WO2013059649A1 - Engineered microbes and methods for microbial oil production - Google Patents

Engineered microbes and methods for microbial oil production Download PDF

Info

Publication number
WO2013059649A1
WO2013059649A1 PCT/US2012/061101 US2012061101W WO2013059649A1 WO 2013059649 A1 WO2013059649 A1 WO 2013059649A1 US 2012061101 W US2012061101 W US 2012061101W WO 2013059649 A1 WO2013059649 A1 WO 2013059649A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
fatty acid
vol
lipid
culture
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/061101
Other languages
English (en)
French (fr)
Inventor
Gregory Stephanopoulos
Mitchell TAI
Sagar CHAKRABORTY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Massachusetts Institute of Technology
Original Assignee
Massachusetts Institute of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute of Technology filed Critical Massachusetts Institute of Technology
Priority to EP18161442.1A priority Critical patent/EP3388516A1/en
Priority to BR112014009245-1A priority patent/BR112014009245A2/pt
Priority to JP2014537306A priority patent/JP6294827B2/ja
Priority to RU2014119784A priority patent/RU2652875C2/ru
Priority to EP12840947.1A priority patent/EP2768954B1/en
Priority to CN201280060959.3A priority patent/CN104160020A/zh
Priority to KR1020147013207A priority patent/KR102036389B1/ko
Publication of WO2013059649A1 publication Critical patent/WO2013059649A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436Fatty acid esters
    • C12P7/649Biodiesel, i.e. fatty acid alkyl esters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083Miscellaneous (1.14.99)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0097Oxidoreductases (1.) acting on reduced flavodoxin as donor (1.19)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436Fatty acid esters
    • C12P7/6445Glycerides
    • C12P7/6458Glycerides by transesterification, e.g. interesterification, ester interchange, alcoholysis or acidolysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436Fatty acid esters
    • C12P7/6445Glycerides
    • C12P7/6463Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/0102Diacylglycerol O-acyltransferase (2.3.1.20)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/03Oxo-acid-lyases (4.1.3)
    • C12Y401/03006Citrate (pro-3S)-lyase (4.1.3.6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • C12Y114/19001Stearoyl-CoA 9-desaturase (1.14.19.1), i.e. DELTA9-desaturase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/03Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/03008ATP citrate synthase (2.3.3.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y604/00Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01002Acetyl-CoA carboxylase (6.4.1.2)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • Biofuels are an alternative to fossil fuels and may help to alleviate the depletion of easily accessible fossil fuel stocks while avoiding fossil fuel- associated pollution and greenhouse gas emission, thus satisfying a rising demand for affordable energy in a sustainable way.
  • the development of methods and oil-producing organisms suitable for the efficient conversion of carbon sources to lipids is prerequisite for widespread implementation of microbial biofuel production.
  • Microbial oil production by heterotrophic organisms is a most promising path for the cost-effective production of biofuels from renewable resources provided high conversion yields can be achieved.
  • the key to cost-effective microbial oil production from renewable feedstocks is a high carbohydrate to oil conversion yield.
  • Metabolic engineering has emerged as the enabling technology applied to this end and numerous examples exist of successful pathway engineering that markedly improved the performance of microbial biocatalysts in the synthesis of chemical, pharmaceutical and fuel products.
  • Some aspects of this disclosure provide a strategy for microbe engineering that combines the amplification of upstream, metabolite-forming pathways, also referred to herein as "push” metabolic pathways, with a similar increase in the flux of downstream, product- sequestering pathways, also referred to herein as "pull” pathways.
  • Some aspects of this invention provide that a balanced combination of push-and-pull modifications in a microbe results in large carbon flux amplifications into lipid synthesis pathways without significant departures of the concentrations of intermediate metabolites from their homeostatic physiological levels, thus avoiding feedback inhibition of lipid synthesis.
  • Some aspects of this disclosure relate to the recognition that the effects of single- branch modifications, e.g., push-only modifications or pull-only modifications, on conversion efficiency are typically limited because of compensatory regulation of synthesis yield in the cell, and that a concerted modulation of push and pull steps of lipid biosynthesis in microbial cells results in a surprising synergistic effect on lipid production.
  • single- branch modifications e.g., push-only modifications or pull-only modifications
  • a microbe provided herein comprises a modification effecting an increased production of metabolites or intermediates required for lipid synthesis and a modification resulting in sequestration of a product of lipid synthesis, for example, of triacylglycerol into a storage form lipid within the cell, thus alleviating feedback inhibition of lipid synthesis by some of its products, e.g., by fatty acids or diacylglycerols.
  • the combination of modifications of the metabolic push and metabolic pull pathways results in a synergistically increased lipid production.
  • the push modification results in an increased level of lipid-synthesis building blocks, or metabolites for lipid synthesis, in the cell.
  • the pull modification alleviates feedback inhibition on lipid synthesis.
  • Some aspects of this invention provide microbes that comprise genetic modifications simultaneously affecting a push- and a pull pathway of lipid biosynthesis.
  • push and pull modifications were introduced into a model microbe for oil production, the oleaginous yeast Yarrowia lipolytica.
  • DGA1 overexpression resulted in a 4-fold increase in lipid production over control microbes, to a lipid content of 33.8% of dry cell weight (DCW).
  • DCW dry cell weight
  • ACC1 acetyl-CoA carboxylase
  • ACC1 overexpression increased lipid content 2-fold over control, to a lipid content of 17.9%.
  • Simultaneous coexpression of ACC1 and DGA1 from a tandem gene expression construct was investigated as an exemplary push-pull modification.
  • Simultaneous ACC1 and DGA1 overexpression further increased lipid content to 41.4%, demonstrating synergistic effects of ACC1 + DGA1 coexpression.
  • the lipid production characteristics of the ACC1 + DGA1 transformant were explored in a 2-L bioreactor fermentation, achieving 61.7% lipid content after 120 hr.
  • the overall yield and productivity were 0.195 g/g and 0.143 g/L/hr, respectively, while the maximum yield and productivity were 0.270 g/g and 0.253 g/L/hr during the lipid accumulation phase of the fermentation.
  • This work demonstrates the excellent capacity for lipid production by the oleaginous yeast Y. lipolytica and the effects of metabolic engineering of two important steps of the lipid synthesis pathway, which acts to divert flux towards the lipid synthesis and creates driving force for TAG synthesis.
  • Some aspects of this invention provide a novel overexpression platform for use in oil- producing microbes, for example, in oleaginous yeast.
  • Some aspects of this invention provide expression constructs comprising a promoter driving transcription of a transcript that comprises a coding sequence and an intron, for example, a translation elongation factor- la (TEF) promoter positioned upstream of a nucleic acid sequence comprising an intron and a coding sequence.
  • TEF translation elongation factor- la
  • Some aspects of this disclosure provide an isolated oleaginous cell comprising a genetic modification that increases expression of a DGA1 gene product.
  • the isolated oleaginous cell further comprises a genetic modification that increases expression of an ACC1 gene product. In some embodiments, the isolated oleaginous cell further comprises a genetic modification that increases expression of an SCD gene product. In some embodiments, the isolated oleaginous cell further comprises a genetic modification that increases expression of an ACL gene product. In some embodiments, the genetic modification comprises a nucleic acid construct that increases the expression of the gene product, the nucleic acid construct comprising (a) an expression cassette comprising a nucleic acid sequence encoding the gene product under the control of a suitable homologous or heterologous promoter, and/or (b) a nucleic acid sequence that modulates the level of expression of the gene product when inserted into the genome of the cell. In some
  • the promoter is an inducible or a constitutive promoter. In some embodiments, the promoter is a TEF promoter. In some embodiments, the expression construct further comprises an intron. In some embodiments, the intron is downstream of the transcription initiation site. In some embodiments, the intron is within the nucleic acid sequence encoding the gene product. In some embodiments, the nucleic acid construct inhibits or disrupts the natural regulation of a native gene encoding the gene product resulting in overexpression of the native gene. In some embodiments, inhibition or disruption of the natural regulation of the native gene is mediated by deletion, disruption, mutation and/or substitution of a regulatory region, or a part of a regulatory region regulating expression of the gene.
  • the gene product is a transcript. In some embodiments, the gene product is a protein. In some embodiments, the nucleic acid construct is inserted into the genome of the cell. In some embodiments, the increased expression of the gene product confers a beneficial phenotype for the conversion of a carbon source to a lipid, e.g., a fatty acid, fatty acid derivative and/or triacylglycerol (TAG) to the cell.
  • a lipid e.g., a fatty acid, fatty acid derivative and/or triacylglycerol (TAG)
  • the beneficial phenotype comprises a modified fatty acid profile, a modified TAG profile, an increased fatty acid and/or triacylglycerol synthesis rate, an increase conversion yield, an increased triacylglycerol accumulation in the cell, and/or an increased triacylglycerol accumulation in a lipid body of the cell.
  • the synthesis rate of a fatty acid or a TAG of the cell is at least 2-fold increased as compared to unmodified cells of the same cell type.
  • the synthesis rate of a fatty acid or a TAG of the cell is at least 5-fold increased as compared to unmodified cells of the same cell type.
  • the synthesis rate of a fatty acid or a TAG of the cell is at least 10-fold increased as compared to unmodified cells of the same cell type.
  • the cell converts a carbon source to a fatty acid or a TAG at a conversion rate within the range of about 0.025g/g to about 0.32g/g (e.g., g lipid produced/ g carbon source consumed).
  • the cell converts a carbon source to a fatty acid or a TAG at a conversion rate of at least about 0.1 lg/g.
  • the cell converts a carbon source to a fatty acid or a TAG at a conversion rate of at least about 0.195g/g.
  • the cell converts a carbon source to a fatty acid or a TAG at a conversion rate of at least about 0.24g/g. In some embodiments, the cell converts a carbon source to a fatty acid or a TAG at a conversion rate of at least about 0.27 g/g. In some embodiments, the cell comprises a lipid body or vacuole. In some embodiments, the cell is a bacterial cell, an algal cell, a fungal cell, or a yeast cell. In some embodiments, the cell is an oleaginous yeast cell. In some embodiments, the cell is a Y. Upolytica cell.
  • the culture further comprises a carbon source.
  • the carbon source comprises a fermentable sugar.
  • the fermentable sugar is a C6 sugar.
  • the carbon source comprises glucose.
  • the carbon source comprises an organic acid.
  • the organic acid is acetic acid.
  • the acetic acid is at a concentration of at least 5% vol/vol, at least 10% vol/vol, at least 15% vol/vol, at least 20% vol/vol, at least 25% vol/vol, or at least 30% vol/vol.
  • the carbon source comprises acetate. In some embodiments, the acetate is at a concentration of at least 1% vol/vol. In some embodiments, the acetate is at a concentration of at least 2% vol/vol. In some embodiments, the acetate is at a concentration of at least 3% vol/vol. In some embodiments, the acetate is at a concentration of at least 4% vol/vol. In some embodiments, the acetate is at a concentration of at least 5% vol/vol. In some embodiments, the culture comprises glycerol. In some embodiments, the glycerol is at a concentration of about 2% vol/vol.
  • the culture comprises a dissolved oxygen level of at least 5%, at least 10%, at least 15%, or at least 20%. In some embodiments, the culture exhibits a pH within the range of pH7.0 to pH7.5. In some embodiments, the culture comprises ammonium sulfate. In some embodiments, the culture comprises ammonium sulfate and acetic acid at a ratio of 1 :2. In some embodiments, the culture exhibits a lipid titer between 5 g/1 and 60 g/1. In some embodiments, the culture exhibits a lipid production between 0.04 g/l/h and 0.60 g/l/h. In some embodiments, the culture exhibits a maximum lipid productivity of between 0.1 g/l/h and 1 g/l/h.
  • Some aspects of this disclosure provide a method comprising contacting a carbon source with an isolated oleaginous cell, the cell comprising a genetic modification that increases expression of a DGA1 gene product; and incubating the carbon source contacted with the cell under conditions suitable for at least partial conversion of the carbon source into a fatty acid or a triacylglycerol by the cell.
  • the oleaginous cell further comprises a genetic modification that increases expression of an ACC1 gene product.
  • the oleaginous cell further comprises a genetic modification that increases expression of an SCD gene product.
  • the oleaginous cell further comprises a genetic modification that increases expression of an ACL gene product.
  • the isolated oleaginous cell is an engineered isolated oleaginous cell as described herein.
  • the carbon source comprises a fermentable sugar.
  • the carbon source comprises glucose.
  • the carbon source comprises acetate.
  • the acetate is at a concentration of at least 1% vol/vol, of at least 2% vol/vol, of at least 3% vol/vol, of at least 4% vol/vol, or of at least 5% vol/vol.
  • the carbon source comprises acetic acid.
  • the acetic acid is at a concentration of at least 5% vol/vol, at least 10% vol/vol, at least 15% vol/vol, at least 20% vol/vol, at least 25% vol/vol, or at least 30% vol/vol.
  • the method comprises contacting the cell with dissolved oxygen at a level of at least 5%, at least 10%, at least 15%, or at least 20%.
  • the contacting and/or the incubating is performed at a pH within the range of pH7.0 to pH7.5. 70. The method of any one of claims 53-69, wherein the method comprises contacting the cell with ammonium sulfate.
  • the method comprises contacting the cell with ammonium sulfate and acetic acid at a ratio of 1:2. In some embodiments, the method further comprises contacting the cells with glycerol. In some embodiments, the method comprises contacting the cells with glycerol at a concentration of about 2% vol/vol. In some embodiments, the carbon source contacted with the isolated oleaginous cell is incubated in a reactor. In some embodiments, the carbon source is contacted with the isolated oleaginous cell and incubated for conversion of the carbon source to a fatty acid or a triacylglycerol in a fed batch process.
  • the carbon source is contacted with the isolated oleaginous cell and incubated for conversion of the carbon source to a fatty acid or a triacylglycerol in a continuous process.
  • the method further comprises contacting an additional amount of the carbon source or an amount of an additional carbon source with the carbon source contacted with the isolated oleaginous cell one or more times during the incubating step.
  • the fatty acid or the triacylglycerol is extracted from the carbon source contacted with the isolated oleaginous cell by solvent extraction.
  • the solvent extraction comprises a chloroform methanol extraction.
  • the solvent extraction comprises a hexane extraction.
  • the fatty acid or the triacylglycerol is separated from the carbon source contacted with the isolated oleaginous cell and subsequently refined by transesterification.
  • Some aspects of this disclosure provide a method comprising modifying the fatty acid profile, the triacylglycerol profile, the fatty acid synthesis rate, the triacylglycerol synthesis rate, the extent of fatty acid derivative accumulation, the rate of fatty acid derivative secretion, the rate of carbohydrate to fatty acid or fatty acid derivative conversion, and/or the efficient yield of carbohydrate to fatty acid or fatty acid derivative conversion in an oleaginous cell by increasing in the cell the expression of a DGA1 gene product.
  • the method further comprises increasing in the cell the expression of an ACC1 gene product, of an SCD gene product, and/or of an ACL gene product.
  • the extent of fatty acid derivative accumulation is the extent of fatty acid derivative accumulation in a lipid body.
  • the fatty acid derivative is a triacylglycerol.
  • modifying the fatty acid profile, the triacylglycerol profile, the fatty acid synthesis rate, the triacylglycerol synthesis rate, the extent of fatty acid derivative accumulation, the rate of fatty acid derivative secretion, the rate of carbohydrate to fatty acid or fatty acid derivative conversion, and/or the efficient yield of carbohydrate to fatty acid or fatty acid derivative conversion in the oleaginous cell comprises increasing the fatty acid synthesis rate, the triacylglycerol synthesis rate, the extent of fatty acid derivative accumulation, the rate of fatty acid derivative secretion, the rate of carbohydrate to fatty acid or fatty acid derivative conversion, and/or the efficient yield of carbohydrate to fatty acid or fatty acid derivative conversion in the oleaginous cell.
  • modifying the efficiency of carbohydrate to fatty acid or fatty acid derivative conversion of the cell comprises increasing the efficiency of conversion by at least 2-fold. In some embodiments, modifying the efficiency of carbohydrate to fatty acid or fatty acid derivative conversion of the cell comprises increasing the efficiency of conversion by at least 3-fold. In some embodiments, modifying the efficiency of carbohydrate to fatty acid or fatty acid derivative conversion of the cell comprises increasing the efficiency of conversion by at least 4-fold. In some embodiments, modifying the efficiency of carbohydrate to fatty acid or fatty acid derivative conversion of the cell comprises increasing the efficiency of conversion by at least 5-fold. In some embodiments, the cell is a yeast cell. In some embodiments, the yeast cell is a Yarrowia sp. cell. In some embodiments, the oleaginous yeast is Y. lipolytica.
  • Some aspects of this disclosure provide an isolated nucleic acid molecule comprising: a) a nucleotide sequence that encodes SEQ ID NO: 2 (Y. lipolytica DGAl), or b) a nucleotide sequence that is at least 85% identical to the nucleotide sequence of a).
  • the nucleotide sequence that encodes SEQ ID NO:2 comprises SEQ ID NO: 1.
  • Some aspects of this disclosure provide an expression cassette comprising an isolated nucleic acid molecule as described herein and a heterologous promoter.
  • the promoter is a constitutive promoter or an inducible promoter.
  • the heterologous promoter is a Translation Elongation Factor (TEF) promoter.
  • the heterologous promoter comprises an intron.
  • the heterologous promoter further comprises a start codon.
  • the intron is downstream of the translation start site of the nucleotide sequence that encodes SEQ ID NO: 2.
  • the subject matter of this application may involve, in some cases, interrelated products, alternative solutions to a particular problem, and/or a plurality of different uses of a single system or article.
  • Figure 1 Overview of the principal metabolic pathways for lipid synthesis in Y. lipolytica.
  • Figure 2. Enzyme activity of ⁇ -galactosidase under different promoters after 50 hours of culture.
  • Figure 6. Fatty acid production by ACC +DGA1 Y. lipolytica on acetate.
  • Figure 7. Combinatorial expression construction scheme. Cloning path and strategy for construction of plasmids containing a combination of lipid accumulation gene targets. These plasmids were then transformed into Y. lipolytica for study of lipid accumulation.
  • FIG. 9 Relative lipid productivity and yield among Y. lipolytica strains expressing combinatorial constructs, as measured by total fatty acid content normalized to the control strain. The presence (+) or absence (-) of a transformed overexpression cassette for the corresponding gene target are indicated below the graph.
  • the productivity (light grey bars) was calculated as relative lipid accumulation within the first 100 hours of culture. Yield calculations were made by dividing lipid accumulation by sugar consumed. The C/N ratio of the media was 20. Results are averaged values across multiple experiments.
  • FIG. 10 Transcriptional expression of target genes in the strain MTYL089. Expression is internally normalized to actin expression, and compared against a control (MTYL038) strain and was taken after 66 hours of growth.
  • FIG. 12 Microscopy of strain MTYL089 at the end of 2-L fermentation. Normal light microscopy (image left) shows that a majority of the cells are in the yeast form, and contain large vacuoles. Fluorescence microscopy (image right) indicates that these vacuoles are composed of neutral lipids.
  • Figure 15 Trends of lipid titer (g/L), lipid content (%) and C/N ratio. Primary axis shows lipid titer and lipid content as % of dry cell weight. Secondary axis shows C/N ratio. C/N ratio drops at the end due to the rapid consumption of acetate.
  • Biodiesel, jet oil and other oil- derived fuels in particular are necessary for aviation and heavy vehicle transport. They are presently produced exclusively from vegetable oils, which is a costly and unsustainable path(2).
  • An attractive possibility is the non-photo synthetic conversion of renewable carbohydrate feedstocks to oil(J).
  • biodiesel a transition from vegetable oil to microbial oil production for the oil feedstock presents numerous additional advantages: adaptability to diverse feedstocks, flexibility in land requirements, efficient process cycle turnover, and ease of scale-up(4).
  • the biological platforms for microbial production are also more genetically tractable for further optimization.
  • the oleaginous yeast Yarrowia lipolytica is an attractive candidate for microbial oil production, which has also demonstrated usefulness in a wide range of other industrial applications: citric acid production, protein production (e.g., proteases and lipases), and bioremediation (8-10). With a fully sequenced genome and a growing body of genetic engineering tools, engineering of Y. lipolytica can be achieved with relative ease (11).
  • Y. lipolytica also has been found to be robust in culture, able to grow on a variety of substrates, and has been used for lipid production on agro-industrial residues, industrial glycerol, and industrial fats (12-14). It has excellent lipid accumulation capacity, commonly accumulating up to 36% of its dry cell weight (DCW) in lipids (15).
  • DCW dry cell weight
  • Glucose entering glycolysis enters the mitochondria as pyruvate for use in the TCA cycle; however, excess acetyl-coA is transported from the mitochondria to the cytosol via the citrate shuttle. Cytosolic acetyl-CoA is then converted into malonyl-CoA by acetyl-CoA carboxylase (ACC) as the first step of fatty acid synthesis.
  • ACC acetyl-CoA carboxylase
  • TAG triacylglycerol
  • Acyl-CoA is the precursor used for acylation to the glycerol- 3 -phosphate backbone to form lysophosphatidic acid (LPA), which is further acylated to form
  • PA phosphatidic acid
  • DAG diacylglycerol
  • DGA diacylglycerol acyltransferase
  • Transport of acetyl-CoA from the mitochondria to the cytosol is carried out by the ATP-citrate lyase (ACL) -mediated cleavage of citrate via the citrate shuttle yielding Acetyl- CoA and Oxaloacetate (OAA).
  • ACL ATP-citrate lyase
  • OAA Oxaloacetate
  • Acetyl-CoA carboxylase (ACC) then catalyzes the first committed step towards lipid biosynthesis, converting cytosolic acetyl-CoA into malonyl- CoA, which is the primary precursor for fatty acid elongation.
  • Completed fatty acyl-CoA chains are then transported to the endoplasmic reticulum (ER) or lipid body membranes for the final assembly of triacylglycerol (TAG) via the Kennedy pathway.
  • ER endoplasmic reticulum
  • TAG triacylglycerol
  • Y. lipolytica Over 80% of the storage lipids produced in Y. lipolytica are in the form of TAG (16). Cytosolic OAA is converted to malate by malic dehydrogenase and transported back into the mitochondria to complete the citrate shuttle cycle. Reducing equivalents in the form of NADPH is provided either by the pentose phosphate pathway or by malic enzyme in the transhydrogenase cycle. In Y. lipolytica, high PPP flux and ineffectual malic enzyme overexpression suggest that the former is the primary source for NADPH (4, 17).
  • Intracellular lipid accumulation can occur via two methods: de novo lipid synthesis or ex novo incorporation of exogenous fatty acids and lipids.
  • Lipid accumulation most commonly occurs when nutrient supply is exhausted in the presence of excess carbon. In culture, this state typically coincides with the onset of the stationary phase. In practice, the most commonly used limiting-nutrient is nitrogen, as it is easily controllable in media compositions (15).
  • lipid synthesis pathways are highly regulated in order for the organism to balance cell growth with energy storage. For example, ACC alone is regulated at multiple levels and by multiple factors (7).
  • Y. lipolytica was able to achieve 40 -70 lipids through ex novo lipid accumulation (18, 19).
  • Coexpression of ⁇ 6- and ⁇ 12- desaturase genes allowed for significant production of ⁇ -linolenic acid (GLA) (20).
  • GLA ⁇ -linolenic acid
  • biofuel refers to a fuel that is derived from a biological source, such as a living cell, microbe, fungus, or plant.
  • the term includes, for example, fuel directly obtained from a biological source, for example, by conventional extraction, distillation, or refining methods, and fuel produced by processing a biofuel precursor obtained from a biological source, for example by chemical modification, such as transesterification procedures.
  • biofuels that are directly obtainable are alcohols such as ethanol, propanol, and butanol, fat, and oil.
  • biofuels that are obtained by processing of a biofuel precursor e.g., a lipid
  • biodiesel e.g., produced by
  • Biodiesel also referred to as fatty acid methyl (or ethyl) ester
  • fatty acid methyl (or ethyl) ester is one of the economically most important biofuels today and can be produced on an industrial scale by transesterification of lipids, in which sodium hydroxide and methanol (or ethanol) reacts with a lipid, for example, a triacylglycerol, to produce biodiesel and glycerol.
  • Feedstocks for industrial- scale production of biodiesel include animal fats, vegetable oils, palm oil, hemp, soy, rapeseed, flax, sunflower, and oleaginous algae.
  • biomass is converted by a microbe into a biofuel precursor, for example, a lipid, that is subsequently extracted and further processed to yield a biofuel.
  • biomass refers to material produced by growth and/or propagation of a living cell or organism, for example, a microbe. Biomass may contain cells, microbes and/or intracellular contents, for example cellular fatty acids and TAGS, as well as extracellular material.
  • Extracellular material includes, but is not limited to, compounds secreted by a cell, for example, secreted fatty acids or TAGs.
  • Important types of biomass for biofuel production are algal biomass and plant-derived biomass, for example, corn stover and wood fiber.
  • biomass for biofuel or biofuel precursor production may comprise plant derived sugars, for example, sugarcane or corn derived sugars.
  • lipid refers to fatty acids and their derivatives. Accordingly, examples of lipids include fatty acids (FA, both saturated and unsaturated); glycerides or glycerolipids, also referred to as acylglycerols (such as monoglycerides (monoacylgycerols), diglycerides (diacylglycerols), triglycerides (triacylglycerols, TAGs, or neutral fats);
  • FA saturated and unsaturated
  • acylglycerols such as monoglycerides (monoacylgycerols), diglycerides (diacylglycerols), triglycerides (triacylglycerols, TAGs, or neutral fats
  • phosphoglycerides glycerophospholipids
  • nonglycerides sphingolipids, sterol lipids, including cholesterol and steroid hormones, prenol lipids including terpenoids, fatty alcohols, waxes, and polyketides
  • complex lipid derivatives sucgar-linked lipids or glycolipids, and protein-linked lipids.
  • Lipids are an essential part of the plasma membrane of living cells and microbes. Some cells and microbes also produce lipids to store energy, for example in the form of triacylglycerols in lipid bodies, lipid droplets, or vacuoles.
  • lipid metabolism refers to the molecular processes that involve the creation or degradation of lipids. Fatty acid synthesis, fatty acid oxidation, fatty acid desaturation, TAG synthesis, TAG storage and TAG degradation are examples of processes that are part of the lipid metabolism of a cell.
  • fatty acid metabolism refers to all cellular or organismic processes that involve the synthesis, creation, transformation or degradation of fatty acids.
  • Fatty acid synthesis, fatty acid oxidation, TAG synthesis, and TAG degradation are examples of processes are part of the fatty acid metabolism of a cell.
  • triacylglycerol (TAG, sometimes also referred to as triglyceride) refers to a molecule comprising a single molecule of glycerol covalently bound to three fatty acid molecules, aliphatic monocarboxylic acids, via ester bonds, one on each of the glycerol molecule's three hydroxyl (OH) groups.
  • Triacylglycerols are highly concentrated stores of metabolic energy because of their reduced, anhydrous nature, and are a suitable feedstock for biodiesel production. Many cells and organisms store metabolic energy in the form of fatty acids and fatty acid derivatives, such as TAGs. Fatty acids and their derivatives, such as TAGs, provide an ideal form to store metabolic energy.
  • microbes can derive fatty acids from external supply, endogenous turnover, and de novo synthesis. Some aspects of this invention relate to the identification of a microbe for biofuel or biofuel precursor production based on the microbe's ability to synthesize and store fatty acids or fatty acid derivatives, such as TAGs, efficiently from an externally supplied carbon source.
  • Natural fatty acid molecules commonly have an unbranched, aliphatic chain, or tail, of 4 to 28 carbon atoms. Fatty acids are referred to as “saturated”, if all carbon atoms of the aliphatic chain are connected via a C-C single bond, or as “unsaturated”, if two or more carbon atoms are connected via a C-C double bond. Unsaturated fatty acids play important roles in the regulation of membrane fluidity, cellular activity, metabolism and nuclear events governing gene transcription.
  • Palmitic acid is an unbranched, saturated fatty acid, with an aliphatic chain of 16 carbon atoms (carbon atoms/unsaturated bonds: 16.0).
  • Stearic acid is an unbranched, saturated fatty acid with an aliphatic chain of 18 carbon atoms (18.0).
  • Palmitoleic acid is a monounsaturated fatty acid with an aliphatic chain of 16 carbon atoms (16.1).
  • Oleic acid is a monounsaturated fatty acid with an aliphatic chain of 18 carbon atoms (18.1).
  • Minor fatty acid species in yeast include C14 and C26 fatty acids, which play essential functions in protein modification or as components of sphingolipids and GPI anchors, respectively.
  • fatty acids utilizes substantial amounts of metabolites, acetyl- CoA, ATP and NADPH, and thus competes with other cellular processes that are dependent on these compounds.
  • NADPH is required for two reduction steps in the fatty acid elongation cycle, linking fatty acid synthesis to the metabolic state of the cell and results in fatty acid synthesis being restricted to conditions of high energy load of the cells, indicated by increased ATP/ AMP ratio, elevated reduction equivalents and elevated acetyl-CoA pool.
  • Almost all subcellular organelles are involved in fatty acid metabolism, indicating that maintenance of fatty acid homeostasis requires regulation at multiple levels.
  • Lipid synthesis steps that generate metabolites, acetyl-CoA, ATP, or NADPH for lipid biosynthesis are sometimes referred to herein as "push steps” of lipid synthesis.
  • the amplification of a process that increases the production of a metabolites, acetyl-CoA, ATP, or NADPH for lipid synthesis in a cell, for example, by overexpressing a gene product mediating such a metabolite-producing process, is sometimes referred to herein as a "push modification.”
  • acetyl-CoA is carboxylated by the addition of C0 2 to malonyl-CoA, by the enzyme acetyl-CoA carboxylase (ACC; encoded by ACC1 and HFA1 in yeast).
  • ACC acetyl-CoA carboxylase
  • Biotin is an essential cofactor in this reaction, and is covalently attached to the ACC apoprotein, by the enzyme biotin:apoprotein ligase (encoded by BPL1/ACC2 in yeast).
  • ACC is a trifunctional enzyme, harboring a biotin carboxyl carrier protein (BCCP) domain, a biotin-carboxylase (BC) domain, and a carboxyl-transferase (CT) domain. In most bacteria, these domains are expressed as individual polypeptides and assembled into a heteromeric complex. In contrast, eukaryotic ACC, including mitochondrial ACC variants (Hfal in yeast) harbor these functions on a single polypeptide. Malonyl-CoA produced by ACC serves as a two carbon donor in a cyclic series of reactions catalyzed by fatty acid synthase, FAS, and elongases.
  • BCCP biotin carboxyl carrier protein
  • BC biotin-carboxylase
  • CT carboxyl-transferase
  • Saturated fatty acids are known to be the precursors of unsaturated fatty acids in eukaryotes, including yeast.
  • Unsaturated fatty acids are generally produced by desaturation of C-C single bonds in saturated fatty acids by specialized enzymes, called desaturases.
  • the control mechanisms that govern the conversion of saturated fatty acids to unsaturated fatty acids are not well understood.
  • unsaturated fatty acids play important roles in the regulation of membrane fluidity, cellular activity, metabolism and nuclear events that govern gene transcription.
  • yeast fatty acids are monounsaturated, meaning that they contain one unsaturated bond in their aliphatic chain.
  • Fatty acids are potent inhibitors of fatty acid synthesis and the feedback inhibition of fatty acid synthesis by fatty acids is a major obstacle in engineering microbes for oil production.
  • Some aspects of this disclosure are based on the recognition that while push modifications of lipid synthesis are typically unable to override fatty acid-mediated feedback inhibition of lipid synthesis, a combination of a push modification (e.g., ACC1 overexpression) with a pull modification (e.g., DGAl overexpression), can efficiently bypass the feedback inhibition, thus fully realizing the increased carbon flux to the lipid synthesis pathway, for example, in TGAs stored in a lipid body or vacuole of the cell.
  • a push modification e.g., ACC1 overexpression
  • a pull modification e.g., DGAl overexpression
  • Some aspects of this disclosure provide strategies for engineering microbes for oil production.
  • such strategies employ genetic engineering of oleaginous microbes, for example, Y. lipolytica, to simultaneously amplify a push- and a pull-step of lipid synthesis.
  • oleaginous microbes for example, Y. lipolytica
  • significant increases of lipid production in oleaginous yeast host cells were achieved using these strategies.
  • Some aspects of this disclosure are based on the recognition that push-an-pull modifications, for example, simultaneous amplification of metabolic steps that produce metabolites for lipid synthesis pathways and of metabolic steps that sequester synthesis products mediating feedback inhibition of lipid synthesis, result in a significant increase of carbon flux into lipid synthesis pathways as compared to the engineering of push-only or pull-only modifications.
  • Some aspects of this invention relate to the surprising discovery that the overexpression of a DGAl gene product in an oleaginous microbe, for example, Yarrowia lipolytica, results in a marked increase in carbon flux into lipid synthesis pathways, and that simultaneous overexpression of an ACC1 gene product synergizes with DGAl
  • lipolytica in a way that confers highly desirable phenotypes for industrial-scale carbohydrate to biofuel or biofuel precursor conversion, such as remarkable increases in fatty acid synthesis, TAG synthesis, and fatty acid and TAG storage in lipid bodies or vacuoles.
  • modifying the lipid metabolism in a microbe in accordance with methods provided herein, for example by simultaneously overexpressing a gene product mediating a metabolite-generating (push) step and a gene product mediating a product-sequestering (pull) step of lipid synthesis allows for the generation of a microbe optimized for use in biofuel or biofuel precursor production processes.
  • Some aspects of this invention provide strategies and methods for engineering the fatty acid metabolism in a microbe by simultaneously amplifying a push step and a pull step of lipid biosynthesis, resulting in increased synthesis rate and accumulation of fatty acids and fatty acid derivatives in the microbe.
  • Some aspects of this invention provide methods that include genetic modifications resulting in the modulation of the expression and/or activity of gene products regulating the lipid metabolism of microbes for biofuel or biofuel precursor production. Such genetic modifications according to some aspects of this invention are targeted to increase
  • modifications provided according to some aspects of this invention for example, overexpression, knockout, knock-down, activation and/or inhibition of specific gene products, may be effected alone or in combination, and/or in combination with other modifications known to those of skill in the art.
  • modification refers to both genetic manipulation, for example, overexpression, knockout, knock-down, activation and/or inhibition of specific gene products, and non-genetic manipulation, for example,
  • a modification of gene expression can be a disruption or inhibition of the natural regulation of expression, an overexpression, an inhibition of expression, or a complete abolishment of expression of a given gene.
  • the insertion of a heterologous promoter upstream of a native gene sequence, for example the native DGA1 or ACC1 gene sequence, or the deletion of regulatory sequences within a promoter, for example regulatory sequences that mediate the feedback inhibition of the DGA1 or ACC1 gene by saturated fatty acids, are examples of a disruption or inhibition of the natural regulation of expression.
  • Strategies for the modulation of gene expression may include genetic alterations, for example by recombinant technologies, such as gene targeting or viral transductions, or non-genetic alterations, for example environmental alterations known to result in the up- or down-regulation of gene expression, or transient delivery of modulators, for example drugs or small RNA molecules to the target cells.
  • Methods for genetic and non-genetic alterations of microbes are well known to those of skill in the art, and are described, for example, in J. Sambrook and D. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd edition (January 15, 2001); David C. Amberg, Daniel J. Burke; and Jeffrey N.
  • overexpression refers to an increased level of expression of a given gene product in a given cell, cell type or cell state, as compared to a reference cell, for example, a wild type cell of the same cell type or a cell of the same cell type but lacking a specific modification, for example, a genetic modification. Forced, continuous expression of the DGA1 and/or ACC1 gene in Y. lipolytica cells exhibiting concentrations of saturated fatty acids that would inhibit DGA1 or ACC1 gene expression in wild- type cells is an example of gene overexpression.
  • Some aspects of this invention provide a method for the manipulation of the activity of a diacylglycerol acyltransferase 1 (DGA1) gene product in a microbe for biofuel or biofuel precursor production.
  • the DGA1 gene encodes an acyltransferase that catalyzes the terminal step of triacylglycerol (TAG) formation, acylating diacylglycerol using acyl-CoA as an acyl donor.
  • TAGs triacylglycerols, which do not exhibit the same inhibitory feedback effect on fatty acid synthesis as fatty acids themselves.
  • TAGs are typically stored in lipid bodies or vacuoles in lipid producing cells.
  • the manipulation is an overexpression.
  • the manipulation is effected by contacting a microbe for biofuel or biofuel precursor production with an expression construct comprising a nucleic acid coding for a DGA1 gene product, for example, a DGAT2 protein, operably linked to a heterologous promoter, for example, a constitutive or an inducible promoter.
  • the nucleic acid coding for a DGA1 gene product comprises the coding sequence of SEQ ID NO: 1.
  • the DGA1 is Y. lipolytica DGA1, for example, Y. lipolytica DGA1 comprising the amino acid sequence of SEQ ID NO: 2.
  • the microbe is Y.
  • manipulation of the activity of a DGA1 gene product in a microbe is effected to confer a beneficial phenotype for large-scale carbohydrate to lipid conversion, for example increased lipid synthesis rate, increased carbohydrate to lipid conversion efficiency, increased lipid storage and, increased growth rate, increased tolerance to elevated concentrations of a carbon source or a lipid product.
  • DGA1 gene and gene product sequences are well known to those of skill in the art. Exemplary, representative gene and gene product sequences can be found under entry XM_504700 in the NCBI database (www . ncbi .nlm. nih . go v) .
  • Non-limiting examples of suitable sequences of DGA1 nucleic acid and protein sequences are provided below. Additional suitable DGA1 sequences, including sequences from other species, will be apparent to those of skill in the art, and the invention is not limited in this respect.
  • Some aspects of this invention provide a method for the manipulation of an acetyl- CoA carboxylase (ACC) gene product in a microbe for biofuel or biofuel precursor production, for example, in Y. lipolytica.
  • ACC gene products mediate the conversion of acetyl-CoA, the main C2 -precursor in fatty acid synthesis, to malonyl-CoA, which is considered the first committed step in fatty acid synthesis and has been suggested to also be the rate-limiting step in fatty acid synthesis (see Cao Y, Yang J, Xian M, Xu X, Liu W. Increasing unsaturated fatty acid contents in Escherichia coli by coexpression of three different genes.
  • ACC activity manipulation is ACC overexpression.
  • the manipulation is effected by contacting a microbe for biofuel or biofuel precursor production with an expression construct comprising a nucleic acid coding for an ACC gene product, for example, an ACC1 protein, operably linked to a heterologous promoter, for example, a constitutive or an inducible promoter.
  • the nucleic acid coding for an ACC gene product comprises the coding sequence of SEQ ID NO: 3.
  • the ACC gene product is an ACC1 protein comprising the amino acid sequence of SEQ ID NO: 4.
  • ACC overexpression in a microbe increases fatty acid synthesis rate and/or confers a beneficial phenotype for large-scale carbohydrate to biofuel or biofuel precursor conversion, for example increased lipid synthesis rate, increased carbohydrate to lipid conversion efficiency, increased lipid storage and, increased growth rate, increased tolerance to concentrations of a substance, e.g. a carbon source, a biofuel or biofuel precursor, or a toxic substance.
  • ACC gene and gene product sequences are well known to those of skill in the art. Exemplary, representative gene and gene product sequences can be found under the entry for GenelDs: 855750 and 2909424, or under the entry NC_006069 in the NCBI database (www.ncbi.nlm.nih.gov).
  • Non-limiting examples of suitable sequences of ACC nucleic acid and protein sequences are provided below. Additional suitable ACC sequences, including sequences from other species, will be apparent to those of skill in the art, and the invention is not limited in this respect.
  • SCD stearoyl-CoA-desaturase
  • SCD is a ⁇ 9 desaturase that inserts a double bond between C9 and CIO of stearic acid coupled to CoA, a key step in the generation of desaturated fatty acids and their derivatives, as described in more detail elsewhere herein.
  • the manipulation is an overexpression.
  • the manipulation is effected by contacting a microbe for biofuel or biofuel precursor production with an expression construct comprising a nucleic acid coding for a SCD gene product, for example, a SCD protein, operably linked to a heterologous promoter, for example, a constitutive or an inducible promoter.
  • the nucleic acid coding for an SCD gene product comprises the coding sequence of SEQ ID NO: 5.
  • the SCD is Y. lipolytica SCD, for example, Y. lipolytica SCD comprising the amino acid sequence of SEQ ID NO: 6.
  • the microbe is Y. lipolytica.
  • manipulation of the activity of a SCD in a microbe is effected to confer a beneficial phenotype for large-scale
  • carbohydrate to lipid conversion for example increased lipid synthesis rate, increased carbohydrate to lipid conversion efficiency, increased lipid storage and, increased growth rate, increased tolerance to elevated concentrations of a carbon source or a lipid product.
  • Stearoyl-CoA Desaturase gene and gene product sequences are well known to those of skill in the art. Exemplary, representative gene and gene product sequences can be found under the entry for GenelD: 852825 in the NCBI database (www.ncbi.nlm.nih.gov).
  • Non-limiting examples of suitable sequences of SCD nucleic acid and protein sequences are provided below. Additional suitable SCD sequences, including sequences from other species, will be apparent to those of skill in the art, and the invention is not limited in this respect.
  • Some aspects of this invention provide a method for the manipulation of the activity of an ATP-citrate lyase (ACL) in a microbe for biofuel or biofuel precursor production.
  • ACL provides cytosolic acetyl-CoA by cleaving citrate which is shuttled out of the mitochondria as a product of the TCA cycle.
  • an ACL gene product is a protein composed of two subunits encoded by separate genes. In some embodiments, an ACL gene product is composed of two subunits encoded by the same gene. In some embodiments, the
  • the manipulation is an overexpression.
  • the manipulation is effected by contacting a microbe for biofuel or biofuel precursor production with an expression construct comprising a nucleic acid coding for an ACL gene product, for example, an ACL protein, operably linked to a heterologous promoter, for example, a constitutive or an inducible promoter.
  • the nucleic acid coding for an ACL gene product comprises the coding sequences of SEQ ID NO: 7 and SEQ ID NO: 9.
  • the ACL is Y. lipolytica ACL, for example, Y. lipolytica ACL comprising the amino acid sequences of SEQ ID NO: 8 and SEQ ID NO: 10.
  • the microbe is Y.
  • manipulation of the activity of a ACL in a microbe is effected to confer a beneficial phenotype for large-scale carbohydrate to lipid conversion, for example increased lipid synthesis rate, increased carbohydrate to lipid conversion efficiency, increased lipid storage and, increased growth rate, increased tolerance to elevated concentrations of a carbon source or a lipid product.
  • ATP-citrate lyase gene and gene product sequences are well known to those of skill in the art. Exemplary, representative gene and gene product sequences can be found under the entry for GenelD: 2912101 and 2910381 in the NCBI database
  • Non-limiting examples of suitable sequences of ACL nucleic acid and protein sequences are provided below. Additional suitable ACL sequences, including sequences from other species, will be apparent to those of skill in the art, and the invention is not limited in this respect.
  • oleaginous microbes for oil production comprising any of the modifications described herein, for example, a DGA1 modification as described herein, an ACC1 modification as described herein, and/or an SCD modification as described herein.
  • a modified oleaginous microbe is provided that comprises a push modification as described herein and a pull modification as described herein.
  • the push modification comprises overexpression of an ACC1 gene product.
  • the pull modification comprises overexpression of a DGA1 and/or an SCD gene product.
  • nucleic acids coding for a gene product conferring a required and/or desired phenotype for biofuel or biofuel precursor production to a microbe for example, Y. lipolytica.
  • the nucleic acid is a nucleic acid derived from Y. lipolytica.
  • the nucleic acid encodes a DGA1 gene product, for example, a DGA1 protein.
  • the nucleic acid encodes an ACC1 gene product, for example, an ACC1 protein.
  • nucleic acid encodes a desaturase, for example a ⁇ 9 desaturase.
  • nucleic acid encodes Y.
  • a nucleic acid encodes a combination of gene products, for example in multiple cistrons, comprising a gene product the overexpression of which represents a push modification of lipid biosynthesis (e.g., an ACC1 gene product), and a gene product the overexpression of which represents a pull modification of lipid biosynthesis (e.g., a DGA1 and/or SCD gene product).
  • a gene product the overexpression of which represents a push modification of lipid biosynthesis e.g., an ACC1 gene product
  • a gene product the overexpression of which represents a pull modification of lipid biosynthesis e.g., a DGA1 and/or SCD gene product
  • nucleic acid refers to a molecule comprising multiple linked nucleotides.
  • Nucleic acid and nucleic acid molecule are used interchangeably and refer to
  • oligoribonucleotides as well as oligodeoxyribonucleotides.
  • the terms also include polynucleosides (i.e., a polynucleotide minus a phosphate) and any other organic base containing nucleic acid.
  • the organic bases include adenine, uracil, guanine, thymine, cytosine and inosine.
  • the nucleic acids may be single or double stranded.
  • the nucleic acid may be naturally or non-naturally occurring. Nucleic acids can be obtained from natural sources, or can be synthesized using a nucleic acid synthesizer (i.e., synthetic).
  • the nucleic acid may be DNA or RNA, such as genomic DNA, mitochondrial DNA, mRNA, cDNA, rRNA, miRNA, PNA or LNA, or a combination thereof, as described herein.
  • Non- naturally occurring nucleic acids such as bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs) can also be used in accordance with some aspects of this invention.
  • nucleic acid derivatives may increase the stability of the nucleic acids of the invention by preventing their digestion, particularly when they are exposed to biological samples that may contain nucleases.
  • a nucleic acid derivative is a non-naturally occurring nucleic acid or a unit thereof.
  • Nucleic acid derivatives may contain non-naturally occurring elements such as non-naturally occurring nucleotides and non-naturally occurring backbone linkages.
  • Nucleic acid derivatives according to some aspects of this invention may contain backbone modifications such as but not limited to phosphorothioate linkages, phosphodiester modified nucleic acids, combinations of phosphodiester and phosphorothioate nucleic acid, methylphosphonate, alkylphosphonates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof.
  • the backbone composition of the nucleic acids may be homogeneous or heterogeneous.
  • Nucleic acid derivatives according to some aspects of this invention may contain substitutions or modifications in the sugars and/or bases.
  • some nucleic acid derivatives may include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position (e.g., an 2'-0-alkylated ribose group).
  • Nucleic acid derivatives may include non-ribose sugars such as arabinose.
  • Nucleic acid derivatives may contain substituted purines and pyrimidines such as C-5 propyne modified bases, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, 2-thiouracil and pseudoisocytosine.
  • substituted purines and pyrimidines such as C-5 propyne modified bases, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, 2-thiouracil and pseudoisocytosine.
  • a nucleic acid may comprise a peptide nucleic acid (PNA), a locked nucleic acid (LNA), DNA, RNA, or a co-nucleic acids of the above such as DNA- LNA co-nucleic acid.
  • PNA peptide nucleic acid
  • LNA locked nucleic acid
  • DNA DNA
  • RNA or a co-nucleic acids of the above such as DNA- LNA co-nucleic acid.
  • isolated nucleic acid molecule refers to a nucleic acid that is not in its natural environment, for example a nucleic acid that has been (i) extracted and/or purified from a cell or microbe, for example, a bacteria or yeast, by methods known in the art, for example, by alkaline lysis of the host cell and subsequent purification of the nucleic acid, for example, by a silica adsorption procedure; (ii) amplified in vitro, for example, by polymerase chain reaction (PCR); (iii) recombinantly produced by cloning, for example, a nucleic acid cloned into an expression vector; (iv) fragmented and size separated, for example, by enzymatic digest in vitro or by shearing and subsequent gel separation; or (v) synthesized by, for example, chemical synthesis.
  • PCR polymerase chain reaction
  • isolated nucleic acid molecule refers to (vi) an nucleic acid that is chemically markedly different from any naturally occurring nucleic acid.
  • an isolated nucleic acid can readily be manipulated by recombinant DNA techniques well known in the art.
  • a nucleic acid cloned into a vector, or a nucleic acid delivered to a host cell and integrated into the host genome is considered isolated but a nucleic acid in its native state in its natural host, for example, in the genome of the host, is not.
  • An isolated nucleic acid may be substantially purified, but need not be.
  • a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise only a small percentage of the material in the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein.
  • nucleic acids encoding a gene product conferring a required or desirable phenotype to a microbe for biofuel or biofuel precursor production which are linked to a promoter or other transcription activating element.
  • the nucleic acid encoding the gene product and linked to a promoter is comprised in an expression vector or expression construct.
  • expression vector or "expression construct” refer to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host microbe, for example, an oleaginous yeast.
  • the expression vector may be part of a plasmid, virus, or nucleic acid fragment.
  • the expression vector includes the coding nucleic acid to be transcribed operably linked to a promoter.
  • a promoter is a nucleic acid element that facilitates transcription of a nucleic acid to be transcribed.
  • a promoter is typically located on the same strand and upstream (or 5') of the nucleic acid sequence the transcription of which it controls.
  • the expression vector includes the coding nucleic acid to be transcribed operably linked to a heterologous promoter.
  • a heterologous promoter is a promoter not naturally operably linked to a given nucleic acid sequence.
  • the DGA1 gene in Y. lipolytica is naturally operably linked to the Y. lipolytica DGA1 gene promoter.
  • Any promoter other than the wildtype Y. lipolytica DGA1 gene promoter operably linked to the DGA1 gene, or parts thereof, for example in an expression construct, would, therefore, be a heterologous promoter in this context.
  • a TEF1 promoter linked to a nucleic acid encoding a DGA1 gene product is a heterologous promoter in the DGA1 context.
  • the expression vector includes a coding nucleic acid, for example, a nucleic acid encoding a DGA1, ACC1, and/or SCD gene product, operably linked to a constitutive promoter.
  • constitutive promoter refers to a promoter that allows for continual transcription of its associated gene.
  • the expression vector includes a coding nucleic acid, for example, a nucleic acid encoding a DGA1, ACC1, and/or SCD gene product, operably linked to an inducible promoter.
  • inducible promoter refers to a promoter that allows for transcription of its associated gene only in the presence or absence of biotic or abiotic factors.
  • Drug-inducible promoters for example tetracycline/doxycycline inducible promoters, tamoxifen-inducible promoters, as well as promoters that depend on a
  • cre-mediated recombination of loxP sites are examples of inducible promoters that are well known in the art.
  • an intron-enhanced constitutive promoter for gene overexpression in oleaginous microbes and expression constructs and vectors comprising this intron-enhanced promoter.
  • an intron-enhanced TEF promoter is provided, that comprises a TEF promoter sequence, a transcription start site, an intronic sequence downstream of the transcription start site, and a coding nucleic acid sequence, for example, a nucleic acid sequence encoding a DGA1, ACC1 and/or SCD gene product.
  • the intron is positioned downstream of the translation start site, yet within the open reading frame of the gene sequence, e.g., after the start codon, but before the termination site of the nucleic acid sequence encoding the gene product.
  • the intron is positioned immediately downstream of the translation start site, e.g., an ATG start codon, yet upstream of the remainder of the coding sequence.
  • the translation start site e.g., an ATG start codon
  • TEF promoter transcription start site - start codon— intron— DGA1 coding sequence - - stop codon— 3'.
  • Expression constructs for ACC1 and SCD gene products would have the
  • DGA1 coding sequence substituted for an ACC or SCD coding sequence, respectively.
  • TEF promoter sequences as well as suitable intron sequences will be apparent to those of skill in the art.
  • Some intron-less TEF promoter sequences are disclosed, for example, in U.S. Patent #6,265,185. Some exemplary, representative sequences are provided below. However, it will be understood that the invention is not limited in this respect.
  • Exemplary TEF promoter sequence :
  • TEF promoter- intron sequence comprising a start codon (ATG) between the promoter and the intron sequences:
  • nucleic acids can be delivered to prokaryotic and eukaryotic microbes by various methods well known to those of skill in the relevant biological arts.
  • Methods for the delivery of nucleic acids to a microbe in accordance to some aspects of this invention include, but are not limited to, different chemical, electrochemical and biological approaches, for example, heat shock transformation, electroporation, transfection, for example liposome-mediated transfection, DEAE-Dextran-mediated transfection or calcium phosphate transfection.
  • a nucleic acid construct for example an expression construct comprising a combination of DGA1, ACC1, and/or SCD encoding nucleic acid sequences, is introduced into the host microbe using a vehicle, or vector, for transferring genetic material.
  • Vectors for transferring genetic material to microbes are well known to those of skill in the art and include, for example, plasmids, artificial chromosomes, and viral vectors.
  • nucleic acid constructs including expression constructs comprising constitutive or inducible heterologous promoters, knockout and knockdown constructs, as well as methods and vectors for the delivery of a nucleic acid or nucleic acid construct to a microbe are well known to those of skill in the art, and are described, for example, in J.
  • the native promoter of a gene encoding a gene product conferring a required or desirable phenotype to a microbe for example, the native DGA1, ACC1, or SCD promoter, is modified in the microbe to alter the regulation of its
  • modified promoter exhibits an increased transcriptional activity as compared to its unmodified counterpart.
  • modified promoter refers to a promoter the nucleotide sequence of which has been artificially altered. Nucleotide deletion(s), insertion(s) or mutation(s), alone or in
  • Artificial promoter alterations can be effected in a targeted fashion, for example by homologous recombination approaches, such as gene targeting, knockout, knock in, site-directed mutagenesis, or artificial zinc finger nuclease-mediated strategies. Alternatively, such alterations may be effected by a random or quasi-random event, such as irradiation or non-targeted nucleotide integration and subsequent selection.
  • Promoter modifications in general, are fashioned in order to modulate the transcriptional activation properties of the respective promoter. For example, the disruption or deletion of a regulatory element mediating the repression of a DGA1, ACC1, or SCD promoter in response to elevated intracellular fatty acid levels would lead to continued transcriptional activation of the respective gene even under conditions of elevated
  • a constitutively active transcriptional activator element into a conditional promoter region may effect overexpression of the respective gene under normally inhibitive conditions.
  • Methods for the targeted disruption of a native promoter for example, a native DGA1, ACC1, or SCD promoter, in a microbe, for example, for targeted disruption resulting in an increased transcription rate, are well known to those of skill in the art.
  • Some aspects of this invention relate to engineering of a microbe, for example, Y. lipolytica, to exhibit a required and/or desirable phenotype for large-scale production of a biofuel or biofuel precursor. Some aspects of this invention relate to the metabolic
  • Some aspects of this invention relate to metabolic engineering that comprises a combination of genetic modifications modulating the expression of genes regulating carbon flux into a lipid synthesis pathway in order to yield a microbe optimized for biofuel production.
  • the combination of genetic modifications includes a push modification and a pull modification.
  • the push modification comprises a genetic modification that increases the level of metabolites, acetyl-CoA, ATP, or NADPH for lipid synthesis in a cell, for example, overexpression of an ACC1 gene product.
  • the pull modification is a genetic modification that decreases the level of a product or intermediary of lipid synthesis that exhibits a feedback inhibitory function, for example, a fatty acid.
  • the pull modification comprises overexpression of a DGA1 and/or an SCD gene product.
  • Some aspects of this invention provide methods to greatly increase the efficiency of Y. lipolytica mediated carbon source to lipid conversion by modulating Y. lipolytica 's native lipid metabolism. Remarkably and unexpectedly, combinations of push-and-pull
  • modifications of lipid metabolism according to some methods provided by this invention confers significantly increased carbon flux to lipid synthesis pathways as compared to individual modifications modulating only push or pull processes, respectively.
  • an engineered microbe is provided that has been manipulated by a method or using a nucleic acid or protein provided by some aspects of this invention, for example, an expression construct or a combination of expression constructs as provided herein, resulting in the overexpression of a combination of a gene product mediating a push process of lipid synthesis (e.g., an ACC1 product), and a gene product mediating a pull process of lipid synthesis (e.g., a DGA1 and/or SCD gene product).
  • a gene product mediating a push process of lipid synthesis e.g., an ACC1 product
  • a gene product mediating a pull process of lipid synthesis e.g., a DGA1 and/or SCD gene product
  • an engineered microbe that overexpresses a push-and-pull combination of gene products that, according to some aspects of this invention, confers a required and/or desirable phenotype for biofuel or biofuel precursor production to the microbe.
  • a microbe comprising an increased DGA1, ACC1, and/or SCD gene product activity is provided.
  • the microbe exhibits an increased fatty acid synthesis rate, an increased TAG storage, and/or an additional required or desirable trait.
  • an increased rate of TAG synthesis in an engineered Y. lipolytica microbe described herein refers to rate of lipid synthesis that is increased as compared to the rate of TAG synthesis in a wild-type Y. lipolytica.
  • an increased rate of lipid synthesis refers to a rate of fatty acid synthesis of a culture of cells, e.g., of a culture of engineered microbes.
  • an increased rate of lipid synthesis is a rate of lipid synthesis, e.g., of TAG synthesis or total lipid synthesis of at least O.Olg/L/h (grams of lipid per liter of culture per hour), at least 0.004g/L/h, at least 0.05g/L/h, at least O.lg/L/h, at least 0.14g/L/h, at least 0.15g/L/h, at least 0.2g/L/h, at least 0.3g/L/h, at least 0.4g/L/h, at least 0.5g/L/h, at least 0.6g/L/h, at least 0.7g/L/h, at least 0.8g/L/h, at least 0.9g/L/h, at least lg/L/h, at least 2g/L/h, at least 3g/L/h, at least 4g/L/h, at least 5g/L/h, at least 6g/L/h, at least
  • the rate of synthesis in this context is the rate of synthesis measured over a complete run of a bioreactor, e.g., calculating the rate of synthesis from the total amount of lipid, e.g., TAG, synthesized over the total time that the bioreactor was run or the total time lipid production was measured over.
  • This type of synthesis rate is also referred to herein sometimes as "total lipid productivity" or “overall lipid productivity,” and it is typically provided in g/L/h (grams of lipid produced per liter of culture medium per run time in hours).
  • an engineered microbe is provided, e.g., an engineered Y.
  • lipolytica that overexpresses an ACC1 gene product, a DGA1 gene product, and/or an SCD gene product, that exhibits at least a 5-fold increase, at least a 6-fold increase, at least a 7-fold increase, at least an 8-fold increase, at least a 9-fold increase, at least a 10-fold increase, at least a 12-fold increase, at least a 10-fold increase, at least a 12.5-fold increase, at least a 15- fold increase, at least a 20-fold increase, at least a 30-fold increase, at least a 40-fold increase, at least a 50-fold increase, at least a 60-fold increase, at least a 70-fold increase, at least an 80-fold increase, at least a 90-fold increase, at least a 100-fold increase, at least a 500-fold increase, or at least a 1000-fold increase in total lipid productivity as compared to a wild- type microbe, e.g., a wild-type Y. lipolytica
  • an increased rate of total lipid synthesis or an increased total lipid productivity is at least O.Olg/L/h, at least 0.004g/L/h, at least 0.05g/L/h, at least
  • O.lg/L/h at least 0.14g/L/h, at least 0.15g/L/h, at least 0.2g/L/h, at least 0.3g/L/h, at least 0.4g/L/h, at least 0.5g/L/h, at least 0.6g/L/h, at least 0.7g/L/h, at least 0.8g/L/h, at least 0.9g/L/h, at least lg/L/h, at least 2g/L/h, at least 3g/L/h, at least 4g/L/h, or at least 5g/L/h.
  • the rate of synthesis is the maximum rate of synthesis, or the peak rate of synthesis, measured, e.g., under optimal growth conditions and exposure to nutrients. This type of synthesis rate is also referred to herein sometimes as "maximum lipid productivity".
  • an increased maximum rate of lipid synthesis is a rate of lipid synthesis, e.g., of TAG synthesis, of at least 0.2g/L/h, at least 0.3g/L/h, at least 0.4g/L/h, at least 0.5g/L/h, at least 0.6g/L/h, at least 0.7g/L/h, at least 0.8g/L/h, at least 0.9g/L/h, at least lg/L/h, at least 2g/L/h, at least 3g/L/h, at least 4g/L/h, at least 5g/L/h, at least 6g/L/h, at least 7g/L/h, at least 8g/L/h, at least 9g/L/h, at least lOg/L/h, or at least 25g/L/h.
  • a rate of lipid synthesis e.g., of TAG synthesis, of at least 0.2g/L/h, at least 0.3g/
  • the engineered microbe is an oleaginous yeast, for example, Y. lipolytica.
  • an engineered yeast provided by this invention exhibits one or more highly desirable and unexpected phenotypic characteristics, for example: increased carbon to oil conversion rate or efficiency, increased lipid accumulation in a lipid body.
  • an engineered microbe for example, an engineered yeast, provided by aspects of this invention exhibits a carbon to oil conversion rate, also referred to herein as "lipid yield," within the range of about 0.02g/g (g oil, lipid, or TAG produced/ g carbon, e.g., glucose, acetate, or acetic acid consumed) to about 0.3 g/g.
  • lipid yield a carbon to oil conversion rate
  • the engineered microbe for example, the engineered yeast, provided by aspects of this invention exhibits a carbon to oil conversion rate of about O.OlOg/g, about 0.02g/g, about 0.025g/g, about 0.03g/g, about 0.04g/g, about 0.05g/g, about 0.06g/g, about 0.07g/g, about 0.075g/g, about 0.08g/g, about 0.09g/g, about 0.
  • lg/g about 0.1 lg/g, about 0.12g/g, about 0.13g/g, about 0.14g/g, about 0.15g/g, about 0.16g/g, about 0.17g/g, about 0.18g/g, about 0.19g/g, about 0.2g/g, about 0.21g/g, about 0.22g/g, about 0.23g/g, about 0.24g/g, about 0.25g/g, about 0.26g/g, about 0.27g/g, about 0.28g/g, about 0.29g/g, about 0.3g/g, about 0.3 lg/g, about 0.32g/g, or approaching theoretical values.
  • about 0.12g/g about 0.13g/g, about 0.14g/g, about 0.15g/g, about 0.16g/g, about 0.17g/g, about 0.18g/g, about 0.19g/g, about 0.2g/g, about 0.21g/g, about 0.22g/g, about 0.23g/g, about
  • the engineered microbe for example, the engineered yeast, provided by aspects of this invention exhibits a carbon to oil conversion rate of at least about O.OlOg/g (g lipid produced/ g carbon, e.g., glucose, acetate, or acetic acid consumed), at least about 0.02g/g, at least about 0.025g/g, at least about 0.03g/g, at least about 0.04g/g, at least about 0.05g/g, at least about 0.06g/g, at least about 0.07g/g, at least about 0.075g/g, at least about 0.08g/g, at least about 0.09g/g, at least about 0.
  • O.OlOg/g g lipid produced/ g carbon, e.g., glucose, acetate, or acetic acid consumed
  • lg/g at least about 0.1 lg/g, at least about 0.12g/g, at least about 0.13g/g, at least about 0.14g/g, at least about 0.15g/g, at least about 0.16g/g, at least about 0.17g/g, at least about 0.18g/g, at least about 0.19g/g, at least about 0.2g/g, at least about 0.21g/g, at least about 0.22g/g, at least about 0.23g/g, at least about 0.24g/g, at least about 0.25g/g, at least about 0.26g/g, at least about 0.27 g/g, at least about 0.28g/g, at least about 0.29g/g, at least about 0.3g/g, at least about 0.3 lg/g, at least about 0.32g/g, or approaching theoretical values.
  • lipid titer as used herein in the context of microbial lipid synthesis, e.g., in the context of a fatty acid synthesis by an oil-producing microbe described herein, refers to an amount of lipid synthesized per volume of a microbial culture comprising the oil-producing microbe.
  • an engineered microbe e.g., an engineered Y.
  • lipolytica microbe described herein can achieve or does achieve a lipid titer of at least lg/L (grams of lipid per liter of microbial culture), at least 2g/L, at least 3g/L, at least 4g/L, at least 5g/L, at least 6g/L, at least 7g/L, at least 8g/L, at least 9g/L, at least lOg/L, at least 15g/L, at least 20g/L, at least 25g/L, at least 30g/L, at least 40g/L, at least 50g/L, at least 60g/L, at least 70g/L, at least 80g/L, at least 90g/L, at least lOOg/L, at least 200g/L, or at least 250g/L.
  • a lipid titer of at least lg/L (grams of lipid per liter of microbial culture), at least 2g/L, at least 3g/L, at least 4
  • an engineered microbe as provided herein exhibits an increased lipid titer during carbon to oil conversion.
  • an increased lipid titer achieved by an engineered Y. lipolytica microbe described herein refers to a lipid titer that is increased as compared to the lipid titer that can be achieved by a wild-type Y. lipolytica under identical conditions.
  • an increased lipid titer refers to a lipid titer of at least lg/L (grams of lipid per liter of microbial culture), at least 2g/L, at least 3g/L, at least 4g/L, at least 5g/L, at least 6g/L, at least 7g/L, at least 8g/L, at least 9g/L, at least lOg/L, at least 15g/L, at least 20g/L, at least 25g/L, at least 30g/L, at least 40g/L, at least 50g/L, at least 60g/L, at least 70g/L, at least 80g/L, at least 90g/L, at least lOOg/L, at least 200g/L, or at least 250g/L.
  • Some aspects of this invention provide engineered microbes for oil production that can use a variety of carbon sources, including, but not limited to fermentable sugars, for example, C6 sugars, such as glucose, and organic acids, e.g., acetic acid, and/or their salts, e.g., acetate.
  • C6 sugars such as glucose
  • organic acids e.g., acetic acid
  • salts e.g., acetate
  • the culture comprises a genetically modified microbe provided herein and a medium, for example, a liquid medium.
  • the culture comprises a genetically modified microbe provided herein and a carbon source, for example, a fermentable carbohydrate source, or an organic acid or salt thereof.
  • the culture comprises a genetically modified microbe provided herein and a salt and/or buffer establishing conditions of salinity, osmolarity, and pH, that are amenable to survival, growth, and/or carbohydrate to biofuel or biofuel precursor conversion by the microbe.
  • the culture comprises an additional component, for example, an additive.
  • Non-limiting examples of additives are nutrients, enzymes, amino acids, albumin, growth factors, enzyme inhibitors (for example protease inhibitors), fatty acids, lipids, hormones (e.g., dexamethasone and gibberellic acid), trace elements, inorganic compounds (e.g., reducing agents, such as manganese), redox-regulators (e.g., antioxidants), stabilizing agents (e.g., dimethylsulfoxide), polyethylene glycol, polyvinylpyrrolidone (PVP), gelatin, antibiotics (e.g., Brefeldin A), salts (e.g., NaCl), chelating agents (e.g., EDTA, EGTA), and enzymes (e.g., cellulase, dispase, hyaluronidase, or DNase).
  • enzyme inhibitors for example protease inhibitors
  • fatty acids e.g., albumin, growth factors
  • hormones e.g.,
  • the culture may comprise a drug inducing or inhibiting transcription from a conditional or inducible promoter, for example doxicycline, tetracycline, tamoxifen, IPTG, hormones, or metal ions.
  • a conditional or inducible promoter for example doxicycline, tetracycline, tamoxifen, IPTG, hormones, or metal ions.
  • the genetically modified microbe exhibits a growth advantage over wild type microbes of the same kind and/or over other microbes, for example, microbes commonly found to contaminate microbial cultures for carbon source to biofuel or biofuel precursor conversion.
  • the growth and/or proliferation advantage of an engineered microbe provided by aspects of this invention translates into the possibility of using non- sterile culturing and fermentation conditions for biofuel or biofuel precursor production, because the problem of culture overgrowth by contaminating microbes is mitigated or completely abolished.
  • an engineered microbe provided by aspects of this invention is cultured under non- sterile conditions for biofuel or biofuel precursor production.
  • non- sterilized feedstock e.g., non- sterilized culture media, non- sterilized supplements, or a non- sterilized bioreactor (e.g. an open reactor under non-sterile conditions) is used for biofuel or biofuel precursor production.
  • a non- sterilized bioreactor e.g. an open reactor under non-sterile conditions
  • microbes can be genetically modified according to some aspects of this invention and used for industrial- scale biofuel or biofuel precursor production, for example, microbes from various sources of yeast, such as oleaginous yeast, bacteria, algae and fungi.
  • yeast cells are cells from Yarrowia lipolytica, Hansenula polymorpha, Pichia pastoris, Saccharomyces cerevisiae, S. bayanus, S. K. lactis, Waltomyces lipofer.
  • suitable bacteria are Bacillus subtilis, Salmonella, Escherichia coli, Vibrio cholerae, Streptomyces, Pseudomonas fluorescens, Pseudomonas putida,
  • Non-limiting examples of suitable fungal cells can, for example, be cultured from species such as
  • Non-limiting examples of suitable algal cells are cells from Neochloris oleoabundans, Scenedesmus obliquus,
  • Nannochloropsis sp. Dunaliella tertiolecta, Chlorella vulgaris, Chlorella emersonii, and Spirulina maxima.
  • Some aspects of this invention provide methods for the production of biofuel or biofuel precursors using genetically modified microbes provided herein.
  • methods for biofuel or biofuel precursor production on an industrial scale are provided.
  • carbon sources can be converted into a biofuel or biofuel precursor using a method and/or a genetically modified microbe provided herein.
  • the carbon source comprises a carbohydrate.
  • Sugars, starches, and fibers are non-limiting examples of carbohydrate sources suitable for conversion methods provided herein.
  • a carbohydrate source may comprise a refined and/or unrefined sugar, starch, and/or fiber, or a combination of any of these.
  • sugars are fermentable sugars, such as glucose, fructose, sucrose, xylose, and lactose.
  • starches are amylase and amylopectin.
  • fibers are plant fibers, such as cellulose, hemicellulose and wood fibers.
  • methods for the production of biofuel or biofuel precursor include the use of a cheap, abundant, and readily available carbon source feedstock as the carbon source.
  • cellulose or hemicellulose is used as the carbon source.
  • the cellulose or hemicellulose is derived from industrial by- or waste products.
  • the cellulose or hemicellulose is derived directly from plant or algal biomass. Plant or algal biomass is one of the most abundant feedstocks and comprises a significant amount of non-fermentable sugars and fibers, for example, cellulose and hemi-cellulose.
  • biomass feedstock is pretreated to convert a non-fermentable sugar or fiber into a fermentable sugar, thus making them available for microbe growth and microbe-mediated biofuel or biofuel precursor production.
  • the pretreatment of biomass feedstock includes depolymerizing cellulose and/or hemicellulose components to monomeric sugars using a pretreatment method known to those of skill in the art, for example, a dilute acid or ammonia fiber expansion (AFEX) method (see, e.g., Yang B, Wyman CE. Dilute acid and
  • a biomass feedstock containing non-fermentable sugars is pretreated using a dilute acid method to depolymerize a non-fermentable sugar to a monomeric, fermentable sugar.
  • biomass is treated with dilute sulphuric acid at moderately mild temperatures for a defined period of time.
  • the biomass is treated with about 0.5%, about 1%, about 2%, about 3%, about 4%, about 5%, or about 6% sulphuric acid.
  • the biomass is treated at about 30°C, at about 37°C, at about 40°C, at about 50°C, at about 60°C, at about 70°C, at about 80°C, at about 90°C, at about 100°C, at about 110°C, at about 120°C, at about 130°C, at about 140°C, at about 150°C, at about 175°C, at about 200°C, or at above about 200°C.
  • the resulting hydrolysate contains insoluble lignin and solubilized cellulosic and hemicellulosic polymers.
  • the latter products can be further treated to generate hexose and pentose sugars such as glucose and xylose monomers by methods well known to those of skill in the art, for example, by treatment with cellulase or other hydrolyzing enzymes.
  • the pretreatment of non-fermentable sugars with dilute acid results in the generation of by-products that include toxic compounds which inhibit growth, decrease viability, and/or inhibit biofuel or biofuel precursor production of microbes not engineered according to aspects of this invention.
  • the pre-treated feedstock is washed, supplemented with media supporting microbial growth and biofuel or biofuel precursor production, and/or over-limed for detoxification.
  • a biomass feedstock containing non-fermentable sugars is pretreated using an AFEX method to depolymerize a non-fermentable sugar to a monomeric, fermentable sugar.
  • biomass is treated with liquid ammonia at high temperature and pressure for a defined period of time.
  • biomass is treated for about 10 minutes, about 20 minutes, about 30 minutes, about 40 minutes, about 50 minutes, about 60 minutes, about 70 minutes, about 80 minutes, about 90 minutes, or longer.
  • biomass is treated at about 30°C, at about 37°C, at about 40°C, at about 50°C, at about 60°C, at about 70°C, at about 80°C, at about 90°C, at about 100°C, at about 110°C, at about 120°C, at about 130°C, at about 140°C, at about 150°C, at about 175°C, at about 200°C, or at above about 200°C.
  • the AFEX pretreatment results in the conversion of crystalline cellulose contained in the feedstock into an amorphous, fermentable form.
  • the AFEX pre-treated biomass feedstock does not contain significant amounts of toxic byproducts that inhibit microbial growth and/or biofuel or biofuel precursor production, and is used without prior
  • biomass feedstock with or without pre-treatment, is treated with an enzyme that hydrolyzes or depolymerizes sugar polymers, for example, with a cellulase or hemicellulase enzyme.
  • the feedstock is contacted with the enzyme in a liquid phase and incubated at a temperature allowing for the enzyme to catalyze a depolymerization or hydrolyzation reaction for a time sufficient to hydrolyze or depolymerize a significant amount of the non-fermentable sugar or fiber in the biomass feedstock.
  • the liquid phase of the feedstock contacted with the enzyme, which contains the soluble, fermentable sugar fraction is separated from the solid phase, including non-fermentable sugars and fibers, after incubation for hydrolyzation and depolymerization, for example, by centrifugation.
  • the liquid fraction of the feedstock is subsequently contacted with a microbe, for example, a microbe provided by aspects of this invention, for conversion to biofuel or biofuel precursor.
  • enzymatic conversion of non-fermentable sugars or fiber occurs in a consolidated bioprocess, for example, at the same time and/or in the same reactor as microbial conversion of the produced fermentable sugars to biofuel or biofuel precursor.
  • the enzymatic conversion is performed first, and the feedstock contacted with enzyme is subsequently contacted with the microbe for biofuel or biofuel precursor production. In some embodiments, enzymatic and microbial conversion are performed at the same time and in the same reactor.
  • an engineered microbe as provided herein for example, a
  • Yarrowia lipolytica overexpressing a DGA1, ACC1, and/or SCD gene product is grown on acetate as the main carbon source.
  • the microbe is grown in a solution of acetic acid with a concentration of about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10% vol/vol, about 20 % vol/vol, about 25 % vol/vol, or about 30 % vol/vol.
  • the acetate concentration is between about 3%-10% wt/vol.
  • cell cultures comprising genetically modified microbes as provided herein that are cultured on acetate or acetic acid as the main carbon source are contacted, or "spiked," with glycerol.
  • the genetically modified microbes are intermittently contacted with glycerol.
  • the microbes are continuously or semi-continuously contacted with glycerol.
  • the microbes are contacted with glycerol at a concentration of about 0.5%, about 1%, about 2%, about 3%, about 4%, or about 5% vol/vol.
  • glycerol spiking is performed in biofuel or biofuel precursor production methods using a carbon source other than acetate, for example, any carbon source described herein.
  • an engineered microbe as provided herein for example, a Yarrowia lipolytica overexpressing a DGA1 gene product, and/optionally, and ACC1 and/or SCD gene product, is grown on a carbon source, e.g., on acetate or acetic acid, that is replenished during the growth process or culture period, e.g, by contacting the microbe with an additional amount of the carbon source, or with an amount of an additional carbon source, after a period of time in culture, e.g., after 8 hours, after 24 hours, or after 48 hours.
  • a carbon source e.g., on acetate or acetic acid
  • an engineered microbe as provided herein is grown initially, e.g., for the first 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, or 72 hours in a culture medium that comprises a low carbon to nitrogen (C/N) ratio, e.g., a C/N ratio of about 10, of about 20, of about 25, of about 30, of less than 30, of less than 25, or of less than 20.
  • a low C/N ratio is achieved by supplementing the culture media with a nitrogen source, e.g., with ammonia, to achieve the desired C/N ratio.
  • the carbon source is supplemented with a nitrogen source, e.g., ammonia.
  • a nitrogen source e.g., ammonia.
  • the supplementation with a nitrogen source is ceased after an initial period of time in culture, e.g., after for the first 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, or 72 hours in culture, thus allowing the engineered microbes in culture to consume the nitrogen source, which, in turn, results in an increase of the C/N ratio.
  • This shift in C/N ratio can be enhanced or sped up by feeding additional carbon source into the culture that is not supplemented with a nitrogen source, e.g., by feeding acetic acid or acetate that is not supplemented with ammonia or any other nitrogen source.
  • the optimal C/N ratio for oil production by an engineered microbe described herein is within the range of 80-120.
  • fermentation processes for large-scale microbe-mediated carbohydrate to lipid conversion may be carried out in bioreactors.
  • bioreactor and “fermentor”, which are interchangeably used, refer to an enclosure, or partial enclosure, in which a biological and/or chemical reaction takes place, at least part of which involves a living organism or part of a living organism.
  • a "large-scale bioreactor” or “industrial-scale bioreactor” is a bioreactor that is used to generate a product, for example a biofuel or biofuel precursor, for example a fatty acid and/or TAG, on a commercial or quasi- commercial scale.
  • a bioreactor in accordance with aspects of this invention may comprise a microbe or a microbe culture.
  • a bioreactor may comprise a spore and/or any kind of dormant cell type of any isolated microbe provided by aspects of this invention, for example, in a dry state.
  • addition of a suitable carbohydrate source to such bioreactors may lead to activation of the dormant cell, for example to germination of a yeast spore, and subsequent conversion of the carbohydrate source, at least in part, to a biofuel or biofuel precursor.
  • bioreactors may include cell culture systems where microbes are in contact with moving liquids and/or gas bubbles.
  • Microbes or microbe cultures in accordance with aspects of this invention may be grown in suspension or attached to solid phase carriers.
  • carrier systems include
  • microcarriers e.g., polymer spheres, microbeads, and microdisks that can be porous or non- porous
  • cross-linked beads e.g., dextran
  • specific chemical groups e.g., tertiary amine groups
  • 2D microcarriers including cells trapped in nonporous polymer fibers 3D carriers (e.g., carrier fibers, hollow fibers, multicartridge reactors, and semi-permeable membranes that can comprising porous fibers), microcarriers having reduced ion exchange capacity, encapsulation cells, capillaries, and aggregates.
  • Carriers can be fabricated from materials such as dextran, gelatin, glass, and cellulose.
  • Industrial- scale carbohydrate to lipid conversion processes in accordance with aspects of this invention may be operated in continuous, semi-continuous or non-continuous modes.
  • operation modes in accordance with this invention are batch, fed batch, extended batch, repetitive batch, draw/fill, rotating- wall, spinning flask, and/or perfusion mode of operation.
  • bioreactors may be used that allow continuous or semi- continuous replenishment of the substrate stock, for example a carbohydrate source and/or continuous or semi-continuous separation of the product, for example a secreted lipid, an organic phase comprising a lipid, and/or cells exhibiting a desired lipid content, from the reactor.
  • a carbohydrate source for example a carbohydrate source
  • continuous or semi-continuous separation of the product for example a secreted lipid, an organic phase comprising a lipid, and/or cells exhibiting a desired lipid content
  • Non-limiting examples of bioreactors in accordance with this invention are: stirred tank fermentors, bioreactors agitated by rotating mixing devices, chemostats, bioreactors agitated by shaking devices, airlift fermentors, packed-bed reactors, fixed-bed reactors, fluidized bed bioreactors, bioreactors employing wave induced agitation, centrifugal bioreactors, roller bottles, and hollow fiber bioreactors, roller apparatuses (for example benchtop, cart-mounted, and/or automated varieties), vertically- stacked plates, spinner flasks, stirring or rocking flasks, shaken multiwell plates, MD bottles, T-flasks, Roux bottles, multiple-surface tissue culture propagators, modified fermentors, and coated beads (e.g., beads coated with serum proteins, nitrocellulose, or carboxymethyl cellulose to prevent cell attachment).
  • coated beads e.g., beads coated with serum proteins, nitrocellulose, or carboxymethyl cellulose to prevent cell attachment.
  • Bioreactors and fermentors may, optionally, comprise a sensor and/or a control system to measure and/or adjust reaction parameters.
  • reaction parameters are: biological parameters, for example growth rate, cell size, cell number, cell density, cell type, or cell state, chemical parameters, for example pH, redox-potential, concentration of reaction substrate and/or product, concentration of dissolved gases, such as oxygen concentration and C0 2 concentration, nutrient
  • concentrations concentrations, metabolite concentrations, glucose concentration, glutamine concentration, pyruvate concentration, apatite concentration, concentration of an oligopeptide, concentration of an amino acid, concentration of a vitamin, concentration of a hormone, concentration of an additive, serum concentration, ionic strength, concentration of an ion, relative humidity, molarity, osmolarity, concentration of other chemicals, for example buffering agents, adjuvants, or reaction by-products, physical/mechanical parameters, for example density, conductivity, degree of agitation, pressure, and flow rate, shear stress, shear rate, viscosity, color, turbidity, light absorption, mixing rate, conversion rate, as well as thermodynamic parameters, such as temperature, light intensity/quality etc.
  • physical/mechanical parameters for example density, conductivity, degree of agitation, pressure, and flow rate, shear stress, shear rate, viscosity, color, turbidity, light absorption, mixing rate, conversion rate, as well as thermodynamic parameters, such as temperature
  • Sensors able to measure parameters as described herein are well known to those of skill in the relevant mechanical and electronic arts.
  • Control systems able to adjust the parameters in a bioreactor based on the inputs from a sensor as described herein are well known to those of skill in the art of bioreactor engineering.
  • the type of carbon source to be employed for conversion to a biofuel or biofuel precursor depends on the specific microbe employed. Some microbes provided by aspects of this invention may be able to efficiently convert a specific carbohydrate source, while a different carbohydrate source may not be processed by the same microbe at high efficiency or at all.
  • the oleaginous yeast Y. lipolytica for example, can efficiently convert sugars, such as glucose, fructose, sucrose, and/or lactose, and carbohydrate sources high in sugars, for example molasses, and plant fibers into fatty acids and their derivatives.
  • a biofuel or biofuel precursor for example, a fatty acid or a triacylglycerol, generated from a carbon source feedstock is secreted, at least partially, by a microbe provided by aspects of this invention, for example, an oleaginous yeast, such as a Y. lipolytica cell.
  • a microbe provided by aspects of this invention is contacted with a carbohydrate source in an aqueous solution in a bioreactor, and secreted biofuel or biofuel precursor forms an organic phase that can be separated from the aqueous phase.
  • organic phase refers to a liquid phase comprising a non- polar, organic compound, for example a fatty acid, TAG, and/or other non-polar lipid.
  • organic phase in accordance to this invention might further contain a microbe, a
  • the organic phase is continuously or semi-continuously siphoned off.
  • a bioreactor comprising a separator, which continuously or semi-continuously extracts the organic phase.
  • a biofuel or biofuel precursor is accumulated in cells according to aspects of this invention.
  • cells that have accumulated a desirable amount of biofuel or biofuel precursor are separated continuously or semi-continuously from a bioreactor, for example, by centrifugation, sedimentation, or filtration. Cell separation can further be effected, for example, based on a change in physical cell characteristics, such as cell size or density, by methods well known to those skilled in the art.
  • the accumulated biofuel or biofuel precursor can subsequently be extracted from the respective cells using standard methods of extraction well known to those skilled in the art, for example, solvent hexane extraction.
  • microbial cells are collected and extracted with 3 times the collected cell volume of hexane.
  • the extracted biofuel or biofuel precursor are further refined.
  • a biofuel precursor for example a triacylglycerol is converted to a biofuel, for example, biodiesel, using a method well known to those of skill in the art, for example, a transesterification procedure.
  • the Y. lipolytica strains used in this study were derived from the wild-type
  • Y. lipolytica W29 strain ATCC20460.
  • Gaillardin(ii) Rich medium (YPD) was prepared with 20 g/L Bacto peptone (Difco).
  • YNB medium was made with 1.7 g/L yeast nitrogen base (without amino acids) (Difco), 0.69 g/L CSM-Leu (MP Biomedicals, Solon, OH), and 20 g/L glucose.
  • Selective YNB plates contained 1.7 g/L yeast nitrogen base (without amino acids), 0.69 g/L CSM-Leu, 20 g/L glucose, and 15 g/L Bacto agar (Difco).
  • Shake flask experiments were carried out using the following medium: 1.7 g/L yeast nitrogen base (without amino acids), 1.5 g/L yeast extract, and 50 g/L glucose. From frozen stocks, precultures were inoculated into YNB medium (5 mL in Falcon tube, 200 rpm, 28°C, 24 hr). Overnight cultures were inoculated into 50 mL of media in 250 mL Erlenmeyer shake flask to an optical density (A 6 oo) of 0.05 and allowed to incubate for 100 hours (200 rpm, 28°C), after which biomass, sugar content, and lipid content were taken and analyzed.
  • YNB medium 5 mL in Falcon tube, 200 rpm, 28°C, 24 hr.
  • Overnight cultures were inoculated into 50 mL of media in 250 mL Erlenmeyer shake flask to an optical density (A 6 oo) of 0.05 and allowed to incubate for 100 hours (200 rpm, 28°
  • Bioreactor scale fermentation was carried out in a 2-liter baffled stirred-tank bioreactor.
  • the medium used contained 1.5 g/L yeast nitrogen base (without amino acids and ammonium sulfate), 2 g/L ammonium sulfate, 1 g/L yeast extract, and 90 g/L glucose. From a selective plate, an initial preculture was inoculated into YPD medium (40 mL in 250 mL Erlenmeyer flask, 200 rpm, 28 °C, 24 hr).
  • transformants was prepared using Yeastar Genomic DNA kit (Zymo Research, Irvine, CA). All constructed plasmids were verified by sequencing. PCR products and DNA fragments were purified with PCR Purification Kit or QIAEX II kit (Qiagen, Valencia, CA). Plasmids used are described in Table 3. Primers used are described in Table 4.
  • Plasmid pMTOlO was constructed by amplifying the translation elongation factor- la
  • TEF TEF promoter region
  • AF054508 Y. lipolytica Polg genomic DNA using primers MT078 and MT079.
  • the amplicon was inserted between Sail and Kpnl sites of the starting vector, pINA1269, also known as pYLEXl, obtained from Yeastern Biotech Company (Taipei, Taiwan).
  • pINA1269 also known as pYLEXl, obtained from Yeastern Biotech Company (Taipei, Taiwan.
  • Mlul and Nsil sites to add restriction sites to the multi-cloning site.
  • Plasmid pMT015 was constructed by amplifying from Y. lipolytica Polg genomic DNA the TEF promoter and the 5' coding region containing the ATG start codon and 113 bp of the endogenous intron (Accession number: CR382129). Primers MT118 and MT122 were used for this amplification and inserted between Sail and Mlul sites of pMTOlO. For cloning purposes, some of the intron was omitted so that the SnaSl restriction site could be incorporated. Cloning a gene into this plasmid thus requires the omission of the gene's ATG start codon, addition of TAACCGCAG to the beginning of the 5' primer, and blunt-end ligation at the 5' end.
  • Plasmid pMT025 was constructed by amplifying the LacZ gene, encoding ⁇ - galactosidase, from E. coli and inserting it into the Pmll and BamHl sites of starting vector pINA1269 using primers MT170 and MT171. Plasmid pMT038 was constructed by amplifying the LacZ gene and inserting it into the Mlul and Nsil sites of pMTOlO using primers MT168 and MT169. Since LacZ contains multiple Mlul sites, Ascl was used as the 5' restriction site on MT168 which has a matching overhang.
  • Plasmid pMT037 was constructed by amplifying LacZ gene and inserting it into the SnaSl and Nsil sites of pMT015. Primers MT172 and MT169 were used, where forward primer MT127 omits the ATG start codon of LacZ and instead begins with the sequence TAACCGCAG which completes the intron sequence of pMT015.
  • Plasmid pMT013 was constructed by amplifying the ACC1 gene from Y. lipolytica Polg genomic DNA (Accession Number: XM_501721) and inserting it into the Mlul and Nsil sites of pMTOlO using primers MT080 and MT081. Plasmid pMT040 was constructed by amplifying the ACC1 gene and its terminator from pMT013 using primers MT222 and MT137 and inserting this into starting vector pINA1269 digested with Pmll and Clal.
  • Plasmid pMT053 was constructed by amplifying the DGA1 gene from Y. lipolytica Polg genomic DNA (Accession Number: XM_504700) using primers MT271 and MT272. The amplified gene was digested with Nsil and was inserted into PMT015 in the same manner as in the construction of pMT037.
  • a promoter- gene-terminator cassette was amplified from pMT053 using primers MT220 and MT265. This was then digested with Dpnl and Asel and inserted into pMT040 which was digested with Nrul and Asel resulting in tandem gene construct pMT065.
  • the Asel restriction site was selected to facilitate selection, as it resides within the Ampicillin resistance marker. Because Nrul is a blunt end restriction site, insertion of the amplicon does not increase the total number of Nrul sites to facilitate progressive insertions.
  • Plasmids were linearized with either Notl or Sacl and chromosomally integrated into
  • LacZ enzyme activity was measured using the ⁇ -gal assay kit from Sigma- Aldrich. Cells were resuspended in PBS buffer and lysed by vortexing with 500 ⁇ glass beads (Sigma- Aldrich) for 2 minutes. 40 ⁇ ⁇ of the cell lysate was transferred into 340
  • Total lipids were extracted using the procedure by Folch et al (23). A measured quantity of cell biomass (roughly 1 mg) was suspended in 1 mL of chloroform:methanol
  • Transesterification of total lipid extracts was performed by adding 1 mL 2% (wt/vol) sulfuric acid in methanol to each sample. Samples were then incubated at 60°C for 2 hours.
  • the GC oven conditions were as follows: 150°C (1 min), a 10 min ramp to 230°C, hold at 230°C for 2 min.
  • the split ratio was 10: 1.
  • Fatty acids were identified and quantified by comparison with commercial FAME standards normalized to methyl tridecanoate (CI 3:0).
  • Total lipid content was calculated as the sum of total fatty acid contents for five FAMEs: methyl palmitate (CI 6:0), methyl palmitoleate (CI 6: 1), methyl stearate (CI 8:0), methyl oleate (C18: l), methyl linoleate (C18:2) (Sigma- Aldrich).
  • the addition of tridecanoic acid to the chloroform-methanol extraction fluid was used as the internal standard, which was carried through the entire analysis procedure and transesterified into its methyl ester.
  • TEF promoter In Y. lipolytica, a number of promoters are available for gene expression, including inducible and constitutive ones (24).
  • the TEF promoter was originally identified as being a strong constitutive promoter; however, subsequent cloning and characterization resulted in lower expression relative to the inducible XPR2 promoter (25). More recently, the hybrid hp4d promoter has become popular for its strong quasi-constitutive expression (26), and has been used in a number of applications requiring high protein expression (20, 27, 28).
  • Analysis of the genomic sequence for TEF reveals the presence of a 122-bp spliceosomal intron immediately after the start codon in the 5' region of the open reading frame.
  • Promoter-proximal spliceosomal introns have often been found to dramatically affect expression of their corresponding genes in a variety of organisms (29). We speculated that the strong expression of TEF was dependent on this intron, and that stronger expression could be achieved by including the intron along with the promoter in the expression vector. Indeed, the initial screening and isolation of the TEF promoter likely relied on the intron
  • Plasmids pMT025, pMT037 and pMT038 were constructed expressing LacZ to compare the relative expression of three promoters: synthetic hybrid promoter (php4d), TEF promoter without intron (pTEF), and TEF promoter with intron (pTEFin).
  • the TEFin promoter exhibits a 17-fold increase in expression over the intronless TEF promoter, and a 5-fold increase in expression over the hp4d promoter after 50 hrs of culture.
  • intron enhancement observed in other systems varies wildly: from only 2-fold in human cells and yeast to over 1000-fold in maize (30, 31). Introns are believed to enhance gene expression in a number of ways: by containing regulatory elements, facilitating mRNA export, and increasing transcription initiation rates (29). Intronic genes, as a group, tend to exhibit higher levels of expression relative to non-intronic genes. For example, in
  • TEF promoter along with its expression-enhancing intron provides an excellent platform for high gene expression in Y. lipolytica.
  • DGA1 pMT053
  • ACCl already having two endogenous promoter-proximal introns, was not cloned with the TEFin promoter. Instead it was cloned with TEF and hp4d promoters (pMT013 and pMT040, respectively).
  • ACC expression and activity is influenced by numerous transcription factors, protein kinases, and metabolites (41).
  • acyl-CoA in acetyl-CoA synthetase mutants led to an 8-fold decrease in ACC activity (42).
  • Y. lipolytica might represent a regulatory exception in eukaryotic organisms, lending much to its oleaginous nature, as here we achieve a 2-fold increase in lipid content through overexpression of endogenous ACC1.
  • DGAlp predominantly localizes to the membrane surface of lipid bodies and acts in concert with triglyceride lipase (TGL3) to balance TAG flux in and out of lipid bodies (16).
  • TGL3 triglyceride lipase
  • DGA diverts flux away from phospholipid synthesis, and thus creates a driving force for lipid synthesis as more flux is required to produce the still necessary phospholipids (6).
  • DGA1 overexpression in an oleaginous Asnf2 mutant led to accumulation of up to 27% lipid content in S. cerevisiae, a 2.3-fold increase (35).
  • Arabidopsis DGAT overexpression led to a 20-fold increase in lipid content in the leaves, and two-fold overall (43).
  • acyl-CoA The balance between fatty acid and TAG synthesis pathways revolves around the acyl-CoA intermediates, since they function as both product and feedback inhibitors in the fatty acid (upstream) pathway and primary precursors in the TAG (downstream) pathway.
  • Up-regulation of the upstream pathway increases the throughput of fatty acid synthesis and, for ACC in particular, diverts flux away from any pathways which would compete for cytosolic acetyl-CoA.
  • Up-regulation of the downstream pathway creates a driving force by depleting acyl-CoA intermediates and increasing the rate of storage of TAG in lipid bodies. However, when modulated individually, they can lead to imbalances which can produce adverse effects on cell metabolism and growth.
  • ACCl+DGAl transformant MTYLE5
  • Glucose concentration was increased and ammonium sulfate concentration was reduced to achieve a C/N molar ratio of 100.
  • Optimal C/N molar ratios for lipid accumulation typically range from 80-120 (15).
  • Glucose was fully consumed over the course of the 120 hour fermentation, with final biomass reaching 28.49 g/L (Figure 3).
  • Final lipid content was 61.7% of DCW, a 50% increase in lipid accumulation compared to the shake flask experiment. This compares favorably with other sugar fermentations (28, 47-49), as well as values found in ex novo lipid accumulation schemes (19, 50).
  • Overall yield and productivity was 0.195 g/g and 0.143 g/L/hr, respectively; however, during maximum lipid production observed between 70-100 hours, a yield of 0.270 g/g, and a productivity of 0.253 g/L/hr were reached (Table 2). Almost all biomass produced during this phase can be accounted for by the increase in lipid content.
  • the overall and maximum yields achieved are 60.9% and 84.3% of the theoretical yield for TAG synthesis.
  • High relative oleate concentrations (up to 58.5%) has also been observed in other 2-L fermentations (51), and is more similar to profiles of other oleaginous yeasts that accumulate more than 50% lipid content(75).
  • oleic acid might be more rapidly stored and easier to accumulate, as DGAlp is known to have varying specificities for different acyl-CoA; in S. cerevisiae, C18: l is the most preferred substrate, having twice the activity of C18:0 (52).
  • the high oleic acid concentration might also be a response to the higher aeration rate achieved in the bioreactor and not easily seen in shake flask fermentations.
  • Yarrowia lipolytica naturally grows on the organic acid acetate.
  • Acetate is an attractive substrate as it can be produced at high yields by homoacetogenic organisms from carbon dioxide or carbon monoxide via non-photo synthetic carbon fixation pathways.
  • Acetate enters cellular metabolic pathways in the form of acetyl-coA, which is the main precursor for lipid synthesis via acetyl-coA carboxylase (ACC).
  • ACC acetyl-coA carboxylase
  • DGA strain looked to be a promising candidate for lipid production on acetate substrate, since there is a direct overexpression of an acetyl-CoA utilizing enzyme coupled with the strong driving force for lipid accumulation.
  • a 2-liter bioreactor fermentation was performed using the ACC+DGA strain with acetate as carbon substrate (Figure 6). At high oxygen content, it was observed that acetate would be rapidly consumed with low biomass generation, so the fermentation was conducted under both nitrogen and oxygen-limited conditions to maximize lipid production and yield.
  • Lipid biosynthesis is a tightly regulated metabolic pathway.
  • thoughtful metabolic engineering is necessary to maximize yields and productivity.
  • the use of the oleaginous yeast Y. lipolytica benefits from having high capacity for lipid accumulation and tools for engineering the lipid metabolic pathway.
  • the intron-enhanced co-overexpression of two important genes in the lipid synthesis pathway, ACC1 and DGA1 provides driving force towards the production of lipids even under moderate C/N ratios.
  • the two enzymes carry out the first and last steps of lipid synthesis, the simultaneous push and pull of carbon flux towards TAG allows for enhanced production with minimal intermediate accumulation, which can lead to inhibition.
  • the resulting ACC1+DGA1 strain was able to accumulate up to 62% of its DCW as lipids through de novo synthesis at an overall volumetric productivity of 0.143 g/L/hr.
  • Metabolic engineering is the use of recombinant DNA technologies to manipulate metabolic pathways in organisms (Bailey 1991). Through manipulation and engineering of specific metabolic networks, controlling factors and rate-limiting steps can be identified and elaborated. Building upon existing knowledge and tools for a specific organism or pathway, one can evaluate how novel perturbations can be used to redirect and control the generation of desired products.
  • Lipid biosynthesis is an excellent pathway for study using for metabolic engineering, having wide applications ranging from health, cancer and medicine, to biochemicals and biofuels production (Beopoulos et al. 2011; Courchesne et al. 2009; Kohlwein and Petschnigg 2007).
  • the oleaginous yeast Yarrowia lipolytica stands as an excellent model organism to study lipid metabolism.
  • Y. lipolytica can naturally accumulate up to 36% lipids in carbon rich environments (Beopoulos et al. 2009). These lipids are stored in the form of triacylglycerides (TAG) in lipid bodies.
  • TAG triacylglycerides
  • It is one of the most extensively studied 'non- conventional' yeast species, with a sequenced genome and a range of genetic tools available (Barth and Gaillardin 1997). It has been used in a number of industrial applications and has been viewed as a model organism for protein secretion, hydrophobic substrate utilization, lipid metabolism, and mitochondrial respiration (Beckerich et al.
  • Acetyl-coA carboxylase is generally known as the rate-limiting step in fatty biosynthesis, controlling the flux entering the pathway. It is responsible for producing malonyl-coA, which can be utilized in fatty acid elongation.
  • ACC utilizes cytosolic acetyl-coA as its main metabolic precursor. The enzyme that supplies cytosolic acetyl-coA in most eukaryotes is ATP citrate lyase (ACL).
  • ACL cleaves citrate, which has been shuttled out of the mitochondria as a product of the TCA cycle, to form acetyl-coA and oxaloacetate.
  • acyl-coA molecules can be further manipulated through elongation and desaturation at the endoplasmic reticulum. These processes help modify the chemical properties of the acyl-coA chains to facilitate storage or utilization in other metabolic pathways.
  • Enzymes such as A9-desaturase (D9) convert stearoyl-coA molecules into oleoyl-coA molecules, which seem to be very important in both lipid regulation and metabolism (Dobrzyn and Ntambi 2005).
  • the final step in lipid assembly and storage is the conversion of diacylglycerol (DAG) into TAG via the enzyme diacylglycerol acyltransferase (DGA).
  • DAG diacylglycerol
  • DGA diacylglycerol acyltransferase
  • ACC controls flux entering lipid synthesis, and overexpression of ACC in the bacteria Escherichia coli resulted in 6-fold increase in fatty acid synthesis (Davis et al. 2000).
  • the citrate shuttle which is under control of ACL, is differentially observed in oleaginous fungi compared to non-oleaginous fungi, and is speculated as a necessary pathway for high flux into the lipid biosynthesis pathway (Boulton and Ratledge 1981; Vorapreeda et al. 2012). It is also thought that deactivation of ACL leads to citrate accumulation and secretion, an undesirable phenomenon in lipid production (Papanikolaou and Aggelis 2002; Papanikolaou et al. 2002).
  • D9 has been implicated in cancer metabolism, being upregulated in mammalian tumor cells. It is potentially a strong positive regulator of lipogenesis and facilitates the lipid production necessary for rapid growth found in cancer cells (Dobrzyn and Ntambi 2005; Hulver et al. 2005; Ntambi and Miyazaki 2004).
  • DGA is the final committed step for lipid storage, and overexpression of DGA in a S. cerevisiae Asnf2 mutant resulted in dramatic increases in lipid accumulation (Kamisaka et al. 2007). While these results have produced interesting results and implications, analysis of their contributions within a single model organism can allow us to systematically identify how they can contribute and cooperate to achieve the increased lipid production.
  • the Y. lipolytica strains used in this study were derived from the wild-type Y.
  • YPD Rich medium
  • Bacto peptone Difco Laboratories, Detroit, MI
  • 10 g/L yeast extract Difco
  • 20 g/L glucose Sigma- Aldrich, St. Louis, MO
  • YNB medium was made with 1.7 g/L yeast nitrogen base (without amino acids) (Difco), 0.69 g/L CSM-Leu (MP Biomedicals, Solon, OH), and 20 g/L glucose.
  • Selective YNB plates contained 1.7 g/L yeast nitrogen base (without amino acids), 0.69 g/L CSM-Leu, 20 g/L glucose, and 15 g/L Bacto agar (Difco). Shake flask experiments were carried out using the following medium: 1.7 g/L yeast nitrogen base (without amino acids), 1.5 g/L yeast extract, and 50 g/L glucose. From frozen stocks, precultures were inoculated into YNB medium (5 mL in Falcon tube, 200 rpm, 28 °C, 24 hr).
  • Overnight cultures were inoculated into 50 mL of media in 250 mL Erlenmeyer shake flask to an optical density (A600) of 0.05 and allowed to incubate for 100 hours (200 rpm, 28 °C), after which biomass, sugar content, and lipid content were taken and analyzed.
  • A600 optical density
  • Bioreactor scale fermentation was carried out in a 2-liter baffled stirred-tank bioreactor.
  • the medium used contained 1.7 g/L yeast nitrogen base (without amino acids and ammonium sulfate), 2 g/L ammonium sulfate, 1 g/L yeast extract, and 90 g/L glucose. From a selective plate, an initial preculture was inoculated into YPD medium (40 mL in 250 mL Erlenmeyer flask, 200 rpm, 28 °C, 24 hr).
  • Exponentially growing cells from the overnight preculture were transferred into the bioreactor to an optical density (A600) of 0.1 in the 2-L reactor (2.5 vvm aeration, pH 6.8, 28°C, 250 rpm agitation).
  • Time point samples were stored at -20°C for subsequent lipid analysis.
  • Sugar organic acid content was determined by HPLC.
  • Biomass was determined by determined gravimetrically from samples washed and dried at 60°C for two nights.
  • the gene encoding for uracil prototrophy, orotidine-5'-phosphate decarboxylase was amplified and used as the basis of a knockout cassette for the generation of URA auxotrophic strains.
  • Upstream and downstream sequences of the URA open reading frame were amplified using primer pairs MT310 - MT311 and MT312 - MT313, respectively.
  • the primers are designed such that the two amplicons carry 23 bp overlapping region.
  • both products are mixed and a PCR is performed using the primers MT310 and MT313 to produce a 456 bp amplicon fusing the upstream and downstream amplicons.
  • This DNA was purified and subsequently transformed into Polg. Transformed cells were then plated on a selective media plate containing uracil and 5- Fluoroorotic Acid (5-FOA). Colonies which grew were replated on 5-FOA plates to reselect for URA auxotrophy, and verified by PCR of prepared genomic DNA.
  • the resulting ALEU2 AURA3 strain was named MTYL 100.
  • Plasmid pMT047 expressing ATP:citrate lyase subunit 1 was constructed by amplifying the ACL1 gene from Y. lipolytica Polg genomic DNA (Accession Number: XM_504787) and inserting it into the Mlul and Nsil sites of pMTOlO using primers MT252 and MT253. Plasmid pMT049 expressing ATP:citrate lyase subunit 2 was likewise constructed by amplifying the ACL2 gene from Y.
  • Polg genomic DNA (Accession Number: XM_503231) and inserting it into the Mlul and Nsil sites of pMTOlO using primers MT254 and MT255.
  • Plasmid pMT061 expressing Delta-9 fatty acid desaturase (D9) was amplified from Polg genomic DNA (Accession Number: XM_501496) and inserted into pINA1269 under control of the php4d promoter using the restriction sites Pmll and BamHI with primers MT283 and MT284.
  • a promoter-gene-terminator cassette was amplified from one plasmid using primers MT220 and MT265. This was then digested with Dpnl and Asel and inserted into a second plasmid that was digested with Nrul and Asel resulting in tandem gene construct pMT065.
  • the Asel restriction site was selected to facilitate selection, as it resides within the ampicillin resistance marker.
  • Nrul is a blunt end restriction site
  • ligation of the insertion does not increase the total number of Nrul sites, thus enabling iterative insertions using the same process.
  • the overall sequence and scheme used for the combinatorial construction of these plasmids is described in Figure 7.
  • pACYCDUET- 1 was selected as the complementary shuttle vector, as it utilizes a different backbone, selective marker and origin of replication.
  • the upstream sequences of LIP2 (Accession Number: XM_500282) was amplified from Y. lipolytica Polg genomic DNA using the primer pairs MT316 - MT317 and integrated into pDUET using the restriction sites BamHI and EcoRI.
  • the downstream sequence of LIP2 was amplified using primer pairs MT318 - MT319 and integrated into pDUET using the restriction sites Kpnl and Avrll.
  • the selective marker for yeast uracil pro to trophy was amplified from the plasmid JMP62-URA using primers pairs MT314 - MT315 and integrated into pDUET using the restriction sites Pvul and Kpnl.
  • the resulting plasmid pMT091 contained a multi-cloning site flanked by upstream and downstream LIP2 sequences and a URA3 marker. Digestion with the restriction enzyme SacII linearizes the plasmid and separates the integration vector from the plasmid backbone, minimizing the integration of foreign and unnecessary DNA.
  • RNA quantity was analyzed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE) and samples were stored in -80°C freezer.
  • qRT-PCR analyses were carried out using iScript One- step RT-PCR Kit with SYBR Green (Bio-Rad, Hercules, CA) using the Bio-Rad iCycler iQ Real-Time PCR Detection System.
  • GC analysis of FAMEs was performed with a Bruker 450-GC instrument equipped with a flame-ionization detector and a capillary column HP-INN OW AX (30 m x 0.25 mm).
  • the GC oven conditions were as follows: 150°C (1 min), a 10 min ramp to 230°C, hold at 230°C for 2 min.
  • the split ratio was 10: 1.
  • Fatty acids were identified and quantified by comparison with commercial FAME standards normalized to methyl tridecanoate (CI 3:0).
  • Total lipid content was calculated as the sum of total fatty acid contents for five FAMEs: methyl palmitate (CI 6:0), methyl palmitoleate (CI 6: 1), methyl stearate (CI 8:0), methyl oleate (C18: l), methyl linoleate (C18:2) (Sigma- Aldrich).
  • the addition of tridecanoic acid to the chloroform-methanol extraction fluid was used as the internal standard, which was carried through the entire analysis procedure and transesterified into its methyl ester.
  • Complementary vector construction allows for alternative method for expression of PGA.
  • the URA marker was knocked out of the parent strain Polg.
  • the extracellular lipase LIP2 gene was selected as the docking site, as this gene is well characterized and likely has a negligible or neutral effect on de novo lipid synthesis and accumulation.
  • LIP2 will be knocked out.
  • DGA diacylglycerol acyltransferase
  • the gene D9 When combined with other genes, the gene D9 was able to confer slight benefits to the lipid productivity. For example, MTYL069, overexpressing D9 and DGA, had higher lipid productivities than MTYL053, which contained only DGA overexpression. Likewise, MTYL066, overexpressing ACC and D9, had higher lipid productivities than MTYL040, overexpressing ACC alone. However, MTYL073, overexpressing ACC+D9+DGA, exhibited lower lipid productivity than MTYL065. There were no significant differences between MTYL089 and its D9-lacking variant, MTYL088. While some benefits were observed for accumulation and productivity, the benefits for yield were not significant.
  • D9 only improves lipid production in combination with other genes seems to suggest that D9 does not have strong regulatory or rate-limiting control over the lipid synthesis process, but its enzymatic action provides favorable conditions magnifying the effect of other genes.
  • D9 As a membrane-associated enzyme on the lipid body membrane and endoplasmic reticulum, D9 is upregulated during lipid accumulation phases (Morin et al. 2011). Many lipid synthesis enzymes have been found to have the highest specificities for oleate, which is the product of D9 desaturation (Oelkers et al. 2002). This is also demonstrated in the observation that Y.
  • lipolytica grows very rapidly on oleate as a carbon source and has extensively been studied growing off of this substrate (Beopoulos et al. 2008; Fickers et al. 2005). Consequently, an increased concentration of oleate, while not specifically driving lipid production or yield, transforms the fatty acid pool to be more rapidly sequestered. This ultimately results in faster rates of lipid accumulation without increases in yield, as increased sequestration will only occur in situations where lipid synthesis has already upregulated by other manipulations.
  • the strain was constructed from the transformation of two plasmids, pMT079 and pMT092, into the ALEU and AURA MTYL100 background strain of Y. lipolytica.
  • the use of two plasmids was primarily due to plasmid size considerations, as pMT079 already included four tandem expression cassettes and was 23 kb in length.
  • PCR of genomic DNA confirmed the successful integration of both plasmids into the strain, with confirmation of correct integration of each individual expression cassette.
  • RT-PCR analysis of the completed and verified strain relative to the control strain confirmed proper transcriptional overexpression of all five genes (Figure 10).
  • DGA which was the only gene under TEFin expression, demonstrates the enhancement characteristics of the spliceosomal intron even with the potential competition from numerous cassettes utilizing the same promoter.
  • ACC which was under control of the intronless TEF promoter, showed the lowest expression.
  • the lipogenic performance of the strain was tested in a 2-L bioreactor fermentation.
  • the C/N ratio of the media was adjusted to 100 to help promote lipid accumulation.
  • the C/N ratio determines the amount of excess carbon available in the fermentation once nitrogen has been depleted, and often requires delicate balancing to optimize lipid production over citrate production
  • Figure 11 shows the time profile for the duration of the batch fermentation. After 185 hrs of fermentation, all 90 g/L of glucose is consumed, yielding 26 g/L of biomass (dry cell weight) and a remarkable 76.8 % lipid content for a productivity of 0.109 g lipids/L/hr. The overall yield of lipids on glucose was 0.227 g lipids/g glucose, which is 70% of the theoretical maximum yield. During the lipid accumulation phase, from 66 to 185 hrs, a maximum in lipid productivity and yield were achieved, at 0.154 g lipids/L/hr and 0.277 g lipids/g glucose, respectively, with the yield increasing to 85% of the maximum theoretical yield.
  • Microscopy of the cell culture, shown in Figure 12, at the end of the fermentation shows that all the cells contain large vacuoles that occupy virtually the entire volume of the cell. Nile red staining and fluorescence indicates that the vacuoles are predominantly composed of neutral lipids. Even the few hyphal cells, which typically are less productive (Coelho et al. 2010), exhibit significant lipid accumulation producing multiple lipid bodies along the length of the cell.
  • MTYL089 exhibited better overall lipid yield, 0.227 g/g compared to 0.195 g lipid/g glucose in MTYL065. It also ended the fermentation with a higher titer, 20.2 g/L lipids, compared to 17.6 g/L.
  • Table 8 summarizes the comparison of key performance characteristics between 2-L fermentations of strain MTYL065 and MTYL089. Comparison of the fatty acid profiles
  • Lipid particle composition of the yeast Yarrowia lipolytica depends on the carbon source.
  • Elevated stearoyl-CoA desaturase-1 expression in skeletal muscle contributes to abnormal fatty acid partitioning in obese humans.
  • DGA1 diacylglycerol acyltransferase gene
  • LIP2 TEFin-DGA Table 7. List of all strains examined for lipid accumulation, labeled with the presence (+) or absence (-) of overexpression cassettes for the four targets: acetyl-coA carboxylase (ACC), diacylglycerol acyltransf erase (DGA), ATP: citrate lyase (ACL12), and A9-desaturase (D9).
  • ACC acetyl-coA carboxylase
  • DGA diacylglycerol acyltransf erase
  • ATP citrate lyase
  • D9-desaturase D9-desaturase
  • MTR002 Actin GGCCAGCCATATCGAGTCGCA 40
  • YPD media was prepared as described in Example 1.
  • the media constituents used in the bioreactor were yeast nitrogen base (without amino acids and ammonium sulfate) (Amresco), yeast extract (Difco), ammonium sulfate (Macron Chemicals), sodium acetate (Macron Chemicals) and acetic acid (Sigma Aldrich, St. Louis, MO). Bioreactor runs were carried out in 2L baffled stirred tank reactors. The inoculum for the bioreactor was prepared as described in Example 1. Bioreactor operation: acetate, acetic acid, and ammonium sulfate feeding
  • the initial media composition in the reactor was: 30 g/L sodium acetate, 2.5 g/L yeast extract, 4.25 g/L yeast nitrogen base and 2.4 g/L ammonium sulfate.
  • the yeast extract and yeast nitrogen base concentrations used in the experiments described in this section were higher as compared to those discussed in Example 1.
  • a carbon to nitrogen ratio (C/N) of 20 was chosen to provide sufficient nitrogen for biomass production.
  • a constant dissolved oxygen level of 20% was maintained at all times in the reactor using cascade control.
  • a pH setpoint of 7.3 was used.
  • acetic acid had several advantages, in that it served the dual purpose of providing a source of carbon to the growing and dividing cells and at the same time provided pH control.
  • acetic acid In order to maintain a low C/N ratio for the initial period of growth, a nitrogen source was fed concurrently with the acetic acid. The initial period of growth involved feeding 15 g/L ammonium sulfate per liter of 30% (vol/vol) acetic acid. The subsequent feed contained pure 100% acetic acid (and no ammonium sulfate), thus creating an increase in the C/N ratio as the nitrogen was consumed by the cells and depleted from the medium, resulting in improved lipid accumulation.
  • the working volume at the beginning of the run was 1.6 L. 1L of the acid and ammonium sulfate solution was added over the first 60 h. Around 200 ml of pure acetic acid was added over the subsequent 40 h. Culture volume was not removed at any point other than the sampling done every 24 h for the purpose of measurements. To compensate for the additional volume entering the reactor, liquid was allowed to evaporate. The high aeration rate (2.5 vvm) led to sufficient evaporation, which helped in maintaining the volume of the reactor. Even with evaporation, the volume of the broth did go up slightly to around 1.8L during the run.
  • Optical density (OD) of the culture broth was measured every 24 hours. Samples were stored at -20° C for lipid analysis. HPLC analysis yielded acetate levels in the reactor.
  • the lipid analysis involved a direct transesterification protocol, which was adapted from US Patent 7,932,077 and Griffiths et al. LIPIDS (2010) 45: 1053-1060, the entire contents of each of which are incorporated herein by reference.
  • the protocol employed 0.5 N sodium methoxide and 18 M sulfuric acid (Sigma Aldrich, St. Louis, MO). Sodium methoxide was generated in-house using sodium hydroxide (Macron Chemicals) and methanol (Sigma Aldrich, St. Louis, MO). 500 ⁇ of the 0.5 N sodium methoxide was first added to 1 mg of the pelleted cell sample followed by vortexing for 1 hour.
  • triheptadecanoate was used as the control instead of tridecanoic acid.
  • Figures 14 and 15 show trends of nitrogen, non-lipid and lipid titers, lipid content and
  • composition it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
  • values that are expressed as ranges can assume any specific value within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
  • any particular embodiment of the present invention may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and/or methods of the invention, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more elements, features, purposes, or aspects is excluded are not set forth explicitly herein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2012/061101 2011-10-19 2012-10-19 Engineered microbes and methods for microbial oil production Ceased WO2013059649A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
EP18161442.1A EP3388516A1 (en) 2011-10-19 2012-10-19 Engineered microbes and methods for microbial oil production
BR112014009245-1A BR112014009245A2 (pt) 2011-10-19 2012-10-19 célula oleaginosa e método para produção de óleos microbiano
JP2014537306A JP6294827B2 (ja) 2011-10-19 2012-10-19 操作された微生物および微生物油生成のための方法
RU2014119784A RU2652875C2 (ru) 2011-10-19 2012-10-19 Сконструированные микробы и способы получения микробного масла
EP12840947.1A EP2768954B1 (en) 2011-10-19 2012-10-19 Engineered microbes and methods for microbial oil production
CN201280060959.3A CN104160020A (zh) 2011-10-19 2012-10-19 工程改造的微生物及用于微生物油生产的方法
KR1020147013207A KR102036389B1 (ko) 2011-10-19 2012-10-19 조작된 미생물 및 미생물 오일 생산을 위한 방법

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161548901P 2011-10-19 2011-10-19
US61/548,901 2011-10-19
US201261663263P 2012-06-22 2012-06-22
US61/663,263 2012-06-22

Publications (1)

Publication Number Publication Date
WO2013059649A1 true WO2013059649A1 (en) 2013-04-25

Family

ID=48141406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/061101 Ceased WO2013059649A1 (en) 2011-10-19 2012-10-19 Engineered microbes and methods for microbial oil production

Country Status (8)

Country Link
US (2) US8951776B2 (https=)
EP (2) EP3388516A1 (https=)
JP (1) JP6294827B2 (https=)
KR (1) KR102036389B1 (https=)
CN (2) CN104160020A (https=)
BR (1) BR112014009245A2 (https=)
RU (1) RU2652875C2 (https=)
WO (1) WO2013059649A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014179748A3 (en) * 2013-05-03 2015-03-05 Board Of Regents, The University Of Texas System Compositions and methods for fungal lipid production
WO2015168531A1 (en) 2014-05-01 2015-11-05 Novogy, Inc. Increasing cellular lipid production by increasingthe activity of diacylglycerol acyltransferase and decreasing the activity of triacylglycerol lipase
US9862977B2 (en) 2011-10-19 2018-01-09 Massachusetts Institute Of Technology Engineered microbes and methods for microbial oil production
WO2022008929A1 (en) * 2020-07-10 2022-01-13 Imperial College Innovations Ltd Formate-inducible promoters and methods of use thereof
US11492647B2 (en) 2014-05-29 2022-11-08 Ginkgo Bioworks, Inc. Increasing lipid production in oleaginous yeast
WO2024097353A1 (en) * 2022-11-04 2024-05-10 Viridos, Inc. Recombinant algae having high biomass and lipid productivity

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8765404B2 (en) 2010-03-02 2014-07-01 Massachusetts Institute Of Technology Microbial engineering for the production of fatty acids and fatty acid derivatives
EP2836578A1 (en) * 2012-04-09 2015-02-18 BP Biofuels UK Ltd. Low polysaccharide microorganisms for production of biofuels and other renewable materials
KR102311681B1 (ko) 2015-07-28 2021-10-12 삼성전자주식회사 내산성을 갖는 효모 세포, 그를 이용하여 유기산을 생산하는 방법 및 상기 내산성 효모 세포를 생산하는 방법
JP2017039078A (ja) * 2015-08-19 2017-02-23 太平洋セメント株式会社 排水の処理方法
WO2017070065A1 (en) * 2015-10-20 2017-04-27 Massachusetts Institute Of Technology Strain and bioprocess engineering for high lipid production
CA3069697A1 (en) 2017-07-13 2019-01-17 Radici Chimica S.P.A. Biological methods for modifying cellular carbon flux
CN107904199A (zh) * 2017-11-30 2018-04-13 杭州唯铂莱生物科技有限公司 用于合成山扁豆酸的工程改造的宿主细胞和方法
CN110358692B (zh) * 2018-04-09 2021-07-27 中国科学院青岛生物能源与过程研究所 生产神经酸的重组酵母菌株及其应用
US20210261992A1 (en) * 2018-06-13 2021-08-26 Manus Bio, Inc. Enzymes, methods, and host cells for producing carminic acid
CN109929870B (zh) * 2019-02-20 2021-03-16 天津大学 糖代谢与脂质代谢协同提高解脂耶氏酵母合成脂肪酸衍生物的产量的应用
WO2025229117A1 (en) 2024-05-02 2025-11-06 Vib Vzw Yeast for increased lipid production
WO2026057627A1 (en) * 2024-09-11 2026-03-19 Vib Vzw Yeast for increased lipid production
CN119799810A (zh) * 2025-03-14 2025-04-11 山西鑫晋商生物科技有限公司 基于发酵工艺优化的二酯油微生物发酵方法及系统

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005118814A2 (en) 2004-06-04 2005-12-15 Fluxome Sciences A/S Metabolically engineered cells for the production of polyunsaturated fatty acids
US20060160193A1 (en) * 2003-07-02 2006-07-20 Yadav Narendra S Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts
US20090104674A1 (en) * 2004-11-04 2009-04-23 E.I. Du Pont De Nemours And Company Diacylglycerol Acyltransferases for Alteration of Polyunsaturated Fatty Acids and Oil Content in Oleaginous Organisms
WO2009073822A2 (en) 2007-12-04 2009-06-11 The Ohio State University Research Foundation Molecular approaches for the optimization of biofuel production
WO2010025374A2 (en) 2008-08-29 2010-03-04 E. I. Du Pont De Nemours And Company Manipulation of snf1 protein kinase activity for altered oil content in oleaginous organisms
US20100081178A1 (en) 2008-10-23 2010-04-01 Targeted Growth, Inc. Modified photosynthetic microorganisms for producing triglycerides
WO2010075440A1 (en) 2008-12-23 2010-07-01 Targeted Growth, Inc. Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
US7932077B2 (en) 2004-11-04 2011-04-26 E. I. Du Pont De Nemours And Company High eicosapentaenoic acid producing strains of Yarrowia lipolytica

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SK13872001A3 (sk) * 1999-04-01 2002-06-04 Basf Plant Science Gmbh Trieda enzýmov v biosyntetickej dráhe na produkciu triacylglycerolu a rekombinantné molekuly DNA kódujúce tieto enzýmy
US7202356B2 (en) * 2003-11-14 2007-04-10 E. I. Du Pont De Nemours And Company Fructose-bisphosphate aldolase regulatory sequences for gene expression in oleaginous yeast
US7198937B2 (en) * 2004-11-04 2007-04-03 E. I. Du Pont De Nemours And Company Mortierella alpina diacylglycerol acyltransferase for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms
CN101137752B (zh) 2005-03-08 2013-04-03 巴斯福植物科学有限公司 增强表达的内含子序列
CN101939434B (zh) * 2007-05-24 2015-03-25 纳幕尔杜邦公司 用于在大豆中提高种子贮藏油脂的生成和改变脂肪酸谱的来自解脂耶氏酵母的dgat基因
WO2011026008A1 (en) 2009-08-28 2011-03-03 Phycal Llc Biofuel from recombinant oleginous algae using sugar carbon sources
CA2784711A1 (en) * 2009-12-24 2011-06-30 E.I. Du Pont De Nemours And Company Plant membrane bound o-acyl transferase (mboat) family protein sequences and their uses for altering fatty acid compositions
US20110177564A1 (en) 2010-01-15 2011-07-21 Massachusetts Institute Of Technology Bioprocess and microbe engineering for total carbon utilization in biofuel production
US8765404B2 (en) 2010-03-02 2014-07-01 Massachusetts Institute Of Technology Microbial engineering for the production of fatty acids and fatty acid derivatives
TW201144442A (en) 2010-05-17 2011-12-16 Dow Agrosciences Llc Production of DHA and other LC-PUFAs in plants
AU2011349463B2 (en) 2010-12-20 2016-10-27 Lumen Bioscience, Inc. Modified photosynthetic microorganisms for producing lipids
US20140004580A1 (en) 2010-12-20 2014-01-02 Matrix Genetics, Llc Modified photosynthetic microorganisms for producing lipids
TW201307553A (zh) 2011-07-26 2013-02-16 Dow Agrosciences Llc 在植物中生產二十二碳六烯酸(dha)及其他長鏈多元不飽和脂肪酸(lc-pufa)之技術
BR112014009245A2 (pt) 2011-10-19 2020-10-27 Massachusetts Institute Of Technology célula oleaginosa e método para produção de óleos microbiano
WO2013116517A2 (en) * 2012-02-03 2013-08-08 Matrix Genetics, Llc Modified photosynthetic microorganisms for continuous production of carbon-containing compounds
US20150024442A1 (en) * 2012-03-09 2015-01-22 Matrix Genetics, Llc Modified diacylglycerol acyltransferase proteins and methods of use thereof
US9096876B2 (en) 2012-06-22 2015-08-04 Massachusetts Institute Of Technology Engineered microbes and methods for microbial oil overproduction from cellulosic materials

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060160193A1 (en) * 2003-07-02 2006-07-20 Yadav Narendra S Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts
WO2005118814A2 (en) 2004-06-04 2005-12-15 Fluxome Sciences A/S Metabolically engineered cells for the production of polyunsaturated fatty acids
US20060051847A1 (en) * 2004-06-04 2006-03-09 Gunnarsson Nina K Metabolically engineered cells for the production of polyunsaturated fatty acids
US20090104674A1 (en) * 2004-11-04 2009-04-23 E.I. Du Pont De Nemours And Company Diacylglycerol Acyltransferases for Alteration of Polyunsaturated Fatty Acids and Oil Content in Oleaginous Organisms
US7932077B2 (en) 2004-11-04 2011-04-26 E. I. Du Pont De Nemours And Company High eicosapentaenoic acid producing strains of Yarrowia lipolytica
WO2009073822A2 (en) 2007-12-04 2009-06-11 The Ohio State University Research Foundation Molecular approaches for the optimization of biofuel production
WO2010025374A2 (en) 2008-08-29 2010-03-04 E. I. Du Pont De Nemours And Company Manipulation of snf1 protein kinase activity for altered oil content in oleaginous organisms
US20100081178A1 (en) 2008-10-23 2010-04-01 Targeted Growth, Inc. Modified photosynthetic microorganisms for producing triglycerides
WO2010075440A1 (en) 2008-12-23 2010-07-01 Targeted Growth, Inc. Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products

Non-Patent Citations (105)

* Cited by examiner, † Cited by third party
Title
A. BEOPOULOS ET AL., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 74, 2008, pages 7779
A. BEOPOULOS ET AL., PROGRESS IN LIPID RESEARCH, vol. 48, 2009, pages 375
A. BEOPOULOS; J.-M. NICAUD; C. GAILLARDIN, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 90, 2011, pages 1193
A. FURGER; J. M. O. S. A. BINNIE; B. A. LEE; N. J. PROUDFOOT, GENES & DEVELOPMENT, vol. 16, 1 November 2002 (2002-11-01), pages 2792
A. T. IVASHCHENKO; M. I. TAUASAROVA; S. A. ATAMBAYEVA, MOLECULAR BIOLOGY, vol. 43, 2009, pages 24
ATHENSTAEDT K; JOLIVET P; BOULARD C; ZIVY M; NEGRONI L; NICAUD JM; CHARDOT T: "Lipid particle composition of the yeast Yarrowia lipolytica depends on the carbon source", PROTEOMICS, vol. 6, no. 5, 2006, pages 1450 - 1459, XP002506420, DOI: doi:10.1002/PMIC.200500339
BAILEY JE: "Toward a science of metabolic engineering", SCIENCE, vol. 252, no. 5013, 1991, pages 1668 - 1675, XP001147763, DOI: doi:10.1126/science.2047876
BALAN V; BALS B; CHUNDAWAT SP; MARSHALL D; DALE BE: "Lignocellulosic biomass pretreatment using AFEX Methods", MOL BIOL., vol. 581, 2009, pages 61 - 77, XP009170955, DOI: doi:10.1007/978-1-60761-214-8_5
BARTH G; GAILLARDIN C: "Physiology and genetics of the dimorphic fungus Yarrowia lipolytica", FEMS MICROBIOL. REV., vol. 19, no. 4, 1997, pages 219 - 237
BECKERICH JM; BOISRAME-BAUDEVIN A; GAILLARDIN C: "Yarrowia lipolytica: a model organism for protein secretion studies", INTERNATIONAL MICROBIOLOGY, vol. 1, no. 2, 1998, pages 123
BEOPOULOS A; CESCUT J; HADDOUCHE R; URIBELARREA JL; MOLINA-JOUVE C; NICAUD JM: "Yarrowia lipolytica as a model for bio-oil production", PROGRESS IN LIPID RESEARCH, vol. 48, no. 6, 2009, pages 375 - 387, XP055005437, DOI: doi:10.1016/j.plipres.2009.08.005
BEOPOULOS A; MROZOVA Z; THEVENIEAU F; LE DALL MT; HAPALA I; PAPANIKOLAOU S; CHARDOT T; NICAUD JM: "Control of lipid accumulation in the yeast Yarrowia lipolytica", APPL. ENVIRON. MICROBIOL., vol. 74, no. 24, 2008, pages 7779, XP002620271, DOI: doi:10.1128/AEM.01412-08
BEOPOULOS A; NICAUD J-M; GAILLARDIN C.: "An overview of lipid metabolism in yeasts and its impact on biotechnological processes", APPL. MICROBIOL. BIOTECHNOL., vol. 90, no. 4, 2011, pages 1193 - 1206, XP002697464, DOI: doi:10.1007/s00253-011-3212-8
BOULTON CA; RATLEDGE C: "Correlation of Lipid Accumulation in Yeasts with Possession of ATP: Citrate Lyase", JOURNAL OF GENERAL MICROBIOLOGY, vol. 127, no. 1, 1981, pages 169 - 176
C. H. ZHAO; W. CUI; X. Y. LIU; Z. M. CHI; C. MADZAK, METABOLIC ENGINEERING, 2010
C. MADZAK; B. TRETON; S. BLANCHIN-ROLAND, JOURNAL OF MOLECULAR MICROBIOLOGY AND BIOTECHNOLOGY, vol. 2, 2000, pages 207
C. MADZAK; C. GAILLARDIN; J. M. BECKERICH, JOURNAL OF BIOTECHNOLOGY, vol. 109, 2004, pages 63
C. R. SHEN ET AL., APPL. ENVIRON. MICROBIOL., vol. 77, 1 May 2011 (2011-05-01), pages 2905
C. RATLEDGE: "Longman Scientific & Technical", 1988, article "Single Cell Oil R. S. Moreton", pages: 33 - 70
C. SCIOLI; L. VOLLARO, WATER RESEARCH, vol. 31, 1997, pages 2520
CAO Y; YANG J; XIAN M; XU X; LIU W: "Increasing unsaturated fatty acid contents in Escherichia coli by coexpression of three different genes", APPL MICROBIOL BIOTECHNOL, 2010
CHEN DC; BECKERICH JM; GAILLARDIN C: "One-step transformation of the dimorphic yeast Yarrowia lipolytica", APPL. MICROBIOL. BIOTECHNOL, vol. 48, no. 2, 1997, pages 232 - 235
CHRISTINA SMOLKE: "The Metabolic Pathway Engineering Handbook", 28 July 2009, FUNDAMENTALS, CRC PRESS
CHRISTINA SMOLKE: "The Metabolic Pathway Engineering Handbook: Fundamentals", 28 July 2009, CRC PRESS
CHRISTINE GUTHRIE; GERALD R. FINK: "Guide to Yeast Genetics and Molecular and Cell Biology", vol. 351, 9 July 2002, ACADEMIC PRESS
CHRISTINE GUTHRIE; GERALD R. FINK: "Methods in Enzymology", vol. 350, 2 July 2002, ACADEMIC PRESS, article "Guide to Yeast Genetics and Molecular and Cell Biology"
CHUANG L-T; CHEN D-C; NICAUD J-M; MADZAK C; CHEN Y-H; HUANG Y-S: "Coexpression of heterologous desaturase genes in Yarrowia lipolytica", NEW BIOTECHNOLOGY, vol. 27, no. 4, 2010, pages 277 - 282, XP027171906
COELHO MAZ; AMARAL PFF; BELO I: "Current Research", 2010, FORMATEX RESEARCH CENTER, article "Technology and Education Topics in Applied Microbiology and Microbial Biotechnology", pages: 930 - 944
COURCHESNE NMD; PARISIEN A; WANG B; LAN CQ.: "Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches", J. BIOTECHNOL., vol. 141, no. 1-2, 2009, pages 31 - 41, XP055251804, DOI: doi:10.1016/j.jbiotec.2009.02.018
D. C. CHEN; J. M. BECKERICH; C. GAILLARDIN, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 48, 1997, pages 232
D. KLAUS; J. B. OHLROGGE; H. E. NEUHAUS; P. DORMANN, PLANTA, vol. 219, 2004, pages 389
DAVID C. AMBERG; DANIEL J. BURKE; JEFFREY N. STRATHERN: "Methods in Yeast Genetics", April 2005, A COLD SPRING HARBOR LABORATORY COURSE MANUAL
DAVID C. AMBERG; DANIEL J. BURKE; JEFFREY N. STRATHERN: "Methods in Yeast Genetics", April 2005, COLD SPRING HARBOR LABORATORY COURSE MANUAL
DAVIS MS; SOLBIATI J; CRONAN JR. JE: "Overproduction of Acetyl-CoA Carboxylase Activity Increases the Rate of Fatty Acid Biosynthesis in Escherichia coli", J. BIOL. CHEM., vol. 275, no. 37, 2000, pages 28593 - 28598, XP055012857, DOI: doi:10.1074/jbc.M004756200
DOBRZYN A; NTAMBI JM.: "The role of stearoyl-CoA desaturase in the control of metabolism", PROSTAGLANDINS LEUKOT ESSENT FATTY ACIDS, vol. 73, no. 1, 2005, pages 35 - 41, XP004949627, DOI: doi:10.1016/j.plefa.2005.04.011
DULERMO T; NICAUD J-M.: "Involvement of the G3P shuttle and 0-oxidation pathway in the control of TAG synthesis and lipid accumulation in Yarrowia lipolytica", METAB. ENG., vol. 13, no. 5, 2011, pages 482 - 491
E. BON ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages 1121
FEIST AM; ZIELINSKI DC; ORTH JD; SCHELLENBERGER J; HERRGARD MJ; PALSSON BO.: "Model-driven evaluation of the production potential for growth-coupled products of Escherichia coli", METAB ENG, vol. 12, no. 3, 2010, pages 173 - 186, XP027013810
FICKERS P; BENETTI PH; WACHE Y; MARTY A; MAUERSBERGER S; SMIT MS; NICAUD JM: "Hydrophobic substrate utilisation by the yeast Yarrowia lipolytica, and its potential applications", FEMS YEAST RES, vol. 5, no. 6-7, 2005, pages 527 - 543, XP004789303, DOI: doi:10.1016/j.femsyr.2004.09.004
FOLCH J; LEES M; SLOANE-STANLEY GH.: "A simple method for the isolation and purification of total lipids from animal tissues", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 226, no. l, 1957, pages 497 - 509
G. AGGELIS; M. KOMAITIS, BIOTECHNOLOGY LETTERS, vol. 21, 1999, pages 747
G. BARTH; C. GAILLARDIN, FEMS MICROBIOLOGY REVIEWS, vol. 19, 1997, pages 219
G. STEPHANOPOULOS, SCIENCE, vol. 315, January 1980 (1980-01-01), pages 2007
GREGORY N. STEPHANOPOULOS; ARISTOS A. ARISTIDOU; JENS NIELSEN: "Metabolic Engineering: Principles and Methodologies", 16 October 1998, ACADEMIC PRESS
GRIFFITHS ET AL., LIPIDS, vol. 45, 2010, pages 1053 - 1060
H. LE HIR; A. NOTT; M. J. MOORE, TRENDS IN BIOCHEMICAL SCIENCES, vol. 28, 2003, pages 215
HULVER MW; BERGGREN JR; CARPER MJ; MIYAZAKI M; NTAMBI JM; HOFFMAN EP; THYFAULT JP; STEVENS R; DOHM GL; HOUMARD JA: "Elevated stearoyl-CoA desaturase-1 expression in skeletal muscle contributes to abnormal fatty acid partitioning in obese humans", CELL METAB, vol. 2, no. 4, 2005, pages 251 - 261
J. B. OHLROGGE; J. G. JAWORSKI, ANNUAL REVIEW OF PLANT BIOLOGY, vol. 48, no. 109, 1997
J. CALLIS; M. FROMM; V. WALBOT, GENES & DEVELOPMENT, vol. 1, 1987, pages 1183
J. D. KEASLING, SCIENCE, vol. 330, 3 December 2010 (2010-12-03), pages 1355
J. FOLCH; M. LEES; G. H. SLOANE-STANLEY, J. BIOL. CHEM, vol. 226, 1957, pages 497
J. HILL; E. NELSON; D. TILMAN; S. POLASKY, D, TIFFANY, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 103, 2006, pages 11206
J. M. BECKERICH; A. BOISRAME-BAUDEVIN; C. GAILLARDIN, INTERNATIONAL MICROBIOLOGY: THE OFFICIAL JOURNAL OF THE SPANISH SOCIETY FOR MICROBIOLOGY, vol. 1, 1998, pages 123
J. SAMBROOK, D. W.: "Russell, Molecular cloning: a laboratory manual", 2001, CSHL PRESS
J. SAMBROOK; D. RUSSELL: "Molecular Cloning: A Laboratory Manual", 15 January 2001, COLD SPRING HARBOR LABORATORY PRESS
J. SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual", 15 January 2001, COLD SPRING HARBOR LABORATORY PRESS
JOHN N. ABELSON; MELVIN I. SIMON; CHRISTINE GUTHRIE; GERALD R. FINK: "Methods in Enzymology Series", vol. 194, 11 March 2004, ACADEMIC PRESS, article "Guide to Yeast Genetics and Molecular Biology"
JOHN N. ABELSON; MELVIN I. SIMON; CHRISTINE GUTHRIE; GERALD R. FINK: "Methods in Enzymology", vol. 194, 11 March 2004, ACADEMIC PRESS, article "Guide to Yeast Genetics and Molecular Biology"
K. ATHENSTAEDT ET AL., PROTEOMICS, vol. 6, 2006, pages 1450
K. ROESLER; D. SHINTANI; L. SAVAGE; S. BODDUPALLI; J. OHLROGGE, PLANT PHYSIOLOGY, vol. 113, 1 January 1997 (1997-01-01), pages 75
KAMISAKA Y; TOMITA N; KIMURA K; KAINOU K; UEMURA H.: "DGA1 (diacylglycerol acyltransferase gene) overexpression and leucine biosynthesis significantly increase lipid accumulation in the Asnf2 disruptant of Saccharomyces cerevisiae", BIOCHEMAL JOURNAL, vol. 408, no. l, 2007, pages 61 - 68, XP055208717, DOI: doi:10.1042/BJ20070449
KERSCHER S; DROSE S; ZWICKER K; ZICKERMANN V; BRANDT U.: "Yarrowia lipolytica, a yeast genetic system to study mitochondrial complex I", BIOCHIM BIOPHYS ACTA, vol. 1555, no. 1-3, 2002, pages 83 - 91, XP004379172, DOI: doi:10.1016/S0005-2728(02)00259-1
KOHLWEIN S; PETSCHNIGG J.: "Lipid-induced cell dysfunction and cell death: Lessons from yeast", CURRENT HYPERTENSION REPORTS, vol. 9, no. 6, 2007, pages 455 - 461
KURAT CF; NATTER K; PETSCHNIGG J; WOLINSKI H; SCHEURINGER K; SCHOLZ H; ZIMMERMANN R; LEBER R; ZECHNER R; KOHLWEIN SD.: "Obese Yeast: Triglyceride Lipolysis Is Functionally Conserved from Mammals to Yeast", J. BIOL. CHEM., vol. 281, no. 1, 2006, pages 491 - 500
L. M. BLANK; F. LEHMBECK; U. SAUER, FEMS YEAST RESEARCH, vol. 5, 2005, pages 545
L.-T. CHUANG ET AL., NEW BIOTECHNOLOGY, vol. 27, 2010, pages 277
M. ARES; L. GRATE; M. H. PAULING, RNA, vol. 5, 1999, pages 1138
MADZAK C; TRETON B; BLANCHIN-ROLAND S.: "Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica", J. MOL. MICROBIOL. BIOTECHNOL., vol. 2, no. 2, 2000, pages 207 - 216, XP002563024
MORIN N; CESCUT J; BEOPOULOS A; LELANDAIS G; LE BERRE V; URIBELARREA J-L; MOLINA-JOUVE C; NICAUD J-M.: "Transcriptomic Analyses during the Transition from Biomass Production to Lipid Accumulation in the Oleaginous Yeast Yarrowia lipolytica", PLOS ONE, vol. 6, no. 11, 2011, pages e27966, XP002730146, DOI: doi:10.1371/journal.pone.0027966
N. GASMI; A. AYED; J. M. NICAUD; H. KALLEL, MICROBIAL CELL FACTORIES, vol. 10, 2011, pages 38
N. M. D. COURCHESNE; A. PARISIEN; B. WANG; C. Q. LAN, JOURNAL OF BIOTECHNOLOGY, vol. 141, no. 31, 2009
NICAUD J-M; MADZAK C; VAN DEN BROEK P; GYSLER C; DUBOC P; NIEDERBERGER P; GAILLARDIN C: "Protein expression and secretion in the yeast Yarrowia lipolytica", FEMS YEAST RES, vol. 2, no. 3, 2002, pages 371 - 379
NTAMBI JM; MIYAZAKI M.: "Regulation of stearoyl-CoA desaturases and role in metabolism", PROG LIPID RES, vol. 43, no. 2, 2004, pages 91 - 104
OELKERS P; CROMLEY D; PADAMSEE M; BILLHEIMER JT; STURLEY SL: "The DGA1 gene determines a second triglyceride synthetic pathway in yeast", J. BIOL. CHEM., vol. 277, no. 11, 2002, pages 8877, XP002561443, DOI: doi:10.1074/jbc.M111646200
OHLROGGE JB; JAWORSKI JG: "Regulation of fatty acid synthesis", ANNU. REV. PLANT BIOL., vol. 48, no. 1, 1997, pages 109 - 136, XP000853519, DOI: doi:10.1146/annurev.arplant.48.1.109
P. OELKERS; D. CROMLEY; M. PADAMSEE; J. T. BILLHEIMER; S. L. STURLEY, JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 277, 2002, pages 8877
PAPANIKOLAOU S; AGGELIS G.: "Lipid production by Yarrowia lipolytica growing on industrial glycerol in a single-stage continuous culture", BIORESOUR. TECHNOL., vol. 82, no. l, 2002, pages 43 - 49, XP002537161, DOI: doi:10.1016/S0960-8524(01)00149-3
PAPANIKOLAOU S; MUNIGLIA L; CHEVALOT I; AGGELIS G; MARC I: "Yarrowia lipolytica as a potential producer of citric acid from raw glycerol", JOURNAL OF APPLIED MICROBIOLOGY, vol. 92, no. 4, 2002, pages 737 - 744
Q. LI; W. DU; D. LIU, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 80, 2008, pages 749
R. RUENWAI; S. CHEEVADHANARAK; K. LAOTENG, MOLECULAR BIOTECHNOLOGY, vol. 42, 2009, pages 327
R. W. BROWNSEY; A. N. BOONE; J. E. ELLIOTT; J. E. KULPA; W. M. LEE, BIOCHEMICAL SOCIETY TRANSACTIONS, vol. 34, 2006, pages 223
S. E. KARATAY; G. DONMEZ, BIORESOURCE TECHNOLOGY, vol. 101, 2010, pages 7988
S. MULLER; T. SANDAL; P. KAMP HANSEN; H. DALBOGE, YEAST, vol. 14, 1998, pages 1267
S. PAPANIKOLAOU ET AL., CURRENT MICROBIOLOGY, vol. 52, 2006, pages 134
S. PAPANIKOLAOU; G. AGGELIS, BIORESOURCE TECHNOLOGY, vol. 82, 2002, pages 43
S. PAPANIKOLAOU; G. AGGELIS, CURRENT MICROBIOLOGY, vol. 46, 2003, pages 398
S. PAPANIKOLAOU; I. CHEVALOT; M. KOMAITIS; I. MARC; G. AGGELIS, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 58, 2002, pages 308
S. PAPANIKOLAOU; L. MUNIGLIA; I. CHEVALO; G. AGGELIS; I. MARC, JOURNAL OF APPLIED MICROBIOLOGY, vol. 92, 2002, pages 737
S. PAPANIKOLAOU; L. MUNIGLIA; I. CHEVALOT; G. AGGELIS; I. MARC, CURRENT MICROBIOLOGY, vol. 46, 2003, pages 124
SAMBROOK J; RUSSELL DW: "Molecular cloning: a laboratory manual", 2001, CSHL PRESS
See also references of EP2768954A4
T. DULERMO; J.-M. NICAUD, METABOLIC ENGINEERING IN PRESS, CORRECTED PROOF, 2011
T. KAMIRYO; Y. NISHIKAWA; M. MISHINA; M. TERAO; S. NUMA, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 76, 1979, pages 4390
TEHLIVETS O; SCHEURINGER K; KOHLWEIN SD: "Fatty acid synthesis and elongation in yeast", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - MOLECULAR AND CELL BIOLOGY OF LIPIDS, vol. 1771, no. 3, 2007, pages 255 - 270, XP005930165, DOI: doi:10.1016/j.bbalip.2006.07.004
TYO KE; ALPER HS; STEPHANOPOULOS GN: "Expanding the metabolic engineering toolbox: more options to engineer cells", TRENDS BIOTECHNOL, vol. 25, no. 3, 2007, pages 132 - 137, XP005896606, DOI: doi:10.1016/j.tibtech.2007.01.003
V. ANDRIANOV ET AL., PLANT BIOTECHNOLOGY JOURNAL, vol. 8, 2009, pages 277
VORAPREEDA T; THAMMARONGTHAM C; CHEEVADHANARAK S; LAOTENG K.: "Alternative routes of acetyl-CoA synthesis identified by comparative genomic analysis: involvement in the lipid production of oleaginous yeast and fungi", MICROBIOLOGY, vol. 158, no. 1, 2012, pages 217 - 228, XP055109083, DOI: doi:10.1099/mic.0.051946-0
W. CUI ET AL., PROCESS BIOCHEMISTRY, vol. 46, 2011, pages 1442
X. LIU; J. SHENG; R. CURTISS III, PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, 26 April 2011 (2011-04-26), pages 6899
Y. A. TSIGIE; C.-Y. WANG; C.-T. TRUONG; Y.-H. JU, BIORESOURCE TECHNOLOGY IN PRESS, CORRECTED PROOF, 2011
Y. KAMISAKA; N. TOMITA; K. KIMURA; K. KAINOU; H. UEMURA, BIOCHEM J, vol. 408, 2007, pages 61
Y. X. HUO ET AL., NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 346
YANG B; WYMAN CE: "Dilute acid and autohydrolysis pretreatment", METHODS MOL BIOL., vol. 581, 2009, pages 103 - 14
ZHANG H; DAMUDE HG; YADAV NS.: "Three diacylglycerol acyltransferases contribute to oil biosynthesis and normal growth in Yarrowia lipolytica", YEAST, vol. 1, 2011, pages 25 - 38
ZHAO S; FERNALD RD: "Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction", JOURNAL OF COMPUTATIONAL BIOLOGY, vol. 12, no. 8, 2005, pages 1047 - 1064, XP002380886, DOI: doi:10.1089/cmb.2005.12.1047

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9862977B2 (en) 2011-10-19 2018-01-09 Massachusetts Institute Of Technology Engineered microbes and methods for microbial oil production
US10920233B2 (en) 2013-05-03 2021-02-16 Board Of Regents, The University Of Texas System Compositions and methods for lipid production
EP2992091A2 (en) * 2013-05-03 2016-03-09 Board of Regents, The University of Texas System Compositions and methods for fungal lipid production
WO2014179748A3 (en) * 2013-05-03 2015-03-05 Board Of Regents, The University Of Texas System Compositions and methods for fungal lipid production
US9896691B2 (en) 2013-05-03 2018-02-20 Board Of Regents, The University Of Texas System Compositions and methods for lipid production
CN106687595A (zh) * 2014-05-01 2017-05-17 诺沃吉公司 通过提高二酰基甘油酰基转移酶活性并降低三酰甘油脂酶活性来提高细胞脂质产量
EP3137616A4 (en) * 2014-05-01 2017-11-29 Novogy Inc. Increasing cellular lipid production by increasingthe activity of diacylglycerol acyltransferase and decreasing the activity of triacylglycerol lipase
US10443047B2 (en) 2014-05-01 2019-10-15 Novogy, Inc. Increasing cellular lipid production by increasing the activity of diacylglycerol acyltransferase and decreasing the activity of triacylglycerol lipase
WO2015168531A1 (en) 2014-05-01 2015-11-05 Novogy, Inc. Increasing cellular lipid production by increasingthe activity of diacylglycerol acyltransferase and decreasing the activity of triacylglycerol lipase
US11492647B2 (en) 2014-05-29 2022-11-08 Ginkgo Bioworks, Inc. Increasing lipid production in oleaginous yeast
EP4174186A1 (en) * 2014-05-29 2023-05-03 Ginkgo Bioworks, Inc. Increasing lipid production in oleaginous yeast
WO2022008929A1 (en) * 2020-07-10 2022-01-13 Imperial College Innovations Ltd Formate-inducible promoters and methods of use thereof
WO2024097353A1 (en) * 2022-11-04 2024-05-10 Viridos, Inc. Recombinant algae having high biomass and lipid productivity

Also Published As

Publication number Publication date
BR112014009245A2 (pt) 2020-10-27
RU2014119784A (ru) 2015-11-27
RU2652875C2 (ru) 2018-05-03
JP2014530626A (ja) 2014-11-20
US9862977B2 (en) 2018-01-09
KR102036389B1 (ko) 2019-10-24
EP2768954A4 (en) 2015-09-23
EP3388516A1 (en) 2018-10-17
EP2768954B1 (en) 2018-12-05
US8951776B2 (en) 2015-02-10
US20150167034A1 (en) 2015-06-18
CN109468241A (zh) 2019-03-15
EP2768954A1 (en) 2014-08-27
CN104160020A (zh) 2014-11-19
US20130143282A1 (en) 2013-06-06
KR20140091004A (ko) 2014-07-18
JP6294827B2 (ja) 2018-03-14

Similar Documents

Publication Publication Date Title
US9862977B2 (en) Engineered microbes and methods for microbial oil production
US10006065B2 (en) Microbial engineering for the production of fatty acids and fatty acid derivatives
Tai et al. Engineering the push and pull of lipid biosynthesis in oleaginous yeast Yarrowia lipolytica for biofuel production
US11142770B2 (en) Isolated oleaginous yeast
US9879248B2 (en) Engineered microbes and methods for microbial oil overproduction from cellulosic materials
Kumari et al. Tailored designing of a diploid S. cerevisiae natural isolate for increased production of fatty acid ethyl ester
US12188073B2 (en) Yeast cells and methods for producing fatty alcohols
US20240200019A1 (en) Genetically modified yeast cells and methods of use for increased lipid yield
Tai Metabolic engineering of oleaginous yeast for the production of biofuels
Weyda et al. Increased production of free fatty acids and triglycerides in Aspergillus carbonarius by metabolic engineering of fatty acid biosynthesis and degradation pathways
CN102869768B (zh) 生产脂肪酸和脂肪酸衍生物的微生物工程
Stephanopoulos et al. Engineered microbes and methods for microbial oil production

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12840947

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2014537306

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012840947

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147013207

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2014119784

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014009245

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014009245

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140416