WO2013032210A2 - 생체막 투과성 조성물 - Google Patents

생체막 투과성 조성물 Download PDF

Info

Publication number
WO2013032210A2
WO2013032210A2 PCT/KR2012/006868 KR2012006868W WO2013032210A2 WO 2013032210 A2 WO2013032210 A2 WO 2013032210A2 KR 2012006868 W KR2012006868 W KR 2012006868W WO 2013032210 A2 WO2013032210 A2 WO 2013032210A2
Authority
WO
WIPO (PCT)
Prior art keywords
molecular weight
low molecular
growth factor
composition
amino acid
Prior art date
Application number
PCT/KR2012/006868
Other languages
English (en)
French (fr)
Other versions
WO2013032210A3 (ko
Inventor
장지혜
김재관
박진우
배준호
Original Assignee
(주)아모레퍼시픽
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020120093838A external-priority patent/KR101417328B1/ko
Application filed by (주)아모레퍼시픽 filed Critical (주)아모레퍼시픽
Publication of WO2013032210A2 publication Critical patent/WO2013032210A2/ko
Publication of WO2013032210A3 publication Critical patent/WO2013032210A3/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

Definitions

  • the present invention relates to a biomembrane permeable composition comprising low molecular weight protamine.
  • Skin tissue consists of the epidermis, the dermis and the hypodermis. As the skin ages, its function decreases rapidly and aging occurs. Representative changes in skin due to aging include wrinkle formation due to reduction and deformation of collagen fibers in the dermis and reduction in skin elasticity due to degeneration of elastic fibers composed of elastin. In order to prevent and improve such wrinkle formation and reduced skin elasticity, studies are being conducted to promote the synthesis of collagen and elastin and prevent collapse of the skin.
  • a major cause of skin aging is the reduction of growth factors that are active in young skin.
  • growth factors act as a switch in the regeneration process in the skin, the reduction of growth factors in the skin leads to deterioration of the skin ' function, leading to loss of various components in the skin and disruption of the skin structure.
  • a composition containing a biologically active substance such as collagen, elastin, or their growth factors to the skin .
  • Its molecular weight is well over 400 500 Daltons, which can be reached, and its hydrophilicity makes it difficult to maintain due to its high absorption rate through skin application and its difficulty of selectively stimulating growth hormone secretion. Did. Therefore, there is a need for a method of effectively transferring macromolecules with biological activity into cells within and outside the body without damaging the cells.
  • peptides with cell permeability were devised.
  • Many cell permeable peptides have been devised from membrane-interacting protein sequences such as recombinant proteins, signal peptides, transmembrane domains or antimicrobial peptides, among which protein transduction domains, Peptides having a sequence called PTDs) are known to effectively penetrate biological membranes and effectively deliver tempered or proteins into cells.
  • Intracellular delivery by the protein delivery domain is efficient and cellular It can be done without disturbing or damaging the membrane.
  • cell membrane permeation by the protein delivery domain can be performed as a universal carrier for intracellular delivery of biologically active substances since it is carried out unaffected by receptors and transporters.
  • protein delivery domains are toxic and immunogenic because most of them originate from highly infectious viral proteins, and secondly, the cost and time required to synthesize protein delivery domains is significant. There are big disadvantages. Thus, there has been a challenge to effectively obtain protein transfer domains from harmless non-virulent sources to improve production efficiency and safety.
  • Protein delivery domains from non-viral sources have been studied, such as TD-1 from phage display and magainin from the skin of African Balop frogs. Can be mentioned. They are free from toxicity and immunogenicity because they are obtained from non-viral sources and have the advantage of being able to deliver biologically active substances into cells with physical incompatibility, but also have a significantly lower delivery efficiency compared to viral protein delivery domains. have.
  • low molecular weight protamine which is obtained from a non-viral source, does not have a lower biological transfer efficiency than the viral protein delivery domain.
  • a harmless delivery domain derived from has been developed. This is advantageous in that it is easy to produce compared to the existing protein delivery domain, has a definite immune profile, and is excellent in safety since it can be obtained from protamine, which is certified by the FDA and used as a neutralizer of heparin.
  • the low molecular weight protamine may also have low production efficiency in the process of obtaining low molecular weight protamine from protamine and chemically linking the biologically active material to be delivered into the cell, and in the process, the activity of the biologically active material may be reduced.
  • One aspect of the present invention is to provide a composition having a maximal efficacy due to excellent biomembrane permeability, including the material to be transported and low molecular weight protamine bound to one or both ends thereof.
  • One aspect of the invention is a material to be transported and one of It is intended to provide a polynucleotide encoding low molecular weight protamine bound to one or both ends.
  • Another aspect of the present invention is to provide a method for producing a composition comprising the material to be transported in a high yield while maintaining the original activity of the material to be transported.
  • One aspect of the present invention is a material to be transported; And low molecular weight protamine which binds to one or both ends of the substance to be transported and comprises an amino acid sequence of at least 70% homology with one of the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2 It provides a biological membrane permeable composition comprising a).
  • Another aspect of the present invention is a material to be transported; And a polynucleotide that binds to one or both ends of the substance to be transported and encodes a fusion of low molecular weight protamine comprising an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • Another aspect of the present invention binds to one or both ends of the substance to be conveyed and the substance to be conveyed, and has at least 703 ⁇ 4 homology with one or more of the amino acid sequences set forth in SEQ ID NOs: 1 and 2
  • Preparing an expression vector of low molecular weight protamine fusion comprising an amino acid sequence Producing a transgenic bacterium using the expression vector prepared in the step; And it provides a method for producing a biopermeable composition comprising the step of expressing the fusion of the material to be transported with low molecular weight protamine using the transformed bacteria produced in the step.
  • the material to be transported according to one aspect of the present invention is excellent in biomembrane permeability and is combined with low molecular weight protamine, which functions as a delivery domain, and maintains its original activity even with a large molecular weight. It can easily and safely penetrate the outer membrane and the inner membrane of, more specifically, the outer membrane and inner membrane of skin cells. Furthermore, since absorption in vivo is improved, the function in the body can be maximized.
  • the polynucleotide according to one aspect of the present invention encodes the material to be transported and the low molecular weight protamine bound to one or both ends thereof, and is easily and efficiently linked to the material to be transported to one or both ends thereof. Allow mass production of molecular weight protamine.
  • the manufacturing method according to one aspect of the present invention can prepare a composition comprising a highly active carrier material and low molecular weight protamine bound to one or both ends thereof in a simple and high yield, and low molecular weight protamine. On the target of the target material Can be effectively coupled to the tooth.
  • 1 is a graph comparing the cell proliferation activity of the transport target material and low molecular weight protamine fusion in fibroblasts with other test substances.
  • FIG. 2 is a graph comparing the percutaneous permeability of the substance to be transported and the low molecular weight protamine fusion in artificial skin tissue with other test substances.
  • FIG. 3 is a graph comparing the transdermal permeability of the substance to be transported with the low molecular weight protamine fusion in hairless mouse skin tissue with other test substances.
  • FIG. 4 is a graph comparing wound healing promoting efficacy of the transport target material and the low molecular weight protamine fusion in the skin epidermal wound model of a hairless mouse with other test substances.
  • FIG. 5 is a photograph comparing the wound healing promoting effect of the transport target material and the low molecular weight protamine fusion in the skin entirety wound model of the hairless mouse with other test materials.
  • the present inventors have completed the present invention as a result of repeated studies to provide excellent biomembrane permeability and transdermal permeability easily even if the material to be transported has a high molecular weight and to be easily delivered into cells.
  • One aspect of the present invention is a material to be transported; And low molecular weight protamine which binds to one or both ends of the subject ' material and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2. It provides a biological membrane permeable composition comprising a).
  • the substance to be transported is biopermeable by binding a low molecular weight protamine comprising an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 to one or both ends of the carrier target material.
  • a low molecular weight protamine comprising an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 to one or both ends of the carrier target material.
  • low molecular weight protamine comprising an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2
  • the terminus may be linked by molecular biological methods such as genetic recombination. Specifically, a gene sequence encoding a low molecular weight 'protamine is bound to one or both ends of the gene sequence coding for a substance to be transported, and then the gene sequence bond is expressed to express a substance and a low molecular weight protamine at the terminal thereof. It is possible to obtain a fusion of the bound transportable substance with low molecular weight protamine.
  • the low molecular weight protamine serves to effectively transport the substance to be transported in vivo, and having the properties of the substance to be conveyed, the fusion of the substance to be transported with the low molecular weight protamine is a "recombinant transport target Material ".
  • the fusion of the substance to be transported with the low molecular weight protamine can exhibit the original effect of the substance to be conveyed and at the same time exert its effect.
  • transfer target (cargo) material includes any material capable of passing through the membranes in combination with a low molecular weight protamine, such as high way desired material to membranes or cell membrane-to the Efficiency, In particular, it includes active substances of pharmaceuticals, cosmetics or health foods, more specifically, substances that are not easily transported into biological membranes or cell membranes through general routes, and more specifically biologically active substances such as proteins, DNA or RNA, It is not limited.
  • biologically active substance refers to a substance involved in promoting or modifying a biological reaction in the body, and includes a substance capable of combining low molecular weight protamine with genetic recombination.
  • the "biological reaction” includes various physiological reactions occurring in the body
  • the biologically active substance may be a substance having a high molecular weight, specifically 1,000 to 1,000,000, more specifically It may have a molecular weight of 3,000 to 500, 000, more specifically 5,000 to 250,000.
  • the substance to be delivered includes one or more selected from the group consisting of proteins, polypeptides, peptides, nucleic acids, mRNAs and antisense RA.
  • the protein is in a group consisting of DKK-2 (dikkopf—related protein 2), adipokine, thrombospondin and superoxide dismutas.e. Include at least one selected, That's not one.
  • the substance to be delivered includes one or more selected from the group consisting of growth factors, enzymes, hormones, transcription factors, toxins, antigens and antibodies.
  • growth factor refers to polypeptides that promote cell division, growth and differentiation, and include all kinds of growth factors having various functions.
  • the growth factor is epidermal growth factor (EGF), platelet-derived growth factor (PIGF), vascular endothelial growth factor (Vascular Endothelial Growth Factor) , VEGF), Fibroblast Growth Factor (FGF), Insulin-like Growth Factor (IGF), Nerve Growth Factor (NGF), and TGF— ⁇ or TGF- One or more selected from the group consisting of transforming growth factor (TGF) containing ⁇ , but is not limited thereto.
  • enzyme means a proteinaceous material which does not change itself in various chemical reactions but speeds up reaction.
  • Hamones are chemical substances that are transported by the body fluid to the target organs in the body and have a specific effect on the activity or physiological processes of the organ, and are generally produced in the body. It refers to a transcriptional regulatory protein that specifically binds to the transcriptional regulatory region of and activates or inhibits transcription of the gene.
  • Toxin refers to a substance that shows toxicity in the body and has antigenicity, and is generally a polymeric substance such as a protein.
  • Antigen refers to a compound that reacts with an antibody produced by inducing an immune response against a living body
  • Antibody refers to a compound that specifically binds to an antigen to produce an antigen-antibody response.
  • protamine is a generic term for basic proteins present in the sperm nucleus of vertebrates, and “Low Molecule Weight Protamine (LMWP)” is obtained by digesting protamine with an enzyme. It means a protein having a short amino acid sequence.
  • low molecular weight protamine includes protamine having a molecular weight of 10,000 or less, specifically 7,000 or less or 100 to 10,000, 300 to 7,000. ⁇
  • the low molecular weight protamine is SEQ ID NO: 1 and 2 in Table 1 below
  • the low molecular weight protamine may comprise one or more amino acid sequences of amino acid sequences of SEQ ID NOs: 1 and 2 of Table 1 below.
  • homo logy means the degree of similarity or the degree of similarity between sequences to be compared, and may mean similarity of physical or chemical properties or biological activity.
  • biomembrane is a broad concept including a skin covering a cell or organelle, a membrane covering a body organ, and a skin covering a living body.
  • the material to be transported and a low molecular weight protamine which binds to one or both ends of the substance to be delivered and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2
  • One aspect of the present invention is a material to be transported; And a low molecular weight protamine which binds to one or both ends of the substance to be transported and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 In particular, it provides a topical skin composition.
  • Another aspect of the invention is a material to be transported; And a low molecular weight protamine which binds to one or both ends of the substance to be transported and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 to provide.
  • the external or injectable composition according to one aspect of the present invention includes a cosmetic composition or a pharmaceutical composition.
  • the effect of the cosmetic composition or the pharmaceutical composition according to one aspect of the present invention depends on the kind of material to be transported contained in the composition.
  • the cosmetic composition or pharmaceutical composition may have a skin regeneration effect, skin wrinkle improvement, or skin aging inhibitory effect.
  • Cosmetic compositions according to one aspect of the invention may comprise a cosmetic or dermatologically acceptable medium or base.
  • Cosmetic or dermatologically acceptable medium or base are all formulations suitable for topical application, for example, emulsions obtained by dispersing the oil phase in solutions, gels, powders, pastes, anhydrous products, water phases, emulsions obtained by dispersing the oil phase in water phases, multiemulsions, suspensions.
  • These compositions can be prepared according to conventional methods in the art.
  • Cosmetic compositions may be prepared from fatty substances, organic solvents, solubilizers, thickeners, gelling agents, softeners 1, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic Emulsifiers, fillers, metal ion sequestrants, chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or auxiliaries commonly used in cosmetics or dermatology It may further include. Such adjuvants are introduced in amounts generally used in the cosmetic or dermatological fields.
  • the cosmetic composition is not particularly limited in formulation, and may be appropriately selected in accordance with the desired formulation.
  • it may be prepared in one or more formulations selected from the group consisting of lotion, lotion, essence, cream, ointment, gel, pack and spray, but is not limited thereto.
  • the pharmaceutical composition according to one aspect of the present invention may further include preservatives, stabilizers, hydrating or emulsifying accelerators, pharmaceutical adjuvants such as salts and / or buffers for controlling osmotic pressure, and other therapeutically useful substances. It can be formulated into various dosage forms such as solutions, suspensions, creams, ointments, gels, eye drops, suppositories, etc. according to conventional methods.
  • the pharmaceutical composition may be administered transdermally, intravenously, intramuscularly, intraperitoneally, subcutaneously.
  • the dosage of the active ingredient is within the level of those skilled in the art, and the daily dose of the drug according to the present invention depends on various factors such as disease progression, time of onset, age, health condition, complications, etc. Varies, but on an adult basis
  • the composition according to the present invention may be administered by dividing the composition 1 to 500 mg / kg, preferably 30 to 200 mg / kg once or twice a day, and the dosage may be any amount of the present invention. It is not intended to limit the scope of.
  • One aspect of the invention provides a carrier for the delivery of one or more active ingredients into a cell comprising a low amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • One aspect of the present invention provides a material to be transported; And encoding a fusion of low molecular weight protamine that binds to one or both ends of the substance to be transported and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • the polynucleotide may be used to mass produce a substance to be delivered and low molecular weight protamine bound to one or both ends thereof.
  • the polynucleotide may be used to mass produce a substance to be delivered and low molecular weight protamine bound to one or both ends thereof.
  • One aspect of the invention is a material to be transported; And applying to the target a low molecular weight protamine that binds to one or both ends of the substance to be transported and comprises an amino acid sequence having at least 70% homology with at least one of the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • a method of delivering a substance of interest to a cell of a subject comprising.
  • one aspect of the present invention carrying the substance; and SEQ ID NO: 1 and SEQ ID NO: 2 amino acid sequences, expression vectors of a low molecular weight protamine fusion comprising an amino acid sequence having one or more and less than 70% homology of the base to Preparing a; Producing a transgenic bacterium using the expression vector prepared in the step; And expressing the fusion of the substance to be transported with the low molecular weight protamine by using the transformed bacterium produced in the step, and the substance to be transported and low molecular weight protamine bound to one or both ends thereof.
  • the composition preparation method can produce a biopermeable composition comprising a fusion of a high molecular weight protamine and a high activity target material simply and efficiently, and can effectively bind the low molecular weight protamine to the target position of the material to be transported. .
  • a method for producing a composition according to another aspect of the present invention is a carrier to be expressed after the step of expressing and preparing the fusion of the substance to be transported with low molecular weight protamine. Purifying the fusion of the substance with the low molecular weight protamine may be further included. At this time, a base sequence encoding the fusion of the substance to be transported with the low molecular weight protamine, a cloning vector for inserting such a base sequence, an expression vector prepared using a cloning technique is transformed into the vector and the target substance to be transported.
  • a host cell for expressing the fusion of a low molecular weight protamine a method for transforming a vector into a host, a method for expressing a fusion of a desired transport target material with a low molecular weight protamine from the transformed host cell, and the expressed transport target material
  • a method for transforming a vector into a host a method for expressing a fusion of a desired transport target material with a low molecular weight protamine from the transformed host cell
  • the expressed transport target material Those skilled in the art will be readily aware of the selection and overall technical details of how to obtain the desired material to be fused with the low molecular weight protamine from the fusion of the low molecular weight protamine.
  • the structure and effect of the present invention will be described in more detail with reference to Examples, Comparative Examples and Experimental Examples. However, the following Examples, Comparative Examples and Experimental Examples are provided only for the purpose of illustration in order to help the understanding of the present invention is not limited by the scope and scope of the present invention.
  • Consecutive low-molecular weight protamine (SEQ ID NO: 2: Val Ser Arg Arg Arg Arg Arg Arg Gly Arg Arg Arg Arg Arg Arg
  • rEGF human epidermal growth factor
  • PCR and T0P0 cloning were performed.
  • a vector for expressing human epidermal growth factor is plasmid purified and used as a template, and a forward primer, 5 '-GGTCGTAGACGTAGAAATAGTGACTCTGAATGT-3', is used as a primary primer.
  • PCR of the 5'-TTATCAGCGCAGTTCCCACCACTT-3 'as a backward primer to the primary-partial human epithelial cell growth factor to which 5 of the amino acids of low molecular weight protamine were added—of low molecular weight protamine cDNA was obtained. This was cloned into the T0P0 vector, which was then plasmid purified and used as a template for the addition of the residual amino acid of continuous low molecular weight protamine.
  • PCR was performed. Thus PCR product to which the restriction enzyme recognition sequences were added was subcloned into the T0PO vector.
  • the T0P0 vector was plasmid purified, double digested with Nde I and Xho I, processed into clones of insert DNA fragments that can be cloned into expression vectors digested with the same restriction enzymes. Expression colonies of candidate colonies grown in a medium containing Kanamycin. After plasmid purification was performed on the cells, DNA sequencing confirmed that 14 amino acid sequences of low molecular weight protamine were correctly inserted at the end of human epidermal growth factor.
  • the expression vector ⁇ -411 3 (+)- ⁇ 1 3 61 prepared above was transformed into an E. coli strain (BL21-DE3).
  • Expression strains were constructed by transformation with.
  • the glycerol for expression thus secured was expressed and purified using glycerol stock as follows.
  • Expression glycerol was inoculated into the L-broth (LB) culture medium and incubated at 37 ° C. and 150 rpm until the optical density (0.D) reached about 1.0.
  • the optical density of the previous culture reached 1.0
  • the present culture was inoculated with glycerol for expression in a L—broth (LB) culture solution, and then cultured until the optical density reached 0.6 to 0.8 at 100 rpm. .
  • isopropyl- ⁇ -D-thiogalactopyranoside (isopropyl— ⁇ -D-thiogalactopyranoside (IPTG) was induced with 0.5 mM and incubated at 25 ° C. and 100 rpm for one day. The next day, the cells were cultured by centrifugation (6,000 rpm, 4 ° C, 10 minutes), and 20 ml of Lysis buffer (sodium phosphate buffer, pH 7.5, lOmM NaCl) per 1 g of the obtained cell pellet. Suspension was added. Once completely suspended, the cells were disrupted by sonication (sonication 10 seconds / holding 10 seconds, Amplitude 50%).
  • sonication sodium phosphate buffer, pH 7.5, lOmM NaCl
  • the crushed cells were centrifuged (12,000 rpm, 4 ° C., 10 minutes) to remove the non-crushed cells and the insoluble fraction, and only the supernatant was carefully taken out and filtered with a 0.45 syringe.
  • Filtered Human Epithelial Cell Growth Factor-Low Molecular Weight The centrifuged supernatant containing the amount of protamine was placed in a Q-cellulose (Q-cellulose) layered column, rotated for 30 minutes, the unbound sample was removed, and the washing buffer Krushing buffer 1). (sodium phosphate buffer, pH 7.5, 50 mM NaCl) was washed twice with 10 minutes column.
  • washing buffer 2 sodium phosphate buffer, pH 7.5, 200 mM NaCl
  • El Lit ion buffer sodium phosphate buffer, pH 7.5, 500 mM NaCl
  • Growth factor-low molecular weight protamine was eluted from the column and concentrated 20 times by volume with ultra filtration (Amicon, cutting membrane 3000Da). The concentrated solution was recovered by gel filtration (Sephadex G-100, Buffer GF (20 mM sodium phosphate buffer, pH 7.5, NaCl 500 mM)) to recover only human epidermal growth factor-low molecular weight protamine fraction.
  • the fractions were diluted with NaCl-containing buffer GF to adjust NaCl concentration to around 150 mM, which was effective for stability, and SDS-PAGE analysis to obtain a purity of around 95%.
  • Purified human epidermal growth factor—low molecular weight protamine was lyophilized to obtain final human epidermal growth factor-low molecular weight protamine with low molecular weight protamine bound to the end of human epidermal growth factor.
  • the reaction was carried out for mixing in a ratio of 4 moles of 2 to 3 hours at room temperature, for the EDC and NHS was dissolved in MES buffer to the human epidermal growth factor .
  • the human epithelial cell growth factor-low molecular weight protamine conjugate made through the reaction was purified by centrifugation at 4 ° C. with a cut off molecular weight of 3,000 Dalton centri prep to remove unreacted material.
  • the recombinant human epidermal growth factor of the Example ⁇ low molecular weight protamine activity was no difference within an error range of about 85% on average, but the human epidermal growth factor of the Comparative Example- Low molecular weight protamine conjugate activity was very low, 3 compared to normal human epidermal growth factor.
  • the low molecular weight protamine is bound to the end of human epidermal growth factor by genetic recombination, it can be seen that human epidermal growth factor-low molecular weight protamine maintaining high activity can be prepared.
  • mice fibroblasts were planted at a concentration of 5 ⁇ 10 3 in Dulbecco's modified essential medium (DMEM) at a volume of 100 / ⁇ per well, incubated at 37 ° C for 24 hours, and then the serum concentration in the culture was reduced to 0.05%. Incubation was further time.
  • DMEM Dulbecco's modified essential medium
  • the cells were treated with human epidermal growth factor (rEGF) and human epidermal growth factor-low molecular weight protamine (rLMWP-EGF) at concentrations of 0 (untreated), 0.1, 1.0 M and cultured for another 24 hours. Stimulated. ⁇ 7i> The activity of cell proliferation was measured by the WST-1 method. The cells were treated with the WST-1 solution diluted at 5 mg / mL, incubated for 2 hours, and absorbance was measured at 450 nm. Activity was measured and the results are shown in FIG. 1.
  • rEGF human epidermal growth factor
  • rLMWP-EGF human epidermal growth factor-low molecular weight protamine
  • the recombinant human epidermal growth factor ⁇ low-molecular weight protamine treated group of the example showed cell proliferation activity of 128% and 143% compared to the untreated group at 0.1 and 1.0 M concentration, respectively, compared to the untreated group
  • the binding of low molecular weight protamine to human epidermal growth factor through genetic recombination does not reduce the activity of human epidermal growth factor.
  • Percutaneous intracellular permeability of human epidermal growth factor using artificial skin tissue was evaluated. Specifically, in a 6-well plate, DMEM 900 ⁇ of pH 7.0 to 7.4, and then insert (insert) artificial skin tissue (keraskin) for 20 hours at 37 ° C, 5% C0 2 conditions pre-culture ( pre—incubation).
  • the inserts were transferred to new DMEM without phenolic red and FBS, followed by human epidermal growth factor (rEGF), recombinant human epidermal growth factor-low molecular weight protamine (rLMWP-EGF) of the example, human epidermal growth factor- TAT (TAT ⁇ EGF), human epidermal growth factor-oligo arginine (OHgoarginine, R7) (R7-EGF), and a mixture of human epithelial growth factor and low molecular weight protamine (LMWP) (LMWP + EGF) Administration was made to a concentration of 2 ⁇ . 37.
  • human epidermal growth factor rEGF
  • rLMWP-EGF recombinant human epidermal growth factor-low molecular weight protamine
  • TAT human epidermal growth factor- TAT
  • R7-EGF human epidermal growth factor-oligo arginine
  • LMWP + EGF a mixture of human epithelial growth factor and
  • the material to be transported such as human epidermal cell growth factor
  • the low molecular weight protamine according to the present invention when the low molecular weight protamine according to the present invention is bound to the terminal, it has very excellent percutaneous permeability, furthermore, biomembrane permeability and skin cell permeability.
  • Percutaneous permeability of human epidermal growth factor using hairless mouse skin tissue was evaluated. Specifically, in the hairless mouse (male, 7 weeks old), the dermal tissue spread over the abdomen is attached to a Franz diffusion cell, a human epidermal growth factor, and a recombinant human epithelial cell growth factor of the example- 0.1 mL of low-molecular weight protamine was treated at 60 ppm based on human epidermal growth factor, followed by fluorescence spectrometry and ELISA after 1 hour, 3 hours, 6 hours, 9 hours, 12 hours, and 24 hours, respectively. Through analysis, hairless mouse skin tissue permeation amount of each test substance was quantified. The results are shown in FIG. 3, and the ratio of hairless mouse skin tissue permeation rate of each test substance based on hairless mouse skin tissue permeation amount of general human epidermal cell growth factor is shown in Table 3.
  • the skin tissue permeability, ie, transdermal permeability, of the recombinant human epidermal growth factor-low molecular weight protamine of the example was 10 times higher than that of the general human epidermal growth factor. That is, it can be seen that the material to be transported, such as human epidermal growth factor, exhibits excellent transdermal permeability, further biomembrane permeability and skin cell permeability when the low molecular weight protamine according to the present invention is bound to the terminal.
  • the wound healing effect of the used human epidermal cell growth factor was evaluated. Specifically, biopsies on the back of each of the hairless mice (male 7 weeks old). Using a bias, a full 8 mm diameter round skin wound is made and the wound area is made with a povidone-iodine solution. Sterilized. Human epithelial cell growth factor (rEGF), the recombinant human epithelial cell growth factor of the example—low molecular weight protamine (rLMWP-EGF), was grown on each wound twice daily for 10 days after the day. 30 L was applied at a concentration of 10 ⁇ based on the factor. The degree of wound healing was evaluated by measuring the size of the wound by digital camera and photograph analysis after 1, 4, 7 and 10 days of application of each substance, and the results were compared with those of FIG. It is shown in FIG. 5 (photo).
  • rEGF Human epithelial cell growth factor
  • rLMWP-EGF low molecular weight protamine
  • the wound healing effect was the best when the recombinant human epidermal growth factor-low molecular weight protamine of Example was treated.
  • the recombinant human epidermal growth factor-low molecular weight protamine treated group of the embodiment showing wound sizes of 61 ⁇ 5% and 17 ⁇ 3%, respectively, on days 4 and 10 compared to the initial wound size, respectively, on days 4 and 10, respectively.
  • the wound size was significantly reduced than the group. That is, it can be seen that the material to be transported, such as human epidermal cell growth factor, has a high percutaneous permeability when the low molecular weight protamine according to the present invention is bound to the terminal and shows excellent wound healing promoting effect.
  • the lotion is prepared by a conventional method according to the composition described in the table below.
  • Creams are prepared by conventional methods according to the compositions set forth in the table below.
  • Ointments are prepared by conventional methods according to the compositions set forth in the table below.
  • Injections are prepared by conventional methods according to the compositions set forth in the table below.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합된 서열 번호 1 또는 서열 번호 2의 아미노산 서열을 포함하는 저분자량 프로타민을 포함하는 생체막 투과성 조성물을 개시한다.

Description

【명세서】
【발명의 명칭】
생체막 투과성 조성물
【기술분야】
본 발명은 저분자량 프로타민을 포함하는 생체막 투과성 조성물에 관한 것이 다.
【배경기술】
피부 조직은 표피, 진피 및 피하 (hypodermis)로 이루어져 있다. 피부는 나이 가 들어감에 따라 그 기능이 급격하게 저하되며 노화가 일어난다. 노화에 따른 피 부의 대표적인 변화로 진피 내에 있는 콜라겐 섬유의 감소 및 변형으로 인한 주름 생성과 엘라스틴으로 구성된 탄력 섬유의 변성으로 인한 피부 탄력 감소를 들 수 있다. 이러한 주름 생성 및 피부 탄력 감소를 예방 및 개선하기 위해 피부 내 콜라 겐과 앨라스틴의 합성 촉진 및 붕괴 방지를 위한 연구가 진행되고 있다.
최근 이러한 연구의 성과로 제시된 것이 성장 인자 펩티드이다. 피부 노화의 가장 큰 원인으로 젊은 피부에서는 활성화되어 있는 성장 인자 (growth factor)의 감소를 들 수 있다. 성장 인자는 피부 속 재생 과정의 스위치 역할을 하므로 피부 속 성장 인자의 감소는 피부'기능 저하를 유발해 피부 내 여러 성분들의 손실과 피 부 구조 붕괴를 유발한다. 이에 콜라겐， 엘라스틴， 혹은 이들의 성장 인자 등과 같 은 생물학적 활성 물질을 배합한 조성물을 피부에 적용하여 피부 노화를 방지하려 는 시도가 있으나， 이들은 피부 도포를 통해 효율적으로 전.달될 수 있는 분자량 한 계인 400 500 달톤을 훨씬 넘는 분자량을 가지고， 친수성이어서 피부 도포를 통한 흡수율이 높지 않으며, 선택적으로 성장 호르몬 분비를 자극할 수 있는 활성을 유 지하기 어렵다는 점 때문에 그 적용이 용이하지 않았다. 따라서 세포 손상 없이 생 물학적 활성을 지닌 거대 물질을 생체 내부 및 외부에서 세포 내로 효과적으로 전 달하는 방법이 필요하다.
이러한 필요에 대한 연구의 결과로， 세포 투과성을 갖는 펩티드가 고안되었 다. 재조합 단백질， 신호 펩티드, 막 횡단 도메인 또는 항 미생물 펩티드와 같은 막-상호작용 (membrane-interacting) 단백질 서열로부터 많은 세포 투과성 펩티드들 이 고안되었는데, 이러한 세포 투과성 펩티드들 중에서 단백질 전달 도메인 (protein transduction domains, PTDs)이라고 불리는 서열을 가지는 펩티드가 생체 막을 효과적으로 투과하고， 템티드 또는 단백질을 세포 내로 효과적으로 전달한다 고 알려진 바 있다. 단백질 전달 도메인에 의한 세포 내 전달은 효율적이며， 세포 막을 교란시키거나 손상시키지 않고 수행될 수 있다. 게다가 단백질 전달 도메인에 의한 세포막 투과는 수용체 및 전달체에 영향을 받지 않고 수행되기 때문에 생물학 적 활성 물질의 세포 내 전달을 위한 보편적 캐리어로서 기능할 수 있다. 그러나 이러한 장점에도 불구하고 단백질 전달 도메인은 첫째， 대부분 매우 전염성이 높은 바이러스성 단백질로부터 유래하기 때문에 독성과 면역 원성을 지니고, 둘째， 단백 질 전달 도메인을 합성하고자 하는 경우 비용과 시간이 상당히 소요된다는 2가지 큰 단점이 있다. 따라서 생산 효율 및 안전성을 개선시키고자 무해한 비 바이러스 성 (non-virulent) 소스로부터 단백질 전달 도메인을 효과적으로 얻어야 한다는 과 제가 존재하였다.
<5> 이에， 비 바이러스성 (nonᅳ virulent) 소스로부터 얻은 단백질 전달 도메인이 연구되었으며， 그 대표적인 예로 파지 디스플레이 (Phage display)에서 얻은 TD-1과 아프리카 발롭 개구리의 피부에서 얻은 마가이닌 (magainin)을 들 수 있다. 이들은 비 바이러스성 소스로부터 얻었기 때문에 독성과 면역 원성에서부터 자유로우며， 물리적인 흔합만으로도 생물학적 활성 물질을 세포 내로 전달할 수 있다는 장점을 가지나， 바이러스성 단백질 전달 도메인 대비 전달 효율이 심각하게 낮다는 단점 또한 가지고 있다.
<6> 이러한 문제를 해결하고자， 비 바이러스성 소스로부터 얻은 것이면서도， 생 물학적 활성 물질의 전달 효율은 바이러스성 단백질 전달 도메인에 비해 낮지 않 은， 저분자량 프로타민 (Low Mol ecu Ire Weight Protamine, LMWP)으로부터 파생된 무 해한 전달 도메인이 개발되었다. 이는 기존의 단백질 전달 도메인에 비해 생산이 용이하고, 확실한 면역 프로파일이 존재하며， FDA에서 인증 받아 헤파린의 중화제 로 쓰이는 프로타민에서 수득될 수 있으므로 안전성이 뛰어나다는 점에서 유리하 다. 그러나 상기의 저분자량 프로타민 또한 프로타민으로부터 저분자량 프로타민을 얻는 과정 및 세포 내로 전달하고자 하는 생물학적 활성 물질과 화학적으로 연결하 는 과정의 생산 효율이 낮고， 그 과정에서 생물학적 활성 물질의 활성이 감소될 수 있으며， 생물학적 활성 물질의 아미노산 배열 중 저분자량 프로타민의 화학적 결합 위치를 정확히 제어할 수 없다는 단점이 있다.
【발명의 상세한 설명】
【기술적 과제】
<7> 본 발명의 일측면은 운반 대상 물질 및 그의 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 포함하여， 우수한 생체막 투과성으로 인한 극대화된 효능을 가지는 조성물을 제공하고자 한다. 본 발명의 일측면은 운반 대상 물질 및 그의 한 쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 코딩하는 폴리뉴클레오티드를 제 공하고자 한다. 본 발명의 또 다른 일측면은 운반 대상 물질 포함하는 조성물을, 운반 대상 물질 본래의 활성은 유지하면서 높은 수율로 제조할 수 있는 방법을 제 공하고자 한다.
【기술적 해결방법】
<8> 본 발명의 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나、이 상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 (low molecular weight protamine)을 포함하는 생체막 투과성 조성물을 제공한다.
<9> 본 발명의 다른 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하 나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 의 융합을 코딩하는 폴리뉴클레오티드를 제공한다.
<ιο> 본 발명의 또 다른 일측면은 운반 대상 물질 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하 나 이상과 70¾) 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 (low molecular weight protamine) 융합의 발현 백터를 제조하는 단계; 상기 단계 에서 제조한 발현 백터를 이용하여 형질 전환 세균을 생산하는 단계; 및 상기 단계 에서 생산한 형질 전환 세균을 이용하여 운반 대상 물질과 저분자량 프로타민의 융 합을 발현시키는 단계를 포함하는 생체 투과성 조성물 제조 방법을 제공한다.
【유리한 효과】
<ιι> 본 발명의 일측면에 따른 운반 대상 물질은， 생체막 투과성이 우수하여 전달 도메인으로서 기능하는 저분자량 프로타민과 결합되어， 큰 분자량을 가지더라도 본 래의 활성을 유지하면서， 생체막， 구체적으로 세포의 외막과 내막, 더 구체적으로 피부 세포의 외막과 내막을 쉽고 안전하게 투과할 수 있다. 나아가 생체 내 흡수가 향상되므로， 체내에서 기능이 극대화될 수 있다. 본 발명의 일측면에 따른 폴리뉴 클레오티드는 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타 민을 코딩하여， 용이하고 효율적으로 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 대량 생산할 수 있도록 한다.
<12> 본 발명의 일측면에 따른 제조 방법은 간편하면서도 높은 수율로 활성이 높 은 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 포함 하는 조성물을 제조할 수 있으며， 저분자량 프로타민을 운반 대상 물질의 표적 위 치에 효과적으로 결합시킬 수 있다.
【도면의 간단한 설명】
<13> 도 1은 섬유아세포에서의 운반 대상 물질과 저분자량 프로타민 융합의 세포 증식 활성을 다른 시험 물질과 대비한 그래프이다.
<14> 도 2는 인공 피부 조직에서의 운반 대상 물질과 저분자량 프로타민 융합의 경피 투과성을 다른 시험 물질과 대비한 그래프이다.
<15> 도 3은 헤어리스 마우스 피부 조직에서의 운반 대상 물질과 저분자량 프로타 민 융합의 경피 투과성을 다른 시험 물질과 대비한 그래프이다.
<16> 도 4는 헤어리스 마우스의 피부 전층 상처 모델에서의 운반 대상 물질과 저 분자량 프로타민 융합의 상처 치유 촉진 효능을 다른 시험 물질과 대비한 그래프이 다.
<17> 도 5는 헤어리스 마우스의 피부 전층 상처 모델에서의 운반 대상 물질과 저 분자량 프로타민 융합의 상처 치유 촉진 효능을 다른 시험 물질과 대비한 사진이 다.
【발명의 실시를 위한 형태】
<18> 본 발명자들은 운반 대상 물질이 높은 분자량을 가지더라도， 우수한 생체막 투과성 및 경피 투과성을 부여하여 세포 내로 용이하게 전달시키고자 연구를 거듭 한 결과， 본 발명을 완성하였다.
<19> '
<20> 본 발명의 일측면은 운반 대상 물질; 및 운반' 대상 물질의 한쪽 또는 양쪽 말단에 결합하고, 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이 상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 (low molecular weight protamine)을 포함하는 생체막 투과성 조성물을 제공한다. 운반 대상 물질은 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민이 운반 대 상 물질의 한쪽 또는 양쪽 말단에 결합됨으로써， 생체 투과성이 높아져 생체막 또 는 세포막을 용이하게 투과할 수 있다. 이와 같은 우수한 효과는 운반 대상 물질과 저분자량.프로타민 융합에 대한 인공 피부 조직과 동물 피부 조직을 이용한 경피 투과성 평가를 통해 증명되었다. 말단에 저분자량 프로타민이 결합된 운반 대상 물 질은 효과적으로 세포 내로 전달될 수 있으므로, 보다 적은 양을 대상에게 적용하 는 경우에도 우수한 생체 내 효과를 발휘할 수 있어 극대화된 효능 발휘가 가능하 다. 특히 운반 대상 물질이 생체 내에서 약리학적 효과를 발휘하는 물질인 경우 적 은 양의 적용으로도 동일한 약리학적 효과를 발휘할 수 있을 뿐만 아니라 다량 적 용에 의한 대상의 부작용을 감소시킬 수 있으므로 람직하다 .
<21> 본 발명의 일측면에서ᅳ 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프 로타민은 운반 대상 물질의 한쪽 또는 양쪽 말단에 유전자 재조합과 같은 분자 생 물학적 방법으로 결합될 수 있다. 구체적으로, 운반 대상 물질을 코딩하는 유전자 염기 서열 한쪽 또는 양쪽 말단에 저분자량 '프로타민을 코딩하는 유전자 염기 서열 을 결합시킨 후， 이 유전자 염기 서열 결합을 발현시켜 운반 대상 물질과 그 말단 에 저분자량 프로타민이 결합된 운반 대상 물질과 저분자량 프로타민의 융합을 수 득할 수 있다. 본 발명의 일측면에서， 저분자량 프로타민은 운반 대상 물질을 생체 내로 효과적으로 운반하는 역할을 하며， 운반 대상 물질의 성질을 그대로 가지는， 운반 대상 물질과 저분자량 프로타민의 융합은 "재조합 (recombinant) 운반 대상 물 질"로 표현될 수 있다. 운반 대상 물질과 저분자량 프로타민의 융합은 운반 대상 물질의 본래의 효과를 나타냄과 동시에 그 효과를 최대한 발휘할 수 있다.
<22> 본 명세서에서， "운반' 대상 (cargo) 물질"은 저분자량 프로타민과 결합하여 생체막을 투과할 수 있는 물질을 모두 포함하며， 예를 들어 생체막 또는 세포막 투 과 효율을 높이길 원하는 물질， 구체적으로 약품， 화장품 또는 건강 식품의 유효 물질， 더 구체적으로 일반적인 경로를 통해서는 생체막 또는 세포막 내로 이동이 용이하지 않은 물질， 보다 더 구체적으로 단백질， DNA 또는 RNA와 같은 생물학적 활성 물질을 포함하나， 이에 제한되는 것은 아니다.
<23> 본 명세서에서， "생물학적 활성 물질"은 체내에서 생물학적 반응을 촉진하거 나 변형 등을 함으로써 그에 관여하는 물질을 의미하며， 저분자량 프로타민과 유전 자 재조합으로 결합될 수 있는 물질을 포함한다. 상기 "생물학적 반웅' '은 체내에서 일어나는 각종 생리 반응을 포함한다. 본 발명의 일측면에서, 생물학적 활성 물질 은 분자량이 큰 물질일 수 있으며， 구체적으로 1，000 내지 1，000，000， 더 구체적으 로 3,000 내지 500， 000， 보다 더 구체적으로 5,000 내지 250 ,000의 분자량을 가질 수 있다.
<24> 본 발명의 일측면에서, 운반 대상 물질은 단백질， 폴리펩티드, 펩티드， 핵 산， mRNA 및 안티센스 R A로 이루어진 군에서 선택된 하나 이상을 포함한다. 본 발 명의 다른 일측면에서， 단백질은 DKK—2(Dickkopf— related protein 2), 아디포카인 (adipokine), 트롬보스폰딘 (thrombospondin) 및 슈퍼옥사이드 디스뮤타제 (Superoxide dismutas.e)로 이루어진 군에서 선택된 하나 이상을 포함하나， 이에 제 한되는 것은 아니다.
<25> 본 발명의 다른 일측면에서， 운반 대상 물질은 성장 인자, 효소, 호르몬， 전 사 인자, 독소, 항원 및 항체로 이루어진 군에서 선택된 하나 이상을 포함한다.
<26> 본 명세서에서, "성장 인자"는 세포 분열， 생장 및 분화를 촉진하는 폴리 펩 티드를 총칭하며， 다양한 기능을 가진 다양한 종류의 성장 인자를 모두 포함한다. 본 발명의 일측면에서， 성장 인자는 상피 세포 성장 인자 (Epidermal Growth Factor, EGF), 혈소판 -유래 성장 인자 (PI ate let -Derived Growth Factor, PDGF) , 혈 관 내피 세포 성장 인자 (Vascular Endothelial Growth Factor, VEGF) , 섬유 아세포 성장 인자 (Fibroblast Growth Factor, FGF), 인술린 유사 성장 인자 (Insul in-1 ike Growth Factor, IGF), 신경 성장 인자 (Nerve Growth Factor, NGF) 및 TGF— α 또는 TGF-β를 포함하는 형질 전환 성장 인자 (Transforming Growth Factor, TGF)로 이루 어진 군에서 선택된 하나 이상을 포함하나， 이에 제한되는 것은 아니다.
<27> 본 명세서에서， "효소 "는 각종 화학 반웅에서 자신은 변하지 않으나 반웅을 빠르게 하는 단백질성 물질을 의미한다. "호르몬' '은 체액에 의하여 체내의 표적 기 관까지 운반되어 그 기관의 활동이나 생리적 과정에 특정한 영향을 미치는 화학 물 질을 의미하며， 일반적으로 체내에서 생성된다. "전사 인자' '는 특정 유전자의 전사 조절 부위 DNA에 특이적으로 결합하여 그 유전자의 전사를 활성화시키거나 억제하 는 전사 조절 단백질을 의미한다. "독소"는 체내에서 유독성을 나타내며 항원성을 가지는 물질을 의미하며， 일반적으로 단백질 등과 같은 고분자 물질이다. "항원''은 생체에 대한 면역 반응을 유도하여 생산된 항체와 반웅하는 화합물을 의미한다. " 항체"는 항원과 특이적으로 결합하여 항원—항체 반응을 일으키는 화합물을 의미한 다.
<28> 본 명세서에서， "프로타민 (protamine)"은 척추 동물의 정자핵에 존재하는 염 기성 단백질의 총칭이며， "저분자량 프로타민 (Low Molecule Weight Protamine, LMWP)"은 프로타민을 효소로 소화시켜 얻은 짧은 아미노산 서열을 가지는 단백질을 의미한다. 본 발명의 일측면에서， 저분자량 프로타민은 10,000 이하， 구체적으로 7,000 이하 또는 100 내지 10,000， 300 내지 7 ,000의 분자량을 가진 프로타민을 포 함한다. ·
<29> 본 발명의 일측면에서, 저분자량 프로타민은 아래 표 1의 서열 번호 1 및 2
의 아미노산 서열 중 하나 이상과 70% 이상， 구체적으로 80% 이상， 더 구체적으로 90% 이상의 상동성을 가지는 아미노산 서열을 포함할 수 있다. 본 발명의 다른 일 측면에서， 서열 번호 1 및 2의 아미노산 서열 중 하나 이상과 70% 내지 100% 미만 의 상동성을 가지는 아미노산 서열은 서열 번호 1 및 2의 아미노산 서열 중 하나 이상의 서열에 치환， 삽입 또는 결실과 같은 임의의 변형이 이루어진 서열 또는 서 열 번호 1 및 2의 아미노산 서열 중 하나 이상의 아미노산 단편의 서열을 포함한 다. 본 발명의 또 다른 일측면에서， 저분자량 프로타민은 아래 표 1의 서열 번호 1 및 2의 아미노산 서열 중 하나 이상의 아미노산 서열을 포함할 수 있다. 본 명세서 에서, "상동성 (homo logy)"은 비교 대상이 되는 서열들 사이의 유사 정도 또는 동일 정도를 의미하며， 물리적 또는 화학적 특성 또는 생물학적 활성의 유사함을 의미할 수 있다.
【표 1】
Figure imgf000009_0001
<31>
<32> 본 명세서에서, "생체막 "은 세포나 세포 소기관의 겉을 싸고 있는 막， 나아 가 체내 기관의 걸을 싸고 있는 막 및 생체의 겉을 싸고 있는 막인 피부를 포함하 는 광범위한 개념이다.
<33> 본 발명의 일측면에서， 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양 쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민을 포함하는 조성물은 운반 대상 물질의 종류에 따라 피부 탄력성 증가， 피부 주름 개 선， 피부 재생， 피부 미백, 기미 감소， 혈관 신생， 모발 성장 촉진, 탈모 방지， 모 낭 세포 활성화ᅳ 피부 세포 분열 촉진， 엘라스틴 또는 콜라겐 합성 증가， 상처 치 유 촉진， 흉터 완화 및 홍반 억제 중 하나 이상의 작용을 할 수 있다.
<34>
<35> 본 발명의 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이 상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민을 포 함하는 외용제 조성물, 구체적으로 피부 외용제 조성물을 제공한다. 본 발명의 다 른 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하 고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민을 포함하는 주사제 조성물을 제공한다. 본 발명의 일측면에 따른 외용제 또는 주사제 조성물은 화장품 조성물 또는 약학 조성물을 포함한다. 본 발명의 일측면에 따른 화장품 조성물 또 는 약학 조성물의 효과는 조성물이 포함하는 운반 대상 물질의 종류에 따라 다를 수 있으며， 예를 들어 운반 대상 물질이 상피 세포 성장 인자인 경우 상기 화장품 조성물 또는 약학 조성물은 피부 재생 효과， 피부 주름 개선 또는 피부 노화 억제 효과 등을 가질 수 있다.
본 발명의 일측면에 따른 화장품 조성물은 화장품학 또는 피부 과학적으로 허용 가능한 매질 또는 기제를 포함할 수 있다. 이는 국소 적용에 적합한 모든 제 형으로， 예를 들면， 용액， 겔， 파우더， 페이스트， 반죽 무수 생성물， 수상에 유상 을 분산시켜 얻은 에멀견， 유상에 수상을 분산시켜 얻은 에멀젼， 멀티에멀젼, 현탁 액， 마이크로 에멀견， 마이크로캡슬， 미세과립구， 이온형 (리포좀) 및 비이온형의 소낭 분산제， 포말 (foam) 또는 압축된 추진제를 함유한 에어로졸 조성물의 형태로 제공될 수 있다. 이들 조성물은 당해 분야의 통상적인 방법에 따라 제조될 수 있 다.
화장료 조성물은 지방 물질, 유기 용매， 용해제, 농축제， 겔화제， 연화거 1， 항산화제， 현탁화제， 안정화제， 발포게 (foaming agent), 방향제， 계면 활성제, 물， 이온형 또는 비이온형 유화제， 충전제， 금속이온봉쇄제 , 킬레이트화제， 보존제， 비 타민, 차단제， 습윤화제， 필수 오일， 염료， 안료， 친수성 또는 친유성 활성제， 지 질 소낭 또는 화장품학 또는 피부과학 분야에서 통상적으로 사용되는 보조제를 더 포함할 수 있다. 상기 보조제는 화장품학 또는 피부 과학 분야에서 일반적으로 사 용되는 양으로 도입된다.
상기 화장료 조성물은 제형이 특별히 한정되지 않으며， 목적하는 바에 따라 제형을 적절히 선택할 수 있다. 예를 들어， 화장수， 로션， 에센스, 크림， 연고， 젤 , 팩 및 분무제로 이루어진 군으로부터 선택된 하나 이상의 제형으로 제조될 수 있 으나， 이에 제한되는 것은 아니다. 본 발명의 일측면에 따른 약학 조성물은 방부제， 안정화제， 수화제 또는 유 화 촉진제, 삼투압 조절을 위한 염 및 /또는 완충제 등의 약제학적 보조제 및 기타 치료적으로 유용한 물질을 추가로 포함할 수 있으며， 통상적인 방법에 따라 용액， 현탁액， 크림， 연고， 젤, 점안액， 좌제 등과 같은 다양한 투여 형태로 제형화될 수 있다. 상기 약학 조성물은 경피， 정맥 내， 근육 내, 복강 내， 피하 등으로 투여될 수 있다.
상기 유효 성분의 투여량 결정은 당업자의 수준 내에 있으며， 본 발명에 따 른 약물의 1일 투여 용량은 투여하고자 하는 대상의 질환 진행 정도， 발병 시기, 연령， 건강 상태， 합병증 등의 다양한 요인에 따라 달라지지만， 성인을 기준으로 할 때 일반적으로는 본 발명에 따른 조성물 1 내지 500mg/kg, 바람직하게는 30 내 지 200 mg/kg을 1일 1 내지 2회 분할하여 투여할 수 있으며， 상기 투여량은 어떠한 방법으로도 본 발명의 범위를 한정하는 것이 아니다.
ί42>
-43> 본 발명의 일측면은 하나 이상의 유효 성분을 세포 내로 전달하기 위한 전달 체로서 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성올 가지는 아미노산 서열을 포함하는 저분자량 프로타민을 제공한다. ;44> 본 발명의 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이 상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민의 융 합을 코딩하는 폴리뉴클레오티드를 제공한다. 상기 폴리뉴클레오티드를 이용하여 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 대량 생 산할 수 있다. 예컨대， 상기 폴리뉴클레오티드를 포함하는 백터를 숙주 세포에 넣 어 배양함으로써， 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프 로타민을 대량 생산할 수 있다.
:45> 본 발명의 일측면은 운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이 상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민을 대 상에게 적용하는 것을 포함하는 대상의 세포 내로 운반 대상 물질을 전달하는 .방법 을 제공한다.
：46> 본 발명의 일측면은 운반 대상 물질 ;과 서열 번호 1 및 서열 번호 2에 기재 된 아미노산 서열'중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함 하는 저분자량 프로타민 융합의 발현 백터를 제조하는 단계; 상기 단계에서 제조한 발현 백터를 이용하여 형질 전환 세균을 생산하는 단계; 및 상기 단계에서 생산한 형질 전환 세균을 이용하여 운반 대상 물질과 저분자량 프로타민의 융합을 발현시 키는 단계를 포함하는 상기의 운반 대상 물질과 그 한쪽 또는 양쪽 말단에 결합된 저분자량 프로타민을 포함하는 생체 투과성 조성물 제조 방법을 제공한다. 상기 조 성물 제조 방법은 간편하면서도 효율적으로 활성이 높은 운반 대상 물질과 저분자 량 프로타민의 융합을 포함하는 생체 투과성 조성물을 제조할 수 있으며， 저분자량 프로타민을 운반 대상 물질의 표적 위치에 효과적으로 결합시킬 수 있다.
：47> 본 발명의 다른 일측면에 따른 조성물 제조 방법은 상기 운반 대상 물질과 저분자량 프로타민의 융합을 발현시켜 제조하는 단계 이후에 발현시킨 운반 대상 물질과 저분자량 프로타민의 융합을 정제하는 단계를 더 포함할 수 있다 . 이 때， 상기 운반 대상 물질과 저분자량 프로타민의 융합을 코딩하는 염기 서열， 이러한 염기 서열을 삽입하기 위한 클로닝 백터， 클로닝 기술을 이용하여 제조한 발현 백 터 이 백터로 형질 전환시켜 목적하는 운반 대상 물질과 저분자량 프로타민의 융 합을 발현시키기 위한 숙주 세포， 백터를 숙주로 형질 전환시키는 방법， 형질 전환 된 숙주 세포로부터 목적하는 운반 대상 물질과 저분자량 프로타민의 융합을 발현 시키는 방법 및 발현된 운반 대상 물질과 저분자량 프로타민의 융합으로부터 목적 하는 운반 대상 물질과 저분자량 프로타민의 융합을 수득하는 방법 등에 대한 선택 및 전반적인 기술적 사항은 당업자라면 용이하게 인식할 수 있다. 이하, 실시예， 비교예 및 실험예를 들어 본 발명의 구성 및 효과를 보다 구 체적으로 설명한다. 그러나 아래 실시예， 비교예 및 실험예는 본 발명에 대한 이해 를 돕기 위해 예시의 목적으로만 제공된 것일 뿐 본 발명의 범주 및 범위가 그에 의해 제한되는 것은 아니다.
[실시예] 인간 상피 세포 성장 인자와 저분자량 프로타민 융합의 제조 대표적인 생물학적 활성 물질인 인간 상피 세포 성장 인자에 유전자 재조합 을 통해 저분자량 프로타민을 결합시켜 인간 상피 세포 성장 인자와 저분자량 프로 타민의 융합을 제조하였다ᅳ
(1) 발현 백터 제조
인간 상피 세포 성장 인자 (rEGF)에 저분자량 프로타민 (LMWP) (표 1의 서열번 호 2: Val Ser Arg Arg Arg Arg Arg Arg Gly Gly Arg Arg Arg Arg)를 유전자 재조 합을 통해 융합하기 위해 연속적인 PCR과 T0P0 클로닝을 수행하였다. 먼저， 인간 상피 세포 성장 인자 발현용 백터를 플라스미드 정제 (plasmid pur i f icat ion)하고 이를 템플릿 (template)으로 삼아， 1차 프라이머로 포워드 프라이머 (forward primer )인 5 ' -GGTCGTAGACGTAGAAATAGTGACTCTGAATGT-3 '와 백워드 프라이머 (backward primer)인 5 ' -TTATCAGCGCAGTTCCCACCACTT-3 '를 이용하여 PCR함으로써 저분자량 프로 타민의 아미노산들 중 5개의 아미노산이 부가된 1차-부분적 (partial) 인간 상피 세 포 성장 인자—저분자량 프로타민의 cDNA를 확보하였다. 이를 T0P0 백터에 클로닝하 였으며， 이를 다시 플라스미드 정제하고 연속적인 저분자량 프로타민의 잔여 아미 노산 부가에 필요한 템플릿으로 활용하였다. 위와 실질적으로 동일한 방법으로 9개 의 아미노산이 부가된 2차ᅳ부분적 인간 상피 세포 성장 인자-저분자량 프로타민의 cDNA를 확보하였으며, 이를 활용하여 저분자량 프로타민의 14 개 아미노산이 모두 부가된 완성된 인간 상피 세포 성장 인자-저분자량 프로타민의 cDNA를 확보하였 -다. 최종적으로 수득한 인간 상피 세포 성장 인자-저분자량 프로타민의 cDNA를 발현 백 터에 삽입하기 위하여 포워드 프라이머인 5'-CATATGGTGAGCCGTAGACGTAGACG-3'와 백 워드 프라이머인 5'ᅳ CTCGAGTCATTAGCGCAGTTCCCACCACTTCA(^TCTCGCT
Figure imgf000013_0001
이용하여
PCR하였다. 이와 같이 목적 제한 효소 인식 서열들이 부가된 PCR 산물을 T0P0 백터 에 서브 클로닝 (subcloning)하였다. 이 T0P0 백터를 플라스미드 정제하여 Nde I과 Xho I으로 이중 절단 (double digestion)하여 동일한 제한 효소들로 절단한 발현 백 터에 클로닝할 수 있는 삽입 DNA( insert DNA) 단편으로 가공하고 클로닝하였다. 발 현 백터를 카나마이신 (Kanamycin)이 함유된 배지에서 생육한 후보 콜로니 (colony) . 들에 대한 플라스미드 정제를 수행한 후 DNA 시뭔싱을 통해 인간 상피 세포 성장 인자 말단에 저분자량 프로타민의 14개 아미노산 서열이 정확하게 삽입되었는지를 최종 확인하였다.
<56>
<57> (2) 발현 및 제조
<58> 상기에서 제조한 발현 백터^ -4113(+)-丽13 61 를 E. coli 균주 (BL21-DE3)
로 형질 전환시킴으로써 발현 균주를 구축하였다. 이렇게 확보된 발현용 글리세를 스특 (glycerol stock)을 이용하여 아래와 같이 발현 및 정제하였다. 발현용 글리세 를 스특을 L-브로쓰 (LB) 배양액에 접종하여 37°C, 150 rpm 조건에서 광학 밀도 (0.D)가 약 1.0에 도달 할 때까지 배양하였다. 이전 배양의 광학 밀도가 1.0에 도 달하면 본 배양은 발현용 글리세를 스특을 L—브로쓰 (LB) 배양액에 접종하여 371：， 100 rpm 조건에서 광학 밀도가 0.6 내지 0.8 정도가 될 때까지 배양하였다. 발현을 위해 이소프로필 -β-D-티오갈락토피라노사이드 (isopropyl— β-D- thiogalactopyranoside, IPTG) 0.5mM로 유도 (induct ion)한 후 25°C， 100 rpm 조건 에서 하루 동안 배양하였다. 다음날 원심 분리 (6,000 rpm, 4°C， 10분)하여 배양 균 체를 획득하고, 획득한 균체 펠렛 1 g당 라이시스 버퍼 (Lysis buffer) (sodium phosphate buffer, pH 7.5, lOmM NaCl) 20 ml씩 첨가하여 현탁하였다. 완전히 현탁 되면 초음파 처리 (sonication)를 통해 균체를 파쇄하였다 (10분간 sonication 10초 /holding 10초 반복, Amplitude 50%). 파쇄된 균체는 원심 분리 (12,000 rpm, 4°C， 10분)하여 비파쇄 균체 및 블용성 분획을 제거하고 상등액만 조심스럽게 취한 후 0.45 시린지 (syringe)로 여과하였다. 여과한 인간 상피 세포 성장 인자-저분자 량 프로타민을 함유하는 원심 분리 상등액을 Q—셀를로오스 (Q-cellulose)(ion exchange chromatography)가 층진된 컬럼에 넣고 30분간 회전시킨 후 결합되지 않 은 샘플을 제거하고， 세척 버퍼 Kwashing buffer 1) (sodium phosphate buffer, pH 7.5, 50 mM NaCl)로 10분씩 2회 컬럼을 씻어주었다. 다시 세척 버퍼 2(sodium phosphate buffer, pH 7.5, 200 mM NaCl)로 30분간 1회 컬럼을 씻어주고 용출 버퍼 (El Lit ion buffer) (sodium phosphate buffer, pH 7.5， 500 mM NaCl)로 인간 상피 세 포 성장 인자-저분자량 프로타민을 컬럼으로부터 용출시킨 뒤 초미세 여과 (ultra filtration)(Amicon, cutting membrane 3000Da)로 용적 대비 20배 농축하였다. 농 축된 용액을 겔 여과 (gel filtration)(Sephadex G— 100， Buffer GF (20mM sodium phosphate buffer, pH 7.5, NaCl 500 mM))를 이용하여 인간 상피 세포 성장 인자- 저분자량 프로타민 분획만을 회수하였다/이 분획을 NaCl이 포함되지 않은 버퍼 GF 로 희석하여 NaCl 농도를 안정도에 효과적인 150 mM 전후로 조정하였고, SDS-PAGE 분석하여 95% 전후의 정제도를 확보하였다. 정제한 인간 상피 세포 성장 인자—저분 자량 프로타민은 동결 건조하여 인간 상피 세포 성장 인자 말단에 저분자량 프로타 민이 결합된 최종 인간 상피 세포 성장 인자-저분자량 프로타민을 수득하였다.
<59>
<60> [비교예] 인간 상피 세포 성장 인자ᅳ저분자량 프로타민 콘쥬게이트의 제조
<6i> 인간 상피 세포 성장 인자-저분자량 프로타민 콘쥬게이트를 NHS/EDC 커플링 반응으로 합성하였다. 먼저， 1.654x10— 8 몰의 인간 상피 세포 성장 인자를 0.5 niL의 MES 버퍼에 녹여 표준 반웅 용기에 넣었다. 결합시키려는 저분자량 프로타민
4.962xl0—8 몰을 0.1 mL의 MES 버퍼에 녹인 뒤 상기 반웅 용기에 넣고, MES 버퍼에 녹인 EDC와 NHS를 인간 상피 세포 성장 인자에 대해 4몰의 비율로 섞어 상온에서 2 내지 3시간 동안 반응시켰다. 상기 반웅을 통해 만들어진 인간 상피 세포 성장 인 자-저분자량 프로타민 콘쥬게이트를 4°C에서 컷 -오프 (cut off) 분자량 3,000 달톤 cent ri prep 으로 원심 분리하여 미반응물을 제거함으로써 정제하였다.
<62>
<63> [실험예 1] 인간 상피 세포 성장 인자ᅳ저분자량 프로타민의 활성 평가
<64> (1) ELSIA 법을 이용한 활성 평가
<65> 실시예 및 비교예의 인간 상피 세포 성장 인자-저분자량 프로타민의 활성을 평가하기 위하여 ELISA 법을 이용하여 정량하였다. PBS에 희석한 최종 농도 4.0 /g Λιι.β의 캡쳐 항체 (capture antibody)를 웰 당 100 씩 로딩 ( loading)하고 37°C에서 밤새 배양하였다. 다음 날 세척 버퍼로 3번 세척하고 블로킹 버퍼 (Blocking Buffer)를 웰 당 200 ^씩 로딩한 뒤 다시 37°C에서 1시간 동안 배양하였다. 다시 세척 버퍼로 3번 세척하여 플레이트를 항체로 코팅하였다. 코팅한 플레이트에 농도 별로 연속 희석한 일반 인간 상피 세포 성장 인자， 실시예의 재조합 인간 상피 세 포 성장 인자ᅳ저분자량 프로타민， 비교예의 인간 상피 세포 성장 인자-저분자량 프 로타민 콘쥬게이트를 100 ^씩 로딩하고 37°C에서 2시간 동안 배양하였다. 세척 버 퍼로 3번 세척한 뒤 블로킹 버퍼를 이용하여 탐지 항체 (Detect ion antibody)를 50 ng/mL 농도로 희석한 다음 웰 당 100 ^씩 로딩하였다. 37'C에서 2시간 동안 배양 하고 세척 버퍼로 3번 세척한 뒤 HRP-연관된 2차 항체 (HRP- linked secondary antibody)를 블로킹 버퍼를 이용하여 1 ： 200으로 희석하여 웰 당 100 씩 로딩하 고 37°C에서 20분간 차광 배양하였다. 세척 버퍼로 3번 세척하고 기질 (Substrate) 용액을 웰 당 100 ^씩 로딩하여 색을 관찰하였다. 웰 당 50 ^씩 정지액 (STOP Solution)을 첨가하여 반웅을 멈추게 하고 자외선 450 nm에서 흡광도를 측정함으로 써 활성을 측정하였다.
<66> 일반 인간 상피 세포 성장 인자와 비교하였을 때， 실시예의 재조합 인간 상 피 세포 성장 인자ᅳ저분자량 프로타민 활성도는 평균 85% 정도로 오차 범위 내에서 차이가 없었으나， 비교예의 인간 상피 세포 성장 인자-저분자량 프로타민 콘쥬게이 트 활성도는 일반 인간 상피 세포 성장 인자 대비 3 로 매우 낮았다. 이를 토대로 유전자 재조합 방법으로 인간 상피 세포 성장 인자 말단에 저분자량 프로타민을 결 합시키는 경우 높은 활성을 유지하는 인간 상피 세포 성장 인자-저분자량 프로타민 을 제조할 수 있음을 알 수 있다.
<67>
<68> (2) 세포 증식을 이용한 활성 평가
<69> 실시예 및 비교예의 인간 상피 세포 성장 인자-저분자량 프로타민의 활성을 평가하기 위하여 쥐의 섬유아세포 (NIH3T3 cell line)의 증식 활성을 측정하였다. <70> 한 웰 당 100 /ί 부피의 DMEM(Dulbecco's modified essential medium)에 상 기 세포를 5 X 103 농도로 심고 37°C에서 24시간 동안 배양 한 뒤 배양액 내의 세럼 농도를 0.05%로 낮추어 24 시간 더 배양하였다. 24시간 뒤， 세포에 0(무처리군)， 0.1， 1.0 M 농도의 인간 상피 세포 성장 인자 (rEGF)와 인간 상피 세포 성장 인자- 저분자량 프로타민 (rLMWP-EGF)를 처리하여 다시 24시간 동안 배양하여 자극하였다. <7i> WST-1법으로 세포 증식의 활성을 측정하였다. 5 mg/mL 농도로 회석한 WST-1 용액을 세포에 처리하여 2시간 동안 배양하고， 450 nm에서 흡광도를 측정함으로써 활성을 측정하였고， 그 결과를 도 1에 나타내었다.
도 1에서 볼 수 있듯이, 실시예의 재조합 인간 상피 세포 성장 인자ᅳ저분자 량 프로타민 처리군은 0.1 과 1.0 M 농도에서 무처리군 대비 각각 128%와 143%의 세포 증식 활성도를 나타내어， 무처리군 대비 각각 123%와 146%의 세포 증식 활성 도를 나타낸 일반 인간 상피 세포 성장 인자 처리군의 결과와 오차.범위 내에서 차 이가 없었다. 즉, 유전자 재조합을 통한 인간 상피 세포 성장 인자로 저분자량 프 로타민의 결합이 인간 상피 세포 성장 인자의 활성을 저하시키지 않음을 알 수 있 다.
<73>
<74> [실험예 2] 경피 투과성 평가
<75> (1) 인공 피부 조직을 이용한 경피 투과성 평가
<76> 인공 피부 조직을 이용한 인간 상피 세포 성장 인자의 경피 투과 실험을 통 해 피부 세포 내 투과성을 평가하였다. 구체적으로, 6-웰 플레이트에 pH 7.0 내지 7.4의 DMEM 900 ^를 넣은 뒤， 인서트 (insert)ᅳ인공 피부 조직 (keraskin)을 넣고 20시간 동안 37°C, 5% C02 조건에서 전 -배양 (pre— incubation)하였다. 인서트를 페놀 一레드와 FBS가 들어있지 않은 새로운 DMEM에 옮긴 후， 인간 상피 세포 성장 인자 (rEGF), 실시예의 재조합 인간 상피 세포 성장 인자-저분자량 프로타민 (rLMWP- EGF), 인간 상피 세포 성장 인자 -TAT(TATᅳ EGF), 인간 상피 세포 성장 인자-올리고 알기닌 (OHgoarginine, R7)(R7-EGF) 및 인간 상피 세포 성장 인자와 저분자량 프로 타민 (LMWP)의 흔합물 (LMWP+EGF) 각각을 최종 농도 2 μΜ이 되도록 투여하였다. 37 . °C, 5% C02 배양 조건에서 0.5시간, 4시간， 24시간 후 각각의 메디아 (media)를 취하 여 분광 형광계를 이용한 형광 측정법과 ELISA 분석을 통해 각 시험 물질의 인공 피부 조직 투과량을 정량하였다. 그 결과를 도 2에 나타내었으며， 일반 인간 상피 세포 성장 인자의 인공 피부 조직 투과량을 기준으로 한 각 시험 물질의 인공 피부 조직 투과량 비율을 표 2에 나타내었다.
<77> 【표 2】
Figure imgf000016_0001
상기 결과에서 알 수 있듯이， 실시예의 재조합 인간 상피 세포 성장 인자-저 분자량 프로타민의 피부 조직 투과성, 즉 경피 투과성이 가장 우수하였다. 이는 실 시예의 재조합 인간 상피 세포 성장 인자—저분자량 프로타민이 종래 경피 투과성을 높이는 효과가 우수하다고 알려진 TAT 단백질 혹은 을리고알기닌 (R7)과 결합한 인 간 상피 세포 성장 인자보다 경피 투과성이 뛰어남을 보여준다. 즉， 인간 상피 세 포 성장 인자와 같은 운반 대상 물질은 그 말단에 본 발명에 따른 저분자량 프로타 민이 결합하면 매우 우수한 경피 투과성， 나아가 생체막 투과성 및 피부 세포 투과 성을 나타냄을 알 수 있다.
<80>
<81> (2) 동물 피부 조직을 이용한 경피 투과성 평가
<82> 헤어리스 마우스 (hairless mouse) 피부 조직을 이용한 인간 상피 세포 성장 인자의 경피 투과성을 평가하였다. 구체적으로， 헤어리스 마우스 (수컷， 7주령)의 등에서 배에 걸친 피부 조직을 분리하여 프란츠 투과 세포 (Frant diffusion cell) 에 장착하고， 인간 상피 세포 성장 인자， 실시예의 재조합 인간 상피 세포 성장 인 자-저분자량 프로타민을 인간 상피 세포 성장 인자를 기준으로 60 ppm 농도로 0.1 mL 처리한 뒤， 각각 1시간， 3시간， 6시간， 9시간， 12시간 및 24시간 후 분광 형광 계를 이용한 형광 측정법과 ELISA 분석을 통해 각 시험 물질의 헤어리스 마우스 피 부 조직 투과량을 정량하였다. 그 결과를 도 3에 나타내었으며, 일반 인간 상피 세 포 성장 인자의 헤어리스 마우스 피부 조직 투과량을 기준으로 한 각 시험 물질의 헤어리스 마우스 피부 조직 투과량 비율을 표 3에 나타내었다.
<83> . 【표 3】
Figure imgf000017_0001
<84>
<85> 상기 결과에서 알 수 있듯이， 실시예의 재조합 인간 상피 세포 성장 인자-저 분자량 프로타민의 피부 조직 투과성， 즉 경피 투과성은 일반 인간 상피 세포 성장 인자의 피부 조직 투과성보다 10배 높았다. 즉， 인간 상피 세포 성장 인자와 같은 운반 대상 물질은 본 발명에 따른 저분자량 프로타민이 말단에 결합되면 매우 우수 한 경피 투과성， 나아가 생체막 투과성 및 피부 세포 투과성을 나타냄을 알 수 있 다.
<86>
<87> [실험예 3] 동물 실험을 통한 상처 치유 효능 평가
<88> 헤어리스 마우스 (hairless mouse)의 피부 전층 상처 (full thickness wound)
이용한 인간 상피 세포 성장 인자의 상처 치유 효과를 평가하였다. 구체적으로, 헤 어리스 마우스 (수컷 7주령) 각각의 등에 생검. 편치를 이용해 8 mm 지름의 동그란 피부 전층 상처를 만들고 상처 부위를 포비돈-요오드 (povidone— iodine) 용액으로 소독하였다. 하루가 지난 뒤부터 10 일간， 하루에 두 번씩 각 상처 부위에 인간 상 피 세포 성장 인자 (rEGF), 실시예의 재조합 인간 상피 세포 성장 인자—저분자량 프 로타민 (rLMWP-EGF)를 인간 상피 세포 성장 인자를 기준으로 10 ρρι의 농도로 30 L 씩 도포하였다. 상처 치유 정도는 각 물질 도포 1일, 4일， 7일 및 10일 후 디지털 카메라와 사진 분석을 통해 상처의 크기를 측정하여 평가하였으며， 그 결과를 도 4(초기 상처 크기 대비 % 결과 그래프)와 도 5(사진)에 나타내었다.
<89> 상기 결과에서 알 수 있듯이， 실시예의 재조합 인간 상피 세포 성장 인자-저 분자량 프로타민을 처리했을 때 상처 치유 효과가 가장 우수하였다. 구체적으로, 초기 상처 크기 대비 4일과 10일째 각각 61±5%와 17±3%의 상처 크기를 나타낸 실 시예의 재조합 인간 상피 세포 성장 인자-저분자량 프로타민 처리군은 초기 상처 대비 4일과 10일째 각각 77土 6%와 21±5%의 상처 크기를 보인 무처리군 (control ) 및 초기 상처 대비 4일과 10일 째 각각 72±3%와 20±5 >의 상처 크기를 보인 인간 상피 세포 성장 인자 처리군보다 상처 크기가 크게 감소하였다. 즉, 인간 상피 세 포 성장 인자와 같은 운반 대상 물질은 본 발명에 따른 저분자량 프로타민이 말단 에 결합되면 높은 경피 투과성을 가져 우수한 상처 치유 촉진 효능을 나타냄을 알 수 있다.
<90>
<91> 아래에 본 발명의 일측면에 따른 조성물의 제형예를 설명하나， 이는 본 발명 을 한정하는 것이 아니라 단지 구체적으로 설명하고자 함이다.
<92>
<93> [제형예 1] 화장수
<94> 아래 표에 기재된 조성에 따라 통상적인 방법으로 화장수를 제조한다.
<95> 【표 4】
Figure imgf000018_0001
<96> <97> [제형예 2] 크림
<98> 아래 표에 기재된 조성에 따라 통상적인 방법으로 크림을 제조한다.
<99> 【표 5]
Figure imgf000019_0001
<100>
<ιοι> [제형예 3] 연고 .
<102> 아래 표에 기재된 조성에 따라 통상적인 방법으로 연고를 제조한다.
<103> 【표 6】
Figure imgf000019_0002
<104>
<105> [제형예 4] 주사제
<106> 아래 표에 기재된 조성에 따라 통상적인 방법으로 주사제를 제조한다.
<107> 실시예 10 ppm
<108> 주사용 멸균 증류수 적량 <109> pH조절제 , 적량
[서열목록 프리텍스트】
<iio> <210> 1
<ιιι> <211> 13
<ii2> <212> PRT
<ii3> <213> Artificial
<ιΐ4> <223> Protamine
<ii5> <400> 1
<ii6> Ala Ser Arg Arg Arg Arg Arg Gly Gly Arg Arg Arg Arg
<ii7> 1 5 10
<118>
<H9> <210> 2
<i20> <211> 14
<i2i> <212> PRT
<i22> <213> Artificial
<123> ' <223> Protamine
<124> <400> 2
<i25> Val Ser Arg Arg Arg Arg Arg Arg Gly Gly Arg Arg Arg Arg
<126> 1 5 10
<127>
<128> <210> 3
<i29> <211> 33
<i30> <212> DNA
<i3i> <213> Artificial
<i32> <223> forward primer
<133> <400> 3
<i34> ggtcgtagac gtagaaatag tgactctgaa tgt 33
<135>
<136> <210> 4
<i37> <211> 24
<138> <212> DNA
<i39> <213> Artificial <i40> <223> backward primer
<i4i> <400> 4
<i42> ttatcagcgc agttcccacc actt 24
<!43>
<i44> <210> 5
<i45> <211> 26
<i46> <212> DNA
<I47> <213> Artificial
<i48> <223> forward primer
<i49> <400> 5
<i50> catatggtga gccgtagacg tagacg 26
<151>
<i52> <210> 6
<i53> <211> 41
<i54> <212> DNA
<i55> <213> Artificial
<!56> <223> backward primer
<i57> <400> 6
<i58> ctcgagtcat tagcgcagtt cccaccactt caggtctcgg t 41

Claims

【청구의 범위】
【청구항 1】
운반 대상 물질; 및
운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서열 번호 1 및 서열 번 호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 (low molecular weight protamine)을 포함하는 생체막 투과성 조성물.
【청구항 2】
제 1 항에 있어서,
저분자량 프로타민은 서열 번호 1 및 서열 번호 2의 아미노산 서열 중 하나 이상의 아미노산 서열을 포함하는 조성물.
【청구항 3]
제 1 항에 있어서，
운반 대상 물질은 단백질， 폴리펩티드， 펩티드， 핵산， mR A 및 안티센스 RNA 로 이루어진 군에서 선택된 하나 이상을 포함하는 조성물.
【청구항 4】
제 3 항에 있어서，
단백질은 D K-2(Dickkopf-related protein 2)， 아디포카인 (adipokine) , 트름 보스폰딘 (thrombospondin) 및 슈퍼옥사이드 디스뮤타제 (Superoxide dismutase)로 이루어진 군에서 선택된 하나 이상을 포함하는 조성물.
【청구항 5】
제 1 항에 있어서,
운반 대상 물질은 성장 인자, 효소， 호르몬, 전사 인자, 독소, 항원 및 항체 로 이루어진 군에서 선택된 하나 이상을 포함하는 조성물.
【청구항 6]
제 5 항에 있어서，
성장 인자는 상피 세포 성장 인자 (EGF), 혈소판 -유래 성장 인자 (PDGF), 혈관 내피 세포 성장 인자 (VEGF), 섬유 아세포 성장 인자 (FGF), 인슐린 유사 성장 인자 (IGF), 신경 성장 인자 (NGF) 및 형질 전환 성장 인자 (TGF)로 이루어진 군에서 선택 된 하나 이상을 포함하는 조성물.
【청구항 7】
제 1 항에 있어서, 운반 대상 물질과 저분자량 프로타민은 유전자 재조합으로 결합된 조성물.
【청구항 8]
게 1 항에 있어서，
조성물은 피부 탄력성 증가， 피부 주름 개선， 피부 재생， 피부 미백, 기미 감소, 혈관 신생， 모발 성장 촉진， 탈모 방지， 모낭 세포 활성화， 피부 세포 분열 촉진， 엘라스틴 또는 콜라겐 합성 증가, 상처 치유 촉진， 흉터 완화 및 홍반 억제 중 하나 이상의 작용을 하는 조성물.
【청구항 9]
제 1 항 내지 제 8 항 중 어느 한 항에 있어서，
조성물은 피부 외용제용인 조성물.
【청구항 10】
제 1 항 내지 제 8 항 중 어느 한 항에 있어서，
조성물은 주사제용인 조성물.
【청구항 111
운반 대상 물질; 및 운반 대상 물질의 한쪽 또는 양쪽 말단에 결합하고， 서 열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 7OT 이상 상동 성을 가지는 아미노산 서열을 포함하는 저분자량 프로타민 (low molecular weight protamine)의 융합을 코딩하는 폴리뉴클레오티드.
【청구항 12】
운반 대상 물질;과 서열 번호 1 및 서열 번호 2에 기재된 아미노산 서열 중 하나 이상과 70% 이상 상동성을 가지는 아미노산 서열을 포함하는 저분자량 프로타 민 (low molecular weight protamine) 융합의 발현 백터를 제조하는 단계;
상기 단계에서 제조한 발현 백터를 이용하여 형질 전환 세균을 생산하는 단 계; 및
상기 단계에서 생산한 형질 전환 세균을 이용하여 운반 대상 물질과 저분자 량 프로타민의 융합을 발현시키는 단계를 포함하는 제 1 항 내지 제 8 항 중 어느 한 항에 따른 조성물 제조 방법 .
PCT/KR2012/006868 2011-08-31 2012-08-28 생체막 투과성 조성물 WO2013032210A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2011-0088171 2011-08-31
KR20110088171 2011-08-31
KR10-2012-0093838 2012-08-27
KR1020120093838A KR101417328B1 (ko) 2011-08-31 2012-08-27 생체막 투과성 조성물

Publications (2)

Publication Number Publication Date
WO2013032210A2 true WO2013032210A2 (ko) 2013-03-07
WO2013032210A3 WO2013032210A3 (ko) 2013-05-10

Family

ID=47757042

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/006868 WO2013032210A2 (ko) 2011-08-31 2012-08-28 생체막 투과성 조성물

Country Status (1)

Country Link
WO (1) WO2013032210A2 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070071677A1 (en) * 2003-03-10 2007-03-29 Park Yoon J Non-toxic membrane-translocating peptides
KR20080041037A (ko) * 2006-11-06 2008-05-09 재단법인서울대학교산학협력재단 단백질 수송 펩타이드와 짧은 간섭 ｒｎａ와의 복합체 및그 용도
KR20090034239A (ko) * 2007-10-02 2009-04-07 재단법인서울대학교산학협력재단 골형성 촉진용 세포투과성 융합 단백질 및 그 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070071677A1 (en) * 2003-03-10 2007-03-29 Park Yoon J Non-toxic membrane-translocating peptides
KR20080041037A (ko) * 2006-11-06 2008-05-09 재단법인서울대학교산학협력재단 단백질 수송 펩타이드와 짧은 간섭 ｒｎａ와의 복합체 및그 용도
KR20090034239A (ko) * 2007-10-02 2009-04-07 재단법인서울대학교산학협력재단 골형성 촉진용 세포투과성 융합 단백질 및 그 용도

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
SONG, H. Y. ET AL.: 'Topical transduction of superoxide dismutase mediated by HIV-1 Tat protein transduction domain ameliorates 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation in mice' BIOCHEMICAL PHARMACOLOGY vol. 75, 2008, pages 1348 - 1357 *
ZHI, Q-W. ET AL.: 'PTD-hEGF Fusion Protein-Gene Expression and Function Analysis' CHINESE JOURNAL OF BIOTECHNOLOGY vol. 23, no. 4, 2007, pages 589 - 592 *

Also Published As

Publication number Publication date
WO2013032210A3 (ko) 2013-05-10

Similar Documents

Publication Publication Date Title
KR101944388B1 (ko) 피부 투과성 펩티드 및 그 이용방법
JP2014500867A (ja) 皮膚浸透性および細胞侵入性（ｓｐａｃｅ）ペプチドとその使用法
US9963484B2 (en) Polynucleotide encoding a fusion protein for improving skin conditions
JPH08506095A (ja) 改変インシュリン様成長因子
CN102596179A (zh) 脂质体组合物及其用途
EP3808762A1 (en) Fusion protein bound to cell-permeable peptide, and composition comprising fusion protein or cell-permeable peptide and epithelial cell growth factor as active ingredients
US20120021020A1 (en) Branched amphipathic oligo-peptides that self-assemble into vesicles
CN101711874A (zh) 穿膜肽Tat介导的生长因子在透皮转运中的应用
KR20120034927A (ko) 피부투과성 인간 상피세포 성장인자 및 그 생산방법
KR101831977B1 (ko) 상피세포 성장인자의 활성을 가지는 펩타이드 및 그의 용도
WO2011113024A1 (en) Compositions and methods for healing of skin wounds
KR101813560B1 (ko) 세포투과형 성장인자들의 피부 생리활성 피부외용제 조성물
KR101417328B1 (ko) 생체막 투과성 조성물
US20240252660A1 (en) Cargo molecule transduction domain rmmr1, variant thereof, recombinant cargo molecule, and method for transducing cargo molecule using same
EP3336098B1 (en) Skin permeable peptide and method for using same
WO2013032210A2 (ko) 생체막 투과성 조성물
KR101797167B1 (ko) 신규의 프로테인 트랜스덕션 도메인 및 이의 용도
KR102114842B1 (ko) 세포 투과형 염기성섬유아세포성장인자를 함유하는 피부 생리활성 피부외용제 조성물
KR101626758B1 (ko) 피부 투과성을 갖는 인간 염기성 섬유아세포 성장인자의 개발, 생산 및 화장품 조성물
KR102504190B1 (ko) 화물분자 수송 도메인 rmmr1, 이의 변이체, 이를 포함하는 재조합 화물분자 및 이를 이용한 화물분자 수송 방법
KR100612484B1 (ko) 상피세포성장인자-폴리에틸렌글리콜 접합체 및 그 제조방법
WO2024041372A1 (zh) 一种用于有效递送核酸的分支链结构多肽载体及其变化形式
CN102532323B (zh) 一种多肽复合物、药物组合物、其制备方法和应用
KR101873816B1 (ko) 상피세포 성장인자의 활성을 가지는 데카펩타이드 및 그의 용도
ペプチドを利用した細胞内へのタンパク質 et al. Peptide-Mediated Strategies for Intracellular Protein Delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12827035

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 16/06/2014)

122 Ep: pct application non-entry in european phase

Ref document number: 12827035

Country of ref document: EP

Kind code of ref document: A2