WO2013055865A1 - Micrornas in neurodegenerative disorders - Google Patents

Micrornas in neurodegenerative disorders Download PDF

Info

Publication number
WO2013055865A1
WO2013055865A1 PCT/US2012/059671 US2012059671W WO2013055865A1 WO 2013055865 A1 WO2013055865 A1 WO 2013055865A1 US 2012059671 W US2012059671 W US 2012059671W WO 2013055865 A1 WO2013055865 A1 WO 2013055865A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
subject
level
micrornas
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/059671
Other languages
English (en)
French (fr)
Inventor
Howard Weiner
Oleg Butovsky
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Brigham and Womens Hospital Inc
Original Assignee
Brigham and Womens Hospital Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to NZ623459A priority Critical patent/NZ623459B2/en
Priority to EP16193582.0A priority patent/EP3170899B1/en
Priority to HK15101851.9A priority patent/HK1201294B/en
Priority to EP12839637.1A priority patent/EP2766482B1/en
Priority to MX2014004516A priority patent/MX2014004516A/es
Priority to BR112014008925-6A priority patent/BR112014008925A2/pt
Priority to AU2012322788A priority patent/AU2012322788B2/en
Priority to US14/350,977 priority patent/US10184151B2/en
Priority to KR1020147012433A priority patent/KR20140074997A/ko
Application filed by Brigham and Womens Hospital Inc filed Critical Brigham and Womens Hospital Inc
Priority to JP2014535856A priority patent/JP6234370B2/ja
Priority to CA2851280A priority patent/CA2851280C/en
Priority to CN201280061082.XA priority patent/CN104011210B/zh
Publication of WO2013055865A1 publication Critical patent/WO2013055865A1/en
Anticipated expiration legal-status Critical
Priority to US15/699,546 priority patent/US20180023142A1/en
Priority to US16/251,945 priority patent/US20190276892A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02Muscle relaxants, e.g. for tetanus or cramps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • Inflammation has been implicated in a number of neurodegenerative disorders (e.g., amyotrophic lateral sclerosis (ALS) and multiple sclerosis). For example, increased ALS and multiple sclerosis.
  • peripheral motor axons In the peripheral nervous system, degeneration of peripheral motor axons is an early and significant pathological feature in ALS patients and in animal models of ALS, and is preceded by the recruitment and activation of macrophages (Chiu et al., Proc. Natl. Acad. Sci. U.S.A.
  • mice A specific monocyte subset (Ly6C Hl ) in mice participates in tissue damage and disease pathogenesis in a mouse models of multiple sclerosis (King et al, Blood 113:3190-3197, 2009), and these monocytes are recruited to inflamed tissues by CCL2 (Kim et al, Immunity 34:769-780, 2011; Getts et al, J. Exp. Med. 205:2319-2337, 2008). Summary of the Invention
  • the invention is based, at least in part, on the discovery that specific microRNAs and inflammatory marker genes are increased or decreased in the cerebrospinal fluid (CSF) and in CD14 + CD16 " and CD14 + CD16 + monocytes from subjects having neurodegenerative diseases compared to the expression level of these microRNAs and these inflammatory marker genes in the CSF and in CD14 CD16 " and CD14 + CD16 + monocytes from healthy subjects.
  • the specific microRNAs and inflammatory marker genes that have been identified as being increased or decreased in the CSF and/or in CD14 CD16 " and/or CD14 + CD16 + monocytes in subjects having a neurodegenerative disease are listed in Tables 1-21.
  • the inflammatory markers as described herein are listed in Tables 20 and 21.
  • a neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • methods of diagnosing a neurodegenerative disorder include determining a level of one or more microRNAs and/or one or more inflammatory markers listed in any one or more of Tables 1-21 in a monocyte (e.g., CD14 CD16 " and CD14 CD16 monocyte) or in CSF from the subject, and comparing the level of the one or more microRNAs and/or one or more
  • inflammatory markers to a reference level of the one or more microRNAs and/or one or more inflammatory markers (e.g., a threshold level or a level present in the CSF, or a CD14 CD16 " or a CD14 + CD16 + monocyte from a healthy subject).
  • a threshold level or a level present in the CSF or a CD14 CD16 " or a CD14 + CD16 + monocyte from a healthy subject.
  • an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers relative to the reference level indicates that the subject has a neurodegenerative disorder.
  • neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • a monocyte e.g., CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte) or CSF from the subject
  • comparing the level of the one or more microRNAs and/or the one or more inflammatory markers to a reference level of the one or more microRNAs and/or the one or more inflammatory markers e.g., a threshold level or a level present in the CSF, or a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte) from a healthy subject).
  • an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers relative to the reference level indicates that the subject has an increased or decreased risk of developing a neurodegenerative disorder (e.g., relative to a person who does not show an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers relative to a reference level).
  • Also provided are methods of predicting the rate of disease progression in a subject having a neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • a neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • determining a level of one or more microRNAs and/or one or more inflammatory markers listed in any one or more of Tables 1-21 in a monocyte e.g., CD14 CD16 " or
  • CD14 + CD16 + monocyte e.g., a peripheral or blood-derived monocyte
  • CSF CSF from the subject
  • comparing the level of the one or more microRNAs and/or the one or more inflammatory markers to a reference level of the one or more microRNAs and/or the one or more inflammatory markers e.g., a threshold level or a level present in the CSF or a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte) from a healthy subject.
  • an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers relative to the reference level indicates that the subject will have an increased or decreased rate of disease progression (e.g., relative to a person who does not show an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers relative to a reference level).
  • Also provided are methods of selecting a subject for treatment of a neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • a neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • neurodegenerative disorder e.g., amyotrophic lateral sclerosis or multiple sclerosis
  • a subject that include determining a level of one or more microRNAs and/or one or more inflammatory markers listed in any one or more of Tables 1-21 in a monocyte (e.g., a CD14 CD16 " or
  • CD14 + CD16 + monocyte e.g., a peripheral or blood-derived monocyte
  • CSF CSF from the subject at a first time point
  • determining a level of the one or more microRNAs and/or the one or more inflammatory markers in a monocyte e.g., a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte) or CSF from the subject at a second time point following administration of at least one dose of a treatment
  • a return or approach to levels in a healthy subject at the second time point indicates that the treatment was effective in the subject (e.g., the treatment was effective relative to a subject having the same neurodegenerative disorder and receiving the same treatment, but does not show a return or approach to levels in a healthy subject at the second time point (e.g., an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers compared to a reference value as described herein), or does not show as significant of an increase or decrease in the level of the one or more microRNAs and/or the one or more inflammatory markers compared to a reference value as described herein).
  • a reference level of the one or more microRNAs and/or the one or more inflammatory markers e.g., a peripheral or blood-derived monocyte
  • an agent e.g., an inhibitory nucleic acid, e.g., an antagomir
  • Also provided are methods of treating a neurodegenerative disorder (e.g., amyotrophic lateral sclerosis or multiple sclerosis) in a subject that include administering to a subject at least one agent (e.g., a nucleic acid containing a sense (protein-encoding) nucleic acid) that increases the expression or activity of one or more of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19, and/or one or more of the
  • a neurodegenerative disorder e.g., ALS, such as sporadic ALS or familial ALS, or multiple sclerosis
  • a neurodegenerative disorder e.g., ALS, such as sporadic ALS or familial ALS, or multiple sclerosis
  • administering to a subject having a neurodegenerative disorder (e.g., ALS, such as sporadic ALS or familial ALS, or multiple sclerosis) at least one inhibitory nucleic acid (e.g., siRNA, an antisense
  • oligonucleotide comprising a sequence that is complementary to a contiguous sequence present in hsa-miR- 155 (e.g., a contiguous sequence present in the precursor or mature form of hsa-miR- 155).
  • an inhibitory nucleic acid comprising a sequence that is complementary to a contiguous sequence, e.g., a contiguous sequence of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, present in hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR- 142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR- 374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa- miR-223, h
  • the sequence is complementary to a contiguous sequence of at least 7 or 8 nucleotides present in hsa- miR- 155.
  • methods of diagnosing amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR- 142-5p, hsa- miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR, hsa
  • ALS amyotrophic lateral sclerosis
  • methods of diagnosing amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a reference level of the one or more of hsa-miR-27b, hsa-miR
  • Also provided are methods of diagnosing familial amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of hsa-miR-27b and a level of one or more of hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) of a subject; and comparing the level of hsa-miR-27b in the CSF of the subject to a reference level of hsa-miR-27b, and the level of one or more of hsa-miR-99b, hsa-miR- 146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a reference level of one or
  • Also provided are methods of diagnosing sporadic amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of two or more microRNAs selected from the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa- miR-532-3p in cerebrospinal fluid (CSF) of a subject; and comparing the level of the two or more microRNAs in the CSF of the subject to a reference level of the two or more microRNAs; whereby an increase in the level of the two or more microRNAs in the CSF of the subject compared to the reference level indicates that the subject has sporadic ALS.
  • ALS amyotrophic lateral sclerosis
  • ALS amyotrophic lateral sclerosis
  • a level of one or more microRNAs selected from the group consisting of: hsa-miR- 19b, hsa-miR- 106b, hsa-miR-30b, hsa-miR-21, hsa-miR- 142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR
  • Also provided are methods of identifying a subject at risk of developing amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of one or more of hsa-miR- 27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a reference level of the one or more of hsa-miR-27b, hsa-miR-99b,
  • ALS amyotrophic lateral sclerosis
  • methods of identifying a subject at risk of developing sporadic amyotrophic lateral sclerosis that include: determining a level of two or more microRNAs selected from the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) of a subject; and comparing the level of the two or more microRNAs in the CSF of the subject with a reference level of the two or more microRNAs, whereby an increase in the level of the two or more microRNAs in the CSF of the subject compared to the reference level indicates that the subject has an increased risk of developing sporadic ALS.
  • CSF cerebrospinal fluid
  • ALS amyotrophic lateral sclerosis
  • a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa- miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24
  • CD14 CD16 monocyte from the subject as compared to the reference level indicates that the subject will have an increased rate of disease progression.
  • ALS amyotrophic lateral sclerosis
  • methods of predicting the rate of disease progression in a subject having amyotrophic lateral sclerosis that include: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a reference level of the one or more of hsa-miR-27b, hsa-
  • an increase in the rate of disease progression is an increased rate of onset of one or more symptoms of ALS, an increase in the worsening of one or more symptoms of ALS, an increase in the frequency of one or more symptoms of ALS, an increase in the duration of one or more symptoms of ALS, or a decrease in the longevity of the subject.
  • ALS amyotrophic lateral sclerosis
  • methods of selecting a subject for treatment of amyotrophic lateral sclerosis that include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR- 30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hs
  • ALS amyotrophic lateral sclerosis
  • methods for selecting a subject for treatment of amyotrophic lateral sclerosis that include: determining a level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid (CSF) in a subject; and comparing the level of one or more of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the CSF of the subject to a reference level of the one or more of hsa-miR-27b, hsa-miR-99
  • ALS amyotrophic lateral sclerosis
  • methods for selecting a subject for treatment of sporadic amyotrophic lateral sclerosis that include: determining a level of two or more microRNAs selected from the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR- 328, and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of the two or more microRNAs in the CSF of the subject to a reference level of the two or more microRNAs; and selecting a subject having an increase in the level of the two or more microRNAs in the CSF compared to the reference level for treatment of sporadic ALS.
  • CSF cerebrospinal fluid
  • the selected subject is further administered a treatment for ALS.
  • Also provided are methods of selecting a subject for participation in a clinical study that include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa- miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-miR-181a,
  • Also provided are methods of selecting a subject for participation in a clinical study that include: determining a level of one or more microRNAs selected from the group consisting of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid (CSF) of a subject; comparing the level of the one or more microRNAs in the CSF of the subject to a reference level of the one or more microRNAs; and selecting a subject having an increase in the level of the one or more microRNAs in the CSF compared to the reference level for participation in a clinical study.
  • CSF cerebrospinal fluid
  • Also provided are methods of determining the efficacy of treatment of amyotrophic lateral sclerosis in a subject that include: determining a level of one or more microRNAs selected from the group consisting of: hsa-miR-19b, hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR- 142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR
  • Also provided are methods of determining the efficacy of treatment of amyotrophic lateral sclerosis (ALS) in a subject that include: determining a level of one or more of hsa-miR- 27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in cerebrospinal fluid of the subject at a first time point; determining a level of one or more of hsa- miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in CSF of the subject at a second time point following administration of at least one dose of a treatment; and comparing the level of one or more of hsa-miR
  • the reference level is a threshold level. In some embodiments, the reference level is a level found in a CD14 CD16 " monocyte (e.g., a peripheral or blood-derived monocyte) from a control subject. In some embodiments, the reference level is a level found in the CSF of a control subject.
  • a CD14 CD16 " monocyte e.g., a peripheral or blood-derived monocyte
  • Some embodiments of the methods described herein further include obtaining a biological sample (e.g., a sample containing blood, plasma, serum, or cerebrospinal fluid) containing a CD 14 + CD 16 " monocyte from the subject.
  • a biological sample e.g., a sample containing blood, plasma, serum, or cerebrospinal fluid
  • the method further comprises purifying a CD14 CD16 " monocyte from the biological sample.
  • Some embodiments of the methods described herein further include obtaining a sample containing CSF from the subject.
  • the microRNA or the one or more microRNA is a precursor microRNA. In some embodiments of any of the methods described herein, the microRNA or the one or more microRNA is a mature microRNA.
  • ALS amyotrophic lateral sclerosis
  • a contiguous sequence e.g., a contiguous sequence of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, preferably at least 7 or 8 nucleotides
  • hsa-miR-19b hsa-miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa- miR-340, hsa-miR-30e, hs
  • ALS amyotrophic lateral sclerosis
  • the at least one inhibitory nucleic acid is an antagomir (e.g., an antagomir contains or has a sequence of SEQ ID NO: 262).
  • the at least one inhibitory nucleic acid is an antisense oligonucleotide.
  • the at least one inhibitory nucleic acid is a ribozyme.
  • the at least one inhibitory inhibitory nucleic acid is injected into the cerebrospinal fluid of a subject (e.g., intracranial injection or intrathecal injection).
  • the at least one inhibitory nucleic acid is complexed with one or more cationic polymers and/or cationic lipids.
  • the inhibitory nucleic acid is delivered using a lentivirus vector.
  • Also provided are methods of using at least one antagomir comprising a sequence that is complementary to a contiguous sequence present in any one of hsa-miR-155, hsa-miR-19b, hsa- miR-106b, hsa-miR-30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR- 374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa- miR-223, hsa-miR-26a, hsa-miR-26b, hsa-miR-24, hsa-mi
  • antagomirs comprising a sequence that is complementary to a contiguous sequence present in any one of hsa-miR-155, hsa-miR-19b, hsa-miR-106b, hsa-miR- 30b, hsa-miR-21, hsa-miR-142-5p, hsa-miR-27a, hsa-miR-16, hsa-miR-374a, hsa-miR-374b, hsa-miR-101, hsa-miR-340, hsa-miR-30e, hsa-miR-29c, hsa-miR-29a, hsa-miR-223, hsa-miR- 26a, hsa-miR-26b, hsa-miR-24, hsa-miR-18
  • inhibitory nucleic acid e.g., an antagomir
  • methods of using at least one inhibitory nucleic acid comprising a sequence that is complementary to a contiguous sequence present in hsa-miR-155 in the manufacture of a medicament for treating amyotrophic lateral sclerosis in a subject.
  • inhibitory nucleic acids e.g., antagomirs
  • containing a sequence that is complementary to a contiguous sequence present in hsa-miR-155 for use in treating amyotrophic lateral sclerosis in a subject.
  • RNA refers to a molecule comprising at least one or more
  • RNA includes double- stranded RNA, single- stranded RNA, isolated RNA, such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly-produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Nucleotides of the RNA molecules can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides.
  • a “mature microRNA” typically refers to a single-stranded RNA molecules of about 21-23 nucleotides in length, which regulates gene expression. miRNAs are encoded by genes from whose DNA they are transcribed, but miRNAs are not translated into protein; instead each primary transcript (pri-miRNA) is processed into a short stem-loop structure (precursor microRNA) before undergoing further processing into a functional mature miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their main function is to down-regulate gene expression. As used throughout, the term “microRNA” or “miRNA” includes both mature microRNA and precursor microRNA.
  • the term "inflammatory marker” refers to any of the proteins or mRNAs listed in Tables 20 and 21.
  • the proteins and mRNAs listed in Tables 20 and 21 have been implicated for a role in inflammation.
  • Methods for detecting the levels or activity of the inflammatory markers are known in the art. Additional methods for detecting the levels or activity of the inflammatory markers are described herein.
  • reference level is meant a control level of one of the microRNAs listed in Tables 1-19 or one of the inflammatory markers listed in Tables 20 and 21.
  • a reference level may represent a threshold level of a specific microRNA or inflammatory marker.
  • a reference level may also be a level of a particular microRNA or inflammatory marker present in the cerebrospinal fluid or in a monocyte (e.g., a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte)) from a healthy subject (e.g., a subject that does not present with two or more symptoms of a neurodegenerative disorder, a subject that has not been diagnosed with a neurodegenerative disorder, and/or a subject that has no family history of neurodegenerative disease).
  • a monocyte e.g., a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., a peripheral or blood-derived monocyte)
  • a healthy subject e.g.,
  • increase is meant an observable, detectable, or significant increase in a level as compared to a reference level or a level measured at an earlier or later time point in the same subject.
  • decrease is meant an observable, detectable, or significant decrease in a level as compared to a reference level or a level measured at an earlier or later time point in the same subject.
  • neurodegenerative disorder a neurological disorder characterized by a progressive loss of neuronal function and structure, and neuron death.
  • Non-limiting examples of neurodegenerative disorders include Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), brain stroke, brain tumors, cardiac ischemia, age-related macular degeneration (AMD), retinitis pigmentosa (RP), amyotrophic lateral sclerosis (ALS, e.g., familial ALS and sporadic ALS), and multiple sclerosis (MS).
  • PD Parkinson's disease
  • AD Alzheimer's disease
  • HD Huntington's disease
  • RP retinitis pigmentosa
  • ALS amyotrophic lateral sclerosis
  • MS multiple sclerosis
  • inhibitory RNA a nucleic acid molecule that contains a sequence that is complementary to a target nucleic acid (e.g., a target microRNA or target inflammatory marker, e.g., any of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, or any of the inflammatory markers listed in Table 21) that mediates a decrease in the level or activity of the target nucleic acid (e.g., activity in CD14 CD16 " or CD14 + CD16 + monocyte).
  • target nucleic acid e.g., a target microRNA or target inflammatory marker, e.g., any of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, or any of the inflammatory markers listed in Table 21
  • a target nucleic acid e.g., a target microRNA or target inflammatory marker, e.g., any of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, or any of the inflammatory markers listed in Table 21
  • an interfering RNA refers to any double stranded or single stranded RNA sequence, capable— either directly or indirectly (i.e., upon conversion)— of inhibiting or down regulating gene expression by mediating RNA interference.
  • Interfering RNA includes but is not limited to small interfering RNA ("siRNA”) and small hairpin RNA (“shRNA”).
  • siRNA small interfering RNA
  • shRNA small hairpin RNA
  • RNA interference refers to the selective degradation of a sequence-compatible messenger RNA transcript.
  • an shRNA small hairpin RNA refers to an RNA molecule comprising an antisense region, a loop portion and a sense region, wherein the sense region has
  • the small hairpin RNA is converted into a small interfering RNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family.
  • small interfering RNA or “siRNA” as used herein refers to any small RNA molecule capable of inhibiting or down regulating gene expression by mediating RNA interference in a sequence specific manner.
  • the small RNA can be, for example, about 18 to 21 nucleotides long.
  • an “antagomir” refers to a small synthetic RNA having complementarity to a specific microRNA target, optionally with either mispairing at the cleavage site or one or more base modifications to inhibit cleavage.
  • post-transcriptional processing refers to mRNA processing that occurs after transcription and is mediated, for example, by the enzymes Dicer and/or Drosha.
  • risk of developing disease is meant the relative probability that a subject will develop a neurodegenerative disorder in the future as compared to a control subject or population (e.g., a healthy subject or population).
  • a control subject or population e.g., a healthy subject or population.
  • methods for determining a subject's risk of developing a neurodegenerative disease in the future include determining the level of one or more of the microRNAs listed in Tables 1-19 and/or one or more of the inflammatory markers listed in Tables 20-21.
  • rate of disease progression is meant one or more of the rate of onset of symptoms of a neurodegenerative disorder in a subject, the rate of the increasing intensity (worsening) of symptoms of a neurodegenerative disorder in a subject, the frequency of one or more symptoms of a neurodegenerative disorder in a subject, the duration of one or more symptoms of a neurodegenerative disorder in a subject, or the longevity of subject.
  • an increased rate of disease progression can include one or more of: an increased rate of onset of symptoms of a neurodegenerative disorder in a subject, an increased frequency of one or more symptoms of a neurodegenerative disorder in a subject, an increase in the duration of one or more symptoms of a neurodegenerative disorder in a subject, or a decrease in the longevity of a subject.
  • neurodegenerative disorder are described herein.
  • purifying is meant a partial isolation of a substance from its natural environment (e.g., partial removal of contaminating biomolecules or cells).
  • a monocyte e.g., a CD14 CD16 " or CD14 + CD16 + monocyte
  • a monocyte can be purified from other cell types present in a sample of peripheral blood (e.g., using fluorescence-assisted cell sorting).
  • treating includes reducing the number of symptoms or reducing the severity, duration, or frequency of one or more symptoms of disease (e.g., a neurodegenerative disease) in a subject.
  • treating can also include reducing the risk of developing a neurodegenerative disorder in a subject, delaying the onset of symptoms of a neurodegenerative disorder in a subject, or increasing the longevity of a subject having a neurodegenerative disorder.
  • cationic polymer is meant a polymeric material that is positively-charged at a physiological pH (e.g., a pH of approximately 6.5 to 8.0) that is capable of condensing nucleic acids into nanoparticles.
  • a physiological pH e.g., a pH of approximately 6.5 to 8.0
  • Non- limiting examples of cationic polymers include poly-L- lysine and poly(ethylenimine). Additional examples of cationic polymers are known in the art.
  • cationic lipids a lipid that has at least one positive charge at a physiological pH (e.g., a pH of approximately 6.5 to 8.0) that is able to form a complex with a nucleic acid.
  • a physiological pH e.g., a pH of approximately 6.5 to 8.0
  • Non-limiting examples of cationic lipids include l,2-dioleoyl-3- trimethylammonium propone (DOTAP), N-methyl-4-(dioleyl)methylpyridinium, and 3 ⁇ -[ ⁇ - (N',N'-dimethylaminoethane)-carbamoyl] cholesterol.
  • DOTAP l,2-dioleoyl-3- trimethylammonium propone
  • N-methyl-4-(dioleyl)methylpyridinium N-methyl-4-(dioleyl)methylpyridinium
  • Figure 1A is a volcano plot of significantly dysregulated microRNAs in CD39 + microglia in SOD G93A mice compared to the expression of microRNAs in CD39 + microglia from non- transgenic litermates at a presymptomatic (60 days) time point (Presymptomatic), at the time of onset of symptoms (Onset), and at the end-stage of the disease (End-Stage).
  • the x-axis represents changes in expression (log 2 -fold change based on ddCT values) and the y-axis shows the statistical significance of the change in log-odds.
  • Figure IB is a Venn diagram of significantly dysregulated microRNAs in CD39 + microglia in SOD G93A mice compared to the expression of the microRNAs in CD39 + microglia from non-transgenic litermates across all disease stages. The numbers represent significantly dysregulated microRNAs at each disease stage.
  • Figure 1C is a summary of significantly dysregulated microRNAs in CD39 + microglia in SOD G93A mice compared to the expression of the microRNAs in CD39 + microglia from non- transgenic litermates. These data were validated in singleplex TaqMan PCR.
  • Figure 2A is a volcano plot of significantly dysregulated microRNAs in Ly6C Hl monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Hl monocytes from non-transgenic litermates at a presymptomatic (60 days) time point (Presymptomatic), at the time of onset of symptoms (Onset), and at the end-stage of disease (End-Stage).
  • the x-axis represents changes in expression (log 2 -fold change based on ddCT values) and the y-axis shows statistical significance of the change in log-odds.
  • Figure 2B is a Venn diagram of significantly dysregulated microRNAs in Ly6C Hl monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Hl monocytes from non-transgenic litermates across all disease stages (presymptomatic, onset of symptoms, and the end-stage of disease). The numbers represent significantly dysregulated microRNAs at each disease stage.
  • Figure 2C is a summary of significantly dysregulated microRNAs in Ly6C Hl monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Hl monocytes from non- transgenic litermates. These data were validated in singleplex TaqMan PCR.
  • Figure 3 A is a volcano plot of significantly dysregulated microRNAs in Ly6C Low monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Low monocytes from non-transgenic litermates at a presymptomatic (60 days) time point, at the time of onset of symptoms (Onset), and at the end-stage of disease (End-Stage).
  • the x-axis represents changes in expression (log 2 -fold change based on ddCT values) and the y-axis shows statistical significance of the change in log-odds.
  • Figure 3B is a Venn diagram of significantly dysregulated microRNAs in Ly6C Low monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Low monocytes from non-transgenic litermates across all disease stages. The numbers represent significantly dysregulated microRNAs at each disease stage.
  • Figure 3C is a summary of significantly dysregulated microRNAs in Ly6C Low monocytes in SOD G93A mice compared to the expression of the microRNAs in Ly6C Low monocytes from non-transgenic litermates. These data were validated in singleplex TaqMan PCR.
  • Figure 4 is a graph and a table showing the results of Ingenuity pathway analysis of the 32 dysregulated microRNAs in Ly6C Hl monocytes (as compared to non-transgenic litermate controls) across all disease stages in SODl mice.
  • the graph shows patterns observed in skeletal diseases, muscular diseases, and myopathic disorders.
  • Figure 5 is a heatmap showing the nCounter expression profiling of blood-derived CD14 + CD16 " monocytes for 664 microRNAs in sporadic ALS (8 subjects) and relapsing- remitting multiple sclerosis (8 subjects) compared to the expression of the microRNAs in CD14 CD16 " monocytes from healthy controls (8 subjects).
  • the heatmap shows the results of analysis of variance (ANOVA) using Dunnett's post hoc test (P ⁇ 0.01).
  • the microRNAs upregulated or downregulated in CD14 + CD16 " monocytes from ALS subjects are indicated.
  • Each row of the heatmap represents an individual gene and each column an individual.
  • Figure 6 is a heatmap showing the nCounter expression profiling of blood-derived CD14 + CD16 " monocytes for 664 microRNAs in sporadic ALS (8 subjects) and relapsing- remitting multiple sclerosis (8 subjects) compared to the expression of these microRNAs in CD14 CD16 " monocytes from healthy controls (8 subjects).
  • the heatmap shows the results of ANOVA using Dunnett's post hoc test (P ⁇ 0.01). The microRNAs upregulated or
  • Figure 7A is a Venn diagram of the unique or similar dysregulated (upregulated or downregulated) microRNAs in CD 14 + CD 16 " monocytes from ALS and MS subjects as compared to the expression of the microRNAs in CD 14 + CD 16 " monocytes from healthy controls.
  • Figure 7B is a volcano plot showing the significantly dysregulated microRNAs in CD 14 + CD 16 " monocytes from ALS subjects as compared to the expression of the microRNAs in CD 14 + CD 16 " monocytes from healthy controls.
  • Figure 7C is a volcano plot showing the significantly dysregulated microRNAs in CD 14 + CD 16 " monocytes from MS subjects as compared to the expression of the microRNAs in CD 14 + CD 16 " monocytes from healthy controls.
  • Figure 8 is a summary of the significantly dysregulated microRNAs in CD14 CD16 " monocytes from ALS and MS subjects compare d to the expression of the microRNAs in CD14 + CD16 " monocytes from healthy controls.
  • the bars show the relative expression of dysregulated microRNAs in CD14 + CD16 " monocytes from ALS and MS subjects compared to the expression of the microRNAs in CD14 + CD16 " monocytes from healthy controls.
  • Figure 9 is a set of six graphs showing the expression of six different microRNAs in CD 14 + CD 16 " monocytes from healthy subjects (8 subjects) and subjects having ALS (11 subjects) (as determined by real-time PCR).
  • a two-tiled Mann- Whitney t-test was used to calculate the P values (*, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001).
  • Figure 10A is two graphs showing the clinical scoring (forced vital capacity (FVC) score and Functional Rating Scale (FRS)) of eight different ALS patients.
  • FVC force vital capacity
  • FRS Functional Rating Scale
  • Figure 10B is a list of the eight different ALS patients described in Figures 10A and IOC.
  • Figure IOC is twenty graphs showing the expression of twenty upregulated microRNAs in CD 14 + CD 16 " monocytes from sporadic ALS subjects (8 subjects), healthy subjects, and subjects having MS (determined using real-time PCR). A two-tiled Mann- Whitney t-test was used to calculate the P values.
  • Figure 12A is two graphs showing the clinical scoring (forced vital capacity (FVC) score and Functional Rating Scale (FRS)) of eight different ALS patients.
  • FVC force vital capacity
  • FRS Functional Rating Scale
  • Figure 12B is a list of the eight different ALS patients described in Figures 12A and 12C.
  • Figure 12C is twenty graphs showing the expression of twenty downregulated
  • microRNAs in CD 14 + CD 16 monocytes from sporadic ALS subjects as compared to healthy subjects, and subjects having MS-relapsing remitting (MS-RR) (determined using real-time PCR).
  • MS-RR MS-relapsing remitting
  • a two-tiled Mann- Whitney t-test was used to calculate the P values (*, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001).
  • Figure 13 is eight graphs showing the expression of eight upregulated microRNAs in CD 14 + CD 16 " monocytes from sporadic ALS and MS-RR as compared to healthy subjects, subjects (8 subjects in each group) (determined using real-time PCR). The data shown were generated using one-way ANOVA and the Dunett's multiple comparison test (**, P ⁇ 0.01; p ⁇ 0.001).
  • Figure 14 is five different graphs showing the expression of five upregulated microRNAs in CD 14 + CD 16 " monocytes from MS-RR subjects as compared to healthy subjects and subjects having ALS (8 subjects) (determined using real-time PCR).
  • a two-tiled Mann- Whitney t-test was used to calculate the P values (*, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001).
  • Figure 15 is five graphs showing the expression of five downregulated microRNAs in CD 14 + CD 16 " monocytes from MS-RR subjects as compared to healthy subjects, and subjects having sporadic ALS (determined by real-time PCR). A two-tiled Mann- Whitney t-test was used to calculate the P values (*, P ⁇ 0.05).
  • Figure 18 A is two volcano plots showing the significantly dysregulated inflammatory marker genes in CD14 + CD16 " monocytes from ALS subjects (left graph) and MS subjects (right graph) compared to the level of the inflammatory marker genes in CD14 + CD16 " monocytes from healthy controls.
  • Figure 18B is a summary of the significantly dysregulated inflammatory marker genes in CD 14 + CD 16 " monocytes from ALS and MS subjects compared to the level of the inflammatory marker genes in CD 14 + CD 16 " monocytes from healthy controls.
  • the bars show the relative expression of dysregulated inflammatory marker genes in CD14 + CD16 " monocytes from ALS and MS subjects compared to the expression of these genes in CD 14 + CD 16 " monocytes from healthy controls.
  • MicroRNAs upregulated or downregulated in CD14 + CD16 + monocytes from ALS subjects relative to CD14 + CD16 + monocytes from healthy subjects are indicated.
  • MicroRNAs upregulated or downregulated in CD14 + CD16 + monocytes from MS subjects relative to the expression of the microRNAs in CD14 + CD16 + monocytes from healthy subjects are indicated.
  • Figure 20C is a summary of the significantly dysregulated microRNAs in CD14 + CD16 + monocytes in ALS and MS subjects compared to the expression of the microRNAs in
  • CD14 + CD16 + monocytes from healthy controls show the relative expression of dysregulated microRNAs in CD14 + CD16 + monocytes from ALS and MS subjects compared to the expression of the microRNAs in CD14 + CD16 + monocytes in healthy controls.
  • Figure 21 A is nCounter expression profiles of 179 inflammatory marker genes in Ly6C Hl spleen-derived monocyte subsets from S0D1 G93A mice compared to the same cells non- transgenic (Tg) litermates at presymptomatic (60d), onset (defined by body weight loss), and end-stage of disease.
  • a heatmap of the ANOVA with Dunett's post hoc test (P ⁇ 0.01) results showing genes with at least 2-fold altered transcription levels is shown. Each row of the heatmap represents an individual gene and each column an individual group in biological triplicates (n 3 arrays for each group of pool of 4-5 mice at each time point). Non-transgenic replicates at each disease stage were collapsed and genes hierarchically clustered. Gene expression level was normalized against the geometric mean of six house-keeping genes (CLTC, GAPDH, GUSB, HPRT1, PGK1, and TUBB5).
  • Figure 2 IB is nCounter expression profile data showing inflammatory marker genes that are significantly downregulated in Ly6C Hl spleen-derived monocyte subsets from S0D1 G93A mice compared to the same cells in non-transgenic (Tg) litermates at presymptomatic (60d), onset (defined by body weight loss), and end-stage of disease.
  • Figure 21C is a list of the major biological networks activated in Ly6C Hl spleen-derived monocytes one month prior to disease onset in S0D1 G93A mice.
  • Figure 2 ID shows the nCounter expression profile data of genes upregulated in spinal cord-derived CD39 + microglia from S0D1 G93A mice compared to the same cells from non- transgenic litermates.
  • Figure 2 IE shows the nCounter expression profile data of genes downregulated in spinal cord-derived CD39 + microglia from S0D1 G93A mice compared to the same cells from non- transgenic litermates.
  • Figure 21F is a list of the major biological pathways activated in CD39 + microglia the spinal cords of SODl mice at the onset of disease
  • Figure 21G is a comparative analysis of the significantly upregulated genes in CD39 + microglia from spinal cords of SODl mice at the onset versus CD39 + microglia isolated from the brain of the same SODl mice.
  • Figure 22B is a graphic showing the fold differences in expression of significantly dysregulated genes in sporadic ALS and MS subjects as compared to healthy controls. Gene expression level was normalized against the geometric mean of 6 internal reference housekeeping genes (CLTC, GAPDH, GUSB, PGK1, and TUBB5).
  • Figure 22C is a graphic showing the principal components analysis (PCA) analysis of the identified dysregulated genes between sporadic ALS subjects and MS subjects with spatial gene distribution.
  • PCA principal components analysis
  • Figure 23 A is an nCounter expression profile of blood- sorted CD 14 + CD 16 " monocytes for 511 immune- and 184-inflammation-related genes in sporadic ALS (10 subjects), and familial SOD1 ALS (4 subjects) compared to healthy controls (10 subjects).
  • the profile is an nCounter expression profile of blood- sorted CD 14 + CD 16 " monocytes for 511 immune- and 184-inflammation-related genes in sporadic ALS (10 subjects), and familial SOD1 ALS (4 subjects) compared to healthy controls (10 subjects). The profile
  • heatmap is an unsupervised hierarchial clustering (Pearson correlation) that shows the significantly dysregulated genes (Nonparametric Kruskal- Wallis test; significance based on false discovery rate (FDR) determined by the Benjamini-Hochberg method; selected FDR limit: 0.05; P ⁇ 0.01).
  • FDR false discovery rate
  • Figure 23B is a graphic showing the fold differences of significantly dysregulated genes in blood-sorted CD 14 + CD 16 " monocytes from sporadic ALC and familial ALS subjects versus healthy controls. Gene expression level was normalized against the geometric mean of 15 internal reference house-keeping genes (ABCF1, ALAS 1 , EEF1G, G6PD, GAPDH, GUSB, HPRT1, OAZ1, POLR1B, POLR2A, PPIA, RPL19, DSHA, TBP, and TUBB).
  • 15 internal reference house-keeping genes ABCF1, ALAS 1 , EEF1G, G6PD, GAPDH, GUSB, HPRT1, OAZ1, POLR1B, POLR2A, PPIA, RPL19, DSHA, TBP, and TUBB.
  • Figure 23 C is a graphic of the PCA analysis of the identified dysregulated genes in blood-sorted CD 14 + CD 16 " monocytes from sporadic ALS and familial ALS subjects vs. healthy controls with spatial gene distribution.
  • Figure 24 is a set of eight graphs showing the real-time PCR validation of eight genes that were the most significantly dysregulated in blood- sorted CD 14 + CD 16 " monocytes from familial and /or sporadic ALS subjects compared to blood-sorted CD 14 + CD 16 " monocytes from healthy controls.
  • the relative expression in sporadic ALS and familial ALS against healthy controls was calculated using the comparative Ct (2-AACt) method.
  • Gene expression level was normalized against the geometric mean of three house-keeping genes (GAPDH, TUBB, and GRB2). The polymerase chain reactions were run in duplicate for each subject.
  • the graphs represent one-way analysis of variance (ANOVA) and the Dunett's multiple comparison test of significantly dysregulated genes in ALS subjects.
  • ANOVA analysis of variance
  • Figure 25 is a graphic of the Ingenuity target filter analysis showing the top 10 miRNA- mRNA interactions in CD14 + CD16 " blood monocytes from ALS subjects based on the identified significantly dysregulated miRNAs and mRNAs in CD 14 CD 16 " blood monocytes from ALS subjects.
  • Figure 26 is a table of the results of the microRNA-mRNA target analysis performed on the data gathered from CD14 CD16 " blood monocytes from ALS subjects (IP A; Ingenuity). The results show 32 miRNAs targeting 27 mRNAs.
  • Figure 27 is a graphic depicting the microRNA-mRNA interactions in blood-sorted CD 14 + CD 16 " monocytes in ALS. The graphic depicts the results for the significantly
  • Figure 28 is two graphs showing the distribution of possible random interactions between 1000 random and non-regulated miRNA-mRNA pairs in comparison to the observed putative miRNA-mRNA pairs in 41 non-regulated highly expressed miRNAs and the 47 dysregulated genes observed in splenic Lys6C Hl monocytes from SOD1 mice ( Figure 28 A), and 64 non- regulated highly expressed miRNAs and the 59 dysregulated genes observed in CD14 + CD16 " peripheral blood monocytes from ALS subjects ( Figure 28B) (Targetscan 4.1).
  • Figure 29 is a table showing the top 20 transcription factors and target genes dysregulated in blood-sorted CD14+CD16- monocytes from ALS subjects (determined using GeneGo pathway analysis), and a graphic showing the specificity protein- 1 (SP1) transcription factor and its targeted genes in blood-sorted CD14+CD16- monocytes in ALS subjects.
  • SP1 specificity protein- 1
  • Figure 30 is a graph of the Kaplan-Meir analysis of the probability of surviving for both the SODl/miR-155 "7" and the SODl/miR-155 +/” mice. Mantel-Cox's F-test comparison between groups SODl/miR-155 "7” vs. SODl/miR-155 +/” mice (P ⁇ 0.0001).
  • Figure 31 is graph of the time-to-event analysis for disease neurologic onset (neurological severity score 2). Disease onset was significantly delayed (P ⁇ 0.0001) in SODl/miR-155 "7" mice compared to the SODl/miR-155 +/" mice.
  • Figure 32 is a graph of the rotarod performance of the SODl/miR-155 "7" and SODl/miR- 155 +/" mice as a function of age. **P ⁇ 0.01; ***P ⁇ 0.001; by factorial ANOVA and Fisher's LSD post-hoc test.
  • Figure 33 is a graph of the weight loss of SODl/miR-155 "7" and SODl/miR-155 +/” mice. Statistical analysis was performed using 2-way ANOVA, Bonferri post-hoc test. ***P ⁇ 0.001.
  • Figure 34 is a set of two graphs showing the duration of an early disease phase (from onset to 5% weight loss) (left graph) and duration of an later disease phase (from 5% weight loss to end stage) for the SODl/miR-155 "7" and SOD l/miR-155 +/ ⁇ mice.
  • Figure 35A shows the fluorescence-activated cell sorting (FACS) analysis data of spinal cord-derived mononuclear cells stained with 4D4 (resident microglia) and CDl lb (myeloid cells) in wildtype, SODl/miR155 +/+ , SODl/miR155 "/+ , and SODl/miR ⁇ 7" mice.
  • FACS fluorescence-activated cell sorting
  • Figure 35B shows the absolute number of microglia (4D4 positive) and monocyte cells (CDl lb positive) cells per spinal cord in wildtype, SODl/miR155+/+, SODl/miR155-/+, and SODl/miR155-/- mice.
  • Figure 36 is a set of four heat maps of showing the expression of inflammation-related genes in spinal cord microglia and Ly6C Hl splenic monocytes in WT, SODl/miR155 "/+ , and SOD l/miR155 _/ ⁇ mice.
  • the heat maps labeled (a) are from animals at end-stage. (Note that SODl/miR155 _/ ⁇ mice are still viable and breeding at the end of the study, while SODl/miR /+ mice experience an onset of symptoms (end stage)). All mice are males C57/BI6-SOD1 background.
  • the heat maps labeled (b) indicate the genes significantly affected by miR155 in SOD1 mice.
  • Figure 37 is nCounter expression profile data showing the expression of several mouse microRNAs in Ly6CHi spleen-derived monocyte subsets from wild type, SODl/miR155 "/+ , SOD l/miR155 _/" mice.
  • Figure 38 is a heatmap and bar graphs showing the nCounter expression profiling of blood-derived CD14 + CD16 " monocytes for microRNAs in sporadic ALS (8 subjects) and relapsing -remitting multiple sclerosis (8 subjects) compared to the expression of the microRNAs in CD14 CD16 " monocytes from healthy controls (8 subjects).
  • the heatmap shows the results of analysis of variance (ANOVA) using Dunnett's post hoc test (P ⁇ 0.01).
  • the microRNAs upregulated or downregulated in CD14 + CD16 " monocytes from ALS subjects are indicated.
  • Each row of the heatmap represents an individual gene and each column an individual.
  • the invention is based, at least in part, on the discovery that specific microRNAs and inflammatory markers are dysregulated in CD14 CD16 " monocytes and/or CD14 + CD16 + monocytes (e.g., peripheral or blood-derived monocytes) from patients having a
  • ALS e.g., sporadic ALS and familial ALS
  • MS neurodegenerative disorder
  • hsa-miR-155 plays a significant role in the development of disease in a mouse model of ALS.
  • methods for diagnosing a neurodegenerative disorder identifying a subject at risk (e.g., increased risk or decreased risk) of developing a neurodegenerative disorder, predicting the rate of disease progression in a subject having a neurodegenerative disorder, selecting a subject for treatment of a neurodegenerative disorder, selecting a treatment for a subject having a neurological disorder, determining the efficacy of treatment of a neurodegenerative disorder, and selecting a subject for participation in a clinical study are provided herein. These methods include measuring a level of one or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) microRNAs listed in one or more of Tables 1-19 and/or one or more inflammatory markers listed in Tables 20-21.
  • a level of one or more e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10
  • Also provided are methods of treating a neurodegenerative disorder e.g., ALS or MS
  • a neurodegenerative disorder e.g., ALS or MS
  • administering e.g., an agent (e.g., a nucleic acid) that decreases the level or activity of one or more of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (e.g., hsa-miR-155), and/or increases the level or activity of one or more of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19.
  • an agent e.g., a nucleic acid
  • hsa-miR-155 e.g., hsa-miR-155
  • Also provided are methods of treating a neurological disorder e.g., ALS or MS
  • a neurological disorder e.g., ALS or MS
  • administering e.g., an agent (e.g., a nucleic acid) that decreases the expression (e.g., protein or mRNA) and/or activity of one or more of the inflammatory markers listed in Table 21 and/or increases the expression (e.g., protein or mRNA) and/or activity of one or more of the genes listed in Table 20.
  • an agent e.g., a nucleic acid
  • a nucleic acid that decreases the expression (e.g., protein or mRNA) and/or activity of one or more of the inflammatory markers listed in Table 21 and/or increases the expression (e.g., protein or mRNA) and/or activity of one or more of the genes listed in Table 20.
  • nucleic acids that contain a sequence complementary to a sequence present in any one of the microRNAs listed in Tables 1-19 or a sequence present in an mRNA that encodes any of the genes listed in Tables 20 and 21 (e.g., a primer or probe).
  • nucleic acids that contain a sequence that is complementary to a sequence present in any one of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (the target microRNA), or a sequence present in a mRNA encoded by any of the genes listed in Table 21 (the target mRNA), that decrease the expression or activity of the target microRNA or target mRNA (e.g., an inhibitory RNA, e.g., any of the inhibitory nucleic acids described herein).
  • the target microRNA e.g., an inhibitory RNA, e.g., any of the inhibitory nucleic acids described herein.
  • compositions that contain a nucleic acid that includes the sequence of any one of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19 (the target microRNA), or a sequence present in an mRNA encoded by any of the genes listed in Table 20 (the target mRNA), that increase the expression or activity of the target microRNA or target mRNA. Also included are compositions that contain at least one antibody that specifically binds to any one of the proteins listed in Table 20 and Table 21. Also included are compositions that contain at least one protein listed in Table 20 and Table 21. Also provided are kits that contain one or more of the above nucleic acids, proteins, or antibodies (in any combination).
  • Neurodegenerative disorders are a class of neurological diseases that are characterized by the progressive loss of the structure and function of neurons and neuronal cell death.
  • Infiammation has been implicated for a role in several neurodegenerative disorders. Progressive loss of motor and sensory neurons and the ability of the mind to refer sensory information to an external object is affected in different kinds of neurodegenerative disorders.
  • Non-limiting examples of neurodegenerative disorders include Parkinson's disease, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS, e.g., familial ALS and sporadic ALS), and multiple sclerosis (MS).
  • ALS amyotrophic lateral sclerosis
  • MS multiple sclerosis
  • a health care professional may diagnose a subject as having a neurodegenerative disorder by the assessment of one or more symptoms of a neurodegenerative disorder in the subject.
  • Non- limiting symptoms of a neurodegenerative disorder in a subject include difficulty lifting the front part of the foot and toes; weakness in arms, legs, feet, or ankles; hand weakness or clumsiness; slurring of speech; difficulty swallowing; muscle cramps; twitching in arms, shoulders, and tongue; difficulty chewing; difficulty breathing; muscle paralysis; partial or complete loss of vision; double vision; tingling or pain in parts of body; electric shock sensations that occur with head movements; tremor; unsteady gait; fatigue; dizziness; loss of memory; disorientation; misinterpretation of spatial relationships; difficulty reading or writing; difficulty concentrating and thinking; difficulty making judgments and decisions; difficulty planning and performing familiar tasks; depression; anxiety; social withdrawal; mood swings; irritability; aggressiveness; changes in sleeping habits; wandering; dementia; loss of automatic movements; impaired posture and balance;
  • a health care professional may also base a diagnosis, in part, on the subject's family history of a neurodegenerative disorder.
  • a health care professional may diagnose a subject as having a neurodegenerative disorder upon presentation of a subject to a health care facility (e.g., a clinic or a hospital).
  • a health care professional may diagnose a subject as having a neurodegenerative disorder while the subject is admitted in an assisted care facility.
  • a physician diagnoses a neurodegenerative disorder in a subject after the presentation of one or more symptoms.
  • a neurodegenerative disorder in a subject e.g., a subject presenting with one or more symptoms of a neurodegenerative disorder or a subject not presenting a symptom of a neurodegenerative disorder (e.g., an undiagnosed and/or asymptomatic subject).
  • prognostic methods and methods of treating a neurodegenerative disorder in a subject e.g., methods of decreasing the rate of onset or the progression of symptoms (e.g., ataxia) of a neurodegenerative disorder in a subject).
  • any combination of one or more of the markers described herein can be used in any of the methods described herein, e.g., used in methods for diagnosing a neurodegenerative disorder in a subject, identifying a subject at risk (e.g., increased or decreased risk) of developing a neurodegenerative disorder, predicting the rate of disease progression in a subject having a neurodegenerative disorder, selecting a subject for treatment of a neurodegenerative disorder, determining the efficacy of treatment in a subject having a neurodegenerative disorder, or selecting a subject for participation in a clinical study.
  • MicroRNA markers increased in monocytes (CD 14 CD 16 " or CD 14 CD 16 monocytes) or the CSF in subjects having a neurodegenerative disorder relative to healthy controls
  • CD14 + CD16 or CD14 + CD16 + monocytes, or the CSF in healthy controls are listed in Table 1.
  • ACUUGCUGCUCCAGCAGG (EQ ID NO: 6) hsa-miR-30b uguaaacauccuacacuca ACCAAGUUUCAGUUCAUGUAAACAUCCUACAC gcu (SEQ ID NO: 7) UCAGCUGUAAUACAUGGAUUGGCUGGGAGGU
  • AGUUCCGCCCCCCAG (SEQ ID NO: 13) hsa-miR-16 uagcagcacguaaauauu GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUG ggcg (SEQ ID NO: GCGUUAAGAUUCUAAAAUUAUCUCCAGUAUU 14) AACUGUGCUGCUGAAGUAAGGUUGAC (SEQ ID NO: 13) hsa-miR-16 uagcagcacguaaauauu GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUG ggcg (SEQ ID NO: GCGUUAAGAUUCUAAAAUUAUCUCCAGUAUU 14) AACUGUGCUGCUGAAGUAAGGUUGAC (SEQ ID NO: 13) hsa-miR-16 uagcagcacguaaauauu GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUG ggcg (SEQ ID NO: GCGUUAAGAU
  • GCUCGGGGACCGG (SEQ ID NO: 41) hsa-miR-24 uggcucaguucagcagga CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUC acag (SEQ ID NO: AUUUUACACACUGGCUCAGUUCAGCAGGAACA 42) GGAG (SEQ ID NO: 44) uggcucaguucagcagga CUCUGCCUCCCGUGCCUACUGAGCUGAAACAC acag (SEQ ID NO: AGUUGGUUUGUGUACACUGGCUCAGUUCAGC 43) AGGAACAGGG (SEQ ID NO: 45)
  • AAAAGGUAA SEQ ID NO: 87
  • hsa-miR-93 caaagugcuguucgugca CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUA gguag (SEQ ID NO: GUGUGAUUACCCAACCUACUGCUGAGCUAGCA 92) CUUCCCGAGCCCCCGG (SEQ ID NO: 93) hsa-miR-221 agcuacauugucugcugg UGAACAUCCAGGUCUGGGGCAUGAACCUGGCA guuuc (SEQ ID NO: UACAAUGUAGAUUUCUGUGUUCGUUAGGCAA 94) CAGCUACAUUGUCUGCUGGGUUUCAGGCUACC
  • hsa-let-7g ugagguaguaguuuguac AGGCUGAGGUAGUAGUUUGUACAGUUUGAGG aguu
  • SEQ ID NO: GUCUAUGAUACCACCCGGUACAGGAGAUAACU 104 GUACAGGCCACUGCCUUGCCA
  • hsa-let-7b ugagguaguagguugugu CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAG gguu
  • SEQ ID NO: 107 hsa-let-7a ugagguaguagguuguau UGGGAUGAGGUAGUAGGUUGUAUAUAGUUUUAG aguu
  • SEQ ID NO: GGUCACACCCACCACUGGGAGAUAACUAUACA 108) AUCUACUGUCUUUCCUA (SEQ ID NO: 111) uga
  • hsa-miR-708 aaggagcuuacaaucuag AACUGCCCUCAAGGAGCUUACAAUCUAGCUGG cuggg (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252) ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252) ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252) ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252) ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACAACUAG 252) ACUGUGAGCUUCUAGAGGGCAGGGA (SEQ ID NO: GGGUAAAUGACUUGCACAUGAACACA
  • MicroRNA markers decreased in CD 14 CD 16 " or CD 14 CD 16 monocytes in subjects having a neurodegenerative disorder relative to healthy controls are listed in Table 2.
  • hsa-miR-206 uggaauguaaggaagugug UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCC ugg (SEQ ID NO: CCAUAUGGAUUACUUUGCUAUGGAAUGUAAG 152) GAAGUGUGUGGUUUCGGCAAGUG (SEQ ID NO:
  • GAAGGAGGCUGGGAAGGCAAAGGGACGUUCA AUUGUCAUCACUGGC (SEQ ID NO: 155) hsa-miR-137 uuauugcuuaagaauacgc GGUCCUCUGACUCUCUUCGGUGACGGGUAUUC guag (SEQ ID NO: UUGGGUGGAUAAUACGGAUUACGUUGUUAUU 156) GCUUAAG AAUACGC GUAGUC G AGG AG AGUAC
  • CAGGUGUAGUGAAAC (SEQ ID NO: 161) hsa-miR-192 cugaccuaugaauugacag GCC G AG ACC G AGUGC AC AGGGCUCUG AC CUAU cc (SEQ ID NO: 162) GAAUUGACAGCCAGUGCUCUCGUCUCCCCUCU
  • GGCUGCCAAUUCCAUAGGUCACAGGUAUGUUC GCCUCAAUGCCAGC (SEQ ID NO: 163) hsa-miR- cucuagagggaagcacuuu CUCAGGCUGUGACCCUCUAGAGGGAAGCACUU 526a cug (SEQ ID NO: UCUGUUGCUUGAAAGAAGAGAAAGCGCUUCC
  • AAUU (SEQ ID NO: 195)
  • hsa-miR-379 ugguagacuauggaacgua AGAGAUGGUAGACUAUGGAACGUAGGCGUUA gg (SEQ ID NO: 198) UGAUUUCUGACCUAUGUAACAUGGUCCACUAA
  • hsa-miR-383 agaucagaaggugauugug CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUG gcu (SEQ ID NO: GGUGGAUAUUAAUCAGCCACAGCACUGCCUGG 218) UCAGAAAGAG (SEQ ID NO: 219) hsa-miR-649 aaaccuguguuguucaaga GGCCUAGCCAAAUACUGUAUUUUUGAUCGACA guc (SEQ ID NO: UUUGGUUGAAAAAUAUCUAUGUAUUAGUAAA 220) CCUGUGUUGUUCAAGAGUCCACUGUGUUUUGC
  • AAC (SEQ ID NO: 223)
  • AAUAUGG (SEQ ID NO: 229)
  • AAACCUCUUUUUUAGUAUC (SEQ ID NO: 245) hsa-miR- agaucgaccguguuauauu UUGAAGGGAGAUCGACCGUGUUAUAUUCGCU 369-3p cgc (SEQ ID NO: 246) UUAUUGACUUCGAAUAAUACAUGGUUGAUCU
  • MicroRNA markers increased in monocytes are listed in Table 3.
  • MicroRNA markers decreased in monocytes (CD 14 CD 16 " or CD 14 CD 16 monocytes) in subjects having ALS relative to healthy controls (CD14 + CD16 " or CD14 + CD16 + monocytes in healthy controls) are listed in Table 4.
  • Table 4 List of microRNAs decreased in CD14 + CD16 or CD14 + CD16 + monocytes in subjects having ALS compared to healthy controls.
  • MicroRNAs that are decreased in CD 14 CD 16 " monocytes from ALS patients relative to CD14 + CD16 " monocytes from healthy controls are listed in Table 6. Table 6. List of microRNAs decreased in CD14 + CD16 " monocytes from ALS patients relative to CD14 + CD16 " monocytes from healthy controls.
  • MicroRNA markers uniquely decreased in CD 14 CD 16 " monocytes from ALS patients relative to CD14 + CD16 " monocytes from both MS subjects and healthy controls are listed in Table 8. Table 8. List of microRNAs uniquely decreased in CD14 + CD16 " monocytes from ALS patients relative to CD14 + CD16 " monocytes from both MS subjects and healthy controls
  • MicroRNA markers uniquely increased in CSF from subjects having sporadic ALS or familial ALS compared to CSF from healthy controls are listed in Table 11. Table 11. List of microRNAs uniquely increased in CSF from subjects having sporadic ALS or familial ALS compared to CSF from healthy controls
  • MicroRNA markers increased in monocytes (CD 14 CD 16 " or CD 14 CD 16 monocytes) in subjects having MS relative to healthy controls (CD14 + CD16 " or CD14 + CD16 + in healthy controls) are listed in Table 12.
  • Table 12 List of microRNAs increased in CD14 + CD16 or CD14 + CD16 + monocytes in subjects having MS relative to CD14 + CD16 " or CD14 + CD16 + monocytes in healthy controls.
  • hsa-miR-320c hsa-miR-1260 hsa-miR- 19b hsa-miR-340 hsa-let-320a hsa-miR-27b hsa-miR-720 hsa-miR- 106b hsa-miR-26b hsa-miR-520g hsa-miR-664 hsa-miR- 1274a hsa-let-7g hsa-miR-1260 hsa-miR-204 hsa-miR-432-5p hsa-miR-423 hsa-miR-181a hsa-miR-361-5p
  • MicroRNA markers decreased in monocytes are listed in Table 13.
  • CD14 + CD16 monocytes from MS patients are listed in Table 14.
  • hsa-miR- 1274a hsa-miR-93 hsa-miR-181a hsa-miR-21 hsa-miR-320c hsa-miR-361-5p hsa-140-5p hsa-miR-374b hsa-miR-27b hsa-miR-423 hsa-142-5p hsa-let-7a
  • MicroRNA markers uniquely increased in CD 14 CD 16 " monocytes from MS patients relative to CD14 + CD16 " monocytes from both ALS subjects and healthy controls are listed in Table 16. Table 16. List of microRNAs uniquely increased in CD14 + CD16 " monocytes from MS patients relative to CD14 + CD16 " monocytes from both ALS subjects and healthy controls
  • MicroRNA markers decreased in CD 14 CD 16 monocytes from MS patients relative to CD14 + CD16 + monocytes from healthy controls are listed in Table 19. Table 19. List of microRNAs decreased in CD14 + CD16 + monocytes from MS patients relative to CD14 + CD16 + monocytes from healthy controls
  • NCBI Accession No. NCBI Accession No.
  • mRNA sequence NCBI Accession No.
  • NP 001161402 NP 001161402.1 NM 001167930; NM 001167930.1 NP 001161403; NP 001161403.1 NM 001167931; NM 001167931.1
  • NP 001186578 NP 001186578.1 NM 001199649; NM 001199649.1 MKNK1 NP 003675; NP 003675.2 NM 003684; NM 003684.4
  • NP 001161330 NP 001161330.1 NM 001167858; NM 001167858.1 NP 001161329; NP 001161329.1 NM 001167857; NM 001167857.1 NP 115287; NP 115287.1 NM 032104; NM 032104.2 NP 115286; NP 115286.1 NM 032103; NM 032103.2 NP 002472; NP 002472.2 NM 002481; NM 002481.3
  • NP 001306 NP 001306.1 NM 001315; NM 001315.2 NP 620583; NP 620583.1 NM 139014; NM 139014.2 NP 620581; NP 620581.1 NM 139012; NM 139012.2
  • NP 001124400 NP 001124400.1 NM 001130928; NM 001130928.1 NP 001124399; NP 001124399.1 NM 001130927; NM 001130927.1 NP 001124398; NP 001124398.1 NM 001130926; NM 001130926.1 NP 005578; NP 005578.2 NM 005587; NM 005587.2
  • CDKN1A NP 000380; NP 000380.1 NM 000389; NM 000389.2
  • NP 001193471 NP 001193471.1 NM 001206542; NM 001206542.1 NP 001193453; NP 001193453.1 NM 001206524; NM 001206524.1
  • NCBI Accession No. NCBI Accession No.
  • mPvNA sequence NCBI Accession No.
  • GNB1 NP 002065; NP 002065.1 NM 002074; NM 002074.3 TGFB3 NP 003230; NP 003230.1 NM 003239; NM 003239.2
  • FCER1A NP 001992; NP 001992.1 NM 002001; NM 002001.2
  • a neurodegenerative disorder includes determining a level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five or six) inflammatory markers listed in Tables 20-21 in cerebrospinal fluid or a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., peripheral or blood-derived monocyte) from the subject, and comparing the level of the one or more microRNAs and/or the one or more inflammatory markers with a reference level of the one or more microRNAs and/or one or more inflammatory markers.
  • An increase or decrease in the level of the one or more microRNAs and/or the level of the one or more inflammatory markers as compared to the reference level(s) indicates that the subject has a neurodegenerative disease as outlined in detail below.
  • a subject can be diagnosed as having a neurodegenerative disorder if the level of one or more or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 1 in the CSF or a CD14 CD16 " or CD14 + CD16 + monocyte (e.g., peripheral or blood- derived monocyte) from the subject is increased compared to a reference level of the one or more microRNAs listed in Table 1, and/or if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 2 in the CSF or a CD14 + CD16 " or CD14 + CD16 + monocyte (e.g., peripheral or blood-derived monocyte) from the subject is decreased compared to a reference level of the one or more microRNAs listed in Table 2.
  • a subject can be diagnosed as having a neurodegenerative disorder if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 3 and 12 in a CD14 CD16 " or CD14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 3 and 12, and/or if the level of one or more microRNAs listed in Tables 4 and 13 in a CD14 CD16 " or CD14 + CD16 + monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Tables 4 and 13.
  • the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 3 and 12 in a CD14 CD16 " or CD14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Tables
  • a subject can be diagnosed as having a neurodegenerative disorder if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 5 and Table 14, and/or one or more inflammatory markers (e.g., at least two, three, four, five or six) in Table 21 in a CD 14 + CD 16 " monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Table 5 and Table 14 and/or a reference level of the one or more inflammatory markers listed in Table 21; and/or if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 6 and Table 15, and/or one or more (e.g., at least two, three, four, five or six) inflammatory markers in Table 20 in a CD14 CD16 " monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Table 6 and Table 15 and/or a reference
  • a subject can be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 5 and 7, and/or one or more (e.g., at least two, three, four, five or six) inflammatory markers listed in Table 21 in a CD14 CD16 " monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Tables 5 and 7, and/or a reference level of the one or more inflammatory markers in Table 21; and/or if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Tables 6 and 8, and/or one or more (e.g., at least two, three, four, five or six) inflammatory markers listed in Table 20 in a CD14 CD16 " monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Tables 6 and 8, and/
  • a subject can be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 9 in a CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Table 9, and/or if the level of one or more (e.g., one, two, or three) microRNAs listed in Table 10 in a CD14 + CD16 + monocyte from the subject is decreased as compared to a reference level of the one or more microRNAs listed in Table 10.
  • the level of one or more (e.g., at least two, three, four, five or six) microRNAs listed in Table 9 in a CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Table 9, and/or if the level of one or more (e.g., one, two, or three) microRNAs listed in Table 10 in
  • a subject can be diagnosed as having amyotrophic lateral sclerosis if the level of one or more (e.g., at least two, three, four, five or six) of hsa-miR-27b, hsa-miR- 99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p are increased in cerebrospinal fluid of the subject compared to a reference level of hsa-miR-27b, hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p.
  • the level of one or more e.g., at least two, three, four, five or six
  • a subject can be diagnosed as having familial ALS if the level of hsa-miR-27b in the cerebrospinal fluid from the subject is increased compared to a reference level of hsa-miR-27b and the level of one or more (e.g., one, two, three, four, or five) of hsa- miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid from the subject is decreased or not significantly changed compared to a reference level of one or more of hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p.
  • a subject can be diagnosed as having sporadic ALS if the level of two or more (e.g., two, three, four, five, or six) microRNAs selected from hsa-27b, hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid from the subject is increased compared to a reference level of the one or more microRNAs.
  • two or more microRNAs selected from hsa-27b, hsa-miR-99b, hsa- miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid from the subject.
  • a subject can be diagnosed as having sporadic ALS if the level of one or more (e.g., two, three, four or five) microRNAs selected from hsa-miR-99b, hsa-miR-146a, hsa-miR- 150, hsa-miR-328, and hsa-miR-532-3p in the cerebrospinal fluid from the subject is increased compared to a reference level of the one or more microRNAs.
  • one or more e.g., two, three, four or five
  • a subject can be diagnosed as having multiple sclerosis if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs in Table 14 and Table 16, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers in Table 21 in a CD 14 + CD 16 " monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Table 14 and Table 16 and/or the reference level of the one or more inflammatory markers listed in Table 21; and/or if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs in Table 15 and Table 17, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers in Table 20 in a CD 14 + CD 16 " monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Table 15 and Table 17, and/or the reference level
  • a subject can be diagnosed as having multiple sclerosis if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs in Table 18 in
  • CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs in Table 18 and/or if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs in Table 19 in a CD 14 CD 16 monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Table 19.
  • the level of one or more (e.g., at least two, three, four, five, or six) microRNAs in Table 19 in a CD 14 CD 16 monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Table 19.
  • the levels of the one or more microRNAs (both the mature and precursor microRNAs) described in Tables 1-19 can be determined using molecular biology methods known in the art. For example, levels of any of the microRNAs described herein can be measured using techniques that include the use of a polymerase chain reaction (PCR) and suitable primers, e.g., quantitative real-time PCR (qRT-PCR). Primers for each of the mature and precursor microRNAs described herein can be designed using methods known in the art. Likewise, the levels of an mRNA encoding any of the inflammatory markers in Tables 20 and 21 can be determined using techniques that include the use of a PCR and suitable primers.
  • PCR polymerase chain reaction
  • suitable primers e.g., quantitative real-time PCR
  • a primer can contain at least 7 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides that are complementary to a sequence present in the target micro RNA or the target inflammatory marker mRNA.
  • Primers can include one or more of the modifications described herein (e.g., one or more modifications in the backbone, one or more modifications in the nucleobase(s), and one or more modifications in the sugar(s)).
  • the primers can also include a label (e.g., a radioisotope or a fluorophore).
  • the primers can also be conjugated to secondary molecules or agents in order to improve the stability of the primers (as described herein).
  • the levels of a protein encoded by the inflammatory marker genes listed in Tables 20 and 21 can be detected using a number of techniques known in the art which utilize antibodies that specifically bind to one of the proteins listed in Tables 20 and 21 (e.g., immunoblotting).
  • any of the methods described herein may further include obtaining or collecting a sample from a subject (e.g., a biological sample containing cerebrospinal fluid or peripheral blood).
  • the methods further include purifying a monocyte (e.g., a CD 14 + CD 16 " monocyte or a CD 14 + CD16 + monocyte from a biological sample from the subject).
  • a monocyte e.g., a CD 14 + CD 16 " monocyte or a CD 14 + CD16 + monocyte from a biological sample from the subject.
  • Methods of purifying a CD 14 + CD 16 " monocyte or a CD 14 + CD 16 monocyte can be performed using a variety of methods known in the art, e.g., antibody-based methods, such as fluorescence-assisted cell sorting (FACS).
  • FACS fluorescence-assisted cell sorting
  • any of the methods described herein can be performed on patients presenting to a health care facility (e.g., a hospital, clinic, or an assisted care facility).
  • the subjects may present with one or more symptoms of a neurodegenerative disorder (e.g., any of the symptoms of a neurodegenerative disorder described herein).
  • the subject can also present with no symptoms (an asymptomatic subject) or just one symptom of a neurodegenerative disorder.
  • the subject can have a familial history of a neurodegenerative disorder (e.g., familial ALS).
  • the diagnostic methods described herein can be performed by any health care professional (e.g., a physician, a laboratory technician, a nurse, a physician's assistant, and a nurse's assistant).
  • the diagnostic methods described herein can be used in combination with any additional diagnostic testing methods known in the art (e.g., the observation or assessment of one or more symptoms of a neurodegenerative disorder in a subject).
  • cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject comparing the level of the one or more microRNAs in cerebrospinal fluid or a CD14 CD16 " or CD14 + CD16 + monocyte from the subject to a reference level of the one or more microRNAs and/or a reference level of the one or more inflammatory markers; and selecting a subject having an increase in the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14 CD16 " or
  • a subject may be selected for treatment on the basis of the relative expression of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 as described in the above section describing diagnostic methods.
  • one or more e.g., at least two, three, four, five, or six
  • microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 as described in the above section describing diagnostic methods.
  • an increase in the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 and/or the level of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 (compared to a reference level), as used to diagnose a subject as having a neurodegenerative disorder, may likewise be used to select a subject for treatment of a neurodegenerative disorder.
  • a decrease in the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19 and/or the level of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 (compared to a reference level), as used to diagnose a subject as having a neurodegenerative disorder, may likewise be used to select a subject for treatment of a neurodegenerative disorder.
  • the levels of the one or more microRNAs (both the mature and precursor microRNAs) described in Tables 1-19 can be determined using molecular biology methods known in the art. For example, levels of any of the microRNAs described herein can be measured using techniques that include the use of a polymerase chain reaction (PCR) and suitable primers, e.g., quantitative real-time PCR (qRT-PCR). Primers for each of the mature and precursor microRNAs described herein can be designed using methods known in the art. Likewise, the levels of an mRNA encoding any of the inflammatory markers in Tables 20 and 21 can be determined using techniques that include the use of a PCR and suitable primers.
  • PCR polymerase chain reaction
  • suitable primers e.g., quantitative real-time PCR
  • a primer can contain at least 7 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) contiguous nucleotides that are complementary to a sequence present in the target micro RNA or the target inflammatory marker mRNA.
  • Primers can include one or more of the modifications described herein (e.g., one or more modifications in the backbone, one or more modifications in the nucleobase(s), and one or more modifications in the sugar(s)).
  • the primers can also include a label (e.g., a radioisotope or a fluorophore).
  • the primers can also be conjugated to secondary molecules or agents in order to improve the stability of the primers (as described herein).
  • the methods can be performed by any health care professional (e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant).
  • the subjects may present with one or more symptoms (e.g., at least two, three, or four) of a neurodegenerative disorder (e.g., any of the symptoms of a neurodegenerative disorder described herein).
  • the subject can also present with no symptoms or just one symptom of a neurodegenerative disorder.
  • the subject can have a familial history of a neurodegenerative disorder (e.g., familial ALS).
  • the subject can be previously diagnosed as having a
  • Treatments of neurodegenerative disorders that can be administered to the subject include riluzole, corticosteroids, beta-interferon, glatiramer, fmgolimod, natalizumab, mitoxantrone, muscle relaxants, and amantadine. Additional treatments of neurodegenerative disorders include physical therapy and plasmapheresis.
  • neurodegenerative disorder include determining a level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject; comparing the level of the one or more microRNAs in the cerebrospinal fluid or a CD14 CD16 " or
  • a subject is identified as having an increased risk of developing a neurological disorder if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15,
  • a subject is identified having a decreased risk of developing a neurological disorder if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is decreased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7,
  • a reference level of the one or more inflammatory markers listed in Table 21 and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is increased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 2, 4, 6, 8,
  • a subject may be identified as having an increased or decreased risk of developing a neurodegenerative disorder on the basis of the relative expression of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject as compared to a reference value as described in the above section describing diagnostic methods.
  • the level of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject (compared to a reference level), as used to diagnose a subject as having a neurodegenerative disorder, may likewise be used to identify a subject at increased risk of developing a neurodegenerative disorder.
  • a decrease in the level of the one or more microRNAs or a decrease in the level of the one or more inflammatory markers indicates a diagnosis of a neurodegenerative disease (as detailed in the section describing diagnostic methods above), indicates that the subject is at decreased risk of developing a neurodegenerative disorder.
  • the increased or decreased risk is relative to a subject that does not have an increase or decrease in the levels of one or more (e.g., at least two, three, four, five, or six) microRNA listed in Tables 1-19 and/or does not have an increase or decrease in the levels of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 (e.g., a subject that is not diagnosed as having a
  • inflammatory markers listed in Tables 20 and 21 may be performed using standard molecular biology methods (e.g., the PCR-based and antibody-based methods described herein). The methods can be performed by any health care professional (e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant).
  • a health care professional e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant.
  • the subjects may present with one or more symptoms of a neurodegenerative disorder (e.g., any of the symptoms of a neurodegenerative disorder described herein).
  • the subject can also present with no symptoms or just one symptom of a neurodegenerative disorder.
  • the subject can have a family history of a neurodegenerative disorder (e.g., familial ALS).
  • Subjects identified as having an increased risk of developing a neurodegenerative disease may be administered a treatment for a neurodegenerative disorder or may be administered a new or alternative treatment for a neurodegenerative disorder.
  • Subjects identified as having an increased risk of developing a neurodegenerative disorder can also undergo more aggressive therapeutic treatment (e.g., increased periodicity of clinic or hospital visits).
  • a level of one or more microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 +
  • a subject is predicted to have an increased rate of disease progression if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in cerebrospinal fluid
  • a subject is predicted to have a slower or average rate of disease progression if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a
  • CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is decreased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7,
  • a reference level of the one or more inflammatory markers listed in Table 21 and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is increased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 2, 4, 6, 8,
  • a subject may be predicted to have an increased or decreased rate of disease progression on the basis of the relative expression of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject as compared to a reference value as described in the above section describing diagnostic methods.
  • one or more e.g., at least two, three, four, five, or six
  • microRNAs listed in Tables 1-19
  • neurodegenerative disease (as detailed in the section describing diagnostic methods above), can be used to predict a decreased or average rate of disease progression.
  • the rate of disease progression is the rate of onset of one or more (e.g., one, two, three, or four) symptoms (e.g., ataxia) of a neurodegenerative disorder, the rate of increasing intensity (worsening) of symptoms of a neurodegenerative disorder, the frequency of one or more symptoms of a neurodegenerative disorder, the duration of one or more symptoms of a neurodegenerative disorder, or the longevity of the subject.
  • an increase in the rate of disease progression can be manifested by one or more of: an increase in the rate of onset of one or more (new) symptoms of a neurodegenerative disorder, an increase in the rate of increasing intensity (worsening) of one or more symptoms of a neurodegenerative disorder, an increase in the duration of one or more symptoms of a neurodegenerative disorder, and a decrease in the longevity of the subject.
  • the rate of disease progression determined using the methods described herein can be compared to the rate of disease progression in subjects that do not have an increase or a decrease in the level of the one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or do not have an increase or a decrease in the level of the one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in their CSF or m a CD14 D16 " or CD 14 + CD 16 monocyte.
  • the rate of disease progression can be compared to the average rate of disease progression for all subjects diagnosed as having the same neurodegenerative disease.
  • inflammatory markers listed in Tables 20 and 21 may be performed using standard molecular biology methods (e.g., the PCR-based and antibody-based methods described herein). The methods can be performed by any health care professional (e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant).
  • a health care professional e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant.
  • the subjects may present with one or more (e.g., one, two, three, or four) symptoms of a neurodegenerative disorder (e.g., any of the symptoms of a neurodegenerative disorder described herein).
  • a neurodegenerative disorder e.g., any of the symptoms of a neurodegenerative disorder described herein.
  • the subject can also present with no symptoms or just one symptom of a neurodegenerative disorder.
  • the subject can have a family history of a neurodegenerative disorder (e.g., familial ALS). In some embodiments, the subject can already be diagnosed as having a neurodegenerative disorder.
  • a neurodegenerative disorder e.g., familial ALS.
  • Some embodiments of these methods further include administering a treatment to a subject predicted to have an increased rate of disease progression.
  • a subject predicted to have an increased rate of disease progression is administered a more aggressive treatment (e.g., increased periodicity of clinic visits).
  • a subject is selected for participation in a clinical study if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 21 in cerebrospinal fluid or a
  • CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is increased compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject is decreased compared to a reference level of the one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one or more inflammatory markers listed in Table 20.
  • a subject is selected for participation in a clinical study if the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or one or more (e.g., at least two, three, four, five, or six)
  • CD 14 + CD16 + monocyte from the subject is decreased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18, and/or a reference level of the one or more inflammatory markers listed in Table 21; and/or the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in cerebrospinal fluid or a CD14 CD16 " or
  • CD 14 + CD16 + monocyte from the subject is increased or not significantly changed compared to a reference level of the one or more microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, and/or a reference level of one or more inflammatory markers listed in Table 20.
  • a subject can be selected for participation in a clinical study on the basis of the relative expression of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 1-19 and/or one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Tables 20 and 21 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte from the subject as compared to a reference value as described in the above section describing diagnostic methods.
  • one or more e.g., at least two, three, four, five, or six
  • microRNAs listed in Tables 1-19
  • CD 14 + CD16 + monocyte from the subject may likewise be used to select a subject for participation in a clinical study.
  • a decrease in the level of one or more (e.g., at least two, three, four, five, or six) microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19 and/or the level of one or more (e.g., at least two, three, four, five, or six) inflammatory markers listed in Table 20 in the cerebrospinal fluid or a CD14 CD16 " or CD 14 + CD16 + monocyte (compared to a reference level), as used to diagnose a subject as having a neurodegenerative disorder, may likewise be used to select a subject for participation in a clinical study.
  • a clinical study e.g., as a control subject.
  • inflammatory markers listed in Tables 20 and 21 may be performed using standard molecular biology methods (e.g., the PCR-based and antibody-based methods described herein). The methods can be performed by any health care professional (e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant).
  • a health care professional e.g., a physician, a nurse, a physician's assistant, a laboratory technician, or a nurse's assistant.
  • the subject may present with one or more symptoms of a neurodegenerative disorder (e.g., any of the symptoms of a neurodegenerative disorder described herein). In some embodiments, the subject can also present with no symptoms or just one symptom of a neurodegenerative disorder. In some embodiments, the subject can have a familial history of a neurodegenerative disorder (e.g., familial ALS). In some embodiments, the subject can already be diagnosed as having a neurodegenerative disorder.
  • a neurodegenerative disorder e.g., any of the symptoms of a neurodegenerative disorder described herein.
  • the subject can also present with no symptoms or just one symptom of a neurodegenerative disorder.
  • the subject can have a familial history of a neurodegenerative disorder (e.g., familial ALS). In some embodiments, the subject can already be diagnosed as having a neurodegenerative disorder.
  • Also provided are methods of treating a neurodegenerative disorder that include administering to a subject at least one (e.g., at least two, three, four, five, or six) agent (e.g., a nucleic acid) that decreases the level or activity of one or more (e.g., at least two, three, four, five, or six) of the microRNAs listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (e.g., an inhibitory nucleic acid, e.g., an antagomir), and/or increases the level or activity of one or more (e.g., at least two, three, four, five, or six) of the microRNAs listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, or 19 (e.g., a sense nucleic acid). Also provided are methods of treating a nucleic acid.
  • neurodegenerative disorder e.g., ALS or MS
  • administering to a subject at least one (e.g., at least two, three, four, five, or six) agent (e.g., a nucleic acid) that decreases the expression (e.g., protein or mRNA) or activity of one or more (e.g., at least two, three, four, five, or six) of the inflammatory markers listed in Table 21 (e.g., an inhibitory nucleic acid or antibody) and/or increases the expression (e.g., protein or mRNA) and/or activity of one or more (e.g., at least two, three, four, five, or six) of the genes listed in Table 20 (e.g., a sense nucleic acid).
  • the subject is first identified or selected for treatment using any of the diagnostic methods described herein or any of the methods of predicting a subject at risk of developing a neurodegenerative disorder described herein.
  • the subject is administered at least one inhibitory nucleic acid comprising a sequence that is complementary to a contiguous sequence present in hsa-miR-155 (e.g., a contiguous sequence present in mature or precursor hsa-miR-155).
  • the inhibitory nucleic acid can be an antisense oligonucleotide, a ribozyme, an siRNA, or an antagomir.
  • the at least one inhibitory nucleic acid is injected into the cerebrospinal fluid of a subject. In some embodiments, the injection is intracranial injection or intrathecal injection.
  • the at least one inhibitory nucleic acid is complexed with one or more cationic polymers and/or cationic lipids (e.g., any of the cationic polymers described herein or known in the art).
  • Antagomirs to decrease the expression and/or activity of a specific target miRNA e.g., hsa-miR-155
  • Krutzfeld et al Nature 438:685-689, 2005. Additional exemplary methods for designing and making antagomirs and other types of inhibitory nucleic acids are described herein.
  • the inhibitory nucleic acid that decreases miR-155 levels is the antogmir-155 LNA sequence +TC+AC+A+A+TTA+G+C+AT+T+A (SEQ ID NO: 262) (wherein the + indicates the presence of an LNA moiety).
  • Methods for designing antagomirs to target microRNA molecules are described in Obad et al, Nature Genetics 43:371-378, 2011. Additional inhibitory nucleic acids for decreasing the levels or expression of hsa-miR-155 are described in Worm et al, Nucleic Acids Res. 37:5784-5792, 2009, and Murugaiyan et al, J. Immunol. 187:2213-2221, 2011.
  • a subject can be administered at least one (e.g., at least 2, 3, 4, or 5) dose of the agent (e.g., one or more inhibitory nucleic acids).
  • the agent e.g., one or more inhibitory nucleic acids
  • a subject can be treated (e.g., periodically administered the agent) for a prolonged period of time (e.g., at least one month, two months, six months, one year, two years, three years, four years, or five years).
  • the dosage of the agent to be administered to the subject can be determined by a physician by consideration of a number of physiological factors including, but not limited to, the sex of the subject, the weight of the subject, the age of the subject, and the presence of other medical conditions.
  • the agent can be administered to the subject orally, intravenously, intraarterially, subcutaneous ly,
  • the agent may be formulated as a solid (e.g., for oral administration) or a physiologically acceptable liquid carrier (e.g., saline) (e.g., for intravenous, intraarterial, subcutaneous, intramuscular,
  • a physiologically acceptable liquid carrier e.g., saline
  • the agent e.g., one or more inhibitory nucleic acids
  • the agent can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection or can be administered by injection
  • agents to be administered to a subject for treatment of a neurodegenerative disorder are described below, and can be used in any combination (e.g., at least one, two, three, four, or five of any combination of the agents or classes of agents described below).
  • Inhibitory agents useful in the methods of treatment described herein include inhibitory nucleic acid molecules that decrease the expression or activity of any of the microRNAs (e.g., mature microRNA or precursor microRNA) listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18 (e.g., hsa-miR-155), or decrease the expression or activity of any of the mRNAs encoding an inflammatory marker listed in Table 21 (the target mRNA).
  • microRNAs e.g., mature microRNA or precursor microRNA listed in Tables 1, 3, 5, 7, 9, 11, 12, 14, 16, or 18
  • hsa-miR-155 e.g., hsa-miR-155
  • Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA
  • RNAi RNA interference
  • siRNA compounds single- or double-stranded RNA interference (RNAi) compounds, such as siRNA compounds, modified bases/locked nucleic acids (LNAs), antagomirs, peptide nucleic acids (PNAs), and other oligomeric compounds, or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function.
  • the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense
  • oligonucleotides antisense oligonucleotides comprising modified linkages, interference RNA (R Ai), short interfering R A (siR A); a micro, interfering R A (miR A); a small, temporal RNA (stR A); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof.
  • interference RNA R Ai
  • siR A short interfering R A
  • miR A micro, interfering R A
  • shR A small, temporal RNA
  • shRNA small RNA-induced gene activation
  • RNAa small activating RNAs
  • the inhibitory nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length.
  • One having ordinary skill in the art will appreciate that this embodies oligonucleotides having antisense portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin.
  • the inhibitory nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length.
  • oligonucleotides are 15 nucleotides in length.
  • the antisense or oligonucleotide compounds of the invention are 12 or 13 to 30 nucleotides in length.
  • One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or any range therewithin.
  • the inhibitory nucleic acids are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • beneficial properties such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target
  • Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Patent Nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711;
  • the inhibitory nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-0-alkyl, 2'-0-alkyl-0-alkyl or 2'- fluoro-modified nucleotide.
  • RNA modifications include 2'- fluoro, 2'-amino, and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA.
  • modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short-chain alkyl or cycloalkyl intersugar linkages, or short-chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2-NH-0-CH2,
  • CH, ⁇ N(CH3) ⁇ 0 ⁇ CH2 (known as a methylene(methylimino) or MMI backbone], CH2 -O-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P— O- CH,); amide backbones (see De Mesmaeker et al, Ace. Chem. Res. 28:366-374, 1995); morpholino backbone structures (see U.S. Patent No.
  • PNA peptide nucleic acid
  • Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,
  • aminoalkylphosphotriesters methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates,
  • thionoalkylphosphonates thionoalkylphosphotriesters, and boranophosphates having normal 3'- 5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see U.S. Patent Nos.
  • Morpholino-based oligomeric compounds are described in Braasch et al, Biochemistry 41(14):4503-4510, 2002; Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol, 243:209- 214, 2002; Nasevicius et al, Nat. Genet. 26: 216-220, 2000; Lacerra et al, Proc. Natl. Acad. Sci. U.S.A. 97:9591-9596, 2000; and U.S. Patent No. 5,034,506. Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al, J. Am. Chem. Soc. 122, 8595-8602, 2000.
  • Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages.
  • These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see U.S. Patent Nos.
  • One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH 3 , F, OCN, OCH 3 OCH 3 , OCH 3 0(CH 2 )n CH 3 , 0(CH 2 )n NH 2 or 0(CH 2 )n CH 3 , where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF3 ; OCF3; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH3; S02 CH3; ON02; N02; N3; NH2; heterocycloalkyl; heterocycloalkaryl;
  • a preferred modification includes 2'-methoxyethoxy [2'- 0-CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta 78:486, 1995).
  • Oligonucleotides may also have sugar mimetics, such as cyclobutyls in place of the pentofuranosyl group.
  • Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • base nucleobase
  • nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxy cytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2- (methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil
  • both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • an oligomeric compound an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar- backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • PNA compounds comprise, but are not limited to, US Patent Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science 254: 1497-1500, 1991.
  • Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleobases comprise other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5- trifluoro
  • nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858- 859, Kroschwitz, J.I., Ed. John Wiley & Sons, 1990, those disclosed by Englisch et al,
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
  • These include 5- substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil, and 5- propynylcytosine. 5-methylcytosine
  • substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ⁇ 0>C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., Eds, Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Patent Nos.
  • the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
  • moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556, 1989), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett. 4: 1053-1060, 1994), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N.
  • a phospholipid e.g., di- hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H-phosphonate (Manoharan et al, Tetrahedron Lett. 36:3651-3654, 1995; Shea et al, Nucl. Acids i?es.
  • conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
  • Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid.
  • Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism, or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Patent No. 6,287,860, which are incorporated herein by reference.
  • Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5- tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a thio
  • the inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target miRNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • “Complementary” refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a miRNA, then the bases are considered to be complementary to each other at that position. In some embodiments, 100% complementarity is not required. In some embodiments, 100% complementarity is required. Routine methods can be used to design an inhibitory nucleic acid that binds to the target sequence with sufficient specificity.
  • Target segments of 5, 6, 7, 8, 9, 10 or more nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the seed sequence, or immediately adjacent thereto, are considered to be suitable for targeting as well.
  • target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5 '-terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5 '-terminus of the seed sequence and continuing until the inhibitory nucleic acid contains about 5 to about 30 nucleotides).
  • target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3 '- terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same miRNA beginning immediately downstream of the 3 '-terminus of the target segment and continuing until the inhibitory nucleic acid contains about 5 to about 30 nucleotides).
  • an inhibitory nucleic acid contain a sequence that is complementary to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 continguous nucleotides present in the target (e.g., the target miRNA, e.g., mature or precursor hsa-miR-155, or the target mRNA).
  • inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target RNAs), to give the desired effect.
  • hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • Complementary refers to the capacity for precise pairing between two nucleotides.
  • a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a miRNA molecule or an mRNA molecule
  • the inhibitory nucleic acid and the miRNA or mRNA are considered to be complementary to each other at that position.
  • the inhibitory nucleic acids and the miRNA or mRNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the miRNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a miRNA or a mRNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
  • a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • complementary nucleic acid sequence for purposes of the present methods is specifically hybridisable when binding of the sequence to the target miRNA or mRNA molecule interferes with the normal function of the target miRNA or mRNA to cause a loss of expression or activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency.
  • stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate.
  • Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide.
  • Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C.
  • Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art.
  • concentration of detergent e.g., sodium dodecyl sulfate (SDS)
  • SDS sodium dodecyl sulfate
  • Various levels of stringency are accomplished by combining these various conditions as needed.
  • hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS.
  • hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 ⁇ g/ml denatured salmon sperm DNA (ssDNA).
  • hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 ⁇ g/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
  • wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature.
  • stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate.
  • Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C.
  • wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis ⁇ Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl.
  • the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an miRNA.
  • an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity.
  • Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al, J. Mol. Biol.
  • Antisense and other compounds of the invention that hybridize to an miRNA or a mRNA are identified through routine experimentation.
  • the inhibitory nucleic acids must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
  • inhibitory nucleic acids please see US2010/0317718 (antisense oligos); US2010/0249052 (double-stranded ribonucleic acid (dsRNA));
  • Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing.
  • Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to the target microRNA or the target inflammatory marker mRNA. Thus, oligonucleotides are chosen that are sufficiently
  • LNAs Bases/Locked Nucleic Acids
  • the inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases.
  • Modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules.
  • the modified nucleotides are locked nucleic acid molecules, including [alpha]-L-LNAs.
  • LNAs comprise ribonucleic acid analogues wherein the ribose ring is "locked" by a methylene bridge between the 2'-oxgygen and the 4'-carbon - i.e., oligonucleotides containing at least one LNA monomer, that is, one 2'-0,4'-C-methylene- ?-D-ribofuranosyl nucleotide.
  • LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the base pairing reaction (Jepsen et al, Oligonucleotides 14:130-146, 2004).
  • LNAs also have increased affinity to base pair with RNA as compared to DNA.
  • LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., miRNAs and mRNAs as described herein.
  • the LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%), or 100%)) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the miRNA or the mRNA.
  • the LNA molecules can be chemically synthesized using methods known in the art.
  • the LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al, Nuc. Acids. Res. 34:e60, 2006; McTigue et al, Biochemistry 43:5388-405, 2004; and Levin et al, Nucl. Acids. Res. 34:el42, 2006.
  • “gene walk” methods similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of the LNA; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target miRNA or mRNA can be prepared, followed by testing for activity.
  • gaps e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested.
  • GC content is preferably between about 30-60%.
  • General guidelines for designing LNAs are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA. Contiguous runs of three or more Gs or Cs, or more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).
  • the LNAs are xylo-LNAs.
  • the LNA molecules can be designed to target a specific region of the miPvNA.
  • a specific functional region can be targeted, e.g., a region comprising a seed sequence.
  • highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity. Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al, J. Mol. Biol. 215:403-410, 1990; Zhang and Madden, Genome Res. 7:649-656, 1997), e.g., using the default parameters.
  • BLAST programs Altschul et al, J. Mol. Biol. 215:403-410, 1990; Zhang and Madden, Genome Res. 7:649-656, 1997), e.g., using the default parameters.
  • the antisense is an antagomir.
  • Antagomirs are chemically- modified antisense oligonucleotides that target a microRNA (e.g., target hsa-miR-155).
  • an antagomir for use in the methods described herein can include a nucleotide sequence sufficiently complementary to hybridize to a miRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides.
  • antagomirs include a cholesterol moiety, e.g., at the 3'-end.
  • antagomirs have various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake.
  • an antagomir can have one or more of complete or partial 2'-0-methylation of sugar and/or a phosphorothioate backbone. Phosphorothioate modifications provide protection against RNase activity and their lipophilicity contributes to enhanced tissue uptake.
  • the antagomir can include six phosphorothioate backbone modifications; two phosphorothioates are located at the 5 '-end and four at the 3'-end. See, e.g., Krutzfeldt et al, Nature 438:685-689, 2005; Czech, N. Engl. J. Med. 354: 1194-1195, 2006; Robertson et al, Silence 1 : 10, 2010; Marquez and McCaffrey, Human Gene Ther. 19(l):27-38, 2008; van Rooij et al, Circ. Res. 103(9):919-928, 2008; and Liu et al, Int. J. Mol. Sci. 9:978-999, 2008.
  • Antagomirs useful in the present methods can also be modified with respect to their length or otherwise the number of nucleotides making up the antagomir.
  • the antagomirs are about 20 - 21 nucleotides in length for optimal function, as this size matches the size of most mature microRNAs.
  • the antagomirs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
  • the inhibitory nucleic acid is locked and includes a cholesterol moiety (e.g., a locked antagomir).
  • the nucleic acid sequence that is complementary to a target miRNA or a target mRNA can be an interfering RNA, including but not limited to a small interfering RNA ("siRNA”) or a small hairpin RNA (“shRNA”).
  • interfering RNAs including but not limited to a small interfering RNA (“siRNA”) or a small hairpin RNA (“shRNA”).
  • the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s).
  • the interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem
  • the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence
  • the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
  • the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region.
  • RNA molecule when expressed desirably forms a "hairpin" structure, and is referred to herein as an "shRNA.”
  • the loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length.
  • the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family.
  • Dicer which is a member of the RNase III family.
  • the siRNA is then capable of inhibiting the expression of a gene with which it shares homology.
  • Dicer a member of the RNase III family.
  • the siRNA is then capable of inhibiting the expression of a gene with which it shares homology.
  • siRNAs The target RNA cleavage reaction guided by siRNAs is highly sequence specific.
  • siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid i.e., a target region comprising the seed sequence of a target miRNA or mRNA
  • 100% sequence identity between the siRNA and the target gene is not required to practice the present invention.
  • the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain
  • siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition.
  • siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition.
  • the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
  • Trans-cleaving enzymatic nucleic acid molecules can also be used; they have shown promise as therapeutic agents for human disease (Usman & McSwiggen, Ann. Rep. Med. Chem. 30:285-294, 1995; Christoffersen and Marr, J. Med. Chem. 38:2023-2037, 1995).
  • Enzymatic nucleic acid molecules can be designed to cleave specific miRNA or mRNA targets within the background of cellular RNA. Such a cleavage event renders the miRNA or mRNA nonfunctional.
  • enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of an enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA.
  • the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its activity. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
  • RNA- cleaving ribozymes for the purpose of regulating gene expression.
  • the hammerhead ribozyme functions with a catalytic rate (kcat) of about 1 min "1 in the presence of saturating (10 rnM) concentrations of Mg 2+ cofactor.
  • An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min "1 .
  • certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min "1 .
  • Agents useful in the methods of treatment described herein include sense nucleic acid molecules that increase the expression or activity of any of the microRNAs (e.g., mature microRNA or precursor microRNA) listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, or increase the expression or activity of any of the mRNAs encoding an inflammatory marker listed in Table 21.
  • a sense nucleic acid can be contain a sequence that is at least 80% (e.g., at least 90%>, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the sequence of any one of the microRNAs (e.g., mature microRNA or precursor microRNA) listed in Tables 2, 4, 6, 8, 10, 13, 15, 17, and 19, or the sequence of any one of the mRNAs listed in Table 21.
  • Sense nucleic acids can contain one or more of any of the modifications (e.g., backbone modifications, nucleobase modifications, sugar modifications, or one or more conjugated molecules) described herein without limitation. Methods of making and administering sense nucleic acids are known in the art. Additional methods of making and using sense nucleic acids are described herein.
  • RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/generated recombinantly.
  • Recombinant nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including e.g., in vitro, bacterial, fungal, mammalian, yeast, insect, or plant cell expression systems. Nucleic acid sequences of the invention (e.g., any of the inhibitory nucleic acids or sense nucleic acids described herein) can be inserted into delivery vectors and expressed from transcription units within the vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in
  • Viral vectors comprise a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell.
  • Viral vectors expressing nucleic acids of the invention can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, herpes virus, adenovirus, adeno-associated virus, pox virus, or alphavirus.
  • the recombinant vectors capable of expressing the nucleic acids of the invention can be delivered as described herein, and persist in target cells (e.g., stable transformants).
  • target cells e.g., stable transformants
  • recombinant vectors e.g., a recombinant vector that results in the expression of an antisense oligomer that is complementary to hsa-miR-155
  • can be administered into e.g., injection or infusion into) the cerebrospinal fluid of the subject (e.g., intracranial injection, intraparenchymal injection, intraventricular injection, and intrathecal injection, see, e.g., Bergen et al, Pharmaceutical Res. 25:983-998, 2007).
  • a number of exemplary recombinant viral vectors that can be used to express any of the nucleic acids described herein are also described in Bergen et al. ⁇ supra). Additional examples of recombinant viral vectors are known in the art
  • the nucleic acids provided herein can be further be complexed with one or more cationic polymers (e.g., poly-L-lysine and poly(ethylenimine), cationic lipids (e.g., l,2-dioleoyl-3-trimethylammonium propone (DOTAP), N-methyl-4- (dioleyl)methylpyridinium, and 3P-[N-(N',N'-dimethylaminoethane)-carbamoyl] cholesterol), and/or nanoparticles (e.g., cationic polybutyl cyanoacrylate nanoparticles, silica nanoparticles, or polyethylene glycol-based nanoparticles) prior to administration to the subject (e.g., injection or infusion into the cerebrospinal fluid of the subject).
  • cationic polymers e.g., poly-L-lysine and poly(ethylenimine
  • cationic lipids e.g.,
  • cationic polymers cationic lipids, and nanoparticles for the therapeutic delivery of nucleic acids are known in the art.
  • the therapeutic delivery of nucleic acids has also been shown to be achieved following intrathecal injection of polyethyleneimine/DNA complexes (Wang et al., Mol. Ther. 12:314-320, 2005).
  • the methods for delivery of nucleic acids described herein are non-limiting. Additional methods for the therapeutic delivery of nucleic acids to a subject are known in the art.
  • the inhibitory nucleic acids e.g., one or more inhibitory nucleic acids targeting hsa-miR-155
  • can be administered systemically e.g., intravenously, intaarterially, intramuscularly, subcutaneously, or intraperitoneally
  • intrathecally e.g., epidural
  • the inhibitory nucleic acid is administered in a composition (e.g., complexed with) one or more cationic lipids.
  • a composition e.g., complexed with
  • cationic lipids that can be used to administer one or more inhibitory nucleic acids (e.g., any of the inhibitory nucleic acids described herein) include: Lipofectamine, the cationic lipid molecules described in WO 97/045069, and U.S. Patent Application Publication Nos.
  • nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification.
  • nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5' or 3' end of the nucleotide sequence.
  • the nucleic acid sequence can include a 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'- fluoro, 2 * -0-methyl, 2 * -0-methoxyethyl (2 * -0-MOE), 2 * -0-aminopropyl (2 * -0-AP), 2 * -0- dimethylaminoethyl (2 * -0-DMAOE), 2 * -0-dimethylaminopropyl (2 * -0-DMAP), 2 * -0- dimethylaminoethyloxy ethyl (2'-0-DMAEOE), or 2'-0 ⁇ N-methylacetamido (2'-0 ⁇ NMA).
  • a 2'-modified nucleotide e.g., a 2'-deoxy, 2'-deoxy-2'- fluoro, 2 * -0-methyl, 2 * -0-methoxyethyl (2 * -0-MOE),
  • the nucleic acid sequence can include at least one 2'-0-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-0-methyl modification.
  • the nucleic acids are "locked," i.e., comprise nucleic acid analogues in which the ribose ring is "locked” by a methylene bridge connecting the 2'-0 atom and the 4'-C atom (see, e.g., Kaupinnen et al, Drug Disc. Today 2(3):287-290, 2005; Koshkin et al, J. Am. Chem. Soc, 120(50): 13252-13253, 1998).
  • US 2010/0004320, US 2009/0298916, and US 2009/0143326 each of which is incorporated by reference).
  • nucleic acids used to practice this invention such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization, and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al, Eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, Ed. Elsevier, N.Y. (1993).
  • labeling probes e.g., random-primer labeling using Klenow polymerase, nick translation, amplification
  • sequencing hybridization, and the like
  • One or more antibodies that specifically bind to a protein encoded by any of the inflammatory marker genes listed in Table 21 can also be administered to a subject to treat a neurodegenerative disease.
  • Antibodies that specifically bind to a protein listed in Table 21 are either commercially available or can be generated using standard methods known in the art.
  • a polyclonal antibody that specifically binds to a protein listed in Table 21 can be generated by immunizing a mammal with the purified protein and isolating antibodies from the mammal that specifically bind to the purified protein.
  • the antibodies used can be a monoclonal or polyclonal antibody.
  • the antibodies administered can be a immunoglobulin G or immunoglobulin M.
  • the antibodies administered can be chimeric (e.g., a humanized antibody) or a human antibody.
  • the antibodies used can also be an antibody fragment (e.g., a Fab, F(ab') 2 , Fv, and single chain Fv (scFv) fragment).
  • One or more inflammatory marker proteins listed in Table 20 can also be administered to a subject for the treatment of a neurodegenerative disorder.
  • a recombinant protein using molecular biology and cell culture techniques.
  • an inflammatory marker protein encoded by a mRNA sequence listed in Table 20 can be transfected into a bacterial, yeast, or mammalian cell (using a protein expression plasmid or viral vector) that allows for the expression of the inflammatory by the transfected cell.
  • the transfected cells or the culture medium can be collected, and the recombinant inflammatory marker protein purified using methods known in the art.
  • the inflammatory marker proteins administered to the subject can contain a sequence having at least 80% (e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any of the amino acid sequences listed in Table 20.
  • the inflammatory marker proteins administered to the subject can further contain a modification (e.g., a polyethylene glycol or an HIV tat protein, or any other moiety that increases the cellular permeability of the inflammatory marker protein).
  • the methods described herein can include the administration of pharmaceutical compositions and formulations comprising any one or more (e.g., two, three, four, or five) of the inhibitory nucleic acids (e.g., one or more inhibitory nucleic acids targeting hsa-miR-155), sense nucleic acids, inflammatory marker proteins, or antibodies described herein.
  • the inhibitory nucleic acids e.g., one or more inhibitory nucleic acids targeting hsa-miR-155
  • sense nucleic acids e.g., one or more inhibitory nucleic acids targeting hsa-miR-155
  • inflammatory marker proteins e.g., one or more inhibitory nucleic acids targeting hsa-miR-155
  • the compositions are formulated with a pharmaceutically acceptable carrier.
  • the pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally.
  • the pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
  • the inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition).
  • composition a pharmaceutical formulation
  • the compounds may be formulated for
  • compositions containing the one or more inhibitory nucleic acids can be included in compositions containing the one or more inhibitory nucleic acids (e.g., compositions containing one or more inhibitory nucleic acids targeting hsa-miR-155).
  • Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
  • the amount of active ingredient e.g., nucleic acid sequences of this invention
  • a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
  • compositions of this invention can be prepared according to any method known to the art for the manufacture of pharmaceuticals.
  • Such drugs can contain sweetening agents, flavoring agents, coloring agents, and preserving agents.
  • a formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture.
  • Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
  • compositions for oral administration can be formulated using
  • compositions for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores.
  • Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen.
  • Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
  • Aqueous suspensions can contain an active agent (e.g., inhibitory nucleic acids or sense nucleic acids described herein) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections.
  • excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose,
  • hydroxypropylmethylcellulose sodium alginate, polyvinylpyrrolidone, gum tragacanth, and gum acacia
  • dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long-chain aliphatic alcohol (e.g.,
  • aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, aspartame, or saccharin.
  • preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, aspartame, or saccharin.
  • Oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention.
  • Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil, or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928, describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic
  • the oil suspensions can contain a thickening agent, such as beeswax, hard paraffin, or cetyl alcohol.
  • Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol, or sucrose.
  • a palatable oral preparation such as glycerol, sorbitol, or sucrose.
  • an antioxidant such as ascorbic acid.
  • compositions can also be in the form of oil-in- water emulsions.
  • the oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these.
  • Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters, or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate.
  • the emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs.
  • Such formulations can also contain a demulcent, a preservative, or a coloring agent.
  • these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate, and/or an ethoxylated sorbitan trioleate.
  • the pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi, J. Clin. Pharmacol. 35: 1187-1193, 1995; Tjwa, Ann. Allergy Asthma Immunol. 75:107-111, 1995).
  • Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary
  • the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
  • the pharmaceutical compounds can also be delivered as microspheres for slow release in the body.
  • microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations, see, e.g., Gao, Pharm. Res. 12:857-863, 1995; or, as microspheres for oral administration, see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997.
  • the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity, a lumen of an organ, or into the cranium (e.g., intracranial injection or infusion) or the cerebrospinal fluid of a subject.
  • IV intravenous
  • cranium e.g., intracranial injection or infusion
  • cerebrospinal fluid of a subject e.g., intracranial injection or infusion
  • These formulations can comprise a solution of active agent dissolved in a
  • compositions may be sterilized by conventional, well known sterilization techniques.
  • the formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, and the like.
  • concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs.
  • the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3-butanediol.
  • the administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
  • the pharmaceutical compounds and formulations can be lyophilized.
  • Stable lyophilized formulations comprising an inhibitory nucleic acid or a sense nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffmose, and sucrose, or mixtures thereof.
  • a process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5, but less than 6.5. See, e.g., US2004/0028670.
  • compositions and formulations can be delivered by the use of liposomes.
  • liposomes particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989.
  • compositions of the invention can be administered for prophylactic and/or therapeutic treatments.
  • compositions are administered to a subject who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount.
  • pharmaceutical compositions of the invention are administered in an amount sufficient to reduce the number of symptoms or reduce the severity, duration, or frequency of one or more symptoms of a neurodegenerative disorder in a subject.
  • the amount of pharmaceutical composition adequate to accomplish this is a
  • the dosage schedule and amounts effective for this use i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age, and the like.
  • the mode of administration also is taken into consideration.
  • the dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones, J. Steroid Biochem. Mol. Biol. 58:611-617, 1996; Groning, Pharmazie 51 :337-341, 1996; Fotherby, Contraception 54:59-69, 1996;
  • formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, and the like.
  • the formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases, or symptoms.
  • pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day.
  • Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray, or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
  • LNAs locked nucleic acids
  • the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., any of the treatments of a neurodegenerative disorder described herein.
  • kits containing one or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, or 20) of any of the probes, inhibitory nucleic acids, sense nucleic acids, inflammatory marker proteins, or antibodies described herein (in any combination).
  • the kits can include instructions for performing any of the methods described herein.
  • the kit can contain at least two primers (e.g., at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 36, 38, or 40) for amplifying a sequence present within any of the microRNAs listed in Tables 1-19 (e.g., mature microRNA or precursor microRNA) or for amplifying a sequence present within any of the mRNAs listed in Tables 20 and 21.
  • at least two primers e.g., at least 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 36, 38, or 40
  • kits contain two or more sets of primer (e.g., 3, 4, 5, 6, 7, 8, 9,
  • kits contain two or more sets of primer (e.g., 3, 4, 5, 6, 7, 8, 9,
  • any one of Tables 1-11 e.g., one or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87
  • mRNAs listed in Table 20 and/or Table 21 e.g., ALS diagnostic kits.
  • kits contain two or more antisense oligonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 pairs of
  • microRNAs listed in any one of Tables 1, 2, andl2-19 e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,
  • kits contain two or more antisense oligonucleotides (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 109 antis
  • microR As listed in any one of Tables 1, 2, andl2-19 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
  • the kit can contain at least two antisense molecules (e.g., at least 4, 6, 8, 10, 12, 14, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40) for hybridizing with a sequence present within any of the microRNAs listed in Tables 1-19 (e.g., mature microRNA or precursor microRNA) or a sequence within any of the mRNAs listed in Tables 20 and 21.
  • at least two antisense molecules e.g., at least 4, 6, 8, 10, 12, 14, 16, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40
  • kits can contain at least one inhibitory nucleic acid and/or at least one sense nucleic acid (e.g., any of the inhibitory nucleic acids or sense nucleic acids described herein).
  • the kit contains at least one inhibitory nucleic acid (e.g., at least one inhibitory nucleic acid targeting hsa-miR-155) formulated for intrathecal or intracranial injection or infusion.
  • kits can contain at least one (e.g., at least two, three, four, five, or six) antibody that specifically binds to any one of the proteins encoded by any of the inflammatory marker genes listed in Table 20 or Table 21 (e.g., any of the variety of antibodies or antibody fragments described herein).
  • the antibodies can be labeled (e.g., labeled with a fluorophore, a radioisotope, an enzyme, biotin, or avidin).
  • the kit further contains at least one additional therapeutic agent (e.g., one or more of K S760704, SB509, ceftriaxone, minocycline, rilutek, and riluzole).
  • the kit further contains instructions for administering the at least one agent (e.g., one or more inhibitory nucleic acids) to a subject having or diagnosed as having a neurodegenerative disease (e.g., sporadic ALS and/or familial ALS, or MS).
  • a neurodegenerative disease e.g., sporadic ALS and/or familial ALS, or MS.
  • Example 1 MicroRNA Deregulation in Ly6C Hi Monocytes, Ly6C Low Monocytes, and CD39 + Microglia in a Mouse Model of ALS (SODl G93A Mice)
  • Lys6C H 7CCR2 + monocytes participate in tissue damage and disease pathogenesis in a variety of conditions, including an animal model of MS (King et al., Blood 113:3190-3197, 2009). Experiments were to performed to compare the microRNA expression profile in CD39 + microglia ( Figure 1A-1C), Ly6C Hl monocytes (Figure 2A-2C), and Ly6C Low monocytes (Figure 3A-3C), and in the mouse S0D1 G93A model of ALS at the presymptomatic stage (60 days), at the time of onset of symptoms, and at the end stage of disease to the expression in the same cells in non-transgenic litermates.
  • the microarray data were normalized using quantile (R software) to remove variation between samples.
  • MicroRNA expression level was normalized using dCT against U6 miRNA (internal control) and geometric mean across all samples. After the normalization step, analysis of variants between groups (ANOVA) was used to define significantly altered microRNAs across all disease stages in SOD1 mice (using a false discovery rate of ⁇ 0.1).
  • MicroRNA profiling of spleen-derived Ly6C Hl and Ly6C Low monocytes of the SOD1 mice during all stages of the disease showed 32 significantly dysregulated microRNAs in Ly6C Hl splenic monocytes and 23 dysregulated microRNAs in Ly6C Low splenic monocytes. All of the dysregulated microRNAs in the monocyte subsets were observed one month prior to clinical onset and during disease progression. The majority of these microRNAs were not overlapping between Lys6C Hl monocytes and Ly6C Low monocytes, suggesting that these different monocyte subsets have different functions during disease progression. Inflammation-related microRNAs such as let-7a, miR-27a, miR-34a, miR-132, miR-146a, miR-451, and miR-155 were
  • microRNA expression profiling of CD39 + microglia in the SOD1 mouse show that 24 microRNAs were upregulated and two microRNAs were downregulated compared to the same cells in non-transgenic litermates. These microRNAs were different from the microRNAs dysregulated in Ly6C Hl monocytes, with the exception of 6 microRNAs (let-7a, miR-27a, miR-34a, miR-132, miR-146a, and miR-155). These data demonstrate differences between resident microglia identified by CD39 and infiltrating Ly6C monocytes, and identify a unique microRNA pattern in microglia in SOD1 mice.
  • microRNA expression profiling was performed on human blood-derived CD14 CD16 " monocytes (Ly6C Hl analog) from ALS subjects and MS subjects.
  • the microRNA expression level was normalized against a geometric mean of five housekeeping genes (ACTB, B2M, GAPDH, RPL19, and RPLPO).
  • Figure 7A depicts the number of microRNAs uniquely upregulated in CD14 CD16 " monocytes from ALS and MS subjects, as well as the number of microRNAs upregulated in CD14 + CD16 " monocytes from both ALS and MS subjects.
  • Figure 7A also depicts the number of microRNAs uniquely downregulated in CD14 CD16 " monocytes from ALS and MS subjects, as well as the number of microRNAs downregulated in CD14 + CD16 " monocytes from both ALS and MS subjects.
  • Figure 7B is a volcano plot showing the significantly deregulated microRNAs in CD14 CD16 " monocytes from ALS subjects compared to the expression of the microRNAs in CD14 CD16 " monocytes from healthy controls.
  • Figure 7C is a volcano plot showing the significantly deregulated microRNAs in CD14 CD16 " monocytes from MS subjects compared to the expression of the microRNAs in CD14 CD16 " monocytes from healthy controls.
  • Figure 8 provides a summary of the microRNAs deregulated in CD14 CD16 " monocytes from ALS and MS subjects compared to the expression of the microRNAs in
  • CD14 CD16 monocytes from healthy controls.
  • CD14 CD16 monocytes from ALS and MS subjects (as compared to healthy controls) were confirmed using real-time PCR.
  • CD14 CD16 monocytes from MS subjects as compared to healthy controls ( Figure 14). These data also show confirm that hsa-miR-664 is uniquely upregulated in CD14 CD16 " monocytes from MS subjects as compared the expression of this microRNA in CD14 CD16 " monocytes from both ALS subjects and healthy controls ( Figure 14).
  • MicroRNA expression profiling was also performed using cerebrospinal fluid (CSF) from subjects having sporadic ALS and familial ALS.
  • CSF cerebrospinal fluid
  • hsa-miR-27b is increased in the CSF of subjects having both sporadic and familial ALS as compared to the level of this microRNA in the CSF of healthy controls, and that hsa-miR-99b, hsa-miR-146a, hsa-miR-150, hsa-miR-328, and hsa-miR-532-3p are uniquely upregulated in CSF from subjects having sporadic ALS compared to the levels of these microRNAs in CSF from healthy controls or subjects having familial ALS (Figure 16).
  • Example 4 Inflammation-Related Genes are also dysregulated in CD14 + CD16 " monocytes from subjects having ALS and MS
  • inflammatory marker genes 179 inflammation-related genes
  • a heatmap showing the change in expression of different inflammatory marker genes in CD14 CD16 " monocytes from ALS or MS subjects, as compared to the expression of these genes in CD14 CD16 " monocytes from healthy subjects is shown in Figure 17).
  • CD14 CD16 monocytes from healthy controls is shown in Figure 18A (left graph and right graph, respectively).
  • MicroRNAs are also Dysregulated in CD14 + CD16 + Monocytes from ALS subjects
  • the data in these experiments were normalized against a geometric mean of five different housekeeping genes (ACTB, B2M, GAPDH, RPL19, and RPL10).
  • the expression of 664 microRNAs were analyzed ( Figures 20A-C).
  • FIG 21 A and Figure 20B A heatmap of the relative expression of microRNAs in CD14 + CD16 + monocytes from ALS subjects and MS subjects compared to the expression of these microRNAs in CD14 + CD16 + monocytes from healthy controls is shown in Figure 21 A and Figure 20B, respectively.
  • Figure 20C A summary of the microRNAs significantly deregulated in CD14 + CD16 + monocytes from ALS and MS subjects compared to the expression of these microRNAs in CD14 + CD16 + monocytes from healthy controls is shown in Figure 20C.
  • Ly6C Hl monocytes isolated from the spleen of SOD1 mice one month prior to clinical disease onset and during disease progression. Pro-inflammatory genes were expressed at both time points (Figure 21 A). Out of 179 inflammatory marker genes measured by nCounter, 97 were detected as having altered expression (compared to Ly6C Hl monocytes from non-transgenic litermates): 40 genes were upregulated in Ly6C Hl monocytes from SOD1 mice (as compared to non-transgenic litermates) at least one disease stage. Seven genes were downregulated in Ly6C Hl monocytes in SOD1 mice compared to Ly6C Hl monocytes from non-transgenic litermates, including TGF i and the TGF i receptor ( Figure 21B).
  • Biological network analysis demonstrates that the most significantly affected pathways in the present analysis relative to inflammatory responses, including CREB1, NF-kB, PU. l, and PPARy (Figure 21C). These pathways have been shown to play an important role in both monocyte activation and differentiation.
  • the gene expression profiling demonstrates an activated pro-inflammatory Ly6C 1 monocyte population in the peripheral immune compartment of SODl mice.
  • genes related to chemotaxis e.g., CCL2, CCL3, CCL4, CCL5, CXCR4, and CXCR10
  • TGF l and the TGF l receptor were among the downregulated genes.
  • Biological network analysis demonstrated activation of inflammatory pathways with the most significant being chemotaxis (Figure 2 IF). The expression of these genes preceded symptom onset and was observed in the spinal cord, but not in the brain ( Figure 21G).
  • CD14 CD16 monocytes from ALS subjects was analyzed as described in Example 6. Several inflammatory-related genes were upregulated in CD14 CD16 " monocytes from ALS subjects as compared to healthy controls. Although there were some differences in immune -related gene expression between CD14 CD16 " monocytes from ALS subjects and MS subjects, the immune-related gene expression pattern in
  • CD14 + CD16 monocytes from ALS subjects and MS subjects were similar ( Figure 22A-C).
  • FDR false discovery rate
  • the whole data set of 58 dysregulated genes in CD39 + microglia from the spinal cord and 47 dysregulated genes in Ly6C Hl splenic monocytes from SOD 1 mice were imported into MetaCore to build an analysis of functional ontologies using GeneGo process, GeneGo disease process, canonical pathway maps, and networks.
  • the calculation of statistical significance throughout MetaCore for the maps, networks, and processes were based on P values, which were calculated based on a hypergeometric distribution. P values represent the probability of a particular mapping arising by chance, given the numbers of genes in the set of all genes present in the maps/networks/processes, the genes on a particular map/network/process, and the genes in the experiment. A P value of 0.01 was used for the cutoff.
  • the degree of relevance for the different categories of the uploaded data sets is defined by P values, so that the lower P value indicates higher priority.
  • the experimental data were input to build the networks.
  • the three different scoring functions that were used to rank the small subnetworks created by the network building algorithms were zScore, gScore, and p value.
  • the zScore ranks the subnetworks (within the analyzed network) with regard to their saturation with genes from the experiment.
  • a high zScore means the network is highly saturated with identified dysregulated genes from the experiment. In other words, it means that relatively larger number of genes/analytes in a particular network were present in the aqueous sample.
  • Each network is comprised of canonical pathways used to build the network.
  • a network has a high gScore, it is saturated with expressed genes (from the zScore), and it contains many canonical pathways.
  • the analysis was controlled for multiple testing by estimating the false discovery rate. Out of 664 microRNAs measured, 56 were confidently detected, and twenty were differentially expressed in at least one disease group.
  • Targetscan 14.1 was used to investigate the statistical significance of miR A-mR A interactions. Targetscan 14.1 was used for the prediction of 862044 conserved miRNA binding sites with non-zero context score which is a measure of conservation.
  • IP A Ingenuity® pathway analysis
  • the mRNA expression studies were integrated using the Nanostring platform into the analysis. 971 filtered targets contain the 47 immune-related genes that are dysregulated in SODl mice taking into account the opposite nature of the miRNA- mRNA regulation. This resulted in a final 87 pairs of miRNA-mRNA interactions representing 27 miRNA families and 33 mRNAs. In the miRNA expression of ALS subjects study, 56 miRNAs were found to be significantly dysregulated in ALS subjects. Filtering the predicted 862044 sites to those containing only targets of these 56 miRNAs lead to a reduction in the number of predicted sites (a reduction to 34118 sites).
  • the number of sites was further reduced by limiting the data to mRNA targets to genes found to be regulated with a fold change of >1.4 in the immunological panel nanostring arrays.
  • the final data indicate 68 unique miRNA-mRNA interaction pairs in which the mRNA and miRNA are oppositely regulated.
  • the true interactions determined in the expression studies is 68, and corresponds to a significant P value ( ⁇ 1.1 x 10 "15 ).
  • B6/SJL-S0D1 G93A Tg and SOD 1 -wild type (WT) were provided by Prize4Life or purchased from the Jackson Laboratories. ALS mice were analyzed at day 30 and 60
  • ALSTDI ALS Therapy Development Institute
  • mice Male S0D1 G93A [B6.Cg-Tg(SODl G93A )lGur/J] mice were bred with non-Tg C57B1/6 miR155 _/ ⁇ females. Non-transgenic miR155 _/ ⁇ were backcross to Fl-SODl G93A /miR155 ⁇ /+ to produce F2-S0D1 G93A / miR155 _/" with a deletion of miR155.
  • mice were assessed clinically by neurobehavioral testing (rotarod performance and neurologic score) and the survival of three experimental groups of SODl mice with different expression levels of miR-155 was assessed: 1) SODl G93A /miR155 +/+ ; 2) SODl G93A /miR155 ⁇ /+ ; and 3) SODl ⁇ /miR ⁇ "7" .
  • a Luciferase reporter bearing 3 'UTR with potential miRNA binding sites is utilized. Site-directed mutagenesis of the miRNA binding site abolishes responsiveness of the Luciferase reporter to miRNA modulation, which will provide proof of direct targeting.
  • Mononuclear cells were directly isolated from the spinal cord of mice as described in Cardona et al. (Nat. Protoc. 1 : 1947- 1951, 2006) except that no dispase was used as we found that dispase cleaves several surface molecules and can diminish surface detection of surface molecules.
  • Mice were transcardially perfused with ice cold phosphate-buffer saline (PBS), and the spinal cords and brains were separately dissected. Single cell suspensions were prepared and centrifuged over a 37%/70% discontinuous Percoll gradient (GE Healthcare), mononuclear cells were isolated from the interface, and the total cell count determined.
  • PBS ice cold phosphate-buffer saline
  • the cells were pre -blocked with anti-CD 16/CD32 (Fc Block BD Biosciences), and stained on ice for 30 minutes with combinations of anti-Ly6C-FITC, CD1 lb-PE-CyTM7, and 4D4-APC (unique microglial antibody). 7AAD-PerCP was used to detect or exclude early apoptotic and dead cells (BD Biosciences). The appropriate antibody IgG isotype controls (BD Biosciences) were used for all stains. Fluorescence-activated cell sorting (FACS) analysis was performed on a LSR machine (BD Biosciences), and the data subsequently analyzed with Flow Jo Software (TreeStar
  • Nanostring nCounter technology was used to study the expression of up to 800 inflammation-related genes. Multiplexed target profiling of 179 inflammation-related transcripts which consist of genes differentially expressed during inflammation and immune responses was also performed as described above. The resulting data show that SOD1 /miR155 ⁇ " animals have a significant delay in disease onset and survival compared to S0D1 G93A animals. (Tables 22 and 23, and Figures 30-
  • mice The body weight of the mice was assessed every 3-4 days starting at day 80, the clinical neurologic score of the mice was assessed daily, and rotarod performance was assessed 3 times a week.
  • the data show that genetic ablation of miR-155 prolonged survival by 51 days (P
  • mice also have a significantly reduction in the recruitment of peripheral monocytes associated with microglia protection in the spinal cord, as compared to S0D1 G93A mice ( Figure 35), and significant reduction in inflammation-related gene expression in spinal cord microglia and Ly6C Hl monocytes as compared to S0D1 G93A mice ( Figure 36). Fewer inflammation-related genes were affected in splenic T cells, however, the expression of antiinflammatory genes (IL4 and IL10) reverted to the level of non-transgenic mice, suggesting that miR-155 may primarily affect activation of the Ml -associated signature in Ly6C Hl monocytes in SOD 1 G93A mice.
  • IL4 and IL10 antiinflammatory genes
  • a neurodegenerative disorder e.g., ALS, e.g., familial ALS and/or sporadic ALS
  • treatment of subjects having a neurodegenerative disorder may be achieved by administering at least one an inhibitory nucleic acid targeting hsa-miR-155 (e.g., precursor or mature hsa-miR-155) to a subject a neurodegenerative disorder (e.g., ALS, e.g., familial ALS and/or sporadic ALS).
  • hsa-miR-155 e.g., precursor or mature hsa-miR-155
  • a neurodegenerative disorder e.g., ALS, e.g., familial ALS and/or sporadic ALS
  • inhibitory nucleic acids targeting hsa-miR-155 e.g., precursor or mature hsa-miR- 155 that can be administered to a subject having a neurodegenerative disorder are described herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Neurosurgery (AREA)
  • Pain & Pain Management (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US2012/059671 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders Ceased WO2013055865A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
KR1020147012433A KR20140074997A (ko) 2011-10-11 2012-10-11 신경병성 질환에서 마이크로rna
HK15101851.9A HK1201294B (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
EP12839637.1A EP2766482B1 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
MX2014004516A MX2014004516A (es) 2011-10-11 2012-10-11 Micro-arns en trastornos neurodegenerativos.
BR112014008925-6A BR112014008925A2 (pt) 2011-10-11 2012-10-11 micro rnas em distúrbios de neurodegenerativos
AU2012322788A AU2012322788B2 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
US14/350,977 US10184151B2 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
NZ623459A NZ623459B2 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
JP2014535856A JP6234370B2 (ja) 2011-10-11 2012-10-11 神経変性障害におけるマイクロrna
EP16193582.0A EP3170899B1 (en) 2011-10-11 2012-10-11 Microrna mir-155 in neurodegenerative disorders
CA2851280A CA2851280C (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
CN201280061082.XA CN104011210B (zh) 2011-10-11 2012-10-11 神经退行性病症中的microRNA
US15/699,546 US20180023142A1 (en) 2011-10-11 2017-09-08 Micrornas in neurodegenerative disorders
US16/251,945 US20190276892A1 (en) 2011-10-11 2019-01-18 Micrornas in neurodegenerative disorders

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161545968P 2011-10-11 2011-10-11
US61/545,968 2011-10-11
US201261601205P 2012-02-21 2012-02-21
US61/601,205 2012-02-21

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US14/350,977 A-371-Of-International US10184151B2 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders
US15/699,546 Continuation US20180023142A1 (en) 2011-10-11 2017-09-08 Micrornas in neurodegenerative disorders
US16/251,945 Continuation US20190276892A1 (en) 2011-10-11 2019-01-18 Micrornas in neurodegenerative disorders

Publications (1)

Publication Number Publication Date
WO2013055865A1 true WO2013055865A1 (en) 2013-04-18

Family

ID=48082415

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/059671 Ceased WO2013055865A1 (en) 2011-10-11 2012-10-11 Micrornas in neurodegenerative disorders

Country Status (10)

Country Link
US (3) US10184151B2 (enExample)
EP (2) EP2766482B1 (enExample)
JP (1) JP6234370B2 (enExample)
KR (1) KR20140074997A (enExample)
CN (1) CN104011210B (enExample)
AU (1) AU2012322788B2 (enExample)
BR (1) BR112014008925A2 (enExample)
CA (1) CA2851280C (enExample)
MX (1) MX2014004516A (enExample)
WO (1) WO2013055865A1 (enExample)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014128249A (ja) * 2012-12-28 2014-07-10 Hokkaido Univ 神経変性疾患の検査と治療に対するmiRNA又はその標的遺伝子の利用
EP2731422A4 (en) * 2011-07-12 2015-04-15 Mart Saarma TRANSGENIC ANIMAL COMPRISING A FUNCTIONAL DELETION OR DELETION OF THE 3 'UTR OF A ENDOGENIC GENE
JP2015133919A (ja) * 2014-01-16 2015-07-27 国立大学法人北海道大学 筋萎縮性側索硬化症のバイオマーカー
WO2015195737A1 (en) * 2014-06-17 2015-12-23 Stealth Peptides International, Inc. Methods of identifying and monitoring mitochondrial dysfunction using monocyte screening
JP2016198021A (ja) * 2015-04-08 2016-12-01 国立大学法人北海道大学 筋萎縮性側索硬化症の検出を補助する方法及び治療剤
US9771585B2 (en) 2015-06-05 2017-09-26 MiRagen Therapeutics, Inc. miR-155 inhibitors for treating cutaneous T cell lymphoma (CTCL)
EP3119797A4 (en) * 2014-03-18 2018-04-18 University of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
US10035825B2 (en) 2009-05-28 2018-07-31 University Of Massachusetts AAV's and uses thereof
US10166297B2 (en) 2008-05-28 2019-01-01 University Of Massachusetts Isolation of novel AAV's and uses thereof
EP3303589A4 (en) * 2015-06-05 2019-01-02 Miragen Therapeutics, Inc. Mir-155 inhibitors for treating amyotrophic lateral sclerosis (als)
KR20190009678A (ko) * 2017-07-19 2019-01-29 국민대학교산학협력단 파킨슨병 바이오마커로서의 miR4726 및 이를 이용한 진단키트
WO2019116412A1 (en) * 2017-12-15 2019-06-20 Istituto Superiore Di Sanita' Method for in vitro diagnosis of amyotrophic lateral sclerosis
US10370432B2 (en) 2014-10-03 2019-08-06 University Of Massachusetts Heterologous targeting peptide grafted AAVS
WO2019202162A1 (en) * 2018-04-20 2019-10-24 Fondazione Telethon Mir-181 inhibitors and uses thereof
US10457940B2 (en) 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
US10480011B2 (en) 2014-10-21 2019-11-19 University Of Massachusetts Recombinant AAV variants and uses thereof
EP3469093A4 (en) * 2016-06-10 2019-12-25 Saunders, Ann M. METHOD FOR DETECTING STRUCTURAL VARIANTS IN NEURODEGENERATIVE DISEASES
US10584321B2 (en) 2015-02-13 2020-03-10 University Of Massachusetts Compositions and methods for transient delivery of nucleases
US10689653B2 (en) 2014-06-03 2020-06-23 University Of Massachusetts Compositions and methods for modulating dysferlin expression
US10711270B2 (en) 2014-10-03 2020-07-14 University Of Massachusetts High efficiency library-identified AAV vectors
US10731178B2 (en) 2010-04-23 2020-08-04 University Of Massachusetts CNS targeting AAV vectors and methods of use thereof
US10829783B2 (en) 2010-04-23 2020-11-10 University Of Massachusetts Multicistronic expression constructs
WO2021001665A1 (en) * 2019-07-04 2021-01-07 Oxford University Innovation Limited Methods for diagnosing multiple sclerosis
US10894949B2 (en) 2014-02-19 2021-01-19 University Of Massachusetts Recombinant AAVS having useful transcytosis properties
US10975391B2 (en) 2014-04-25 2021-04-13 University Of Massachusetts Recombinant AAV vectors useful for reducing immunity against transgene products
EP3669880A4 (en) * 2017-08-18 2021-05-05 Curamys Co., Ltd. USE OF miR-18b IN THE PREVENTION, TREATMENT, OR DIAGNOSIS OF MUSCLE AND NEUROMUSCULAR DISEASE
US11046955B2 (en) 2015-04-24 2021-06-29 University Of Massachusetts Modified AAV constructs and uses thereof
US11060088B2 (en) 2016-02-12 2021-07-13 University Of Massachusetts Anti-angiogenic miRNA therapeutics for inhibiting corneal neovascularization
US11207426B2 (en) 2016-04-05 2021-12-28 University Of Massachusetts Compositions and methods for selective inhibition of grainyhead-like protein expression
US11253576B2 (en) 2015-10-22 2022-02-22 University Of Massachusetts Methods and compositions for treating metabolic imbalance in neurodegenerative disease
US11413356B2 (en) 2016-04-15 2022-08-16 University Of Massachusetts Methods and compositions for treating metabolic imbalance
US11426469B2 (en) 2015-10-22 2022-08-30 University Of Massachusetts Prostate-targeting adeno-associated virus serotype vectors
EP3887546A4 (en) * 2019-09-16 2022-08-31 Genieus Genomics Pty Ltd BIOMARKERS FOR NEURODEGENERATIVE DISEASES
US11578340B2 (en) 2016-10-13 2023-02-14 University Of Massachusetts AAV capsid designs
WO2023140652A1 (ko) * 2022-01-21 2023-07-27 (재)바이오나노헬스가드연구단 알츠하이머 조기진단용 바이오마커와 이의 용도
WO2023140653A1 (ko) * 2022-01-21 2023-07-27 (재)바이오나노헬스가드연구단 알츠하이머병 진단용 바이오마커 및 이의 용도
US11739330B2 (en) 2017-09-22 2023-08-29 University Of Massachusetts SOD1 dual expression vectors and uses thereof
US11826433B2 (en) 2016-02-02 2023-11-28 University Of Massachusetts Method to enhance the efficiency of systemic AAV gene delivery to the central nervous system
US11859179B2 (en) 2017-05-09 2024-01-02 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
US11882815B2 (en) 2016-06-15 2024-01-30 University Of Massachusetts Recombinant adeno-associated viruses for delivering gene editing molecules to embryonic cells
US12163129B2 (en) 2018-06-08 2024-12-10 University Of Massachusetts Antisense oligonucleotides to restore dysferlin protein expression in dysferlinopathy patient cells
US12529051B2 (en) 2023-11-09 2026-01-20 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)

Families Citing this family (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10487324B2 (en) 2015-02-25 2019-11-26 Washington University Methods to detect motor neuron disease comprising micro-RNAs
CN104826131B (zh) * 2015-04-15 2018-12-18 涛康生物科技(上海)有限公司 miR-17-92基因簇在制备治疗精神类疾病药物中的用途
WO2017004381A1 (en) * 2015-06-30 2017-01-05 St. Jude Children's Research Hospital, Inc. Method for treating schizophrenia
KR101723826B1 (ko) * 2015-07-14 2017-04-06 한국과학기술연구원 마약 중독 여부 진단용 바이오마커 및 마약 중독 여부 진단용 키트
WO2017177028A1 (en) * 2016-04-06 2017-10-12 Duke University Compositions and methods for blood storage
US20190131019A1 (en) * 2016-05-09 2019-05-02 Wayne State University Orthogonal approach to integrate independent omic data
CN105861728B (zh) * 2016-06-12 2024-11-19 上海市第十人民医院 循环miRNA作为年龄相关黄斑变性诊断标志物中的应用
CN106620718B (zh) * 2016-08-30 2019-11-05 广东医科大学 PF-127-miRNA-615 agomir复合物及其制备方法和应用
EP3526319B1 (en) 2016-10-14 2025-12-10 Children's Medical Center Corporation Compositions and methods for treating diseases and disorders of the central nervous system
CA3050691A1 (en) 2017-01-17 2018-07-26 Dana-Farber Cancer Institute, Inc. Compositions and methods for treating lysosomal storage diseases and disorders
EP3571310A4 (en) 2017-01-17 2020-12-16 Children's Medical Center Corporation COMPOSITIONS AND METHODS FOR DIAGNOSIS AND TREATMENT OF PEROXYSOMAL DISEASES
ES2993181T3 (en) 2017-06-19 2024-12-23 St Johns Univ Circulating serum microrna biomarkers and methods for determining the progression rate of parkinson's disease
US11078535B2 (en) * 2017-07-18 2021-08-03 The Trustees Of Indiana University Presymptomatic micro RNA targets for treatment of neurodegeneration pathology
KR102361394B1 (ko) * 2017-12-28 2022-02-14 재단법인 대구경북과학기술원 뇌전증과 관련된 miRNA 및 그의 용도
KR102248910B1 (ko) * 2017-12-28 2021-05-06 재단법인대구경북과학기술원 뇌전증과 관련된 miRNA 및 그의 용도
EP3791188A1 (en) * 2018-05-10 2021-03-17 The Methodist Hospital Methods for prognosis and management of disease
WO2020171889A1 (en) 2019-02-19 2020-08-27 University Of Rochester Blocking lipid accumulation or inflammation in thyroid eye disease
WO2021067613A1 (en) * 2019-10-01 2021-04-08 Children's Medical Center Corporation Compositions and methods for treating amyotrophic lateral sclerosis
CN111727260A (zh) * 2019-10-15 2020-09-29 湖南乾康科技有限公司 中间型单核细胞在制备诊断和预测ad药物中的应用
CN110791560B (zh) * 2019-11-06 2021-09-14 中国医学科学院医药生物技术研究所 一种用于阿尔茨海默病诊断和/或治疗的miRNA标志物
US20210164051A1 (en) * 2019-12-02 2021-06-03 The Institute for Ethnomedicine dba Brain Chemistry Labs Methods of detection and analysis of nucleic acid in neural-derived exosomes
CN112458165A (zh) * 2020-12-27 2021-03-09 中山大学孙逸仙纪念医院 一种阿尔茨海默病的预测标志物、检测试剂盒及应用
CN117427090A (zh) * 2023-10-25 2024-01-23 暨南大学附属第一医院(广州华侨医院) miR-137-3p在制备阿尔茨海默病神经炎症药物的用途
CN119824108B (zh) * 2025-02-26 2025-12-12 湖南农业大学 一种棘胸蛙InDel分子标记用样本保存试剂及其制备方法

Citations (152)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5013830A (en) 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5491133A (en) 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5565350A (en) 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
WO1997045069A1 (en) 1996-05-29 1997-12-04 Cell Genesys, Inc. Cationic polymer/lipid nucleic acid delivery vehicles
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6287860B1 (en) 2000-01-20 2001-09-11 Isis Pharmaceuticals, Inc. Antisense inhibition of MEKK2 expression
WO2003048773A2 (en) * 2001-11-16 2003-06-12 Slil Biomedical Corporation Methods for monitoring amyotrophic lateral sclerosis
US6734291B2 (en) 1999-03-24 2004-05-11 Exiqon A/S Synthesis of [2.2.1]bicyclo nucleosides
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US7060809B2 (en) 2001-09-04 2006-06-13 Exiqon A/S LNA compositions and uses thereof
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
WO2008153692A2 (en) * 2007-05-22 2008-12-18 The Brigham And Women's Hospital, Inc. Microrna expression profiling of cerebrospinal fluid
WO2009029690A1 (en) * 2007-08-27 2009-03-05 Boston Biomedical, Inc. Composition of asymmetric rna duplex as microrna mimetic or inhibitor
US20090143326A1 (en) 2007-10-04 2009-06-04 Santaris Pharma A/S MICROMIRs
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
WO2009117418A2 (en) 2008-03-17 2009-09-24 The Board Of Regents Of The University Of Texas System Identification of micro-rnas involved in neuromuscular synapse maintenance and regeneration
US20090298916A1 (en) 2008-03-07 2009-12-03 Santaris Pharma A/S Pharmaceutical compositions for treatment of microRNA related diseases
US20100004320A1 (en) 2006-04-03 2010-01-07 Santaris Pharma A/S Pharmaceutical Composition
US20100035968A1 (en) 2007-01-19 2010-02-11 Exiqon A/S Mediated cellular delivery of lna oligonucleotides
WO2010040112A2 (en) 2008-10-03 2010-04-08 Curna, Inc. Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
US20100104629A1 (en) 2008-04-16 2010-04-29 Abbott Laboratories Cationic lipids and uses thereof
US20100203112A1 (en) 2007-03-29 2010-08-12 Snu R&Db Foundation Composition of cationic phospholipid nanoparticles for effective delivery of nucleic acids
US20100261175A1 (en) 2007-06-15 2010-10-14 Exiqon A/S Use of short oligonucleotides for reagent redundancy experiments in rna functional analysis
US20100286385A1 (en) * 2004-02-13 2010-11-11 Rockefeller University Anti-MicroRNA Oligonucleotide Molecules
US20100305198A1 (en) 2007-10-19 2010-12-02 The University Court Of The University Of Edinburg Cationic lipids
US20110142789A1 (en) * 2009-12-10 2011-06-16 The Trustees Of The University Of Pennsylvania Compositions and Methods for the Diagnosis and Treatment of Amyotrophic Lateral Sclerosis
US20110229581A1 (en) 2008-11-17 2011-09-22 Enzon Pharmaceuticals, Inc. Releasable cationic lipids for nucleic acids delivery systems
US20110262527A1 (en) 2004-06-07 2011-10-27 Protiva Biotherapeutics, Inc. Cationic lipids and methods of use
US20110305769A1 (en) 2008-11-17 2011-12-15 Enzon Pharmaceuticals, Inc. Branched cationic lipids for nucleic acids delivery system
US20120015865A1 (en) 2007-12-19 2012-01-19 Oz Biosciences Novel class of cationic lipids for transporting active agents into cells
US20120021044A1 (en) 2007-08-28 2012-01-26 Snu R&Db Foundation Novel Cationic Lipid, A Preparation Method of the Same and A Delivery System Comprising the Same
US9209196B2 (en) 2011-11-30 2015-12-08 Sharp Kabushiki Kaisha Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5716928A (en) 1995-06-07 1998-02-10 Avmax, Inc. Use of essential oils to increase bioavailability of oral pharmaceutical compounds
US5858401A (en) 1996-01-22 1999-01-12 Sidmak Laboratories, Inc. Pharmaceutical composition for cyclosporines
US6007839A (en) 1996-02-16 1999-12-28 The Liposome Company, Inc. Preparation of pharmaceutical compositions containing etherlipid-containing multiple lipid liposomes
US6630137B1 (en) 1997-04-28 2003-10-07 Eli Lilly And Company Activated protein C formulations
JP2001511821A (ja) 1997-06-05 2001-08-14 シューベルト、バルター 筋萎縮性側索硬化症の治療のための免疫調節活性を有する物質の使用
JP2000516641A (ja) 1997-07-02 2000-12-12 エスディージー インコーポレイテッド 診断および治療用途の目標指向性リポソーム構成物
US7087648B1 (en) 1997-10-27 2006-08-08 The Regents Of The University Of California Methods for modulating macrophage proliferation using polyamine analogs
DE60042785D1 (de) 1999-06-09 2009-10-01 Immunomedics Inc Immuntherapie von autoimmunerkrankungen durch die verwendung von b-zell spezifischen antikörpern
US9045518B2 (en) 2002-11-18 2015-06-02 Santaris Pharma A/S Amino-LNA, thio-LNA and alpha-L-oxy-LN
JP4755972B2 (ja) 2003-03-21 2011-08-24 サンタリス ファーマ アー/エス 短鎖干渉RNA(siRNA)アナログ
EP2530157B1 (en) 2003-07-31 2016-09-28 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of miRNAs
CN100569945C (zh) 2003-12-23 2009-12-16 桑塔里斯制药公司 用于调节bcl-2的寡聚化合物
WO2005073378A1 (en) 2004-01-30 2005-08-11 Santaris Pharma A/S MODIFIED SHORT INTERFERING RNA (MODIFIED siRNA)
US7618947B2 (en) 2004-08-25 2009-11-17 Isis Pharmaceuticals, Inc. Modulation of HIF-1 beta expression
MX2007005557A (es) 2004-11-09 2008-02-15 Santaris Pharma As Oligonucleotidos lna y el tratamiento de cancer.
US20070099196A1 (en) 2004-12-29 2007-05-03 Sakari Kauppinen Novel oligonucleotide compositions and probe sequences useful for detection and analysis of micrornas and their target mRNAs
SG170773A1 (en) * 2006-04-03 2011-05-30 Santaris Pharma As Pharmaceutical composition comprising anti-mirna antisense oligonucleotides
US8338376B2 (en) * 2006-10-20 2012-12-25 Biogen Idec Ma Inc. Compositions comprising variant LT-B-R-IG fusion proteins
PE20090064A1 (es) 2007-03-26 2009-03-02 Novartis Ag Acido ribonucleico de doble cadena para inhibir la expresion del gen e6ap humano y composicion farmaceutica que lo comprende
KR20100110298A (ko) 2007-11-26 2010-10-12 산타리스 팔마 에이/에스 안드로겐 수용체를 표적화하는 lna 길항제
EP2427552B1 (en) 2009-05-06 2016-11-16 CuRNA, Inc. Treatment of tristetraproline (ttp) related diseases by inhibition of natural antisense transcript to ttp
US9364495B2 (en) 2009-10-20 2016-06-14 Roche Innovation Center Copenhagen A/S Oral delivery of therapeutically effective LNA oligonucleotides
WO2012037043A2 (en) * 2010-09-13 2012-03-22 California Institute Of Technolgoy Treatment of autoimmune inflammation using mir-155
WO2013134403A1 (en) * 2012-03-06 2013-09-12 The Washington University Method of treating neurodegenerative diseases with microrna regulators
IN2014DN07639A (enExample) * 2012-03-09 2015-05-15 Ts Tech Co Ltd
CA2986913A1 (en) 2015-06-05 2016-12-08 MiRagen Therapeutics, Inc. Mir-155 inhibitors for treating amyotrophic lateral sclerosis (als)

Patent Citations (169)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4789737A (en) 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US5541313A (en) 1983-02-22 1996-07-30 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5552538A (en) 1984-10-16 1996-09-03 Chiron Corporation Oligonucleotides with cleavable sites
US5578717A (en) 1984-10-16 1996-11-26 Chiron Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US5013830A (en) 1986-09-08 1991-05-07 Ajinomoto Co., Inc. Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5286717A (en) 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5403711A (en) 1987-11-30 1995-04-04 University Of Iowa Research Foundation Nucleic acid hybridization and amplification method for detection of specific sequences in which a complementary labeled nucleic acid probe is cleaved
US5491133A (en) 1987-11-30 1996-02-13 University Of Iowa Research Foundation Methods for blocking the expression of specifically targeted genes
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5453496A (en) 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5366878A (en) 1990-02-15 1994-11-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5563253A (en) 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5541306A (en) 1990-03-08 1996-07-30 Worcester Foundation For Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
US5536821A (en) 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5567810A (en) 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5565350A (en) 1993-12-09 1996-10-15 Thomas Jefferson University Compounds and methods for site directed mutations in eukaryotic cells
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591584A (en) 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5652356A (en) 1995-08-17 1997-07-29 Hybridon, Inc. Inverted chimeric and hybrid oligonucleotides
WO1997045069A1 (en) 1996-05-29 1997-12-04 Cell Genesys, Inc. Cationic polymer/lipid nucleic acid delivery vehicles
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6770748B2 (en) 1997-03-07 2004-08-03 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogue
US7034133B2 (en) 1997-09-12 2006-04-25 Exiqon A/S Oligonucleotide analogues
US20100267018A1 (en) 1997-09-12 2010-10-21 Exiqon A/S Oligonucleotide analogues
US7572582B2 (en) 1997-09-12 2009-08-11 Exiqon A/S Oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US6734291B2 (en) 1999-03-24 2004-05-11 Exiqon A/S Synthesis of [2.2.1]bicyclo nucleosides
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6287860B1 (en) 2000-01-20 2001-09-11 Isis Pharmaceuticals, Inc. Antisense inhibition of MEKK2 expression
US7060809B2 (en) 2001-09-04 2006-06-13 Exiqon A/S LNA compositions and uses thereof
WO2003048773A2 (en) * 2001-11-16 2003-06-12 Slil Biomedical Corporation Methods for monitoring amyotrophic lateral sclerosis
US20100286385A1 (en) * 2004-02-13 2010-11-11 Rockefeller University Anti-MicroRNA Oligonucleotide Molecules
US20110262527A1 (en) 2004-06-07 2011-10-27 Protiva Biotherapeutics, Inc. Cationic lipids and methods of use
US20100004320A1 (en) 2006-04-03 2010-01-07 Santaris Pharma A/S Pharmaceutical Composition
US20100035968A1 (en) 2007-01-19 2010-02-11 Exiqon A/S Mediated cellular delivery of lna oligonucleotides
US20100203112A1 (en) 2007-03-29 2010-08-12 Snu R&Db Foundation Composition of cationic phospholipid nanoparticles for effective delivery of nucleic acids
WO2008153692A2 (en) * 2007-05-22 2008-12-18 The Brigham And Women's Hospital, Inc. Microrna expression profiling of cerebrospinal fluid
US20100261175A1 (en) 2007-06-15 2010-10-14 Exiqon A/S Use of short oligonucleotides for reagent redundancy experiments in rna functional analysis
WO2009029690A1 (en) * 2007-08-27 2009-03-05 Boston Biomedical, Inc. Composition of asymmetric rna duplex as microrna mimetic or inhibitor
US20120021044A1 (en) 2007-08-28 2012-01-26 Snu R&Db Foundation Novel Cationic Lipid, A Preparation Method of the Same and A Delivery System Comprising the Same
US20090143326A1 (en) 2007-10-04 2009-06-04 Santaris Pharma A/S MICROMIRs
US20100305198A1 (en) 2007-10-19 2010-12-02 The University Court Of The University Of Edinburg Cationic lipids
US20120015865A1 (en) 2007-12-19 2012-01-19 Oz Biosciences Novel class of cationic lipids for transporting active agents into cells
US20090298916A1 (en) 2008-03-07 2009-12-03 Santaris Pharma A/S Pharmaceutical compositions for treatment of microRNA related diseases
WO2009117418A2 (en) 2008-03-17 2009-09-24 The Board Of Regents Of The University Of Texas System Identification of micro-rnas involved in neuromuscular synapse maintenance and regeneration
US20100104629A1 (en) 2008-04-16 2010-04-29 Abbott Laboratories Cationic lipids and uses thereof
WO2010040112A2 (en) 2008-10-03 2010-04-08 Curna, Inc. Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
US20110229581A1 (en) 2008-11-17 2011-09-22 Enzon Pharmaceuticals, Inc. Releasable cationic lipids for nucleic acids delivery systems
US20110305769A1 (en) 2008-11-17 2011-12-15 Enzon Pharmaceuticals, Inc. Branched cationic lipids for nucleic acids delivery system
US20110142789A1 (en) * 2009-12-10 2011-06-16 The Trustees Of The University Of Pennsylvania Compositions and Methods for the Diagnosis and Treatment of Amyotrophic Lateral Sclerosis
US9209196B2 (en) 2011-11-30 2015-12-08 Sharp Kabushiki Kaisha Memory circuit, method of driving the same, nonvolatile storage device using the same, and liquid crystal display device

Non-Patent Citations (67)

* Cited by examiner, † Cited by third party
Title
"Antisense Research and Applications", 1993, CRC PRESS, pages: 276 - 278
"Current Protocols in Molecular Biology", 2010, JOHN WILEY & SONS, INC.
"Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation", 1993, ELSEVIER
"The Concise Encyclopedia of Polymer Science And Engineering", 1990, JOHN WILEY & SONS, pages: 858 - 859
ADAMS, J. AM. CHEM. SOC., vol. 105, 1983, pages 661
ALEXIANU ET AL., NEUROLOGY, vol. 57, 2001, pages 1282 - 1289
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
BANERJEE ET AL., PLOS ONE, vol. 3, 2008, pages E2740
BEAUCAGE, TETRA. LETT., vol. 22, 1981, pages 1859
BEERS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 103, 2006, pages 16021 - 16026
BEERS ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 105, 2008, pages 15558 - 15563
BELOUSOV, NUCLEIC ACIDS RES., vol. 25, 1997, pages 3440 - 3444
BLOMMERS, BIOCHEMISTRY, vol. 33, 1994, pages 7886 - 7896
BRAASCH ET AL., BIOCHEMISTRY, vol. 41, no. 14, 2002, pages 4503 - 4510
BROWN, METH. ENZYMOL., vol. 68, 1979, pages 109
CHIU ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 105, 2008, pages 17913 - 17918
CHIU ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 106, 2009, pages 20960 - 20965
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
DE MESMAEKER ET AL., ACE. CHEM. RES., vol. 28, 1995, pages 366 - 374
ELIJAH W. STOMMEL ET AL.: "Efficacy of thalidomide for the treatment of amyotrophic lateral sclerosis: A phase II open label clinical trial.", AMYOTROPHIC LATERAL SCLEROSIS, vol. 10, 2009, pages 393 - 404, XP055149540 *
ELMEN ET AL., NATURE, vol. 452, 2008, pages 896 - 899
ENGLISCH ET AL., ANGEWANDLE CHEMIE, vol. 30, 1991, pages 613
FRENKEL, FREE RADIC. BIOL. MED., vol. 19, 1995, pages 373 - 380
GENESIS, vol. 30, no. 3, 2001
GETTS ET AL., J. EXP. MED., vol. 205, 2008, pages 2319 - 2337
HALL ET AL., GLIA, vol. 23, 1998, pages 249 - 256
HEASMAN, J., DEV. BIOL., vol. 243, 2002, pages 209 - 214
HENKEL ET AL., ANN. NEUROL., vol. 55, 2004, pages 221 - 235
JEPSEN ET AL., OLIGONUCLEOTIDES, vol. 14, 2004, pages 130 - 146
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
KAUPINNEN ET AL., DRUG DISC. TODAY, vol. 2, no. 3, 2005, pages 287 - 290
KAUPPINEN ET AL., DRUG DISC. TODAY, vol. 2, no. 3, 2005, pages 287 - 290
KIM ET AL., IMMUNITY, vol. 34, 2011, pages 769 - 780
KING ET AL., BLOOD, vol. 113, 2009, pages 3190 - 3197
KOSHKIN ET AL., J. AM. CHEM. SOC., vol. 120, no. 50, 1998, pages 13252 - 13253
KOSHKIN ET AL., TETRAHEDRON, vol. 54, 1998, pages 3607 - 3630
KRIEGLER: "Gene Transfer and Expression: A Laboratory Manual", 1990
KRUTZFELD ET AL., NATURE, vol. 438, 2005, pages 685 - 689
KRUTZFELDT J. ET AL., NATURE, vol. 438, 2005, pages 685 - 689
LACERRA ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 97, 2000, pages 9591 - 9596
LETSINGER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 86, 1989, pages 6553 - 6556
MANCHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MANOHARAN ET AL., ANN. N. Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 3, 1993, pages 2765 - 2770
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
MCGREER ET AL., MUSCLE NERVE, vol. 26, 2002, pages 459 - 470
MEISSNER ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 107, 2010, pages 13046 - 13050
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
MURUGAIYAN ET AL., J. IMMUNOL., vol. 187, 2011, pages 2213 - 2221
NARANG, METH. ENZYMOL., vol. 68, 1994, pages 90
NASEVICIUS ET AL., NAT. GENET., vol. 26, 2000, pages 216 - 220
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
OBAD ET AL., NATURE GENETICS, vol. 43, 2011, pages 371 - 378
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
OBIKA ET AL., TETRAHEDRON LETT., vol. 39, 1998, pages 5401 - 5404
PONTING ET AL., CELL, vol. 136, no. 4, 2009, pages 629 - 641
SAMBROOK ET AL.: "Molecular Cloning; A Laboratory Manual", 2001
SANGHVI, Y. S.: "Antisense Research and Applications", 1993, CRC PRESS, pages: 289 - 302
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SUSANNA OBAD ET AL.: "Silencing of microRNA families by seed-targeting tiny LNAs.", NATURE GENETICS, vol. 43, no. 4, April 2011 (2011-04-01), pages 371 - 378, XP055149539 *
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
WANG ET AL., J. AM. CHEM. SOC., vol. 122, 2000, pages 8595 - 8602
WANG ET AL., MOL. THER., vol. 12, 2005, pages 314 - 320
WORM ET AL., NUCLEIC ACIDS RES., vol. 37, 2009, pages 5784 - 5792
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656

Cited By (85)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10166297B2 (en) 2008-05-28 2019-01-01 University Of Massachusetts Isolation of novel AAV's and uses thereof
US10905776B2 (en) 2008-05-28 2021-02-02 University Of Massachusetts Isolation of novel AAV's and uses thereof
US10300146B2 (en) 2008-05-28 2019-05-28 University Of Massachusetts Isolation of novel AAV's and uses thereof
US11826434B2 (en) 2008-05-28 2023-11-28 University Of Massachusetts Isolation of novel AAV's and uses thereof
US10689420B2 (en) 2009-05-28 2020-06-23 University Of Massachusetts AAV's and uses thereof
US10035825B2 (en) 2009-05-28 2018-07-31 University Of Massachusetts AAV's and uses thereof
US11834474B2 (en) 2009-05-28 2023-12-05 University Of Massachusetts AAV's and uses thereof
US10829783B2 (en) 2010-04-23 2020-11-10 University Of Massachusetts Multicistronic expression constructs
US10731178B2 (en) 2010-04-23 2020-08-04 University Of Massachusetts CNS targeting AAV vectors and methods of use thereof
EP2731422A4 (en) * 2011-07-12 2015-04-15 Mart Saarma TRANSGENIC ANIMAL COMPRISING A FUNCTIONAL DELETION OR DELETION OF THE 3 'UTR OF A ENDOGENIC GENE
JP2014128249A (ja) * 2012-12-28 2014-07-10 Hokkaido Univ 神経変性疾患の検査と治療に対するmiRNA又はその標的遺伝子の利用
JP2015133919A (ja) * 2014-01-16 2015-07-27 国立大学法人北海道大学 筋萎縮性側索硬化症のバイオマーカー
US10894949B2 (en) 2014-02-19 2021-01-19 University Of Massachusetts Recombinant AAVS having useful transcytosis properties
EP4410805A3 (en) * 2014-03-18 2024-11-27 University of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
AU2015231294B2 (en) * 2014-03-18 2020-10-29 University Of Massachusetts rAAV-based compositions and methods for treating amyotrophic lateral sclerosis
EP3119797A4 (en) * 2014-03-18 2018-04-18 University of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
US10711274B2 (en) 2014-03-18 2020-07-14 University Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
US11760999B2 (en) 2014-03-18 2023-09-19 University Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
US10851375B2 (en) 2014-03-18 2020-12-01 University Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
US10280418B2 (en) 2014-03-18 2019-05-07 Univeristy Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
US10954518B2 (en) 2014-03-18 2021-03-23 University Of Massachusetts RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
US12467063B2 (en) 2014-04-25 2025-11-11 University Of Massachusetts Recombinant AAV vectors useful for reducing immunity against transgene products
US10975391B2 (en) 2014-04-25 2021-04-13 University Of Massachusetts Recombinant AAV vectors useful for reducing immunity against transgene products
US10689653B2 (en) 2014-06-03 2020-06-23 University Of Massachusetts Compositions and methods for modulating dysferlin expression
US11827886B2 (en) 2014-06-03 2023-11-28 University Of Massachusetts Compositions and methods for modulating dysferlin expression
US11366104B2 (en) 2014-06-17 2022-06-21 Stealth Biotherapeutics Inc. Methods of identifying and monitoring mitochondrial dysfunction using monocyte screening
WO2015195737A1 (en) * 2014-06-17 2015-12-23 Stealth Peptides International, Inc. Methods of identifying and monitoring mitochondrial dysfunction using monocyte screening
US10627392B2 (en) 2014-06-17 2020-04-21 Stealth Biotherapeutics Corp Methods of identifying and monitoring mitochondrial dysfunction using monocyte screening
US12091659B2 (en) 2014-10-03 2024-09-17 University Of Massachusetts High efficiency library-identified AAV vectors
US11014976B2 (en) 2014-10-03 2021-05-25 University Of Massachusetts Heterologous targeting peptide grafted AAVS
US10370432B2 (en) 2014-10-03 2019-08-06 University Of Massachusetts Heterologous targeting peptide grafted AAVS
US10711270B2 (en) 2014-10-03 2020-07-14 University Of Massachusetts High efficiency library-identified AAV vectors
US12291719B2 (en) 2014-10-03 2025-05-06 University Of Massachusetts Heterologous targeting peptide grafted AAVs
US10480011B2 (en) 2014-10-21 2019-11-19 University Of Massachusetts Recombinant AAV variants and uses thereof
US11542525B2 (en) 2014-10-21 2023-01-03 University Of Massachusetts Recombinant AAV variants and uses thereof
US10584321B2 (en) 2015-02-13 2020-03-10 University Of Massachusetts Compositions and methods for transient delivery of nucleases
US11920168B2 (en) 2015-02-13 2024-03-05 University Of Massachusetts Compositions and methods for transient delivery of nucleases
JP2016198021A (ja) * 2015-04-08 2016-12-01 国立大学法人北海道大学 筋萎縮性側索硬化症の検出を補助する方法及び治療剤
US11046955B2 (en) 2015-04-24 2021-06-29 University Of Massachusetts Modified AAV constructs and uses thereof
US12054715B2 (en) 2015-04-24 2024-08-06 University Of Massachusetts Modified AAV constructs and uses thereof
US10316318B2 (en) 2015-06-05 2019-06-11 MiRagen Therapeutics, Inc. Oligonucleotide compositions and uses thereof
US9771585B2 (en) 2015-06-05 2017-09-26 MiRagen Therapeutics, Inc. miR-155 inhibitors for treating cutaneous T cell lymphoma (CTCL)
EP3303589A4 (en) * 2015-06-05 2019-01-02 Miragen Therapeutics, Inc. Mir-155 inhibitors for treating amyotrophic lateral sclerosis (als)
US9994852B2 (en) 2015-06-05 2018-06-12 MiRagen Therapeutics, Inc. Oligonucleotide compositions and uses thereof
US11426469B2 (en) 2015-10-22 2022-08-30 University Of Massachusetts Prostate-targeting adeno-associated virus serotype vectors
US12491235B2 (en) 2015-10-22 2025-12-09 University Of Massachusetts Methods and compositions for treating metabolic imbalance in neurodegenerative disease
US11253576B2 (en) 2015-10-22 2022-02-22 University Of Massachusetts Methods and compositions for treating metabolic imbalance in neurodegenerative disease
US11826433B2 (en) 2016-02-02 2023-11-28 University Of Massachusetts Method to enhance the efficiency of systemic AAV gene delivery to the central nervous system
US11851657B2 (en) 2016-02-12 2023-12-26 University Of Massachusetts Anti-angiogenic miRNA therapeutics for inhibiting corneal neovascularization
US11060088B2 (en) 2016-02-12 2021-07-13 University Of Massachusetts Anti-angiogenic miRNA therapeutics for inhibiting corneal neovascularization
US11207426B2 (en) 2016-04-05 2021-12-28 University Of Massachusetts Compositions and methods for selective inhibition of grainyhead-like protein expression
US11413356B2 (en) 2016-04-15 2022-08-16 University Of Massachusetts Methods and compositions for treating metabolic imbalance
US11001893B2 (en) 2016-06-10 2021-05-11 Zinfandel Pharmaceuticals, Inc. Methods for detecting structural variants in neurodegenerative disease
EP3469093A4 (en) * 2016-06-10 2019-12-25 Saunders, Ann M. METHOD FOR DETECTING STRUCTURAL VARIANTS IN NEURODEGENERATIVE DISEASES
US11882815B2 (en) 2016-06-15 2024-01-30 University Of Massachusetts Recombinant adeno-associated viruses for delivering gene editing molecules to embryonic cells
US11046957B2 (en) 2016-09-22 2021-06-29 University Of Massachusetts AAV treatment of Huntington's disease
US11773392B2 (en) 2016-09-22 2023-10-03 University Of Massachusetts AAV treatment of Huntington's disease
US10457940B2 (en) 2016-09-22 2019-10-29 University Of Massachusetts AAV treatment of Huntington's disease
US12522824B2 (en) 2016-09-22 2026-01-13 University Of Massachusetts AAV treatment of Huntington's disease
US11578340B2 (en) 2016-10-13 2023-02-14 University Of Massachusetts AAV capsid designs
US11859179B2 (en) 2017-05-09 2024-01-02 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
KR20190009678A (ko) * 2017-07-19 2019-01-29 국민대학교산학협력단 파킨슨병 바이오마커로서의 miR4726 및 이를 이용한 진단키트
KR20190009674A (ko) * 2017-07-19 2019-01-29 국민대학교산학협력단 파킨슨병 바이오마커로서의 miR494 및 이를 이용한 진단키트
KR101956328B1 (ko) 2017-07-19 2019-03-08 국민대학교 산학협력단 파킨슨병 바이오마커로서의 miR4324 및 이를 이용한 진단키트
KR102063244B1 (ko) 2017-07-19 2020-01-06 국민대학교 산학협력단 파킨슨병 바이오마커로서의 miR1244 및 이를 이용한 진단키트
KR20190009676A (ko) * 2017-07-19 2019-01-29 국민대학교산학협력단 파킨슨병 바이오마커로서의 miR6768 및 이를 이용한 진단키트
KR101956315B1 (ko) 2017-07-19 2019-03-08 국민대학교 산학협력단 파킨슨병 바이오마커로서의 miR494 및 이를 이용한 진단키트
KR101956323B1 (ko) 2017-07-19 2019-03-08 국민대학교 산학협력단 파킨슨병 바이오마커로서의 miR6768 및 이를 이용한 진단키트
KR20190009677A (ko) * 2017-07-19 2019-01-29 국민대학교산학협력단 파킨슨병 바이오마커로서의 miR4324 및 이를 이용한 진단키트
KR101956329B1 (ko) 2017-07-19 2019-03-08 국민대학교 산학협력단 파킨슨병 바이오마커로서의 miR4726 및 이를 이용한 진단키트
EP3669880A4 (en) * 2017-08-18 2021-05-05 Curamys Co., Ltd. USE OF miR-18b IN THE PREVENTION, TREATMENT, OR DIAGNOSIS OF MUSCLE AND NEUROMUSCULAR DISEASE
US11739330B2 (en) 2017-09-22 2023-08-29 University Of Massachusetts SOD1 dual expression vectors and uses thereof
US12312587B2 (en) 2017-09-22 2025-05-27 University Of Massachusetts SOD1 dual expression vectors and uses thereof
WO2019116412A1 (en) * 2017-12-15 2019-06-20 Istituto Superiore Di Sanita' Method for in vitro diagnosis of amyotrophic lateral sclerosis
US20220160749A1 (en) * 2018-04-20 2022-05-26 Fondazione Telethon Mir-181 inhibitors and uses thereof
WO2019202162A1 (en) * 2018-04-20 2019-10-24 Fondazione Telethon Mir-181 inhibitors and uses thereof
AU2019254701B2 (en) * 2018-04-20 2025-08-14 Association Française contre les Myopathies (AFM) MIR-181 inhibitors and uses thereof
US12163129B2 (en) 2018-06-08 2024-12-10 University Of Massachusetts Antisense oligonucleotides to restore dysferlin protein expression in dysferlinopathy patient cells
WO2021001665A1 (en) * 2019-07-04 2021-01-07 Oxford University Innovation Limited Methods for diagnosing multiple sclerosis
EP3887546A4 (en) * 2019-09-16 2022-08-31 Genieus Genomics Pty Ltd BIOMARKERS FOR NEURODEGENERATIVE DISEASES
KR102779900B1 (ko) 2022-01-21 2025-03-12 재단법인 바이오나노헬스가드연구단 알츠하이머 조기진단용 바이오마커와 이의 용도
WO2023140652A1 (ko) * 2022-01-21 2023-07-27 (재)바이오나노헬스가드연구단 알츠하이머 조기진단용 바이오마커와 이의 용도
WO2023140653A1 (ko) * 2022-01-21 2023-07-27 (재)바이오나노헬스가드연구단 알츠하이머병 진단용 바이오마커 및 이의 용도
KR20230113048A (ko) * 2022-01-21 2023-07-28 재단법인 바이오나노헬스가드연구단 알츠하이머 조기진단용 바이오마커와 이의 용도
US12529051B2 (en) 2023-11-09 2026-01-20 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)

Also Published As

Publication number Publication date
NZ623459A (en) 2016-05-27
JP2014534810A (ja) 2014-12-25
MX2014004516A (es) 2015-01-16
CA2851280C (en) 2021-05-18
EP3170899B1 (en) 2020-06-24
EP2766482A4 (en) 2015-03-11
KR20140074997A (ko) 2014-06-18
US10184151B2 (en) 2019-01-22
CN104011210B (zh) 2018-05-01
JP6234370B2 (ja) 2017-11-22
AU2012322788B2 (en) 2018-01-04
EP2766482B1 (en) 2016-12-07
US20190276892A1 (en) 2019-09-12
EP3170899A1 (en) 2017-05-24
US20180023142A1 (en) 2018-01-25
US20140235697A1 (en) 2014-08-21
AU2012322788A1 (en) 2014-04-24
CN104011210A (zh) 2014-08-27
HK1201294A1 (en) 2015-08-28
EP2766482A1 (en) 2014-08-20
CA2851280A1 (en) 2013-04-18
BR112014008925A2 (pt) 2020-10-27

Similar Documents

Publication Publication Date Title
US10184151B2 (en) Micrornas in neurodegenerative disorders
RU2609631C2 (ru) Лечение заболеваний, связанных с фактором роста гепатоцитов (фрг), посредством ингибирования природного антисмыслового транскрипта к фрг
US20100197772A1 (en) Tissue-Specific MicroRNAs and Compositions and Uses Thereof
US20180155414A1 (en) Targeting Apolipoprotein E (APOE) in Neurologic Disease
EP3210611B1 (en) Methods of treating vascular inflammatory disorders
MX2011003527A (es) Tratamiento de enfermedades relacionadas con la apolipoproteina-a1 por inhibicion de transcrito antisentido natural para apolipoproteina-a1.
EP2683411B1 (en) Methods of using microrna-26a to promote angiogenesis
EP2298359A1 (en) Nucleic acid capable of controlling degranulation of mast cell
CN102712927A (zh) 通过抑制膜结合转录因子肽酶,位点1(mbtps1)的天然反义转录物来治疗mbtps1相关疾病
WO2008116267A1 (en) Therapeutic targets and molecules
CN102906264A (zh) 通过抑制干扰素调节因子8(irf8)的天然反义转录物而治疗irf8相关疾病
WO2022086935A1 (en) Targeting xist and rna methylation for x reactivation therapy
EP2663323B1 (en) Methods targeting mir-128 for regulating cholesterol/lipid metabolism
WO2013013165A2 (en) Use of lna compounds for therapeutic inhibition of mir-21 in systemic lupus erythematosus
WO2019112975A1 (en) Methods for reactivating genes on the inactive x chromosome
WO2022026648A1 (en) Inhibition of incexact1 to treat heart disease
WO2015051239A1 (en) Methods for increasing neuronal survival
HK1201294B (en) Micrornas in neurodegenerative disorders
NZ623459B2 (en) Micrornas in neurodegenerative disorders
WO2022032017A2 (en) Human xist antisense oligonucleotides for x reactivation therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12839637

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2851280

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014535856

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14350977

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/004516

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2012322788

Country of ref document: AU

Date of ref document: 20121011

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2012839637

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2012839637

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147012433

Country of ref document: KR

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014008925

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112014008925

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20140411