WO2013150122A1 - Oligonucleotides modifies compenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques - Google Patents
Oligonucleotides modifies compenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques Download PDFInfo
- Publication number
- WO2013150122A1 WO2013150122A1 PCT/EP2013/057150 EP2013057150W WO2013150122A1 WO 2013150122 A1 WO2013150122 A1 WO 2013150122A1 EP 2013057150 W EP2013057150 W EP 2013057150W WO 2013150122 A1 WO2013150122 A1 WO 2013150122A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- modified oligonucleotide
- compound
- amplicon
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC(C*)(COP(N(C)*)O*)C(NC)=O Chemical compound CC(C*)(COP(N(C)*)O*)C(NC)=O 0.000 description 5
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
- C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6832—Enhancement of hybridisation reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to a modified oligonucleotide having two or more thiol functions, capable of being immobilized on a gold surface or on a grafted surface, in particular a surface comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions.
- the invention also relates to a method for detecting a nucleic acid in a biological sample comprising a step of detecting hybridization between a modified oligonucleotide and a target nucleic acid amplified from the biological sample.
- the invention more particularly relates to a method for detecting, genotyping or sequencing a pathogenic organism, preferably a virus.
- nucleic acids constitute extremely well suited molecules for use in the detection and identification processes specific to human organisms, animals, plants, bacteria or viruses.
- Biosensors which typically consist of a molecular recognition element and a transducer.
- the molecular recognition element called a “probe”
- the role of the transducer is to convert the molecular recognition event, i.e. the hybridization between the nucleotide sequences of the probe and the target, into an easily measurable signal.
- the biosensors thus exploit the pairing capabilities of two complementary nucleotide sequences contained in the probe and the target, and generate a signal when the hybridization of the two sequences occurs.
- Biosensors are characterized by the transduction mode used to reveal hybridization of the probe and target sequences.
- Direct transduction biosensors can detect sequence hybridization without the need for special labeling. They include, for example, electrochemical systems, in which the transduction is effected by electron transfer reactions, such as amperometry, based on the detection of current changes for a constant potential, the conductimetry, based on the detection of conductivity changes between two electrodes, or potentiometry, based on the detection of potential changes, for a constant current.
- Direct transduction biosensors also include gravimetric systems, based on piezoelectric technologies, and using, for example, the properties of a quartz crystal whose frequency changes in response to changes occurring on its surface.
- Indirectly transduced biosensors require, for their part, the labeling of the target nucleic acid sequences, and require the implementation of washing steps before detection.
- Indirectly transduced biosensors are generally in the form of optical systems, in which detection is performed in a reader coupled to a confocal microscope, based on light emission by one or more fluorescent markers in response to induced excitation. by a laser.
- Biosensors indirect transduction therefore generally require heavy instruments, complicated to use and require skilled people, but they have a high detection sensitivity (10 from 12 to 10 "15 M).
- Indirect transduction biosensors are the most used technology in the field of nucleic acid-based diagnostics.
- the biosensors direct or indirect transduction, detect thousands or tens of thousands of nucleic acid sequence hybridizations simultaneously and are generally arranged in the form of an ordered arrangement of immobilized probes in dot form on a support solid. Each point contains about 10 6 Identical probes having the same nucleotide sequence, and the nucleotide sequence of the probes differs from one point to another.
- “Microarrays” are high-complexity biosensors comprising 1000 to 10 6 points with a size of about 20 to 50 ⁇ . They are very sophisticated and expensive and are mainly intended for DNA sequencing, the study of genetic diseases and polymorphism analyzes. This type of biosensor is developed by the companies Affymetrix, Illumina and Agilent. "Macro networks” (in English “macroarrays”) are, for their part, low-complexity biosensors comprising 1000 to 10000 points of a size greater than or equal to 200 ⁇ .
- the immobilization of the probes on the biosensors may be carried out by co-valent or non-covalent coupling.
- Co-coupling of the probe with the transducer can be obtained for example by photo lithography or by reaction of an amino oligonucleotide with a functionalized silane coated surface.
- the probe may also be immobilized on a metal surface, and in particular on a gold surface, for example by means of a bond between a gold atom and a sulfur atom.
- the Au-S bond is moderately strong, and a single gold-sulfur bond is not sufficient to immobilize a probe on the gold surface very stably.
- the detection methods comprise steps, especially washing, which cause high mechanical stresses likely to destabilize the Au-S bond.
- the probe may also be coupled to the transducer in a non-covalent manner, for example by electrostatic adsorption.
- Non-covalent coupling may for example result from the interaction between the negatively charged phosphates of the probe DNA and the surface of the ⁇ -amino propylsilane-coated transducer or poly-L-lysine layer.
- the non-covalent interactions between the probe and the transducer are poorly resistant to the washing steps carried out during the detection procedures, in particular when the detection is carried out by indirect transduction since the detection of the hybridization requires, after the step d hybridization itself, eliminating labeled target nucleotide sequences that have not been linked to the nucleotide sequence of the probe.
- the non-covalent coupling also does not make it possible to significantly modify the operating conditions to increase the stringency of the hybridization or washing steps and thus make them more specific.
- EP 0 523 978 discloses phosphoramidite or phosphonate compounds useful for the production of thiol-modified oligonucleotides. These compounds can, however, be introduced only once and only on the 5 'end of an oligonucleotide.
- US 7,601,848 discloses a polyfunctional compound comprising two sulfur atoms for incorporation into oligo-mothers to create at least two gold-sulfur bonds and thereby stabilize the oligonucleotide on the gold surface. Some of these compounds have a phosphoramidite function.
- the compounds used in this document are nonetheless made from very expensive compounds and the coupling of the polyfunctional compound to the oligonucleotides does not have a satisfactory yield because of the steric hindrance of this compound.
- a linker is required to link the thiol compounds to one another and thereby effect multiple introduction of thiol compounds into an oligonucleotide.
- the object of the invention is therefore to develop a probe formed by an oligonucleotide having at least two thiol functional groups, which can be grafted in a simple and effective manner onto a variety of supports comprising both metal coated surfaces (for example or) graft surfaces comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions.
- the probe of the invention at least partially overcomes the aforementioned drawbacks and makes it possible to increase the specificity and detection sensitivity of target nucleotide sequences, regardless of the type of transduction (direct or indirect) implemented during the detection.
- the invention also aims to provide a method for detecting, sequencing and / or genotyping nucleic acids of pathogenic or infectious organisms or genes responsible or involved in diseases, which is economical, fast, sensitive, more flexible and easier to automate than current methods.
- a first object of the invention relates to a modified oligonucleotide corresponding to formula (Xllb):
- Ni,. .., N n independently of one another represent a nucleotide
- Mi,. .., M m independently of one another represent a nucleotide
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- p 0 or 1
- y ' is an integer from 0 to 12 if p is 1 and y' is 0 if p is 0, y '' is an integer from 0 to 12 if p is 1 and if p is 0 then y '' is 0, the sum of the integers (y + y ') or (y + y' + y '') being between 2 and 12,
- X is chosen from linear or branched C1-Cl2 alkyl, C1-C12 aminoalkyl, C1-C12 alkoxy, C3-C12 cycloalkyl, and C3-C12 oxygenated or nitrogen-containing cycloheteroalkyl groups;
- Y is chosen from linear or branched C1-Cl2 alkyl, C1-C12 aminoalkyl, C1-C12 alkoxy, C3-C12 cycloalkyl, and C3-C12 oxygenated or nitrogen-containing cycloheteroalkyl groups;
- Z is chosen from C1-C12 alkoxy, C3-C12 oxygenated or nitrogen-containing cycloheteroalkyl, C -C 12 -alkyl-alkyl, C 1 -C 12 -alkyl groups;
- W is selected from C 1 -C 12 trialkyl alkan groups, C 6 -C 18 aryl triyl groups and C 6 -C 18 trialkyl aryl groups, preferably a group selected from CH, CCH 3 , CCH 2; CH 3 , cyclohexane tri-yl and benzene tri-yl
- R is H or is selected from C1-Cl2, S-C1-Cl2alkyl, C6-Cl2alkyl, S-2-pyridine, S-heteroalkyl, oxygenated or C1-Cl2alkyl groups; C3-C12 cycloalkyl, S-cycloalkyl, S-cycloheteroalkyl oxygenated or C3-C12 nitrogen, and
- RI is selected from 2-cyanoethyl groups or R'iR'2R ' 3 SiCH 2 CH 2 , wherein R'i, R '2 and R' 3 are identical or different and represent a group selected from linear or
- the modified oligonucleotide of the invention has the formula:
- n, y, Ni, ..., N n-1 , X, Y, Z, W and R have the same definition as above, and B n is the base of the nth nucleotide.
- the modified oligonucleotide has the formula:
- n, y, N 2 , ..., N n , X, Y, Z, W and R have the same definition as above, and Bi represents the base of the first nucleotide.
- the modified oligonucleotide as described above comprises a nucleotide sequence (Ni-N2 -...- N n _i-N n ) and, optionally, a nucleotide sequence. (Mi-M 2 -...- M m -m-M m ) which are specific for a virus, a bacterium or a gene responsible or involved in a disease.
- nucleotide sequence (Ni N 2 -...- N _i n N n) and optionally the nucleotide sequence (Mi-M 2 -...- M m _i-M m ) are chosen from:
- the nucleotide sequence (Ni N 2 -...- N _i n N n) and optionally the nucleotide sequence (Mi-M 2 -...- M m _i-m m) have an anomeric alpha-type structure, beta anomer, linear, or stem-loop ( "snail").
- Another subject of the invention relates to a substrate grafted with at least one modified oligonucleotide as described above, said substrate comprising at least one receiving zone coated with a substance which tolerates the grafting of said modified oligonucleotide.
- said receiving zone of said graft substrate is coated with a gold or platinum film, and said substrate is made of metal, preferably copper, or said receiving zone comprises at its surface at least one carbon-carbon double bond (alkenyl function) or a carbon-carbon triple bond (alkynyl function) or haloacetamide functions, preferably maleimide or acrylamide functions, and said substrate is plastic, preferably polystyrene.
- the substrates used are non-conductive polymers.
- the substrates used to implement the invention are conductive.
- the flat grafted substrate (partly or wholly) or curved, and may advantageously take a spherical shape.
- the substrate is non-planar, for example in the form of micorparticles or nanoparticles, and is preferably magnetic.
- Another subject of the invention relates to a method for detecting at least one target nucleic acid in a biological sample, comprising a step of detecting said target nucleic acid with at least one detection probe formed by a modified oligonucleotide as described herein. -above.
- the detection method of the invention comprises the steps:
- the detection method of the invention makes it possible to determine the genotype and / or the subtype of a virus present in a biological sample, and comprises: the generation of an amplicon by amplification of a target nucleotide sequence, corresponding to a genomic region of the virus carrying information relating to the genotype and / or the viral subtype, and
- the step of producing the amplicon of the detection method of the invention is carried out with a mixture of nucleotide primers, preferably chosen from primer pairs:
- SEQ ID NO: 8 and SEQ ID NO: 9 when the amplicon is generated from HCV, regardless of the viral genotype involved.
- This pair of primers is generic and can amplify a "long" amplicon of 401nt from any genotype of HCV;
- SEQ ID NO: 29 and SEQ ID NO: 9 a pair enabling the generation of "short" amplicons of 108 nt specific for genotype 2;
- kits for detecting at least one target nucleic acid in a biological sample comprising:
- At least one modified oligonucleotide as described above and at least one substrate comprising at least one reception zone coated with a graft-tolerant substance of said modified oligonucleotide, said receiving zone preferably being coated with gold, platinum or comprises at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions
- Another subject of the invention relates to an oligonucleotide having a nucleotide sequence chosen from the sequences SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 40 and SEQ ID NO: 41.
- Another subject of the invention relates to the use of a modified oligonucleotide or oligonucleotide as described above or of a graft substrate as described above for detecting at least one target nucleic acid in a sample organic.
- said use allows the diagnosis or genotyping of viral strains, preferably HCV, Dengue virus or West Nile virus.
- the modified oligonucleotide of the invention carrying the thiol functions is inexpensive to produce
- the modified oligonucleotide of the invention may be immobilized stably on a gold surface, or on a surface comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functions, preferably functions maleimide or acrylamide,
- modified oligonucleotide of the invention in methods for detecting, sequencing and / or genotyping nucleic acids makes it possible to specifically detect target nucleotide sequences of several hundred nucleotides,
- nucleotide sequence of the modified oligonucleotide of the invention is advantageously shorter than those of the probes used in the known detection and / or genotyping methods, while presenting a better detection sensitivity and specificity.
- FIG. 1 represents a diagram describing a process for synthesizing the compounds (I).
- FIGS. 2A and 2B respectively represent a diagram describing a process for synthesizing an oligomer of the compounds of the invention from compounds (Ia) and from compounds (Ib).
- FIG. 3 represents a diagram describing a process for synthesizing an oligonucleotide compound (XIIc) grafted with an oligomer of (I) at its 5 'end.
- FIG. 4 represents a diagram explaining a process for synthesizing an oligonucleotide compound (XIIIc) grafted with an oligomer of (I) at its 3 'end.
- Figure 5 shows a histogram of the grafting rate of modified oligonucleotides on a gold surface.
- Fig. 6 is a diagram showing the stability of the grafting of modified oligonucleotides on a gold surface as a function of time at 60 ° C.
- Fig. 7 is a diagram showing the stability of the grafting of modified oligonucleotides on a gold surface as a function of time at 80 ° C.
- FIGS. 8 and 9 represent diagrams schematizing the results of ELOSA tests with fluorescence detection carried out with a tetrathiol type 3 a probe.
- FIG. 10 is a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a la / lb type tetrathiol probe.
- FIG. 11 is a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with type Ia / Ib probes bearing 1, 2, 4, 6 or 8 thiol groups.
- FIG. 12 is a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a La / Ib monothiol type probe at different graft densities.
- FIG. 13 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a La / Ib dithiol type probe at different graft densities.
- FIG. 14 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a La / Ib tetrathiol type probe at different graft densities.
- Figure 15 shows the results of a probe / target hybridization test with a tetrathiol probe grafted onto a gold surface.
- FIG. 16a shows the reactions between the modified oligonucleotide according to the invention and the grafted surface with activated alkenyl or alkynyl groups.
- FIG. 17 is a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a la / Ib type tetrathiol VHC probe.
- FIG. 18 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a mixture of two type 2a / 2c and / 2b tetrathiol VHC probes.
- FIG. 19 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a type 3a VHC tetrathiol probe.
- FIG. 20 is a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a 4a / 4d type 4a / 4d VHC tetrathiol probe.
- FIG. 21 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a generic tetrathiol probe for flaviviruses.
- FIG. 22 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a tetrathiol probe specific for serotype 4 of Dengue.
- FIG. 23 represents a diagram schematizing the results of ELOSA tests with fluorescence detection, carried out with a generic tetrathiol probe for the West Nile virus. DESCRIPTION OF THE EMBODIMENTS OF THE INVENTION
- the present application describes the preparation of compounds of structure phosphoramidite, H-phosphonate or compounds bound to a solid support having a protected thiol function. These thiol compounds are intended to be introduced into oligonucleotides to form the modified oligonucleotides according to the invention.
- the modified oligonucleotides thus obtained may have several thiol functions.
- the thiol compounds to be introduced into the modified oligonucleotides of the present invention have the following formula (I): Y
- T is a group chosen from -O-P (ORi) N (R 2 ) 2 , -O-PH (O) O ⁇ ,
- R 1 is chosen from 2-cyanoethyl groups, R ' 1 R' 2 R ' 3 SiCH 2 CH 2 , and R' h R ' 2 , R' 3 , which may be identical or different, represent a group chosen from linear or branched alkyls having 1 to 12 carbon atoms and C6-C12 aryls,
- R 2 is chosen from linear or branched alkyl groups containing from 1 to 12 carbon atoms, pyrrolidine,
- J is chosen from a single bond, a group -CH 2 -, -CH 2 CH 2 -, -CH 2 OCH 2 -, -CH 2 OPhOCH 2 - where Ph is a benzyl, o represents a solid support,
- W is selected from C1-Cl2 tri-yl alkane groups, C6-C18 aryl tri-yl groups and C6-C18 tri-yl aralkane groups;
- Z is chosen from C1-C12 alkoxy, C3-C12 oxygenated or nitrogenous cycloheteroalkyl, C1-C12 NCO-alkyl, C1-C12 alkyl-C1-C12,
- Y is chosen from linear or branched C1-Cl2 alkyl, C1-C12 aminoalkyl, C1-C12 alkoxy, C3-C12 cycloalkyl, and C3-C12 oxygenated or nitrogen-containing cycloheteroalkyl groups;
- X is chosen from linear or branched C1-Cl2 alkyl, C1-C12 aminoalkyl, C1-C12 alkoxy, C3-C12 cycloalkyl, and C3-C12 oxygenated or nitrogen-containing cycloheteroalkyl groups;
- R is selected from the group consisting of C1-Cl2, S-C1-Cl2alkyl, S-C6-C12alkyl, S-2-pyridine, S-heteroalkyl oxygenated or nitrogen-containing C1-Cl2, S- C3-C12cycloalkyl, S-cycloheteroalkyl oxygenated or nitrogen C3-C12.
- tri-yl alkane means linear, branched or cyclic tri-l-alkanes, optionally substituted with one or more alkyl grouping.
- tri-yl aryl groups which may be present in the compound according to the invention, mention may be made of benzene tri-yl and naphthalene triyl.
- aralkane groups there may be mentioned 1,3,5-trimethylbenzene tri-yl and trimethylnaphthalene tri-yl.
- the compound (I) can be distinguished into three sub-compounds (Ia), (Ib) and (Ic) corresponding to formulas (Ia), (Ib) and (Ic) below in which the parameters X, Y, Z , R, R 1, R 2 and D have the same definition as explained above for the formula (I):
- R 1 is chosen from 2-cyanoethyl and R ' 1 R' 2 R ' 3 SiCH 2 CH 2 groups , and R' 1 , R ' 2 , R' 3, which may be identical or different, represent a group chosen from linear alkyl groups.
- R 1 is chosen from 2-cyanoethyl groups and R ' 1 R' 2 R ' 3 SiCH 2 CH 2 , and R' 1 , R ' 2 , R' 3, which may be identical or different, represent a group chosen from linear or branched alkyl groups having 1 to 3 carbon atoms, phenyl; still more preferably R 1 is selected from 2-cyanoethyl, 2- (trimethylsilyl) ethyl, 2- (triphenylsilyl) ethyl, 2- (diphenylmethylsilyl) ethyl.
- R 2 is chosen from linear or branched alkyl groups containing from 1 to 6 carbon atoms.
- R 2 is an isopropyl group (iPr).
- the solid support ⁇ is chosen from resins, in particular from resins based on polystyrene, polyacrylamide, polyethylene glycol, cellulose, polyethylene, polyester, latex, polyamide, polydimethylacrylamide, synthetic or natural hydrophilic polymers, glass, silica gels.
- W is chosen from C1-C6 tri-yl alkane groups, a C6-C12 aryl tri-yl group, a C6-C12 aralkane tri-yl group, more particularly from the groups CH, CCH 3 , CCH 2 CH 3 , cyclohexanes tri-yl and benzenes tri-yl.
- D is chosen from among the alcohol protecting groups which allow an orthogonal deprotection with respect to the other groups of the compound (I). More particularly, D is chosen from 4,4'-dimethoxytrityl (DMTr), 9-phenylxanthen-9-yl (pixyl) or fluorenylmethyloxycarbonyl (Fmoc).
- DMTr 4,4'-dimethoxytrityl
- pixyl 9-phenylxanthen-9-yl
- Fmoc fluorenylmethyloxycarbonyl
- the pixyl protecting group is described in particular in the document Chattopadhyaya and Reese, Chem. Soc. Chem. Comm., 1978, 639-640.
- Another protecting group of the alcohols may be a tert-butyl-dimethylsilyl group, in this case a polystyrene support will be particularly preferred.
- Z is chosen from aminoalkyl groups C1-C6, alkoxy C1-C6, cycloheteroalkyl oxygenated or nitrogen C3-C6, NCO-C1-C6 alkyl CON-C1-C6 alkyl.
- Y is chosen from linear or branched C1-C6 alkyl, C1-C6 aminoalkyl, C1-C6 alkoxy, C3-C6 cycloalkyl, and C3-C6 oxygenated or nitrogen-containing cycloheteroalkyl groups.
- X is chosen from linear or branched C1-C6 alkyl, C1-C6 aminoalkyl, C1-C6 alkoxy, C3-C6 cycloalkyl, and C3-C6 oxygenated or nitrogen-containing cycloheteroalkyl groups.
- R is chosen from C1-C12-alkyl, C-C6-alkyl, C6-oxygenated S-aryl, C6-oxygenated or C6-oxygenated heterocycloalkyl groups, oxygenated C6, S-cycloheteroalkyl, or nitrogen in C6.
- the linear or branched alkyls are chosen from methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, isopropyl, isobutyl and tert-butyl groups.
- the aminoalkyls are chosen from aminomethyl, aminoethyl, aminopropyl, aminobutyl, aminopentyl, aminohexyl, aminoheptyl, aminooctyl, aminononyl and aminodecyl groups, aminoundecyl, aminododecyl, aminoisopropyl, aminoisobutyl, amino-tert-butyl comprising one or more nitrogen atoms.
- the alkoxy are chosen from methoxy, ethoxy, propyloxy, oxybutyloxy, pentyloxy, hexyloxy, heptyloxy, octyloxy, nonyloxy, decyloxy, undecyloxy, dodecyloxy, isopropyloxy, isobutyloxy and tert-butyloxy groups comprising one or more carbon atoms. 'oxygen.
- the cycloalkyls are chosen from rings, optionally comprising one or more unsaturations, comprising between 3 and 12 carbon atoms, preferably 6 carbon atoms.
- the cycloheteroalkyls are chosen from rings substituted with one or more nitrogen and / or oxygen atoms, optionally comprising one or more unsaturations and comprising between 3 and 12 carbon atoms, preferably 5 carbon atoms. carbon and a nitrogen or oxygen atom.
- the NCO-alkyls and CON-alkyls are groups in which the alkyls can be linear or branched alkyls chosen from the methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl and nonyl groups, decyl, undecyl, dodecyl, isopropyl, isobutyl, tert-butyl.
- R 2 is an isopropyl group (iPr) and / or Ri is a cyanoethyl group.
- the thiol compound (Ia) is the compound (VI) corresponding to the following formula:
- n is an integer between 1 and 12, preferably between 1 and 6, R, R 1, R 2 and D have the same definition as above for (la).
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- R is an acetyl group.
- D is 4,4'-dimethoxytrityl.
- the thiol compound (Ia) is the compound (VII) corresponding to the following formula: SR
- n is an integer between 1 and 12, preferably between 1 and 6, R, R 1, R 2 and D have the same definition as above for (la).
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- R is an acetyl group.
- D is 4,4'-dimethoxytrityl.
- the thiol compound (Ie) is the compound (VIII) corresponding to the following formula:
- n is an integer between 1 and 12, preferably between 1 and 6, R and ⁇ have the same definition as above for (le).
- R is an acetyl group.
- J is an ethyl group.
- D is 4,4'-dimethoxytrityl.
- the thiol compound (Ia) is the compound (IX) of formula:
- n is an integer between 1 and 12, preferably between 1 and 6,
- R, R 1, R 2 and D have the same definition as above for (Ia).
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- R is an acetyl group.
- D is 4,4'-dimethoxytrityl.
- the thiol compound (Ia) is the compound (X) of formula:
- n is an integer between 1 and 12, preferably between 1 and 6,
- R, R 1, R 2 and D have the same definition as above for (Ia).
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- R is an acetyl group.
- D is 4,4'-dimethoxytrityl.
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- the thiol compound (Ia) is the compound (XI) of formula:
- n is an integer between 1 and 12, preferably between 1 and 6, R, R 1, R 2 and D have the same definition as above for (Ia).
- R 2 is an isopropyl group (iPr) and R 1 is a cyanoethyl group.
- R is an acetyl group.
- D is 4,4'-dimethoxytrityl.
- the compound of formula (Ia) can be obtained according to the reaction shown in the following scheme: HO below p (0Rl) / 0- ⁇ (0 ⁇ ) ⁇ (3 ⁇ 4) 2
- Q and Q ' represent, independently of each other, a substituted or unsubstituted benzene group.
- the preceding reaction for obtaining compound (Ia) or (Ib) is carried out starting from compound (II), preferably in the presence of a base, for example diisopropylethylamine (DIEA), in an anhydrous solvent, such as anhydrous dichloromethane.
- a base for example diisopropylethylamine (DIEA)
- DIEA diisopropylethylamine
- the preceding reaction for obtaining the compound (Ic) is preferably carried out in an anhydrous solvent, such as pyridine, in the presence of a base, such as triethylamine.
- the compound (Ie) can also be obtained according to the following reaction scheme
- the compound of formula (II) can be obtained from compound (III) according to the reaction step described below:
- G is halogen, preferably bromine or iodine.
- the reaction described above is preferably carried out in an anhydrous solvent, such as anhydrous toluene and in the presence of a crown ether.
- anhydrous solvent such as anhydrous toluene and in the presence of a crown ether.
- the compound (III) can be obtained from the compound (IV) according to the reaction step described below:
- G and G ' are identical or different halogen atoms, preferably G and G' are bromine or iodine atoms,
- Z ' is a C 1 -C 12 aminoalkyl, C 1 -C 12 alkoxy, C 3 -C 12 oxygenated or C 3 -C 12 nitrogenous cycloheteroalkyl, NCO-C 1 -C 12 alkyl, CON-C 1 -C 12 alkyl group;
- Z " is a linear or branched C 1 -C 12 alkyl, C 1 -C 12 aminoalkyl, C 1 -C 12 alkoxy, C 3 -C 12 cycloalkyl, C 3 -C 12 oxygenated or C 3 -C 12 alkylated heterocycloalkyl or NCO-C 1 -C 12 alkyl group; CON-C1-C12 alkyl,
- the dihalogenated compound G-Z "-G ' being intended to react with the Z' group of the compound (IV) to give rise to the formation of the Z-G group of the compound (III).
- the step of obtaining the compound (III) is preferably carried out in the presence of an alkaline hydride, such as NaH.
- the compound (IV) can be obtained from the commercial compound (V) by protecting the alcohol function, according to the following reaction step:
- This step of protecting the alcohol function is carried out under conditions well known to those skilled in the art, depending on the choice of D.
- the compound (IV) is obtained from the compound (V) by reaction with 4,4'-dimethoxytrityl chloride (DMTr-Cl) preferably in a solvent, such as pyridine to protect the alcohol function.
- DMTr-Cl 4,4'-dimethoxytrityl chloride
- the compound (IV) is obtained from the compound (V) from 9-phenylxanten-9-yl chloride (pixyl-Cl) under the conditions described in the document Chattopadhyaya and Reese, Chem . Soc. Chem. Comm., 1978, 639-640.
- the compound (IV) is obtained from the compound (V) by reaction with fluorenylmethyloxycarbonyl chloride (Fmoc-Cl) under conditions well known to those skilled in the art.
- the starting compound (V) is 1,1,1-tris (hydroxymethyl) ethane or 2,2-bis (hydroxymethyl) propionic acid or 1,3,5-tris (hydroxyethoxy) benzene or 1,3,5-tris (hydroxymethyl) cyclohexane or 2-amino-1,3-propanediol.
- An oligomer may be formed from thiol compounds of formula (I) previously described. The process for the synthesis of such oligomers is described in the scheme of FIG. 2A for the oligomerization of compounds of formula (Ia) and in the scheme of FIG. 2B for the oligomerization of compounds of formula (Ib).
- a first step the alcohol function of the compound (Ic) is deprotected to yield the compound (Ic i).
- This deprotection step is carried out by means well known to those skilled in the art, preferably in the presence of di or trichloroacetic acid for the groups DMTr and Pixyl and piperidine for the group Fmoc
- the compound (Ic i) reacts with the compound (Ia) or (Ib) to yield respectively the compound phosphitetriester (XIV) 1 or H-phosphonate diester
- the compound (XIV) 1 is preferably oxidized in the presence of a diiodode, the diiodide being then displaced by water supplying the oxygen atom of the phosphate triester bond, to yield the phosphotriester compound (XIV) 1.
- the oxidation step is carried out after each coupling step between a compound (XIV) and a compound (Ia).
- the compound (XV ') k is oxidized, preferably in the presence of diiod and water to yield the phosphodiester compound (XV) k .
- a last optional step consists in deprotecting the compounds (XIV) k or (XV) k to yield the same compound (I) k.
- the oligomer results from the oligomerization of 2 to 12 compounds (I), in particular between 2 and 8 compounds (I), that is to say that the oligomer may comprise 2, 3, 4, 5, 6, 7 or 8 compounds (I).
- the thiol oligomer to be grafted onto a gold surface comprises between 3 and 8, advantageously between 4 and 8 compounds (I) and the thiol oligomer intended for conjugation with a surface comprising at least one double bond carbon-carbon or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions advantageously comprises between 2 and 6 compounds (I).
- the oligomer is manufactured solely from compounds of formula (Ia) or compounds of formula (Ib).
- the oligomerization is carried out by reaction between the deprotected alcohol function of a first compound (I) and the phosphoramidite or H-phosphonate function of a second compound (I).
- the oligomer is manufactured using phosphoramidite chemistry, i.e., oligomerization of type (Ia) compounds.
- the oligomerization may be carried out on a solid support or in solution.
- the oligomerization is carried out on a solid support.
- oligomerization in solution involves purification steps by chromatography, non-economically viable steps, particularly for small quantities required in diagnostic applications.
- k represents an integer between 1 and 11
- D, X, Y, W, Z, J, R and R 1 have the same definition as above and R may further represent H, k is an integer from 1 to 11.
- D, X, Y, W, Z, J and R have the same definition as above and R may further represent H, k is an integer from 1 to 11.
- the compound obtained (XV) k has the same formula as the compound (XIV) k but in which Ri is a hydrogen atom after oxidation of the H-phosphonate diester bonds.
- An object of the present invention relates to a modified oligonucleotide, comprising at least ten nucleotides and at least two thiol compounds (I) as previously described.
- oligonucleotide denotes a chain comprising from 4 to 100 nucleotides.
- the grafting of the thiol compound according to the invention is carried out at the 3 'position, in the chain, or at the 5' position of an oligonucleotide.
- the process for preparing such a modified oligonucleotide comprises at least:
- a step of grafting a nucleotide on an oligomer of a compound (I) to give a 3'-thiol oligonucleotide a step of grafting a nucleotide on an oligomer of a compound (I) to give a 3'-thiol oligonucleotide.
- the grafted oligonucleotide corresponds to the formula
- Ni,. ..N n independently of one another represent a nucleotide
- Mi,. ..M m represent independently of one another a nucleotide
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- p 0 or 1
- y ' is an integer from 0 to 12 if p is 1 and y' is 0 if p is 0, the sum of the integers (y + y ') not being greater than 12,
- ⁇ represents a solid support.
- a scheme for obtaining the compound (Xlla) is described in FIG. 3 in which the thiol compounds are of the type (Ia) and p is equal to 0.
- the first three stages of manufacture of the compound (Xlla) allow the synthesis of an oligonucleotide.
- the synthesis of the oligonucleotide is carried out on a solid support by a conventional method well known to those skilled in the art.
- a first nucleotide is grafted on a solid support, then the other nucleotides are grafted following synthetic methods well known to those skilled in the art.
- the following compound is obtained:
- a thiol compound as described above, of type (Ia) is grafted at the 5 'position of the oligonucleotide (XIIa.2) to yield compound (XIIa.3):
- the grafting is done conventionally by reaction of the compound of phosphoramidite function (Ia) with the alcohol function at the 5 'position of the terminal nucleotide of the compound (XIIa.2).
- n, y and Ni, N 2 ,. ..N n-1 have the same definition as for the compound (Xlla), Bn represents a base conventionally used in a nucleotide chain.
- the modified oligonucleotide has a structure similar to that of the modified oligonucleotide (XIIa.4) but in which Ri represents H.
- This grafting step is carried out conventionally by methods known to those skilled in the art.
- the grafted oligonucleotide has the following formula (XHIa):
- Ni,. ..N n independently of one another represent a nucleotide
- Mi,. .. M m represent independently of one another a nucleotide
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- y ' is an integer ranging from 2 to 12,
- p is 0 or 1 if y 'is other than 0 and if y' is 0 then p is 0,
- y is an integer from 0 to 12 if p is 1 and if p is 0 then y" is
- a scheme showing a synthetic mode of the compound (XIIIc) is described in Figure 4 using an oligomer formed from a compound of type (Ie) where J is an ethyl group, and type (Ib) compounds.
- the synthesis of the compound of formula (XIIIc) comprises a first step consisting of the oligomerization of the thiol compound according to the invention of formula (I), the method of which is described above, to give the compound of formula (XIIIa):
- (F) represents a group of type (Fa) or (I "b), where
- a first nucleotide Ni is grafted onto the oligomer of formula (XIIIa.1) to yield the compound of formula (XIIIa.2) below:
- This grafting step is carried out by reaction between the deprotected alcohol function at the end of the oligomer chain of the compound (XIIIa.1) and the phosphoramidite or H-phosphonate function of the first nucleotide Ni.
- the modified oligonucleotide is then synthesized by any method known to those skilled in the art, including a conventional method well known to those skilled in the art by reaction between the alcohol function 5 'of the first nucleotide present on the oligomer of the thiol compound and the phosphoramidite or H-phosphonate function at the 3 'position of a second nucleotide.
- the synthesis is followed by similar successive steps of elongation of the nucleotide chain well known to those skilled in the art to yield the compound of formula (XIIIa).
- An object of the present invention thus relates to the compounds obtained from the compounds of formula (Xlla) and (XIIIa) above after cleavage of the bond which connects the modified oligonucleotide to the solid support.
- the link is broken at the ester function.
- the unsupported modified oligonucleotide of the invention has the following structure (Xllb):
- Ni,. ..N n independently of one another represent a nucleotide
- Mi,. ..M m represent independently of one another a nucleotide
- n is an integer ranging from 4 to 100
- m is a number ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- p 0 or 1
- y ' is an integer from 0 to 12 if p is 1 and y' is 0 if p is 0, the sum of the integers (y + y ') not being greater than 12.
- the removal of the support is carried out in two stages with firstly a strong non-nucleophilic base (piperidine or DBU) to eliminate the cyanoethyl groups if present (phosphoramidites case) and secondly by a conventional method known to those skilled in the art, preferably by treating the compound (Xlla) with ammonium hydroxide (NH 4 OH). It is necessary to remove the cyanoethyl groups before the deprotection of the thiol groups because they form acrylonitrile during their removal which reacts strongly with the thiol functions.
- a strong non-nucleophilic base piperidine or DBU
- the unsupported modified oligonucleotide of the invention has the following structure (XlIIb):
- Ni,. ..N n independently of one another represent a nucleotide
- Mi,. .. M m represent independently of one another a nucleotide
- (le ') represents the compound obtained from (Ic) by cleavage of the ester bond with the solid support, and preferably has the structure
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- y ' is an integer ranging from 0 to 12
- p is 0 or 1 if y 'is other than 0 and if y' is 0 then p is 0,
- y is an integer from 0 to 12 if p is 1 and if p is 0 then y" is
- the removal of the support is carried out by a conventional method known to those skilled in the art, preferably by treatment of the compound (XIIIa) with ammonium hydroxide (NH 4 OH).
- the modified oligonucleotide corresponds to the structural formula (Xllb):
- n, y, ⁇ , ..., N n-1 , X, Y, Z, W and R have the same definition as above, and B n is the base of the nth nucleotide.
- the modified oligonucleotide corresponds to the structural formula (XlIIb):
- n, y, N 2 , ..., N n , X, Y, Z, W and R have the same definition as above, and Bi represents the base of the first nucleotide.
- Another subject of the present invention relates to the modified oligonucleotides (XIIc) and (XIIIc) obtained respectively from the compounds (Xlla) and (Xllla) by deprotection of the thiol function and cleavage of the bond connecting the compound to the solid support (FIGS. 3 and 4 respectively).
- the oligonucleotide is modified with one or more thiol compounds of the type (la)
- the compound of formula (XIIc) is obtained:
- Ni,. ..N n represent independently of one another a nucleotide
- Mi,. ..M m represent independently of one another a nucleotide
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- p 0 or 1
- Ni,. ..N n , n, y have the same definition as for the compound (Xlla),
- Bn represents a base conventionally used in a nucleotide chain.
- the oligonucleotide is modified with one or more thiol compounds of type (Ib)
- the compound of formula (XIIIc) is obtained:
- Ni,. . .N n independently of one another represent a nucleotide
- Mi,. . . M m independently of one another represent a nucleotide
- (le ') represents the compound obtained from (Ic) by cleavage of the ester bond with the solid support
- n is an integer ranging from 4 to 100
- n is an integer ranging from 4 to 100
- y is an integer ranging from 2 to 12,
- y ' is an integer ranging from 2 to 12,
- p is 0 or 1 if y 'is other than 0 and if y' is 0 then p is 0,
- y '' is an integer from 0 to 12 if p is 1 and, if p is 0 then y '' is
- N 2 ,. . .N n , n and y have the same definition as for the compound (Xlla), Bn corresponds to a base conventionally used in a nucleotide chain.
- the thiol function is preferably protected. Indeed, the thiol function can react with the incoming phosphoramidite function.
- the step of deprotection of the thiol functions and elimination of the solid support can be carried out in a single step of treatment of the modified oligonucleotide (Xlla) or (XIIIa).
- the removal of the solid support can also be carried out in a first step and the deprotection of the thiol functions is then carried out in a second step.
- the final oligonucleotide (XIIc) (respectively the final oligonucleotide (XIIIc)) is obtained independently of the starting thiol compound, whether from the compound (Ia) or the compound (Ib). Indeed, whatever the monomer (Ia) or (Ib) used, the thiol monomer unit resulting from the oligomerization reaction corresponds to the compound (I ") described above.
- the grafted supports of formulas (XVI) k described above make it possible to initiate the synthesis of oligonucleotides.
- the nucleotide sequence (N 1 -N 2 -...- N n-1 -N n ) and, optionally, the nucleotide sequence (Mi-M 2 -...- m m _i-m m) of the modified oligonucleotide of the invention as described above are specific to a virus, a bacterium or a gene responsible or involved in a disease.
- sequence (Ni-N 2 -...- N n -i-N n ) and optionally, the sequence (Mi-M 2 -...- M m -m- m ) are complementary to all or part of at least one target nucleic acid sequence included in a gene or in the genome of a virus or bacterium, and characteristic of the latter.
- the hybridization of the sequence (Ni-N 2 -...- N _i n N n) and optionally the sequence (Mi-2 -...- M M m M m-_i ) with the part or all of the corresponding target sequence leads to the formation of a nucleic acid duplex having at most 2 mismatches.
- the term "specific" means that the duplex formed comprises only one or two mismatches.
- the duplex formed contains no mismatch.
- Chargeristic sequence of a gene or genome of a virus or bacterium means a genomic, chromosomal or plasmid region of an organism, a virus or a bacterium, having an arrangement of nucleotides that is not found in other organisms, due to unique genetic variations.
- modified oligonucleotide and “probe” are used interchangeably and denote an oligonucleotide of 4 to 100 nucleotides and having at least 2 thiol functions, as described above.
- the modified oligonucleotide of the invention comprises from 13 to 20 nucleotides, advantageously 14 or 15 nucleotides.
- the probe therefore has the ability to graft onto a suitable surface, such as a surface coated with gold or maleimide groups, and also has the ability to hybridize, via its nucleotide portion, with a target nucleotide sequence.
- the modified oligonucleotide of the invention comprises from 2 to 12 thiol functions, in particular between 2 and 8 functions, that is to say that the modified oligonucleotide may comprise 2, 3, 4, 5, 6 , 7 or 8 functions.
- the modified oligonucleotide to be grafted onto a gold surface comprises between 3 and 8, advantageously between 4 and 8 thiol functions.
- the modified oligonucleotide intended for conjugation with a surface comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions advantageously comprises between 2 and 8 thiol functions, and preferably 4 thiol functions.
- target sequence denotes a sequence complementary or partially complementary to the probe of the invention, and which is amplified from a gene or the genome of a or a bacterium, and preferably from a region characteristic of the latter.
- virus refers to a biological entity requiring a host cell to replicate, and consisting of at least one nucleic acid and proteins, the nucleic acid possibly being DNA and / or RNA, single or double-stranded.
- viruses include those capable of parasitizing prokaryotes (eg Myoviridae, Siphoviridae, Podoviridae, Microviridae and Inoviridae), those capable of parasitizing plants (phytovirus such as tobamovirus), insects (eg baculoviruses), mushrooms, and the man.
- viruses also include arboviruses.
- Arboviruses bring together morphologically heterogeneous viruses belonging to several distinct genera including more particularly the genera Flaviviruses (Flaviviridae family), Alphavirus (Togaviriadae family), Coltivirus (Reoviridae family), Phlebovirus (Bunyaviriadae family).
- the family Flaviviridae includes the genera Flavivirus (yellow fever virus, West Nile virus), tick-borne encephalitis virus (TBE), Japanese encephalitis virus, influenza virus. St. Louis encephalitis, usutu virus and Dengue virus), Hepacivirus (hepatitis C virus) and Pestivirus (bovine viral diarrhea virus (BVD), swine fever virus).
- the Togaviridae family includes the genera Alphavirus (Sindbis virus, Ross River virus, O'nyong'nyong virus, Chikungunya virus) and Rubivirus (Rubella virus, Rubella virus).
- the family Reoviridae includes viruses affecting the digestive system (such as Rotavirus), or the respiratory system.
- the Bunyaviridae family includes the genera Hantavirus (Hantavirus pulmonary syndrome, Korean hemorrhagic fever), Nairovirus (Dugbe virus), Orthobunyavirus (Bunyamwera virus), Phlebovirus (Rift Valley fever) and Tospovirus.
- viruses capable of infecting humans include Vesiculoviruses (vesicular stomatitis virus, etc.), Lyssaviruses (rabies virus, Australian bat virus), Picornaviruses. (Rhinovirus, Poliovirus, hepatitis A virus %), Herpesvirus (varicella zoster, CMV cytomegalovirus, Epstein Barr EBV virus 10), Orthomyxovirus (influenza virus %), Paramixovirus ( measles virus, mumps virus %), Poxviruses (smallpox virus), Coronavirus (SARS ....), Filoviruses (Ebola %), Hepadnaviruses (HBV) and Retroviruses (HIV, HTLV ).
- bacteria refers to any living organism that is prokaryotic, characterized by an absence of nucleus and organelles, and has a cell wall. This term includes, in particular, bacteria that may be pathogenic and cause diseases and / or infections in humans, such as Corynebacterium diphtheriae (diphtheria), Treponema pallidum (syphilis), Mycobacterium tuberculosis (tuberculosis), Mycobacterium leprae (leprosy) ), Neisseria gonorrhoeae (gonorrhea), Rickettsia (typhus), Clostridium tetani (tetanus), Nibrio cholerae (cholera), Pseudomonas aeruginosa and Staphylococci (opportunistic pathogens).
- diphtheria diphtheria
- Treponema pallidum syphilis
- Mycobacterium tuberculosis tubercul
- This term also includes bacteria involved in transfusion risks and in nosocomial infections such as, for example, Gram-negative bacteria Escherichia coli, Klebsiella oxytoca Klebsiella pneumoniae, Serratia marcescens, Yersinia enterocolitica, Enterobacter aerogenes, Acinetobacter baumanii, and Pseudomonas aeruginosa. , or Gram-positive bacteria Staphylococcus epidermidis, Staphylococcus aureus, Bacillus cereus, Streptococcus pyogenes, Propionibacterium acnes and Clostridium perfringens.
- the nucleotide sequence (Ni-N 2 -...- N n _ iN n ) and, optionally, the nucleotide sequence (Mi-M 2 -. ..- M m _i-M m ) are chosen from:
- SEQ ID NO: 1 SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 35 or SEQ ID NO: 36, specific for the virus of the hepatitis C (HCV),
- the nucleotide sequence (N 1 -N 2 -...- N n _ iN n ) and, optionally, the nucleotide sequence (Mi-M 2 -. ..- M m _i-m m) have an anomeric alpha-type structure, beta anomer, linear, or "snail".
- the modified oligomer of the invention (wherein the thiols are 5 ') hybridizes antiparallel to the target sequence.
- the modified oligomer of the invention whose thiols are located 3 ' hybridizes in parallel with the target sequence.
- the modified oligonucleotides according to the invention may be deposited on a substrate in order to functionalize the surface of this substrate.
- the substrate may be metallic or of polymer, conductive or non-conductive. It may be plane (in part or in its entirety) or curved, and may advantageously take a spherical shape. According to one embodiment, the substrate is non-planar, for example in the form of microparticles or nanoparticles.
- the modified oligonucleotides according to the invention can then be grafted onto these microparticles or nanoparticles. Preferably, these particles are magnetic.
- these magnetic particles can then be easily brought to the surface of an electrode or the bottom of the wells of a microplate, for a detection test, genotyping or sequencing, by applying a magnet.
- the use of a non-planar support of the microparticle or nanoparticle type in the context of the detection method of the invention advantageously makes it possible to increase the area of the surface on which the modified oligonucleotides of the invention can be grafted, and thus makes it possible to increase the proportion of hybridizations between the probes and the target sequences.
- the substrate is metallic, for example copper or titanium, and is covered partially or over its entire surface with a gold or platinum film, preferably gold.
- the substrate is made of polymer, preferably a conductive polymer.
- the substrate may comprise receiving zones covered with a gold or platinum film or covered with alkenyl, alkynyl or haloacetamide functions, such as maleimide or acrylamide functions, on which the modified oligonucleotide is deposit.
- the groups comprising at least one carbon-carbon double bond or a carbon-carbon triple bond are chosen from alkenes activated by an alpha carbonyl function, preferably the alkenes are chosen from the groups maleimide and acrylamide.
- the haloacetamide groups are chosen from bromoacetamido and iodoacetamido groups.
- the groups comprising at least one carbon-carbon triple bond are chosen from alkynes activated by an alpha carbonyl function, preferably the alkynes are chosen from 2-propynamide groups.
- the thiol function reacts with the carbon-carbon double bond or the carbon-carbon triple bond activated by a function carbonyl in alpha. From the top to the bottom of FIG.
- the first functionalization reaction corresponds to a maleimide grafted surface
- the second reaction corresponds to an acrylamide grafted surface
- the third reaction corresponds to a grafted surface of iodoacetamido or bromoacetamido
- the fourth reaction corresponds to a 2-propynamide grafted surface made in the case of a modified oligonucleotide according to the invention comprising two thiol compounds.
- the surface is grafted by alkenyl groups ( 1st reaction) and alkynyl (2 nde reaction) unactivated.
- the first functionalization reaction is carried out using a monothiol modified oligonucleotide schematically represented by gpt-SH and the second reaction is carried out using a modified dithiol oligonucleotide.
- the surface functionalization with a modified polythiol oligonucleotide is very interesting because it leads to a cyclic structure thanks to two successive reactions between a first thiol function and the -yne function in a first one. step then between a second thiol function and the resulting -ene function in a second step ( Figures 16a and 16b).
- the substrate is grafted with maleimide or acrylamide groups.
- the invention makes it possible, for example, to functionalize a gold surface by creating gold-sulfur bond (s) between the surface of the substrate and the modified oligonucleotide, or to functionalize a grafted surface with maleimide or acrylamide functions by creation. liaison (s) thioethers.
- Fixing the modified oligonucleotides on the surface of the substrate is carried out by soaking the surface to be treated in a solution comprising the modified oligonucleotide according to the invention as described above. Generally one or more steps of washing and drying are subsequently provided.
- the solution of modified oligonucleotides is at a concentration of between 0.1 .mu.m and 500 .mu.M, preferably between 0.5 .mu. and 100 .mu.M when the substrate surface is in gold and between 50 nM and 200 nM. preferably between 75 nM and 150 nM when the surface of the substrate is maleimide. Soaking is followed by washing to remove unreacted.
- An object of the invention therefore comprises a substrate grafted with at least one modified oligonucleotide as described above, said substrate comprising at least one reception zone coated with a substance that tolerates the grafting of said modified oligonucleotide.
- the substrate has the shape of an electrode.
- the substrate is in the form of a microplate having 96 wells or more.
- the graft substrate according to the invention is made of metal, preferably copper or titanium, and comprises at least one receiving zone coated with a gold or platinum film.
- the grafted substrate is made of plastic, preferably polystyrene, and the receiving zone is coated with maleimide groups and / or has on its surface at least one carbon-carbon double bond or a triple bond. carbon-carbon bond or haloacetamide functions, preferably maleimide or acrylamide functions.
- the graft density of the modified oligonucleotide according to the invention obtained on the reception zone results from the use of grafting solutions of 10 nM per well at 500 nM per well, when a 96-well plate is used as a substrate.
- the graft density of the modified oligonucleotide according to the invention on the substrate receiving zone is obtained by using a grafting solution of 100 nM per well when a 96-well plate is used as a substrate.
- the modified oligomers of the present invention may also be linked by one or more points of attachment to markers or ligands which may be, for example, enzymatic, chromogenic, fluorogenic, radioactive or chemiluminescent markers, metals, metal ions, hormones, proteins, peptides, saccharides, oligosaccharides, nucleolytic or proteolytic agents, binding agents, such as biotin, antigen, hapten, antibody or receptor.
- this marker or ligand makes it possible to detect the hybridization event between the modified oligonucleotide of the invention and a target sequence representative of a gene, a virus or a bacterium.
- the marker or ligand binds to the target nucleotide sequence representative of a gene, a virus or a bacterium, and makes it possible to detect the hybridization event between the modified oligonucleotide of the invention and the target sequence.
- Another subject of the present invention relates to a method for detecting at least one target nucleic acid in a biological sample, comprising a step of detecting said target nucleic acid with at least one detection probe formed by a modified oligonucleotide as described herein. -above.
- the detection method comprises the steps:
- Bio sample means any substance containing or suspected of containing a nucleic acid, such as DNA or RA, and obtained from a human, animal, plant or animal. any liquid or solid composition.
- the biological sample includes, for example, samples of tissues or fluids isolated from an individual or individuals, including but not limited to skin, blood, plasma, serum, spinal fluid, lymphatic fluid, synovial fluid, urine, tears, blood cells, bone marrow, organs, tumors, as well as samples of constituents of in vitro cell cultures.
- the biological sample can be advantageously treated to destroy the structure of the tissues or cells, in order to place the intracellular constituents in solution.
- amplicon is meant a nucleic acid molecule generated during an amplification procedure of a target nucleic acid sequence characteristic of the gene, virus or bacterium contained in the biological sample.
- the amplicon is generated by the polymerase chain reaction (or PCR) technique.
- the amplicon used in the detection method of the invention advantageously has a size ranging from 75 bp to about 500 bp. It appears in particular that one of the advantages of the method of the invention lies in the possibility of using amplicons having a length of one or several hundred nucleotides, which proves impossible in the detection methods known in the art. state of the art.
- the detection method of the invention thus makes it possible to select and amplify larger target sequences in genes, viruses or bacteria.
- the detection method makes it possible to determine the genotype and / or the subtype of a virus present in a biological sample.
- the amplicon is more specifically generated by amplification of a target nucleotide sequence, corresponding to a genomic region of the virus carrying information relating to the genotype and / or the viral subtype, and the detection is carried out with a specific probe of a genotype and / or a particular viral subtype.
- the method of the invention thus makes it possible to perform the detection on the basis of target sequences containing more information on the type, or the viral or bacterial subtype. This advantage results directly from the modified oligonucleotide according to the invention, its mode and its ability to attach to the substrate attachment zone.
- the method of the present invention makes it possible, on the contrary, to select primers located in conserved regions in the families of viruses or bacteria targeted, and to amplify longer target sequences. This results in significant savings and increased ease of use insofar as the same primers can be used to amplify a genomic area found in several types and / or viral or bacterial subtype, without fear of seeing the results of the hybridization distorted by the size of the amplicon used.
- the step of producing the amplicon of the detection method of the invention is carried out with a mixture of nucleotide primers, preferably chosen from primer pairs:
- SEQ ID NO: 8 and SEQ ID NO: 9 when the amplicon is generated from HCV, regardless of the viral genotype involved.
- This pair of primers is generic and can amplify a "long" amplicon of 401nt from any genotype of HCV;
- SEQ ID NO: 10 and SEQ ID NO: 9 a pair enabling the generation of "short” amplicons of 191 nt specific for genotype 1a / lb; SEQ ID NO: 29 and SEQ ID NO: 9, a pair allowing the generation of "short” amplicons of 108 nt specific for genotype 2;
- the modified oligonucleotide according to the invention is used in the detection method at a density resulting from the contacting of a grafting solution ranging from 10 nM to 500 nM with a well, when a 96-well plate is used as a substrate.
- the grafting solution of the modified oligonucleotide according to the invention is 100 nM, when a 96-well plate is used as a substrate.
- the grafting solution used has a modified oligonucleotide concentration of at least ⁇ (when a 96-well plate is used as a substrate) and the concentration of the amplicon used. in the detection method is at least ⁇ .
- the modified oligonucleotide according to the invention comprises 4 thiol functions
- the grafting solution used has a modified oligonucleotide concentration of at least ⁇ per well and the concentration of the amplicon used in the detection method is at least ⁇ per well, when a 96-well plate is used as a substrate.
- the detection method according to the invention has a particular advantage for the genotyping of HCV, in that it makes it possible in particular to distinguish the various known genotypes and subtypes of HCV, by implementing a simple molecular detection test.
- Hepatitis C virus infections are an extremely important health problem because infected individuals are at risk of developing liver disease, cirrhosis, and primary liver carcinoma, and are also an infectious reservoir.
- Epidemiological studies predict a tripling of annual deaths from HCV over the next 10 years if new diagnostic and therapeutic systems are not developed. Characterized by high genetic variability, HCV is classified into six major genotypes, comprising more than 80 subtypes.
- the precise determination of the infectious genotype and / or subtype has crucial implications for therapeutic strategies, and can predict the efficacy of the antiviral response and define the duration of therapy, as well as the type and dosage of the therapy. treatment.
- the identification of the precise classification of HCV found in infected individuals is also important for epidemiological monitoring, in order to monitor the distribution of viral strains and to identify transmission factors.
- the 5 'NCR region is thus chosen as the target in the various known and commercially distributed genotyping methods, such as the Bayer Bayer INNO LiPA HCV II assay, the Bayer / Siemens Healthcare NCR Trugene HCV 5' kit (WO2007 / 076493). , based on sequence analysis and duplex mobility test, or a hybridization detection system comprising a plurality of VHC typing drawn in the 5 'NCR region or the NS5 region developed by Roche Molecular Systems (US 2007/014160).
- the 5 'NCR region also does not appear to be sufficiently reliable to identify genotypes 2 and 4 of the virus.
- the reference method for genotyping HCV further resides in the sequencing of specific regions of HCV, and in particular of the NS5b region of the virus, encoding RNA-dependent RNA polymerase.
- sequencing is expensive and time consuming, requiring specialized equipment and skilled operators. It is therefore not appropriate for conducting large-scale clinical studies.
- Another subject of the present invention relates to an oligonucleotide having a nucleotide sequence chosen from the sequences SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 40 and SEQ ID NO: 41.
- the oligonucleotide of sequence SEQ ID NO : 1 corresponds to a nucleotide sequence specifically found in HCV type la / lb and specifically detect these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 27 corresponds to a nucleotide sequence specifically found in HCV type 2 and allows specific detection of these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 35 corresponds to a nucleotide sequence specifically found in HCV type 2a / 2c and can specifically detect these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 36 corresponds to a nucleotide sequence specifically found in HCV type 2b and allows specific detection of these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 4 corresponds to a nucleotide sequence specifically found in HCV type 3a and can specifically detect these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 28 corresponds to a nucleotide sequence found specifically in HCV type 4a / 4d and allows specifically detect these in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 40 corresponds to a nucleotide sequence found specifically in flaviviruses and makes it possible to detect them specifically as part of a detection method. as described above.
- the oligonucleotide of sequence SEQ ID NO: 18 corresponds to a nucleotide sequence found specifically in Dengue viruses and makes it possible to specifically detect them in the context of a detection method as described above.
- the oligonucleotide of sequence SEQ ID NO: 41 corresponds to a nucleotide sequence found specifically in Dengue serotype 4 viruses, and makes it possible to specifically detect the latter in the context of a detection method as described above. above.
- the oligonucleotide of sequence SEQ ID NO: 19 corresponds to a nucleotide sequence specifically found in West Nile viruses and can specifically detect them in the context of a detection method as described above. Detection kits
- Another subject of the invention consists of a detection and / or diagnostic kit comprising at least one support comprising at least one reception zone, on which at least one modified oligonucleotide according to the invention is placed.
- the detection kit can be used for the screening of logically active bio molecules or for diagnostic or sequencing tests. It can be provided that the diagnostic kit comprises a plurality of distinct reception zones, on which a solid support grafted with identical or distinct oligonucleotides is deposited.
- solid supports grafted with identical or distinct modified oligonucleotides may be placed on separate reception zones of a substrate coated with a gold film or a substrate grafted with functions comprising at least one double bond carbon-carbon or a carbon-carbon triple bond or haloacetamide functions, preferably maleimide or acrylamide functions so as to form a test and / or diagnostic support.
- the support can in particular be a gold electrode.
- the test kit may advantageously comprise an electrochemical cell comprising a working electrode, a counter-electrode and a reference electrode.
- the working electrode may be gold, the platinum counter electrode and the silver reference electrode.
- the study of the interaction of a modified oligonucleotide with a test molecule may comprise a cyclic voltammetry step.
- Grafting with a surface comprising at least one carbon-carbon double bond (alkenyl function) or a carbon-carbon triple bond (alkynyl function) or haloacetamide functions, preferably maleimide or acrylamide functions may for example be used for applications in the field of diagnostics in microplate format and / or for the implementation of ELOSA type tests ("Enzyme-Linked OligoSorbent Assay” or "assay of bound enzyme oligoadsorption" in French).
- ELOSA type tests Enzyme-Linked OligoSorbent Assay
- the surface of the wells is grafted with alkenyl, alkynyl or haloacetamide functions, preferably maleimide or acrylamide 1 functions.
- the surface is brought into contact with modified oligonucleotides according to the invention.
- one or more thioether bonds are formed by virtue of the presence of one or more thiol functions on the oligonucleotides according to the invention.
- the test consists in putting in contact a sample to be tested comprising a target nucleotide sequence with the wells thus functionalized, in particular to measure the hybridization of the oligonucleotides.
- the measurement can for example be done by fluorescence by labeling the o ligonucleotide chains.
- the invention also relates to the use of a modified oligonucleotide as described above and comprising at least two thiol functions for surface grafting comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or functions haloacetamide, preferably maleimide or acrylamide functions.
- the compound may comprise three or four thiol functions.
- the modified oligonucleotide immobilized on the surface comprising at least one carbon-carbon double bond or a carbon-carbon triple bond or haloacetamide functional groups, preferably maleimide or acrylamide functions, via at least two thiol functions has a very good stability for use in a diagnostic test, such as an ELOSA type test, as well as better availability vis-à-vis targets.
- a diagnostic test such as an ELOSA type test
- the number of hybridizations on the entire grafted medium during the detection test increases.
- a modified oligonucleotide having four thiol functions provides more efficient target hybridization.
- probe means an oligonucleotide chain comprising at least one thiol compound according to the invention intended to be immobilized on a surface.
- target is intended to mean an oligonucleotide chain intended to hybridize with the probe, for example, during a diagnostic test.
- Compound 3 is obtained from compound 1 following the protocol described in Pourceau, G., Meyer, A., Vasseur, J.J., and Morvan, F., Journal of Organic Chemistry 74, 2009, 1218-1222.
- the excess reagent is neutralized by the addition of 500 ml of water and the mixture is then diluted with dichloromethane (150 ml). The organic phase is washed with a saturated aqueous solution of NaHCC3 (100 mL) and then dried over Na 2 SO 4. After evaporation, the crude is purified by chromatography on silica (0 to 30% of ethyl acetate in cyclohexane containing 4% triethylamine) yielding the desired compound as a colorless oil (400 mg, 72%).
- 1-O- (4,4'-dimethoxytrityl) -2- (6-S-acetylthiohexyloxymethyl) -2-methyl-1,3-propanediol 4 (178 mg, 0.3 mmol) and the dimethylaminopyridine (DMAP 36 mg, 0.3 mmol) are coevaporated with 3 mL of anhydrous pyridine.
- succinyl-long chain alkylamine -CPG Controled Pore Glass
- anhydrous pyridine 5 ml
- anhydrous triethylamine 160 ml, 1.2 mmol
- ethyldimethylaminopropyl carbodiimide EDC, 280 mg
- the mixture is filtered and washed with CH 2 Cl 2 (10 mL) and then dried in a desiccator.
- the solid support thiol compound is treated with a solution of acetic anhydride, N-methylimidazole, 2,6-lutidine in THF for 3 hours with stirring.
- the mixture is filtered and washed with CH 2 Cl 2 (10 mL) and then dried in a desiccator to give the solid support thiol 6 (940 mg) with a functionalisation of 29 ⁇ / g.
- oligonucleotides comprising a ferrocene group at the 5 'position and an increasing number of thiol compounds of type (Ia) according to the invention (1, 2 and 4 compounds thiol) were synthesized on a DNA synthesizer.
- the ferrocene group was used to visualize the immobilization of the oligonucleotide on the gold surface by cyclic voltammetry.
- One, two or four thiol groups were introduced on a propanediol solid support and the DNA sequence SEQ ID NO: 7 was grafted.
- an alpha-thymidine phosphoramidite bearing a ferrocene group was introduced at the 5 'position of the modified oligonucleotide.
- the following deprotection takes place in two stages. First, the medium is treated with 10% piperidine in acetonitrile for 10 minutes to remove the cyanoethyl group by beta-elimination and the resulting acrylonitrile is removed from the medium by washing with acetonitrile. Then, a concentrated ammonium hydroxide treatment makes it possible to eliminate the acyl protecting groups on the nucleobases and on the thiol functions and makes it possible to hydrolyze the succinyl linker (solid support). This protocol makes it possible to avoid the addition of Michael between deprotected thiol functions and acrilonitrile. After evaporation, the unsupported modified oligonucleotide is purified by reverse phase HPLC chromatography on a Cl 8 column.
- Tetrathiol modified oligonucleotide with 4 thiol compounds
- VMP3 Biology multi-path potentiostat (Biology Science Instruments, Claix Bridge) was used. The results were recorded using the EC-Lab software from Biology Science Instruments.
- the electrochemical cell is composed of a 0.28 cm 2 gold electrode, a platinum counter-electrode and an Ag / AgCl reference electrode.
- ODN-thiol oligonucleotides modified with one or more thiol compounds
- TCEP Tris (2-carboxyethyl) phosphine hydrochloride
- ie a concentration in the 20 mM solution in TCEP, HC1, at 20 ° C, for 2 hours under argon.
- a grafting solution containing 4nmol ODN, 90mM sodium phosphate, 2mM TCEP, HC1 is obtained.
- Step 2 Activation of the gold electrode
- the gold working electrode is cleaned by a first wash in acetone for 10 minutes with ultrasound. Once dried the surface is dipped in a "piranha” solution (H 2 SO 4 0.7mL, H 2 O 2 0.3mL) for 1 minute to remove any organic residue from the surface.
- a "piranha” solution H 2 SO 4 0.7mL, H 2 O 2 0.3mL
- the basic activation of the electrode consists in cleaning the gold surface by producing hydrogen at the electrode by hydrolysis of water in 0.5M sodium hydroxide in the negative potentials (-1.4V vs Ag / AgCl) for several cycles.
- the grafting solution containing the thiol oligonucleotide is brought into contact with the activated gold electrode for three days under an inert atmosphere.
- the electrochemical cell After rinsing, the electrochemical cell is filled with the analysis electrolyte
- Step 4 Analysis of the stability of surface grafted compounds
- the analyzes are carried out by cyclic voltammetry (CV) at 50mV / s; between -0.1V and 0.45V.
- the stability studies of the grafted layer are carried out after stabilization of the electrochemical signal for 2 hours by cycling every 30 minutes.
- the cell is filled with distilled water degassed at 60 ° C or 80 ° C for 1 or 5 minutes, after rinsing the cell is filled with 1.5mL of phosphate analysis electrolyte (20mM) perchlorate (250mM). After 30 minutes of stabilization, a CV is produced.
- a comparison of the degree of grafting of the 3 oligonucleotides modified with thiol compounds (tetrathiol, dithiol and monothiol) was carried out.
- the degree of grafting was determined by integration of the peak of oxidation of ferrocene. Indeed, the transferred electron charge is directly related to the number of ferrocenes present on the surface of the electrode, and therefore to the number of probes grafted on gold.
- the tetrathiol molecule is very stable with respect to successive treatments in water at 60 ° C. (FIG. 6). Indeed, after 5 times one minute of this treatment, 97% of the starting signal remains, unlike monothiol (70% of starting signal) and dithiol (62%> of starting signal).
- HCV (+) amplicons of 401 bp are produced from the HCV viral region NS5b, by RT-PCR from each of the previously described plasma samples.
- the RNA is extracted from 200 ⁇ of human plasma using the High Pure Viral Nucleic Acid kit (Roche) according to the manufacturer's recommendations. The RNA is eluted in 50 ⁇ of sterile water (DNase / RNase free). In order to perform reverse transcription step (RT), 1 ⁇ RNA were denatured at 72 ° C for 10 minutes and reverse transcribed in the presence of ⁇ 4 ⁇ of 5X First Strand Buffer (Invitrogen), 2 ⁇ , of 10X Hexanucleotide Mix (Roche), 2 ⁇ .
- RT reverse transcription step
- VHCanti-sense (of GGC GGA ATT CCT GGT CAT sequence CTC CGT GAA (SEQ ID NO: 9)) (see Tamalet C. et al., 2003, Journal of Medical Virology
- the amplification reaction is carried out in 50 ⁇ l of reaction mixture comprising: IX PCR Buffer without MgCl 2 (Invitrogen), 0.2 ⁇ l of each primer, 1.5 mM MgCl 2 (Invitrogen), 0.2 mM dNTP mix (Invitrogen) and 1 , 3U Taq Polymerase (Invitrogen).
- the PCR conditions are as follows: 5 min at 95 ° C, 40 cycles
- the HCV amplicons obtained are analyzed by agarose gel electrophoresis, aliquoted and stored at -20 ° C. before use.
- primers In addition to these long amplicons, other primers have been designed to generate shorter amplicons from each of the previously described plasma samples. The same global protocol is followed to generate the amplicons "Short", and only the primers used are changed. The primers used are chosen according to the genotype and / or subtype of the HCV that infected the patients.
- HCV-specific amplicons of subtype la / lb, with a size of 191 nucleotides are amplified with the following primers:
- VHCantisens antisense primer of SEQ ID NO: 9 (see above).
- An example of a short amplicon of 191 nucleotides obtained from a viral strain la / lb, reference # PTR6719 has the following sequence:
- Subtype 2 HCV-specific amplicons with a size of 108 nucleotides are amplified with the following primers:
- Biotinylated sense primer "biotinylated VHC 2", of sequence 5 '- [Btn] -ATG-YTG-GTR-TGC-GGC-GAC-GAC-3' (ie [Btn] -SEQ ID NO: 29), and
- VHCantisens antisense primer of SEQ ID NO: 9 (see above).
- HCV subtype 3a-specific amplicons 143 nucleotides in size, are amplified with the following primers:
- Biotinylated sense primer "VHC sense”, of SEQ ID NO: 8 see above
- An example of a short amplicon of 143 nucleotides obtained from a viral strain 3a, reference # PTR9058 has the following sequence:
- HCV-specific amplicons of subtype 4a / 4d, of a size of 175 nucleotides are amplified with the following primers:
- Biotinylated sense primer "VHC sense”, of SEQ ID NO: 8 see above
- the "short" HCV amplicons obtained from 191, 108, 175 and 143 nucleotides are analyzed by agarose gel electrophoresis, aliquoted and stored at -20 ° C. before use.
- Synthetic Targets 15-mer or 105-mer biotinylated oligonucleotides Synthetic oligonucleotides 15-mer or 105-mer biotinylated at the 5 'end were synthesized.
- the synthetic 15-mer oligonucleotides are strictly complementary to the selected HCV probes (see below), and have the following sequences:
- the 15-mer synthetic oligonucleotides specific for the subtype la / lb have the sequence: 5 '[Btn] -GCT CCRGGA ACT GCA C -3' (ie [Btn] -SEQ ID NO: 2); the 15-mer synthetic oligonucleotides specific for subtype 3a have the sequence: [Btn] -CTT GAA CCG GAG GCC-3 '(ie [Btn] -SEQ ID NO: 5) and
- the 15-mer synthetic oligonucleotides specific for subtype 4a / 4d have the sequence: 5 '[Btn] -CTA YGT GGG CGG YCC -3' (ie [Btn] -SEQ ID NO: 39).
- Older oligonucleotides comprising the sequence complementary to the HCV probes presented below, flanked on either side by sequences of 45 nucleotides, ie 105 nucleotides in total, and biotinylated at the 5 'end, have also been synthesized for the development of probe / target hybridization assays.
- the 105-mer synthetic oligonucleotides used have the following sequences:
- the synthetic 105-mer synthetic oligonucleotides specific for the subtype la / lb have the sequence: 5 '[Btn] - CCT CAC TTG CTA CAA CAT GGC CCA GGC AGC CTG TCG AGC CGC AGG - GCT CCR GGA ACT GCA C - CAT GCT CGT GTG TGG CGA CGA CTT AGT CGT TAT CTG TGA AAG TGC-3 '(ie [Btn] -SEQ ID NO: 3); and
- the synthetic subtype 3a-specific synthetic 105-mer oligonucleotides have the following sequence: 5 '[Btn] - GAA CAG GAC ATC AGG GTG GAA GAG GAG ATA TAC CAA TGC TGT AAC - CTT GAA CCG GAG GCC - AGG AAA GTG ATC TCC TCC CTC ACG GAG CGG CTT TAC TGC GGG GGC -3 '(ie [Btn] -SEQ ID NO: 6).
- the NS5b region encoding HCV RNA polymerase has been targeted for the design of the oligonucleotide probes of the invention.
- HCV genome sequences amplified in the NS5b region were determined and analyzed using clustalW2 alignment and Mega5 phylogeny software to identify the most conserved areas for each genotype and / or or subtype of HCV. Separate regions allowing the generic recognition of the viral sequences of a genotype and possibly a given subtype have been selected. A highly conserved region allowing the specific detection of all HCV of viral genotype la / lb has thus been identified and selected. Similarly, a region for the specific detection of HCV viral genotype 2, 2a / 2c, 2b, 3a and 4a / 4d has been identified and selected.
- oligonucleotides complementary to each of the selected regions were drawn and multi-thiol oligonucleotides were then synthesized on the basis of the sequences selected for the specific recognition of the la / lb, 2, 2a / 2c, 2b, 3a and 4a / 4d subtypes.
- the oligonucleotide sequence selected to generate the probe la / lb is: 5'-
- the oligonucleotide sequence selected for generating probe 2 is: 5'-TGG-CTY-TCT-GAG-ATG (SEQ ID NO: 27). This probe is specific for subtype 2 strains.
- the oligonucleotide sequence selected to generate probe 2a / 2c is: 5'-GGA-CTC-CTC-RGT-TCT (SEQ ID NO: 35). This probe is specific for strains of subtype 2a and 2c.
- the oligonucleotide sequence selected to generate probe 2b is: 5'-TAT-GGA-TTC-TTC-TGT (SEQ ID NO: 36). This probe is specific for strains of subtype 2b.
- the oligonucleotide sequence selected to generate probe 3a is: 5'-GGC-CTC-CGG-TTC-AAG (SEQ ID NO: 4). This probe is specific for strains of subtype 3a.
- the oligonucleotide sequence selected to generate the 4a / 4d probe is: 5'-GGR-CCG-CCC-ACR-TAG (SEQ ID NO: 28). This probe is specific for strains of subtypes 4a and 4d. Evaluation of probe / target hybridizations by ELOSA (Enzyme-Linked OligoSorbent Assay)
- thiol probes oligonucleotides alpha or beta anomers, linear probes or stem-loop ("snails")
- WB1 0.1 M Na 2 HPO 4, 0.15 M NaCl, 0.05% Tween 20 (w / v), pH 7.2
- Functionalization of the wells is carried out with 100 nM of multi-thiol probes (as described above) in BB buffer (0.1 M Na 2 HPO 4 , 0.15 M NaCl, 10 mM EDTA, pH 7.2) for 2 hours at room temperature (RT).
- the wells are then washed three times with WB1, saturated with a solution of cysteine-HCl 10 ⁇ g.mL ⁇ 1 in BB (Pierce) for 1 hour at RT, and washed again three times with WB1.
- Hybridization assays are performed with short 15-mer or 105-mer synthetic targets or with real long (401 nt) or shorter (191 nt or 143 nt) HCV amplicons.
- the synthetic targets and the amplicons are diluted in 150 ⁇ l of hybridization buffer (TH: 0.9M NaCl, 60mM NaH 2 PO 4 , 6mM EDTA, pH 7.4, Denhardt 5X) before being deposited in the wells.
- An additional denaturation step of 10 min at 95 ° C. is carried out on the amplicons before transfer into the microwells.
- Hybridization is carried out overnight at 37 ° C.
- Wells are washed with WB2 buffer (0.75M NaCl, 50mM NaH 2 PO 4 , 5mM EDTA, pH 7.4, 0.1% SDS) three times 2 min at RT and once 30 min at 50 ° C.
- the detection step is carried out after incubation for 30 min at RT of the wells in the presence of 100 ⁇ / ⁇ of Streptavidin-Europium (Perkin Elmer) diluted in 100 of assay buffer (Perkin Elmer).
- the wells were finally washed six times with buffer WB3 (WB1X, Perkin Elmer) and 200 ⁇ ⁇ of the signal revelation buffer ( "Buffer Enhancement", Perkin Elmer) were added to each well for 5 min at RT.
- the time-resolved fluorescence is measured on a Victor 3 TM 1420 multi-label detector ("multilabel counter", Perkin Elmer) according to the manufacturer's protocol (excitation at 340 nm and emission at 615 nm).
- Results 1 Hybridization Assays on Linear Probes of Beta Anomers with 4 Thiol Functions
- Linear beta-anomeric probe 3a having 4 thiol functions are grafted, at a density of 100 nM, onto a support covered with maleimide groups according to the protocol described above. The results obtained with the probes 3a are described in FIGS. 8 and 9.
- ELOSA tests are performed by varying the nature and concentration of the target used (short synthetic targets 15-mothers and 105-mothers, short amplicons of 143 nt or 191 nt, 401 nt long amplicons), in order to verify specificity. selected probes.
- the results presented in FIG. 8 correspond to an ELOSA test carried out with long amplicons specific for the genotype VHC 3a, at the 1/10, 1/100 and 1/1000 dilutions and with non-specific long amplicons (corresponding to the VHC genotype la / lb) at 1/10, 1/100 and 1/1000 dilutions.
- hybridization positive control is performed with a synthetic target (15-mer) specific for genotype 3a at concentrations of 1000 ⁇ M and 5 ⁇ M.
- Hybridization negative controls are performed with a non-specific (15-mer) synthetic target (corresponding to the target sequence la / lb) at a concentration of ⁇ , or with TH (hybridization buffer) alone, not including target.
- probe 3a In order for probe 3a to be considered as "specific” for subtype 3a, it is therefore necessary for the results obtained with targets "3a" to exceed the background noise obtained with negative controls, so that probe / target hybridization can be quantified.
- the results presented in FIG. 9 correspond to an ELOSA test carried out with the following targets:
- the probe "3a" according to the present invention is not only capable of hybridizing with specific synthetic targets 3 to 15 -mers (the target having a concentration of 5 ⁇ M) or 105 -mers (the target having a concentration of ⁇ ), but also with long amplicons of 401 nt or 143 nt short obtained from plasmas genotyped 3a, and therefore genotype 3a specific (at a dilution at 1/1000 th ) .
- results presented in FIG. 10 correspond to an ELOSA test carried out with linear la / Ib probes (see above), of beta anomerism having 4 thiol functions, which are grafted at a density of 100 nM on a support covered with maleimide groups. according to the protocol described above.
- the probe 1a / 1b according to the present invention is not only capable of hybridizing with specific 15-mer or 105-mer synthetic targets la / lb (the target having a concentration of ⁇ ) , but also with short-term amplifiers of 191 nt obtained from genotyped plasmas la / lb, and therefore genotype-specific la / lb (at a dilution at 1/1000 th ), and with long amplicons of 401 nt specific to the genotype Ia / Ib (at a dilution of l / 100 th).
- results presented in FIG. 17 correspond to an ELOSA test carried out with a linear la / lb probe of beta anomer with 4 thiol functions, which is grafted at a density of 100 nM on a support covered with maleimide groups according to the protocol described above. above.
- the results of FIG. 17 are obtained from the following targets:
- 15-specific synthetic target la / lb at a concentration of ⁇ or ⁇
- 15-mer non-specific synthetic target 2a / 2c, 2b, 3a or 4a / 4d (negative control) at a concentration of ⁇ or ⁇
- results presented in FIG. 18 correspond to an ELOSA test carried out with a mixture of two probes (2a / 2c of SEQ ID NO: 35 and 2b of SEQ ID NO: 36) linear of beta anomer with 4 thiol functions, which are grafted at a density of 50nM each on a support covered with maleimide groups according to the protocol described above.
- results presented in FIG. 19 correspond to an ELOSA test carried out with a beta linear anomer 3a probe having 4 thiol functions, which is grafted at a density of 100 nm onto a support covered with maleimide groups according to the protocol described above.
- results presented in FIG. 20 correspond to an ELOSA test carried out with a linear 4a / 4d probe of beta anomerism having 4 thiol functions, which is grafted to a density of ⁇ on a support covered with maleimide groups according to the protocol described above.
- TH hybridization buffer
- each of the probes 1a / 1b, 2a // 2c, 2b, 3a or 4a / 4d according to the present invention is not only capable of hybridizing with synthetic 15-mer targets which they are specific (the target having a concentration of ⁇ ), but also with specific amplicons of the same genotype (at a dilution of 1 / 100th ). These results also show that nonspecific targets do not detectably hybridize.
- ELOSA tests are also performed by varying the number of thiol functions in the probe used and by testing different natures and target concentrations (15-mer or 105-mer short synthetic target, 143 nt or 191 nt short amplicons, long amplicons 401 nt).
- results presented in FIG. 11 correspond to an ELOSA test carried out with linear la / Ib probes (see above), of beta anomerism having 1, 2, 4, 6 or 8 thiol functions, which are grafted at a density of lOOnM on a support covered with maleimide groups according to the protocol described above.
- the results of FIG. 11 are obtained from the following targets:
- 15-mer synthetic target or specific 105-mer target la / lb at a concentration of ⁇ , ⁇ or ⁇ , 15-mer synthetic target or nonspecific 105-mer 3a (negative control), at a concentration of ⁇ , ⁇ or ⁇ ,
- each probe / target hybridization condition is triplicat tested in a microplate. The tests are reproduced three times integrally from the probes grafting step to the detection of the hybridization (on 3 different microplates). The results presented in the application therefore correspond to an average of 9 measurements.
- the results obtained in FIG. 11 show that hybridization of a specific 15-mer synthetic target la / lb with probe la / lb is detectable from target ⁇ , as soon as a thiol is present.
- the detection of the specific synthetic target 105a la / lb requires, in turn, a target concentration of ⁇ when the probe comprises 2 thiol or ⁇ functions when the probe comprises 4, 6 or 8 thiol functions.
- Results 3 Study of the Effect of the Grafting Density
- the results presented in FIGS. 12, 13 and 14 correspond to ELOSA tests carried out with linear 1a / lb probes (see above), of beta anomerism having 1, 2 or 4 thiol functions, which are grafted at densities of 1, 10, 25, 50 or 100nM on a support covered with maleimide groups according to the protocol described above.
- FIG. 12 illustrates the results obtained for the monothiol probe, that is to say comprising a single thiol compound according to the invention.
- FIG. 13 illustrates the results obtained for the dithiol probe, that is to say comprising two thiol compounds according to the invention
- FIG. 14 illustrates the results obtained for the tetrathiol probe, that is to say comprising four thiol compounds according to the invention.
- the hybridization tests are carried out with the following targets:
- a hybridization assay was performed by grafting a specific probe sequence la / lb onto a gold surface electrode.
- a tetrathiol probe carrying an oligonucleotide of sequence SEQ ID NO: 1 was grafted onto the gold surface working electrode of a cell.
- 105-specific mothers la / lb (of SEQ ID NO: 3) was evaluated, for 3 different concentrations of targets: ⁇ , ⁇ and ⁇ .
- a negative control is performed with a specific 105-mer target 3a of SEQ ID NO: 6 (negative control).
- the values in ordinate correspond to the normalized values of variation of current.
- the results obtained show that the electrochemical hybridization test is sensitive and specific to a concentration of lpM targets.
- the signal variation also appears to be stronger at lpM than when the test is conducted at ⁇ .
- a non-specific adsorption effect of the targets on the surface of the electrode reduces the efficiency of the recognition reaction.
- the method electrochemical does not allow quantitative monitoring of the hybridization reaction. Nevertheless, it provides a yes / no specific response of great sensitivity.
- GUI 31762 GUI 31982
- Probes 1 to 3 presented in Table 2 below thus make it possible to detect flaviviruses in a general manner (including the flaviviruses of Dengue and West Nile).
- Probe 4 is specific for Dengue viruses, whatever the serotype.
- Probe 5 is specific for serotype 4 of Dengue viruses.
- Probe 6 is specific for West Nile viruses.
- Probe 4 5'-CTT CYC CTT CYA CTC-3 'Dengue 15 -m SEQ ID NO: 18 Probe 5 5'-CAC TCC ACT CCA TGA-3 'Dengue 4 15 -m SEQ ID NO: 41
- Probe 6 5'-CKC CTC CTG ART TCT-3 'West Nile Viras 15 -m SEQ ID NO: 19
- the primary amplification by PCR is thus carried out with:
- the cFD2 antisense primer (SEQ ID NO: 21): 5'-GTG-TCC-CAG-CCG-GCG-GTG-TCA-TCA-GC-3 '.
- This amplification leads to the production of a primary amplicon of 263 bp.
- a secondary PCR is performed using as matrix the amplification products resulting from the first PCR. This "semi-nested" PCR advantageously allows a significant gain in sensitivity.
- amplicon 263 bp obtained after amplification from Dengue virus strain referenced as FJ882517 number has the sequence: 5'AACATGATGGGGAAGAGAGAAAAAACTAGGAGAGTTCGGAAAGGCAA AAGGAAGTCGTGCAATATGGTACATGTGGCTGGGAGCACGCTTTCTAGAG TTCGAAGCTCTTGGTTTCATGAACGAAGATCACTGGTTCAGCAGAGAA TTCACTCAGCGGAGTGGAAGGAAGGACTCCACAAACTTGGATATATAC TCAGAGACATATCAAAGATTCCAGGGGGAAACATGTATGCAGATGACACA GCCGGATGGGACAC-3 '(SEQ ID NO: 23).
- An example of a 263 bp amplicon obtained after amplification from the strain of West Nile virus referenced under the number EF429200 / H442 has for sequence: 5 '- AACATGATGGGAAAGAGAGAAGAAGCCTGGAGAGTTCGGCAAGGCTA AAGGCAGCAGAGCCATCTGGTTCATGTGGCTGGGGGCTCGTTTCCTGGAG TTTGAAGCTCTCGGATTCCTCAATGAAGACCACTGGCTGGGTAGGAAGAA CTCAGGAGGAGGAGTTGAAGGCTTAGGACTGCAGAAGCTTGGGTACATCT TGAAGGAAGTTGGGACAAAGCCTGGAGGAAAGATTTACGCCGATGATACC GCAGGCTGGGACAC-3 '(SEQ ID NO: 25).
- Secondary amplification by PCR may optionally be carried out according to the protocol published by Scaramozzino et al, using the above primary amplicons as a template with:
- the cFD2 antisense primer (SEQ ID NO: 21): 5'-GTG-TCC-CAG-CCG-GCG-GTG-TCA-TCA-GC-3 '.
- This amplification leads to the production of a secondary amplicon of 215 bp.
- amplicon 215 bp obtained after amplification from Dengue virus strain referenced as FJ882517 number has the sequence: 5'AAAGGAAGTCGTGCAATATGGTACATGTGGCTGGGAGCACGCTTTCTAGA GTTCGAAGCTCTTGGTTTCATGAACGAAGATCACTGGTTCAGCAGAGAGA ATTCACTCAGCGGAGTGGAAGGAAGGACTCCACAAACTTGGATATATA CTCAGAGACATATCAAAGATTCCAGGGGGAAACATGTATGCAGATGACAC AGCCGGATGGGACAC-3 '(SEQ ID NO: 24).
- amplicon 215 bp obtained after amplification from the West Nile virus strain referenced under number EF429200 / H442 has the sequence: 5 '- AAAGGCAGCAGAGCCATCTGGTTCATGTGGCTGGGGGCTCGTTTCCTGGA GTTTGAAGCTCTCGGATTCCTCAATGAAGACCACTGGCTGGGTAGGAAGA ACTCAGGAGGAGGAGTTGAAGGCTTAGGACTGCAGAAGCTTGGGTACATC TTGAAGGAAGTTGGGACAAAGCCTGGAGGAAAGATTTACGCCGATGATAC AGGCTGGGACAC CGC-3' (SEQ ID NO: 26) .
- the amplicons are prepared from flavivirus, Dengue or West Nile viral RNAs by asymmetric RT-PCR.
- Viral RNAs are extracted from Dengue (1-4) and West Nile (US NY or African Af) viruses produced in vitro.
- 263 bp amplicons are produced from the flavivirus NS5 viral region by RT-PCR from each of the previously described RNA samples.
- RT retro-transcription
- 5 ⁇ l of RNA are denatured at 72 ° C. for 10 minutes and retro-transcribed in the presence of 4 ⁇ l of 5 X First Strand Buffer (Invitrogen), 2 ⁇ l of 10X Hexanucleotide.
- biotinylated flavivirus "M AMD" sense (of sequence: [Btn] -AAC ATG ATG GGR AAR AGR GAR AA (ie [Btn] -SEQ ID NO: 20)) and
- flavivirus antisense "cFD2” from GTG TCC CAG CCG sequence GCG GTG TCA TCA GC (SEQ ID NO: 21)) (see Scaramozzino N. et al., 2001, Journal of Clinical Microbiology 39: 1922-1927).
- the asymmetric amplification reaction is carried out in 50 ⁇ l of reaction mixture comprising: IX PCR Buffer without MgCl 2 (Invitrogen), 0.2 ⁇ of MAMD, 0.02 ⁇ l of cFD2, 1.5 mM MgCl 2 (Invitrogen), 0.2 mM dNTP mix (Invitrogen) and 1, 5U Taq Polymerase (Invitrogen).
- the PCR conditions are as follows: 5 min at 95 ° C, 40 cycles (denaturation: 40 sec, 94 ° C, hybridization: 40 sec, 53 ° C, elongation: 50 sec, 72 ° C), and a final extension from 10 minutes to 72 ° C.
- the amplicons obtained are analyzed by agarose gel electrophoresis, aliquoted and stored at -20 ° C. before use. These amplicons, whose viral genotypes of origin are known, are preserved in the form of a theca.
- Biotinylated synthetic 5-mer oligonucleotides at the 5 'end were synthesized. These oligonucleotides are strictly complementary to the probes chosen above, that is to say to the generic probe 3 for detecting flaviviruses, to the generic probe for detecting West Nile virus and to the specific probe of serotype 4 of the the dengue. These synthetic oligonucleotides have the following sequences:
- the 14-mer synthetic oligonucleotides specific for flaviviruses have the sequence: 5 '[Btn] -TGG TWC ATG TGG CT-3' (ie [Btn] -SEQ ID NO: 43);
- the 15-mer synthetic oligonucleotides specific for West Nile virus have the sequence: 5 '[Btn] - AGA AYT AGC GAG GMG -3' (ie [Btn] - SEQ ID NO: 42) and
- the 15-mer synthetic oligonucleotides specific for serotype 4 of Dengue virus have the following sequence: 5 '[Btn] - TCA TGG AGT GGA GTG
- Hybridization tests are carried out with probe 3 generically recognizing flaviviruses (see FIG. 21), probe 5 specifically recognizing serotype 4 of Dengue (see FIG. 22) and probe 6 recognizing West Nile virus (see FIG. Figure 23).
- the probes having 4 thiol functions are grafted at a density of 200 nm onto a support covered with maleimide groups according to the protocol described above.
- ELOSA tests are then performed using amplicons prepared from serotypes 1, 2, 3 or 4 of Dengue, West Nile virus of US (NY) or African (Af) origin, or hepatitis virus.
- samples / background noise is obtained by calculating the ratio between the number of strokes measured for each sample and the number of strokes measured for the control (TH), corresponding to the hybridization buffer alone, not including a target. Dengue and West Nile virus amplicons used in these assays were obtained by the asymmetric RT-PCR method described above.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Communicable Diseases (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EA201491821A EA029907B1 (ru) | 2012-04-04 | 2013-04-04 | Модифицированные олигонуклеотиды, включающие тиольные функциональные группы, и их применение для детекции нуклеиновых кислот |
| EP13716756.5A EP2859008B1 (fr) | 2012-04-04 | 2013-04-04 | Oligonucleotides modifies compenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques |
| ES13716756.5T ES2624993T3 (es) | 2012-04-04 | 2013-04-04 | Oligonucleótidos modificados que comprenden funciones tiol y su uso para la detección de ácidos nucleicos |
| IN8170DEN2014 IN2014DN08170A (cg-RX-API-DMAC7.html) | 2012-04-04 | 2013-04-04 | |
| JP2015503888A JP6175489B2 (ja) | 2012-04-04 | 2013-04-04 | チオール官能基を含む修飾オリゴヌクレオチドおよび核酸検出のためのこれらの使用 |
| CA2868926A CA2868926C (fr) | 2012-04-04 | 2013-04-04 | Oligonucleotides modifies comprenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques |
| US14/390,748 US20150232957A1 (en) | 2012-04-04 | 2013-04-04 | Modified oligonucleotides comprising thiol functions and use thereof for detecting nucleic acids |
| KR1020147027987A KR102186143B1 (ko) | 2012-04-04 | 2013-04-04 | 티올 관능기를 포함하는 개질된 올리고뉴클레오티드 및 이를 이용한 핵산의 검출 |
| AU2013244900A AU2013244900B2 (en) | 2012-04-04 | 2013-04-04 | Modified oligonucleotides comprising thiol functions and the use of same for the detection of nucleic acids |
| BR112014024601-7A BR112014024601B1 (pt) | 2012-04-04 | 2013-04-04 | Oligonucleotídeo modificado composto de funções tióis; substrato enxertado com oligonucleotídeo modificado; método e kit de detecção de ácido nucleico em uma amostra de oligonucleotídeo modificado; e o uso oligonucleotídeo modificado para a detecção de ácidos nucleicos |
| US16/271,581 US11390643B2 (en) | 2012-04-04 | 2019-02-08 | Modified oligonucleotides comprising thiol functions and use thereof for detecting nucleic acids |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1253122A FR2989089B1 (fr) | 2012-04-04 | 2012-04-04 | Oligonucleotides modifies comprenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques |
| FR1253122 | 2012-04-04 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/390,748 A-371-Of-International US20150232957A1 (en) | 2012-04-04 | 2013-04-04 | Modified oligonucleotides comprising thiol functions and use thereof for detecting nucleic acids |
| US16/271,581 Continuation US11390643B2 (en) | 2012-04-04 | 2019-02-08 | Modified oligonucleotides comprising thiol functions and use thereof for detecting nucleic acids |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013150122A1 true WO2013150122A1 (fr) | 2013-10-10 |
Family
ID=48128279
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2013/057150 Ceased WO2013150122A1 (fr) | 2012-04-04 | 2013-04-04 | Oligonucleotides modifies compenant des fonctions thiol et leur utilisation pour la detection d'acides nucleiques |
Country Status (12)
| Country | Link |
|---|---|
| US (2) | US20150232957A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2859008B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP6175489B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR102186143B1 (cg-RX-API-DMAC7.html) |
| AU (1) | AU2013244900B2 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112014024601B1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2868926C (cg-RX-API-DMAC7.html) |
| EA (1) | EA029907B1 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2624993T3 (cg-RX-API-DMAC7.html) |
| FR (1) | FR2989089B1 (cg-RX-API-DMAC7.html) |
| IN (1) | IN2014DN08170A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013150122A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022189819A1 (en) | 2021-03-09 | 2022-09-15 | Etablissement Francais Du Sang | Detection of infectious agent based on recombinase polymerase amplification combined with a magnetic field-enhanced agglutination |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017218293A1 (en) | 2016-06-16 | 2017-12-21 | Richard Edward Watts | Oligonucleotide directed and recorded combinatorial synthesis of encoded probe molecules |
| US11795580B2 (en) | 2017-05-02 | 2023-10-24 | Haystack Sciences Corporation | Molecules for verifying oligonucleotide directed combinatorial synthesis and methods of making and using the same |
| JP7282379B2 (ja) * | 2017-08-22 | 2023-05-29 | 国立大学法人東海国立大学機構 | 修飾ポリヌクレオチド |
| WO2019060856A1 (en) * | 2017-09-25 | 2019-03-28 | Haystack Sciences Corporation | MULTINOMIAL CODING FOR COMBINATION CHEMISTRY DIRECTED BY OLIGONUCLEOTIDES |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0523978A1 (en) * | 1991-07-15 | 1993-01-20 | La Jolla Pharmaceutical | Modified phosphorous intermediates for providing functional groups on the 5' end of oligonucleotides |
| JPH0641183A (ja) * | 1992-07-23 | 1994-02-15 | Mitsubishi Kasei Corp | オリゴヌクレオチド単分子膜 |
| WO2005065405A1 (en) * | 2003-12-31 | 2005-07-21 | Genencor International, Inc. | Membranes incorporating recognition moieties |
| US7601848B2 (en) * | 2001-12-22 | 2009-10-13 | Fidicula Gmbh | Multifunctional reagent for the synthesis of thiol modified oligomers |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6041183A (ja) * | 1983-08-16 | 1985-03-04 | 三菱電機株式会社 | 入場管理装置 |
| US7167395B1 (en) | 2005-07-13 | 2007-01-23 | Infineon Technologies Flash Gmbh & Co. Kg | Non-volatile semiconductor memory |
| MX2008008237A (es) | 2005-12-23 | 2008-11-06 | Siemens Healthcare Diagnostics | Metodos y reactivos para genotipificar hcv. |
| FR2989086B1 (fr) | 2012-04-04 | 2017-03-24 | Centre Nat De La Rech Scient (Cnrs) | Composes thiol et leur utilisation pour la synthese d'oligonucleotides modifies |
-
2012
- 2012-04-04 FR FR1253122A patent/FR2989089B1/fr not_active Expired - Fee Related
-
2013
- 2013-04-04 IN IN8170DEN2014 patent/IN2014DN08170A/en unknown
- 2013-04-04 ES ES13716756.5T patent/ES2624993T3/es active Active
- 2013-04-04 WO PCT/EP2013/057150 patent/WO2013150122A1/fr not_active Ceased
- 2013-04-04 JP JP2015503888A patent/JP6175489B2/ja not_active Expired - Fee Related
- 2013-04-04 AU AU2013244900A patent/AU2013244900B2/en not_active Ceased
- 2013-04-04 KR KR1020147027987A patent/KR102186143B1/ko active Active
- 2013-04-04 EP EP13716756.5A patent/EP2859008B1/fr active Active
- 2013-04-04 EA EA201491821A patent/EA029907B1/ru not_active IP Right Cessation
- 2013-04-04 CA CA2868926A patent/CA2868926C/fr active Active
- 2013-04-04 US US14/390,748 patent/US20150232957A1/en not_active Abandoned
- 2013-04-04 BR BR112014024601-7A patent/BR112014024601B1/pt not_active IP Right Cessation
-
2019
- 2019-02-08 US US16/271,581 patent/US11390643B2/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0523978A1 (en) * | 1991-07-15 | 1993-01-20 | La Jolla Pharmaceutical | Modified phosphorous intermediates for providing functional groups on the 5' end of oligonucleotides |
| JPH0641183A (ja) * | 1992-07-23 | 1994-02-15 | Mitsubishi Kasei Corp | オリゴヌクレオチド単分子膜 |
| US7601848B2 (en) * | 2001-12-22 | 2009-10-13 | Fidicula Gmbh | Multifunctional reagent for the synthesis of thiol modified oligomers |
| WO2005065405A1 (en) * | 2003-12-31 | 2005-07-21 | Genencor International, Inc. | Membranes incorporating recognition moieties |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022189819A1 (en) | 2021-03-09 | 2022-09-15 | Etablissement Francais Du Sang | Detection of infectious agent based on recombinase polymerase amplification combined with a magnetic field-enhanced agglutination |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2015514402A (ja) | 2015-05-21 |
| KR20150021493A (ko) | 2015-03-02 |
| CA2868926A1 (fr) | 2013-10-10 |
| AU2013244900A1 (en) | 2014-10-16 |
| EA029907B1 (ru) | 2018-05-31 |
| EP2859008B1 (fr) | 2017-02-22 |
| EP2859008A1 (fr) | 2015-04-15 |
| JP6175489B2 (ja) | 2017-08-02 |
| US11390643B2 (en) | 2022-07-19 |
| ES2624993T3 (es) | 2017-07-18 |
| CA2868926C (fr) | 2021-05-04 |
| BR112014024601B1 (pt) | 2022-05-24 |
| FR2989089A1 (fr) | 2013-10-11 |
| US20190376151A1 (en) | 2019-12-12 |
| FR2989089B1 (fr) | 2020-02-07 |
| EA201491821A1 (ru) | 2015-02-27 |
| BR112014024601A2 (pt) | 2018-04-17 |
| AU2013244900B2 (en) | 2017-01-12 |
| KR102186143B1 (ko) | 2020-12-03 |
| IN2014DN08170A (cg-RX-API-DMAC7.html) | 2015-05-01 |
| US20150232957A1 (en) | 2015-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11390643B2 (en) | Modified oligonucleotides comprising thiol functions and use thereof for detecting nucleic acids | |
| JP6805425B2 (ja) | タグ付けされたヌクレオチドを製造するための化学的方法 | |
| AU2017317568B2 (en) | Tagged nucleotides useful for nanopore detection | |
| EP0524864B1 (fr) | Procédé d'immobilisation d'un fragment d'acide nucléique par fixation passive sur un support solide, support solide ainsi obtenu et son utilisation | |
| KR101028980B1 (ko) | 포스페이트 모방체를 함유하는 폴리뉴클레오티드 | |
| US8465926B2 (en) | Method and system for real time quantification and monitoring of nucleic acid amplification using electroconductive or electrochemically active labels | |
| US11078229B2 (en) | Thiol compounds and the use thereof for the synthesis of modified oligonucleotides | |
| JP2017515887A5 (cg-RX-API-DMAC7.html) | ||
| CA2411036A1 (fr) | Production combinatoire d'analogues de nucleotides et nucleosides(xitp) | |
| EP0772694A1 (fr) | Systeme de sondes permettant d'effectuer le typage hla dr, et procede de typage utilisant lesdites sondes | |
| CA2091775C (fr) | Systeme de sondes permettant d'effectuer le typage hla dr, et procede de typage utilisant lesdites sondes | |
| JPWO2004011643A1 (ja) | 核酸プローブ固定化基体およびそれを用いた標的核酸の存在を検出する方法 | |
| EP0334694A1 (fr) | Sonde d'acides nucléiques avec marquage non-radioactif et procédés de préparation | |
| JP3917640B2 (ja) | 核酸プローブ固定化基体を用いた標的核酸の存在を検出する方法 | |
| Gramlich | Selective DNA Modification Using the Cu (I)-Catalyzed Alkyne-Azide Cycloaddition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13716756 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2868926 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 20147027987 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2015503888 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14390748 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2013244900 Country of ref document: AU Date of ref document: 20130404 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013716756 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013716756 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201491821 Country of ref document: EA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014024601 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014024601 Country of ref document: BR Kind code of ref document: A2 Effective date: 20141002 |