal olefins, and ketones is enhanced by modifying the expression
- the disclosure provides recombinant host cells which have been engineered to provide enhanced fatty acid biosynthesis relative to non-engineered or native host cells (e.g., wild type host cells that function as control cells), which is accomplished, for example, through strain improvements.
- non-engineered or native host cells e.g., wild type host cells that function as control cells
- the disclosure identifies polynucleotides useful in the recombinant host cells, methods, and compositions of the disclosure. It will be generally recognized that absolute sequence identity to such polynucleotides is not necessary. For example, changes in a particular polynucleotide sequence can be made and the encoded polypeptide screened for activity. Such changes typically comprise conservative mutations and silent mutations (e.g., codon optimization).
- Genetically engineered or modified polynucleotides and encoded variant polypeptides can be screened for a desired function, including but not limited to, increased catalytic activity, increased stability, or decreased inhibition (e.g., decreased feedback inhibition), using methods known in the art.
- the disclosure identifies enzymatic activities involved in various steps (i. e., reactions) of the fatty acid biosynthetic pathways described herein according to Enzyme
- EC Classification
- polypeptides e.g.,enzymes
- exemplary polynucleotides encoding such polypeptides.
- Such exemplary polypeptides and polynucleotides which are identified herein by Accession Numbers and/or Sequence Identifier Numbers (SEQ ID NOs), are useful for engineering fatty acid pathways in parental host cells to obtain the recombinant host cells described herein.
- SEQ ID NOs are exemplary and non-limiting.
- sequences of homologues of exemplary polypeptides described herein are available to those of skill in the art through various databases (e.g., rhw Entrez databases provided by the National Center for Biotechnology Information (NCBI) , the ExPasy databases provided by the Swiss Institute of Bioinformatics, the BRENDA database provided by the Technical University of Braunschweig, and the KEGG database provided by the Bioinformatics Center of Kyoto University and University of Tokyo, all which are available on the World Wide Web).
- NCBI National Center for Biotechnology Information
- a recombinant host cell includes two or more such recombinant host cells
- reference to “a fatty alcohol” includes one or more fatty alcohols, or mixtures of fatty alcohols
- reference to “a nucleic acid coding sequence” includes one or more nucleic acid coding sequences
- reference to “an enzyme” includes one or more enzymes, and the like.
- NCBI Accession Numbers are identified herein as “NCBI Accession Numbers” or alternatively as “GenBank Accession Numbers”
- UniProtKB Accession Numbers are identified herein as “UniProtKB Accession Numbers”.
- Enzyme Classification (EC) Numbers are established by the
- IUBMB International Union of Biochemistry and Molecular Biology
- nucleotide refers to a monomeric unit of a polynucleotide that consists of a heterocyclic base, a sugar, and one or more phosphate groups.
- the naturally occurring bases are typically derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included.
- the naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included.
- Nucleic acids are typically linked via phosphate bonds to form nucleic acids or polynucleotides, though many other linkages are known in the art ⁇ e.g., phosphorothioates, boranophosphates, and the like).
- polynucleotide refers to a polymer of ribonucleotides (RNA) or deoxyribonucleotides (DNA), which can be single-stranded or double-stranded and which can contain non-natural or altered nucleotides.
- RNA ribonucleotides
- DNA deoxyribonucleotides
- polynucleotide refers to a polymeric form of nucleotides of any length, either RNA or DNA. These terms refer to the primary structure of the molecule, and thus include double- and single-stranded DNA, and double- and single-stranded RNA.
- RNA or DNA made from nucleotide analogs and modified polynucleotides such as, though not limited to methylated and/or capped polynucleotides.
- the polynucleotide can be in any form, including but not limited to, plasmid, viral, chromosomal, EST, cDNA, mRNA, and rRNA.
- polypeptide and “protein” are used interchangeably to refer to a polymer of amino acid residues.
- recombinant polypeptide refers to a polypeptide that is produced by recombinant techniques, wherein generally DNA or RNA encoding the expressed protein is inserted into a suitable expression vector that is in turn used to transform a host cell to produce the polypeptide.
- homologous polynucleotide or a polypeptide comprising a sequence that is at least about 50% identical to the corresponding polynucleotide or polypeptide sequence.
- polypeptides have polynucleotide sequences or amino acid sequences that have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%), 97%, 98%> or at least about 99% homology to the corresponding amino acid sequence or polynucleotide sequence.
- identity are used interchangeably.
- sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison memeposes).
- the length of a first sequence that is aligned for comparison purposes is at least about 30%, preferably at least about 40%, more preferably at least about 50%, even more preferably at least about 60%, and even more preferably at least about 70%), at least about 75%, at least about 80%>, at least about 85%, at least about 90%), at least about 95%, or about 100% of the length of a second sequence.
- the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions of the first and second sequences are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the percent homology between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, that need to be introduced for optimal alignment of the two sequences.
- the comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algoritlim, such as BLAST (Altschul et al., J. Mol. Biol, 215(3): 403-410 (1990)).
- the percent homology between two amino acid sequences also can be determined using the Needleman and Wunsch algorithm that has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6 (Needleman and Wunsch, J. Mol. Biol., 48: 444-453 (1970)).
- the percent homology between two nucleotide sequences also can be determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
- One of ordinary skill in the art can perform initial homology calculations and adjust the algorithm parameters accordingly.
- a preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
- hybridizes under low stringency, medium stringency, high stringency, or very high stringency conditions describes conditions for hybridization and washing.
- Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 - 6.3.6. Aqueous and non-aqueous methods are described in that reference and either method can be used.
- Specific hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions - 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by two washes in 0.2X SSC, 0.1% SDS at least at 50°C (the temperature of the washes can be increased to 55°C for low stringency conditions); 2) medium stringency hybridization conditions ⁇ 6X SSC at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 60°C; 3) high stringency hybridization conditions ⁇ 6X SSC at about 45°C, followed by one or more washes in 0.2.X SSC, 0.1% SDS at 65°C; and 4) very high stringency hybridization conditions - 0.5M sodium phosphate, 7% SDS at 65°C, followed by one or more washes at 0.2X SSC, 1% SDS at 65°C. Very high stringency conditions (4) are the preferred conditions unless otherwise specified.
- An "endogenous" polypeptide refers to a polypeptide encoded by the genome of the host cell (e.g., parental microbial cell) from which the recombinant cell is engineered or derived.
- exogenous polypeptide refers to a polypeptide which is not encoded by the genome of the parental microbial cell.
- variant (i.e., mutant) polypeptide is an example of an exogenous polypeptide.
- heterologous generally means derived from a different species or derived from a different organism. As used herein it refers to a nucleotide sequence or a polypeptide sequence that is not naturally present in a particular organism. Heterologous expression means that a protein or polypeptide is experimentally added to a cell that does not normally express that protein. As such, heterologous refers to the fact that a transferred protein was initially derived from a different cell type or a different species then the recipient.
- a polynucleotide sequence endogenous to a plant cell can be introduced into a bacterial host cell by recombinant methods, and the plant polynucleotide is then a heterologous polynucleotide in a recombinant bacterial host cell.
- fragment of a polypeptide refers to a shorter portion of a full-length polypeptide or protein ranging in size from four amino acid residues to the entire amino acid sequence minus one amino acid residue. In certain embodiments of the disclosure, a fragment refers to the entire amino acid sequence of a domain of a polypeptide or protein (e.g., a substrate binding domain or a catalytic domain).
- mutagenesis refers to a process by which the genetic information of an organism is changed in a stable manner. Mutagenesis of a protein coding nucleic acid sequence produces a mutant protein. Mutagenesis also refers to changes in non- coding nucleic acid sequences that result in modified protein activity.
- the term "gene” refers to nucleic acid sequences encoding either an RNA product or a protein product, as well as operably-linked nucleic acid sequences affecting the expression of the RNA or protein (e.g., such sequences include but are not limited to promoter or enhancer sequences) or operably-linked nucleic acid sequences encoding sequences that affect the expression of the RNA or protein (e.g., such sequences include but are not limited to ribosome binding sites or translational control sequences).
- Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, that provide for the expression of the polynucleotide sequence in a host cell.
- Expression control sequences interact specifically with cellular proteins involved in transcription (Maniatis et al., Science, 236: 1237-1245 (1987)).
- Exemplary expression control sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).
- an expression control sequence is operably linked to a polynucleotide sequence.
- operably linked is meant that a polynucleotide sequence and an expression control sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the expression control sequence(s).
- Operably linked promoters are located upstream of the selected polynucleotide sequence in terms of the direction of transcription and translation.
- Operably linked enhancers can be located upstream, within, or downstream of the selected polynucleotide.
- vector refers to a nucleic acid molecule capable of transporting another nucleic acid, i.e., a polynucleotide sequence, to which it has been linked.
- a useful vector is an episome (i.e., a nucleic acid capable of extra-chromosomal replication).
- Useful vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked.
- telomeres Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors.”
- expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids,” which refer generally to circular double stranded DNA loops that, in their vector form, are not bound to the chromosome.
- plasmid and vector are used interchangeably herein, in as much as a plasmid is the most commonly used form of vector.
- a recombinant vector further comprises a promoter operably linked to the polynucleotide sequence.
- the promoter is a developmentally-regulated, an organelle-specific, a tissue-specific, an inducible, a constitutive, or a cell-specific promoter.
- the recombinant vector typically comprises at least one sequence including (a) an expression control sequence operatively coupled to the polynucleotide sequence; (b) a selection marker operatively coupled to the polynucleotide sequence; (c) a marker sequence operatively coupled to the polynucleotide sequence; (d) a purification moiety operatively coupled to the polynucleotide sequence; (e) a secretion sequence operatively coupled to the polynucleotide sequence; and (f) a targeting sequence operatively coupled to the polynucleotide sequence.
- the nucleotide sequence is stably incorporated into the genomic DNA of the host cell, and the expression of the nucleotide sequence is under the control of a regulated promoter region.
- polynucleotide sequence described herein in a form suitable for expression of the polynucleotide sequence in a host cell. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of polypeptide desired, etc.
- the expression vectors described herein can be introduced into host cells to produce polypeptides, including fusion polypeptides, encoded by the polynucleotide sequences as described herein. [0062] Expression of genes encoding polypeptides in prokaryotes, for example, E. coli, is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion polypeptides.
- Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino- or carboxy-terminus of the recombinant polypeptide.
- Such fusion vectors typically serve one or more of the following three purposes: (1) to increase expression of the recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide; and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide.
- a polynucleotide sequence of the disclosure is operably linked to a promoter derived from bacteriophage T5.
- the host cell is a yeast cell
- the expression vector is a yeast expression vector.
- yeast expression vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al., EMBO J., 6: 229-234 (1987)), pMFa (Kurjan et al., Cell, 30: 933-943 (1982)), pJRY88 (Schultz et al., Gene, 54: 1 13-123 (1987)), pYES2 (Invitrogen Corp., San Diego, CA), and picZ (Invitrogen Corp., San Diego, CA).
- the host cell is an insect cell
- the expression vector is a baculovirus expression vector.
- Baculovirus vectors available for expression of proteins in cultured insect cells include, for example, the pAc series (Smith et al., Mol. Cell Biol., 3 : 2156-2165 (1983)) and the pVL series (Lucklow et al., Virology, 170: 31-39 (1989)).
- polynucleotide sequences described herein can be expressed in mammalian cells using a mammalian expression vector.
- suitable expression systems for both prokaryotic and eukaryotic cells are well known in the art; see, e.g.,
- corresponding wild type host cell means a cell that functions as a control cell. For example, if a polypeptide in a recombinant host cell is up- regulated, then the same polypeptide would exist at a lower level in the control cell. Conversely, if a polypeptide in a recombinant host cell is down-regulated, then the same polypeptide would exist at a higher level in the control cell.
- the "recombinant or engineered host cell” is a microorganism used to produce one or more of fatty acid derivatives including, for example, acyl-CoA, fatty acids, fatty aldehydes, short and long chain alcohols, hydrocarbons, fatty alcohols, esters ⁇ e.g., waxes, fatty acid esters, or fatty esters), terminal olefins, internal olefins, and ketones.
- the recombinant host cell comprises one or more polynucleotides, each polynucleotide encoding a polypeptide having fatty acid biosynthetic enzyme activity.
- acyl-CoA refers to an acyl thioester formed between the carbonyl carbon of alkyl chain and the sulfhydryl group of the 4'-phosphopantethionyl moiety of coenzyme A (CoA), which has the formula R-C(0)S-CoA, where R is any alkyl group having at least 4 carbon atoms.
- acyl-ACP refers to an acyl thioester formed between the carbonyl carbon of alkyl chain and the sulfhydryl group of the phosphopantetheinyl moiety of an acyl carrier protein (ACP).
- ACP acyl carrier protein
- the phosphopantetheinyl moiety is post-translationally attached to a conserved serine residue on the ACP by the action of holo-acyl carrier protein synthase (ACPS), a phosphopantetheinyl transferase.
- ACPS holo-acyl carrier protein synthase
- an acyl-ACP is an intermediate in the synthesis of fully saturated acyl-ACPs.
- an acyl-ACP is an intermediate in the synthesis of unsaturated acyl-ACPs.
- the carbon chain will have about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 carbons.
- Each of these acyl-ACPs are substrates for enzymes that convert them to fatty acid derivatives.
- fatty acid derivative means a "fatty acid” or a “fatty acid derivative”, which may be referred to as a "fatty acid or derivative thereof.
- fatty acid means a carboxylic acid having the formula RCOOH.
- R represents an aliphatic group, preferably an alkyl group.
- R can comprise between about 4 and about 22 carbon atoms.
- Fatty acids can be saturated, monounsaturated, or polyunsaturated.
- a “fatty acid derivative” is a product made in part from the fatty acid biosynthetic pathway of the production host organism.
- “Fatty acid derivatives” includes products made in part from acyl-ACP or acyl-ACP derivatives.
- Exemplary fatty acid derivatives include, for example, acyl-CoA, fatty acids, fatty aldehydes, short and long chain alcohols, fatty alcohols, hydrocarbons, esters (e.g., waxes, fatty acid esters, or fatty esters), terminal olefins, internal olefins, and ketones.
- a "fatty acid derivative composition" as referred to herein is produced by a recombinant host cell and typically comprises a mixture of fatty acid derivative. In some cases, the mixture includes more than one type of product (e.g., fatty acids and fatty alcohols, fatty acids and fatty acid esters or alkanes and olefins).
- the fatty acid derivative compositions may comprise, for example, a mixture of fatty alcohols (or another fatty acid derivative) with various chain lengths and saturation or branching characteristics.
- the fatty acid derivative composition comprises a mixture of both more than one type of product and products with various chain lengths and saturation or branching characteristics.
- fatty acid biosynthetic pathway means a biosynthetic pathway that produces fatty acids and derivatives thereof.
- the fatty acid biosynthetic pathway may include additional enzymes or polypeptides with enzymatic activities besides the ones discussed herein to produce fatty acid derivatives having desired characteristics.
- the R group is 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, or 6 or less carbons in length.
- the R group can have an R group bounded by any two of the above endpoints.
- the R group can be 6-16 carbons in length, 10-14 carbons in length, or 12-18 carbons in length.
- the fatty aldehyde is a C6, C7, C8, C9, CIO, CI 1, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 , C22, C23, C24, C25, or a C26 fatty aldehyde.
- the fatty aldehyde is a C6, C7, C8, C9, CI O, CI 1, C12, C13, C14, C15, CI 6, CI 7, or CI 8 fatty aldehyde.
- fatty alcohol means an alcohol having the formula ROH.
- the R group is at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, carbons in length.
- the R group is 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 1 1 or less, 10 or less, 9 or less, 8 or less, 7 or less, or 6 or less carbons in length.
- the R group can have an R group bounded by any two of the above endpoints.
- the R group can be 6-16 carbons in length, 10-14 carbons in length, or 12-18 carbons in length.
- the fatty alcohol is a C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, or a C26 fatty alcohol.
- the fatty alcohol is a C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, or C18 fatty alcohol.
- the R group of a fatty acid derivative for example a fatty alcohol
- branched chains may have more than one point of branching and may include cyclic branches.
- the branched fatty acid, branched fatty aldehyde, or branched fatty alcohol is a C6, C7, C8, C9, CIO, Cl l, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, or a C26 branched fatty acid, branched fatty aldehyde, or branched fatty alcohol.
- the branched fatty acid, branched fatty aldehyde, or branched fatty alcohol is a C6, C7, C8, C9, CIO, Cl l, C12, C13, CI 4, C15, C16, CI 7, or C18 branched fatty acid, branched fatty aldehyde, or branched fatty alcohol.
- the hydroxyl group of the branched fatty acid, branched fatty aldehyde, or branched fatty alcohol is in the primary (CI) position.
- the branched fatty acid derivative is an iso-fatty acid derivative, for example an iso-fatty aldehyde, an iso-fatty alcohol, or an antesio-fatty acid derivative, an anteiso-fatty aldehyde, or an anteiso-fatty alcohol.
- the branched fatty acid derivative is selected from iso-C7:0, iso-C8:0, iso-C9:0, iso-C10:0, iso- C11 :0, iso-C12:0, iso-C13 :0, iso-C14:0, iso-C15:0, iso-C16:0, iso-C17:0, iso-C18:0, iso-C19:0, anteiso-C7:0, anteiso-C8:0, anteiso-C9:0, anteiso-C10:0, anteiso-Cl l :0,anteiso-C12:0, anteiso- C13:0, anteiso-C14:0, anteiso-C15:0, anteiso-C16:0, anteiso-C17:0, anteiso-C18:0, and an anteiso-C19:
- the R group of a branched or unbranched fatty acid derivative can be saturated or unsaturated. If unsaturated, the R group can have one or more than one point of unsaturation. In some embodiments, the unsaturated fatty acid derivative is a monounsaturated fatty acid derivative.
- the unsaturated fatty acid derivative is a C6:l, C7:l, C8:l, C9:l, C10: l, Cl l :l, C12:l, C13:l, C14:l, C15:l, C16: l, C17:l, C18:l, C19:l, C20:l, C21 : l, C22 : 1 , C23 : 1 , C24 : 1 , C25 : 1 , or a C26 : 1 unsaturated fatty acid derivative.
- the unsaturated fatty acid derivative is a C10:l, C12: l, C14:l, C16:l, or C18:l unsaturated fatty acid derivative. In other embodiments, the unsaturated fatty acid derivative is unsaturated at the omega-7 position. In certain embodiments, the unsaturated fatty acid derivative comprises a cis double bond.
- clone typically refers to a cell or group of cells descended from and essentially genetically identical to a single common ancestor, for example, the bacteria of a cloned bacterial colony arose from a single bacterial cell.
- a culture typically refers to a liquid media comprising viable cells.
- a culture comprises cells reproducing in a predetermined culture media under controlled conditions, for example, a culture of recombinant host cells grown in liquid media comprising a selected carbon source and nitrogen.
- “Culturing” or “cultivation” refers to growing a population of recombinant host cells under suitable conditions in a liquid or solid medium.
- culturing refers to the fermentative bioconversion of a substrate to an end-product.
- Culturing media are well known and individual components of such culture media are available from commercial sources, e.g., under the DifcoTM and BBLTM trademarks.
- the aqueous nutrient medium is a "rich medium" comprising complex sources of nitrogen, salts, and carbon, such as YP medium, comprising 10 g/L of peptone and 10 g/L yeast extract of such a medium.
- the host cell of a culture can be additionally engineered to assimilate carbon efficiently and use cellulosic materials as carbon sources according to methods described in U.S. Patents 5,000,000; 5,028,539; 5,424,202;
- the host cell is engineered to express an invertase so that sucrose can be used as a carbon source.
- the term "under conditions effective to express a genetically engineered polynucleotide sequence” means any condition that allows a host cell to produce a desired fatty acid derivative. Suitable conditions include, for example, fermentation conditions.
- modified or an "altered level of activity of a protein, for example an enzyme, in a recombinant host cell refers to a difference in one or more characteristics in the activity determined relative to the parent or native host cell. Typically differences in activity are determined between a recombinant host cell, having modified activity, and the corresponding wild-type host cell (e.g., comparison of a culture of a recombinant host cell relative to the corresponding wild-type host cell).
- Modified activities can be the result of, for example, modified amounts of protein expressed by a recombinant host cell (e.g., as the result of increased or decreased number of copies of DNA sequences encoding the protein, increased or decreased number of mRNA transcripts encoding the protein, and/or increased or decreased amounts of protein translation of the protein from mRNA); changes in the structure of the protein (e.g., changes to the primary structure, such as, changes to the protein's coding sequence that result in changes in substrate specificity, changes in observed kinetic parameters); and changes in protein stability (e.g., increased or decreased degradation of the protein).
- the polypeptide is a mutant or a variant of any of the polypeptides described herein.
- the coding sequences for the polypeptides described herein are codon optimized for expression in a particular host cell.
- one or more codons can be optimized as described in, e.g., Grosjean et al., Gene 18:199-209 (1982).
- regulatory sequences typically refers to a sequence of bases in DNA, operably-linlced to DNA sequences encoding a protein that ultimately controls the expression of the protein.
- regulatory sequences include, but are not limited to, RNA promoter sequences, transcription factor binding sequences, transcription termination sequences, modulators of transcription (such as enhancer elements), nucleotide sequences that affect RNA stability, and translational regulatory sequences (such as, ribosome binding sites (e.g., Shine-Dalgarno sequences in prokaryotes or Kozak sequences in eukaryotes), initiation codons, termination codons).
- altered level of expression and “modified level of expression” are used interchangeably and mean that a polynucleotide, polypeptide, or hydrocarbon is present in a different concentration in an engineered host cell as compared to its concentration in a corresponding wild-type cell under the same conditions.
- titer refers to the quantity of fatty acid derivative produced per unit volume of host cell culture.
- a fatty acid derivative is produced at a titer of about 25 mg/L, about 50 mg/L, about 75 mg/L, about 100 mg/L, about 125 mg/L, about 150 mg/L, about 175 mg/L, about 200 mg/L, about 225 mg/L, about 250 mg/L, about 275 mg/L, about 300 mg/L, about 325 mg/L, about 350 mg/L, about 375 mg/L, about 400 mg/L, about 425 mg/L, about 450 mg/L, about 475 mg/L, about 500 mg/L, about 525 mg/L, about 550 mg/L, about 575 mg/L, about 600 mg/L, about 625 mg/L, about 650 mg/L, about 675 mg/L, about 700 mg/L, about 725 mg/L, about
- a fatty acid derivative is produced at a titer of more than lOOg/L, more than 200g/L, more than 300g/L, or higher, such as 500 g/L, 700 g/L, 1000 g/L, 1200 g/L, 1500 g/L, or 2000 g/L.
- the preferred titer of fatty acid derivative produced by a recombinant host cell according to the methods of the disclosure is from 5g/L to 200g/L, lOg/L to 150g/L, 20g/L to 120g/L and 30g/L to lOOg/L.
- the titer of fatty acid derivative produced by a recombinant host cell according to the methods of the disclosure is about lg/L to about 250g/L and more particularly, 90 g/L to about 120g/L.
- the titer may refer to a particular fatty acid derivative or a combination of fatty acid derivatives produced by a given recombinant host cell culture.
- the "yield of fatty acid derivative produced by a host cell” refers to the efficiency by which an input carbon source is converted to product (i.e., fatty alcohol or fatty aldehyde) in a host cell.
- Host cells engineered to produce fatty acid derivatives according to the methods of the disclosure have a yield of at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20 %, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%o, at least 29%, or at least 30%> or a range bounded by any two of the foregoing values.
- a fatty acid derivative or derivatives is produced at a yield of more than 30%, 40%, 50%, 60%, 70%, 80%, 90% or more.
- the yield is about 30%) or less, about 27% or less, about 25% or less, or about 22%> or less.
- the yield can be bounded by any two of the above endpoints.
- the yield of a fatty acid derivative or derivatives produced by the recombinant host cell according to the methods of the disclosure can be 5% to 15%, 10% to 25%, 10% to 22%, 15% to 27%, 18% to 22%, 20% to 28%, or 20% to 30%.
- the yield of a fatty acid derivative or derivatives produced by the recombinant host cell is about 10% to about 40%. In another particular embodiment, the yield of a fatty acid derivative or derivatives produced by the recombinant host cell is about 25%.
- the yield may refer to a particular fatty acid derivative or a combination of fatty acid derivatives produced by a given recombinant host cell culture.
- the productivity of a fatty acid derivative or derivatives produced by a recombinant host cell is at least 100 mg/L/hour, at least 200 mg/L/hour, at least 300 mg/L/hour, at least 400 mg/L/hour, at least 500 mg/L/hour, at least 600 mg/L/hour, at least 700 mg/L/hour, at least 800 mg/L/hour, at least 900 mg/L/hour, at least 1000 mg/L/hour, at least 1100 mg/L/hour, at least 1200 mg/L/hour, at least 1300 mg/L/hour, at least 1400 mg/L/hour, at least 1500 mg/L/hour, at least 1600 mg/L/hour, at least 1700 mg/L/hour, at least 1800 mg/L/hour, at least 1900 mg/L/hour
- the productivity of a fatty acid derivative or derivatives produced by a recombinant host cell according to the methods of the may be from 500 mg/L/hour to 2500 mg/L/hour, or from 700 mg/L/hour to 2000 mg/L/hour. In one particular embodiment, the yield is about 0.7mg/L/h to about 3g/L/h.
- the productivity may refer to a particular fatty acid derivative or a combination of fatty acid derivatives produced by a given recombinant host cell culture.
- total fatty species and “total fatty acid product” may be used interchangeably herein with reference to the amount of fatty alcohols, fatty aldehydes and fatty acids, as evaluated by GC-FID as described in International Patent Application Publication WO2008/119082. The same terms may be used to mean fatty esters and free fatty acids when referring to a fatty ester analysis.
- glucose utilization rate means the amount of glucose used by the culture per unit time, reported as grams/liter/hour (g/L/hr).
- carbon source refers to a substrate or compound suitable to be used as a source of carbon for prokaryotic or simple eukaryotic cell growth. Carbon sources can be in various forms, including, but not limited to polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino acids, peptides, and gases (e.g., CO and C0 2 ). Exemplary carbon sources include, but are not limited to, monosaccharides, such as glucose, fructose, mannose, galactose, xylose, and arabinose;
- oligosaccharides such as fructo-oligosaccharide and galacto-oligosaccharide
- polysaccharides such as starch, cellulose, pectin, and xylan
- disaccharides such as sucrose, maltose, cellobiose, and turanose
- cellulosic material and variants such as hemicelluloses, methyl cellulose and sodium carboxymethyl cellulose
- alcohols such as ethanol, methanol, and glycerol, or mixtures thereof.
- the carbon source can also be a product of photosynthesis, such as glucose.
- the carbon source is biomass. In other preferred embodiments, the carbon source is glucose. In other preferred embodiments the carbon source is sucrose.
- biomass refers to any biological material from which a carbon source is derived.
- a biomass is processed into a carbon source, which is suitable for bioconversion.
- the biomass does not require further processing into a carbon source.
- the carbon source can be converted into a biofuel.
- An exemplary source of biomass is plant matter or vegetation, such as corn, sugar cane, or switchgrass.
- Another exemplary source of biomass is metabolic waste products, such as animal matter ⁇ e.g., cow manure).
- Further exemplary sources of biomass include algae and other marine plants. Biomass also includes waste products from industry, agriculture, forestry, and
- biomass also refers to sources of carbon, such as carbohydrates ⁇ e.g., monosaccharides, disaccharides, or polysaccharides).
- the term "isolated,” with respect to products refers to products that are separated from cellular components, cell culture media, or chemical or synthetic precursors.
- the fatty acids and derivatives thereof produced by the methods described herein can be relatively immiscible in the fermentation broth, as well as in the cytoplasm. Therefore, the fatty acids and derivatives thereof can collect in an organic phase either intracellularly or extracellularly.
- the terms “purify,” “purified,” or “purification” mean the removal or isolation of a molecule from its environment by, for example, isolation or separation.
- “Substantially purified” molecules are at least about 60% free (e.g., at least about 70% free, at least about 75% free, at least about 85% free, at least about 90% free, at least about 95% free, at least about 97% free, at least about 99% free) from other components with which they are associated.
- these terms also refer to the removal of contaminants from a sample. For example, the removal of contaminants can result in an increase in the percentage of fatty acid derivatives in a sample.
- a fatty acid derivative when a fatty acid derivative is produced in a recombinant host cell, the fatty acid derivative can be purified by the removal of host cell proteins. After purification, the percentage of fatty acid derivative in the sample is increased.
- the terms "purify,” “purified,” and “purification” are relative terms which do not require absolute purity.
- a purified fatty acid derivative when a fatty acid derivative is produced in recombinant host cells, a purified fatty acid derivative is a fatty acid derivative that is substantially separated from other cellular components (e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other hydrocarbons).
- FadR is a key regulatory factor involved in fatty acid degradation and fatty acid biosynthetic pathways (Cronan et al, Mol Microbiol, 29(4): 937-943 (1998)).
- the E. colt ACS enzyme FadD and the fatty acid transport protein FadL are components of a fatty acid uptake system. FadL mediates transport of fatty acids into the bacterial cell, and FadD mediates formation of acyl-CoA esters.
- Example 3 describes studies which show construction of fab operons that encode enzymes in the biosynthetic pathway for conversion of malonyl-CoA into acyl-ACPs and integration into the chromosome of an E.coli host cell. Without wanting to be bound by theory, this may increase the flux of fatty acid biosynthesis.
- the supply of acyl-ACPs from acetyl-CoA via the acetyl- CoA carboxylase (acc) complex and fatty acid biosynthetic (fab) pathway is another step that may limit the rate of fatty acid derivative production (see Figure 3).
- Example 2 shows the effect of overexpression of an optimized version of E. coli Corynebacterhim glutamicum accABCD ( ⁇ birA) demonstrated that such genetic modifications can lead to increased production of acetyl- coA and malonyl-CoA in E. coli.
- polypeptides ⁇ i.e., enzymes
- fatty acid biosynthetic polypeptides are collectively referred to herein as "fatty acid biosynthetic polypeptides" or "fatty acid biosynthetic enzymes".
- Non-limiting examples of fatty acid pathway polypeptides suitable for use in recombinant host cells of the disclosure are provided herein.
- the disclosure includes a recombinant host cell including a polynucleotide sequence which encodes a fatty acid biosynthetic polypeptide.
- the polynucleotide sequence which includes an open reading frame encoding a fatty acid biosynthetic polypeptide and operably-linked regulatory sequences, can be integrated into a chromosome of the recombinant host cells, incorporated in one or more plasmid expression systems resident in the recombinant host cell, or both.
- a fatty acid biosynthetic polynucleotide sequence encodes a polypeptide which is endogenous to the parental host cell ⁇ i.e., the control cell) of the recombinant host cell that is being engineered. Some such endogenous polypeptides are overexpressed in the recombinant host cell.
- the fatty acid biosynthetic polynucleotide sequence encodes an exogenous or heterologous polypeptide.
- the polypeptide encoded by the polynucleotide is exogenous to the parental host cell.
- the genetically modified host cell overexpresses a gene encoding a polypeptide (protein) that increases the rate at which the host cell produces the substrate of a fatty acid biosynthetic enzyme, i.e., a fatty acyl-thioester substrate.
- the enzyme encoded by the expressed gene is directly involved in fatty acid biosynthesis.
- Such recombinant host cells may be further engineered to include a polynucleotide sequence encoding one or more fatty acid biosynthetic polypeptides (i.e., enzymes involved in fatty acid biosynthesis).
- polypeptides examples include polpeptides or proteins having thioesterase activity, wherein the recombinant host cell synthesizes fatty acids; or having thioesterase activity and carboxylic acid reductase (CAR) activity, wherein the recombinant host cell synthesizes fatty aldehydes and fatty alcohols; or having thioesterase activity, carboxylic acid reductase activity and alcohol dehydrogenase activity wherein the recombinant host cell synthesizes fatty alcohols; or having acyl-CoA reductase (AAR) activity wherein the recombinant host cell synthesizes fatty aldehydes and fatty alcohols; or having acyl-CoA reductase (AAR) activity and alcohol dehydrogenase activity wherein the recombinant host cell synthesizes fatty alcohols; or having fatty alcohol forming acyl-CoA reductase (FAR) activity, wherein
- recombinant host cell synthesizes alkanes; or having ester synthase activity wherein the recombinant host cell synthesizes fatty esters (e.g., one enzyme system; see Figure 5); or having thioesterase activity, acyl-CoA synthase activity and ester synthase activity wherein the recombinant host cell synthesizes fatty esters (e.g., three enzyme system; see Figure 5); or having OleA activity, wherein the recombinant host cell synthesizes aliphatic ketones; or having OleABCD activity, wherein the recombinant host cell synthesizes internal olefins; or having thioesterase activity and decarboxylase activity, wherein the recombinant host cell synthesizes terminal olefins; or combinations thereof.
- fatty esters e.g., one enzyme system; see Figure 5
- thioesterase activity acyl-CoA synthase
- At least one polypeptide encoded by a fatty acid biosynthetic polynucleotide is an exogenous (or heterologous) polypeptide (e.g., a polypeptide originating from an organism other than the parental host cell, or a variant of a polypeptide native to the parental microbial cell) or an endogenous polypeptide (i. e., a polypeptide native to the parental host cell) wherein the endogenous polypeptide is overexpressed in the recombinant host cell.
- exogenous (or heterologous) polypeptide e.g., a polypeptide originating from an organism other than the parental host cell, or a variant of a polypeptide native to the parental microbial cell
- an endogenous polypeptide i. e., a polypeptide native to the parental host cell
- Table 1 below provides a listing of exemplary proteins which can be expressed in recombinant host cells to facilitate production of particular fatty acid derivatives.
- GnsB E. coli suppressors of the AAC74076 None increase unsaturated secG null 1 fatty acid esters mutation
- ELOl Pichia angusta Fatty acid BAD98251 2.3.1.- produce very long elongase chain length fatty acids plsC Saccharomyce acyltransferase AAA16514 2.3.1.51 wax production s cerevisiae
- BmFAR Bombyxmori FAR (fatty BAC79425 1.1.1.- convert acyl-CoA to alcohol forming fatty alcohol acyl-CoA
- acrl Acinetobacter acyl-CoA YP_047869 1.2.1.42 reduce fatty acyl-CoA sp.
- E. coli W3110 alcohol AP_003562 1 .1.-.- reduce fatty aldehydes dehydrogenase to fatty alcohols;
- AAR Synechococcn Acyl-ACP YP 400611 1.2.1.42 reduce fatty acyl- s elongatus reductase ACP/CoA to fatty aldehydes carB Mycobacterhi carboxylic acid YP_889972 6.2.1.3, reduce fatty acids to m smegmatis reductase protein 1.2.1.42 fatty aldehyde
- FadD E. coli K12 acyl-CoA NP_416319 6.2.1.3 activates fatty acids to synthetase fatty acyl-CoAs atoB Ei-winiacaroto acetyl-CoA YP 049388 2.3.1.9 production of butanol vora acetyltransferase
- AAT Fragaria x alcohol 0- AAG13130 2.3.1.84 modify output cmanassa acetyltransferase
- AtMRP5 Arabidopsis Arabidopsis NPJ71908 none modify product export thaliana thaliana multidrug amount
- AmiS2 Rhodococcus ABC transporter JC5491 none modify product export p. AmiS2 amount
- glycoprotein 1 glycoprotein 1
- CandidatusPr putative CAF23274 none modify product export otochlamydiaa multidrug-efflux amount moebophila transport protein
- the recombinant host cells may include one or more polynucleotide sequences that comprise an open reading frame encoding a thioesterase, e.g., having an Enzyme Commission number of EC 3.1.1.5 or EC 3.1.2 - (for example, EC 3.1.2.14), together with operably-linked regulatory sequences that facilitate expression of the protein in the recombinant host cells.
- the open reading frame coding sequences and/or the regulatory sequences are modified relative to the coiTesponding wild-type gene encoding the thioesterase.
- the activity of the thioesterase in the recombinant host cell is modified relative to the activity of the thioesterase expressed from the corresponding wild-type gene in a corresponding host cell.
- a fatty acid derivative composition including fatty acids is produced by culturing a recombinant cell in the presence of a carbon source under conditions effective to express the thioesterase.
- the recombinant host cell comprises a polynucleotide encoding a polypeptide having thioesterase activity, and one or more additional polynucleotides encoding polypeptides having other fatty acid biosynthetic enzyme activities.
- the fatty acid produced by the action of the thioesterase is converted by one or more enzymes having a different fatty acid biosynthetic enzyme activity to another fatty acid derivative, such as, for example, a fatty ester, fatty aldehyde, fatty alcohol, or a hydrocarbon.
- the chain length of a fatty acid, or a fatty acid derivative made therefrom, can be selected for by modifying the expression of particular thioesterases.
- the thioesterase will influence the chain length of fatty acid derivatives produced.
- the chain length of a fatty acid derivative substrate can be selected for by modifying the expression of selected thioesterases (EC 3.1. 2.14 or EC 3.1.1.5).
- host cells can be engineered to express, overexpress, have attenuated expression, or not express one or more selected thioesterases to increase the production of a preferred fatty acid derivative substrate.
- C 10 fatty acids can be produced by expressing a thioesterase that has a preference for producing Cio fatty acids and attenuating thioesterases that have a preference for producing fatty acids other than Ci 0 fatty acids (e.g., a thioesterase which prefers to produce C) 4 fatty acids). This would result in a relatively homogeneous population of fatty acids that have a carbon chain length of 10.
- C14 fatty acids can be produced by attenuating endogenous thioesterases that produce non-C 14 fatty acids and expressing the thioesterases that use Ci 4 -ACP.
- C12 fatty acids can be produced by expressing thioesterases that use Ci 2 -ACP and attenuating thioesterases that produce non-Cj 2 fatty acids.
- C12 fatty acids can be produced by expressing a thioesterase that has a preference for producing C12 fatty acids and attenuating thioesterases that have a preference for producing fatty acids other than CI 2 fatty acids. This would result in a relatively homogeneous population of fatty acids that have a carbon chain length of 12.
- the fatty acid derivatives are recovered from the culture medium with substantially all of the fatty acid derivatives produced extracellularly.
- the fatty acid derivative composition produced by a recombinant host cell can be analyzed using methods known in the art, for example, GC-FID, in order to determine the distribution of particular fatty acid derivatives as well as chain lengths and degree of saturation of the components of the fatty acid derivative composition.
- Acetyl-CoA, malonyl-CoA, and fatty acid overproduction can be verified using methods known in the art, for example, by using radioactive precursors, HPLC, or GC-MS subsequent to cell lysis.
- Additional non-limiting examples of thioesterases and polynucleotides encoding them for use in the fatty acid pathway are provided in PCT Publication Application No. WO2010/075483, expressly incorporated by reference herein.
- the recombinant host cell produces a fatty aldehyde.
- a fatty acid produced by the recombinant host cell is converted into a fatty aldehyde.
- the fatty aldehyde produced by the recombinant host cell is then converted into a fatty alcohol or a hydrocarbon.
- native (endogenous) fatty aldehyde biosynthetic polypeptides such as aldehyde reductases, are present in the host cell (e.g., E. coli) and are effective to convert fatty aldehydes to fatty alcohols.
- a native (endogenous) fatty aldehyde biosynthetic polypeptide is overexpressed.
- an exogenous fatty aldehyde biosynthetic polypeptide is introduced into a recombinant host cell and expressed or overexpressed.
- a native or recombinant host cell may comprise a polynucleotide encoding an enzyme having fatty aldehyde biosynthesis activity (e.g., a fatty aldehyde biosynthetic polypeptide or a fatty aldehyde biosynthetic polypeptide or enzyme).
- a fatty aldehyde is produced when the fatty aldehyde biosynthetic enzyme is expressed or overexpressed in the host cell.
- a recombinant host cell engineered to produce a fatty aldehyde will typically convert some of the fatty aldehyde to a fatty alcohol.
- a fatty aldehyde is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a polypeptide having fatty aldehyde biosynthetic activity such as carboxylic acid reductase (CAR) activity.
- CAR carboxylic acid reductase
- CarB is an exemplary carboxylic acid reductase.
- a gene encoding a carboxylic acid reductase polypeptide may be expressed or overexpressed in the host cell.
- the CarB polypeptide has the amino acid sequence of SEQ ID NO: 7.
- the CarB polypeptide is a variant or mutant of SEQ ID NO: 7. Examples of carboxylic acid reductase (CAR)
- polypeptides and polynucleotides encoding them include, but are not limited to FadD9 (EC 6.2.1.-, UniProtKB Q50631, GenBank NP_217106, SEQ ID NO: 34), CarA (GenBank ABK75684), CarB (GenBank YP889972; SEQ ID NO: 33) and related polypeptides described in PCT Publication No. WO2010/042664 and US Patent No. 8,097,439, each of which is expressly incorporated by reference herein.
- the recombinant host cell further comprises a polynucleotide encoding a thioesterase.
- the fatty aldehyde is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a fatty aldehyde biosynthetic polypeptide, such as a polypeptide having acyl-ACP reductase (AAR) activity.
- a fatty aldehyde biosynthetic polypeptide such as a polypeptide having acyl-ACP reductase (AAR) activity.
- AAR acyl-ACP reductase
- Native (endogenous) aldehyde reductases present in a recombinant host cell e.g., E. coli
- Exemplary acyl-ACP reductase polypeptides are described in PCT
- a composition comprising fatty aldehydes (a fatty aldehyde composition) is produced by culturing a host cell in the presence of a carbon source under conditions effective to express the fatty aldehyde biosynthetic enzyme.
- the fatty aldehyde composition comprises fatty aldehydes and fatty alcohols.
- the fatty aldehyde composition is recovered from the extracellular environment of the recombinant host cell, i.e., the cell culture medium.
- the recombinant host cell includes a polynucleotide encoding a polypeptide (an enzyme) having fatty alcohol biosynthetic activity (a fatty alcohol biosynthetic polypeptide or a fatty alcohol biosynthetic enzyme), and a fatty alcohol is produced by the recombinant host cell.
- a composition comprising fatty alcohols may be produced by culturing the recombinant host cell in the presence of a carbon source under conditions effective to express a fatty alcohol biosynthetic enzyme.
- the fatty alcohol composition comprises fatty alcohols, however, a fatty alcohol composition may comprise other fatty acid derivatives.
- the fatty alcohol composition is recovered from the extracellular environment of the recombinant host cell, i.e., the cell culture medium.
- recombinant host cells have been engineered to produce fatty alcohols by expressing a thioesterase, which catalyzes the conversion of acyl-ACPs into free fatty acids (FFAs) and a carboxylic acid reductase (CAR), which converts free fatty acids into fatty aldehydes.
- Native (endogenous) aldehyde reductases present in the host cell e.g., E. coli
- native (endogenous) fatty aldehyde biosynthetic polypeptides such as aldehyde reductases present in the host cell, may be sufficient to convert fatty aldehydes to fatty alcohols.
- a native (endogenous) fatty aldehyde biosynthetic polypeptides such as aldehyde reductases present in the host cell, may be sufficient to convert fatty aldehydes to fatty alcohols.
- a native (endogenous) fatty aldehyde biosynthetic polypeptides such as aldehyde reductases present in the host cell, may be sufficient to convert fatty aldehydes to fatty alcohols.
- a native (endogenous) fatty aldehyde biosynthetic polypeptides such as aldehyde reductases present in the host cell, may be sufficient to convert fatty aldehydes to fatty alcohols.
- the fatty alcohol is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a polypeptide having fatty alcohol biosynthetic activity which converts a fatty aldehyde to a fatty alcohol.
- an alcohol dehydrogenase aldehyde reductase, e.g., EC 1.1.1.1
- EC 1.1.1.1 an alcohol dehydrogenase
- an alcohol dehydrogenase refers to a polypeptide capable of catalyzing the conversion of a fatty aldehyde to an alcohol (e.g., a fatty alcohol).
- an alcohol e.g., a fatty alcohol.
- certain alcohol dehydrogenases are capable of catalyzing other reactions as well, and these non-specific alcohol dehydrogenases also are encompassed by the alcohol dehydrogenase. Examples of alcohol dehydrogenase
- polypeptides useful in accordance with the disclosure include, but are not limited to AlrA of Acinetobacter sp. M-l (SEQ ID NO: 3) or AlrA homologs such as AlrAadpl (SEQ ID NO: 4) and endogenous E.
- coli alcohol dehydrogenases such as YjgB, (AAC77226) (SEQ ID NO: 5), DkgA (NP_417485), DkgB (NP_414743), YdjL (AAC74846), YdjJ (NP_416288), AdhP (NP_415995), YhdH (NP_417719), YahK (NP_414859), YphC (AAC75598), YqhD (446856) and YbbO [AAC73595.1]. Additional examples are described in International Patent
- the fatty alcohol biosynthetic polypeptide has aldehyde reductase or alcohol dehydrogenase activity (EC 1.1.1.1).
- recombinant host cells have been engineered to produce fatty alcohols by expressing fatty alcohol forming acyl-CoA reductases or fatty acyl reductases (FARs) which convert fatty acyl-thioester substrates (e.g., fatty acyl-CoA or fatty acyl-ACP) to fatty alcohols.
- FARs fatty acyl reductases
- the fatty alcohol is produced by expressing or
- FAR polypeptides useful in accordance with this embodiment are described in PCT Publication No. WO2010/062480 which is expressly incorporated by reference herein.
- Fatty alcohol may be produced via an acyl-CoA dependent pathway utilizing fatty acyl-ACP and fatty acyl-CoA intermediates and an acyl-CoA independent pathway utilizing fatty acyl-ACP intermediates but not a fatty acyl-CoA
- the enzyme encoded by the over expressed gene is selected from a fatty acid synthase, an acyl-ACP thioesterase, a fatty acyl-CoA synthase and an acetyl-CoA carboxylase.
- the protein encoded by the over expressed gene is endogenous to the host cell.
- the protein encoded by the overexpressed gene is heterologous to the host cell.
- Fatty alcohols are also made in nature by enzymes that are able to reduce various acyl-ACP or acyl-CoA molecules to the corresponding primary alcohols. See also, U.S. Patent Publication Nos. 20100105963, and 20110206630 and US Patent No.
- Strategies to increase production of fatty alcohols by recombinant host cells include increased flux through the fatty acid biosynthetic pathway by overexpression of native fatty acid biosynthetic genes and/or expression of exogenous fatty acid biosynthetic genes from different organisms in the production host such that fatty alcohol biosynthesis is increased.
- fatty ester may be used with reference to an ester.
- a fatty ester as referred to herein can be any ester made from a fatty acid, for example a fatty acid ester.
- a fatty ester contains an A side and a B side.
- an "A side” of an ester refers to the carbon chain attached to the carboxylate oxygen of the ester.
- a "B side” of an ester refers to the carbon chain comprising the parent carboxylate of the ester.
- the A side is contributed by an alcohol
- the B side is contributed by a fatty acid.
- any alcohol can be used to form the A side of the fatty esters.
- the alcohol can be derived from the fatty acid biosynthetic pathway.
- the alcohol can be produced through non- fatty acid biosynthetic pathways.
- the alcohol can be provided exogenously.
- the alcohol can be supplied in the fermentation broth in instances where the fatty ester is produced by an organism.
- a carboxylic acid such as a fatty acid or acetic acid, can be supplied exogenously in instances where the fatty ester is produced by an organism that can also produce alcohol.
- the carbon chains comprising the A side or B side can be of any length.
- the A side of the ester is at least about 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 16, or 18 carbons in length.
- the A side of the ester is 1 carbon in length.
- the A side of the ester is 2 carbons in length.
- the B side of the ester can be at least about 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, or 26 carbons in length.
- the A side and/or the B side can be straight or branched chain.
- the branched chains can have one or more points of branching.
- the branched chains can include cyclic branches.
- the A side and/or B side can be saturated or unsaturated. If unsaturated, the A side and/or B side can have one or more points of
- the fatty ester is produced biosynthetically.
- first the fatty acid is activated.
- activated fatty acids are acyl-CoA, acyl ACP, and acyl phosphate.
- Acyl-CoA can be a direct product of fatty acid biosynthesis or degradation.
- acyl-CoA can be synthesized from a free fatty acid, a CoA, and an adenosine nucleotide triphosphate (ATP).
- ATP adenosine nucleotide triphosphate
- An example of an enzyme which produces acyl-CoA is acyl-CoA synthase.
- the recombinant host cell comprises a polynucleotide encoding a polypeptide, e.g., an enzyme having ester synthase activity, (ester synthase polypeptide or an ester synthase).
- a polypeptide e.g., an enzyme having ester synthase activity, (ester synthase polypeptide or an ester synthase).
- a fatty ester is produced by a reaction catalyzed by the ester synthase polypeptide expressed or overexpressed in the recombinant host cell.
- a composition comprising fatty esters fatty ester is produced by culturing the recombinant cell in the presence of a carbon source under conditions effective to express an ester synthase.
- the fatty ester composition is recovered from the cell culture.
- Ester synthase polypeptides include, for example, an ester synthase polypeptide classified as EC 2.3.1.75, or any other polypeptide which catalyzes the conversion of an acyl-thioester to a fatty ester, including, without limitation, a thioesterase, an ester synthase, an acyl-CoA:alcohol transacylase, an acyltransferase, or a fatty acyl-CoA:fatty alcohol acyltransferase.
- the polynucleotide may encode wax/dgat, a bifunctional ester synthase/acyl-CoA:diacylglycerol acyltransferase from Simmondsia chinensis, Acinetobacter sp. Strain ADP, Alcanivorax borkumensis, Pseudomonas aeruginosa, Fundibacter jadensis, Arabidopsis thaliana, or
- ester synthase polypeptide is an
- Acinetobacter sp. diacylglycerol O-acyltransferase (wax-dgaT; UniProtKB Q8GGG1, GenBank AA017391) or Simmondsia chinensis wax synthase (UniProtKB Q9XGY6 , GenBank
- ester synthase polypeptide is for example ES9 (a wax ester synthase from Marinobacter hydrocarbonoclasticiis DSM 8798, UniProtKB A3RE51(SEQ ID NO: 6); ES8 of Marinobacter hydrocarbonoclasticus DSM8789 (GenBank Accession No. ABO21021; SEQ ID NO:7); GenBank ABO21021, encoded by the ws2 gene; or ES376 (another wax ester synthase derived from Marinobacter hydrocarbonoclasticus DSM 8798, UniProtKB A3RE50, GenBank ABO21020, encoded by the wsl gene.
- ES9 a wax ester synthase from Marinobacter hydrocarbonoclasticiis DSM 8798, UniProtKB A3RE51(SEQ ID NO: 6
- ES8 of Marinobacter hydrocarbonoclasticus DSM8789 GenBank Accession No. ABO21021; SEQ ID NO:7)
- the polynucleotide encoding the ester synthase polypeptide is overexpressed in the recombinant host cell.
- a fatty acid ester is produced by a recombinant host cell engineered to express three fatty acid biosynthetic enzymes: a thioesterase enzyme, an acyl-CoA synthetase (fadD) enzyme and an ester synthase enzyme ⁇ e.g., three enzyme system; see Figure 5).
- a fatty acid ester is produced by a recombinant host cell engineered to express one fatty acid biosynthetic enzyme, an ester synthase enzyme (e.g., one enzyme system; see Figure 5).
- an ester synthase enzyme e.g., one enzyme system; see Figure 5.
- ester synthase polypeptides and polynucleotides encoding them suitable for use in these embodiments include those described in PCT Publication Nos.
- the recombinant host cell may produce a fatty ester, such as a fatty acid methyl ester, a fatty acid ethyl ester or a wax ester in the extracellular environment of the host cells.
- This aspect of the disclosure is based, at least in part, on the discovery that altering the level of expression of a fatty aldehyde biosynthetic polypeptide, for example, an acyl-ACP reductase polypeptide (EC 6.4.1.2) and a hydrocarbon biosynthetic polypeptide, e.g., a decarbonylase in a recombinant host cell facilitates enhanced production of hydrocarbons by the recombinant host cell.
- the recombinant host cell produces a hydrocarbon, such as an alkane or an alkene (e.g., a terminal olefin or an internal olefin) or a ketone.
- a fatty aldehyde produced by a recombinant host cell is converted by
- a fatty acid produced by a recombinant host cell is converted by decarboxylation, removing a carbon atom to form a terminal olefin.
- an acyl-ACP intermediate is converted by decarboxylation, removing a carbon atom to form an internal olefin or a ketone (see Figure 6).
- the recombinant host cell comprises a polynucleotide encoding a polypeptide (an enzyme) having hydrocarbon biosynthetic activity (a hydrocarbon biosynthetic polypeptide or a hydrocarbon biosynthetic enzyme), and the hydrocarbon is produced by expression or overexpression of the hydrocarbon biosynthetic enzyme in a recombinant host cell.
- alkane biosynthetic pathway from cyanobacteria consisting of an acyl-acyl carrier protein reductase (AAR) and an aldehyde decarbonylase (ADC), which together convert intermediates of fatty acid metabolism to alkanes and alkenes has been used to engineer recombinant host cells for the production of hydrocarbons ( Figure 6).
- the second of two reactions in the pathway through which saturated acyl-ACPs are converted to alkanes in cyanobacteria entails scission of the C1-C2 bond of a fatty aldehyde intermediate by the enzyme aldehyde decarbonylase (ADC), a ferritin-like protein with a binuclear metal cofactor of unknown composition.
- the hydrocarbon is produced by expressing or
- a polynucleotide encoding a polypeptide having hydrocarbon biosynthetic activity such as an aldehyde decarbonylase (ADC) activity (e.g., EC 4.1.99.5).
- ADC aldehyde decarbonylase
- Exemplary polynucleotides encoding an aldehyde decarbonylase useful in accordance with this embodiment include, but are not limited to, those described in PCT Publication Nos. WO2008/119082 and WO2009/140695 which are expressly incorporated by reference herein and those sequences presented in Table 2 below.
- the recombinant host cell further comprises a polynucleotide encoding a fatty aldehyde biosynthesis polypeptide.
- the recombinant host cell further comprises a polynucleotide encoding an acyl- ACP reductase. See, for example, Table 2 below.
- composition comprising is produced by culturing the
- the hydrocarbon composition comprises saturated and unsaturated hydrocarbons.
- a hydrocarbon composition may comprise other fatty acid derivatives.
- the hydrocarbon composition is recovered from the extracellular environment of the recombinant host cell, i.e., the cell culture medium.
- an alkane refers to saturated hydrocarbons or compounds that consist only of carbon (C) and hydrogen (H), wherein these atoms are linked together by single bonds ⁇ i.e., they are saturated compounds).
- Olefins and alkenes refer to hydrocarbons containing at least one carbon-to-carbon double bond ⁇ i.e., they are unsaturated compounds).
- Terminal olefins, a-olefms, terminal alkenes, and 1 -alkenes refer to the same compounds with reference to ⁇ -olefins or alkenes with a chemical formula CxH2x, distinguished from other olefins with a similar molecular formula by linearity of the hydrocarbon chain and the position of the double bond at the primary or alpha position.
- a terminal olefin is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a hydrocarbon biosynthetic polypeptide, such as a polypeptide having decarboxylase activity as described, for example, in PCT Publication No.
- the recombinant host cell further comprises a polynucleotide encoding a thioesterase.
- a ketone is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a hydrocarbon biosynthetic polypeptide, such as a polypeptide having OleA activity as described, for example, in PCT Publication No. WO2008/147781, which is expressly incorporated by reference herein.
- an internal olefin is produced by expressing or overexpressing in the recombinant host cell a polynucleotide encoding a hydrocarbon biosynthetic polypeptide, such as a polypeptide having OleCD or OleBCD activity together with a polypeptide having OleA activity as described, for example, in PCT Publication No. WO2008/147781, expressly incorporated by reference herein.
- a hydrocarbon biosynthetic polypeptide such as a polypeptide having OleCD or OleBCD activity together with a polypeptide having OleA activity as described, for example, in PCT Publication No. WO2008/147781, expressly incorporated by reference herein.
- a recombinant host cell or engineered host cell refers to a host cell whose genetic makeup has been altered relative to the corresponding wild-type host cell, for example, by deliberate introduction of new genetic elements and/or deliberate modification of genetic elements naturally present in the host cell. The offspring of such recombinant host cells also contain these new and/or modified genetic elements.
- the host cell can be selected from the group consisting of a plant cell, insect cell, fungus cell ⁇ e.g., a filamentous fungus, such as Candida sp., or a budding yeast, such as Saccharomyces sp.), an algal cell and a bacterial cell.
- fungus cell ⁇ e.g., a filamentous fungus, such as Candida sp., or a budding yeast, such as Saccharomyces sp.
- recombinant host cells are recombinant microorganisms.
- host cells that are microorganisms, include but are not limited to cells from the genus Escherichia, Bacillus, Lactobacillus, Zymomonas, Rhodococcus, Pseudomonas,
- the host cell is a Gram-positive bacterial cell. In other embodiments, the host cell is a Gram-negative bacterial cell. In some embodiments, the host cell is an E. coli cell.
- the host cell is a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus lichenoformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, or a Bacillus amyloliqiiefaciens cell.
- the host cell is a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lamiginose cell, a Rhodococcus opacus cell, a Rhizomucor miehei cell, or a Mucor miehei cell.
- the host cell is a Streptomyces lividans cell or a Streptomyces murinus cell. In yet other embodiments, the host cell is an Actinomycetes cell. In some embodiments, the host cell is a Saccharomyces cerevisiae cell. In other embodiments, the host cell is a cell from a eukaryotic plant, algae, cyanobacterium, green-sulfur bacterium, green non-sulfur bacterium, purple sulfur bacterium, purple non-sulfur bacterium, extremophile, yeast, fungus, an engineered organism thereof, or a synthetic organism. In some embodiments, the host cell is light-dependent or fixes carbon.
- the host cell has autotrophic activity. In some embodiments, the host cell has photoautotrophic activity, such as in the presence of light. In some embodiments, the host cell is heterotrophic or mixotrophic in the absence of light. In certain embodiments, the host cell is a cell from Arabidopsis thaliana, Panicum virgatum, Miscanthiis giganteus, Zea mays, Botryococcuse braunii, Chlamydomonas reinhardtii, Dunaliela salina, Synechococcus Sp. PCC 7002, Synechococcus Sp. PCC 7942, Synechocystis Sp.
- PCC 6803 Thermosynechococcus elongates BP-1, Chlorobium tepidum, Chlorojlexits auranticus, Chromatiumm vinosum, Rhodospirillum rubrum, Rhodobacter capsiilatiis, Rhodopseudomonas palusris, Clostridium Ijungdahlii, Clostridiuthermocelhim, PenicilUum chrysogenum, Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas mobilis.
- a large variety of fatty acid derivatives can be produced by recombinant host cells comprising strain improvements as described herein, including, but not limited to, fatty acids, acyl-CoA, fatty aldehydes, short and long chain alcohols, hydrocarbons (e.g., alkanes, alkenes or olefins, such as terminal or internal olefins), fatty alcohols, esters (e.g., wax esters, fatty acid esters (e.g., methyl or ethyl esters)), and ketones.
- fatty acids acyl-CoA
- fatty aldehydes short and long chain alcohols
- hydrocarbons e.g., alkanes, alkenes or olefins, such as terminal or internal olefins
- esters e.g., wax esters, fatty acid esters (e.g., methyl or ethyl esters)
- ketones e.g.
- the higher titer of fatty acid derivatives in a particular composition is a higher titer of a particular type of fatty acid derivative (e.g., fatty alcohols, fatty acid esters, or hydrocarbons) produced by a recombinant host cell culture relative to the titer of the same fatty acid derivatives produced by a control culture of a corresponding wild-type host cell.
- the fatty acid derivative compositions may comprise, for example, a mixture of the fatty alcohols with a variety of chain lengths and saturation or branching characteristics.
- the higher titer of fatty acid derivatives in a particular compositions is a higher titer of a combination of different fatty acid derivatives (for example, fatty aldehydes and alcohols, or fatty acids and esters) relative to the titer of the same fatty acid derivative produced by a control culture of a corresponding wild-type host cell.
- different fatty acid derivatives for example, fatty aldehydes and alcohols, or fatty acids and esters
- a polynucleotide (or gene) sequence is provided to the host cell by way of a recombinant vector, which comprises a promoter operably linked to the polynucleotide sequence.
- the promoter is a developmentally-regulated, an organelle-specific, a tissue-specific, an inducible, a constitutive, or a cell-specific promoter.
- the recombinant vector includes at least one sequence including, but not limited to, (a) an expression control sequence operatively coupled to the polynucleotide sequence; (b) a selection marker operatively coupled to the polynucleotide sequence; (c) a marker sequence operatively coupled to the polynucleotide sequence; (d) a purification moiety operatively coupled to the polynucleotide sequence; (e) a secretion sequence operatively coupled to the polynucleotide sequence; and (f) a targeting sequence operatively coupled to the polynucleotide sequence.
- the expression vectors described herein include a polynucleotide sequence described herein in a form suitable for expression of the polynucleotide sequence in a host cell. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of polypeptide desired, etc.
- the expression vectors described herein can be introduced into host cells to produce polypeptides, including fusion polypeptides, encoded by the polynucleotide sequences as described herein. Expression of genes encoding polypeptides in prokaryotes, for example, E.
- Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino- or carboxy- terminus of the recombinant polypeptide.
- Such fusion vectors typically serve one or more of the following three purposes (1) to increase expression of the recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide; and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide. This enables separation of the recombinant polypeptide from the fusion moiety after purification of the fusion polypeptide.
- enzymes include Factor Xa, thrombin, and enterokinase.
- Exemplary fusion expression vectors include pGEX (Pharmacia Biotech, Inc., Piscataway, NJ; Smith et al., Gene, 67: 31-40 (1988)), pMAL (New England Biolabs, Beverly, MA), and pRITS (Pharmacia Biotech, Inc., Piscataway, N. J.), which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant polypeptide. Examples of inducible, non-fusion E.
- coli expression vectors include pTrc (Amann et al , Gene (1988) 69:301-315) and pET l id (Studier et al , Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89).
- Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
- Target gene expression from the pET l id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl).
- This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident ⁇ prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
- Suitable expression systems for both prokaryotic and eukaryotic cells are well Icnown in the art; see, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual," second edition, Cold Spring Harbor Laboratory, (1989). Examples of inducible, non-fusion E.
- coli expression vectors include pTrc (Amann et al, Gene, 69: 301-315 (1988)) and PET l id (Studier et al, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA, pp. 60-89 (1990)).
- a polynucleotide sequence of the disclosure is operably linked to a promoter derived from bacteriophage T5.
- the host cell is a yeast cell.
- the expression vector is a yeast expression vector.
- Vectors can be introduced into prokaryotic or eukaryotic cells via a variety of art-recognized techniques for introducing foreign nucleic acid ⁇ e.g., DNA) into a host cell. Suitable methods for transforming or transfecting host cells can be found in, for example, Sambrook et al. (supra). For stable transformation of bacterial cells, it is known that, depending upon the expression vector and transformation technique used, only a small fraction of cells will take-up and replicate the expression vector. In order to identify and select these transformants, a gene that encodes a selectable marker (e.g., resistance to an antibiotic) can be introduced into the host cells along with the gene of interest.
- a selectable marker e.g., resistance to an antibiotic
- Selectable markers include those that confer resistance to drugs such as, but not limited to, ampicillin, kanamycin, chloramphenicol, or tetracycline.
- Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transformed with the introduced nucleic acid can be identified by growth in the presence of an appropriate selection drug.
- an engineered or recombinant host cell is a cell used to produce a fatty acid derivative composition as further described herein.
- a host cell is referred to as an engineered host cell or a recombinant host cell if the expression of one or more polynucleotides or polypeptides in the host cell are altered or modified as compared to their expression in a corresponding wild-type host cell (e.g., control cell) under the same conditions.
- the host cell can be selected from the group consisting of a eukaryotic plant, algae, cyanobacterium, green-sulfur bacterium, green non-sulfur bacterium, purple sulfur bacterium, purple non-sulfur bacterium, extremophile, yeast, fungus, engineered organisms thereof, or a synthetic organism.
- the host cell is light dependent or fixes carbon.
- the host cell has autotrophic activity.
- Various host cells can be used to produce fatty acid derivatives, as described herein.
- the polypeptide is a mutant or a variant of any of the polypeptides described herein.
- mutant and variant as used herein refer to a polypeptide having an amino acid sequence that differs from a wild-type polypeptide by at least one amino acid.
- the mutant can comprise one or more of the following
- conservative amino acid substitutions replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine; replacement of a threonine with a serine; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.
- an aliphatic amino acid such as alanine, valine, leucine, and isoleucine
- replacement of a serine with a threonine replacement of a threonine with a serine
- replacement of an acidic residue such as aspartic acid
- the mutant polypeptide has about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more amino acid substitutions, additions, insertions, or deletions.
- Preferred fragments or mutants of a polypeptide retain some or all of the biological function (e.g., enzymatic activity) of the corresponding wild-type polypeptide. In some embodiments, the fragment or mutant retains at least 75%, at least 80%, at least 90%, at least 95%), or at least 98% or more of the biological function of the corresponding wild-type polypeptide. In other embodiments, the fragment or mutant retains about 100% of the biological function of the corresponding wild-type polypeptide.
- a fragment or mutant exhibits increased biological function as compared to a corresponding wild-type polypeptide.
- a fragment or mutant may display at least a 10%>, at least a 25%, at least a 50%, at least a 75%), or at least a 90%> improvement in enzymatic activity as compared to the corresponding wild-type polypeptide.
- the fragment or mutant displays at least 100% (e.g., at least 200%, or at least 500%) improvement in enzymatic activity as compared to the corresponding wild-type polypeptide.
- polypeptides described herein may have additional conservative or non-essential amino acid substitutions, which do not have a substantial effect on the polypeptide function. Whether or not a particular substitution will be tolerated (i.e., will not adversely affect desired biological function, such as carboxylic acid reductase activity) can be determined as described in Bowie et al. (Science, 247: 1306-1310 (1990)).
- a conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g.
- Variants can be naturally occurring or created in vitro.
- such variants can be created using genetic engineering techniques, such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, or standard cloning techniques.
- such variants, fragments, analogs, or derivatives can be created using chemical synthesis or modification procedures.
- Methods of making variants are well known in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids that encode polypeptides having characteristics that enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized.
- variants can be prepared by using random and site-directed mutagenesis. Random and site-directed mutagenesis are described in, for example, Arnold, Curr. Opin. Biotech., 4: 450-455 (1993). Random mutagenesis can be achieved using error prone PCR (see, e.g., Leung et al., Technique, 1 : 11-15 (1989); and Caldwell et al., PCR Methods Applic, 2: 28-33 (1992)).
- nucleic acids to be mutagenized e.g., a polynucleotide sequence encoding a carboxylic reductase enzyme
- reaction buffer MgCl 2 , MnCl 2 , Taq polymerase, and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product.
- the reaction can be performed using 20 fmoles of nucleic acid to be mutagenized, 30 pmole of each PCR primer, a reaction buffer comprising 50 mM KG, 10 mM Tris HC1 (pH 8.3), 0.01% gelatin, 7 mM MgCl 2 , 0.5 mM MnCl 2 , 5 units of Taq polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP.
- PCR can be performed for 30 cycles of 94 °C for 1 min, 45 °C for 1 min, and 72 °C for 1 min.
- these parameters can be varied as appropriate.
- the mutagenized nucleic acids are then cloned into an appropriate vector, and the activities of the polypeptides encoded by the mutagenized nucleic acids are evaluated.
- Site-directed mutagenesis can be achieved using oligonucleotide- directed mutagenesis to generate site-specific mutations in any cloned DNA of interest.
- Oligonucleotide mutagenesis is described in, for example, Reidhaar-Olson et al., Science, 241 : 53-57 (1988). Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized (e.g., a polynucleotide sequence encoding a CAR
- Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in, for example, U.S. Patent 5,965,408. Still another method of generating variants is sexual PCR mutagenesis. In sexual PCR mutagenesis, forced homologous recombination occurs between DNA molecules of different, but highly related, DNA sequences in vitro as a result of random fragmentation of the DNA molecule based on sequence homology.
- Propagating a DNA sequence e.g., a polynucleotide sequence encoding a CAR polypeptide
- a DNA sequence e.g., a polynucleotide sequence encoding a CAR polypeptide
- Mutator strains suitable for use for in vivo mutagenesis are described in, for example, International Patent Application Publication No. WO1991/016427.
- Variants can also be generated using cassette mutagenesis.
- cassette mutagenesis a small region of a double-stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence.
- the oligonucleotide often contains a completely and/or partially randomized native sequence.
- Recursive ensemble mutagenesis can also be used to generate variants.
- Recursive ensemble mutagenesis is an algorithm for protein engineering (i.e., protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in, for example, Arkin et al, Proc. Natl. Acad. Sci., U.S.A., 89: 7811-7815 (1992). In some embodiments, variants are created using exponential ensemble mutagenesis.
- Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins.
- Exponential ensemble mutagenesis is described in, for example, Delegrave et al., Biotech. Res, 11 : 1548-1552 (1993).
- variants are created using shuffling procedures wherein portions of a plurality of nucleic acids that encode distinct polypeptides are fused together to create chimeric nucleic acid sequences that encode chimeric polypeptides as described in, for example, U.S. Patents 5,965,408 and 5,939,250.
- Insertional mutagenesis is mutagenesis of DNA by the insertion of one or more bases. Insertional mutations can occur naturally, mediated by virus or transposon, or can be artificially created for research purposes in the lab, e.g., by transposon mutagenesis. When exogenous DNA is integrated into that of the host, the severity of any ensuing mutation depends entirely on the location within the host's genome wherein the DNA is inserted. For example, significant effects may be evident if a transposon inserts in the middle of an essential gene, in a promoter region, or into a repressor or an enhancer region. Transposon mutagenesis and high- throughput screening was done to find beneficial mutations that increase the titer or yield of a fatty acid derivative or derivatives. [00125] Culture Recombinant Host Cells and Cell Cultures/Fermentation
- the term “fermentation” broadly refers to the conversion of organic materials into target substances by host cells, for example, the conversion of a carbon source by recombinant host cells into fatty acids or derivatives thereof by propagating a culture of the recombinant host cells in a media comprising the carbon source.
- the term “conditions permissive for the production” means any conditions that allow a host cell to produce a desired product, such as a fatty acid or a fatty acid derivative.
- the term “conditions in which the polynucleotide sequence of a vector is expressed” means any conditions that allow a host cell to synthesize a polypeptide. Suitable conditions include, for example, fermentation conditions.
- Fermentation conditions can comprise many parameters, including but not limited to temperature ranges, levels of aeration, feed rates and media composition. Each of these conditions, individually and in combination, allows the host cell to grow. Fermentation can be aerobic, anaerobic, or variations thereof (such as micro-aerobic). Exemplary culture media include broths or gels. Generally, the medium includes a carbon source that can be metabolized by a host cell directly. In addition, enzymes can be used in the medium to facilitate the mobilization (e.g., the depolymerization of starch or cellulose to fermentable sugars) and subsequent metabolism of the carbon source.
- the engineered host cells can be grown in batches of, for example, about 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced to express a desired polynucleotide sequence, such as a polynucleotide sequence encoding a CAR polypeptide.
- a desired polynucleotide sequence such as a polynucleotide sequence encoding a CAR polypeptide.
- the engineered host cells can be grown in batches of about 10 L, 100 L, 1000 L, 10,000 L, 100,000 L, and 1,000,000 L or larger; fermented; and induced to express a desired polynucleotide sequence.
- large scale fed-batch fermentation may be carried out.
- the fatty acid derivative compositions described herein are found in the extracellular environment of the recombinant host cell culture and can be readily isolated from the culture medium.
- a fatty acid derivative may be secreted by the recombinant host cell, transported into the extracellular environment or passively transfeiTed into the extracellular environment of the recombinant host cell culture.
- the fatty acid derivative is isolated from a recombinant host cell culture using routine methods known in the art.
- fraction of modem carbon or fM has the same meaning as defined by National Institute of Standards and Technology (NIST) Standard Reference Materials (SRMs4990B and 4990C, known as oxalic acids standards HOxI and HOxII, respectively.
- SRMs4990B and 4990C Standard Reference Materials
- HOxI and HOxII respectively.
- the fundamental definition relates to 0.95 times the 14C /12C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected pre-Industrial Revolution wood.
- fJVl is approximately 1.1.
- Bioproducts e.g., the fatty acid derivatives produced in accordance with the present disclosure
- Bioproducts comprising biologically produced organic compounds, and in particular, the fatty acid derivatives produced using the fatty acid biosynthetic pathway herein, have not been produced from renewable sources and, as such, are new compositions of matter.
- These new bioproducts can be distinguished from organic compounds derived from petrochemical carbon on the basis of dual carbon-isotopic
- biosourced carbon e.g., glucose vs. glycerol
- dual carbon-isotopic fingerprinting see, e.g., U.S. Patent No. 7,169,588, which is herein incorporated by reference.
- bioproducts from petroleum based organic compounds is beneficial in tracking these materials in commerce.
- organic compounds or chemicals comprising both biologically based and petroleum based carbon isotope profiles may be distinguished from organic compounds and chemicals made only of petroleum based materials.
- the bioproducts herein can be followed or tracked in commerce on the basis of their unique carbon isotope profile.
- Bioproducts can be distinguished from petroleum based organic compounds by comparing the stable carbon isotope ratio ( 13 C/ 12 C) in each sample.
- the 13 C/ 12 C ratio in a given bioproduct is a consequence of the 13 C/ 12 C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed. It also reflects the precise metabolic pathway. Regional variations also occur. Petroleum, C3 plants (the broadleaf), C4 plants (the grasses), and marine carbonates all show significant differences in 13 C/ 12 C and the corresponding 6 13 C values. Furthermore, lipid matter of C3 and C4 plants analyze differently than materials derived from the carbohydrate components of the same plants as a consequence of the metabolic pathway.
- 13 C shows large variations due to isotopic fractionation effects, the most significant of which for bioproducts is the photosynthetic mechanism.
- the major cause of differences in the carbon isotope ratio in plants is closely associated with differences in the pathway of photosynthetic carbon metabolism in the plants, particularly the reaction occurring during the primary carboxylation (i.e., the initial fixation of atmospheric C0 2 ).
- Two large classes of vegetation are those that incorporate the "C3" (or Calvin-Benson) photosynthetic cycle and those that incorporate the "C4" (or Hatch-Slack) photosynthetic cycle.
- the primary C0 2 fixation or carboxylation reaction involves the enzyme ribulose-l,5-diphosphate carboxylase, and the first stable product is a 3 -carbon compound.
- C3 plants such as hardwoods and conifers, are dominant in the temperate climate zones.
- an additional carboxylation reaction involving another enzyme, phosphoenol-pyruvate carboxylase, is the primary carboxylation reaction.
- the first stable carbon compound is a 4-carbon acid that is subsequently
- compositions described herein include bioproducts produced by any of the methods described herein, including, for example, fatty aldehyde and alcohol products. Specifically, the bioproduct can have a ⁇ C of about -28 or greater, about -27 or greater, -20 or greater, -18 or greater, -15 or greater, -13 or greater, -10 or greater, or -8 or greater.
- the bioproduct can have a 8 13 C of about -30 to about -15, about -27 to about -19, about -25 to about -21, about -15 to about -5, about -13 to about -7, or about -13 to about -10.
- the bioproduct can have a 5 1J C of about -10, -1 1, -12, or -12.3.
- Bioproducts produced in accordance with the disclosure herein can also be distinguished from petroleum based organic compounds by comparing the amount of 14 C in each compound.
- the bioproduct of the disclosure can have an fM 14 C of at least about 1.01, an fM 14 C of about 1 to about 1.5, an fM 14 C of about 1.04 to about 1.18, or an fM 14 C of about 1.111 to about 1.124.
- a bioproduct comprising one or more fatty acid derivatives as described herein can have a pMC of at least about 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100.
- a fatty acid derivative described herein can have a pMC of between about 50 and about 100; about 60 and about 100; about 70 and about 100; about 80 and about 100; about 85 and about 100; about 87 and about 98; or about 90 and about 95.
- a fatty acid derivative described herein can have a pMC of about 90, 91, 92, 93, 94, or 94.2.
- a host cell can be cultured, for example, for about 4, 8, 12, 24, 36, or 48 hours. During and/or after culturing, samples can be obtained and analyzed to determine if the conditions allow expression. For example, the host cells in the sample or the medium in which the host cells were grown can be tested for the presence of a desired product. When testing for the presence of a product, assays, such as, but not limited to, TLC, HPLC, GC/FID, GC/MS, LC/MS, MS, can be used.
- Recombinant host cell cultures are screened at the 96 well plate level, 1 liter and 5 liter tanlc level and in a 1000L pilot plant using a GC/FID assay for "total fatty species".
- a fatty acid is a carboxylic acid with a long aliphatic tail (chain), which is either saturated or unsaturated. Most naturally occurring fatty acids have a chain of an even number of carbon atoms, from 4 to 28.
- Fatty acids are usually derived from triglycerides. When they are not attached to other molecules, they are known as "free" fatty acids. Fatty acids are usually produced industrially by the hydrolysis of triglycerides, with the removal of glycerol. Palm, soybean, rapeseed, coconut oil and sunflower oil are currently the most common sources of fatty acids. The majority of fatty acids derived from such sources are used in human food products. Coconut oil and palm kernel oil (consist mainly of 12 and 14 carbon fatty acids).
- long-chain fatty acids e.g., CI 8, saturated and unsaturated
- Ecological and toxicological studies suggest that fatty acid-derived products based on renewable resources have more favorable properties than petrochemical-based substances.
- Fatty aldehydes are used to produce many specialty chemicals.
- aldehydes are used to produce polymers, resins (e.g., Bakelite), dyes, flavorings, plasticizers, perfumes, pharmaceuticals, and other chemicals, some of which may be used as solvents, preservatives, or disinfectants.
- resins e.g., Bakelite
- dyes e.g., dyes, flavorings, plasticizers, perfumes, pharmaceuticals, and other chemicals, some of which may be used as solvents, preservatives, or disinfectants.
- certain natural and synthetic compounds such as vitamins and hormones, are aldehydes, and many sugars contain aldehyde groups.
- Fatty aldehydes can be converted to fatty alcohols by chemical or enzymatic reduction. Fatty alcohols have many commercial uses. Worldwide annual sales of fatty alcohols and their derivatives are in excess of U.S. $1 billion.
- the shorter chain fatty alcohols are used in the cosmetic and food industries as emulsifiers, emollients, and thickeners.
- fatty alcohols behave as nonionic surfactants, which are useful in personal care and household products, such as, for example, detergents.
- fatty alcohols are used in waxes, gums, resins, pharmaceutical salves and lotions, lubricating oil additives, textile antistatic and finishing agents, plasticizers, cosmetics, industrial solvents, and solvents for fats.
- the disclosure also provides a surfactant composition or a detergent composition comprising a fatty alcohol produced by any of the methods described herein.
- a surfactant composition or a detergent composition comprising a fatty alcohol produced by any of the methods described herein.
- the fatty alcohols described herein when used as a feedstock for surfactant or detergent production, one of ordinary skill in the art will appreciate that the characteristics of the fatty alcohol feedstock will affect the characteristics of the surfactant or detergent composition produced. Hence, the characteristics of the surfactant or detergent composition can be selected for by producing particular fatty alcohols for use as a feedstock.
- a fatty alcohol-based surfactant and/or detergent composition described herein can be mixed with other surfactants and/or detergents well known in the art.
- the mixture can include at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%), or a range bounded by any two of the foregoing values, by weight of the fatty alcohol.
- a surfactant or detergent composition can be made that includes at least about 5%), at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%), at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or a range bounded by any two of the foregoing values, by weight of a fatty alcohol that includes a carbon chain that is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 carbons in length.
- Such surfactant or detergent compositions also can include at least one additive, such as a microemulsion or a surfactant or detergent from non- microbial sources such as plant oils or petroleum, which can be present in the amount of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or a range bounded by any two of the foregoing values, by weight of the fatty alcohol.
- Esters have many commercial uses.
- biodiesel an alternative fuel, is comprised of esters (e.g., fatty acid methyl esters, fatty acid ethyl esters, etc.).
- esters are volatile with a pleasant odor, which makes them useful as fragrances or flavoring agents.
- esters are used as solvents for lacquers, paints, and varnishes.
- some naturally occurring substances such as waxes, fats, and oils are comprised of esters.
- Esters are also used as softening agents in resins and plasticizers, flame retardants, and additives in gasoline and oil.
- esters can be used in the manufacture of polymers, films, textiles, dyes, and pharmaceuticals.
- Hydrocarbons have many commercial uses. For example, shorter chain alkanes are used as fuels. Longer chain alkanes (e.g., from five to sixteen carbons) are used as transportation fuels (e.g., gasoline, diesel, or aviation fuel). Alkanes having more than sixteen carbon atoms are important components of fuel oils and lubricating oils. Even longer alkanes, which are solid at room temperature, can be used, for example, as a paraffin wax. In addition, longer chain alkanes can be cracked to produce commercially valuable shorter chain hydrocarbons. Like short chain alkanes, short chain alkenes are used in transportation fuels. Longer chain alkenes are used in plastics, lubricants, and synthetic lubricants.
- alkenes are used as a feedstock to produce alcohols, esters, plasticizers, surfactants, tertiary amines, enhanced oil recovery agents, fatty acids, thiols, alkenylsuccinic anhydrides, epoxides, chlorinated alkanes, chlorinated alkenes, waxes, fuel additives, and drag flow reducers.
- Ketones are used commercially as solvents. For example, acetone is frequently used as a solvent, but it is also a raw material for making polymers. Ketones are also used in lacquers, paints, explosives, perfumes, and textile processing.
- Lubricants are typically composed of olefins, particularly polyolefms and alpha- olefins. Lubricants can either be refined from crude petroleum or manufactured using raw materials refined from crude petroleum. Obtaining these specialty chemicals from crude petroleum requires a significant financial investment as well as a great deal of energy. It is also an inefficient process because frequently the long chain hydrocarbons in crude petroleum are cracked to produce smaller monomers. These monomers are then used as the raw material to manufacture the more complex specialty chemicals.
- the disclosure is further illustrated by the following examples. The examples are provided for illustrative purposes only. They are not to be construed as limiting the scope or content of the disclosure in any way.
- This example describes the construction of a genetically engineered host cell wherein the expression of a fatty acid degradation enzyme is attenuated.
- fadE deletion confirmation primers were: fadE-L2 5'-CGGGCAGGTGCTATGACCAGGAC (SEQ ID NO: 11); and
- iFAB138 is SEQ ID NO: 19.
- the main precursors for fatty acid biosynthesis are malonyl-CoA and acetyl-CoA ( Figure 1). It has been suggested that these precursors limit the rate of fatty acid biosynthesis in E. coli.
- synthetic acc operons [Corynebacterium glutamicum accABCD
- C. glutamicum was overexpressed in i. coli.
- Acetyl-CoA carboxylase (acc) consists of four discrete subunits, accA, accB, accC and accD ( Figure 3).
- the advantage of C. glutamicum acc is that two subunits are expressed as fusion proteins, accCB and accDA, respectively, which facilitates its balanced expression.
- C. glutamicum birA which biotinylates the accB subunit ( Figure 3) was overexpressed.
- Exemplary C. glutamicum birA DNA sequences are presented as SEQ ID NO: 55 and SEQ ID NO: 56.
- a C. glutamicum birA protein sequence is presented as SEQ ID NO: 57.
- glutamicum birA gene was codon optimized and obtained by gene synthesis. It was cloned downstream of the acc genes in all four operon constructs. Below we refer to the operon configuration accDACB as accD- and the operon configuration accDACB+birA as accD+.
- the resulting plasmids were transformed into E. coli DAM l_i377, which contains integrated copies (i) of leaderless thioesterease 'tesA and acyl-CoA synthetase fadD from E.coli and Ester synthase 9 (ES9) from Marinobacter hydrocarbonoclasticus (SEQ ID NO: 6). All genes are controlled by trc promoters.
- the strains were grown in 5NBT media (described below) in shake flasks and were analyzed for malonyl- CoA using short chain-CoA assay described below. Figure 8 shows that six of the eight C.
- glutamic m acc ⁇ birA constructs showed elevated levels of malonyl-CoA in logarithmic phase demonstrating their functionality in E. coli. It was noted that coexpression of birA further increased malonyl-CoA levels in the ptrcl/3_accDACB strains, in particular with the plasmid containing the Ptrc3-accDACB-birA operon configuration (plasmid pASl 19.50D; SEQ ID NO: 62).
- panK In order to test the effect of combining panK and acc-birA overexpression, the optimized panK gene was cloned downstream of birA in ptrcl/3_accDACB-birA.
- Pantothenate kinase panK (or CoaA) catalyzes the first step in the biosynthesis of coenzyme A, an essential cofactor that is involved in many reactions, e.g., the formation of acetyl-CoA, the substrate for acetyl-CoA carboxylase.
- the resulting plasmids were transformed into DAMl_i377, grown in 5NBT (+TVS1) media in shake flasks, and the strains were analyzed for short-chain-Co As using the method described below.
- panK in log phase panK coexpression further increased malonyl-CoA levels and also increased acetyl-CoA levels demonstrating that panK can further increase the malonyl-CoA levels.
- ester synthase 9 SEQ ID NO: 6
- plasmids OP80 vector control
- pDS57 with ES9
- pDS57-accD- with ES9 and accDACB
- pDS57-accD+ with ES9 and accDACB-birA; SEQ ID NO: 63
- the cultures were diluted 10-fold in quadruplicate into minimal medium of the same composition except that the media contained 1 g/L instead of 2 g/L NH 4 C1 and was supplemented with 1 mM IPTG and 2% (v/v) methanol.
- the resulting cultures were then grown at 32°C in a shaker.
- the production of fatty acid methyl esters (FAMEs) was analyzed by gas chromatography with flame ionization detector (GC-FID). The samples were extracted with butyl acetate in a ratio of 1 : 1 vol/vol. After vortexing, the samples were centrifuged, and the organic phase was analyzed by gas
- GC chromatography
- instrument Trace GC Ultra, Thermo Electron Corporation with Flame ionization detector (FID) detector; column: DB-1 (1% diphenyl siloxane; 99% dimethyl siloxane) COl UFM 1/0.1/5 01 DET from Thermo Electron Corporation, phase pH 5, FT: 0.4 ⁇ , length 5m, id: 0.1mm; inlet conditions: 250°C splitless, 3.8 m 1/25 split method used depending upon sample concentration with split flow of 75 mL/m; carrier gas, flow rate: Helium, 3.0mL/m; block temperature: 330°C; oven temperature: 0.5 m hold at 50°C, 100°C/m to 330°C, 0.5 m hold at 330°C; detector temperature: 300°C; injection volume: 2 ⁇ ; run time/flow rate: 6.3 m/3.0 mL/m (splitless method), 3.8 m 1.5 mL/m (split 1/2
- FAMEs produced are shown in Figure 10.
- the expression of ES9 by itself in E. coli DV2 led to FAME production above the control DV2 OP80.
- Coexpression of the C. ghitamiciim acetyl-CoA carboxylase complex led to an approx. 1.5 -fold increase in FAMEs and the additional expression of the C. glutamicum biotin protein ligase led to an approx. 5-fold increase in FAMEs.
- Synechococcus elongat s (SEQ ID NO: 38) with and without acc genes in E. coli DV2.
- the accD+ operon configuration was selected as it gave the best results when coexpressed with ester synthase (see previous example).
- the accDABC-birA operon was cloned downstream from the aar gene in pLS9-l 85 (a pCL1920 derivative) using Infusion technology (Clontech Laboratories, Inc., Mountain View, CA).
- the resulting plasmid was transformed into E. coli DV2 and the corresponding transformants were selected on LB plates supplemented with 100 mg/L of spectinomycin. Fatty alcohols produced are shown in Figure 11.
- Example 3 describes co-expression of acc genes together with entire fab operons.
- Table 4 Components from Different Species used in iFABs 130-145
- Each "iFAB” included various fab genes in the following order: 1) an enoyl-ACP reductase (BS_fabI, BS_FabL, Vc_FabV, or Ec_FabI); 2) a b -ketoacyl-ACP synthetase III (St_fabH); 3) a malonyl-CoA-ACP transacylase (St_fabD); 4) a b-ketoacyl-ACP reductase (St_fabG); 5) a 3-hydroxy-acyl-ACP dehydratase (St_fabA or St_fabZ); 6) a b -ketoacyl-ACP synthetase II (Cac_fabF).
- St_fabA also has trans-2, cis-3-decenoyl-ACP isomerase activity and that Cac_fabF has b -ketoacyl-ACP synthetase II and b -ketoacyl-ACP synthetase I activities (Zhu et al., BMC Microbiology 9: 119 (2009)). See Table 5, below for the specific composition of iFABs 130 - 145.
- the DAM1 ifab strains were analyzed in 96-well plates (4NBT medium), shake flasks (5NBT medium) (see above for medium description) and in fermenters at 32°C. The best results were obtained in 96-well plates and in shake flasks, where several DAM1 ifab strains with pDS57-acc-birA plasmids showed higher FAME titers.
- DAM1 ifabl31, ifabl35, ifabl37, ifabl38 and ifabl43 with pDS57-accDACB-birA showed 20-40% improved titers indicating that in these strains a higher flux through the fatty acid pathway was achieved, which resulted in a better product formation rate (these results were reproducible in several independent experiments).
- FabH and fabl are two fatty acid biosynthetic enzymes that have been shown to be feedback inhibited (Heath and Rock, JBC 271 : 1833-1836 (1996)). A study was conducted to determine if FabH and Fabl might be limiting the rate of FAME production. FabH and fabl homologues (from E. coli, B.
- subtilis, Acinetobacter baylyi ADP1, Marinobacter aqvaeoU VT8, and Rhodococcus opacus were overexpressed as a synthetic operon and evaluated in E. coli DAM1 pDS57 (a strain observed to be a good FAME producer).
- fabHfabI operons were constructed from organisms that accumulate waxes (A. baylyi, M. aquaeoli) or triacylglycerides (R. opaciis) and integrated into the chromosome of E. coli DAMl pDS57.
- a synthetic acc operons from C. gl tamicum were co-expressed (as described in Example 2, above).
- Bs Bacillus siibtilis; Ec: Escherichia coli; ADP1 : Acinetobacter sp. ADP1; VT8:
- the lacUV5 promoter of iFAB 138 was replaced by a T5 promoter (SEQ ID NO : 2) leading to higher levels of expression of iFAB 138, as confirmed by mRNA analysis.
- the expression of iFAB138 from the T5 promoter resulted in a higher titer, yield and productivity of fatty esters.
- Strain shu.002 (Table 3) is isogenic to strain BD64 (Table 3) except that it contains the T5 promoter controlling expression of the iFAB138 operon (SEQ ID NO: 19).
- DG406 21 GATAAATCCACGAATTTTAGGTTTGATGATCATTGGTCTCCTCCTGCAGGTG CGTGTTCGTCGTCATCGCAATTG
- Plasmid pJW168 (Palmeros et al, Gene 247: 255-264 (2000)) was transformed into strain BD64 i-cat- loxP-T5_138 and selected on LB + carbenicillin plates at 32°C. In order to remove the cat marker, expression of the cre-recombinase was induced by IPTG. The plasmid pJW168 was removed by growing cultures at 42°C. Colonies were patched on LB + chloramphenicol and LB + carbenicillin to verify loss of pJW168 and removal of cat marker, respectively. The colony was also patched into LB as a positive control, all patched plates were incubated at 32°C.
- Figure 16 shows the iFAB138 locus: a diagram of the cat-loxP-P T5 cassette integrated in front of FAB 138 ( Figure 16 A) and a diagram of the PT5_IFAB 138 region ( Figure 16B).
- the sequence of the cat-loxP-T5 promoter integrated in front of iFAB138 with homology to integration site is presented as SEQ ID NO: 1 and the sequence of the
- iT5_FAB138 promoter region with homology to integration site is presented as SEQ ID NO: 2.
- increased fatty acid flux was achieved by altering the promoter strength of operon iFAB138.
- the expression of iFAB138 from the T5 promoter was beneficial, nonetheless, when this promoter change was combined with the insertion of yijP::Tn5 cassette further improvements were observed in titer, yield and productivity of fatty acid esters and other fatty acid derivatives (data not shown).
- V668/ pCL_P trc _tesA produced more FFA than the EG149/ pCL_P tre _tesA control. Since FFA is a precursor to the LS9 products, higher FFA production is a good indicator that the new strain can produce higher levels of LS9 products.
- EXAMPLE 5 Increased Production of Fatty Acid Derivativ es by Transposon
- colonies were picked into deep-well plates containing LB, grown overnight, inoculated into fresh LB and grown for 3 hours, inoculated into fresh FA2.1 media, grown for 16 hours, then extracted using butyl acetate.
- the crude extract was derivatized with BSTFA ( ⁇ , ⁇ - bis[Trimethylsilyl]trifluoroacetamide) and analyzed using GC/FID.
- Spectinomycin (lOOmg/L) was included in all media to maintain selection of the pDG109 plasmid. Hits were selected by choosing clones that produced a similar total fatty species as the control strain SL313, but that had a higher percent of fatty alcohol species and a lower percent of free fatty acids than the control.
- Strain 68F11 was identified as a hit and was validated in a shake flask fermentation using FA2.1 media. A comparison of transposon hit 68F11 to control strain SL313 indicated that 68F11 produces a higher percentage of fatty alcohol species than the control, while both strains produce similar titers of total fatty species. A single colony of hit 68F11 , named LC535, was sequenced to identify the location of the transposon insertion. Briefly, genomic DNA was purified from a 10 mL overnight LB culture using the kit ZR Fungal/Bacterial DNA MiniPrepTM (Zymo Research Corporation, Irvine, CA) according to the manufacturer's instructions. The purified genomic DNA was sequenced outward from the transposon using primers internal to the transposon:
- Strain LC535 was determined to have a transposon insertion in the yijP gene
- yijP encodes a conserved inner membrane protein whose function is unclear.
- the yijP gene is in an operon and co-transcribed with the ppc gene, encoding phosphoenolpyruvate carboxylase, and the yijO gene, encoding a predicted DNA-binding transcriptional regulator of unknown function. Promoters internal to the transposon likely have effects on the level and timing of transcription of yijP, ppc and yijO, and may also have effects on adjacent genes frwD, pflC, pfld, and argE.
- Strain LC535 was evaluated in a fed-batch fermentation on two different dates. Both fermentations demonstrated that LC535 produced fatty alcohols with a higher yield than control SL313, and the improvement was 1.3-1.9% absolute yield based on carbon input.
- the yijP transposon cassette was further evaluated in a different strain V940, which produces fatty alcohol at a higher yield than strain SL313.
- the yijP::Tn5-cat cassette was amplified from strain LC535 using primers:
- a colony with the correct yijP transposon cassette was transformed with the production plasmid pV171.1 to produce strain D851.
- D851 was tested in a shake-flask fermentation against strain V940 that does not contain the yijP transposon cassette. The result of this fermentation showed that the yijP transposon cassette confers production of a higher percent of fatty alcohol by the D851 strain relative to the V940 strain and produces similar titers of total fatty species as the V940 control strain.
- Strain D851 was evaluated in a fed-batch fermentation on two different dates.
- total fatty species and “total fatty acid product” may be used interchangeably herein with reference to the amount of fatty alcohols, fatty aldehydes and free fatty acids, as evaluated by GC-FID as described in International Patent Application Publication WO
- fatty esters includes beta hydroxy esters.
- yijP::Tn5 DG18 (LC942 yijP::Tn5-cat/pLC56) [00191] Ppc activity was measured in cells grown in a shake flask fermentation using a standard shake flask protocol in FA2.3 media (described above) and harvested 12-16 hours after induction. Approximately 5 mL of cells were centrifuged and the cell paste was suspended in BugBuster Protein Extraction Reagent (Novagen) with a protease inhibitor cocktail solution. The cell suspension was incubated with gentle shaking on a shaker for 20 min. Insoluble cell debris was removed by centrifugation at 16,000 xg for 20 min at 4 °C followed by transferring the supernatant to a new tube. Ppc activity in the cell lysate was determined by a coupling reaction with citrate synthase using following reaction mixture: 0.4 mM acetyl-CoA, 10 mM
- Proteomics data was also collected to assess the abundance of the Ppc protein in two strains with and without the yijP::Tn5-cat transposon cassette. Protein samples were collected from strains V940 and D851 grown in bioreactors under standard fatty alcohol production conditions (described above). Samples were taken at two different time points: 32 and 48hours and prepared for analysis.
- Proteomics data showed a significant reduction in the relative abundance of Ppc protein in D851 strain when compared to V940 at 32 hours and 48 hours.
- D851 had about 15% of the Ppc levels of V940 at 32 hours and about 35% of the Ppc levels of V940 at 48 hours.
- These data show that the yijP::Tn5-cat transposon cassette results in a significant reduction in Ppc abundance in the cell. This suggests that the observed benefits to fatty alcohol production by strains harboring the yijP: :Tn5-cat transposon hit is due to reducing the amount of Ppc protein.
- the sfp gene (Accession no. X63158; SEQ ID NO: 53)_fiom Bacillus subtilis, encoding a phosphopantetheinyl transferase with broad substrate specificity, was cloned downstream of the respective acp genes. This enzyme is involved in conversion of the inactive apo-ACP to the active holo-ACP.
- the plasmids constructed are described in Table 12.
- Table 12 Plasmids Coexpressing Cyanobacterial ACP with and without B. subtilis sfp Downstream from S. elongatus PCC7942 AAR
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (19)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR122019026142-3A BR122019026142B1 (pt) | 2012-04-02 | 2013-04-02 | Célula hospedeira recombinante |
| BR122019026127-0A BR122019026127B1 (pt) | 2012-04-02 | 2013-04-02 | Célula hospedeira recombinante e cultura celular |
| JP2015504687A JP6381518B2 (ja) | 2012-04-02 | 2013-04-02 | 改良された脂肪酸誘導体産生方法 |
| MYPI2014002773A MY181688A (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
| KR1020147030467A KR102166271B1 (ko) | 2012-04-02 | 2013-04-02 | 지방산 유도체들의 개선된 생산 |
| MX2014011905A MX366939B (es) | 2012-04-02 | 2013-04-02 | Producción mejorada de derivados de ácidos grasos. |
| CN202210135822.5A CN114456996A (zh) | 2012-04-02 | 2013-04-02 | 改善的脂肪酸衍生物的生产 |
| EP19211601.0A EP3674400A1 (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
| AU2013243601A AU2013243601B2 (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
| BR112014024675-0A BR112014024675B1 (pt) | 2012-04-02 | 2013-04-02 | Célula hospedeira recombinante |
| KR1020207015194A KR102353113B1 (ko) | 2012-04-02 | 2013-04-02 | 지방산 유도체들의 개선된 생산 |
| EP13715879.6A EP2834352B1 (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
| MX2019004568A MX379251B (es) | 2012-04-02 | 2013-04-02 | Producción mejorada de derivados de ácidos grasos. |
| US14/390,378 US20150064782A1 (en) | 2012-04-02 | 2013-04-02 | Production of fatty acid derivatives |
| CN201380026304.9A CN104395464B (zh) | 2012-04-02 | 2013-04-02 | 改善的脂肪酸衍生物的生产 |
| CA2883968A CA2883968C (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
| US15/650,285 US11060099B2 (en) | 2012-04-02 | 2017-07-14 | Production of fatty acid derivatives |
| US17/335,812 US20210348173A1 (en) | 2012-04-02 | 2021-06-01 | Production Of Fatty Acid Derivatives |
| US18/344,219 US20240150774A1 (en) | 2012-04-02 | 2023-06-29 | Production of fatty acid derivatives |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261619324P | 2012-04-02 | 2012-04-02 | |
| US61/619,324 | 2012-04-02 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/390,378 A-371-Of-International US20150064782A1 (en) | 2012-04-02 | 2013-04-02 | Production of fatty acid derivatives |
| US15/650,285 Division US11060099B2 (en) | 2012-04-02 | 2017-07-14 | Production of fatty acid derivatives |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013152051A2 true WO2013152051A2 (en) | 2013-10-10 |
| WO2013152051A3 WO2013152051A3 (en) | 2013-12-12 |
Family
ID=48087775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/035037 Ceased WO2013152051A2 (en) | 2012-04-02 | 2013-04-02 | Improved production of fatty acid derivatives |
Country Status (12)
| Country | Link |
|---|---|
| US (4) | US20150064782A1 (cg-RX-API-DMAC7.html) |
| EP (2) | EP2834352B1 (cg-RX-API-DMAC7.html) |
| JP (3) | JP6381518B2 (cg-RX-API-DMAC7.html) |
| KR (2) | KR102166271B1 (cg-RX-API-DMAC7.html) |
| CN (2) | CN114456996A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2013243601B2 (cg-RX-API-DMAC7.html) |
| BR (3) | BR112014024675B1 (cg-RX-API-DMAC7.html) |
| CA (2) | CA2883968C (cg-RX-API-DMAC7.html) |
| CO (1) | CO7170149A2 (cg-RX-API-DMAC7.html) |
| MX (2) | MX379251B (cg-RX-API-DMAC7.html) |
| MY (1) | MY181688A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013152051A2 (cg-RX-API-DMAC7.html) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015054138A1 (en) * | 2013-10-10 | 2015-04-16 | William Marsh Rice University | Improved fatty acid productivity |
| WO2015095240A3 (en) * | 2013-12-20 | 2015-08-27 | The Regents Of The University Of California | Biosynthesis of 1-undecence and related terminal olefins |
| WO2015200335A1 (en) * | 2014-06-23 | 2015-12-30 | Joule Unlimited Technologies, Inc. | Engineered photosynthetic microbes and recombinant synthesis of carbon-based products |
| JP2016052303A (ja) * | 2014-09-02 | 2016-04-14 | エボニック デグサ ゲーエムベーハーEvonik Degussa GmbH | 脂肪酸エステルの製造 |
| WO2016138712A1 (zh) * | 2015-03-02 | 2016-09-09 | 苏州安捷生物科技有限公司 | 一种生物法制备脂肪醇的方法 |
| EP2970982A4 (en) * | 2013-03-15 | 2016-11-23 | Cargill Inc | ACETYL-COA CARBOXYLASEMUTATIONEN |
| US10155937B2 (en) | 2013-03-15 | 2018-12-18 | Cargill, Incorporated | Acetyl-CoA carboxylases |
| US10337038B2 (en) | 2013-07-19 | 2019-07-02 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| WO2019191770A1 (en) * | 2018-03-30 | 2019-10-03 | Invista North America S.A.R.L. | Materials and methods for biosynthetic manufacture of pimelic acid and utilization of synthetic polypeptides |
| US10465213B2 (en) | 2012-08-10 | 2019-11-05 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| US10676763B2 (en) | 2014-07-18 | 2020-06-09 | Genomatica, Inc. | Microbial production of fatty diols |
| WO2020181091A1 (en) | 2019-03-05 | 2020-09-10 | Bp Corporation North America Inc. | Fatty acyl-acp reductases and their uses |
| US10801044B2 (en) | 2017-02-08 | 2020-10-13 | Kao Corporation | Method of producing fatty alcohol |
| US11053287B2 (en) | 2018-05-02 | 2021-07-06 | Inv Nylon Chemicals Americas, Llc | Materials and methods for differential biosynthesis in species of the genera Ralstonia and Cupriavidus and organisms related thereto |
| US11060099B2 (en) | 2012-04-02 | 2021-07-13 | Genomatica, Inc. | Production of fatty acid derivatives |
| US11098381B2 (en) | 2018-05-02 | 2021-08-24 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling regulation in biosynthesis in species of the genera Ralstonia or Cupriavidus and organisms related thereto |
| US11203771B2 (en) | 2018-03-30 | 2021-12-21 | Inv Nylon Chemicals Americas, Llc | Materials and methods for biosynthetic manufacture of carbon-based chemicals |
| US11345938B2 (en) | 2017-02-02 | 2022-05-31 | Cargill, Incorporated | Genetically modified cells that produce C6-C10 fatty acid derivatives |
| US11408013B2 (en) | 2013-07-19 | 2022-08-09 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| US11512276B2 (en) | 2018-03-30 | 2022-11-29 | Inv Nylon Chemicals Americas, Llc | Methods for controlling oxygen concentration during aerobic biosynthesis |
| US11702680B2 (en) | 2018-05-02 | 2023-07-18 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling PHA biosynthesis in PHA-generating species of the genera Ralstonia or Cupriavidus and organisms related thereto |
| US11788055B2 (en) | 2018-05-02 | 2023-10-17 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling oxidation and reduction in biosynthetic pathways of species of the genera ralstonia and cupriavidus and organisms related thereto |
| US11999943B2 (en) | 2018-05-02 | 2024-06-04 | Inv Nylon Chemicals Americas, Llc | Materials and methods for maximizing biosynthesis through alteration of pyruvate-acetyl-CoA-TCA balance in species of the genera ralstonia and cupriavidus and organisms related thereto |
| WO2024119298A1 (en) | 2022-12-05 | 2024-06-13 | The Procter & Gamble Company | Fabric and home care composition comprising a polyalkylenecarbonate compound |
| US12065636B2 (en) | 2018-03-30 | 2024-08-20 | Inv Nylon Chemicals Americas, Llc | High hydrogen utilization and gas recycle |
| US12338428B2 (en) | 2018-03-30 | 2025-06-24 | Inv Nylon Chemicals Americas, Llc | Materials and methods for managing aerobic gas fermentation |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102677413B1 (ko) | 2017-04-03 | 2024-06-24 | 게노마티카 인코포레이티드 | 중쇄 지방산 유도체의 생산을 위해 개선된 활성을 갖는 티오에스테라제 변이체 |
| KR102117828B1 (ko) | 2018-07-19 | 2020-06-02 | 서울대학교산학협력단 | 레귤론 변이를 통한 지방산 및 지방산 유도체 생산에서 불포화도 감소 |
| EP3844179A4 (en) | 2018-08-31 | 2022-08-31 | Genomatica, Inc. | XYLR MUTANT FOR IMPROVED XYLOSE UTILIZATION OR IMPROVED CO-UTILIZATION OF GLUCOSE AND XYLOSE |
| CN118382700A (zh) * | 2021-12-06 | 2024-07-23 | 能源与材料国家研究中心 | 嵌合酶和生产末端烯烃的方法 |
| CN114634917A (zh) * | 2022-03-25 | 2022-06-17 | 湖南农业大学 | accD突变蛋白在提高植物种子脂肪酸含量中的应用 |
Citations (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5000000A (en) | 1988-08-31 | 1991-03-19 | University Of Florida | Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes |
| US5028539A (en) | 1988-08-31 | 1991-07-02 | The University Of Florida | Ethanol production using engineered mutant E. coli |
| WO1991016427A1 (en) | 1990-04-24 | 1991-10-31 | Stratagene | Methods for phenotype creation from multiple gene populations |
| US5424202A (en) | 1988-08-31 | 1995-06-13 | The University Of Florida | Ethanol production by recombinant hosts |
| US5482846A (en) | 1988-08-31 | 1996-01-09 | University Of Florida | Ethanol production in Gram-positive microbes |
| US5602030A (en) | 1994-03-28 | 1997-02-11 | University Of Florida Research Foundation | Recombinant glucose uptake system |
| US5939250A (en) | 1995-12-07 | 1999-08-17 | Diversa Corporation | Production of enzymes having desired activities by mutagenesis |
| US5965408A (en) | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
| US7169588B2 (en) | 1995-05-12 | 2007-01-30 | E. I. Du Pont De Nemours And Company | Bioconversion of a fermentable carbon source to 1,3-propanediol by a single microorganism |
| WO2007136762A2 (en) | 2006-05-19 | 2007-11-29 | Ls9, Inc. | Production of fatty acids and derivatives thereof |
| WO2008119082A2 (en) | 2007-03-28 | 2008-10-02 | Ls9, Inc. | Enhanced production of fatty acid derivatives |
| WO2008147781A2 (en) | 2007-05-22 | 2008-12-04 | Ls9, Inc. | Hydrocarbon-producing genes and methods of their use |
| WO2009085278A1 (en) | 2007-12-21 | 2009-07-09 | Ls9, Inc. | Methods and compositions for producing olefins |
| WO2009140696A2 (en) | 2008-05-16 | 2009-11-19 | Ls9, Inc. | Methods and compositions for producing hydrocarbons |
| WO2010042664A2 (en) | 2008-10-07 | 2010-04-15 | Ls9, Inc. | Method and compositions for producing fatty aldehydes |
| US20100105963A1 (en) | 2008-10-28 | 2010-04-29 | Ls9, Inc. | Methods and compositions for producing fatty alcohols |
| WO2010075483A2 (en) | 2008-12-23 | 2010-07-01 | Ls9, Inc. | Methods and compositions related to thioesterase enzymes |
| WO2010127318A2 (en) | 2009-05-01 | 2010-11-04 | The Regents Of The University Of California | Product of fatty acid esters from biomass polymers |
| WO2011038134A1 (en) | 2009-09-25 | 2011-03-31 | Ls9, Inc. | Production of fatty acid derivatives |
| US20110206630A1 (en) | 2010-02-14 | 2011-08-25 | Ls9, Inc. | Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2232230C (en) * | 1995-10-13 | 2005-06-28 | Ralph H. Lambalot | Phosphopantetheinyl transferases and uses thereof |
| CN1154745C (zh) | 1999-11-09 | 2004-06-23 | 浙江省农业科学院 | 利用反义基因调控籽粒油脂含量的方法 |
| US20100242345A1 (en) * | 2006-05-19 | 2010-09-30 | LS9, Inc | Production of fatty acids & derivatives thereof |
| CN101490241A (zh) * | 2006-05-19 | 2009-07-22 | Ls9公司 | 脂肪酸及其衍生物的制备 |
| KR20090129393A (ko) * | 2006-10-20 | 2009-12-16 | 아리조나 보드 오브 리젠츠 퍼 앤 온 비하프 오브 아리조나 스테이트 유니버시티 | 변형된 시아노박테리아 |
| WO2008113041A2 (en) | 2007-03-14 | 2008-09-18 | Ls9, Inc. | Process for producing low molecular weight hydrocarbons from renewable resources |
| ES2540933T3 (es) | 2007-05-11 | 2015-07-14 | Thomas Jefferson University | Métodos de tratamiento y prevención de enfermedades y trastornos neurodegenerativos |
| WO2009002480A2 (en) | 2007-06-26 | 2008-12-31 | Danisco Us, Inc., Genencor Division | Acyl transferase having altered substrate specificity |
| US7897369B2 (en) | 2007-08-27 | 2011-03-01 | Regents Of The University Of Minnesota | Isoprenoid wax ester synthases, isoprenoid acyl CoA-synthetases, and uses thereof |
| TWI351779B (en) | 2007-12-03 | 2011-11-01 | Advance Smart Ind Ltd | Apparatus and method for correcting residual capac |
| WO2009116566A1 (ja) | 2008-03-18 | 2009-09-24 | 協和発酵キリン株式会社 | 工業的に有用な微生物 |
| BRPI1015313B1 (pt) * | 2009-04-27 | 2021-06-01 | Genomatica, Inc. | Método fermentativo para produzir um éster de ácido graxo empregando um microorganismo geneticamente modificado e método para a produção de ésteres de ácidos graxos |
| US20110151526A1 (en) * | 2009-12-22 | 2011-06-23 | Charles Winston Saunders | Branched-Chain Fatty Acids And Biological Production Thereof |
| US20120172281A1 (en) * | 2010-07-15 | 2012-07-05 | Jeffrey John Scheibel | Detergent compositions comprising microbially produced fatty alcohols and derivatives thereof |
| BR112013003003A2 (pt) | 2010-08-06 | 2016-06-14 | Mascoma Corp | produção de produtos malonil-coa derivados através de rotas anaeróbicas |
| US8372610B2 (en) * | 2010-09-15 | 2013-02-12 | Ls9, Inc. | Production of odd chain fatty acid derivatives in recombinant microbial cells |
| EP2739726A1 (en) * | 2011-08-03 | 2014-06-11 | LS9, Inc. | Production of fatty acids and derivatives thereof having improved aliphatic chain length and saturation characteristics |
| US8790901B2 (en) | 2011-12-14 | 2014-07-29 | Pronutria, Inc. | Microorganisms and methods for producing unsaturated fatty acids |
| MX379251B (es) | 2012-04-02 | 2025-03-11 | Genomatica Inc | Producción mejorada de derivados de ácidos grasos. |
| KR101831331B1 (ko) * | 2012-04-02 | 2018-02-23 | 알이지 라이프 사이언시스, 엘엘씨 | Car 효소들 및 지방족 알코올들의 개선된 생산 |
-
2013
- 2013-04-02 MX MX2019004568A patent/MX379251B/es unknown
- 2013-04-02 CA CA2883968A patent/CA2883968C/en active Active
- 2013-04-02 CA CA3162104A patent/CA3162104A1/en active Pending
- 2013-04-02 MX MX2014011905A patent/MX366939B/es active IP Right Grant
- 2013-04-02 EP EP13715879.6A patent/EP2834352B1/en active Active
- 2013-04-02 US US14/390,378 patent/US20150064782A1/en not_active Abandoned
- 2013-04-02 BR BR112014024675-0A patent/BR112014024675B1/pt not_active IP Right Cessation
- 2013-04-02 KR KR1020147030467A patent/KR102166271B1/ko not_active Expired - Fee Related
- 2013-04-02 WO PCT/US2013/035037 patent/WO2013152051A2/en not_active Ceased
- 2013-04-02 KR KR1020207015194A patent/KR102353113B1/ko active Active
- 2013-04-02 JP JP2015504687A patent/JP6381518B2/ja not_active Expired - Fee Related
- 2013-04-02 EP EP19211601.0A patent/EP3674400A1/en not_active Withdrawn
- 2013-04-02 BR BR122019026142-3A patent/BR122019026142B1/pt active IP Right Grant
- 2013-04-02 BR BR122019026127-0A patent/BR122019026127B1/pt active IP Right Grant
- 2013-04-02 CN CN202210135822.5A patent/CN114456996A/zh active Pending
- 2013-04-02 CN CN201380026304.9A patent/CN104395464B/zh not_active Expired - Fee Related
- 2013-04-02 AU AU2013243601A patent/AU2013243601B2/en not_active Ceased
- 2013-04-02 MY MYPI2014002773A patent/MY181688A/en unknown
-
2014
- 2014-10-29 CO CO14240053A patent/CO7170149A2/es unknown
-
2017
- 2017-07-14 US US15/650,285 patent/US11060099B2/en not_active Expired - Fee Related
-
2018
- 2018-04-04 JP JP2018072000A patent/JP6738852B2/ja not_active Expired - Fee Related
-
2020
- 2020-05-07 JP JP2020081804A patent/JP7366836B2/ja active Active
-
2021
- 2021-06-01 US US17/335,812 patent/US20210348173A1/en not_active Abandoned
-
2023
- 2023-06-29 US US18/344,219 patent/US20240150774A1/en active Pending
Patent Citations (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5000000A (en) | 1988-08-31 | 1991-03-19 | University Of Florida | Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes |
| US5028539A (en) | 1988-08-31 | 1991-07-02 | The University Of Florida | Ethanol production using engineered mutant E. coli |
| US5424202A (en) | 1988-08-31 | 1995-06-13 | The University Of Florida | Ethanol production by recombinant hosts |
| US5482846A (en) | 1988-08-31 | 1996-01-09 | University Of Florida | Ethanol production in Gram-positive microbes |
| WO1991016427A1 (en) | 1990-04-24 | 1991-10-31 | Stratagene | Methods for phenotype creation from multiple gene populations |
| US5602030A (en) | 1994-03-28 | 1997-02-11 | University Of Florida Research Foundation | Recombinant glucose uptake system |
| US7169588B2 (en) | 1995-05-12 | 2007-01-30 | E. I. Du Pont De Nemours And Company | Bioconversion of a fermentable carbon source to 1,3-propanediol by a single microorganism |
| US5939250A (en) | 1995-12-07 | 1999-08-17 | Diversa Corporation | Production of enzymes having desired activities by mutagenesis |
| US5965408A (en) | 1996-07-09 | 1999-10-12 | Diversa Corporation | Method of DNA reassembly by interrupting synthesis |
| WO2007136762A2 (en) | 2006-05-19 | 2007-11-29 | Ls9, Inc. | Production of fatty acids and derivatives thereof |
| WO2008119082A2 (en) | 2007-03-28 | 2008-10-02 | Ls9, Inc. | Enhanced production of fatty acid derivatives |
| WO2008147781A2 (en) | 2007-05-22 | 2008-12-04 | Ls9, Inc. | Hydrocarbon-producing genes and methods of their use |
| WO2009085278A1 (en) | 2007-12-21 | 2009-07-09 | Ls9, Inc. | Methods and compositions for producing olefins |
| WO2009140696A2 (en) | 2008-05-16 | 2009-11-19 | Ls9, Inc. | Methods and compositions for producing hydrocarbons |
| WO2009140695A1 (en) | 2008-05-16 | 2009-11-19 | Ls9, Inc. | Methods and compositions for producing hydrocarbons |
| WO2010042664A2 (en) | 2008-10-07 | 2010-04-15 | Ls9, Inc. | Method and compositions for producing fatty aldehydes |
| US8097439B2 (en) | 2008-10-07 | 2012-01-17 | Ls9, Inc. | Methods and compositions for producing fatty aldehydes |
| US20100105963A1 (en) | 2008-10-28 | 2010-04-29 | Ls9, Inc. | Methods and compositions for producing fatty alcohols |
| WO2010062480A2 (en) | 2008-10-28 | 2010-06-03 | Ls9, Inc. | Methods and compositions for producing fatty alcohols |
| WO2010075483A2 (en) | 2008-12-23 | 2010-07-01 | Ls9, Inc. | Methods and compositions related to thioesterase enzymes |
| WO2010127318A2 (en) | 2009-05-01 | 2010-11-04 | The Regents Of The University Of California | Product of fatty acid esters from biomass polymers |
| WO2011038134A1 (en) | 2009-09-25 | 2011-03-31 | Ls9, Inc. | Production of fatty acid derivatives |
| WO2011038132A1 (en) | 2009-09-25 | 2011-03-31 | Ls9, Inc. | Production of fatty acid derivatives |
| US20110206630A1 (en) | 2010-02-14 | 2011-08-25 | Ls9, Inc. | Surfactant and cleaning compositions comprising microbially produced branched fatty alcohols |
Non-Patent Citations (33)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS, pages: 6.3.1 - 6.3.6 |
| ALTSCHUL ET AL., FEBS J., vol. 272, no. 20, 2005, pages 5101 - 5109 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, no. 3, 1990, pages 403 - 410 |
| AMANN ET AL., GENE, vol. 69, 1988, pages 301 - 315 |
| ARKIN ET AL., PROC. NATL. ACAD. SCI., U.S.A., vol. 89, 1992, pages 7811 - 7815 |
| ARNOLD, CURR. OPIN. BIOTECH., vol. 4, 1993, pages 450 - 455 |
| BALDARI ET AL., EMBO J., vol. 6, 1987, pages 229 - 234 |
| BOWIE ET AL., SCIENCE, vol. 247, 1990, pages 1306 - 1310 |
| CALDWELL ET AL., PCR METHODS APPLIC., vol. 2, 1992, pages 28 - 33 |
| CAVIGLIA ET AL., J. BIOL. CHEM., vol. 279, no. 12, 2004, pages 1163 - 1169 |
| CRONAN ET AL., MOL. MICROBIOL., vol. 29, no. 4, 1998, pages 937 - 943 |
| CURRIE: "Characterization of Environmental Particles", vol. I, 1992, LEWIS PUBLISHERS, INC., article "Source Apportionment of Atmospheric Particles", pages: 3 - 74 |
| DATSENKO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 6640 - 6645 |
| DELEGRAVE ET AL., BIOTECH. RES, vol. 11, 1993, pages 1548 - 1552 |
| GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS |
| GROSJEAN ET AL., GENE, vol. 18, 1982, pages 199 - 209 |
| HEATH; ROCK, JBC, vol. 271, 1996, pages 1833 - 1836 |
| KURJAN ET AL., CELL, vol. 30, 1982, pages 933 - 943 |
| LEUNG ET AL., TECHNIQUE, vol. 1, 1989, pages 11 - 15 |
| LUCKLOW ET AL., VIROLOGY, vol. 170, 1989, pages 31 - 39 |
| MANIATIS ET AL., SCIENCE, vol. 236, 1987, pages 1237 - 1245 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453 |
| PALMEROS ET AL., GENE, vol. 247, 2000, pages 255 - 264 |
| REIDHAAR-OLSON ET AL., SCIENCE, vol. 241, 1988, pages 53 - 57 |
| ROSENBERG, BMC BIOINFONNATICS, vol. 6, 2005, pages 278 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| SCHULTZ ET AL., GENE, vol. 54, 1987, pages 113 - 123 |
| SMITH ET AL., GENE, vol. 67, 1988, pages 31 - 40 |
| SMITH ET AL., MOL. CELL BIOL., vol. 3, 1983, pages 2156 - 2165 |
| STEMMER, PROC. NATL. ACAD. SCI., U.S.A., vol. 91, 1994, pages 10747 - 10751 |
| STUDIER ET AL.: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS, pages: 60 - 89 |
| STUIVER ET AL., RADIOCARBON, vol. 19, 1977, pages 355 |
| ZHU ET AL., BMC MICROBIOLOGY, vol. 9, 2009, pages 119 |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11060099B2 (en) | 2012-04-02 | 2021-07-13 | Genomatica, Inc. | Production of fatty acid derivatives |
| US10465213B2 (en) | 2012-08-10 | 2019-11-05 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| EP2970982A4 (en) * | 2013-03-15 | 2016-11-23 | Cargill Inc | ACETYL-COA CARBOXYLASEMUTATIONEN |
| US10815473B2 (en) | 2013-03-15 | 2020-10-27 | Cargill, Incorporated | Acetyl-CoA carboxylases |
| US10155937B2 (en) | 2013-03-15 | 2018-12-18 | Cargill, Incorporated | Acetyl-CoA carboxylases |
| US12129506B2 (en) | 2013-07-19 | 2024-10-29 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| US10337038B2 (en) | 2013-07-19 | 2019-07-02 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| US11408013B2 (en) | 2013-07-19 | 2022-08-09 | Cargill, Incorporated | Microorganisms and methods for the production of fatty acids and fatty acid derived products |
| WO2015054138A1 (en) * | 2013-10-10 | 2015-04-16 | William Marsh Rice University | Improved fatty acid productivity |
| WO2015095240A3 (en) * | 2013-12-20 | 2015-08-27 | The Regents Of The University Of California | Biosynthesis of 1-undecence and related terminal olefins |
| WO2015200335A1 (en) * | 2014-06-23 | 2015-12-30 | Joule Unlimited Technologies, Inc. | Engineered photosynthetic microbes and recombinant synthesis of carbon-based products |
| US11359216B2 (en) | 2014-07-18 | 2022-06-14 | Genomatica, Inc. | Microbial production of fatty diols |
| US10676763B2 (en) | 2014-07-18 | 2020-06-09 | Genomatica, Inc. | Microbial production of fatty diols |
| US10494654B2 (en) | 2014-09-02 | 2019-12-03 | Cargill, Incorporated | Production of fatty acids esters |
| JP2016052303A (ja) * | 2014-09-02 | 2016-04-14 | エボニック デグサ ゲーエムベーハーEvonik Degussa GmbH | 脂肪酸エステルの製造 |
| WO2016138712A1 (zh) * | 2015-03-02 | 2016-09-09 | 苏州安捷生物科技有限公司 | 一种生物法制备脂肪醇的方法 |
| US11345938B2 (en) | 2017-02-02 | 2022-05-31 | Cargill, Incorporated | Genetically modified cells that produce C6-C10 fatty acid derivatives |
| US12123045B2 (en) | 2017-02-02 | 2024-10-22 | Cargill, Incorporated | Genetically modified cells that produce C6-C10 fatty acid derivatives |
| US10801044B2 (en) | 2017-02-08 | 2020-10-13 | Kao Corporation | Method of producing fatty alcohol |
| US10975363B2 (en) | 2018-03-30 | 2021-04-13 | Inv Nylon Chemicals Americas, Llc | Materials and methods for biosynthetic manufacture and utilization of synthetic polypeptides, and products therefrom |
| US12338428B2 (en) | 2018-03-30 | 2025-06-24 | Inv Nylon Chemicals Americas, Llc | Materials and methods for managing aerobic gas fermentation |
| US12065636B2 (en) | 2018-03-30 | 2024-08-20 | Inv Nylon Chemicals Americas, Llc | High hydrogen utilization and gas recycle |
| US11203771B2 (en) | 2018-03-30 | 2021-12-21 | Inv Nylon Chemicals Americas, Llc | Materials and methods for biosynthetic manufacture of carbon-based chemicals |
| WO2019191770A1 (en) * | 2018-03-30 | 2019-10-03 | Invista North America S.A.R.L. | Materials and methods for biosynthetic manufacture of pimelic acid and utilization of synthetic polypeptides |
| US11512276B2 (en) | 2018-03-30 | 2022-11-29 | Inv Nylon Chemicals Americas, Llc | Methods for controlling oxygen concentration during aerobic biosynthesis |
| US11053287B2 (en) | 2018-05-02 | 2021-07-06 | Inv Nylon Chemicals Americas, Llc | Materials and methods for differential biosynthesis in species of the genera Ralstonia and Cupriavidus and organisms related thereto |
| US11999943B2 (en) | 2018-05-02 | 2024-06-04 | Inv Nylon Chemicals Americas, Llc | Materials and methods for maximizing biosynthesis through alteration of pyruvate-acetyl-CoA-TCA balance in species of the genera ralstonia and cupriavidus and organisms related thereto |
| US12060596B2 (en) | 2018-05-02 | 2024-08-13 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling limitation conditions in product biosynthesis for non-PHB generating species of the genera Ralstonia or Cupriavidus and organisms related thereto |
| US11788055B2 (en) | 2018-05-02 | 2023-10-17 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling oxidation and reduction in biosynthetic pathways of species of the genera ralstonia and cupriavidus and organisms related thereto |
| US11702680B2 (en) | 2018-05-02 | 2023-07-18 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling PHA biosynthesis in PHA-generating species of the genera Ralstonia or Cupriavidus and organisms related thereto |
| US11098381B2 (en) | 2018-05-02 | 2021-08-24 | Inv Nylon Chemicals Americas, Llc | Materials and methods for controlling regulation in biosynthesis in species of the genera Ralstonia or Cupriavidus and organisms related thereto |
| WO2020181091A1 (en) | 2019-03-05 | 2020-09-10 | Bp Corporation North America Inc. | Fatty acyl-acp reductases and their uses |
| WO2024119298A1 (en) | 2022-12-05 | 2024-06-13 | The Procter & Gamble Company | Fabric and home care composition comprising a polyalkylenecarbonate compound |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240150774A1 (en) | Production of fatty acid derivatives | |
| US11034937B2 (en) | Car enzymes and improved production of fatty alcohols | |
| EP2931742A2 (en) | Acp-mediated production of fatty acid derivatives | |
| CA2951925A1 (en) | Omega-hydroxylase-related fusion polypeptides with improved properties |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13715879 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2015504687 Country of ref document: JP Kind code of ref document: A Ref document number: 2883968 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 122019026138 Country of ref document: BR Ref document number: MX/A/2014/011905 Country of ref document: MX Ref document number: 14390378 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 20147030467 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14240053 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 2013243601 Country of ref document: AU Date of ref document: 20130402 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: IDP00201406815 Country of ref document: ID Ref document number: 2013715879 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014024675 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014024675 Country of ref document: BR Kind code of ref document: A2 Effective date: 20141002 |