WO2013063383A2 - Vectors encoding rod-derived cone viability factor - Google Patents
Vectors encoding rod-derived cone viability factor Download PDFInfo
- Publication number
- WO2013063383A2 WO2013063383A2 PCT/US2012/062106 US2012062106W WO2013063383A2 WO 2013063383 A2 WO2013063383 A2 WO 2013063383A2 US 2012062106 W US2012062106 W US 2012062106W WO 2013063383 A2 WO2013063383 A2 WO 2013063383A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- rdcvf
- nucleic acid
- protein
- viral vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/06—Antiglaucoma agents or miotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/08—Mydriatics or cycloplegics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/10—Ophthalmic agents for accommodation disorders, e.g. myopia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/12—Ophthalmic agents for cataracts
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
- A61P27/14—Decongestants or antiallergics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/861—Adenoviral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0051—Oxidoreductases (1.) acting on a sulfur group of donors (1.8)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/025—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a parvovirus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
Definitions
- RdCVF is a thioredoxin-like protein specifically expressed by rod photoreceptor cells in the retina (Leveillard et al. (2004) Nature Genetics 36:755-759 and the supplemental information).
- RdCVF 1 and RdCVF2 Two different RdCVF genes are found in humans and they are designated RdCVF 1 and RdCVF2.
- Both RdCVF genes encode two products via alternative splicing: a full length protein and a C-terminal post-transcriptionally truncated protein, known as RdCVF-long and RdCVF-short, respectively.
- RdCVF-short is described as a secreted trophic factor for promoting cone survival, and RdCVF -Long as a redox-active enzyme that interacts with intracellular proteins (Leveillard et al. (2010) Sci Transl Med. 2(26): 26psl6).
- tau is described as a binding partner for RdCVF-L and tau is exclusively intracellular (Fridlich et al. (2009) Molecular & Cellular Proteomics 8(6): 1206-18).
- RdCVF protein can promote cone photoreceptor cell survival in vitro and in vivo.
- intraocular injections of the short form of human RdCVF 1 (RdCVF IS) protein not only rescued cone cells from degeneration but also preserved their function in animal models of inherited retinal degeneration (Yang et al. (2009) Mol Therapy 17:787-795).
- demonstration of the in vivo cone cell protective effect of this protein required using multiple intraocular injections.
- the present invention relates, in part, to nucleic acids encoding RdCVF, RdCVF expression constructs, RdCVF vectors, methods of expressing RdCVF, methods of slowing, preventing or inhibiting photoreceptor cell (e.g., cone and/or rod cells) death, treating eye diseases, such as retinal dystrophies, and treating neurodegenerative diseases such as Alzheimer's disease, Huntington's disease, Parkinson's disease or an olfactory disease.
- photoreceptor cell e.g., cone and/or rod cells
- the present invention provides compositions, methods for expressing RdCVF proteins from a cell(s) and methods of treatment.
- Some embodiments of the invention provide nucleic acids comprising a nucleotide sequence encoding a coding sequence for an RdCVF protein, wherein the RdCVF coding sequence comprises a recoded nucleotide sequence.
- the invention also includes viral vectors comprising a nucleic acid, wherein the nucleic acid comprises a nucleotide sequence encoding a coding sequence for an RdCVF protein, wherein the RdCVF coding sequence comprises a recoded nucleotide sequence.
- Some embodiments of the invention relate to an isolated cell comprising a nucleic acid of the invention.
- an RdCVF protein produced by a cell of the invention or from a nucleic acid of the invention.
- an RdCVF protein is not a naturally occurring RdCVF amino acid sequence.
- compositions comprising (i) a pharmaceutically acceptable carrier and (ii) a nucleic acid of the invention, a viral vector of the invention, an RdCVF protein of the invention or a combination thereof.
- Methods for producing an RdCVF protein comprising culturing a cell of the invention under conditions that allow for expression and secretion of the RdCVF protein and isolating the RdCVF protein from the cell culture are also provided.
- Some embodiments of the invention relate to methods of preserving ocular rod cells comprising administering to the eye of a mammal a nucleic acid of the invention, a viral vector of the invention, an RdCVF protein of the invention or a combination thereof.
- the invention also provides methods of treating diseases such as retinal dystrophy, Stargardt's disease, retinitis pigmentosa, dry age-related macular degeneration (dry AMD), geographic atrophy (advanced stage of dry AMD), wet age-related macular degeneration (wet AMD), glaucoma with or without ocular hypertension, diabetic retinopathy, Bardet-Biedel syndrome, Bassen-Kornzweig syndrome, Best disease, choroidema, gyrate atrophy, congenital amaurosis, refsun syndrome, Usher syndrome, thyroid related eye disease, Grave's disease, a disease associated with retinal pigmented epithelial cells, anterior segment disease, lens disease/cataracts, an eye cup disorder, uveitis, Alzheimer's disease, Huntington's disease, Parkinson's disease or an olfactory disease.
- diseases such as retinal dystrophy, Stargardt's disease, retinitis pigmentosa, dry age-related ma
- Some embodiments of the invention relate to methods of preserving ocular rod cells comprising administering to the eye of a mammal the nucleic acid and/or viral vector of the invention, wherein the nucleic acid and/or the viral vector is administered by subretinal injection and the rod cells are preserved at a site different from the site of the subretinal injection.
- Some embodiments of the invention relate to methods of preserving ocular cone cells comprising administering to the eye of a mammal the nucleic acid and/or viral vector of the invention, wherein the nucleic acid and/or the viral vector is administered by subretinal injection and the cone cells are preserved at a site different from the site of the subretinal injection.
- the invention also provides methods of secreting an RdCVF protein from a cell comprising administering to the cell a nucleic acid or a viral vector of the invention.
- An RdCVF protein can be an RdCVF 1 or RdCVF2 protein or a long or short version.
- any method or composition described herein can be implemented with respect to any other method or composition described herein.
- the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of "one or more,” “at least one,” and “one or more than one.”
- the use of the term/phrase “and/or” when used with a list means one or more of the listed items may be utilized, e.g., it is not limited to one or all of the elements.
- Figure 1 shows an SDS-PAGE analysis of purified recombinant AAV-RdCVF IL and AAV-GFP vector particles. Proteins of a rAAV-GFP preparation (lane 1) and two rAAV- RdCVF lL preparations (lane 2 and 3) were separated by SDS-PAGE and visualized by silver stain analysis.
- Figure 2 shows a Western blot analysis of RdCVF 1L expression in rAAV-RdCVFIL vector transduced ARPE-19 cells.
- Cell lysate ( Figure 2A) and supernatant (Figure 2B) of rAAV transduced ARPE-19 cells were separated by SDS-PAGE, and a Western Blot was performed against RdCVF 1L protein.
- Lane 1 shows untransduced ARPE-19 cell lysate ( Figure 2A) and supernatant for control ( Figure 2B), lane 2 and lane 3 show cell lysates (Figure 2 A) and supernatant (Figure 2B) of rAAV-GFP and rAAV-RdCVF IL transduced ARPE-19 cell, respectively.
- Figure 3 shows confirmation of increased RdCVF expression in rAAV-RdCVF IL versus rAAV-GFP injected eyes and untreated eyes of normal Balb/C mice by Western blot six weeks after injection of the vectors.
- Protein extracts from rAAV-RdCVF lL-transduced ARPE-19 cells were used as a positive control (Lane 14 and 17) while untransduced cell extract was used as a negative control (Lane 15).
- RdCVF protein was detected in rAAV- RdCVF lL injected eyes (Lane 6, 8, 10 and 12) while no or only faint RdCVF-corresponding bands were observed in the untreated contralateral eyes in the same animals (Lane 7, 9, 11 and 13) as well as in rAAV-GFP injected eyes (Lane 2-5).
- Lane 1 is a protein standard marker.
- Lane 16 is the protein extract from a wild-type normal mouse eye.
- FIG. 4 shows immunohistochemical staining of RdCVF in the RPE cells of RPE- choroid-scleral flatmounts.
- Robust RdCVF expression was observed in the rAAV-RdCVF IL injected eye of normal Balb/C mice six weeks after vector injection (Fig. 4A), but not in the uninjected contralateral eye (Fig. 4B).
- No immunoreactivity was seen in the sample processed without primary antibody (Fig. 4C).
- the flatmounts were counterstained with DAPI to show the cell nuclei in blue.
- FIG. 5 shows immunohistochemical staining of RdCVF 1L of neuroretinal flatmounts. Robust RdCVF 1L expression was observed in the photoreceptor cells in the rAAV-RdCVF IL injected eye of normal Balb/C mice six weeks after vector injection (Fig. 5A). The majority of the staining was in the outer segments of photoreceptor cells. In contrast, only background staining was seen in the photoreceptor cells in the uninjected contralateral eye (Fig. 5B). No immunoreactivity was observed in the samples processed without primary antibody (Fig. 5C).
- Figure 6 shows results for studies that demonstrated RdCVFIL expression in RPE and photoreceptor cells 5 weeks after subretinal injection of AAV-RdCVFIL in rdlO mice.
- RdCVF-expressing RPE cells were seen in approximately half of RPE-choroid-scleral flatmount of rAAV-RdCVFlL vector injected eye (A), but not in the uninjected, contralateral eye (B). Photoreceptor cells (C) were also transduced as RdCVF-expressing segments were observed in the flat-mounted retina of the same eye. In contrast, no RdCVF-expression was found in the uninjected, contralateral eye (D). The dark green cells in (D) likely are auto fluorescent macrophages adhered to the retina. High magnification view of transduced RPE cells (E), maintaining typical hexagonal morphology, and RdCVF-expressing photoreceptor segments (F).
- Figure 7 shows photoreceptor rescue by subretinal injection of AAV-RdCVFIL in rdlO mice.
- the rdlO mice were sacrificed at 5 weeks old.
- Photoreceptor inner and outer segments remained in some areas of the protected retina (E).
- IS inner segments
- OS outer segments
- ONL outer nuclear layer
- Figure 8 shows a light photomicrograph of an eyecup from a representative 5-week old rdlO mouse that received a subretinal injection of rAAV-RdCVFlL in one eye (Panel A, Figure 8) and no treatment in the contralateral eye (Panel B, Figure 8). As shown, more photoreceptor cells were preserved in the treated eye.
- Figure 9 shows the annotated nucleotide sequence of rAAV-RdCVF lL.
- FIG 10A rAAV-RdCVFlL delivery improves retinal function in the rdlO mice.
- FIG. 10B rAAV -RdCVF IL delivery improves retinal function in the rdlO mice.
- the ERGs were performed at approximately 5 wks after injection of rAAV-RdCVFlL.
- Figures 1 1A and 1 IB Photoreceptor preservation by subretinal injection of rAAV- RdCVF lL in rdlO mice. Light photomicrographs of representative retinal sections from a mouse in which right eye received rAAV-RdCVF IL at postnatal day 3 (A) and left eye (B) serving as untreated controls. Note the difference in ONL thickness between treated and untreated eye. There are about 4 rows in the treated eye (A) versus 1 row in untreated eyes (B). Photoreceptor outer segments are remained in some areas of the protected retina; onl, outer nuclear layer.
- Figure 12 Comparison of the thickness of outer nuclear layer (ONL) in rAAV- RdCVFlL treated versus untreated eyes in rdlO mice.
- identity when used in the context of comparing two sequences, such as nucleotide or amino acid sequences, refers to the percentage of the sequence that aligns between the two sequences. Percent identity can be determined by algorithms commonly employed by those skilled in this art. For example, percent identity can be determined using tools and programs available from the National Center for
- NCBI Biotechnology Information
- WO2008/148860, and WO2009/146183 can be utilized, for example, by replacing an RdCVF encoding nucleic acid, vector or protein with those of the present invention e.g., nucleic acids and vectors comprising a wild-type RdCVF coding sequence).
- Some embodiments of the invention provide RdCVF proprotein amino acid sequences such as SEQ ID NOs:2 and 4.
- the invention also provides nucleotide sequences encoding RdCVF proproteins such as SEQ ID NOs: l, 3 and 1 1.
- the invention also provides methods of treating a disease in a subject where the disease is mediated by or associated with a change in RdCVF 1 or RdCVF2 gene expression (e.g., a decrease in the presence of RDCVF 1 or RDCVF2 polypeptide in the eye) by the administration of a therapeutically effective amount of a nucleic acid or vector encoding an RDCVF 1 or RDCVF2 protein or a related protein or a fragment or portion thereof to a subject.
- a change in RdCVF 1 or RdCVF2 gene expression e.g., a decrease in the presence of RDCVF 1 or RDCVF2 polypeptide in the eye
- an RdCVF protein, nucleic acid, vector or composition of the invention can be used in the manufacture of a medicament, e.g., to treat diseases listed herein.
- Products, compositions, processes and methods of the invention can be used for, inter alia, research, biological, clinical or therapeutic purposes.
- RdCVF protein can promote cone photoreceptor cell survival in vitro and in vivo.
- intraocular injections of the short form of human RdCVF 1 (RdCVF I S) protein not only rescued cone cells from degeneration but also preserved their function in animal models of inherited retinal degeneration.
- RdCVF is expressed by several cell types including rod photoreceptor cells in the retina (Leveillard et al. (2004) Nature Genetics 36:755-759).
- RdCVF 1 and RdCVF2 Two different RdCVF genes are found in humans and other mammals and they are designated RdCVF 1 and RdCVF2. Both RdCVF genes encode two products via alternative splicing: a full length protein and a C-terminal truncated protein, known as RdCVF-long and RdCVF-short, respectively.
- the invention includes a recoded RdCVF coding sequence.
- a recoded RdCVF coding sequence can encode for any RdCVF protein including any of those disclosed herein. Sequences for various RdCVF proteins can be found in PCT Publication Nos. WO2002081513 and WO2010029130; Chalmel et al. (BMC Molecular Biology (2007) 8:74 ppl-12 and the supplemental information); Leveillard et al. (Nature Genetics (2004) 36:755-759 and the supplemental information); Yang et al. (Mol Therapy (2009) 17:787-795 and the supplemental material) and GenBank Accession Nos.
- an RdCVF protein is a fragment or an analog of an RdCVF protein that retains a cone cell and/or a rod cell survival activity or protective effect.
- RdCVF protein or an RdCVF coded for by a nucleic acid can have an amino acid sequence other than a naturally-occurring amino acid sequence.
- an RdCVF protein that is not naturally-occurring may contain amino acids in addition to those found in a naturally occurring RdCVF protein (e.g., at the amino or carboxy terminus) and/or may contain single or multiple amino acid substitutions (e.g., conservative or non-conservative amino acid substitutions) as compared to a naturally-occurring RdCVF amino acid sequence.
- a conservative amino acid substitution generally should not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence). Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles
- Conservative substitutions include, but are not limited to, those from the following groupings: Acidic Residues Asp (D) and Glu (E); Basic Residues Lys (K), Arg (R), and His (H); Hydrophilic Uncharged Residues Ser (S), Thr (T), Asn (N), and Gin (Q); Aliphatic Uncharged Residues Gly (G), Ala (A), Val (V), Leu (L), and He (I); Non-polar Uncharged Residues Cys (C), Met (M), and Pro (P); Aromatic Residues Phe (F), Tyr (Y), and Trp (W); Alcohol group-containing residues S and T; Aliphatic residues I, L, V and M; Cycloalkenyl-associated residues F, H, W and Y; Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W and Y; Negatively charged residues D and E;
- an RdCVF protein of the invention is initially translated from a nucleotide coding sequence with a signal peptide and in some cases all or part of the amino acids of the signal peptide are retained on an expressed and/or secreted RdCVF protein of the invention.
- a recoded RdCVF coding region has at least 2.5%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least or at least 95% of the codons recoded.
- a recoded codon is replaced with a codon that is more prevalently used in humans.
- at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% or at least 55% of the codons have been replaced with a codon that is more prevalently used in humans.
- a recoded sequence has between about 70-90%, about 75-85%, about 80-85% or about 82-85% identity with the corresponding native coding sequence. In some embodiments, a recoded nucleotide sequence has at least 15% of the nucleotides different as compared to a corresponding native nucleotide sequence. In some embodiments, a recoded nucleotide sequence is less than 90% identical to a corresponding native nucleotide sequence.
- Recoding can also be used to change the chemical make-up of a DNA and/or an RNA coding sequence such as the guanine/cytosine (GC) percentage.
- recoding of an RdCVF coding region raises the GC content to at least 60%.
- a recoded RdCVF coding region has a GC percentage between 60-64% or 60.4%-63.5%. Recocting can be used to change the secondary structure of mRNA.
- Recoding can also be used to remove or add particular motifs or sites to a coding sequence or nucleic acid molecule, such as procarya inhibitory motifs, consensus splice donor sites, cryptic splice donor sites or a combination thereof.
- a recoded RdCVF coding sequence has less procarya inhibitory motifs, consensus splice donor sites, cryptic splice donor sites or a combination thereof than the native sequence. In some embodiments, a recoded RdCVF coding sequence contains no procarya inhibitory motifs, no consensus splice donor sites and/or no cryptic splice donor sites.
- a recoded RdCVF coding sequence does not contain the initial RdCVF ATG codon and/or RdCVF stop codon (e.g., TAG).
- an RdCVF recoded coding sequence can be operatively linked 5' or 3' to another coding sequence resulting in a protein comprising a heterologous amino acid sequence, N-terminal and/or C-terminal to the RdCVF amino acid sequence, respectively.
- the initial RdCVF ATG codon and/or RdCVF stop codon may be deleted or present in the RdCVF coding region. For example, see SEQ ID NO: 1 and SEQ ID NO:3. If another coding sequence is fused in frame at the 3 'end of an RdCVF coding region, then the native RdCVF stop codon will not typically be present at the end of the RdCVF coding sequence.
- a recoded RdCVF coding region comprises nucleotides 106 to 741 of SEQ ID NO: l, nucleotides 106 to 429 of SEQ ID NO: l, nucleotides 106 to 432 of SEQ ID NO: 3 or nucleotides 106 to 744 of SEQ ID NO:3.
- a recoded RdCVF coding sequence is a recoded sequence that codes for amino acids 36-246 of SEQ ID NO:2
- a coding sequence of the invention codes for a protein containing a signal sequence.
- Signal sequences are translated in frame as a peptide attached, typically, to the amino- terminal end of a polypeptide of choice.
- a secretory signal sequence will cause the secretion of the polypeptide from the cell by interacting with the machinery of the host cell. As part of the secretory process, this secretory signal sequence will typically be cleaved off or at least partially cleaved off.
- the term "signal sequence” also refers to a nucleic acid sequence encoding the signal peptide. In some embodiments, a signal sequence is heterologous as compared to a particular RdCVF.
- the structure of a typical signal peptide can include three distinct regions: (i) an N- terminal region that contains a number of positively charged amino acids (e.g., lysines and arginines); (ii) a central hydrophobic core region (h-region); (iii) a hydrophilic cleavage region (c-region) that contains the sequence motif recognized by the signal peptidase, (e.g., see von Heijne, G. (1983) Eur. J. Biochem., 133 : 17-21 ; von Heijne, G. (1985) J. Mol. Biol, 184:99-105; von Heijne, G. (1997) Protein Engineering (10): 1-6).
- proteins with signal peptides include, but are not limited to, human growth hormone (HGH), bone morphogenetic protein 7 (BMP7), bone morphogenetic protein 2 (BMP2), ciliary neurotrophic factor (CNTF), brain derived neurotrophic factor (BDNF), insulin growth factor 1 (IGF-1), ⁇ -glucoronidase (GUSB), glial cell-derived neurotrophic factor (GDNF), hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), leukemia inhibitory factor (LIF), immunoglobulin proteins, bovine growth hormone, bovine proalbumin, human proinsulin, human interferon-gamma., human alpha-fibrinogen, human IgG heavy chain, rat amylase, murine alpha- fetoprotein, chicken lysozyme, human placental alkaline phosphatase and Zea mays rein protein 22.1.
- HGH human growth hormone
- BMP7 bone morphogenetic protein 7
- signal peptides can be used in accordance with the invention.
- a signal peptide used in accordance with the invention is selected from the group consisting of HGH, BDNF, IGF-1 and GUSB.
- the signal peptide is from an immunoglobulin such as an IgK.
- a signal sequence can be a mammalian, murine or human signal sequence.
- a nucleic acid or vector of the invention comprises nucleotides 1-105 of SEQ ID NO: l or 4-105 of SEQ ID NO: l .
- a signal sequence codes for an amino acid sequence comprising amino acids 2-34 of SEQ ID NO:2 or comprises SEQ ID NO: 15.
- a nucleotide sequence coding for a signal peptide can be a wild-type sequence or it can be a recoded sequence.
- a signal peptide sequence is encoded for the N-terminal or C-terminal of an RdCVF.
- the signal peptide directs transit of the protein to secretory pathways, e.g., to the endoplasmic reticulum (ER).
- ER endoplasmic reticulum
- a signal peptide facilitates protein transport from the cytoplasm to destinations outside the cell.
- Signal peptide sequences may be selected from naturally occurring signal peptide sequences, derivatives thereof, or a synthetic designed sequence.
- non-limiting parameters for a designed signal peptide sequences include a sequence of 3-40 residues, comprising a 3 - to 20-residue hydrophobic core flanked by several relatively hydrophilic residues.
- a signal peptide sequence lacks a hydrophobic core.
- mammalian secretory proteins that lack a typical hydrophobic signal sequence that can be used in the invention include, but are not limited to, human IL-la, ILl , bFGF, aFGF, PDEGF, anticoagulant protein, lectin L-14, ATL-derived factor, Factor XHIa, Anchorin CII, lipocortin I, parathymosin, a-prothymosin, and rodent transglutaminase, parathymosin and MDGI.
- the invention includes nucleic acids comprising a nucleotide sequence encoding an RdCVF and includes vectors comprising these nucleic acids.
- some embodiments of the invention contemplate transducing a cell with a nucleic acid or vector encoding an RdCVF.
- the instant invention is not to be construed as limited to any one particular nucleic delivery method, and any available nucleic acid delivery vehicle with either an in vivo or in vitro nucleic acid delivery strategy, or the use of manipulated cells (such as the technology ofNeurotech, Lincoln, RI, e.g., see U.S. Patent Nos.
- viral vectors amphitrophic lipids, amphitrophic lipids, cationic polymers, such as polyethylenimine (PEI) and polylysine, dendrimers, such as combburst molecules and starburst molecules, nonionic lipids, anionic lipids, vesicles, liposomes and other synthetic nucleic acid means of delivery
- PKI polyethylenimine
- dendrimers such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and starburst molecules
- nonionic lipids such as combburst molecules and star
- a nucleic acid molecule is used in which the RdCVF coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the RdCVF nucleic acid (Koller et ah, (1989) Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et ah (1989) Nature 342:435-438).
- Delivery of a nucleic acid into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid-carrying vector, or indirect, in which case, cells are first transformed with the nucleic acid in vitro, then transplanted into the patient.
- a vector is a means by which a nucleic acid of interest (e.g., a therapeutic nucleic acid that can encode a therapeutic protein) is introduced into a target cell of interest.
- Methods for obtaining or constructing a vector of interest include, but are not limited to, standard gene manipulation techniques, sequencing reactions, restriction enzymes digests, polymerase reactions, PCR, PCR SOEing, ligations, recombinase reactions (e.g., Invitrogen's
- GATEWAY ® technology other enzymes active on nucleic acids, bacteria and virus propagation materials and methods, chemicals and reagents, site directed mutagenesis protocols and so on, as known in the art, see, for example, the Maniatis et al. text, "Molecular Cloning.”
- Nucleic acids of the invention will typically comprise a promoter sequence operatively linked to an RdCVF coding sequence.
- a promoter may be a tissue specific promoter, a cell specific promoter, an inducible promoter, a repressible promoter, a constitutive promoter, a synthetic promoter or a hybrid promoter, for example.
- promoters useful in the constructs of the invention include, but are not limited to, a phage lambda (PL) promoter; an SV40 early promoter; a herpes simplex viral (HSV) promoter; a cytomegalovirus (CMV) promoter, such as the human CMV immediate early promoter; a hybrid promoter with CMV enhancer and chicken beta-actin promoter; a tetracycline- controlled trans-activator-responsive promoter (tet) system; a long terminal repeat (LTR) promoter, such as a MoMLV LTR, BIV LTR or an HIV LTR; a U3 region promoter of Moloney murine sarcoma virus; a Granzyme A promoter; a regulatory sequence(s) of the metallothionein gene; a CD34 promoter; a CD8 promoter; a thymidine kinase (TK) promoter; a B19 parvovirus promoter; a PGK promoter
- a promoter is an MND promoter (Robbins et al., 1997, J. Virol. 71 :9466-9474), or an MNC promoter, which is a derivative of the MND promoter in which the LTR enhancers are combined with a minimal CMV promoter (Haberman et al, J. Virol. 74(18): 8732-8739, 2000).
- an RdCVF coding sequence is operatively linked to a promoter sequence comprising nucleotide sequence 150-812 of SEQ ID NO: 11.
- a vector or nucleic acid of the invention comprises an intron, operatively linked to a coding sequence for an RdCVF protein.
- An intron can be from an RdCVF gene or be a heterologous intron. Heterologous introns are known and non-limiting examples include a human ⁇ -globin gene intron and a beta-actin intron.
- an intron sequence is a human ⁇ -globin gene intron sequence.
- an intron sequence comprises nucleotides 820-1312 of SEQ ID NO: l 1 or 908- 1307 of SEQ ID NO: 1 1.
- a nucleic acid of the invention comprises a nucleotide sequence encoding a coding sequence for an RdCVF protein, wherein the RdCVF coding sequence comprises a recoded nucleotide sequence.
- a nucleic acid can encode for an RdCVF 1 protein and/or an RdCVF2 protein.
- an RdCVF protein is a short version RdCVF protein.
- an RdCVF protein is a long version RdCVF protein.
- an RdCVF protein can be an RdCVF 1 -short, RdCVF 1 -long, RdCVF2-short or RdCVF2-long protein.
- the RdCVF protein is a human RdCVF protein.
- a mammalian nucleotide coding region starts with the nucleotide sequence ATG (initiating methionine codon), such as found in a human RdCVF coding region.
- ATG initiiating methionine codon
- some embodiments of the invention provide a recoded RdCVF coding region and in some further embodiments the coding region is fused, in-frame with a second coding region, e.g., a coding sequence for a signal sequence.
- the ATG nucleotide sequence is not necessarily at the start of the RdCVF coding region, e.g., the RdCVF coding region starts by coding for the second amino acid of the particular RdCVF protein.
- the ATG nucleotide sequence can be at the start of the RdCVF coding region, even when the RdCVF coding region is operatively linked to another coding region 5' to the RdCVF coding region.
- a nucleic acid of the invention comprises SEQ ID NOs: l, 3 or 1 1. In some embodiments, a nucleic acid of the invention comprises nucleotides 150-812, 820-1312 and 1340-2080 of SEQ ID NO: 11. In some embodiments, a nucleic acid of the invention comprises nucleotides 150-812, 908-1307 and 1340-2080 of SEQ ID NO: l l . In some embodiments, a nucleic acid further comprises nucleotides 2130-2608 of SEQ ID NO: l l.
- a nucleic acid of the invention comprises a coding region for an RdCVF, wherein the RdCVF coding sequence has been recoded.
- a nucleic of the invention is in a vector, such as a viral vector.
- the invention includes viral vectors comprising an RdCVF coding region of the invention.
- viral vectors comprising an RdCVF coding region of the invention. Examples of viral vectors useful in the present invention are described in PCT Publication No. WO08/106644 and U.S. Patent Publication No. US20100120665. In some embodiments, the invention is not limited to a particular viral vector.
- Viral vectors include, but are not limited to, retroviral vectors, lentiviral vectors, adenoviral vectors (see, for example, U.S. Pat. No. 7,045,344), AAV vectors (e.g., see U.S. Pat. No. 7, 105,345), Herpes viral vectors (e.g., see U.S. Pat. Nos.
- hepatitis e.g., hepatitis D viral vectors (e.g., see U.S. Pat. No. 5,225,347), SV40 vectors, EBV vectors (e.g., see U.S. Pat. No. 6,521,449) and Newcastle disease virus vectors (e.g., see U.S. Pat. Nos. 6, 146,642, 7,442,379, 7,332,169 and 6,719,979).
- a lentiviral vector is an HIV, EIAV, SIV, FIV or BIV vector.
- a vector is selected from an AAV vector or an adenoviral vector.
- the invention also provides a cell that produces a viral vector of the invention.
- Vector virions of the invention may be administered in vivo or in vitro to cells (e.g., mammalian cells).
- Vectors can be used to transduce or transform cells including, but not limited to, undifferentiated cells, differentiated cells, somatic cells, primitive cells and/or stem cells.
- stem cells are intended for administration to a human and not for implantation in a suitably pseudopregnant woman for differentiation and development into an infant.
- a viral vector of the invention comprises a decay accelerating factor (DAF).
- DAF decay accelerating factor
- an enveloped viral vector includes a DAF on the viral membrane.
- a DAF is a wild-type DAF.
- a DAF is part of a fusion protein with an envelope protein, e.g., see Guibinga et al. Mol Ther. 2005 11(4):645-51.
- Adenovirus is a non-enveloped, nuclear DNA virus with a genome typically of about 36 kb.
- the human adenoviruses are divided into numerous serotypes (approximately 47, numbered accordingly and classified into 6 groups: A, B, C, D, E and F).
- Recombinant adenoviral vectors have tropism for both dividing and non-dividing cells, minimal pathogenic potential, ability to replicate to high titer for preparation of vector stocks and the potential to carry relatively large nucleotide sequence inserts (Berkner, (1992) Curr. Top. Micro. Immunol. 158:39-66; Jolly, (1994) Cancer Gene Therapy 1 :51-64).
- an adenoviral vector of the invention is a helper dependent or a "gutless" adenoviral vector.
- Adenoviral vectors can be used that are deleted in one or more of the following genes: Ela, Elb, E2a, E2b and E3. Methods for conducting adenovirus-based nucleic acid delivery are described in, e.g., U.S.
- AAV vectors are derived from single-stranded (ss) DNA parvoviruses.
- a single AAV particle can accommodate up to 5 kb of ssDNA, leaving about 4.5 kb for a transgene and regulatory elements.
- Trans-splicing systems as described, for example, in U.S. Pat. No. 6,544,785, may nearly double this limit and these types of vectors may also be used with the invention.
- essentially AAV of any serotype can be used.
- an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 serotype may be used (e.g., see U.S. Patent Nos.
- An AAV vector of the invention may also be pseudotyped.
- Pseudotyped AAV vectors contain the genome of one AAV serotype in the capsid of a second AAV serotype (e.g., see Auricchio et al, (2001) Hum. Mol. Genet., 10(26):3075-81).
- An AAV vector of the invention may contain a mutated capsid and/or be retargeted. For example, see Grieger et al. (Adv Biochem Eng Biotechnol. (2005) 99: 1 19-45); Goncalves et al. (Mol Ther. (2006) 13(5):976-86); and Warrington et al. (J Virol. (2004) 78(12):6595-609).
- an AAV vector is coated with polymers, e.g., reactive polymers to reduce natural tropism or natural binding of the AAV vector; to retarget the AAV vector and/or to provide resistance to neutralizing antisera.
- polymers e.g., reactive polymers to reduce natural tropism or natural binding of the AAV vector; to retarget the AAV vector and/or to provide resistance to neutralizing antisera.
- Retroviruses are RNA viruses wherein the viral genome is RNA. When a host cell is infected with a retrovirus, the genomic RNA is reverse transcribed into a DNA intermediate which is integrated efficiently into the chromosomal DNA of infected cells. Lentiviruses contain other genes with regulatory or structural function. The use of retroviral vectors for gene delivery is described, for example, in U.S. Pat. No. 6,013,516; and U.S. Pat. No.
- BIV systems are described, for example, in Matukonis et al, 2002 Hum. Gene Ther. 13, 1293-1303; Molina et al, 2002 Virology. 304, 10-23; Molina et al, 2004 Hum. Gene Ther., 15, 65-877; U.S. Pat. Nos. 6,864,085, 7, 125,712, 7,153,512; PCT Publication No. WO08/106644 and U.S. Patent Publication No. US20100120665.
- a DNA viral vector is a viral vector based on or derived from a virus that has a DNA based genome.
- a non-enveloped virus viral vector is a viral vector based on or derived from a virus that lacks a lipid-bilayer membrane.
- a viral vector of the invention is an AAV vector. In some embodiments, a viral vector of the invention is not a bovine immunodeficiency viral vector or it is not a lentiviral vector. In some embodiments, a viral vector is selected from the group consisting of a DNA viral vector, a non-enveloped viral vector and an adenoviral vector.
- Transferring a nucleic acid to cells can be by any method, such as, transfection, microinjection, electroporation, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, lipofection, microparticle bombardment, calcium phosphate mediated transfection, viral vector or bacteriophage transduction and so on.
- a selectable marker also can be introduced into the cells.
- the cells can be then placed under selection, e.g., to enhance expression and/or to isolate/select those cells that express the transferred coding region (see, e.g., Loeffler & Behr, Meth.
- a nucleic acid is introduced into a cell prior to in vivo administration of the resulting recombinant cell.
- a technique can provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and in some cases heritable and expressible by its cell progeny.
- Recombinant cells can be delivered to a patient by various methods.
- an RdCVF protein is expressed from a cell via a regulatable, inducible and/or repressible promoter.
- a cell used is autologous, allogeneic or xenogeneic with regard to a patient.
- autologous cells are manipulated ex vivo to cause them to contain a nucleic acid of the invention which allows the cell to produce or secrete an RdCVF protein and the cells are introduced back to the patient.
- cells are administered locally (e.g., in a joint, intravitreal, intraretinal, intracranially etc.) or systemically (e.g., i.v.).
- recombinant blood cells e.g., hematopoietic stem and/or progenitor cells
- eye cells and/or pluripotential cells can be injected directly into the eye.
- a stem-and/or progenitor cell which can be isolated and maintained in vitro can potentially be used in accordance with some embodiments of the invention.
- Such stem cells include, but are not limited, to hematopoietic stem cells (HSC), stem cells of epithelial tissues such as the skin and the lining of the gut, embryonic heart muscle cells, liver stem cells (see, e.g., WO 94/08598), and neural stem cells (e.g., Stemple and Anderson (1992) Cell 71 :973- 985).
- the administered cell is a stem cell comprising a nucleic acid of the invention and is capable of expressing and secreting an RdCVF.
- Encapsulated cells can allow controlled and/or continuous delivery of a protein, such as RdCVF, in vivo.
- cells comprising a nucleic acid of the invention and expressing and/or secreting an RdCVF are encapsulated.
- cells are encapsulated within a semipermeable membrane that allows diffusion of RdCVF through the membrane. More information related to encapsulated cells and encapsulated cell implants is found in Sieving et al. (Proc Natl Acad Sci USA, (2006) 103(10):3896-901); U.S. Patent Nos. 7, 115,257 and 7,820,195; and PCT Publication No. WO2011044216.
- encapsulated cells that express an RdCVF protein are delivered to an animal.
- encapsulated cells are implanted into a mammal, e.g., implanted in the eye, brain or olfactory region.
- encapsulated cells are retinal pigment epithelial cells, e.g., ARPE-19 (available from ATCC, Manassas, VA).
- encapsulated cells are used to deliver RdCVF to the eye, e.g., to the back of the eye.
- an encapsulated cell implant of the invention is comprised of cells that are encapsulated in a section of semi-permeable hollow fiber membrane and the cells have been genetically modified to produce an RdCVF.
- an encapsulated cell implant has a suture loop at one end to anchor it to the sclera in the vitreo- retinal body inside the eye.
- an encapsulated cell implant is 3, 4, 5, 6, 7, 8 ,9 or 10 mm in length.
- Nucleic acids and viral vectors of the invention can be used to express, produce and/or secrete an RdCVF from a cell. This expression, production and/or secretion can occur in vitro, in vivo or ex vivo.
- Some embodiments of the invention provide methods of secreting an RdCVF protein from a cell comprising administering to the cell a nucleic acid and/or a viral vector of the invention.
- the cell can be a mammalian cell, a human cell, an ocular cell, a retinal pigment epithelial (RPE) cell, a rod cell or a cone cell.
- RPE retinal pigment epithelial
- Some embodiments of the invention utilize vertebrate or mammalian cells.
- useful mammalian host cell lines are a monkey kidney CVI cell line transformed by SV40 (e.g., COS-7, ATCC CRL 1651); human embryonic kidney line (e.g., 293 or 293T cells including either cell line subcloned for growth in suspension culture, Graham et ah, J. Gen Virol.
- 293 Freestyle Invitrogen, Carlsbad, CA
- 293FT baby hamster kidney cells
- baby hamster kidney cells e.g., BHK, ATCC CCL 10
- Chinese hamster ovary cells CHO cells
- Chinese hamster ovary cells/-DHFR e.g., CHO, Urlaub et ah, Proc. Natl. Acad. Sci. USA 77:4216 (1980)
- mouse Sertoli cells e.g., TM4, Mather, Biol. Reprod.
- monkey kidney cells e.g., CVI ATCC CCL 70); African green monkey kidney cells (e.g., VERO-76, ATCC CRL-1587); human cervical carcinoma cells (e.g., HELA, ATCC CCL 2); canine kidney cells (e.g., MOCK, ATCC CCL 34); CF2TH cells; buffalo rat liver cells (e.g., BRL 3 A, ATCC CRL 1442); human lung cells (e.g., W138, ATCC CCL 75); human liver cells (e.g., Hep G2, HB 8065); mouse mammary tumor cells (e.g., MMT 060562, ATCC CCL51); TRI cells (Mather et ah, Annals N.Y. Acad. Sci. 383 :44-68 (1983)); MRC 5 cells; ARPE-19 cells (ATCC) and FS4 cells.
- CVI ATCC CCL 70 African green monkey kidney cells
- VERO-76 VERO-76, AT
- a cell is selected from the group consisting of a 293 cell, a CHO cell, a PerC6 cell, a Vero cell, a BHK cell, a HeLa cell, a COS cell, a MDCK cell, a 3T3 cell or a WI38.
- Some embodiments of the invention provide an isolated cell comprising a nucleic acid of the invention.
- the nucleic acid is integrated into the cellular genome/DNA.
- the invention also includes methods for producing an RdCVF protein comprising culturing a cell under conditions that allow for expression and secretion of the RdCVF protein and isolating the RdCVF protein from the cell culture, wherein the cell comprises a nucleic acid of the invention that codes for and allows the expression of the RdCVF protein, e.g., secretion of an RdCVF protein.
- the nucleic comprises a nucleotide sequence comprises a coding sequence for an RdCVF protein, wherein the RdCVF coding sequence comprises a recoded sequence.
- the RdCVF protein can be an RdCVF 1 or 2 protein or be the long or short form. In some embodiments, these methods further comprise purification of the RdCVF protein from the cell and/or culture supernatant.
- the invention also includes an RdCVF protein expressed by a cell from a nucleic acid of the invention.
- the invention also provides secreted forms of RdCVF proteins of the invention and compositions comprising a secreted RdCVF protein of the invention.
- an RdCVF protein expressed from a cell is purified to at least 90%, at least 93%, at least 95%, at least 98%, at least 99.5% or at least 99.9% pure in relation to total protein.
- compositions, formulations or preparations e.g., pharmaceutical compositions, containing a nucleic acid of the invention, a vector of the invention, a RdCVF protein of the invention, or any combination thereof.
- Formulations are generally, but not necessarily, biocompatible solutions of the active ingredient, e.g., comprising Hank's solution, Ringer's solution or phosphate buffered saline.
- a formulation or pharmaceutical composition comprises one or more of the following: citrate, NaCl, potassium chloride (KCl), calcium chloride dihydrate (CaCi 2 -2H 2 0), magnesium chloride hexahydrate (MgCi 2 -6H 2 0), sodium acetate trihydrate (CH 3 C0 2 Na-3H 2 0), sodium citrate dihydrate (C 6 H 5 07 a 3 -2H 2 0), sucrose, sodium hydroxide and/or hydrochloric acid (to adjust pH) and water.
- a formulation or pharmaceutical composition comprises one or more ingredients selected from the group consisting of histidine, MgCl 2 , trehalose, a polysorbate, polysorbate 20, NaCl, sucrose, arginine and proline.
- a formulation comprises one or more of the following: histidine; a, a-trehalose dehydrate; Mg(3 ⁇ 4 a polysorbate such as polysorbate 20; and NaCl.
- a formulation or pharmaceutical composition comprises one or more of the following:
- pluronic F-68 concentration can be 0.0001%, 0.001%, 0.005%, 0.01% or 0.1%.
- composition for use in vivo contains a "carrier” or a
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the a nucleic acid, vector or protein of the invention is administered.
- carrier' includes, but is not limited to, either solid or liquid material, which may be inorganic or organic and of synthetic or natural origin, with which an active component(s) of the composition is mixed or formulated to facilitate administration to a subject. Any other materials customarily employed in formulating a pharmaceutical are suitable.
- Pharmaceutical carriers can differ from typical solutions and suspensions in that they are specifically prepared for use in vivo to exclude substances that may be harmful to the host to whom the composition is administered (e.g., removal of bacterial toxins).
- suitable liquid carriers include water and aqueous solutions containing oxygenated organic compounds such as ethanol. Buffers and other materials normally present in pharmaceutical preparations, such as flavoring and suspending agents, can also be present.
- a suitable oil(s), saline, aqueous dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are typically suitable carriers for parenteral solutions.
- solutions for parenteral are typically suitable carriers for parenteral solutions.
- parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propylparaben and chlorobutanol.
- Carriers can include carbohydrates such as trehalose, mannitol, glutathione, xylitol, sucrose, lactose and sorbitol.
- Other ingredients for use in formulations may include, for example, DPPC (l,2-Didecanoyl-sw-glycero-3-phosphocholine), DOPE (1,2-Dioleoyl-sn- glycero-3-phosphoethanolamine), DSPC (l,2-Distearoyl-sw-glycero-3-phosphocholinez 1,2- Distearoyl-sn-glycero-3-phosphocholine) and DOPC (l,2-Dioleoyl-sn-glycero-3- phosphocholine).
- Natural or synthetic surfactants may be used. Polyethylene glycol may be used (even apart from its use in derivatizing a protein). Dextrans, such as cyclodextran, may be used. In some embodiments, cyclodextrin, tertiary amines and/or beta-cyclodextrin may be used. Bile salts and other related enhancers may be used. Cellulose and cellulose derivatives may be used. Amino acids may be used, such as use in a buffer formulation. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
- a composition can also contain wetting and/or emulsifying agents, and/or pH buffering agents.
- a composition may also include a solubilizing agent and/or a local anesthetic such as lignocaine to ease pain at the site of the injection.
- a pharmaceutical preparation or composition of the invention comprises a (i) pharmaceutically acceptable carrier and (ii) a nucleic acid of the invention, a viral vector of the invention, an RdCVF protein of the invention or any combination thereof.
- compositions of the invention can be administered locally or systemically.
- Useful routes of administration are described herein and known in the art.
- Methods of introduction or administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, intratracheal, topical, inhaled, transdermal, rectal, parenteral routes, epidural, intracranial, into the brain, intraventricular, subdural, intraarticular, intrathecal, intracardiac, intracoronary, intravitreal, subretinal, intraanterior chamber of the eye, locally on the cornea, subconjunctival, subtenon injection, by applying eyedrops, oral routes, via balloon catheter, via stent or any combinations thereof.
- Systemic administration may be, but is not limited to, by intravenous or intra-arterial injection or by transmucosal, subcutaneous, transdermal and/or
- an RdCVF encoding vector or nucleic acid of the invention is administered about once every week, month, 2 months, 3 months, 6 months, 9 months, year, 18 months, 2 years, 30 months, 3 years, 5 years, 10 years or as needed.
- an RdCVF encoding vector or nucleic acid of the invention is administered from about every 1 to 4 weeks, about every 4 to 8 weeks, about every 1 to 4 months, about every 3 to 6 months, about every 4 to 8 months, about every 6 to 12 months, about every 9 to 15 months, about every 12 to 18 months, about every 15 to 21 months, about every 18 to 24 months, about every 1 to 2 years, about every 1.5 to 3 years, about every 2 to 4 years, about every 3 to 5 years, about every 5 to 7 years, about every 7 to 10 years or about every 10 to 20 years. It is expected that administration of a vector coding for an RdCVF protein would be less frequent than administration of the RdCVF protein itself.
- a pharmaceutical preparation comprises a vector encoding an RdCVF protein of the invention and the pharmaceutical preparation is administered only once to the patient.
- an RdCVF protein of the invention is administered by intravitreal or subretinal injection to a human eye.
- about 15 ⁇ g to about 5 mg; about 15 ⁇ g to about 500 ⁇ g; about 100 ⁇ g to about 900 ⁇ g; about 300 ⁇ g to about 700 ⁇ g; about 500 ⁇ g to about 1 mg; about 1 mg to about 5 mg; about lmg; or about 500 ⁇ g of an RdCVF protein is administered by intravitreal or subretinal injection to a human eye.
- an RdCVF protein is administered by subretinal injection or intravitreal injection of an AAV vector that encodes RdCVF.
- GC vector genome copy
- an anti-inflammatory may be delivered in combination with an RdCVF protein, vector or nucleic acid of the invention.
- An anti-inflammatory may be delivered prior to, concurrently with, and/or after administration of a molecule or vector of the invention.
- an anti-inflammatory is administered in the same solution and/or same syringe as an RdCVF protein, nucleic acid or vector of the invention.
- an RdCVF protein, nucleic acid or vector of the invention and an antiinflammatory are co-administered to the eye.
- anti-inflammatory drugs include, but are not limited to, dexamethasone, dexamethasone sodium metasulfobenzoate, dexamethasone sodium phosphate, fluorometholone, bromfenac, pranoprofen, cyclosporine ophthalmic emulsion (e.g., RESTASISTM), naproxen, glucocorticoids, ketorolac, ibuprofen, tolmetin, non-steroidal anti-inflammatory drugs, steroidal anti-inflammatory drugs, diclofenac, flurbiprofen, indomethacin, and suprofen.
- Some embodiments of the invention include administration of both an RdCVF protein and a vector encoding it.
- An RdCVF protein may be delivered prior to, concurrently with, and/or after administration of a vector of the invention.
- an RdCVF protein is administered in the same solution and/or same syringe as a vector of the invention.
- a vector of the invention and an RdCVF protein are co-administered to the eye.
- a gene delivery system can result in transduction and/or stable integration of a gene or coding region for an RdCVF protein into a target cell.
- target cells are mammalian cells such as primate cells or human cells.
- target cells are cells of the eye, such as retinal pigment epithelial cells, rod photoreceptor cells, cone photoreceptor cells, bipolar cells, horizontal cells, amacrine cells, ganglion cells, retinal cells, or pluripotential cells.
- Target cells can be in vitro, ex vivo or in vivo.
- a target cell is a stem cell.
- Stem cells include, but are not limited to, pluripotent stem cells, totipotent stem cells, hematopoietic stem cells, cancer stem cells and embryonic stem cells.
- pluripotential cells contemplated herein are not those for propagating a living entity from a zygote or blastomere.
- the instant invention also contemplates the use of a partially undifferentiated cell for implantation into the eye of a patient in need of treatment, e.g., to regenerate cells of the eye.
- the invention also provides methods of treatment.
- the invention provides methods of preserving ocular rod cells comprising administering to the eye of a mammal a nucleic acid of the invention, a viral vector of the invention, an RdCVF protein of the invention, a pharmaceutical composition of the invention or a combination thereof.
- a viral vector and/or nucleic acid of the invention is administered by subretinal injection, intravitreal injection, injection to the intraanterior chamber of the eye, subconjunctival injection, subtenon injection or any combination thereof.
- a human is treated.
- the mammal to be treated suffers from an ocular disease selected from the group consisting of a retinal dystrophy, Stargardt's disease, retinitis pigmentosa, dry age-related macular degeneration (dry AMD), geographic atrophy (advanced stage of dry AMD), wet age-related macular degeneration (wet AMD), glaucoma/ocular hypertension, diabetic retinopathy, Bardet-Biedel syndrome, Bassen-Kornzweig syndrome, Best disease, choroidema, gyrate atrophy, congenital amaurosis, refsun syndrome, Usher syndrome, thyroid related eye disease, Grave's disease, a disease associated with retinal pigmented epithelial cells, anterior segment disease, lens disease/cataracts, an eye cup disorder, or uveitis.
- the preserved ocular rod cell does not contain a nucleic acid and/or viral vector of the invention.
- the preserved ocular cell is not
- Some embodiments of the invention provide a method of preserving ocular rod cells comprising administering to the eye of a mammal a nucleic acid and/or viral vector of the invention, wherein the nucleic acid and/or the viral vector is administered by subretinal injection and the rod cells and/or cones cells are preserved at a site at least 1 mm, at least 2 mm, at least 3 mm, at least 5 mm, at least 7 mm, at least 10 mm, at least 15 mm, at least 20 mm or at least 25 mm from the site of the subretinal injection.
- the cells transduced with the nucleic acid or viral vector at the subretinal injection site expresses and/or secrete an RdCVF-long and/or an RdCVF-short protein which can provide an ocular rod and/or cone preserving effect at a site distant to the transduced cell or injection site.
- RdCVF protein is also naturally expressed in other tissues.
- Fridlich et al. demonstrated that the level of phosphorylation of TAU is increased in the retina of the NxnlF (RdCVF 1-/-) mice as it is hyperphosphorylated in the brain of patients suffering from Alzheimer disease, presumably in some cases through oxidative stress. Fridlich et al. also showed that RdCVFL inhibits TAU phosphorylation.
- Cronin et al. Cell Death and Differentiation (2010) 17: 1 199-1210 found that Nxnll-h (RdCVFl-/-) retinas contained aggregated TAU protein, as found in the brain of patients suffering from Alzheimer's disease.
- mice lacking RdCVF2 have impaired vision and olfaction.
- Normal mice express RdCVF2 in the olfactory epithelium.
- Jaillard et al. (ARVO meeting (2009) program#/poster# 491/D636) reported that olfactory neurons were found to survive to a higher rate when cultured in the presence of RdCVF2.
- Jaillard et al. also compared RdCVF2-/- to control mice, by performing olfactory discrimination learning tests. By 12 months of age, the RdCVF2-/- mice failed to respond correctly to the stimulus.
- RdCVF proteins have neuroprotective activity and are not only a factor for cone and/or rod survival, but are general neuron survival factors.
- an RdCVF encoding nucleic acid, viral vector or RdCVF protein of the invention can be used to treat or ameliorate Alzheimer's disease, Huntington's disease, Parkinson's disease and olfactory diseases.
- the invention includes methods of treating a disease comprising administering to a mammal a nucleic acid of the invention, a viral vector of the invention, an RdCVF protein of the invention, a pharmaceutical composition of the invention or a combination thereof, wherein the disease is selected from the group consisting of Alzheimer's disease,
- the viral vector of this invention is an AAV vector.
- Recoded human RdCVFl S and RdCVF l L nucleotide coding regions were designed (e.g., nucleotides 106-741 of SEQ ID NO: l, nucleotides 106-744 of SEQ ID NO:3, SEQ ID NO: 12 or 14).
- GENEART® (Regensburg, Germany) synthesized nucleic acid sequences that, among other things, contained codon optimized nucleotide coding sequences for RdCVFl S and RdCVF lL. These coding sequences were also recoded to minimize motifs such as procarya inhibitory motifs, consensus splice donor sites and cryptic splice donor sites.
- the recoding of a human RdCVF 1L coding sequence also provided a recoded RdCVF lS coding region, nucleotides 1-327 of SEQ ID NO: 12 with a stop codon at the 3 ' end.
- Recoding of a native RdCVF IL coding sequence to SEQ ID NO: 12 removed 2 procarya inhibitory motifs, 1 consensus splice donor site and 3 cryptic splice donor sites leaving none of these elements in the recoded sequence (SEQ ID NO: 12). Recoding also changed the average GC content from 65% to 63%.
- Nucleotides 1-327 of SEQ ID NO: 12 also provide a recoded coding sequence for RdCVF IS but without a stop codon, such as TGA.
- CTGCCCTTCGAGGACGACCTGCGGAGATGA 330 (SEQ ID O: 14)
- Recocting of a native RdCVF IS coding sequence to SEQ ID NO: 14 removed 1 procarya inhibitory motif, 1 consensus splice donor site and 2 cryptic splice donor sites leaving none of these elements in the recoded sequence (SEQ ID NO: 14). Recoding also changed the average GC content from 58% to 61%.
- Example 2 In vitro expression of long form rod-derived cone viability factor mediated by adeno-associated viral vector
- the cDNA of the short form of the RdCVF protein was amplified by PCR from the nucleic acid synthesized by GENEART® and cloned into pSecTag2A plasmid (Invitrogen, Catalog No. V900-20) that incorporated a mouse Igk signal peptide sequence such that the Igk signal peptide DNA sequence is oriented five prime to an RdCVFS coding sequence.
- pAVTrRd034 The size and orientation of
- pAVTrRd034 was confirmed using restriction enzyme digests.
- the Igk-RdCVFS sequence was amplified by PCR from pAVTrRd034 and inserted into the adeno-associated virus vector plasmid pAAV-MCS (Cell Biolabs, San Diego, CA), creating the plasmid pAAV-SRd269 (SEQ ID NO:8).
- the codon-optimized long form of RdCVF was amplified by PCR and inserted into the in-house cloning plasmid pAVTOOl, creating the plasmid pAVTLrRd055 (SEQ ID NO:9).
- Plasmids pAVTLrRd055 and pAAV-SRd269 were double digested with Bgl II and Stu I.
- pAVTLrRd055 were ligated, creating pAAV-LRd268 (SEQ ID NO: 10) that contained a recoded coding sequence for long RdCVF.
- SEQ ID NO: 10 The size and orientation of pAAV-LRd268 was confirmed using restriction enzyme digests.
- Plasmids pAAV-LRd268, pHELPER (Cell BioLabs, Catalog No. 340202), and pRC2 (Cell BioLabs, Catalog No. 340201) were transformed into DH10B competent bacteria cells (Invitrogen, Catalog No. 18297-010) and scaled up using the Qiagen EndoFree Plasmid Maxi Kit or EndoFree Plasmid Mega Kit according to the manufacturer's instructions.
- the plasmid concentrations were determined using a Beckman DU-600 spectrophotometer. Each plasmids identity was confirmed by restriction digests and analysis.
- rAAV-RdCVF 1 L vector 293 AAV cells (Cell BioLabs, Catalog No. AAV-100) were seeded at 4 million cells per 15 cm dish in cDMEM (DMEM supplemented with 10% FBS, 1% Glutamine, 1% non-essential amino acids, and 1%
- rAAV-RdCVFIL vector To purify the rAAV-RdCVFIL vector, four 50 mL conical tubes containing the vector from the freeze/thaw/freeze step was thawed at 37°C in a water bath. Forty microliters of BENZONASE® (Sigma, Catalog No. E8263-25kU) was added to each tube which was then incubated at 37°C for 30 minutes. The tubes were centrifuged for 10 minutes at 3,000 rpm and the supernatants were transferred into a 500 mL bottle. Six milliliters of a 10% sodium deoxycholate solution (8.2 g in 82 mL water) was added. The sample was briefly mixed and incubated at 37°C for 30 minutes. The suspension was filtered using 5 ⁇ filters.
- BENZONASE® Sigma, Catalog No. E8263-25kU
- a heparin agarose column (8 mL) (Sigma, Catalog No. H6508-25mL) was prepared and the column was equilibrated with 48 mL phosphate buffered saline (PBS) (Invitrogen, Catalog No. 10010- 049).
- PBS phosphate buffered saline
- the filtered cell lysate was loaded onto the column and the column was washed with 40 mL washing buffer (20 mL 5 M NaCl, 980 mL PBS).
- the vector was eluted using 15 mL elution buffer (80 mL 5 M NaCl, 920 mL PBS) and collected in a new 50 mL conical tube.
- the vector was concentrated by centrifugal filtration.
- An Amicon Ultra- 15 centrifugational filter unit (Millipore, Catalog No. UFC910024) was rinsed once with PBS and the eluted sample was added to the device. Centrifugation was performed in a Beckman Allegro 6KR centrifuge at 2,200 rpm, 22°C, until the sample was concentrated to a 1-2 mL volume. A 15 mL volume of PBS was added and the centrifugation was repeated until the sample volume was ⁇ 1 mL.
- the purified vector was collected and the filter walls rinsed with 100 of PBS. The sample was mixed and 30 aliquots of the vector were stored at -80°C in 600 conical tubes until use.
- This process was repeated to purify the rAAV-GFP vector.
- Figure 9 and SEQ ID NO: 11 show the nucleic acid sequence of the rAAV-RdCVFIL vector.
- a spike control was used where 5 ⁇ ⁇ of the spike standard (2xl0 9 single stranded DNA from pAAV-GFP) was added to the reaction.
- These reactions were performed in 0.2 mL 8-tube strips without caps (Biorad, Catalog No. TBS- 0201), using 8-flat cap strips (BioRad, Catalog No. TCS-0803), in a BioRad PCR thermo- cycler.
- a master mix for the qPCR was setup, containing 825 ⁇ ⁇ water, 1.875 ⁇ ⁇ iQ SYBR Green Supermix (BioRad, Catalog No. 170-8882) and 337.5 ⁇ ⁇ of each of the primers (QPCR CMV 1 (SEQ ID NO:5) and QPCR CMV 2 (SEQ ID NO:6)).
- a 45 ⁇ , volume of the mix was added per well into a 96-well PCR plate, and either 5 ⁇ ⁇ of the digested vector, spike digested vector, undigested vector (5 ⁇ ⁇ purified vector with 40 ⁇ ⁇ water and 5 ⁇ ⁇ DNase buffer), undigested spiked vector (5 ⁇ ⁇ purified vector with 35 ⁇ ⁇ water, 5 ⁇ ⁇ DNase buffer, and 5 ⁇ , spike standard) were added and mixed.
- a PCR process was performed and samples from Cycle 3 used for melting curve analysis.
- the concentration of these single-stranded DNA genomes was analyzed by quantitative PCR as described above.
- the concentration of the rAAV-RdCVFIL vector particles was determined to be 2xlO n vector genome copies per milliliter (GC/mL) and the concentration of rAAV-GFP vector particles was determined to be 2xlO n GC/mL.
- the vector lysates were subjected to SDS-PAGE with silver staining analysis. Specifically, 20 ⁇ , of lysis buffer (8.4 mL water, 500 ⁇ . 1 M Tris (pH 8.0), 1 mL Glycerol, 300 ⁇ , 5 ⁇ NaCl, 50 ⁇ . NP-40, 40 ⁇ . EDTA, 100 ⁇ . PMSF, 1 tablet protease inhibitor (Roche, Catalog No. 1 1836170001)) was added to 20 ⁇ , of the respective purified recombinant AAV vector and kept on ice for 20 minutes.
- lysis buffer 8.4 mL water, 500 ⁇ . 1 M Tris (pH 8.0), 1 mL Glycerol, 300 ⁇ , 5 ⁇ NaCl, 50 ⁇ . NP-40, 40 ⁇ . EDTA, 100 ⁇ . PMSF, 1 tablet protease inhibitor (Roche, Catalog No. 1 1836170001)
- the reaction was centrifuged for 2 minutes at 13,000 rpm and 4°C in a tabletop centrifuge. The supernatant was transferred into a new tube, 10 ⁇ ⁇ of 5x reducing sample buffer (Pierce, Catalog No. 39000) was added and the samples were incubated for 10 minutes at 95°C.
- Electrophoresis was performed according to the manufacturer's instructions. A 4-15% SDS-PAGE gel was rinsed with water and placed into the gel chamber. Running buffer (IX Tris/Glycine/SDS made by diluting 10X Tris/Glycine/SDS running buffer (BioRad, Catalog No. 161-0732) with water) was added to upper and lower buffer chambers. The wells were rinsed twice with 200 ⁇ ⁇ running buffer and the samples were loaded. As a control, a 1 ⁇ volume of BENCHMARKTM protein ladder (Invitrogen, Catalog No. 10747- 012) was added to the outer wells. Equal concentrations of the vectors, as determined by genomic titer analysis, were loaded. The gel was run at 200 V until the dye reached the bottom of the gel. The gel was fixed and silver stained according to the manufacturer's directions (Biorad Silver Stain Plus, Catalog No. 161-0449).
- ARPE-19 human retinal pigment epithelial cells (ATCC, Manassas, VA) were seeded at 200,000 cells in 3 mL of cDMEM per well in a 6-well plate.
- the time limiting step is the second-strand synthesis of the single- stranded DNA genome, which can take several weeks, e.g., see Ferrari et al. (1996). J Virol. 70:3227-3234.
- radiation can be used prior to transduction to expedite the expression of proteins after rAAV vector transduction in cell culture, e.g., see Alexander et al. (1994) J Virol. 68:8282-8287.
- the supernatants from the transduced and untransduced cells were harvested and filtered through a 0.45 ⁇ filter.
- An equal volume of lysate buffer (9.4 mL water, 200 ⁇ , 1 M Tris (pH 8.0), 40 ⁇ , 0.5 M EDTA, 300 ⁇ , 5 ⁇ NaCl, 100 ⁇ , NP-40, 100 ⁇ , PMSF, 1 tablet protease inhibitor) was added, and stored at -80°C until use.
- the cells from each plate were washed with PBS, scraped off using a cell lifter, pooled and transferred into 15 mL conical tubes.
- the cells were centrifuged for 4 minutes at 1,200 rpm and 4°C in a Beckman Coulter Allegra 6KR centrifuge and the supernatant was discarded.
- the cell pellets were resuspended in 1 mL of lysis buffer (see above), transferred into 1.5 mL tubes, and incubated on ice for 10 minutes.
- the cell lysates were centrifuged for 2 minutes at 13,000 rpm and 4°C in a tabletop centrifuge.
- the cleared cell lysates were aliquoted into 200 volumes in 1.5 mL tubes and stored at -80°C until use.
- the membrane was blocked in 200 mL of IX casein solution with gentle agitation on a rocker platform for at least two hours at room temperature (RT) for supernatant and 4°C over night plus 1 hour at RT for cell lysate.
- the membrane was incubated with 50 mL with rabbit anti-RdCVF protein specific monoclonal antibody (primary antibody, generated by Covance (Denver, PA) using purified His-Tag RdCVFIL protein produced in E. coli (Protein One, Rockville, MD)) diluted 1 :2,000 (supernatant) or 1 : 10,000 (cell lysate) in IX casein solution with gentle agitation at 4°C overnight or 2 hours at room temperature, respectively.
- rabbit anti-RdCVF protein specific monoclonal antibody primary antibody, generated by Covance (Denver, PA) using purified His-Tag RdCVFIL protein produced in E. coli (Protein One, Rockville, MD)
- the membrane was washed with 30 mL of a IX casein solution 4 times for 5 minutes each at RT with gentle agitation.
- the membrane was incubated with 30 mL of biotinylated goat anti-rabbit IgG (secondary antibody) diluted 1 :24,000 in IX casein solution for 1 hour at RT with gentle agitation.
- the membrane was washed in 30 mL of IX casein solution 3 times for 5 minutes each at RT with gentle agitation.
- the membrane was incubated for 45 minutes in Vectastain ABC-AmP in 50 mL of IX casein containing 100 ⁇ ⁇ of Reagent A and 100 ⁇ ⁇ of Reagent B.
- the membrane was washed in 30 mL of IX casein solution 3 times for 5 minutes each at RT with gentle agitation.
- the membrane was incubated in Tris, pH 9.5.
- the chemiluminescent signal was acquired using 6 mL of Duolox Substrate (Vector Laboratories, Catalog No. SK 6605) and exposing the membrane to Kodak BioMax MS X-ray film (Kodak Carestream Health, Catalog No. 8572786) in a film cassette for 10 seconds to 5 minutes followed by
- the level of expressed RdCVFIL protein in the cell lysate indicated that the rAAV-RdCVFIL vector transduced ARPE cells efficiently. More importantly, the RdCVFIL protein was efficiently secreted into the cell culture medium of the vector transduced cells ( Figure 2B). However, two RdCVFIL protein positive bands with the expected molecular weight were observed in the rAAV-RdCVFIL vector transduced cell lysate samples ( Figure 2 A, lane 3), and three such bands were detected in the cell supernatant samples ( Figure 2B, lane 3).
- the two lower molecular weight bands in the cell supernatant ( Figure 2B, lane 3) that have the same molecular weights as those in the cell lysate may have been released from some dead cells in the culture.
- the third band with slightly higher molecular weight in the supernatant likely represented a secreted form of RdCVFIL which was absent from the cell lysate.
- the data also suggested that the three forms of RdCVFlL, including the secreted form of RdCVFlL, was likely post-translationally modified.
- the RdCVFlL AAV vector was able to efficiently transduce human retinal pigment epithelial (ARPE-19) cells, leading to expression and secretion of the long RdCVF protein as detected by Western Blot.
- Two distinct RdCVFL proteins bands were observed in the rAAV- RdCVFlL vector transduced cell lysate samples in addition to a higher band.
- RdCVFL protein bands were detected in the vector transduced cell supernatant. The two of them that having the same molecular weights as those seen in the cell lysate were possibly from dead cells in the cell culture. The third band with slightly higher molecular weight likely represented the secreted form of RdCVFlL. These data also suggested that RdCVFlL, including the secreted form of RdCVFlL, was likely post-translationally modified.
- mice Female BALB/C mice, 5-6 weeks of age, were purchased from The Jackson
- Subretinal injections were performed under anesthesia. Animals were anesthetized with an intraperitoneal injection of 25-30 ⁇ g/gram of ketamine combined with 5-6 ⁇ g/gram xylazine. Anesthetic doses were adjusted to achieve a deep plane of anesthesia. Eyes were treated with a topical application of 0.5% proparacaine hydrochloride (Bausch & Lomb Inc. Rochester, NY) for local anesthesia and 0.3% AK-Tob (Bausch & Lomb Inc.) for disinfection immediately before procedures. Pupils were dilated with 1% tropicamide (Akorn, Inc., Buffalo Grove, IL).
- the anesthetized mouse was positioned under a Zeiss operating microscope with the eye to be injected under view (approx 10X magnification).
- gentle pressure was applied on the eyelids with a jeweler's forceps to make the entire globe prolapse forward.
- the superior temporal conjunctiva was carefully dissected to expose the sclera.
- a 30-gauge needle was used to perform a shelving puncture of the sclera, choroid and retina at approximately 1 1 o'clock (right eye) and 1 o'clock (left eye) 0.5 mm posterior to the limbus.
- a drop of Gonak (2.5%, Akorn, Inc) was instilled on the cornea and a coverslip gently placed on the corneal surface to aid in viewing the fundus.
- a 33-gauge blunt needle attached to a 5 ⁇ ⁇ Hamilton syringe was inserted through the sclerotomy in a tangential direction toward the posterior pole without touching the lens and the tip of the needle placed on the inner surface of the retina.
- the retina was perforated and 1 ⁇ ⁇ of vector was injected into the subretinal space. After injection, the needle was carefully withdrawn and the conjunctiva repositioned. The success of each injection was confirmed by evaluating the fundus for signs of retinal detachment.
- Neomycin and polymycin B sulfate and Bacitracin Zinc ophthalmic ointment was applied to the cornea to minimize drying of this tissue while the animals were recovering from anesthesia on a warm blanket.
- rAAV-RdCVFIL vector administration of rAAV-RdCVFIL vector. Briefly, eyeballs were enucleated and extraocular tissues and anterior segment were removed. The remaining posterior segments were quickly frozen with liquid nitrogen. These samples were stored at -80°C until used for protein extraction. For each eyecup, 200 ⁇ ⁇ of ice-cold T-PER tissue protein extraction reagent (Pierce, Cat. No. 78510) with Protease Inhibitor Cocktail (Roche Diagnostics, Cat. No. 1 1836170001) was added. The samples were sonicated 5 seconds on ice with a Sonic dismembrator (Fisher Scientific Model 100, Pittsburgh, PA).
- sonicated samples were kept on ice for 15 minutes and centrifuged at 10,000 g for 5 minutes at 4°C to remove cell debris. The supernatants were collected and protein concentrations determined using a Bradford protein assay.
- rAAV-RdCVF 1 L transduced ARPE-19 cell lysate served as the positive control and untransduced cell lysate as the negative control. Proteins were separated by gel electrophoresis. For each lane, 36 ⁇ g of total protein was loaded on a 4-20% CriterionTM TGXTM Precast Gel (Bio-Rad, Cat. No. 567-1094) and subjected to electrophoreses at 200 volts for 70 minutes.
- the proteins were electroblotted onto 0.2 ⁇ nitrocellulose blotting membranes using a Trans Blot Semi-Dry Transfer Cell.
- the blots were blocked using a IX casein solution (Vector Laboratories, Cat. No. SP-5020) for 2 hrs at RT and incubated with the rabbit anti-RdCVFL primary antibody (Covance Research Products, Denver, PA) diluted 1 :2,000 or rabbit anti-opsin, red/green polyclonal antibody (Millipore, Temecura, CA) diluted 1 :500. After three washes with IX casein solution each blot was incubated with alkaline phosphatase goat anti-rabbit IgG antibody (Vector Laboratories, Cat. No.
- Beta-tubulin (50-kD) was used for equal protein loading control.
- the blot was stripped with Restore Plus Western Blot Stripping Buffer (Thermo Scientific, Cat. No. 46430) and re-probed with an anti-B-tubulin monoclonal antibody (Sigma-Aldrich, Cat. No. T4026) diluted 1 :500 followed by an alkaline
- Protein densitometry of the autoradiographs was used to quantify the scanned protein bands, which were normalized with respect to the beta-tubulin level in the same blot.
- RdCVF lL immunostaining was performed in the wholemount preparation of the neuroretina and RPE-choroida-sclera.
- Animals were terminally anesthetized and eyes were enucleated and immediately fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) 7.4 (IX), liquid (Gibco, Cat. No. 10010-031) overnight at 4°C.
- PBS phosphate-buffered saline
- IX phosphate-buffered saline
- Libco phosphate-buffered saline
- Each mouse eye was marked at the inferior quadrant of cornea with India ink prior to enucleation. Eyecups were prepared by removing anterior segment under a Leica dissecting microscope. A small nick was made at the inferior quadrant for orientation.
- the neuroretina was carefully dissected away from the RPE, severed at the optic nerve.
- the wholemounts were rinsed three times with IX PBS, and blocked with 5% donkey serum in 2% Triton X-100 in PBS for 2 hrs at RT. After removing blocking solution, the wholemounts were sequentially incubated with the primary antibody -rabbit anti-RdCVF, 1 : 1,000 in blocking solution at 4°C overnight and secondary antibody-ALEXA FLUOR® 488 donkey anti-rabbit 1 : 1,000 in 2% Triton X-100 in PBS, 2 hrs at RT.
- each wholemount was flat-mounted on a glass slide with photoreceptors facing upward for the neuroretina and RPE facing upward for the RPE-choroid-sclera.
- the flatmounts were then examined with an Olympus BX51 microscope equipped with digital camera (Spot RT Color 2.2.1, Diagnostic Instruments, Inc) and epifluorescence.
- RPE-choroid-sclera and neuroretina were separated and flat-mounted on glass slides. Fluorescent microscopy revealed robust GFP expression in RPE and photoreceptor layer (data not shown).
- the RPE cells expressing GFP spread 1-2 quadrants of the flatmount, with the maximal number and most robust GFP-expressing cells present at the injection site.
- Transduced RPE cells appeared healthy as they maintained their hexagonal morphology.
- GFP expression was identified in the photoreceptor outer segments.
- inner retinal cells such as ganglion cells, were GFP positive, possibly due to vector leakage into the vitreous after subretinal injection.
- RdlO mice are a naturally occurring animal model for autosomal recessive retinitis pigmentosa (RP). RdlO mice have a missense point mutation in rod cGMP
- Rod photoreceptor cells start degenerating at 18 days of age, with peak photoreceptor death occurring at P25 (Gargini et al. (2007) J Comp Neurol 500:222- 238). By five weeks most photoreceptor cells have been degenerated (Chang et al. (2002) Vision Res 42:517-525; Chang et al. (2007) Vision Res 47:624-633; Gargini et al. (2007) J Comp Neurol 500:222-238).
- mice Animals (at the age of postnatal day 3) were anesthetized by hypothermia. This anesthetic method has been well established for neonatal mice and rats for up to 5 days of age and is appropriate for short, minor surgical procedures (5-15 minutes) in these animals (Gaertner et al. Anesthesia and Analgesia 2nd ed. pages 277-278). The pup was placed on crushed ice for 3-4 minutes. During this time the color of pup was changed from pink to pale. Subretinal injections were performed under this type of anesthesia.
- the anesthetized mouse was positioned under a Zeiss operating microscope with the eye to be injected under view (approx. 10X magnification). Eyelids and adjacent area were disinfected with 5% povidone-iodine. The eye was exposed by separation of the palpebral fissure using an Iris scissor. Gentle pressure was applied on the eyelids with a jeweler's forceps to make the entire globe prolapse forward. A drop of 0.3% Tobromycin (Bausch & Lomb Inc.) was given for disinfection. A 30-gauge sharp needle was used to perform a shelving puncture of the sclera, choroid and retina at approximately the 1 1 O'clock (right eye) position about 0.5 mm posterior to the limbus.
- a 33-gauge blunt needle attached to a 5- ⁇ Hamilton syringe was inserted through the sclerotomy in a tangential direction toward the posterior pole.
- the tip of the needle was placed in the subretinal space, and 1 of AAV vector was injected into the subretinal space. After injection, the needle was slowly withdrawn. Any eyes that displayed subretinal or intravitreal hemorrhages were excluded from study.
- Neomycin and polymycin B sulfate and bacitracin zinc ophthalmic ointment (Bausch & Lomb Inc.) was applied to the cornea to prevent infection and minimize drying of this tissue. Animals were allowed to recover on a warm heating pad.
- mice were deeply anesthetized and their eyes were marked at the superior quadrant with red tissue dye for orientation. They were then sacrificed and immediately enucleated and fixed in Davidson's fixative for about 24 hrs at RT. After sequential dehydration in ethanol and Clear-rite, eyes were embedded in paraffin (Fisher Sci., Houston, TX). Retinal sections of 5 ⁇ thickness were cut along the vertical meridian to allow examination of the superior and inferior retina. The sections were stained with hematoxylin and eosin and examined under a light microscope (Olympus BX51). The outer nuclear layer (ONL) thickness was evaluated by counting the number of rows of nuclei in the central and peripheral retina. Photoreceptor morphology was also examined.
- ONL outer nuclear layer
- the treated rdlO mouse eyes were assessed for the degree of structural rescue at the age of 5 weeks.
- Light microscopy showed obvious preservation of outer nuclear layer (ONL) in the AAV-RdCVF IL treated eyes in comparison with untreated contralateral eyes.
- ONL outer nuclear layer
- the RdCVFIL vector-treated retina possessed 2-5 rows of photoreceptor nuclei in the superior and/or inferior regions as opposed to 1-2 rows in the untreated, contralateral eyes in the same locations (Fig. 7).
- the rescue was not limited to the injected area, the superior quadrant, as the protection was also observed in the inferior quadrant.
- Morphometric analysis showed approximately 75% of retina was protected in vector-treated eyes in comparison with 34% in untreated eyes. Some preserved photoreceptors even possessed inner and outer segments (Fig. 7E). It is noteworthy that the rescued photoreceptors contained both rod and cone cells.
- Peanut agglutinin (PNA), a cone cell-specific marker, was used to stain the wholemount preparation of the retina.
- Mouse eyes were marked at the superior quadrant of cornea with Indian ink and red dye at temporal quadrant prior to enucleation. They were immediately fixed in 4% paraformaldehyde at least overnight at 4°C. Eyecups were prepared by removing anterior segment under a Leica dissecting microscope. A small nick was made at the superior quadrant for orientation. After 4 radial cuts around the circumference, the entire neuroretina was carefully dissected away from the eye cup. The retinas were rinsed three times with IX PBS, and blocked with 6% of bovine serum albumin (BSA) in PBS (Gibco, Cat. No.
- BSA bovine serum albumin
- retinal cryostat sections (12 ⁇ in thickness) were cut with a Leica cryostat microtome (Leica Microsystems, Model CM 1850, Leica, Bannockburn, IL) and stained with PNA, examined with the fluorescent microscope aforementioned.
- Leica cryostat microtome Leica Microsystems, Model CM 1850, Leica, Bannockburn, IL
- RdCVF immunostaining was performed in the wholemount preparation of the neuroretina and RPE-choroida-sclera.
- the wholemounts were rinsed three times with IX PBS, and blocked with 5% donkey serum and 2% Triton X-100 in PBS for 2 hrs at RT. After removing blocking solution, the wholemounts were sequentially incubated with the primary antibody -rabbit anti-RdCVF at 1 : 1,000 in blocking solution at 4°C overnight and secondary antibody-Alexa Fluor® 488 donkey anti-rabbit at 1 : 1,000 and 2% Triton X-100 in PBS, 2 hrs at RT.
- each wholemount was flat-mounted on a glass slide with photoreceptors facing upward for the neuroretina and RPE facing upward for the RPE- choroid-sclera.
- the flatmounts were then examined with an Olympus BX51 microscope equipped with a digital camera (Spot RT Color 2.2.1, Diagnostic Instruments, Inc) and epifluorescence.
- Example 5 Subretinal injection of rAAV-RdCVFIL preserved photoreceptor cells distant from the injection site in rdlO mice
- rAAV-RdCVF IL (1 ⁇ , 2xl0 8 GC) was subretinally injected into the superior quadrant oirdlO mouse right eyes at postnatal day 3, with the uninjected contralateral eyes as controls. Mice were sacrificed at 5-weeks old. Retinal histology from the entire eye cup was examined.
- Figure 8 shows a light photomicrograph of an eyecup from a representative 5-week old rdlO mouse that received a subretinal injection of rAAV-RdCVF IL in one eye (Panel A, Figure 8) and no treatment in the contralateral eye (Panel B, Figure 8). Note the difference in ONL thickness between the treated and untreated eye. Photoreceptor preservation was clearly seen in the entire retina of rAAV-RdCVFIL treated eye (Panel A, Figure 8). The injection site in the superior retina was labeled. In contrast, most photoreceptor cells were lost except in the inferior peripheral retina in the untreated contralateral eye (Panel B, Figure 8).
- Example 6 Subretinal injection of rAAV-RdCVF IL preserved rod photoreceptor cells
- Example 7 Functional rescue of photoreceptors by RdCVFL mediated by adeno-associated viral vectors in RdlO mice
- Neonatal rdlO mice at 3 or 4 days of age, were injected subretinally with rAAV-RdCVFL vector in one eye while the contralateral eye was left untreated.
- Five weeks after subretinal injection the mice were tested with electroretinogram (ERG) to evaluate retinal functions. After ERGs, the mice were sacrificed, and their eyes were processed for histological assessment of the retina.
- ERG electroretinogram
- Recombinant AAV serotype 2 vector rAAV-RdCVFIL and control vector rAAV- GFP were prepared as described in Example 2.
- mice were dark adapted overnight (at least 14 hours) before the experiments and their pupils dilated with 0.5% tropicamide (Alkorn) eye drops. Anesthesia was induced by intraperitoneal injection of ketamine and xylazine. Silver needle electrodes served as reference (forehead) and ground (tail) and DTL ring electrodes as active electrodes. Gonesol was applied to ensure good electrical contact and to keep the eye hydrated during the entire procedure.
- the recording setup featured a Ganzfeld bowl, a DC amplifier, and a computer- based control and recording unit of the Espion E3 electroretinography system (Diagnosys LLC. Lowell, MA). ERGs were recorded from both eyes simultaneously after the mice were placed in the Ganzfeld bowl.
- Single-flash and flicker recordings were obtained both under dark-adapted (scotopic) and light-adapted (photopic) conditions.
- Single flash stimuli were presented with increasing intensities, reaching from 10 ⁇ 2 to 25 cds/m 2 .
- Five responses were averaged with an inter-stimulus interval of 5 or 17 seconds.
- Flicker stimuli had an intensity of 3 cds/m 2 with frequencies of 2, 5, 10, 15, and 30 Hz.
- Light adaptation was performed with a background illumination of 30 cds/m 2 presented for 10 minutes to reach a stable level of the photopic responses. For comparison of the mean amplitudes, Student pair-t-test was used.
- mice were deeply anesthetized and marked their eyes at the superior quadrant with red tissue dye for orientation. They were then sacrificed and immediately enucleated and fixed in Davidson's fixative for about 24 hrs at room temperature. After sequential dehydration in ethanol and Clear-rite, eyes were embedded in paraffin (Fisher Sci., Houston, TX). Retinal sections of 5 ⁇ thickness were cut along the vertical meridian to allow examination of the superior and inferior retina. The sections were stained with hematoxylin and eosin and examined under a light microscope (Olympus BX51). The outer nuclear layer (ONL) thickness was evaluated by counting the number of rows of nuclei in the central and peripheral retina. Photoreceptor morphology was also examined.
- ONL outer nuclear layer
- the rdlO mice showed a significant reduction of scotopic and photopic responses in ERG recording in comparison to the age-matched, wild- typed C57BL/6 mice (data not shown).
- the eyes treated with rAAV-RdCVF IL showed an approximately 3 -fold increase in b-wave amplitudes (33.6 ⁇ 14 ⁇ ) as compared to the untreated fellow eyes (1 1.5 ⁇ 8.4 ⁇ ) under the flash intensity of 25 cd at the scotopic background (Figs. 10A and 10B). Under this condition, both rod and cone responses were recorded.
- ERG demonstrated a significant increase in the amplitudes of b-wave in rAAV- RdCVFlL-treated eyes (33.6+14 ⁇ ) in relative to the untreated fellow eyes (1 1.5+8.4 ⁇ ).
- the increase in the ERG amplitudes was correlated with improvement of retinal structure.
- This study demonstrated subretinal injection of rAAV-RdCVFIL vectors significantly improved retinal function and delayed photoreceptor degeneration in the RdlO mice.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Ophthalmology & Optometry (AREA)
- Microbiology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Virology (AREA)
- Psychology (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Urology & Nephrology (AREA)
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201280064474.1A CN104321069A (zh) | 2011-10-27 | 2012-10-26 | 编码视杆细胞来源的视锥细胞活力因子的载体 |
| BR112014010091-8A BR112014010091B1 (pt) | 2011-10-27 | 2012-10-26 | Ácido nucleico, vetor viral, preparação farmacêutica, uso destes, método para produção de uma proteína rdcvf, e método in vitro ou ex vivo de secreção de uma proteína rdcvf a partir de uma célula |
| EP12843778.7A EP2797613B1 (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| DK12843778.7T DK2797613T3 (da) | 2011-10-27 | 2012-10-26 | Vektorer, der koder for rod-derived cone viability-faktor |
| JP2014539038A JP6293664B2 (ja) | 2011-10-27 | 2012-10-26 | 桿体由来錐体生存因子をコードするベクター |
| KR1020147011857A KR102000141B1 (ko) | 2011-10-27 | 2012-10-26 | 간상세포 유래 원추세포 생존능 인자를 인코딩하는 벡터 |
| RU2014121256A RU2664673C2 (ru) | 2011-10-27 | 2012-10-26 | Векторы, кодирующие фактор жизнеспособности колбочек, полученный из палочек |
| US14/354,415 US9265813B2 (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| PL12843778T PL2797613T3 (pl) | 2011-10-27 | 2012-10-26 | Wektory kodujące pręcikowy czynnik żywotności czopków |
| HK15102471.7A HK1202049B (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| MX2014004949A MX354516B (es) | 2011-10-27 | 2012-10-26 | Vectores que codifican el factor de viabilidad de conos derivado de bastones. |
| CA2853379A CA2853379C (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| ES12843778T ES2774779T3 (es) | 2011-10-27 | 2012-10-26 | Vectores que codifican el factor de viabilidad de conos derivado de bastones |
| AU2012321102A AU2012321102C1 (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| US14/962,337 US10040835B2 (en) | 2011-10-27 | 2015-12-08 | Vectors encoding rod-derived cone viability factor |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161552155P | 2011-10-27 | 2011-10-27 | |
| US61/552,155 | 2011-10-27 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/354,415 A-371-Of-International US9265813B2 (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
| US14/962,337 Continuation US10040835B2 (en) | 2011-10-27 | 2015-12-08 | Vectors encoding rod-derived cone viability factor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013063383A2 true WO2013063383A2 (en) | 2013-05-02 |
| WO2013063383A3 WO2013063383A3 (en) | 2013-06-20 |
Family
ID=48168788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/062106 Ceased WO2013063383A2 (en) | 2011-10-27 | 2012-10-26 | Vectors encoding rod-derived cone viability factor |
Country Status (14)
| Country | Link |
|---|---|
| US (2) | US9265813B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2797613B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP6293664B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR102000141B1 (cg-RX-API-DMAC7.html) |
| CN (2) | CN110777124A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2012321102C1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112014010091B1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2853379C (cg-RX-API-DMAC7.html) |
| DK (1) | DK2797613T3 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2774779T3 (cg-RX-API-DMAC7.html) |
| MX (1) | MX354516B (cg-RX-API-DMAC7.html) |
| PL (1) | PL2797613T3 (cg-RX-API-DMAC7.html) |
| RU (1) | RU2664673C2 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013063383A2 (cg-RX-API-DMAC7.html) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014060517A1 (en) * | 2012-10-17 | 2014-04-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of age-related macular degeneration (amd) |
| WO2015162302A3 (en) * | 2014-04-25 | 2015-12-30 | Genethon | Treatment of hyperbilirubinemia |
| WO2017042584A1 (en) * | 2015-09-10 | 2017-03-16 | Oxford University Innovation Limited | Treatment of retinitis pigmentosa |
| WO2017120294A1 (en) * | 2016-01-05 | 2017-07-13 | The Trustees Of The University Of Pennsylvania | Methods and compositions for treatment of ocular disorders and blinding diseases |
| US11241506B2 (en) | 2015-12-14 | 2022-02-08 | The Trustees Of The University Of Pennsylvania | Composition for treatment of Crigler-Najjar syndrome |
| US12076367B2 (en) | 2016-10-11 | 2024-09-03 | Pharma Cinq, Llc | Fusion protein between short form rod-derived cone viability factor and a hydrophilic peptide |
| WO2024206928A1 (en) | 2023-03-30 | 2024-10-03 | Pharma Cinq, Llc | VECTOR ENCODING ROD-DERIVED CONE VIABILITY FACTOR AND HUMAN IgK SIGNAL SEQUENCE |
| WO2026072752A1 (en) * | 2024-09-27 | 2026-04-02 | Pharma Cinq, Llc | Rod-derived cone viability factor fusion protein |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2027889A1 (en) * | 2007-06-05 | 2009-02-25 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | New neuronal viability factor and use thereof |
| JP6684343B2 (ja) * | 2015-05-21 | 2020-04-22 | アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル | ニューロン生存因子の相乗組み合わせ及びその使用 |
| CN106148528B (zh) * | 2016-07-11 | 2019-10-01 | 赵晨 | 一种遗传性Usher综合征的致病突变及其检测试剂 |
| US12043848B2 (en) * | 2017-10-16 | 2024-07-23 | Vigeneron Gmbh | AAV vectors |
| SG11202006796RA (en) * | 2017-12-22 | 2020-08-28 | Sparingvision | Constructs comprising neuronal viability factors and uses thereof |
| JP7213891B2 (ja) * | 2018-01-30 | 2023-01-27 | ユニベルシテイト ゲント | 白内障を処置するのに使用するための組成物 |
| CN108504685A (zh) * | 2018-03-27 | 2018-09-07 | 宜明细胞生物科技有限公司 | 一种利用CRISPR/Cas9系统同源重组修复IL-2RG缺陷基因的方法 |
| CA3110745A1 (en) * | 2018-09-07 | 2020-03-12 | University Of Southern California | Cryopreservation of cell-seeded substrates and related methods |
| BR112021009370A2 (pt) * | 2018-11-14 | 2021-08-17 | Regenxbio Inc. | método de tratamento da doença de batten cln2, composição farmacêutica e kit |
| AU2019407921A1 (en) * | 2018-12-19 | 2021-06-10 | Versameb Ag | RNA encoding a protein |
| WO2021050789A1 (en) | 2019-09-10 | 2021-03-18 | Obsidian Therapeutics, Inc. | Ca2-il15 fusion proteins for tunable regulation |
| CN113260704B (zh) * | 2019-12-09 | 2022-06-28 | 北京中因科技有限公司 | CYP4V2和RdCVF在制备药物中的用途 |
| CN111733174B (zh) * | 2020-08-07 | 2021-02-09 | 北京大学第三医院(北京大学第三临床医学院) | 一种分离的核酸分子及其用途 |
| WO2022045935A1 (en) * | 2020-08-28 | 2022-03-03 | Joint Stock Company "Biocad" | Aav5-based vaccine against sars-cov-2 |
Citations (57)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| US5225347A (en) | 1989-09-25 | 1993-07-06 | Innovir Laboratories, Inc. | Therapeutic ribozyme compositions and expression vectors |
| US5252479A (en) | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
| WO1994008598A1 (en) | 1992-10-09 | 1994-04-28 | Advanced Tissue Sciences, Inc. | Liver reserve cells |
| US5552311A (en) | 1993-09-14 | 1996-09-03 | University Of Alabama At Birmingham Research Foundation | Purine nucleoside phosphorylase gene therapy for human malignancy |
| US5658785A (en) | 1994-06-06 | 1997-08-19 | Children's Hospital, Inc. | Adeno-associated virus materials and methods |
| US5658776A (en) | 1993-11-09 | 1997-08-19 | Targeted Genetics Corporation | Generation of high titers of recombinant AAV vectors |
| US5763416A (en) | 1994-02-18 | 1998-06-09 | The Regent Of The University Of Michigan | Gene transfer into bone cells and tissues |
| US5773289A (en) | 1995-06-06 | 1998-06-30 | University Of Pittsburgh | AAV directed targeted integration |
| US5824544A (en) | 1995-03-24 | 1998-10-20 | Genzyme Corporation | Adenovirus vectors for gene therapy |
| US5830727A (en) | 1995-11-18 | 1998-11-03 | Human Gene Therapy Research Institute | Herpes simplex virus amplicon mini-vector gene transfer system |
| US5843742A (en) | 1994-12-16 | 1998-12-01 | Avigen Incorporated | Adeno-associated derived vector systems for gene delivery and integration into target cells |
| US5868040A (en) | 1995-04-20 | 1999-02-09 | Mercedes-Benz Ag. | Gas pedal with friction structure |
| US5869040A (en) | 1995-06-07 | 1999-02-09 | Biogen, Inc | Gene therapy methods and compositions |
| US5871722A (en) | 1988-11-16 | 1999-02-16 | Advanced Polymer Systems, Inc. | Ionic beads useful for controlled release and adsorption |
| US5880102A (en) | 1995-01-17 | 1999-03-09 | Duke University | Adenoviral vector system |
| US5882877A (en) | 1992-12-03 | 1999-03-16 | Genzyme Corporation | Adenoviral vectors for gene therapy containing deletions in the adenoviral genome |
| US5885808A (en) | 1992-11-04 | 1999-03-23 | Imperial Cancer Research Technology Limited | Adenovirus with modified binding moiety specific for the target cells |
| US5932210A (en) | 1993-10-25 | 1999-08-03 | Canji Inc. | Recombinant adenoviral vector and methods of use |
| US5942496A (en) | 1994-02-18 | 1999-08-24 | The Regent Of The University Of Michigan | Methods and compositions for multiple gene transfer into bone cells |
| US5948675A (en) | 1994-02-22 | 1999-09-07 | Universite Pierre Et Marie Curie (Paris Vi) | Host-vector system which can be used in gene therapy |
| US5981225A (en) | 1998-04-16 | 1999-11-09 | Baylor College Of Medicine | Gene transfer vector, recombinant adenovirus particles containing the same, method for producing the same and method of use of the same |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US5994106A (en) | 1994-06-10 | 1999-11-30 | Genvec, Inc. | Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus |
| US5994132A (en) | 1996-10-23 | 1999-11-30 | University Of Michigan | Adenovirus vectors |
| US5994134A (en) | 1998-05-04 | 1999-11-30 | Canji, Inc. | Viral production process |
| US6001650A (en) | 1995-08-03 | 1999-12-14 | Avigen, Inc. | High-efficiency wild-type-free AAV helper functions |
| US6001557A (en) | 1994-10-28 | 1999-12-14 | The Trustees Of The University Of Pennsylvania | Adenovirus and methods of use thereof |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| US6040172A (en) | 1992-08-14 | 2000-03-21 | The Rockefeller University | Defective DNA viral vector comprising a neural tissue-specific promoter for in vivo expression of a gene |
| US6146642A (en) | 1998-09-14 | 2000-11-14 | Mount Sinai School Of Medicine, Of The City University Of New York | Recombinant new castle disease virus RNA expression systems and vaccines |
| US6231879B1 (en) | 1996-08-01 | 2001-05-15 | Neurotech S.A. | Biocompatible devices with foam scaffolds |
| US6262034B1 (en) | 1994-03-15 | 2001-07-17 | Neurotech S.A. | Polymeric gene delivery system |
| US6264941B1 (en) | 1993-08-12 | 2001-07-24 | Neurotech S.A. | Compositions for the delivery of biologically active molecules using genetically altered cells contained in biocompatible immunoisolatory capsules |
| US6303136B1 (en) | 1998-04-13 | 2001-10-16 | Neurotech S.A. | Cells or tissue attached to a non-degradable filamentous matrix encapsulated by a semi-permeable membrane |
| US6322804B1 (en) | 1991-04-25 | 2001-11-27 | Neurotech S.A. | Implantable biocompatible immunoisolatory vehicle for the delivery of selected therapeutic products |
| US6436427B1 (en) | 1996-03-22 | 2002-08-20 | Neurotech S.A. | Device and method for treating ophthalmic diseases |
| WO2002081513A2 (en) | 2001-04-06 | 2002-10-17 | Novartis Ag | Disease-associated protein |
| US6521449B1 (en) | 1995-11-07 | 2003-02-18 | GSF-Forschungszentrum für Umwelt und Gesundheit GmbH | Gene construct and its use |
| US6544785B1 (en) | 1998-09-14 | 2003-04-08 | Mount Sinai School Of Medicine Of New York University | Helper-free rescue of recombinant negative strand RNA viruses |
| US6719979B2 (en) | 1998-06-19 | 2004-04-13 | Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. | Newcastle disease virus infectious clones, vaccines and diagnostic assays |
| US6864085B2 (en) | 1999-12-14 | 2005-03-08 | Novartis Ag | Bovine immunodeficiency virus (BIV) based vectors |
| US6878544B2 (en) | 1996-04-19 | 2005-04-12 | Neurotech Sa | Retinal cell lines with extended life-span and their applications |
| US6958325B2 (en) | 2001-01-10 | 2005-10-25 | Efrat Biopolymers Limited | Cationic polysaccharide compositions |
| US7045344B2 (en) | 1998-11-19 | 2006-05-16 | The Board Of Trustees Of The Leland Stanford Junior University | Adenoviral vector and methods for making and using the same |
| US7098030B2 (en) | 1999-12-31 | 2006-08-29 | Mirus Bio Corporation | Polyampholytes for delivering polyions to a cell |
| US7105345B2 (en) | 1998-11-05 | 2006-09-12 | The University Of Pennsylvania | Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same |
| US7115257B1 (en) | 1999-04-06 | 2006-10-03 | Neurotech S.A. | ARPE-19 as a platform cell line for encapsulated cell-based delivery |
| US7208577B2 (en) | 1995-11-22 | 2007-04-24 | Amgen, Inc. | Methods of increasing lean tissue mass using OB protein compositions |
| WO2008106644A2 (en) | 2007-03-01 | 2008-09-04 | Advanced Vision Therapies, Inc. | Treatment of diseases characterized by inflammation |
| WO2008148860A1 (en) | 2007-06-05 | 2008-12-11 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | New neuronal viability factor and use thereof |
| WO2009134681A2 (en) | 2008-04-30 | 2009-11-05 | The Trustees Of The University Of Pennsylvania | Aav7 viral vectors for targeted delivery of rpe cells |
| WO2009146183A1 (en) | 2008-04-15 | 2009-12-03 | Genzyme Corporation | Methods to produce rod-derived cone viability factor (rdcvf) |
| WO2010029130A1 (en) | 2008-09-10 | 2010-03-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuronal viability factor and use thereof |
| US7790449B2 (en) | 2001-12-17 | 2010-09-07 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (AAV) serotype 8 sequences, vectors containing the same, and uses therefor |
| US7820195B2 (en) | 2005-12-30 | 2010-10-26 | Neurotech Usa, Inc. | Micronized device for the delivery of biologically active molecules and methods of use thereof |
| WO2011044216A1 (en) | 2009-10-08 | 2011-04-14 | Neurotech Usa, Inc. | Use of pedf in an encapsulated cell-based delivery system |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE69731660T2 (de) | 1996-12-02 | 2005-12-22 | Valentis Inc., Burlingame | Insulinähnlicher wachstumfaktor i (igf-i) expressionssystem und methode zur verwendung |
| JP2005533485A (ja) * | 2002-02-04 | 2005-11-10 | ノバルティス アクチエンゲゼルシャフト | 組換えウシ免疫不全ウイルスに基づく遺伝子導入システム |
| CA2493122C (en) | 2002-07-25 | 2012-11-27 | The Scripps Research Institute | Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith |
| DE10260805A1 (de) * | 2002-12-23 | 2004-07-22 | Geneart Gmbh | Verfahren und Vorrichtung zum Optimieren einer Nucleotidsequenz zur Expression eines Proteins |
| CA2524063C (en) * | 2003-05-02 | 2015-02-17 | The Scripps Research Institute | Hematopoietic stem cells and methods of treatment of neovascular eye diseases therewith |
| FR2870241B1 (fr) | 2004-05-13 | 2015-02-27 | Novartis Ag | Facteur de viabilite des cones derive des batonnets ou rdcvf et applications |
| ES2582559T3 (es) * | 2007-12-06 | 2016-09-13 | Inserm - Institut National De La Santé Et De La Recherche Médicale | Factor trófico para el tratamiento de las enfermedades degenerativas de la retina |
| WO2010050586A1 (ja) * | 2008-10-31 | 2010-05-06 | ディナベック株式会社 | 組み換え蛋白質の発現を増強する方法 |
| DE102009016934A1 (de) | 2009-04-08 | 2010-10-14 | Daimler Ag | Brennstoffzelle, Brennstoffzellenstapel und Verfahren zum Abdichten einer Brennstoffzelle |
-
2012
- 2012-10-26 CA CA2853379A patent/CA2853379C/en active Active
- 2012-10-26 AU AU2012321102A patent/AU2012321102C1/en active Active
- 2012-10-26 BR BR112014010091-8A patent/BR112014010091B1/pt active IP Right Grant
- 2012-10-26 JP JP2014539038A patent/JP6293664B2/ja not_active Expired - Fee Related
- 2012-10-26 WO PCT/US2012/062106 patent/WO2013063383A2/en not_active Ceased
- 2012-10-26 DK DK12843778.7T patent/DK2797613T3/da active
- 2012-10-26 RU RU2014121256A patent/RU2664673C2/ru active
- 2012-10-26 CN CN201911125836.3A patent/CN110777124A/zh active Pending
- 2012-10-26 ES ES12843778T patent/ES2774779T3/es active Active
- 2012-10-26 US US14/354,415 patent/US9265813B2/en active Active
- 2012-10-26 MX MX2014004949A patent/MX354516B/es active IP Right Grant
- 2012-10-26 KR KR1020147011857A patent/KR102000141B1/ko active Active
- 2012-10-26 PL PL12843778T patent/PL2797613T3/pl unknown
- 2012-10-26 CN CN201280064474.1A patent/CN104321069A/zh active Pending
- 2012-10-26 EP EP12843778.7A patent/EP2797613B1/en active Active
-
2015
- 2015-12-08 US US14/962,337 patent/US10040835B2/en active Active
Patent Citations (63)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5871722A (en) | 1988-11-16 | 1999-02-16 | Advanced Polymer Systems, Inc. | Ionic beads useful for controlled release and adsorption |
| US5225347A (en) | 1989-09-25 | 1993-07-06 | Innovir Laboratories, Inc. | Therapeutic ribozyme compositions and expression vectors |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| US6322804B1 (en) | 1991-04-25 | 2001-11-27 | Neurotech S.A. | Implantable biocompatible immunoisolatory vehicle for the delivery of selected therapeutic products |
| US5252479A (en) | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
| US6040172A (en) | 1992-08-14 | 2000-03-21 | The Rockefeller University | Defective DNA viral vector comprising a neural tissue-specific promoter for in vivo expression of a gene |
| WO1994008598A1 (en) | 1992-10-09 | 1994-04-28 | Advanced Tissue Sciences, Inc. | Liver reserve cells |
| US5885808A (en) | 1992-11-04 | 1999-03-23 | Imperial Cancer Research Technology Limited | Adenovirus with modified binding moiety specific for the target cells |
| US5882877A (en) | 1992-12-03 | 1999-03-16 | Genzyme Corporation | Adenoviral vectors for gene therapy containing deletions in the adenoviral genome |
| US6264941B1 (en) | 1993-08-12 | 2001-07-24 | Neurotech S.A. | Compositions for the delivery of biologically active molecules using genetically altered cells contained in biocompatible immunoisolatory capsules |
| US5552311A (en) | 1993-09-14 | 1996-09-03 | University Of Alabama At Birmingham Research Foundation | Purine nucleoside phosphorylase gene therapy for human malignancy |
| US5932210A (en) | 1993-10-25 | 1999-08-03 | Canji Inc. | Recombinant adenoviral vector and methods of use |
| US5658776A (en) | 1993-11-09 | 1997-08-19 | Targeted Genetics Corporation | Generation of high titers of recombinant AAV vectors |
| US5763416A (en) | 1994-02-18 | 1998-06-09 | The Regent Of The University Of Michigan | Gene transfer into bone cells and tissues |
| US5942496A (en) | 1994-02-18 | 1999-08-24 | The Regent Of The University Of Michigan | Methods and compositions for multiple gene transfer into bone cells |
| US5948675A (en) | 1994-02-22 | 1999-09-07 | Universite Pierre Et Marie Curie (Paris Vi) | Host-vector system which can be used in gene therapy |
| US6262034B1 (en) | 1994-03-15 | 2001-07-17 | Neurotech S.A. | Polymeric gene delivery system |
| US5658785A (en) | 1994-06-06 | 1997-08-19 | Children's Hospital, Inc. | Adeno-associated virus materials and methods |
| US5994106A (en) | 1994-06-10 | 1999-11-30 | Genvec, Inc. | Stocks of recombinant, replication-deficient adenovirus free of replication-competent adenovirus |
| US6001557A (en) | 1994-10-28 | 1999-12-14 | The Trustees Of The University Of Pennsylvania | Adenovirus and methods of use thereof |
| US5843742A (en) | 1994-12-16 | 1998-12-01 | Avigen Incorporated | Adeno-associated derived vector systems for gene delivery and integration into target cells |
| US5880102A (en) | 1995-01-17 | 1999-03-09 | Duke University | Adenoviral vector system |
| US5824544A (en) | 1995-03-24 | 1998-10-20 | Genzyme Corporation | Adenovirus vectors for gene therapy |
| US5868040A (en) | 1995-04-20 | 1999-02-09 | Mercedes-Benz Ag. | Gas pedal with friction structure |
| US5773289A (en) | 1995-06-06 | 1998-06-30 | University Of Pittsburgh | AAV directed targeted integration |
| US5869040A (en) | 1995-06-07 | 1999-02-09 | Biogen, Inc | Gene therapy methods and compositions |
| US6001650A (en) | 1995-08-03 | 1999-12-14 | Avigen, Inc. | High-efficiency wild-type-free AAV helper functions |
| US6013516A (en) | 1995-10-06 | 2000-01-11 | The Salk Institute For Biological Studies | Vector and method of use for nucleic acid delivery to non-dividing cells |
| US6521449B1 (en) | 1995-11-07 | 2003-02-18 | GSF-Forschungszentrum für Umwelt und Gesundheit GmbH | Gene construct and its use |
| US5830727A (en) | 1995-11-18 | 1998-11-03 | Human Gene Therapy Research Institute | Herpes simplex virus amplicon mini-vector gene transfer system |
| US7208577B2 (en) | 1995-11-22 | 2007-04-24 | Amgen, Inc. | Methods of increasing lean tissue mass using OB protein compositions |
| US6436427B1 (en) | 1996-03-22 | 2002-08-20 | Neurotech S.A. | Device and method for treating ophthalmic diseases |
| US6878544B2 (en) | 1996-04-19 | 2005-04-12 | Neurotech Sa | Retinal cell lines with extended life-span and their applications |
| US6231879B1 (en) | 1996-08-01 | 2001-05-15 | Neurotech S.A. | Biocompatible devices with foam scaffolds |
| US5994132A (en) | 1996-10-23 | 1999-11-30 | University Of Michigan | Adenovirus vectors |
| US5994136A (en) | 1997-12-12 | 1999-11-30 | Cell Genesys, Inc. | Method and means for producing high titer, safe, recombinant lentivirus vectors |
| US6303136B1 (en) | 1998-04-13 | 2001-10-16 | Neurotech S.A. | Cells or tissue attached to a non-degradable filamentous matrix encapsulated by a semi-permeable membrane |
| US5981225A (en) | 1998-04-16 | 1999-11-09 | Baylor College Of Medicine | Gene transfer vector, recombinant adenovirus particles containing the same, method for producing the same and method of use of the same |
| US5994134A (en) | 1998-05-04 | 1999-11-30 | Canji, Inc. | Viral production process |
| US6719979B2 (en) | 1998-06-19 | 2004-04-13 | Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. | Newcastle disease virus infectious clones, vaccines and diagnostic assays |
| US7332169B2 (en) | 1998-06-19 | 2008-02-19 | Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. | Newcastle disease virus infectious clones, vaccines and new diagnostic assays |
| US6544785B1 (en) | 1998-09-14 | 2003-04-08 | Mount Sinai School Of Medicine Of New York University | Helper-free rescue of recombinant negative strand RNA viruses |
| US7442379B2 (en) | 1998-09-14 | 2008-10-28 | Mount Sinai School Of Medicine Of New York University | Recombinant Newcastle disease virus RNA expression systems and vaccines |
| US6146642A (en) | 1998-09-14 | 2000-11-14 | Mount Sinai School Of Medicine, Of The City University Of New York | Recombinant new castle disease virus RNA expression systems and vaccines |
| US7105345B2 (en) | 1998-11-05 | 2006-09-12 | The University Of Pennsylvania | Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same |
| US7045344B2 (en) | 1998-11-19 | 2006-05-16 | The Board Of Trustees Of The Leland Stanford Junior University | Adenoviral vector and methods for making and using the same |
| US7115257B1 (en) | 1999-04-06 | 2006-10-03 | Neurotech S.A. | ARPE-19 as a platform cell line for encapsulated cell-based delivery |
| US7125712B2 (en) | 1999-12-14 | 2006-10-24 | Novartis Ag | Bovine immunodeficiency virus (BIV) based vectors |
| US7153512B2 (en) | 1999-12-14 | 2006-12-26 | Novartis Ag | Bovine immunodeficiency virus (BIV) based vectors |
| US6864085B2 (en) | 1999-12-14 | 2005-03-08 | Novartis Ag | Bovine immunodeficiency virus (BIV) based vectors |
| US7098030B2 (en) | 1999-12-31 | 2006-08-29 | Mirus Bio Corporation | Polyampholytes for delivering polyions to a cell |
| US6958325B2 (en) | 2001-01-10 | 2005-10-25 | Efrat Biopolymers Limited | Cationic polysaccharide compositions |
| WO2002081513A2 (en) | 2001-04-06 | 2002-10-17 | Novartis Ag | Disease-associated protein |
| US7790449B2 (en) | 2001-12-17 | 2010-09-07 | The Trustees Of The University Of Pennsylvania | Adeno-associated virus (AAV) serotype 8 sequences, vectors containing the same, and uses therefor |
| US7820195B2 (en) | 2005-12-30 | 2010-10-26 | Neurotech Usa, Inc. | Micronized device for the delivery of biologically active molecules and methods of use thereof |
| US20100120665A1 (en) | 2007-03-01 | 2010-05-13 | Advanced Vision Therapies, Inc. | Treatment of diseases characterized by inflammation |
| WO2008106644A2 (en) | 2007-03-01 | 2008-09-04 | Advanced Vision Therapies, Inc. | Treatment of diseases characterized by inflammation |
| WO2008148860A1 (en) | 2007-06-05 | 2008-12-11 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | New neuronal viability factor and use thereof |
| WO2009146183A1 (en) | 2008-04-15 | 2009-12-03 | Genzyme Corporation | Methods to produce rod-derived cone viability factor (rdcvf) |
| US20110034546A1 (en) | 2008-04-15 | 2011-02-10 | Genzyme Corporation | Methods to produce rod-derived cone viability factor (rdcvf) |
| WO2009134681A2 (en) | 2008-04-30 | 2009-11-05 | The Trustees Of The University Of Pennsylvania | Aav7 viral vectors for targeted delivery of rpe cells |
| WO2010029130A1 (en) | 2008-09-10 | 2010-03-18 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Neuronal viability factor and use thereof |
| WO2011044216A1 (en) | 2009-10-08 | 2011-04-14 | Neurotech Usa, Inc. | Use of pedf in an encapsulated cell-based delivery system |
Non-Patent Citations (47)
| Title |
|---|
| "Introduction to Protein Structure", 1991, GARLAND PUBLISHING |
| "Proteins, Structures and Molecular Principles", 1984, W. H. FREEMAN AND COMPANY |
| "Remington's Pharmaceutical Sciences", MACK PUBLISHING CO. |
| "Viral Vectors for Gene Therapy: Methods and Protocols", 2003, HUMANA PRESS |
| AURICCHIO ET AL., HUM. MOL. GENET., vol. 10, no. 26, 2001, pages 3075 - 3081 |
| BERKNER, CURR. TOP. MICRO. IMMUNOL., vol. 158, 1992, pages 39 - 66 |
| CARLISLE ET AL., J GENE MED., vol. 10, no. 4, 2008, pages 400 - 411 |
| CHALMEL ET AL., BMC MOLECULAR BIOLOGY, vol. 8, no. 74, 2007, pages 1 - 12 |
| CLINE, PHARMAC. THER., vol. 29, 1985, pages 69 - 92 |
| COHEN ET AL., METH. ENZYMOL., vol. 217, 1993, pages 618 - 644 |
| CRONIN ET AL., CELL DEATH AND DIFFERENTIATION, vol. 17, 2010, pages 1199 - 1210 |
| FATH ET AL., PLOS ONE, vol. 6, no. E17596, 2011, pages 1 - 14 |
| FRIDLICH ET AL., MOL CELL PROTEOMICS, vol. 8, no. 6, 2009, pages 1206 - 1218 |
| FRIDLICH ET AL., MOLECULAR & CELLULAR PROTEOMICS, vol. 8, no. 6, 2009, pages 1206 - 1218 |
| GAO ET AL., PNAS, vol. 99, 2002, pages 11854 - 11859 |
| GONGALVES ET AL., MOL THER., vol. 13, no. 5, 2006, pages 976 - 986 |
| GRAF ET AL., J VIROL, vol. 74, 2000, pages 10822 - 10826 |
| GRAHAM ET AL., J. GEN VIROL., vol. 36, 1977, pages 59 |
| GRIEGER ET AL., ADV BIOCHEM ENG BIOTECHNOL., vol. 99, 2005, pages 119 - 145 |
| GUIBINGA ET AL., MOL THER., vol. 11, no. 4, 2005, pages 645 - 51 |
| HABERMAN ET AL., J. VIROL., vol. 74, no. 18, 2000, pages 8732 - 8739 |
| HOOVER ET AL., NUCLEIC ACIDS RES., vol. 30, no. E43, 2002, pages L-7 |
| JOLLY, CANCER GENE THERAPY, vol. 1, 1994, pages 51 - 64 |
| KASSIM ET AL., PLOS ONE, vol. 5, no. 10, 2010, pages 1 - 10 |
| KOLLER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 8932 - 8935 |
| KOTIN, HUM MOL GENET, vol. 20, no. RL, 2011, pages R2 - R6 |
| LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533 |
| LEVEILLARD ET AL., NATURE GENETICS, vol. 36, 2004, pages 755 - 759 |
| LEVEILLARD ET AL., SCI TRANSL MED., vol. 2, no. 26, 2010, pages 26PS 16 |
| LOEFFLER; BEHR, METH. ENZYMOL., vol. 217, 1993, pages 599 - 618 |
| MATHER ET AL.: "Annals N.Y. Acad. Sci.", vol. 383, 1983, pages: 44 - 68 |
| MATHER, BIOL. REPROD., vol. 23, 1980, pages 243 - 251 |
| MATUKONIS ET AL., HUM. GENE THER., vol. 13, 2002, pages 1293 - 1303 |
| MOLINA ET AL., HUM. GENE THER., vol. 15, 2004, pages 65 - 877 |
| MOLINA ET AL., VIROLOGY, vol. 304, 2002, pages 10 - 23 |
| RAAB ET AL., SYST SYNTH BIOL, vol. 4, 2010, pages 215 - 225 |
| ROBBINS ET AL., J. VIROL., vol. 71, 1997, pages 9466 - 9474 |
| SIEVING ET AL., PROC NATL ACAD SCI USA, vol. 103, no. 10, 2006, pages 3896 - 3901 |
| STEMPLE; ANDERSON, CELL, vol. 71, 1992, pages 973 - 985 |
| THORNTON ET AL., NATURE, vol. 354, 1991, pages 105 |
| TREAT ET AL.: "The Therapy of Infectious Disease and Cancer", 1989, LISS, article "Liposomes", pages: 317 - 327,353-365 |
| VON HEIJNE, G., EUR. J. BIOCHEM., vol. 133, 1983, pages 17 - 21 |
| VON HEIJNE, G., J. MOL. BIOL., vol. 184, 1985, pages 99 - 105 |
| VON HEIJNE, G., PROTEIN ENGINEERING, 1997, pages 1 - 6 |
| WARRINGTON ET AL., J VIROL., vol. 78, no. 12, 2004, pages 6595 - 6609 |
| YANG ET AL., MOL THERAPY, vol. 17, 2009, pages 787 - 795 |
| ZIJLSTRA ET AL., NATURE, vol. 342, 1989, pages 435 - 438 |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10004780B2 (en) | 2012-10-17 | 2018-06-26 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of age-related macular degeneration (AMD) |
| WO2014060517A1 (en) * | 2012-10-17 | 2014-04-24 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of age-related macular degeneration (amd) |
| EP2909232B1 (en) | 2012-10-17 | 2020-03-11 | Institut National de la Sante et de la Recherche Medicale (INSERM) | Methods and pharmaceutical compositions for the treatment of age-related macular degeneration (amd) |
| US20230414724A1 (en) * | 2014-04-25 | 2023-12-28 | Genethon | Treatment of hyperbilirubinemia |
| EP3851537A1 (en) * | 2014-04-25 | 2021-07-21 | Genethon | Treatment of hyperbilirubinemia |
| JP2017513501A (ja) * | 2014-04-25 | 2017-06-01 | ジェネトン | 高ビリルビン血症の処置 |
| EP3546585A1 (en) * | 2014-04-25 | 2019-10-02 | Genethon | Treatment of hyperbilirubinemia |
| US10471132B2 (en) | 2014-04-25 | 2019-11-12 | Genethon | Treatment of hyperbilirubinemia |
| EP4643946A3 (en) * | 2014-04-25 | 2026-03-04 | Genethon | Treatment of hyperbilirubinemia |
| JP2020103300A (ja) * | 2014-04-25 | 2020-07-09 | ジェネトン | 高ビリルビン血症の処置 |
| WO2015162302A3 (en) * | 2014-04-25 | 2015-12-30 | Genethon | Treatment of hyperbilirubinemia |
| JP7349931B2 (ja) | 2014-04-25 | 2023-09-25 | ジェネトン | 高ビリルビン血症の処置 |
| WO2017042584A1 (en) * | 2015-09-10 | 2017-03-16 | Oxford University Innovation Limited | Treatment of retinitis pigmentosa |
| US10836803B2 (en) | 2015-09-10 | 2020-11-17 | Oxford University Innovation Limited | Treatment of retinitis pigmentosa |
| US11241506B2 (en) | 2015-12-14 | 2022-02-08 | The Trustees Of The University Of Pennsylvania | Composition for treatment of Crigler-Najjar syndrome |
| US12023386B2 (en) | 2015-12-14 | 2024-07-02 | The Trustees Of The University Of Pennsylvania | Composition for treatment of Crigler-Najjar syndrome |
| US10857240B2 (en) | 2016-01-05 | 2020-12-08 | The Trustees Of The University Of Pennsylvania | Methods and compositions for treatment of ocular disorders and blinding diseases |
| US12097267B2 (en) | 2016-01-05 | 2024-09-24 | The Trustees Of The University Of Pennsylvania | Methods and compositions for treatment of ocular disorders and blinding diseases |
| WO2017120294A1 (en) * | 2016-01-05 | 2017-07-13 | The Trustees Of The University Of Pennsylvania | Methods and compositions for treatment of ocular disorders and blinding diseases |
| US12076367B2 (en) | 2016-10-11 | 2024-09-03 | Pharma Cinq, Llc | Fusion protein between short form rod-derived cone viability factor and a hydrophilic peptide |
| WO2024206928A1 (en) | 2023-03-30 | 2024-10-03 | Pharma Cinq, Llc | VECTOR ENCODING ROD-DERIVED CONE VIABILITY FACTOR AND HUMAN IgK SIGNAL SEQUENCE |
| WO2026072752A1 (en) * | 2024-09-27 | 2026-04-02 | Pharma Cinq, Llc | Rod-derived cone viability factor fusion protein |
Also Published As
| Publication number | Publication date |
|---|---|
| JP6293664B2 (ja) | 2018-03-14 |
| HK1202049A1 (en) | 2015-09-18 |
| AU2012321102C1 (en) | 2016-11-10 |
| BR112014010091A2 (pt) | 2020-10-27 |
| JP2015501156A (ja) | 2015-01-15 |
| CN104321069A (zh) | 2015-01-28 |
| US10040835B2 (en) | 2018-08-07 |
| KR20140092320A (ko) | 2014-07-23 |
| EP2797613A4 (en) | 2015-09-09 |
| PL2797613T3 (pl) | 2020-06-15 |
| US20160108099A1 (en) | 2016-04-21 |
| EP2797613B1 (en) | 2019-12-04 |
| RU2664673C2 (ru) | 2018-08-21 |
| CN110777124A (zh) | 2020-02-11 |
| EP2797613A2 (en) | 2014-11-05 |
| DK2797613T3 (da) | 2020-03-02 |
| MX354516B (es) | 2018-03-08 |
| US9265813B2 (en) | 2016-02-23 |
| AU2012321102B2 (en) | 2016-07-14 |
| KR102000141B1 (ko) | 2019-07-15 |
| ES2774779T3 (es) | 2020-07-22 |
| RU2014121256A (ru) | 2015-12-10 |
| US20140328821A1 (en) | 2014-11-06 |
| CA2853379A1 (en) | 2013-05-02 |
| WO2013063383A3 (en) | 2013-06-20 |
| MX2014004949A (es) | 2014-09-12 |
| BR112014010091B1 (pt) | 2022-11-08 |
| AU2012321102A1 (en) | 2013-05-16 |
| CA2853379C (en) | 2020-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012321102B2 (en) | Vectors encoding rod-derived cone viability factor | |
| US10836803B2 (en) | Treatment of retinitis pigmentosa | |
| RU2734678C2 (ru) | Генетическая конструкция | |
| WO2018200542A1 (en) | Gene therapy for ocular disorders | |
| EP3589738A1 (en) | Gene therapy for ocular disorders | |
| EP3606944A1 (en) | Treatment of retinitis pigmentosa | |
| US20240342313A1 (en) | Vector encoding rod-derived cone viability factor and human igk signal sequence | |
| HK1202049B (en) | Vectors encoding rod-derived cone viability factor | |
| WO2023213817A1 (en) | Gene therapy for gyrate atrophy of the choroid and retina |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012321102 Country of ref document: AU |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12843778 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2853379 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2014539038 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/004949 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14354415 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 20147011857 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014121256 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012843778 Country of ref document: EP |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12843778 Country of ref document: EP Kind code of ref document: A2 |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014010091 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112014010091 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140428 |