WO2013012674A1 - Methods of transcription activator like effector assembly - Google Patents

Methods of transcription activator like effector assembly Download PDF

Info

Publication number
WO2013012674A1
WO2013012674A1 PCT/US2012/046451 US2012046451W WO2013012674A1 WO 2013012674 A1 WO2013012674 A1 WO 2013012674A1 US 2012046451 W US2012046451 W US 2012046451W WO 2013012674 A1 WO2013012674 A1 WO 2013012674A1
Authority
WO
WIPO (PCT)
Prior art keywords
βγδε
nucleic acid
tale
tale repeat
ligated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/046451
Other languages
English (en)
French (fr)
Inventor
J. Keith Joung
Jeffry D. SANDER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2014520317A priority Critical patent/JP6214530B2/ja
Priority to CA2841710A priority patent/CA2841710C/en
Priority to EP12814750.1A priority patent/EP2732038B1/en
Priority to AU2012284365A priority patent/AU2012284365B2/en
Priority to EP18191841.8A priority patent/EP3461896B1/en
Priority to US14/232,067 priority patent/US20140274812A1/en
Application filed by General Hospital Corp filed Critical General Hospital Corp
Publication of WO2013012674A1 publication Critical patent/WO2013012674A1/en
Anticipated expiration legal-status Critical
Priority to US15/156,574 priority patent/US10273271B2/en
Priority to AU2017204819A priority patent/AU2017204819A1/en
Priority to US16/283,380 priority patent/US11472849B2/en
Priority to AU2019226213A priority patent/AU2019226213A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/24Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a MBP (maltose binding protein)-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/41Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Definitions

  • This invention relates to methods of producing nucleic acids encoding peptides and polypeptides encoding multiple transcription-like activator effector (TALE) repeat domains and the proteins themselves.
  • TALE transcription-like activator effector
  • TALE proteins of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes (see, e.g., Gu et al., 2005, Nature 435: 1 122; Yang et al., 2006 Proc. Natl. Acad. Sci. USA 103: 10503; Kay et al., 2007, Science 318:648; Sugio et al., 2007, Proc. Natl. Acad. Sci. USA 104: 10720; and Romer et al., 2007, Science 318:645).
  • nucleic acid sequences Based on an effector-variable number of imperfect, typically -33-35 amino acid repeats (Schornack et al., 2006, J. Plant Physiol. 163:256). Each repeat binds to one nucleotide in the target sequence, and the specificity of each repeat for its nucleotide is largely context-independent, allowing for the development of custom sequence-specific TALE proteins (Moscou et al., 2009, Science 326: 1501 ; Boch et al., 2009, Science 326: 1509-1512).
  • This application is based, at least in part, on the development of rapid, simple, and easily automatable methods for assembling nucleic acids encoding custom TALE repeat array proteins.
  • this disclosure features a process that includes: (a) providing a first nucleic acid having a sequence encoding a first set comprising one or more (e.g., two or more, three or more, four or more, five or more, six or more, one to six, two to six, three to six, four to six, five or six, one two to five, three to five, four or five, one to four, two to four, three or four, one to three, two or three, one or two, one, two, three, four, five, or six) transcription activator-like effector (TALE) repeat domains and/or one or more portions of one or more TALE repeat domains; (b) contacting the first nucleic acid with a first enzyme, wherein the first enzyme creates a first ligatable end; (c) providing a second nucleic acid having a sequence encoding a second set comprising one or more (e.g., two or more, three or more, four or more, five or more, six or more, one to six,
  • the methods include linking the first nucleic acid to a solid support prior to (b) contacting the first nucleic acid with the first enzyme or prior to (e) ligating the first and second nucleic acids. In some embodiments, the methods include linking the first ligated nucleic acid to a solid support.
  • the first set is N-terminal to the second set in the polypeptide. In some embodiments, the second set is N-terminal to the first set in the polypeptide.
  • the first and second enzymes are a first and second restriction endonuclease, wherein the first restriction endonuclease cleaves at a site within the first nucleic acid and creates a first cut end, and the second restriction endonuclease cleaves at a site within the second nucleic acid and creates a second cut end, and wherein the first and second ligatable ends are the first and second cut ends.
  • restriction endonucleases are used, the first ligated nucleic acid cannot include a restriction site recognized by the first restriction endonuclease.
  • the process can further include: (f) contacting the first ligated nucleic acid with a third enzyme, wherein the third enzyme creates a third ligatable end; (g) providing a third nucleic acid comprising a sequence encoding a third set comprising one or more (e.g., two or more, three or more, four or more, five or more, six or more, one to six, two to six, three to six, four to six, five or six, one two to five, three to five, four or five, one to four, two to four, three or four, one to three, two or three, one or two, one, two, three, four, five, or six) TALE repeat domains and/or one or more portions of one or more TALE repeat domains; (h) contacting the third nucleic acid with a fourth enzyme, wherein the fourth enzyme creates a fourth ligatable end, and wherein the third and fourth ligatable ends are compatible; and (i) ligating the first ligated and third nucleic acids through the third
  • the third and fourth enzymes are a third and fourth restriction endonuclease, wherein the third restriction endonuclease cleaves at a site within the first ligated nucleic acid and creates a third cut end, and the fourth restriction endonuclease cleaves at a site within the third nucleic acid and creates a fourth cut end, and wherein the third and fourth ligatable ends are the third and fourth cut ends.
  • the ligated nucleic acid does not include a restriction site recognized by the first endonuclease, and the first and third restriction endonucleases are the same. In some embodiments, the second and fourth restriction endonucleases are the same.
  • the process can further include: (j) contacting the second ligated nucleic acid with a fifth enzyme, wherein the fifth enzyme creates a fifth ligatable end; (k) providing a fourth nucleic acid having a sequence encoding a fourth set comprising one or more (e.g., two or more, three or more, four or more, five or more, six or more, one to six, two to six, three to six, four to six, five or six, one two to five, three to five, four or five, one to four, two to four, three or four, one to three, two or three, one or two, one, two, three, four, five, or six) TALE repeat domains and/or one or more portions of one or more TALE repeat domains; (1) contacting the fourth nucleic acid with a sixth enzyme, wherein the sixth enzyme creates a sixth ligatable end, and wherein the fifth and sixth ligatable ends are compatible; and (m) ligating the second ligated and fourth nucleic acids through the fifth and sixth
  • the fifth and sixth enzymes are a fifth and sixth restriction endonuclease, wherein the fifth restriction endonuclease cleaves at a site within the second ligated nucleic acid and creates a fifth cut end, and the sixth restriction endonuclease cleaves at a site within the fourth nucleic acid and creates a sixth cut end, and wherein the fifth and sixth ligatable ends are the fifth and sixth cut ends.
  • the second ligated nucleic acid does not include a restriction site recognized by the first endonuclease, and the first, third, and fifth restriction endonucleases are the same. In some embodiments, the second, fourth, and sixth restriction endonucleases are the same.
  • the solid support and linked nucleic acid are isolated, e.g., following any of the above steps (a) - (m).
  • the second, third, or fourth set comprises one to four TALE repeat domains.
  • the ligatable ends include an overhang of 1-10 nucleotides. In some embodiments, the ligatable ends are blunt ends. In some embodiments, an overhang can be generated using an exonuclease and polymerase in the presence of one or more nucleotides.
  • an enzyme or restriction endonuclease used in the above processes is a type IIS restriction endonuclease.
  • the processes can further comprise unlinking a ligated nucleic acid from the solid support and inserting the ligated nucleic acid (or a processed derivative thereof comprising the TALE repeat array coding sequences) into a vector, e.g., an expression vector.
  • the expression vector can include a sequence encoding an effector domain (e.g., a nuclease domain) configured to create a sequence encoding a fusion protein of the polypeptide and the effector domain.
  • the expression vector can be inserted into a cell to affect the cell directly or for expression of the polypeptide or fusion protein.
  • the processes can further include expressing and purifying the polypeptide or fusion protein.
  • this disclosure features TALE proteins that bind to a target nucleotide sequence (e.g., a "half site") disclosed herein (e.g., in Table 6 or 7), TALE nucleases that include the TALE proteins, pairs of TALE proteins (e.g., TALENs) that bind to the target sites disclosed herein (e.g., in Table 6 or 7), and nucleic acids that encode any of the above.
  • a target nucleotide sequence e.g., a "half site”
  • TALE nucleases that include the TALE proteins
  • pairs of TALE proteins e.g., TALENs
  • the TALE proteins, TALE nucleases, and pairs of TALE proteins are those disclosed in Example 7.
  • the nucleic acids encoding the TALE proteins, TALE nucleases, and pairs of TALE proteins can be those disclosed in Example 7 or other sequences that encode the proteins disclosed in Example 7.
  • the disclosure also includes vectors and cells that include the nucleic acids encoding the TALE proteins, TALE nucleases, or pairs of TALE proteins (e.g., TALENs) disclosed herein and methods of expressing the TALE proteins, TALE nucleases, or pairs of TALE proteins (e.g., TALENs) that include culturing the cells.
  • the methods of expressing the TALE proteins, TALE nucleases, or pairs of TALE proteins can also include isolating the TALE proteins, TALE nucleases, or pairs of TALE proteins (e.g., TALENs) from the cell culture.
  • the invention features a set, archive, or library of nucleic acids (e.g., plasmids) that include sequences encoding one or more TALE domains.
  • the set, archive,- or library includes sequences encoding one, two, three, and/or four (or more than four (e.g., five, six, or more)) TALE repeat domains.
  • the set, library, or archive of nucleic acids includes sequences encoding TALE repeat domains that bind to nucleotide sequences having one, two, three, four (or more than four (e.g., five, six, or more)) nucleotides.
  • the set, library, or archive includes restriction sites (e.g., sites for type IIS restriction endonucleases) surrounding the sequences encoding the TALE repeat domains.
  • TALE repeat arrays of any desired length can be constructed, and the methods can be easily multiplexed and/or automated.
  • FIG. 1 is a schematic depiction of an exemplary method of assembling a nucleic acid encoding a TALE protein.
  • FIG. 2 is a schematic depiction of exemplary archives of nucleic acids encoding single (one-mer), two-mer, three-mer, and four-mer TALE repeat domains.
  • FIG. 3 depicts the sequence of the pUC57-ABsaI plasmid. This plasmid is identical to plasmid pUC57 except for mutation of a single base (in bold, underlined and lowercase) that destroys a Bsal restriction site.
  • FIG 4A depicts the polypeptide sequences of exemplary TALE repeats of type ⁇ / ⁇ , ⁇ , ⁇ , and ⁇ . Polymorphic residues characteristic of each type are indicated in bold and italic. The hypervariable triplet SNl for binding to A is indicated in underscore.
  • FIG. 4B depicts the polynucleotide sequences of the exemplary TALE repeats of FIG. 4A.
  • FIGs. 5A-5B depict the common sequence of expression plasmids pJDS70, pJDS71 , pJDS74, pJDS76, and pJDS78.
  • the region of the variable sequences is depicted as XXXXXXXX (underlined and bold).
  • FIG. 6 is a schematic diagram of the enhanced green fluorescent protein (eGFP) gene and the location of the binding sites for synthetic TALE proteins described herein.
  • eGFP enhanced green fluorescent protein
  • FIG. 7 is a bar graph depicting the % of TALE nuclease-modified, eGFP-negative cells at 2 and 5 days following transfection with plasmids encoding TALE nucleases designed to bind and cleave the eGFP reporter gene.
  • FIG. 8 is a depiction of the sequences of insertion-deletion mutants of eGFP induced by TALE nucleases. Deleted bases are indicated by dashes and inserted bases indicated by double underlining; the TALEN target half-sites are single underlined. The net number of bases inserted or deleted is shown to the right.
  • FIG 9 is a depiction of an electrophoresis gel of assembled DNA fragments encoding 17-mer TALE array preparations.
  • FIG 10 is a depiction of an electrophoresis gel of 16-mer TALE array preparations.
  • FIGs. 11A- 11B depict the nucleotide (11 A) and polypeptide (11 B) sequence of engineered DR-TALE-0003.
  • FIGs. 12A-12B depict the nucleotide (12A) and polypeptide (12B) sequence of engineered DR-TALE-0006.
  • FIGs. 13A- 13B depict the nucleotide (13A) and polypeptide (13B) sequence of engineered DR-TALE-0005.
  • FIGs. 14A-14B depict the nucleotide (14A) and polypeptide (14B) sequence of engineered DR-TALE-0010.
  • FIGs. 15A- 15B depict the nucleotide (15A) and polypeptide (15B) sequence of engineered DR-TALE-0023.
  • FIGs. 16A-16B depict the nucleotide (16A) and polypeptide (16B) sequence of engineered DR-TALE-0025.
  • FIGs. 17 A- 17B depict the nucleotide ( 17 A) and polypeptide ( 17B) seqpence of engineered DR-TALE-0020.
  • FIGs. 18 A- 18B depict the nucleotide ( 18 A) and polypeptide ( 18B) sequence of engineered DR-TALE-0022.
  • FIG. 19A is a bar graph depicting activities of 48 TALEN pairs and four ZFN pairs in the EGFP gene-disruption assay. Percentages of EGFP-negative cells as measured 2 and 5 days following transfection of U20S cells bearing a chromosomally integrated EGFP reporter gene with nuclease-encoding plasmids are shown. Mean percent disruption of EGFP and standard error of the mean from three independent transfections are shown.
  • FIG. 19B is a bar graph depicting mean EGFP-disruption activities from FIG.
  • FIG 20A is a graph depicting the ratio of mean percent EGFP disruption values from day 2 to day 5. Ratios were calculated for groups of each length TALEN using the data from FIG 19B. Values greater than 1 indicate a decrease in the average of EGFP - disrupted cells at day 5 relative to day 2.
  • FIG 20B is a graph depicting the ratio of mean tdTomato-positive cells from day 2 to day 5 grouped by various lengths of TALENs. tdTomato-encoding control plasmids were transfected together with nuclease-encoding plasmids on day 0.
  • FIGs. 21A-E depict DNA sequences and frequencies of assembled TALEN- induced mutations at endogenous human genes.
  • WT wild-type
  • ATG translation start codon of the gene
  • Deletions are indicated by dashes and insertions by lowercase letters and double underlining.
  • the sizes of the insertions (+) or deletions ( ⁇ ) are indicated to the right of each mutated site.
  • the number of times that each mutant was isolated is shown in parentheses. Mutation frequencies are calculated as the number of mutants identified divided by the total number of sequences analyzed. Note that for several of the genes, we also identified larger deletions that extend beyond the sequences of the TALEN target sites.
  • FIG 22 is a schematic depiction of an exemplary method of assembling a nucleic acid encoding a TALE protein containing TALE repeat domains or portions of TALE repeat domains.
  • the methods described herein can be used to assemble engineered proteins containing TALE repeat domains for binding to specific sequences of interest.
  • TALE repeat domain repeats can be challenging because the repeats differ only at a small number of amino acids within their highly conserved ⁇ 33-35 amino acid consensus sequence.
  • PCR assembly can lead to the introduction of unwanted mutations.
  • Hierarchical assembly methods that involve one or more passages of intermediate plasmid constructs in E. coli can also be problematic because the highly repetitive nature of these constructs can make them unstable and prone to recombination and because the need to passage these intermediate constructs makes these approaches difficult to automate.
  • TAL effectors of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes. Specificity depends on an effector-variable number of imperfect, typically ⁇ 33-35 amino acid repeats. Polymorphisms are present primarily at repeat positions 12 and 13, which are referred to herein as the "repeat variable-diresidue" (RVD).
  • RVDs of TAL effectors correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence.
  • the polymorphic region that grants nucleotide specificity may be expressed as a triresidue or triplet e.g., encompassing residues 11, 12, and 13.
  • Each DNA binding repeat can include an RVD that determines recognition of a base pair in the target DNA sequence, wherein each DNA binding repeat is responsible for recognizing one base pair in the target DNA sequence, and wherein the RVD comprises, but is not limited to, one or more of the following: HA for recognizing C; ND for recognizing C; HI for recognizing C; HN for recognizing G; NA for recognizing G; SN for recognizing G or A; YG for recognizing T; and NK for recognizing G, and one or more of: HD for recognizing C; NG for recognizing T; NI for recognizing A; NN for recognizing G or A; NS for recognizing A or C or G or T; N* for recognizing C or T, wherein * represents a gap in the second position of the RVD; HG for recognizing T; H* for recognizing T, wherein * represents a gap in the second position of the RVD; and IG for recognizing T.
  • the RVD comprises, but is not limited to, one or more of the following
  • TALE proteins are useful in research and biotechnology as targeted chimeric nucleases that can facilitate homologous recombination in genome engineering (e.g., to add or enhance traits useful for biofuels or biorenewables in plants). These proteins also are useful as, for example, transcription factors, and especially for therapeutic applications requiring a very high level of specificity such as therapeutics against pathogens (e.g., viruses) as non-limiting examples. Assembly Methods
  • FIG. 1 An example of the methods described herein of assembling a TALE repeat domain array is shown in FIG. 1 and includes the following steps: (1) provision a single biotinylated PCR product encoding one single N-terminal TALE repeat domain (a one- mer) with a linker suitable for attachment to a solid support (in the example shown here, a magnetic streptavidin coated bead is used but other solid supports can also be utilized as well as other ways of tethering the initial D A fragment to the solid support); (2) creation of an overhang at the 3' end of the one-mer DNA (e.g., using a Type IIS restriction enzyme); (3) ligation of a second fragment containing four TALE repeat domain (i.e., a pre-assembled four-mer), creating a five-mer; (4) attachment of the five- mer to the solid support; (5) ligation of additional pre-assembled TALE repeat domains to create a long array, e.g., a piece or pieces of DNA encoding one,
  • TALE repeat domains depending upon the length of the desired final array
  • release of the extended DNA encoding the TALE repeats from the solid support e.g., by using a Type IIS restriction enzyme whose site is built in at the 5' end of the initial biotinylated DNA product.
  • the final fragment can then he prepared for ligation to an appropriate expression plasmid.
  • the method can proceed as follows: (1) attachment of a single biotinylated PCR product encoding one single N-terminal TALE repeat domains to a solid support (in the example shown here, a magnetic streptavidin coated bead is used but other solid supports such as the streptavidin-coated wells of a multi-well plate can also be utilized as well as other ways of tethering the initial DNA fragment to the solid support), (2) creation of an overhang at the 3' end of the anchored DNA (e.g., using a Type IIS restriction enzyme), (3) ligation of a second fragment containing four TALE repeat domain, (4) additional cycles of steps (2) and (3) to create a long array, (5) in the final cycle performing ligation of a piece of DNA encoding one, two, three, or four TALE repeat domains depending upon the length of the desired final array, and (6) release of the extended DNA encoding the TALE repeats from the solid support (e.g., by using a Type IIS restriction enzyme whose site is
  • FIG. 22 Another example of a method of assembling a TALE repeat domain array based on the methods described herein is shown in FIG. 22 and includes the following steps: (1) provision a single biotinylated PCR product encoding a portion of one single N- terminal TALE repeat domain (a partial one-mer) with a linker suitable for attachment to a solid support (in the example shown here, a magnetic streptavidin coated bead is used but other solid supports can also be utilized as well as other ways of tethering the initial DNA fragment to the solid support); (2) creation of an overhang at the 3' end of the partial one-mer DNA (e.g., using a Type IIS restriction enzyme); (3) ligation of a second fragment containing consisting of two partial and three full TALE repeats; (4) attachment of the second fragment to the solid support; (5) ligation of additional pre-assembled TALE repeat domains or portions of TALE repeat domains to create a long array, e.g., a piece or pieces of DNA encoding one,
  • the initial nucleic acid encoding one or more TALE repeat domains (or portions) is linked to a solid support.
  • the initial nucleic acid can be prepared by any means (e.g., chemical synthesis, PCR, or cleavage from a plasmid). Additionally, the nucleic acid can be linked to the solid support by any means, e.g., covalently or noncovalently.
  • the nucleic acid is linked noncovalently by using a nucleic acid modified with one member of a binding pair and incorporating the other member of the binding pair on the solid support.
  • a member of a binding pair is meant to be one of a first and a second moiety, wherein said first and said second moiety have a specific binding affinity for each other.
  • Suitable binding pairs for use in the invention include, but are not limited to, antigens/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X/anti-dansyl, Fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, peptide/anti-peptide, ligand/receptor and
  • antigens/antibodies for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X/anti-dansyl, Fluorescein/anti-fluorescein, lucifer yellow/anti-lucifer yellow, peptide/anti-peptide, ligand/receptor and
  • rhodamine/anti-rhodamine biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin.
  • CBP calmodulin binding protein
  • suitable binding pairs include polypeptides such as the FLAG-peptide (Hopp et al, 1988, BioTechnology, 6: 1204 10); the KT3 epitope peptide (Martin et al. Science 255: 192 194 (1992)); tubulin epitope peptide (Skinner et al., J. Biol. Chem. 266: 15163-66 (1991)); and the T7 gene 10 protein peptide tag (Lutz- Freyerinuth et al., Proc. Natl. Acad. Sci. USA, 87:6393 97 (1990)) and the antibodies each thereto.
  • the individual nucleic acids encoding one or more TALE repeat domains are present in an archive or library of plasmids (see FIG. 2). Although nucleic acids encoding one to four TALE repeat domains are shown, the library of plasmids can contain nucleic acids encoding more than four (e.g., five, six, or more) TALE repeat domains. Alternatively, as shown Figure 22, the nucleic acids encoding parts or portions of one or more TALE repeat domains can also be joined together to create final DNA f agments encoding the desired full-length arrays of TALE repeat domains.
  • TALE repeat domain sequences with binding specificity for specific nucleotides or sets of nucleotides are known in the art, and one of ordinary skill can design and prepare a library of plasmids based on these known sequences and the disclosures herein.
  • a solid support refers to any solid or semisolid or insoluble support to which the nucleic acid can be linked.
  • materials include any materials that are used as supports for chemical and biological molecule syntheses and analyses, such as, but not limited to: polystyrene, polycarbonate, polypropylene, nylon, glass, dextran, chitin, sand, pumice, agarose, polysaccharides, dendrimers, buckyballs, polyacryl-amide, silicon, rubber, and other materials used as supports for solid phase syntheses, affinity separations and purifications, hybridization reactions, immunoassays and other such applications.
  • the solid support can be particulate or can be in the form of a continuous surface, such as a microtiter dish or well, a glass slide, a silicon chip, a nitrocellulose sheet, nylon mesh, or other such materials.
  • the particles When particulate, typically the particles have at least one dimension in the 5-10 mm range or smaller.
  • Such particles referred collectively herein as "beads,” are often, but not necessarily, spherical. Such reference, however, does not constrain the geometry of the matrix, which can be any shape, including random shapes, needles, fibers, and elongated. Roughly spherical "beads,” particularly microspheres that can be used in the liquid phase, also are contemplated.
  • the “beads” can include additional components, such as magnetic or paramagnetic particles (see, e.g., Dynabeads (Dynal, Oslo, Norway)) for separation using magnets, as long as the additional components do not interfere with the methods described herein.
  • additional components such as magnetic or paramagnetic particles (see, e.g., Dynabeads (Dynal, Oslo, Norway)) for separation using magnets, as long as the additional components do not interfere with the methods described herein.
  • the ligatable ends. can be produced by cutting with a restriction endonuclease (e.g., a type II or type IIS restriction endonuclease) or by "chewing back" the end using an enzyme (or enzymes) with exonuclease and polymerase activities in the presence of one or more nucleotides (see, Aslanidis et al., 1990, Nucl. Acids Res., 18:6069-74). Suitable enzymes are known to those of ordinary skill in the art. When restriction endonucleases are used, the nucleic acids can be designed to include restriction sites for the enzymes at suitable locations.
  • a restriction endonuclease e.g., a type II or type IIS restriction endonuclease
  • any unligated ends with 5' or 3' overhangs can be "blunted” by use of a polymerase, e.g., a DNA polymerase with both 3 ' ⁇ 5' exonuclease activity and 5' ⁇ 3' polymerase activity.
  • a polymerase e.g., a DNA polymerase with both 3 ' ⁇ 5' exonuclease activity and 5' ⁇ 3' polymerase activity.
  • This blunting step can reduce the appearance of undesired or partial assembly products.
  • these ends can be capped using either a "hairpin" oligo bearing a compatible overhang (Briggs et al., 2012, Nucleic Acids Res, PMID: 22740649) or by short double-stranded DNAs bearing a compatible overhang on one end and a blunt end on the other.
  • nucleic acids of the expected size can be useful to select nucleic acids of the expected size, to reduce the presence of minor products created by incomplete ligations.
  • Methods of selecting nucleic acids by size include gel electrophoresis (e.g., slab gel electrophoresis or capillary gel electrophoresis (see, e.g., Caruso et al., 2003, Electrophoresis, 24:1-2:78- 85)), liquid chromatography (e.g., size exclusion chromatography or reverse phase chromatography (see, e.g., Huber et al., 1995, Anal.
  • a size exclusion step can be performed using an automated system, e.g., an automated gel electrophoresis system (e.g., a Pippin PrepTM automated DNA size selection system, Sage Science, Beverly, MA).
  • an automated gel electrophoresis system e.g., a Pippin PrepTM automated DNA size selection system, Sage Science, Beverly, MA.
  • the methods disclosed herein can be performed manually or implemented in laboratory automation hardware (e.g., SciClone G3 Liquid Handling Workstation, Caliper Life Sciences, Hopkinton, MA) controlled by a compatible software package (e.g., MaestroTM liquid handling software) programmed according to the new methods described herein or a new software package designed and implemented to carry out the specific method steps described herein.
  • laboratory automation hardware e.g., SciClone G3 Liquid Handling Workstation, Caliper Life Sciences, Hopkinton, MA
  • a compatible software package e.g., MaestroTM liquid handling software
  • the methods can be implemented by computer programs using standard programming techniques following the method steps described herein.
  • automated laboratory system robots include the ScicloneTM G3 liquid handling workstation (Caliper Life Sciences, Hopkinton, MA), Biomek® FX liquid handling system (Beckman-Coulter, Fullerton, California),. TekBenchTM automated liquid handling platform (TekCel, Hopkinton, Massachusetts), and Freedom EVO® automation platform (Tecan Trading AG, Switzerland).
  • the programs can be designed to execute on a programmable computer including at least one processor, at least one data storage system (including volatile and non- volatile memory and/or storage elements, e.g., RAM and ROM), at least one communications port that provides access for devices such as a computer keyboard, telephone, or a wireless, hand-held device, such as a PDA, and optionally at least one output device, such as a monitor, printer, or website.
  • the central computer also includes a clock and a communications port that provides control of the lab automation hardware. These are all implemented using known techniques, software, and devices.
  • the system also, includes a database that includes data, e.g., data describing the procedure of one or more method steps described herein.
  • Program code is applied to data input by a user (e.g., location of samples to be processed, timing and frequency of manipulations, amounts of liquid dispensed or aspirated, transfer of samples from one location in the system to another) and data in the database, to perform the functions described herein.
  • the system can also generate inquiries and provide messages to the user.
  • the output information is applied to instruments, e.g., robots, that manipulate, heat, agitate, etc. the vessels that contain the reactants as described herein.
  • the system can include one or more output devices such as a telephone, printer, or a monitor, or a web page on a computer monitor with access to a website to provide to the user information regarding the synthesis and/or its progress.
  • Each program embodying the new methods is preferably implemented in a high level procedural or object-oriented programming language to communicate with a computer system.
  • the programs can also be implemented in assembly or machine language if desired.
  • the language can be a compiled or interpreted language.
  • Each such computer program is preferably stored on a storage medium or device (e.g., RAM, ROM, optical, magnetic) readable by a general or special purpose programmable computer, for configuring and operating the computer when the storage media or device is read by the computer to perform the procedures described herein.
  • a storage medium or device e.g., RAM, ROM, optical, magnetic
  • the system can also be considered to be implemented as a computer- or machine- readable storage medium (electronic apparatus readable medium), configured with a program, whereby the storage medium so configured causes a computer or machine to operate in a specific and predefined manner to perform the functions described herein.
  • the new methods can be implemented using various means of data storage.
  • the files can be transferred physically on recordable media or electronically, e.g., by email on a dedicated intranet, or on the Internet.
  • the files can be encrypted using standard encryption software from such companies as RSA Security (Bedford, Massachusetts) and Baltimore ® .
  • the files can be stored in various formats, e.g., spreadsheets or databases.
  • the term "electronic apparatus” is intended to include any suitable computing or processing apparatus or other device configured or adapted for storing data or information.
  • Examples of electronic apparatus suitable for use with the present invention include stand-alone computing apparatus; communications networks, including local area networks (LAN), wide area networks (WAN), Internet, Intranet, and Extranet; electronic appliances such as a personal digital assistants (PDAs), cellular telephones, “smartphones,” pagers and the like; and local and distributed processing systems.
  • stored refers to a process for encoding information on an electronic apparatus readable medium.
  • Those skilled in the art can readily adopt any of the presently known methods for recording information on known media to generate manufactures comprising the sequence information.
  • a variety of software programs and formats can be used to store method data on an electronic apparatus readable medium.
  • the data and machine instructions can be incorporated in the system of the software provided with the automated system, represented in a word processing text file, formatted in commercially- available software such as WordPerfect® and Microsoft® Word®, or represented in the form of an ASCII file, stored in a database application, such as Microsoft Access®, Microsoft SQL Server®, Sybase®, Oracle®, or the like, as well as in other forms.
  • Any number of data processor structuring formats e.g., text file or database
  • programmable computer can communicate with and control the lab automation hardware to perform the methods described herein.
  • One skilled in the art can input data in electronic apparatus readable form (or a form that is converted to electronic apparatus readable form) to describe the completion of various method steps by the lab automation hardware.
  • the engineered proteins of the present invention it is typically necessary to express the engineered proteins from a nucleic acid that encodes them.
  • the nucleic acid encoding the engineered TALE repeat protein is typically cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication and/or expression.
  • Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the nucleic acid encoding the engineered TALE protein or production of protein.
  • the nucleic acid encoding the engineered TALE repeat protein is also typically cloned into an expression vector, for administration to a plant cell, animal cell, preferably a mammalian cell or a human cell, fungal cell, bacterial cell, or protozoan cell.
  • the engineered TALE repeat protein is typically subcloned into an expression vector that contains a promoter to direct transcription.
  • Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (3d ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 2010).
  • Bacterial expression systems for expressing the engineered TALE repeat protein are available in, e.g., E.
  • Kits for such expression systems are commercially available.
  • Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
  • the promoter used to direct expression of the engineered TALE repeat protein nucleic acid depends on the particular application. For example, a strong constitutive promoter is typically used for expression and purification of the engineered TALE repeat protein. In contrast, when the engineered TALE repeat protein is to be administered in vivo for gene regulation, either a constitutive or an inducible promoter can be used, depending on the particular use of the engineered TALE repeat protein. In addition, a preferred promoter for administration of the engineered TALE repeat protein can be a weak promoter, such as HSV TK or a promoter having similar activity.
  • the promoter typically can also include elements that are responsive to transactivation, e.g., hypoxia response elements, Gal4 response elements, lac repressor response element, and small ' molecule control systems such as tet-regulated systems and the RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci. USA, 89:5547; Oligino et al., 1998, Gene Ther, 5:491-496; Wang et al., 1997, Gene Then, 4:432-441 ; Neering et al., 1996, Blood, 88: 1 147-55; and Rendahl et al., 1998, Nat. Biotechnol., 16:757-761).
  • the expression vector typically contains a
  • transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic.
  • a typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the TALE repeat protein signals required, e.g., for efficient polyadenylation of the transcript, transcriptional termination, ribosome binding sites, or translation termination. Additional elements of the cassette can include, e.g., enhancers, and heterologous spliced intronic signals.
  • the particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the engineered TALE repeat protein, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc.
  • Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and commercially available fusion expression systems such as GST and LacZ.
  • a preferred fusion protein is the maltose binding protein, "MBP.”
  • MBP maltose binding protein
  • Such fusion proteins can be used for purification of the engineered TALE repeat protein.
  • Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, for monitoring expression, and for monitoring cellular and subcellular localization, e.g., c-myc or FLAG.
  • Expression vectors containing regulatory elements from eukaryotic viruses are often used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
  • eukaryotic vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • Some expression systems have markers for selection of stably transfected cell lines such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
  • High yield expression systems are also suitable, such as using a baculovirus vector in insect cells, with the engineered TALE repeat protein encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.
  • the elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.
  • Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264: 17619-22; Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)).
  • Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, 1977, J. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101 :347-362 (Wu et-al., eds, 1983).
  • Any of the well-known procedures for introducing foreign nucleotide sequences into host cells can be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well- known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the protein of choice.
  • Engineered TALE repeat array proteins designed using methods of the present invention can be further characterized to ensure that they have the desired characteristics for their chosen use.
  • TALE repeat array protein can be assayed using a bacterial two-hybrid, bacterial promoter repression, phage-display, or ribosome display system or using an electrophoretic mobility shift assay or "EMSA" (Buratowski & Chodosh, in Current Protocols in Molecular Biology pp. 12.2.1- 12.2.7).
  • ESA electrophoretic mobility shift assay
  • any other DNA binding assay known in the art could be used to verify the DNA binding properties of the selected protein.
  • a bacterial "two-hybrid" system is used to express and test a TALE repeat protein of the present invention.
  • the bacterial two-hybrid system has an additional advantage, in that the protein expression and the DNA binding "assay" occur within the same cells, thus there is no separate DNA binding assay to set up.
  • the DNA binding protein is expressed in a bacterial strain bearing the sequence of interest upstream of a weak promoter controlling expression of a reporter gene (e.g., histidine 3 (HIS3), the beta-lactamase antibiotic resistance gene, or the beta-galactosidase (lacZ) gene).
  • a reporter gene e.g., histidine 3 (HIS3), the beta-lactamase antibiotic resistance gene, or the beta-galactosidase (lacZ) gene.
  • HIS3 histidine 3
  • lacZ beta-galactosidase
  • calculations of binding affinity and specificity are also made. This can be done by a variety of methods.
  • the affinity with which the selected TALE repeat array protein binds to the sequence of interest can be measured and quantified in terms of its K D . Any assay system can be used, as long as it gives an accurate measurement of the actual KQ of the TALE repeat array protein.
  • the K D for the binding of a TALE repeat array protein to its target is measured using an EMSA
  • EMSA is used to determine the KD for binding of the selected TALE repeat array protein both to the sequence of interest (i.e., the specific K D ) and to non-specific DNA (i.e., the non-specific K D ).
  • Any suitable non-specific or “competitor" double stranded DNA known in the art can be used.
  • calf thymus DNA or human placental DNA is used.
  • the ratio of the non-specific K D to the specific KD is the specificity ratio.
  • TALE repeat array proteins that bind with high specificity have a high specificity ratio. This measurement is very useful in deciding which of a group of selected TALE should be used for a given purpose. For example, use of TALE repeat array protein in vivo requires not only high affinity binding but also high- specificity binding.
  • the aim of producing a custom-designed TALE repeat array DNA binding domain is to obtain a TALE repeat array protein that can be used to perform a function.
  • the TALE repeat array DNA binding domain can be used alone, for example to bind to a specific site on a gene and thus block binding of other DNA-binding domains.
  • the TALE repeat array protein will be used in the construction of a chimeric TALE protein containing a TALE repeat array DNA binding domain , and an additional domain having some desired specific function (e.g., gene activation) or enzymatic activity i.e., a "functional domain.”
  • Chimeric TALE repeat array proteins designed and produced using the methods described herein can be used to perform any function where it is desired to target, for example, some specific enzymatic activity to a specific DNA sequence, as well as any of the functions already described for other types of synthetic or engineered DNA binding molecules.
  • Engineered TALE repeat array DNA binding domains can be used in the construction of chimeric proteins useful for the treatment of disease (see, for example, U.S. patent application 2002/0160940, and U.S. Pat. Nos. 6,51 1,808, 6,013,453 and 6,007,988, and International patent application WO 02/057308), or for otherwise altering the structure or function of a given gene in vivo.
  • the engineered TALE repeat array proteins of the present invention are also useful as research tools, for example, in performing either in vivo or in vitro functional genomics studies (see, for example, U.S. Pat. No. 6,503,717 and U.S. patent application 2002/0164575).
  • the engineered TALE repeat array DNA binding domain will typically be fused to at least one "functional" domain.
  • Fusing functional domains to synthetic TALE repeat array proteins to form functional transcription factors involves only routine molecular biology techniques which are commonly practiced by those of skill in the art, see for example, U.S. Pat. Nos.
  • Functional domains can be associated with the engineered TALE repeat array domain at any suitable position, including the C- or N-terminus of the TALE protein.
  • Suitable "functional" domains for addition to the engineered protein made using the methods of the invention are described in U.S. Pat. Nos. 6,511,808, 6,013,453, 6,007,988, and 6,503,717 and U.S. patent application 2002/0160940.
  • the functional domain is a nuclear localization domain which provides for the protein to be translocated to the nucleus.
  • nuclear localization sequences NLS
  • any suitable NLS can be used.
  • many NLSs have a plurality of basic amino acids, referred to as a bipartite basic repeats (reviewed in Garcia-Bustos et al, 1991, Biochim. Biophys. Acta, 1071 :83-101).
  • An NLS containing bipartite basic repeats can be placed in any portion of chimeric protein and results in the chimeric protein being localized inside the nucleus.
  • a nuclear localization domain is routinely incorporated into the final chimeric protein, as the ultimate functions of the chimeric proteins of the present invention will typically require the proteins to be localized in the nucleus. However, it may not be necessary to add a separate nuclear localization domain in cases where the engineered TALE repeat array domain itself or another functional domain within the final chimeric protein, has intrinsic nuclear translocation function.
  • the functional domain is a transcriptional activation domain such that the chimeric protein can be used to activate transcription of the gene of interest.
  • Any transcriptional activation domain known in the art can be used, such as for example, the VP 16 domain form herpes simplex virus (Sadowski et al., 1988, Nature, 335:563-564) or the p65 domain from the cellular transcription factor NF-kappaB (Ruben et al., 1991 , Science, 251 :1490-93).
  • the functional domain is a transcriptional repression domain such that the chimeric protein can be used to repress transcription of the gene of interest.
  • Any transcriptional repression domain known in the art can be used, such as for example, the KRAB (Kruppel-associated box) domain found in many naturally occurring KRAB proteins (Thiesen et al., 1991 , Nucleic Acids Res., 19:3996).
  • the functional domain is a DNA modification domain such as a methyltransferase (or methylase) domain, a de-methylation domain, a deaminase domain, a hydroxylase domain, an acetylation domain, or a deacetylation domain.
  • a DNA methylation domain can be fused to a TALE repeat array DNA binding protein and used for targeted methylation of a specific DNA sequence (Xu et al., 1997, Nat. Genet., 17:376-378).
  • the state of methylation of a gene affects its expression and regulation, and furthermore, there are several diseases associated with defects in DNA methylation.
  • the functional domain is a chromatin modification domain such as a histone acetylase or histone de-acetylase (or HDAC) domain.
  • a histone acetylase or histone de-acetylase (or HDAC) domain is known in the art and any such domain can be used, depending on the desired function of the resultant chimeric protein.
  • Histone deacetylases (such as HDACl and HDAC2) are involved in gene repression. Therefore, by targeting HDAC activity to a specific gene of interest using an engineered TALE protein, the expression of the gene of interest can be repressed.
  • the functional domain is a nuclease domain, such as a restriction endonuclease (or restriction enzyme) domain.
  • the DNA cleavage activity of a nuclease enzyme can be targeted to a specific target sequence by fusing it to an appropriate engineered TALE repeat array DNA binding domain. In this way, sequence specific chimeric restriction enzyme can be produced.
  • nuclease domains are known in the art and any suitable nuclease domain can be used.
  • an endonuclease domain of a type IIS restriction endonuclease e.g., Fokl
  • Fokl a type IIS restriction endonuclease
  • the endonuclease is an engineered Fokl variant as described in US 2008/0131962.
  • Such chimeric endonucleases can be used in any situation where cleavage of a specific DNA sequence is desired, such as in laboratory procedures for the construction of recombinant DNA molecules, or in producing double-stranded DNA breaks in genomic DNA in order to promote homologous recombination (Kim et al., 1996, Proc. Natl. Acad. Sci. USA, 6: 1156-60; Bibikova et al, 2001 , Mol. Cell. Biol., 21:289-297; Porteus & Baltimore, 2003, Science, 300:763; Miller et al., 2011, Nat.
  • repair of a DSB by homology-directed repair with an exogenously introduced "donor template” can lead to highly efficient introduction of precise base alterations or insertions at the break site (Bibikova et al., 2003, Science, 300:764; Urnov et al., 2005, Nature, 435:646-651; Porteus et al, 2003, Science, 300:763; Miller et al, 201 1 , Nat. Biotechnol., 29: 143- 148).
  • the functional domain is an integrase domain, such that the chimeric protein can be used to insert exogenous DNA at a specific location in, for example, the human genome.
  • Suitable functional domains include silencer domains, nuclear hormone receptors, resolvase domains oncogene transcription factors (e.g., myc, jun, fos, myb, max, mad, rel, ets, bcl, myb, mos family members etc.), kinases, phosphatases, and any other proteins that modify the structure of DNA and/or the expression of genes.
  • Suitable kinase domains, from kinases involved in transcription regulation are reviewed in Davis, 1995, Mol. Reprod. Dev., 42:459-67.
  • Suitable phosphatase domains are reviewed in, for example, Schonthal & Semin, 1995, Cancer Biol. 6:239-48.
  • TALE repeat arrays to functional domains can be performed by standard recombinant DNA techniques well known to those skilled in the art, and as are described in, for example, basic laboratory texts such as Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001), and in U.S. Pat. Nos. 6,51 1,808, 6,013,453, 6,007,988, and 6,503,717 and U.S. patent application 2002/0160940.
  • two or more engineered TALE repeat array proteins are linked together to produce the final DNA binding domain.
  • the linkage of two or more engineered proteins can be performed by covalent or non-covalent means.
  • engineered proteins can be covalently linked together using an amino acid linker (see, for example, U.S. patent application 2002/0160940, and International applications WO 02/099084 and WO 01/53480).
  • This linker can be any string of amino acids desired.
  • the linker is a canonical TGEKP linker.
  • standard recombinant DNA techniques such as described in, for example, Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001) can be used to produce such linked proteins.
  • the chimeric protein can possess a dimerization domain as such endonucleases are believed to function as dimers. Any suitable dimerization domain can be used.
  • the endonuclease domain itself possesses dimerization activity.
  • the nuclease domain of Fokl which has intrinsic dimerization activity can be used (Kim et al., 1 96, Proc. Natl. Acad. Sci., 93: 1156-60).
  • the activity of a particular engineered TALE repeat protein can be assessed using a variety of in vitro and in vivo assays, by measuring, e.g., protein or mRNA levels, product levels, enzyme activity, tumor growth; transcriptional activation or repression of a reporter gene; second messenger levels (e.g., cGMP, cAMP, IP3, DAG, Ca 2+ ); cytokine and hormone production levels; and neovascularization, using, e.g., immunoassays (e.g.,
  • ELISA and immunohistochemical assays with antibodies include hybridization assays (e.g., RNase protection, northerns, in situ hybridization, oligonucleotide array studies), colorimetric assays, amplification assays, enzyme activity assays, tumor growth assays, phenotypic assays, and the like.
  • hybridization assays e.g., RNase protection, northerns, in situ hybridization, oligonucleotide array studies
  • colorimetric assays e.g., amplification assays
  • enzyme activity assays e.g., tumor growth assays, phenotypic assays, and the like.
  • TALE proteins can be first tested for activity in vitro using cultured cells! e.g.,
  • the engineered TALE repeat array protein is often first tested using a transient expression system with a reporter gene, and then regulation of the target endogenous gene is tested in cells and in animals, both in vivo and ex vivo.
  • the engineered TALE repeat array protein can be recombinantly expressed in a cell, recombinantly expressed in cells transplanted into an animal, or recombinantly expressed in a transgenic animal, as well as administered as a protein to an animal or cell using delivery vehicles described below.
  • the cells can be immobilized, be in solution, be injected into an animal, or be naturally occurring in a transgenic or non-transgenic animal.
  • Modulation of gene expression is tested using one of the in vitro or in vivo assays described herein. Samples or assays are treated with the engineered TALE repeat array protein and compared to un-treated control samples, to examine the extent of modulation.
  • the TALE repeat array protein ideally has a K D of 200 nM or less, more preferably 100 nM or less, more preferably 50 nM, most preferably 25 nM or less.
  • the effects of the engineered TALE repeat array protein can be measured by examining any of the parameters described above. Any suitable gene expression, phenotypic, or physiological change can be used to assess the influence of the engineered TALE repeat array protein.
  • Preferred assays for regulation of endogenous gene expression can be performed in vitro.
  • the engineered TALE repeat array protein regulation of endogenous gene expression in cultured cells is measured by examining protein production using an ELISA assay.
  • the test sample is compared to control cells treated with an empty vector or an unrelated TALE repeat array protein that is targeted to another gene.
  • regulation of endogenous gene expression is determined in vitro by measuring the level of target gene mR A expression.
  • the level of gene expression is measured using amplification, e.g., using RT-PCR, LCR, or hybridization assays, e.g., northern hybridization, RNase protection, dot blotting. RNase protection is used in one embodiment.
  • the level of protein or mRNA is detected using directly or indirectly labeled detection agents, e.g., fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
  • a reporter gene system can be devised using the target gene promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or beta-galactosidase.
  • the reporter construct is typically co-transfected into a cultured cell. After treatment with the TALE repeat array protein, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill in the art.
  • an assay format useful for monitoring regulation of endogenous gene expression is performed in vivo.
  • This assay is particularly useful for examining TALE repeat array proteins that inhibit expression of tumor promoting genes, genes involved in tumor support, such as neovascularization (e.g., VEGF), or that activate tumor suppressor genes such as p53.
  • cultured tumor cells expressing the engineered TALE protein are injected subcutaneously into an immune compromised mouse such as an athymic mouse, an irradiated mouse, or a SCID mouse. After a suitable length of time, preferably 4-8 weeks, tumor growth is measured, e.g., by volume or by its two largest dimensions, and compared to the control. Tumors that have statistically significant reduction (using, e.g., Student's T test) are said to have inhibited growth. Alternatively, the extent of tumor neovascularization can also be measured.
  • Immunoassays using endothelial cell specific antibodies are used to stain for vascularization of the tumor and the number of vessels in the tumor. Tumors that have a statistically significant reduction in the number of vessels (using, e.g., Student's T test) are said to have inhibited neovascularization.
  • Transgenic and non-transgenic animals can also be used for examining regulation of endogenous gene expression in vivo.
  • Transgenic animals can express the engineered TALE repeat array protein.
  • animals that transiently express the engineered TALE repeat array protein, or to which the engineered TALE repeat array protein has been administered in a delivery vehicle can be used. Regulation of endogenous gene expression is tested using any one of the assays described herein.
  • the engineered proteins of the present invention can be used to regulate gene expression or alter gene sequence in gene therapy applications in the same. Similar methods have been described for synthetic zinc finger proteins, see for example U.S. Pat. No. 6,511,808, U.S. Pat. No. 6,013,453, U.S. Pat. No. 6,007,988, U.S. Pat. No.
  • Non- viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • Methods of non- viral delivery of nucleic acids encoding the engineered TALE repeat array proteins include lipofection, microinjection, biolistics, virosomes, liposomes, immuno liposomes, polycation or lipid:nucleic acid conjugates, naked DNA or RNA, artificial virions, and agent-enhanced uptake of DNA or RNA.
  • Lipofection is described in e.g., U.S. Pat. No. 5,049,386, No. 4,946,787; and No.4,897,355) and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. DeUvery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • lipidrnucleic acid complexes including targeted liposomes such as immunolipid complexes
  • the preparation of lipidrnucleic acid complexes, including targeted liposomes such as immunolipid complexes is well known to one of skill in the art (see, e.g., Crystal, 1995, Science, 270:404-410; Blaese et al., 1995, Cancer Gene Ther., 2:291-297; Behr et al., 1994, Bioconjugate Chem. 5:382-389; emy et al., 1994, Bioconjugate Chem., 5:647- 654; Gao et al., Gene Ther., 2:710-722; Ahmad et al., 1992, Cancer Res., 52:4817-20; U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, ,261 ,975, 4,485,054, 4,501 ,728, 4,774,085, 4,837,02
  • R A or DNA viral based systems for the delivery of nucleic acids encoding the engineered TALE repeat array proteins takes advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Viral vectors can be administered directly to patients (in vivo) or they can be used, to treat cells in vitro and the modified cells are administered to patients (ex vivo).
  • Conventional viral based systems for the delivery of TALE repeat array proteins could include retroviral, lentivirus, adenoviral, adeno-associated, Sendai, and herpes simplex virus vectors for gene transfer.
  • Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
  • Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SrV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., 1992, J. Virol., 66:2731-39; Johann et al., 1992, J. Virol., 66: 1635-40; Sommerfelt et al., 1990, Virololgy, 176:58-59; Wilson et al., 1989, J. Virol, 63:2374-78; Miller et al, 1991, J. Virol, 65:2220-24; WO 94/26877).
  • MiLV murine leukemia virus
  • GaLV gibbon ape leukemia virus
  • SrV Simian Immuno deficiency virus
  • HAV human immuno deficiency virus
  • adenoviral based systems can be used.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system.
  • Adeno- associated virus (“AAV”) vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al, 1987, Virology 160:38-47; U.S. Pat. No.
  • At least six viral vector approaches are currently available for gene transfer in clinical trials, with retroviral vectors by far the most frequently used system. All of these viral vectors utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
  • pLASN and MFG-S are examples are retroviral vectors that have been used in clinical trials (Dunbar et al, 1995, Blood, 85:3048; Kohn et al., 1995, Nat. Med, 1 :1017; Malech et al, 1997, Proc. Natl. Acad. Sci. USA, 94: 12133-38).
  • PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al, 1995, Science, 270:475-480). Transduction efficiencies of 50% or greater have been observed for MFG- S packaged vectors (Ellem et al, 1997, Immunol Immunother., 44: 10-20; Dranoffet al., 1997, Hum. Gene Ther, 1 :111-112).
  • rAAV Recombinant adeno-associated virus vectors
  • the vectors are derived from a plasmid that retains only the AAV 145 bp inverted tenninal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system (Wagner et al., 1998, Lancet, 351 : 1702-1703; Kearns et al., 1996, Gene Ther, 9:748-55).
  • Ad vectors Replication-deficient recombinant adenoviral vectors
  • Most adenovirus vectors are engineered such that a transgene replaces the Ad E 1 a, E 1 b, and E3 genes; subsequently the replication defector vector is propagated in human 293 cells that supply deleted gene function in trans.
  • Ad vectors can transduce multiple types of tissues in vivo, including nondividing, differentiated cells such as those found in the liver, kidney and muscle system tissues. Conventional Ad vectors have a large carrying capacity.
  • An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Sterman et al., 1998, Hum. Gene Ther.
  • Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome.
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV,
  • a viral vector is typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the viruses outer surface.
  • the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest.
  • Han et al. 1995, Proc. Natl. Acad. Sci. USA, 92:9747-51, reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
  • filamentous phage can be engineered to display antibody fragments (e.g., Fab or Fv) having specific binding affinity for virtually any chosen cellular receptor.
  • antibody fragments e.g., Fab or Fv
  • nonviral vectors Such vectors can be engineered to contain specific uptake sequences thought to favor uptake by specific target cells.
  • Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below.
  • vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or stem cells (e.g., universal donor hematopoietic stem cells, embryonic stem cells (ES), partially differentiated stem cells, non-pluripotent stem cells, pluripotent stem cells, induced pluripotent stem cells (iPS cells) (see e.g., Sipione et al., Diabetologia, 47:499- 508, 2004)), followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
  • stem cells e.g., universal donor hematopoietic stem cells, embryonic stem cells
  • Ex vivo cell transfection for diagnostics, research, or for gene therapy is well known to those of skill in the art.
  • cells are isolated from the subject organism, transfected with nucleic acid (gene or cDNA), encoding the engineered TALE repeat array protein, and re-infused back into the subject organism (e.g., patient).
  • nucleic acid gene or cDNA
  • encoding the engineered TALE repeat array protein e.g., patient
  • Various cell types suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney et al., Culture of Animal Cells, A Manual of Basic Technique (5th ed. 2005)) and the references cited therein for a discussion of how to isolate and culture cells from patients).
  • stem cells e.g., universal donor hematopoietic stem cells, embryonic stem cells (ES), partially differentiated stem cells, non-pluripotent stem cells, pluripotent stem cells, induced pluripotent stem cells (iPS cells) (see e.g., Sipione et al., Diabetologia, 47:499-508, 2004)
  • ES embryonic stem cells
  • iPS cells induced pluripotent stem cells
  • the advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow.
  • Stem cells can be isolated for transduction and differentiation using known methods.
  • stem cells can be isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells) (see Inaba et al., 1992, J. Exp. Med., 176: 1693-1702).
  • Vectors containing nucleic acids encoding the engineered TALE repeat array protein can be also administered directly to the organism for transduction of cells in vivo.
  • naked DNA can be administered.
  • Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • stable formulations of the engineered TALE repeat array protein can also be administered.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (see, e.g., Remington: The Science and Practice of Pharmacy, 21 st ed., 2005).
  • polypeptide compounds such as the engineered TALE repeat array proteins of the present invention
  • the polypeptide has the ability to traverse the plasma membrane of a cell, or the membrane of an intra-cellular compartment such as the nucleus!
  • Cellular membranes are composed of lipid-protein bilayers that are freely permeable to small, nonionic lipophilic compounds and are inherently impermeable to polar compounds, macromolecules, and therapeutic or diagnostic agents.
  • proteins and other compounds such as liposomes have been described, which have the ability to translocate polypeptides such as engineered TALE repeat array protein across a cell membrane.
  • membrane translocation polypeptides have amphiphilic or hydrophobic amino acid subsequences that have the ability to act as membrane- translocating carriers.
  • homeodomain proteins have the ability to translocate across cell membranes.
  • the shortest internalizable peptide of a homeodomain protein, Antennapedia was found to be the third helix of the protein, from amino acid position 43 to 58 (see, e.g., Prochiantz, 1996, Curr. Opin. Neurobiol., 6:629-634).
  • peptide sequences that can be linked to a protein, for facilitating uptake of the protein into cells include, but are not limited to: peptide fragments of the tat protein of HIV (Endoh et al, 2010, Methods Mol. Biol., 623:271 -281; Schmidt et al, 2010, FEBS Lett., 584: 1806-13; Futaki, 2006, Biopolymers, 84:241-249); a 20 residue peptide sequence which corresponds to amino acids 84-103 of the pl6 protein (see Fahraeus et al., 1996, Curr.
  • Toxin molecules also have the ability to transport polypeptides across cell membranes. Often, such molecules are composed of at least two parts (called "binary toxins"): a translocation or binding domain or polypeptide and a separate toxin domain or polypeptide. Typically, the translocation domain or polypeptide binds to a cellular receptor, and then the toxin is transported into the cell.
  • Clostridium perfringens iota toxin diphtheria toxin (DT), Pseudomonas exotoxin A (PE), pertussis toxin (PT), Bacillus anthracis toxin, and pertussis adenylate cyclase (CYA)
  • DT diphtheria toxin
  • PE Pseudomonas exotoxin A
  • PT pertussis toxin
  • Bacillus anthracis toxin Bacillus anthracis toxin
  • pertussis adenylate cyclase CYA
  • Such subsequences can be used to translocate engineered TALE repeat array proteins across a cell membrane.
  • the engineered TALE repeat array proteins can be conveniently fused to or derivatized with such sequences.
  • the translocation sequence is provided as part of a fusion protein.
  • a linker can be used to link the engineered TALE repeat array protein and the translocation sequence. Any suitable linker can be used, e.g., a peptide linker.
  • the engineered TALE repeat array protein cari also be introduced into an animal cell, preferably a mammalian cell, via liposomes and liposome derivatives such as immunoliposomes.
  • liposome refers to vesicles comprised of one or more concentrically ordered lipid bilayers, which encapsulate an aqueous phase.
  • the aqueous phase typically contains the compound to be delivered to the cell, i.e., the engineered TALE repeat array protein.
  • the liposome fuses with the plasma membrane, thereby releasing the compound into the cytosol.
  • the liposome is phagocytosed or taken up by the cell in a transport vesicle. Once in the endosome or phagosome, the liposome either degrades or fuses with the membrane of the transport vesicle and releases its contents.
  • the liposome In current methods of drug delivery via liposomes, the liposome ultimately becomes permeable and releases the encapsulated compound (e.g., the engineered TALE repeat array protein or a nucleic acid encoding the same) at the target tissue or cell.
  • the encapsulated compound e.g., the engineered TALE repeat array protein or a nucleic acid encoding the same
  • this can be accomplished, for example, in a passive manner wherein the liposome bilayer degrades over time through the action of various agents in the body.
  • active compound release involves using an agent to induce a permeability change in the liposome vesicle.
  • Liposome membranes can be constructed so that they become destabilized when the environment becomes acidic near the liposome membrane (see, e.g., Proc. Natl. Acad. Sci. USA, 84:7851 (1987);
  • DOPE Dioleoylphosphatidylethanolamine
  • Such liposomes typically comprise the engineered TALE repeat array protein and a lipid component, e.g., a neutral and/or cationic lipid, optionally including a receptor- recognition molecule such as an antibody that binds to a predetermined cell surface receptor or ligand (e.g., an antigen).
  • a lipid component e.g., a neutral and/or cationic lipid, optionally including a receptor- recognition molecule such as an antibody that binds to a predetermined cell surface receptor or ligand (e.g., an antigen).
  • Suitable methods include, for example, sonication, extrusion, high pressure/homogenization, microfluidization, detergent dialysis, calcium-induced fusion of small liposome vesicles and ether-fusion methods, all of which are well known in the art.
  • targeting moieties that are specific to a particular cell type, tissue, and the like.
  • targeting moieties e.g., ligands, receptors, and monoclonal antibodies
  • targeting moieties include monoclonal antibodies specific to antigens associated with neoplasms, such as prostate cancer specific antigen and MAGE. Tumors can also be diagnosed by detecting gene products resulting from the activation or over- expression of oncogenes, such as ras or c-erbB2, In addition, many tumors express antigens normally expressed by fetal tissue, such as the alphafetoprotein (AFP) and carcinoembryonic antigen (CEA).
  • AFP alphafetoprotein
  • CEA carcinoembryonic antigen
  • Sites of viral infection can be diagnosed using various viral antigens such as hepatitis B core and surface antigens (HBVc, HBVs) hepatitis C antigens, Epstein-Barr virus antigens, human immunodeficiency type-1 virus (HIV1) and papilloma virus antigens.
  • Inflammation can be detected using molecules specifically recognized by surface molecules which are expressed at sites of inflammation such as integrins (e.g., VCAM-1), selectin receptors (e.g., ELAM-1) and the like.
  • Standard methods for coupling targeting agents to liposomes can be used. These methods generally involve incorporation into liposomes lipid components, e.g., phosphatidylethanolamine, which can be activated for attachment of targeting agents, or derivatized lipophilic compounds, such as lipid derivatized bleomycin.
  • Antibody targeted liposomes can be constructed using, for instance, liposomes which incorporate protein A (see Renneisen et al., 1990, J. Biol. Chem., 265: 16337-42 and Leonetti et al, 1990, Proc. Natl. Acad. Sci. USA, 87:2448-51). Dosages
  • the dose of the engineered TALE repeat array protein to be administered to a patient is calculated in a similar way as has been described for zinc finger proteins, see for example U.S. Pat. No. 6, 11,808, U.S. Pat. No. 6,492,117, U.S. Pat. No. 6,453,242, U.S. patent application 2002/0164575, and U.S. patent application 2002/0160940.
  • the dose should be sufficient to effect a beneficial therapeutic response in the patient over time.
  • particular dosage regimens can be useful for determining phenotypic changes in an experimental setting, e.g., in functional genomics studies, and in cell or animal models.
  • the dose will be determined by the efficacy, specificity, and K D of the particular engineered TALE repeat array protein employed, the nuclear volume of the target cell, and the condition of the patient, as well as the body weight or surface area of the patient to be treated.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular compound or vector in a particular patient.
  • Appropriate pharmaceutical compositions for administration of the engineered TALE repeat array proteins of the present invention can be determined as described for zinc finger proteins, see for example U.S. Pat. No. 6,511,808, U.S. Pat. No. 6,492,117, U.S. Pat. No. 6,453,242, U.S. patent application 2002/0164575, and U.S. patent application 2002/0160940.
  • Engineered TALE repeat array proteins, and expression vectors encoding engineered TALE repeat array proteins can be administered directly to the patient for modulation of gene expression and for therapeutic or prophylactic applications, for example, cancer, ischemia, diabetic retinopathy, macular degeneration, rheumatoid arthritis, psoriasis, HIV infection, sickle cell anemia, Alzheimer's disease, muscular dystrophy, neurodegenerative diseases, vascular disease, cystic fibrosis, stroke, and the like.
  • pathogenic bacteria e.g., chlamydia, rickettsial bacteria, my
  • Leishmania, Trichomonas, Giardia, etc. hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-1, HSV-6, HSV- ⁇ , CMV, and EBV), HIV, Ebola, adenovirus, influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie virus, comovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, poliovirus, rabies virus, and arboviral encephalitis virus, etc.
  • viruses e.g., hepatitis (A, B, or C)
  • herpes virus e.g., VZV, HSV-1, HSV-6, HSV- ⁇ , CMV, and EBV
  • HIV Ebola
  • adenovirus influenza virus
  • TALE repeat array proteins are administered in any suitable manner, preferably with pharmaceutically acceptable carriers. Suitable methods of administering such modulators are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions that are available (see, e.g., Remington: The Science and Practice of Pharmacy, 21 st ed., 2005).
  • the engineered TALE repeat array proteins can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol formulations (i.e., they can be made into aerosol
  • Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the disclosed compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally.
  • formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
  • Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • TALE nucleases engineered using the methods described herein can be used to induce mutations in a genomic sequence, e.g., by cleaving at two sites and deleting sequences in between, by cleavage at a single site followed by non-homologous end joining, and/or by cleaving at a site so as to remove or replace one or two or a few nucleotides.
  • the TALE nuclease is used to induce mutation in an animal, plant, fungal, or bacterial genome.
  • Targeted cleavage can also be used to create gene knock-outs (e.g., for functional genomics or target validation) and to facilitate targeted insertion of a sequence into a genome (i.e., gene knock-in); e.g., for purposes of cell engineering or protein overexpression. Insertion can be by means of replacements of chromosomal sequences through homologous recombination or by targeted integration, in which a new sequence (i.e., a sequence not present in the region of interest), flanked by sequences homologous to the region of interest in the chromosome, is used to insert the new sequence at a predetermined target site via homologous recombination.
  • a new sequence i.e., a sequence not present in the region of interest
  • Exogenous DNA can also be inserted into TALE nuclease-induced double stranded breaks without the need for flanking homology sequences (see, Orlando et al., 2010, Nucl. Acids Res., 1- 15, doi:10.1093/nar/gkq512).
  • TALE nucleases produced by the methods described herein were capable of inducing site-specific mutagenesis in mammalian cells.
  • TALE nucleases produced by the methods described herein woluld also function to induce efficient site- specific mutagenesis in other cell types and organisms (see, for example, Cade et al, 2012, Nucleic Acids Res, PMID: 22684503 and Moore et al, 2012, PLoS One, PM1D: 22655075).
  • the same methods can also be used to replace a wild-type sequence with a mutant sequence, or to convert one allele to a different allele.
  • Targeted cleavage of infecting or integrated viral genomes can be used to treat viral infections in a host. Additionally, targeted cleavage of genes encoding receptors for viruses can be used to block expression of such receptors, thereby preventing viral infection and/or viral spread in a host organism. Targeted mutagenesis of genes encoding viral receptors (e.g., the CCR5 and CXCR4 receptors for HIV) can be used to render the receptors unable to bind to virus, thereby preventing new infection and blocking the spread of existing infections.
  • Targeted mutagenesis of genes encoding viral receptors e.g., the CCR5 and CXCR4 receptors for HIV
  • viruses or viral receptors that can be targeted include herpes simplex virus (HSV), such as HSV- 1 and HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV), HHV6 and HHV7.
  • HSV herpes simplex virus
  • VZV varicella zoster virus
  • EBV Epstein-Barr virus
  • CMV cytomegalovirus
  • HHV6 and HHV7 herpes simplex virus
  • the hepatitis family of viruses includes hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), the delta hepatitis virus (HDV), hepatitis E virus (HEV) and hepatitis G virus (HGV).
  • viruses or their receptors can be targeted, including, but not limited to, Picornaviridae (e.g., polioviruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, dengue virus, etc.); Flaviviridae; Coronaviridae; Reoviridae;
  • Bimaviridae Bimaviridae; Rhabodoviridae (e.g., rabies virus, etc.); Filoviridae; Paramyxoviridae (e.g., mumps virus, measles virus, respiratory syncytial virus, etc.); Orthomyxoviridae (e.g., influenza virus types A, B and C, etc.); Bunyaviridae; Arenaviridae; Retroviradae;
  • lentiviruses e.g., HTLV-I; HTLV-II; HIV-1 (also known as HTLV-III, LAV, ARV, hTLR, etc.) HIV-II); simian immunodeficiency virus (SIV), human papillomavirus (HPV), influenza virus and the tick-borne encephalitis viruses.
  • SIV simian immunodeficiency virus
  • HPV human papillomavirus
  • influenza virus e.g., Virology, 3rd Edition (W. K. Joklik, ed. 1988); Fundamental Virology, 4th Edition (Knipe and How ley, eds. 2001), for a description of these and other viruses.
  • Receptors for HIV for example, include CCR-5 and CXCR-4.
  • the genome of an infecting bacterium can be mutagenized by targeted DNA cleavage followed by non-homologous end joining, to block or ameliorate bacterial infections.
  • the disclosed methods for targeted recombination can be used to replace any genomic sequence with a homologous, non-identical sequence.
  • a mutant genomic sequence can be replaced by its wild-type counterpart, thereby providing methods for treatment of e.g., genetic disease, inherited disorders, cancer, and autoimmune disease.
  • one allele of a gene can be replaced by a different allele using the methods of targeted recombination disclosed herein.
  • Exemplary genetic diseases include, but are not limited to, achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency (OMIM . No.102700), adrenoleukodystrophy, aicardi syndrome, alpha- 1 antitrypsin deficiency, alpha-thalassemia, androgen insensitivity syndrome, apert syndrome, arrhythmogenic right ventricular, dysplasia, ataxia telangictasia, barth syndrome, beta-thalassemia, blue rubber bleb nevus syndrome, canavan disease, chronic granulomatous diseases (CGD), cri du chat syndrome, cystic fibrosis, dercum's disease, ectodermal dysplasia, Fanconi anemia, fibrodysplasia ossificans progressive, fragile X syndrome, galactosemis, Gaucher's disease, generalized gangliosidoses (e
  • mucopolysaccharidosis nail patella syndrome, nephrogenic diabetes insipdius, neurofibromatosis, Neimann-Pick disease, osteogenesis imperfecta, porphyria, Prader- Willi syndrome, progeria, Proteus syndrome, retinoblastoma, Rett syndrome, Rubinstein- Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Shwachman syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins syndrome, trisomy, tuberous sclerosis, Turner's syndrome, urea cycle disorder, von Hippel-Landau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome, X-linked lymphoproliferative syndrome (XLP, OMIM No. 308240).
  • MPS mucopo
  • Additional exemplary diseases that can be treated by targeted DNA cleavage and/or homologous recombination include acquired immunodeficiencies, lysosomal storage diseases (e.g., Gaucher's disease, GM1, Fabry disease and Tay-Sachs disease), mucopolysaccahidosis (e.g., Hunter's disease, Hurler's disease), hemoglobinopathies (e.g., sickle cell diseases, HbC, alpha-thalassemia, beta-thalassemia) and hemophilias.
  • acquired immunodeficiencies e.g., Gaucher's disease, GM1, Fabry disease and Tay-Sachs disease
  • mucopolysaccahidosis e.g., Hunter's disease, Hurler's disease
  • hemoglobinopathies e.g., sickle cell diseases, HbC, alpha-thalassemia, beta-thalassemia
  • hemophilias e.g., sickle cell
  • a pluripotent cell e.g., a hematopoietic stem cell
  • Methods for mobilization, enrichment and culture of hematopoietic stem cells are known in the art. See for example, U.S. Pat. Nos.
  • Treated stem cells can be returned to a patient for treatment of various diseases including, but not limited to, SCID and sickle-cell anemia.
  • a region of interest comprises a mutation
  • the donor polynucleotide comprises the corresponding wild-type sequence.
  • a wild-type genomic sequence can be replaced by a mutant sequence, if such is desirable.
  • overexpression of an oncogene can be reversed either by mutating the gene or by replacing its control sequences with sequences that support a lower, non-pathologic level of expression.
  • the wild-type allele of the ApoAI gene can be replaced by the ApoAI Milano allele, to treat atherosclerosis. Indeed, any pathology dependent upon a particular genomic sequence, in any fashion, can be corrected or alleviated using the methods and compositions disclosed herein.
  • Targeted cleavage and targeted recombination can also be used to alter non- coding sequences (e.g., sequences encoding microRNAs and long non-coding RNAs, and regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites) to alter the levels of expression of a gene product.
  • non- coding sequences e.g., sequences encoding microRNAs and long non-coding RNAs, and regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites
  • Such methods can be used, for example, for therapeutic purposes, functional genomics and/or target validation studies.
  • compositions and methods described herein also allow for novel approaches and systems to address immune reactions of a host to allogeneic grafts.
  • a major problem faced when allogeneic stem cells (or any type of allogeneic cell) are grafted into a host recipient is the high risk of rejection by the host's immune system, primarily mediated through recognition of the Major Histocompatibility Complex (MHC) on the surface of the engrafted cells.
  • MHC Major Histocompatibility Complex
  • the MHC comprises the HLA class I protein(s) that function as heterodimers that are comprised of a common beta subunit and variable alpha subunits. It has been demonstrated that tissue grafts derived from stem cells that are devoid of HLA escape the host's immune response.
  • genes encoding HLA proteins involved in graft rejection can be cleaved, mutagenized or altered by recombination, in either their coding or regulatory sequences, so that their expression is blocked or they express a non-functional product.
  • HLA class I can be removed from the cells to rapidly and reliably generate HLA class I null stem cells from any donor, thereby reducing the need for closely matched donor/recipient MHC haplotypes during stem cell grafting.
  • Inactivation of any gene can be achieved, for example, by a single cleavage event, by cleavage followed by non-homologous end joining, by cleavage at two sites followed by joining so as to delete the sequence between the two cleavage sites, by targeted recombination of a missense or nonsense codon into the coding region, or by targeted recombination of an irrelevant sequence (i.e., a "stuffer" sequence) into the gene or its regulatory region, so as to disrupt the gene or regulatory region.
  • a single cleavage event by cleavage followed by non-homologous end joining, by cleavage at two sites followed by joining so as to delete the sequence between the two cleavage sites, by targeted recombination of a missense or nonsense codon into the coding region, or by targeted recombination of an irrelevant sequence (i.e., a "stuffer" sequence) into the gene or its regulatory region, so as to disrupt the gene or regulatory region
  • Targeted modification of chromatin structure can be used to facilitate the binding of fusion proteins to cellular chromatin.
  • one or more fusions between a TALE binding domain and a recombinase can be used, in addition to or instead of the TALE-cleavage domain fusions disclosed herein, to facilitate targeted
  • the disclosed methods and compositions are used to provide fusions of TALE repeat DNA-binding domains with transcriptional activation or repression domains that require dimerization (either homodimerization or
  • a fusion polypeptide comprises a TALE repeat DNA-binding domain and a functional domain monomer (e.g., a monomer from a dimeric transcriptional activation or repression domain). Binding of two such fusion polypeptides to properly situated target sites allows dimerization so as to reconstitute a functional transcription activation or repression domain.
  • Engineered TALE repeat array proteins can be used to engineer plants for traits such as increased disease resistance, modification of structural and storage
  • seed oils are composed primarily of triacylglycerols (TAGs), which are glycerol esters of fatty acids.
  • TAGs triacylglycerols
  • Commercial production of these vegetable oils is accounted for primarily by six major oil crops (soybean, oil palm, rapeseed, sunflower, cotton seed, and peanut).
  • Vegetable oils are used predominantly (90%) for human consumption as margarine, shortening, salad oils, and frying oil. The remaining 10% is used for non-food applications such as lubricants, oleochemicals, biofuels, detergents, and other industrial applications.
  • the desired characteristics of the oil used in each of these applications varies widely, particularly in terms of the chain length and number of double bonds present in the fatty acids making up the TAGs. These properties are manipulated by the plant in order to control membrane fluidity and temperature sensitivity. The same properties can be controlled using TALE repeat array proteins to produce oils with improved characteristics for food and industrial uses.
  • the primary fatty acids in the TAGs of oilseed crops are 16 to 18 carbons in length and contain 0 to 3 double bonds. Palmitic acid (16:0 [16 carbons: 0 double bonds]), oleic acid ( 18: 1), linoleic acid (18:2), and linolenic acid (18:3) predominate. The number of double bonds, or degree of saturation, determines the melting temperature, reactivity, cooking performance, and health attributes of the resulting oil.
  • delta- 12-oleate desaturase also referred to as omega-6 desaturase: A block at this step in the fatty acid desaturation pathway should result in the accumulation of oleic acid at the expense of polyunsaturates.
  • engineered TALE repeat array proteins are used to regulate expression of the FAD2-1 gene in soybeans.
  • Two genes encoding microsomal delta-6 desaturases have been cloned recently from soybean, and are referred to as FAD2-1 and FAD2-2 (Heppard et al., 1996, Plant Physiol. 110:311-319).
  • FAD2-1 delta-12 desaturase
  • Engineered TALE repeat array proteins can thus be used to modulate gene expression of FAD2-1 in plants.
  • engineered TALE repeat array proteins can be used to inhibit expression of the FAD2- 1 gene in soybean in order to increase the accumulation of oleic acid ( 18: 1) in the oil seed.
  • engineered TALE proteins can be used to modulate expression of any other plant gene, such as delta-9 desaturase, delta-12 desaturases from other plants, delta- 15 desaturase, acetyl-CoA carboxylase, acyl-ACP- thioesterase, ADP-glucose pyrophosphorylase, starch synthase, cellulose synthase, sucrose synthase, senescence-associated genes, heavy metal chelators, fatty acid hydroperoxide lyase, polygalacturonase, EPSP synthase, plant viral genes, plant fungal pathogen genes, and plant bacterial pathogen genes.
  • delta-9 desaturase delta-12 desaturases from other plants
  • delta- 15 desaturase acetyl-CoA carboxylase
  • acyl-ACP- thioesterase ADP-glucose pyrophosphorylase
  • starch synthase cellulose synthase
  • sucrose synthase sucrose synth
  • Recombinant DNA vectors suitable for transformation of plant cells are also used to deliver protein (e.g., engineered TALE repeat array protein)-encoding nucleic acids to plant cells.
  • protein e.g., engineered TALE repeat array protein
  • Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature (see, e.g., Weising et al., 1988, Ann. Rev. Genet., 22:421-477).
  • a DNA sequence coding for the desired TALE repeat array protein is combined with transcriptional and trans lational initiation regulatory sequences which will direct the transcription of the TALE protein in the intended tissues of the transformed plant.
  • a plant promoter fragment can be employed which will direct expression of the engineered TALE repeat array protein in all tissues of a regenerated plant.
  • Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation.
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35 S transcription initiation region, the ⁇ - or 2'-promoter derived from T-DNA of
  • Agrobacterium tumefaciens and other transcription initiation regions from various plant genes known to those of skill.
  • the plant promoter can direct expression of the engineered TALE repeat array protein in a specific tissue or can be otherwise under more precise environmental or developmental control.
  • Such promoters are referred to here as "inducible" promoters.
  • environmental conditions that can affect transcription by inducible promoters include anaerobic conditions or the presence of light.
  • promoters under developmental control include promoters that initiate transcription only in certain tissues, such as fruit, seeds, or flowers.
  • a polygalacturonase promoter can direct expression of the TALE repeat array protein in the fruit
  • a CHS-A (chalcone synthase A from petunia) promoter can direct expression of the TALE repeat array protein in the flower of a plant.
  • the vector comprising the TALE repeat array protein sequences will typically comprise a marker gene which confers a selectable phenotype on plant cells.
  • the marker can encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosulfuron or Basta.
  • DNA constructs can be introduced into the genome of the desired plant host by a variety of conventional techniques.
  • the DNA construct can be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using biolistic methods, such as DNA particle bombardment.
  • the DNA constructs can be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
  • Electroporation techniques are described in Fromm et al. 1985, Proc. Natl. Acad. Sci. USA, 82:5824. Biolistic transformation techniques are described in Klein et al., 1987, Nature, 327:70-73.
  • Agrobacterium tumefaciens-meditated transformation techniques are well described in the scientific literature (see, e.g., Horsch et al., 1984, Science, 233:496-498; and Fraley et al, 1983, Proc. Natl. Acad. Sci. USA, 80:4803).
  • Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired TALE repeat array protein-controlled phenotype.
  • Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the TALE repeat array protein nucleotide sequences.
  • Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176 (1983); and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73 (1985). Regeneration can also be obtained from plant callus, explants, organs, or parts thereof Such regeneration techniques are described generally in Klee et al., 1987, Ann. Rev. Plant Phys., 38:467-486.
  • Engineered TALE repeat array proteins also have use for assays to determine the phenotypic consequences and function of gene expression.
  • Recent advances in analytical techniques, coupled with focused mass sequencing efforts have created the opportunity to identify and characterize many more molecular targets than were previously available. This new information about genes and their functions will improve basic biological understanding and present many new targets for therapeutic intervention. In some cases analytical tools have not kept pace with the generation of new data.
  • An example is provided by recent advances in the measurement of global differential gene expression. These methods, typified by gene expression microarrays, differential cDNA cloning frequencies, subtractive hybridization and differential display methods, can very rapidly identify genes that are up or down-regulated in different tissues or in response to specific stimuli.
  • differentially expressed genes correlate with a given physiological phenomenon, but demonstrating a causative relationship between an individual differentially expressed gene and the phenomenon is labor intensive.
  • simple methods for assigning function to differentially expressed genes have not kept pace with the ability to monitor differential gene expression.
  • the engineered TALE repeat array proteins described herein can be used to rapidly analyze the iiinction of a differentially expressed gene.
  • Engineered TALE proteins can be readily used to up or down-regulate or knockout any endogenous target gene, or to knock in an endogenous or endogenous gene. Very little sequence information is required to create a gene-specific DNA binding domain. This makes the engineered TALE repeat array technology ideal for analysis of long lists of poorly characterized differentially expressed genes.
  • TALE repeat array protein-based DNA binding domain for each candidate gene, create chimeric up and down-regulating artificial transcription factors and test the consequence of up or down- regulation on the phenotype under study (e.g., transformation or response to a cytokine) by switching the candidate genes on or off one at a time in a model system.
  • engineered TALE repeat array proteins can be achieved by more conventional methods. This is because the production and/or function of engineered TALE repeat array proteins can be placed under small molecule control. Examples of this approach are provided by the Tet- On system, the ecdysone-regulated system and a system incorporating a chimeric factor including a mutant progesterone receptor. These systems are all capable of indirectly imparting small molecule control on any endogenous gene of interest or any transgene by placing the function and/or expression of a engineered TALE repeat array protein under small molecule control.
  • a further application of engineered TALE repeat array proteins is manipulating gene expression in animal models.
  • a heterologous gene into or knockout of an endogenous in a transgenic animal, such as a transgenic mouse or zebrafish, is a fairly straightforward process.
  • transgenic or transient expression of an engineered TALE repeat array protein in an animal can be readily performed.
  • a target gene of interest can be over- expressed.
  • a target gene of interest can be down-regulated, or even switched off to create "functional knockout”.
  • Knock-in or knockout mutations by insertion or deletion of a target gene of interest can be prepared using TALE nucleases.
  • Embryonic lethality results when the gene plays an essential role in development.
  • Developmental compensation is the substitution of a related gene product for the gene product being knocked out, and often results in a lack of a phenotype in a knockout mouse when the ablation of that gene's function would otherwise cause a physiological change.
  • transgenic engineered TALE repeat array proteins can be temporally controlled, for example using small molecule regulated systems as described in the previous section.
  • a gene can be over-expressed or
  • Example 1 Assembly of TALE Repeat Arrays using streptavidin coated magnetic beads
  • An archive of D A plasmids ( ⁇ 850 different plasmids) encoding one, two, three, or four TALE repeat domains was created for assembly of nucleic acids encoding multiple TALE arrays of any desired length.
  • the plasmids were created by cloning synthetic arrays of one, two, three or four TALE repeat domains into the pUC57-ABsaI backbone (FIG. 3).
  • the TALE repeats were of the arrangement ⁇ , ⁇ , ⁇ , ⁇ ', ⁇ , ⁇ ', and ⁇ , and included hypervariable triplet residues at each position to bind to the nucleotides as shown in Table 1.
  • Polypeptide and nucleotide sequences of the TALE repeat types are shown in FIGs. 4A and 4B, respectively.
  • the polypeptide and polynucleotide sequences were varied slightly among the four types to reduce the possibility of recombination-mediated mutations due to long sequences of exact repeats.
  • a 16-mer TALE repeat array targeted to the eGFP gene was created by in vitro assembly of 16 TALE repeats designed to bind the target sequence
  • a plasmid carrying an a- type TALE repeat with an NNN triplet was amplified by PCR using a biotinylated forward primer Biotin-TCTAGAGAAGACAAGAACCTGACC (SEQ ID NO: 42) and a reverse primer GGATCCGGTCTCTTAAGGCCGTGG (SEQ ID NO: 43).
  • the amplified fragment (50 ⁇ ) was purified using a QIA Quick PCR purification kit (QIAGEN), eluted in 40 ⁇ 0.
  • IX elution buffer (as provided in the QIA Quick PCR purification kit), and digested with Bsal HF (New England Biolabs (NEB)) in NEB Buffer 4 for 15 minutes at 50 °C (40 ⁇ elution, 5 ⁇ NEBuffer 4, 5 ⁇ Bsal HF).
  • Bsal HF New England Biolabs (NEB)
  • NEB Buffer 4 5 ⁇ Bsal HF
  • a plasmid containing a four TALE repeat domain sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, SNl, NNN, and SNG (designed to bind the sequence 5'-CAGT-3') was digested with Bbsl (NEB) in NEBuffer 2 for 2 hours at 37 °C in 100 ⁇ (50 ⁇ plasmid [-200 ng/ ⁇ ], 10 ⁇ NEBuffer 2, 10 ⁇ Bbsl, 30 ⁇ water).
  • DNA ligase 400 U/ ⁇ ; NEB and 27 ⁇ Quick Ligase Buffer (QLB) (NEB).
  • QLB Quick Ligase Buffer
  • Magnetic beads were prepared by washing 5 ⁇ of Dynabeads MyOne Streptavidin CI (Invitrogen) three times with 50 ⁇ lx B&W Buffer (5.0 mM Tris-HCl [pH 7.5], 0.5 mM EDTA, 1.0 M NaCl, 0.005% Tween 20) and resuspending in 54 ⁇ B&W Buffer.
  • the ligated mixture was added to the washed beads and incubated for 15 minutes at room temperature (with mixing every five minutes). The mixture was then placed on a SPRIplate 96-well Ring magnet for 3 minutes. The supernatant was then aspirated, and 100 ⁇ lx B&W Buffer was added to wash, with mixing by moving the beads 31 times from side to side within the tube using a DynaMag- 96 Side magnet (Invitrogen). The B&W Buffer was then aspirated, and 100 ⁇ lx BSA was added, with mixing, then aspirated.
  • the ligated, bead-bound nucleic acids ( ⁇ ) were resuspended in 50 ⁇ Bsal HF mix (5 ⁇ NEBuffer 4, 2 ⁇ Bsal HF, 43 ⁇ water).
  • the digest was incubated at 50 °C for 10 minutes, and 50 ⁇ IX B&W buffer was added. The digest was placed on a magnet for 3 minutes, and the supernatant was aspirated. The beads were washed with 100 ⁇ 1 X B&W Buffer and 100 ⁇ IX BSA as above. To the washed beads were added a digested plasmid containing a four TALE repeat domain sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids NNN, SHD, SNG, and SNG (designed to bind the DNA sequence 5'-GCTT-3') (22.5 ⁇ ) and 27.5 ⁇ ligase mix (25 ⁇ Quick Ligase Buffer, 2 ⁇ DNA ligase).
  • TALE repeat domain sub-array unit
  • the beads were resuspended by pipetting up and down, and the mixture was incubated for 15 minutes at room temperature with mixing every five minutes. To the ligation was added 50 ⁇ IX B&W Buffer, and the mixture was placed on the magnet for 3 minutes. The supernatant was aspirated, and the beads were washed with 100 ⁇ IX B&W Buffer and 100 ⁇ IX BSA as above.
  • the ligated, bead-bound nucleic acids ( ⁇ ) were resuspended in 50 ⁇ Bsal HF mix (5 ⁇ NEBuffer 4, 2 ⁇ Bsal HF, 43 ⁇ water).
  • TALE repeat sub-array units Two more TALE repeat sub-array units were ligated sequentially as above, the first a four TALE repeat sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, SNI, NNN, and SHD (designed to bind the DNA sequence 5 '-CAGC-3 ') and the second a three TALE repeat sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, NNN, and SHD (designed to bind the DNA sequence 5'-CGC-3').
  • the final TALE repeat array contained subunits of the format ⁇ with individual TALE repeats designed to bind the target DNA sequence 5'-GCAGTGCTTCAGCCGC-3' (SEQ ID NO: 44).
  • the construct was digested with Bsal HF for eventual cloning into an expression vector and the beads were washed with I X B&W Buffer and IX BSA.
  • the washed beads were resuspended in 50 ⁇ Bbsl mix (5 ⁇ NEBuffer 2, 5 ⁇ Bbsl, 40 ⁇ water) and incubated at 37 °C for 2 hours with agitation at 1500 rpm to cleave the biotinylated 5' end and release the assembled TALE repeat array from the magnetic beads.
  • the digested mixture was purified by MinElute column purified (QIAGEN) and ligated into a BsmBI-digested TALE expression vector.
  • the ligated mixture was transformed into chemically competent XLl Blue cells and plated on LB/Carb 100 plates overnight.
  • the expression vectors each harbor the following elements: a T7 promoter, a nuclear localization signal, a FLAG tag, amino acids 153 to 288 from the TALE 13 protein (numbering as defined by Miller et al., 2011, Nat. Biotechnol., 29: 143-148), two adjacent BsmBI restriction sites into which a DNA fragment encoding a TALE repeat array can be cloned, a 0.5 TALE repeat, amino acids 715 to 777 from the C-terminal end of the TALE13 protein (numbering as defined by Miller et al., 2011, Nat. Biotechnol, 29: 143-148), and the wild-type Fokl cleavage domain.
  • Plasmid pJDS70 encodes a 0.5 TALE repeat with a SNI RVD (for recognition of an A nucleotide)
  • plasmid pJDS71 encodes a 0.5 TALE repeat with a SHD RVD (for recognition of a C nucleotide)
  • plasmid pJDS74 encodes a 0.5 TALE repeat with a NNN RVD (for recognition of a G nucleotide)
  • plasmid pJDS76 encodes a 0.5 TALE repeat with a SNK RVD (for recognition of a G nucleotide)
  • plasmid pJDS78 encodes a 0.5 TALE repeat with a NG RVD (for recognition of a T nucleotide).
  • All plasmids share the common sequence shown in FIGs. 5A-5B and differ at just nine nucleotide positions marked as XXXXXXXX (underlined and bold). The sequence of these 9 bps and plasmid names are also shown below in Table 2.
  • This example demonstrates the construction of TALE repeat arrays on an immobilized substrate using preassembled TALE repeat sub-array units.
  • the above method, up to the cloning step, can be performed in one day.
  • TALE repeats are assembled using the archive of DNA plasmids (-850 different plasmids) as described in Example 1.
  • a 16-mer TALE repeat array was created by in vitro assembly of 16 TALE repeats designed to bind a target sequence.
  • a plasmid carrying an a-type TALE repeat with an NNN triplet (G) was amplified by PCR using a biotinylated forward primer Biotin-TCTAGAGAAGACAAGAACCTGACC (SEQ ID NO: 42) and a reverse primer GGATCCGGTCTCTTAAGGCCGTGG (SEQ ID NO: 43).
  • the amplified fragment (50 ⁇ ) was purified using a QIA Quick PCR purification kit (QIAGEN), eluted in 40 ⁇ 0.1 X elution buffer (as provided in the QIA Quick PCR purification kit), and digested with Bsal HF (New England Biolabs (NEB)) in NEB Buffer 4 for 15 minutes at 50 °C (40 ⁇ elution-, 5 ⁇ NEBuffer 4, 5 ⁇ Bsal HF).
  • the digested fragment was purified using a QIA Quick PCR purification kit and eluted in 0.1X elution buffer (50 ⁇ ).
  • a plasmid containing a four TALE repeat domain sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, SNI, NNN, and SNG (designed to bind the sequence 5'-CAGT-3') was digested with Bbsl (NEB) in NEBuffer 2 for 2 hours at 37 °C in 100 ⁇ (50 ⁇ plasmid [-200 ng/ ⁇ ], 10 ⁇ NEBuffer 2, 10 ⁇ Bbsl, 30 ⁇ water). To the 100 ⁇ digest was added 25 ⁇ NEBuffer 4, 2.5 ⁇ 100X BSA (NEB), 107.5 ⁇ water, and 5 ⁇ Xbal (NEB), and the digest was incubated for 5 minutes at 37 °C.
  • Bbsl Bbsl
  • DNA ligase 400 U/ ⁇ ; NEB and 27 ⁇ Quick Ligase Buffer (QLB) (NEB).
  • QLB Quick Ligase Buffer
  • Each well in the 96 well plate was washed with 200ul of lx Bovine Serum Albumin (BSA) by pipetting up and down 10 times before discarding the lx BSA.
  • BSA lx Bovine Serum Albumin
  • the digest was incubated at 50 °C for 10 minutes and then the supernatant was aspirated. The wells were then washed with 200 ⁇ I X B&W Buffer and 200 ⁇ I X BSA twice by pipetting up and down ten times before removal of each supernatant. 22.5 ⁇ of digested plasmid encoding a four TALE repeat domain sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids NNN, SHD, SNG, and SNI and 27.5 ⁇ ligase mix (25 ⁇ Quick Ligase Buffer, 2 ⁇ DNA ligase) were added to the well.
  • TALE repeat domain sub-array unit
  • the supernatant was mixed by pipetting up and down, and the mixture was incubated for 15 minutes at room temperature. The supernatant was removed and the well was washed with IX B&W and lx BSA as above. Then 50 ⁇ Bsal HF mix (5 ⁇ NEBuffer 4, 2 ⁇ Bsal HF, 43 ⁇ water) was added to the ligated nucleic acids
  • TALE repeat sub-array units Two more TALE repeat sub-array units were ligated sequentially as above, the first a four TALE repeat sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, SNI, NNN, and SNG and the second a three TALE repeat sub-array unit ( ⁇ ) coding for repeats that each harbor one of the following variable amino acids SHD, SNI, NNN, and SHD.
  • the final TALE repeat array contained subunits of the format ⁇ with individual TALE repeats designed to bind a target DNA sequence.
  • the fragments in the well were digested with Bsal HF for eventual cloning into an expression vector.
  • the well was then washed with 1 X B&W Buffer and twice with IX BSA.
  • 50 ⁇ Bbsl mix (5 ⁇ NEBuffer 2, 5 ⁇ Bbsl, 40 ⁇ water) was added to the well and incubated at 37 °C for 2 hours to cleave the biotinylated 5' end and release the assembled TALE repeat array from the well.
  • the digested mixture was purified, ligated, and transformed as described in Example 1.
  • TALE repeat arrays were constructed and cloned into TALE nuclease expression vectors (as described in Example 1) to produce plasmids encoding TALE nuclease monomers targeted to the eGFP coding sequences shown in FIG. 6 and Table 3.
  • Nucleic acid and polypeptide sequences of the TALE nuclease monomers are shown in FIGs. 11A-18B. Table 3.
  • NHEJ Non-homologous end joining
  • FIG. 8 Sequences targeted by the TALE nucleases encoded by expression plasmids SQT70/SQT56 in human USOS-eGFP cells are underlined in the wild-type (WT) sequence shown at the top of FIG. 8. Insertion and deletion mutations induced by the TALE nuclease pair are shown below with deleted bases indicated by dashes and inserted bases indicated by double underlining. The net number of bases inserted or deleted is shown to the right. All mutations were isolated once unless otherwise indicated in brackets. The overall frequency of mutagenesis (46%) is also indicated.
  • Example 1 The assembly method described in Example 1 has been automated so as to be performed using a ScicloneTM G3 liquid handling workstation (Caliper Life Sciences, Hopkinton, MA) in 96-well plates. All of the steps were automated except digestion of the nucleic acids prior to ligation and linking to the beads and the steps following release of the assembled TALE repeat array from the magnetic beads. The automated steps were performed essentially as when done manually with minor variations in the number of resuspension and mixing motions. The results of assembly of two 17-mers are shown in FIG. 9. A major product of the expected size can be seen, corresponding to the 17-mer. Additional minor 13-mer, 9-mer, and 5-mer products can also be seen, likely produced by carry forward of incompletely ligated products.
  • FIG. 10 shows the results of assembly of 16-mers from an N-terminal 1-mer sub-array (1), three 4-mer subarrays (4A, 4B, 4C), and a C-terminal 3-mer subarray (3D).
  • TALE repeat arrays were created using an architecture in which four distinct TALE repeat backbones that differ slightly in their amino acid and DNA sequences occur in a repeated pattern.
  • the first, amino-terminal TALE repeat in an array was designated as the a unit. This was followed by ⁇ , ⁇ , and ⁇ units and then an ⁇ unit that is essentially identical to the a unit except for the different positioning of a Type IIS restriction site on the 5' end (required to enable creation of a unique overhang on the a unit needed for cloning).
  • the ⁇ unit was then followed again by repeats of ⁇ , ⁇ , ⁇ , and ⁇ units.
  • AAACCGTGCAAAGGTTGTTGCCGG TCCTTTGTCAAGACCACGGCCTTA AGAGACCGGATCC TCTAGAGAAGACAACTGACTCCCG ATCAAGTTGTAGCGATTGCGTCGA ACATTGGAGGGAAACAAGCATTGG
  • TAL011/016/025/026 AATA NI/NI/NG/NI ⁇ TAL011/016/025/027 AATC Nl / 'NI/NG/HD ⁇
  • TAL012/016/024/029 CAGG HD/NI/NN/NN ⁇ TAL012/016/024/030 CAGT HD/NI/NN/NG ⁇
  • TAL013/019/025/029 GGTG NK/NN/NG/NN .
  • TAL013/019/025/030 GGTT NK/NN/NG/NG ⁇
  • TAL014/018/022/026 GGCA NN/NK/HD/NI ⁇ TAL014/018/022/027 GGCC NN/NK/HD/HD ⁇
  • TAL015/016/023/028 TAGG NG/NI/NK/N
  • TAL015/016/023/029 TAGG NG/NI/NK/NN
  • TAL015/018/021/029 TGAG NG/NK/NI/NN
  • TAL015/018/021/030 TGAT NG/NK/NI/NG ⁇

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2012/046451 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly Ceased WO2013012674A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA2841710A CA2841710C (en) 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly
EP12814750.1A EP2732038B1 (en) 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly
AU2012284365A AU2012284365B2 (en) 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly
EP18191841.8A EP3461896B1 (en) 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly
US14/232,067 US20140274812A1 (en) 2011-07-15 2012-07-12 Methods of Transcription Activator Like Effector Assembly
JP2014520317A JP6214530B2 (ja) 2011-07-15 2012-07-12 転写活性化因子様エフェクターの組立て方法
US15/156,574 US10273271B2 (en) 2011-07-15 2016-05-17 Methods of transcription activator like effector assembly
AU2017204819A AU2017204819A1 (en) 2011-07-15 2017-07-13 Methods of transcription activator like effector assembly
US16/283,380 US11472849B2 (en) 2011-07-15 2019-02-22 Methods of transcription activator like effector assembly
AU2019226213A AU2019226213A1 (en) 2011-07-15 2019-09-06 Methods of transcription activator like effector assembly

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US201161508366P 2011-07-15 2011-07-15
US61/508,366 2011-07-15
US201261601409P 2012-02-21 2012-02-21
US61/601,409 2012-02-21
US201261610212P 2012-03-13 2012-03-13
US61/610,212 2012-03-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/232,067 A-371-Of-International US20140274812A1 (en) 2011-07-15 2012-07-12 Methods of Transcription Activator Like Effector Assembly
US15/156,574 Continuation US10273271B2 (en) 2011-07-15 2016-05-17 Methods of transcription activator like effector assembly

Publications (1)

Publication Number Publication Date
WO2013012674A1 true WO2013012674A1 (en) 2013-01-24

Family

ID=47558397

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/046451 Ceased WO2013012674A1 (en) 2011-07-15 2012-07-12 Methods of transcription activator like effector assembly

Country Status (6)

Country Link
US (3) US20140274812A1 (enExample)
EP (2) EP2732038B1 (enExample)
JP (3) JP6214530B2 (enExample)
AU (3) AU2012284365B2 (enExample)
CA (1) CA2841710C (enExample)
WO (1) WO2013012674A1 (enExample)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103789840A (zh) * 2014-02-07 2014-05-14 赛业(广州)生物科技有限公司 一种tale聚体库的构建方法
WO2014124284A1 (en) * 2013-02-07 2014-08-14 The General Hospital Corporation Tale transcriptional activators
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
WO2015173436A1 (en) * 2014-05-16 2015-11-19 Vrije Universiteit Brussel Genetic correction of myotonic dystrophy type 1
WO2015153889A3 (en) * 2014-04-02 2015-12-10 University Of Florida Research Foundation, Incorporated Materials and methods for the treatment of latent viral infection
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
JP2016512264A (ja) * 2013-03-15 2016-04-25 ザ ジェネラル ホスピタル コーポレイション 特定のゲノム遺伝子座へのゲノムおよびエピゲノム調節タンパク質のrna誘導型標的化
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US10011850B2 (en) 2013-06-21 2018-07-03 The General Hospital Corporation Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10273271B2 (en) 2011-07-15 2019-04-30 The General Hospital Corporation Methods of transcription activator like effector assembly
WO2019140353A1 (en) * 2018-01-12 2019-07-18 Camena Bioscience Limited Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
US10526589B2 (en) 2013-03-15 2020-01-07 The General Hospital Corporation Multiplex guide RNAs
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11851690B2 (en) 2017-03-14 2023-12-26 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US11891631B2 (en) 2012-10-12 2024-02-06 The General Hospital Corporation Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12460231B2 (en) 2014-04-02 2025-11-04 Editas Medicine, Inc. Crispr/CAS-related methods and compositions for treating primary open angle glaucoma
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2737066B1 (en) * 2011-07-29 2017-11-08 Cellectis High throughput method for assembly and cloning polynucleotides comprising highly similar polynucleotidic modules
US9840542B2 (en) * 2015-09-11 2017-12-12 Nomadogen Biotechnologies Inc. Methods and compositions for the packaging of nucleic acids into microglial exosomes for the targeted expression of polypeptides in neural cells
WO2019173728A1 (en) * 2018-03-09 2019-09-12 Lee Hye Young Crispr-nanoparticles and methods of use in brain disorders
WO2019204643A2 (en) 2018-04-18 2019-10-24 Altius Institute For Biomedical Sciences Animal pathogen-derived polypeptides and uses thereof for genetic engineering
EP3814493A4 (en) 2018-06-27 2022-03-30 Altius Institute For Biomedical Sciences NUCLEIC ACID BINDING DOMAINS AND METHODS OF USE THEREOF

Citations (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4603044A (en) 1983-01-06 1986-07-29 Technology Unlimited, Inc. Hepatocyte Directed Vesicle delivery system
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4957773A (en) 1989-02-13 1990-09-18 Syracuse University Deposition of boron-containing films from decaborane
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
WO1991017424A1 (en) 1990-05-03 1991-11-14 Vical, Inc. Intracellular delivery of biologically active substances by means of self-assembling lipid complexes
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
WO1994026877A1 (en) 1993-05-17 1994-11-24 The Regents Of The University Of California Ribozyme gene therapy for hiv infection and aids
US5681559A (en) 1993-08-25 1997-10-28 Systemix, Inc. Method for producing a highly enriched population of hematopoietic stem cells
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
WO2001053480A1 (en) 2000-01-24 2001-07-26 Sangamo Biosciences, Inc. Nucleic acid binding polypeptides characterized by flexible linkers connected nucleic acid binding modules
WO2001083793A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
US6335195B1 (en) 1997-01-28 2002-01-01 Maret Corporation Method for promoting hematopoietic and mesenchymal cell proliferation and differentiation
WO2002057308A2 (en) 2001-01-22 2002-07-25 Sangamo Biosciences, Inc. Zinc finger polypeptides and their use
US20020119498A1 (en) 2000-05-16 2002-08-29 Joung J. Keith Methods and compositions for interaction trap assays
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US20020160940A1 (en) 1999-01-12 2002-10-31 Case Casey C. Modulation of endogenous gene expression in cells
US20020164575A1 (en) 1999-09-14 2002-11-07 Sangamo Biosciences, Inc., A Delaware Corporation Gene identification
US6492117B1 (en) 2000-07-12 2002-12-10 Gendaq Limited Zinc finger polypeptides capable of binding DNA quadruplexes
WO2002099084A2 (en) 2001-04-04 2002-12-12 Gendaq Limited Composite binding polypeptides
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6511808B2 (en) 2000-04-28 2003-01-28 Sangamo Biosciences, Inc. Methods for designing exogenous regulatory molecules
US6645489B2 (en) 1997-09-25 2003-11-11 Cytomatrix, Llc Methods and devices for the long-term culture of hematopoietic progenitor cells
US6667064B2 (en) 2000-08-30 2003-12-23 Pilot Therapeutics, Inc. Composition and method for treatment of hypertriglyceridemia
WO2005115850A1 (en) 2004-05-20 2005-12-08 Graham Packaging Pet Technologies, Inc. Molded plastic hot-fill container and method of manufacture
US20080131962A1 (en) 2006-05-25 2008-06-05 Sangamo Biosciences, Inc. Engineered cleavage half-domains
WO2011017293A2 (en) * 2009-08-03 2011-02-10 The General Hospital Corporation Engineering of zinc finger arrays by context-dependent assembly
WO2011072246A2 (en) * 2009-12-10 2011-06-16 Regents Of The University Of Minnesota Tal effector-mediated dna modification

Family Cites Families (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6900306B2 (en) 2001-08-01 2005-05-31 Isis Pharmaceuticals, Inc. Antisense modulation of CoREST expression
JPH07507201A (ja) 1992-03-10 1995-08-10 ザ ガバメント オブ ザ ユナイテッド ステイツ オブ アメリカ,アズ レプリゼンテッド バイ ザ セクレタリー,デパートメント オブ ヘルス アンド ヒューマン サービシーズ 可変鋳型反応
DE4343591A1 (de) 1993-12-21 1995-06-22 Evotec Biosystems Gmbh Verfahren zum evolutiven Design und Synthese funktionaler Polymere auf der Basis von Formenelementen und Formencodes
GB9618544D0 (en) 1996-09-05 1996-10-16 Brax Genomics Ltd Characterising DNA
DE19812103A1 (de) 1998-03-19 1999-09-23 Bernauer Annette Verfahren zur Synthese von Nucleinsäuremolekülen
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
DE19925862A1 (de) 1999-06-07 2000-12-14 Diavir Gmbh Verfahren zur Synthese von DNA-Fragmenten
US8137906B2 (en) * 1999-06-07 2012-03-20 Sloning Biotechnology Gmbh Method for the synthesis of DNA fragments
ATE374249T1 (de) 2000-04-28 2007-10-15 Sangamo Biosciences Inc Datenbanken von regulatorischen sequenzen, methoden zu ihrer herstellung und verwendung
EP1276865B1 (en) 2000-04-28 2014-05-21 Sangamo BioSciences, Inc. Methods for binding an exogenous molecule to cellular chromatin
JP2002262870A (ja) * 2000-11-09 2002-09-17 Nara Institute Of Science & Technology 固相において二本鎖dna分子を順次連結する方法およびその装置
WO2004099366A2 (en) 2002-10-23 2004-11-18 The General Hospital Corporation Context sensitive parallel optimization of zinc finger dna binding domains
US7741086B2 (en) 2004-12-16 2010-06-22 President And Fellows Of Harvard College Histone demethylation mediated by the nuclear amine oxidase homolog LSD1
CA2622615A1 (en) 2005-10-28 2007-05-10 The University Of North Carolina At Chapel Hill Protein demethylases comprising a jmjc domain
GB0607063D0 (en) 2006-04-07 2006-05-17 Cellcentric Ltd Compositions and methods for epigenetic modification of nucleic acid sequences in vivo
CN101815722B (zh) 2007-09-28 2015-11-25 双刃基金会 Bs3抗性基因和使用方法
AU2009243187C1 (en) 2008-04-28 2015-12-24 President And Fellows Of Harvard College Supercharged proteins for cell penetration
US10316288B2 (en) 2008-04-30 2019-06-11 Sanbio, Inc. Neural regenerating cells with alterations in DNA methylation
WO2010037001A2 (en) 2008-09-26 2010-04-01 Immune Disease Institute, Inc. Selective oxidation of 5-methylcytosine by tet-family proteins
WO2010054348A2 (en) 2008-11-10 2010-05-14 Two Blades Foundation Pathogen-inducible promoters and their use in enhancing the disease resistance of plants
EP2206723A1 (en) 2009-01-12 2010-07-14 Bonas, Ulla Modular DNA-binding domains
US9221886B2 (en) 2009-04-28 2015-12-29 President And Fellows Of Harvard College Supercharged proteins for cell penetration
KR20120038020A (ko) 2009-08-11 2012-04-20 상가모 바이오사이언스 인코포레이티드 표적화 변형에 대한 동형접합성 유기체
US8889394B2 (en) 2009-09-07 2014-11-18 Empire Technology Development Llc Multiple domain proteins
CA2788560A1 (en) 2010-02-08 2011-08-11 Sangamo Biosciences, Inc. Engineered cleavage half-domains
CN103025344B (zh) * 2010-05-17 2016-06-29 桑格摩生物科学股份有限公司 新型dna-结合蛋白及其用途
KR101982360B1 (ko) * 2011-04-05 2019-05-24 셀렉티스 콤팩트 tale-뉴클레아제의 발생 방법 및 이의 용도
CA2841710C (en) 2011-07-15 2021-03-16 The General Hospital Corporation Methods of transcription activator like effector assembly
EP2737066B1 (en) * 2011-07-29 2017-11-08 Cellectis High throughput method for assembly and cloning polynucleotides comprising highly similar polynucleotidic modules
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
CN105188767A (zh) 2012-07-25 2015-12-23 布罗德研究所有限公司 可诱导的dna结合蛋白和基因组干扰工具及其应用
EP3789405A1 (en) 2012-10-12 2021-03-10 The General Hospital Corporation Transcription activator-like effector (tale) - lysine-specific demethylase 1 (lsd1) fusion proteins
EP2954042B1 (en) 2013-02-07 2017-12-06 The General Hospital Corporation Tale transcriptional activators
US9885033B2 (en) 2013-03-15 2018-02-06 The General Hospital Corporation Increasing specificity for RNA-guided genome editing

Patent Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4217344A (en) 1976-06-23 1980-08-12 L'oreal Compositions containing aqueous dispersions of lipid spheres
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
US4186183A (en) 1978-03-29 1980-01-29 The United States Of America As Represented By The Secretary Of The Army Liposome carriers in chemotherapy of leishmaniasis
US4261975A (en) 1979-09-19 1981-04-14 Merck & Co., Inc. Viral liposome particle
US4485054A (en) 1982-10-04 1984-11-27 Lipoderm Pharmaceuticals Limited Method of encapsulating biologically active materials in multilamellar lipid vesicles (MLV)
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4603044A (en) 1983-01-06 1986-07-29 Technology Unlimited, Inc. Hepatocyte Directed Vesicle delivery system
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4946787A (en) 1985-01-07 1990-08-07 Syntex (U.S.A.) Inc. N-(ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US5049386A (en) 1985-01-07 1991-09-17 Syntex (U.S.A.) Inc. N-ω,(ω-1)-dialkyloxy)- and N-(ω,(ω-1)-dialkenyloxy)Alk-1-YL-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US4774085A (en) 1985-07-09 1988-09-27 501 Board of Regents, Univ. of Texas Pharmaceutical administration systems containing a mixture of immunomodulators
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US4957773A (en) 1989-02-13 1990-09-18 Syracuse University Deposition of boron-containing films from decaborane
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
WO1991016024A1 (en) 1990-04-19 1991-10-31 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
WO1991017424A1 (en) 1990-05-03 1991-11-14 Vical, Inc. Intracellular delivery of biologically active substances by means of self-assembling lipid complexes
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
WO1994026877A1 (en) 1993-05-17 1994-11-24 The Regents Of The University Of California Ribozyme gene therapy for hiv infection and aids
US5681559A (en) 1993-08-25 1997-10-28 Systemix, Inc. Method for producing a highly enriched population of hematopoietic stem cells
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
US6013453A (en) 1994-08-20 2000-01-11 Medical Research Council Binding proteins for recognition of DNA
US6335195B1 (en) 1997-01-28 2002-01-01 Maret Corporation Method for promoting hematopoietic and mesenchymal cell proliferation and differentiation
US6645489B2 (en) 1997-09-25 2003-11-11 Cytomatrix, Llc Methods and devices for the long-term culture of hematopoietic progenitor cells
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US20020160940A1 (en) 1999-01-12 2002-10-31 Case Casey C. Modulation of endogenous gene expression in cells
US20020164575A1 (en) 1999-09-14 2002-11-07 Sangamo Biosciences, Inc., A Delaware Corporation Gene identification
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
WO2001053480A1 (en) 2000-01-24 2001-07-26 Sangamo Biosciences, Inc. Nucleic acid binding polypeptides characterized by flexible linkers connected nucleic acid binding modules
WO2001083793A2 (en) 2000-04-28 2001-11-08 Sangamo Biosciences, Inc. Targeted modification of chromatin structure
US6511808B2 (en) 2000-04-28 2003-01-28 Sangamo Biosciences, Inc. Methods for designing exogenous regulatory molecules
US20020119498A1 (en) 2000-05-16 2002-08-29 Joung J. Keith Methods and compositions for interaction trap assays
US6492117B1 (en) 2000-07-12 2002-12-10 Gendaq Limited Zinc finger polypeptides capable of binding DNA quadruplexes
US6667064B2 (en) 2000-08-30 2003-12-23 Pilot Therapeutics, Inc. Composition and method for treatment of hypertriglyceridemia
WO2002057308A2 (en) 2001-01-22 2002-07-25 Sangamo Biosciences, Inc. Zinc finger polypeptides and their use
WO2002099084A2 (en) 2001-04-04 2002-12-12 Gendaq Limited Composite binding polypeptides
WO2005115850A1 (en) 2004-05-20 2005-12-08 Graham Packaging Pet Technologies, Inc. Molded plastic hot-fill container and method of manufacture
US20080131962A1 (en) 2006-05-25 2008-06-05 Sangamo Biosciences, Inc. Engineered cleavage half-domains
WO2011017293A2 (en) * 2009-08-03 2011-02-10 The General Hospital Corporation Engineering of zinc finger arrays by context-dependent assembly
WO2011072246A2 (en) * 2009-12-10 2011-06-16 Regents Of The University Of Minnesota Tal effector-mediated dna modification

Non-Patent Citations (160)

* Cited by examiner, † Cited by third party
Title
"Fundamental Virology", 2001
"Liposomes", 1983
"Remington: The Science and Practice of Pharmacy", 2005
"Virology", 1988
AHMAD ET AL., CANCER RES., vol. 52, 1992, pages 4817 - 20
AKOPIAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 100, 2003, pages 8688 - 8691
ALVAREZ ET AL., HUM. GENE THER., vol. 5, 1997, pages 597 - 613
ANDERSON, SCIENCE, vol. 256, 1992, pages 808 - 813
ARORA ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 3334 - 41
ASLANIDIS ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 6069 - 74
BEHR ET AL., BIOCONJUGATE CHEM, vol. 5, 1994, pages 382 - 389
BIBIKOVA ET AL., MOL. CELL. BIOL., vol. 21, 2001, pages 289 - 297
BIBIKOVA ET AL., SCIENCE, vol. 300, 2003, pages 764
BINDING: "Regeneration of Plants", PLANT PROTOPLASTS, 1985, pages 21 - 73
BIOCHEMISTRY, vol. 28, 1989, pages 908
BLAESE ET AL., CANCER GENE THER., vol. 2, 1995, pages 291 - 297
BLAESE ET AL., SCIENCE, vol. 270, 1995, pages 475 - 480
BOCH ET AL., SCIENCE, vol. 326, 2009, pages 1509 - 1512
BRIGGS ET AL., NUCLEIC ACIDS RES, 2012
BUCHSCHER ET AL., J. VIROL., vol. 66, 1992, pages 2731 - 39
CADE ET AL., NUCLEIC ACIDS RES., 2012
CARBONETTI ET AL., ABSTR. ANNU. MEET. AM. SOC. MICROBIOL., vol. 95, 1995, pages 295
CARON ET AL., MOL THER., vol. 3, 2001, pages 310 - 318
CARUSO ET AL., ELECTROPHORESIS, vol. 24, no. 1-2, 2003, pages 78 - 85
CERMAK ET AL., NUCL. ACIDS RES., vol. 39, 2011, pages E82
CERMAK ET AL., NUCLEIC ACIDS RES., vol. 39, 2011, pages E82
CHRISTIAN M.: "Targeting DNA double-strand breaks with TAL effector nucleases", GENETICS, vol. 186, no. 2, 2010, pages 757 - 761, XP002632806 *
CLARK-CURTISS; CURTISS ET AL.: "Methods in Enzymology", vol. 101, 1983, pages: 347 - 362
COFFMAN ET AL., J. IMMUNOL., vol. 151, 1993, pages 425 - 35
COLLEY ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 17619 - 22
CRYSTAL, SCIENCE, vol. 270, 1995, pages 404 - 410
DAVIS, MOL. REPROD. DEV., vol. 42, 1995, pages 459 - 67
DEAMER; BANGHAM, BIOCHIM. BIOPHYS. ACTA, vol. 443, 1976, pages 629 - 634
DEROSSI ET AL., J. BIOL. CHEM, vol. 269, 1994, pages 10444
DESHAYES ET AL., CELL. MOL. LIFE SCI., vol. 62, 2005, pages 1839 - 49
DEUTSCHER: "Methods in Enzymology", vol. 182, 1990, article "Guide to Protein Purification"
DILLON, TIBTECH, vol. 11, 1993, pages 167 - 175
DONNELLY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 3530 - 34
DRANOFFET, HUM. GENE THER., vol. 1, 1997, pages 111 - 112
DUNBAR ET AL., BLOOD, vol. 85, 1995, pages 3048
EL-ANDALOUSSI ET AL., CURR. PHARM. DES., vol. 11, 2005, pages 3597 - 3611
ELLEM ET AL., IMMUNOL IMMUNOTHER., vol. 44, 1997, pages 10 - 20
ELLIOT; O'HARE, CELL, vol. 88, 1997, pages 223 - 233
ENDOH ET AL., METHODS MOL. BIOL., vol. 623, 2010, pages 271 - 281
EVANS ET AL.: "Handbook of Plant Cell Culture", 1983, article "Protoplasts Isolation and Culture", pages: 124 - 176
FAHRAEUS ET AL., CURR. BIOL., vol. 6, 1996, pages 84
FRALEY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 76, 1979, pages 3348 - 52
FRALEY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 80, 1983, pages 4803
FRESHNEY ET AL.: "A Manual of Basic Technique", 2005, article "Culture of Animal Cells"
FROMM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 5824
FUTAKI, BIOPOLYMERS, vol. 84, 2006, pages 241 - 249
GAO ET AL., GENE THER., vol. 2, pages 710 - 722
GARCIA-BUSTOS ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1071, 1991, pages 83 - 101
GOSSEN & BUJARD, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547
GREGORIADIS, LIPOSOME TECHNOLOGY, 1984
GU ET AL., NATURE, vol. 435, 2005, pages 1122
HADDADA ET AL.: "Current Topics in Microbiology and Immunology", 1995
HAN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 9747 - 51
HEPPARD ET AL., PLANT PHYSIOL, vol. 110, 1996, pages 311 - 319
HERMONAT; MUZYCZKA, PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466 - 70
HOPE ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 812, 1985, pages 55 - 65
HOPE ET AL., CHEM. PHYS. LIP., vol. 40, 1986, pages 89
HOPP ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1204 10
HORSCH ET AL., SCIENCE, vol. 233, 1984, pages 496 - 498
HUBER ET AL., ANAL. CHEM., vol. 67, 1995, pages 578 - 585
INABA ET AL., J. EXP. MED., vol. 176, 1992, pages 1693 - 1702
JOHANN ET AL., J. VIROL., vol. 66, 1992, pages 1635 - 40
JOUNG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 7382
KAY ET AL., SCIENCE, vol. 318, 2007, pages 648
KEARNS ET AL., GENE THER., vol. 9, 1996, pages 748 - 55
KIM ET AL., GENOME RES., vol. 19, 2009, pages 1279 - 88
KIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 6, 1996, pages 1156 - 60
KIM ET AL., PROC. NATL. ACAD. SCI., vol. 93, 1996, pages 1156 - 60
KLEE ET AL., ANN. REV. PLANT PHYS., vol. 38, 1987, pages 467 - 486
KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73
KLIMPEL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10277 - 81
KOHN ET AL., NAT. MED., vol. 1, 1995, pages 1017
KOLLER ET AL., SCIENCE, vol. 248, 1990, pages 1227 - 30
KOTIN, HUM. GENE THER., vol. 5, 1994, pages 793 - 801
KREMER; PERRICAUDET, BR. MED. BULL., vol. 51, 1995, pages 31 - 44
LANGEL: "Cell-Penetrating Peptides: Processes and Applications", 2002, CRC PRESS
LASIC, LIPOSOMES: FROM PHYSICS TO APPLICATIONS, 1993
LEONETTI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 2448 - 51
LI T. ET AL.: "TAL nucleases (TALNs): hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain", NUCLEIC ACIDS RESEARCH, vol. 39, no. 1, 2011, pages 359 - 372, XP002632807 *
LIN ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 14255 - 58
LUTZ-FREYERINUTH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 6393 97
MAEDER ET AL., MOL. CELL, vol. 31, 2008, pages 294 - 301
MAEDER ET AL., NAT. PROTOC., vol. 4, 2009, pages 1471 - 1501
MALECH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1997, pages 12133 - 38
MARKMANN ET AL., TRANSPLANTATION, vol. 54, 1992, pages 1085 - 89
MARTIN ET AL., SCIENCE, vol. 255, 1992, pages 192 194
MAYER ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 858, 1986, pages 161 - 168
MILLER ET AL., J. VIROL., vol. 65, 1991, pages 2220 - 24
MILLER ET AL., NAT. BIOTECHNOL., vol. 29, 2011, pages 143 - 148
MILLER J.C. ET AL.: "A TALE nuclease architecture for efficient genome editing", NATURE BIOTECHNOLOGY, vol. 29, no. 2, 2011, pages 143 - 148, XP002685898 *
MILLER, NATURE, vol. 357, 1992, pages 455 - 460
MITANI; CASKEY, TIBTECH, vol. 11, 1993, pages 162 - 166
MOORE ET AL., PLOS ONE, 2012
MORBITZER R. ET AL.: "Assembly of custom TALE-type DNA binding domains by modular cloning", NUCLEIC ACIDS RESEARCH, vol. 39, no. 13, 2011, pages 5790 - 5799, XP002689132 *
MORRISON, J. BACTERIOL., vol. 132, 1977, pages 349 - 351
MOSCOU ET AL., SCIENCE, vol. 326, 2009, pages 1501
MUSSOLINO ET AL., NUCLEIC ACIDS RES., vol. 39, 2011, pages 9283 - 93
MUZYCZKA, J. CLIN. INVEST., vol. 94, 1994, pages 1351
NABEL; FELGNER, TIBTECH, vol. 11, 1993, pages 211 - 217
NEERING ET AL., BLOOD, vol. 88, 1996, pages 1147 - 55
NOVAK ET AL., J. BIOL. CHEM., vol. 267, 1992, pages 17186 - 93
OLIGINO ET AL., GENE THER., vol. 5, 1998, pages 491 - 496
ORLANDO ET AL., NUCL. ACIDS RES., 2010, pages 1 - 15
PALVA ET AL., GENE, vol. 22, 1983, pages 229 - 235
PASZKOWSKI ET AL., EMBO J., vol. 3, 1984, pages 2717 - 22
PERELLE ET AL., INFECT. IMMUN., vol. 61, 1993, pages 5147 - 56
PORTEUS ET AL., SCIENCE, vol. 300, 2003, pages 763
PORTEUS; BALTIMORE, SCIENCE, vol. 300, 2003, pages 763
PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 7851
PROCHIANTZ, CURR. OPIN. NEUROBIOL., vol. 6, 1996, pages 629 - 634
REMY ET AL., BIOCONJUGATE CHEM., vol. 5, 1994, pages 647 - 654
RENDAHL ET AL., NAT. BIOTECHNOL., vol. 16, 1998, pages 757 - 761
RENNEISEN ET AL., J. BIOL. CHEM, vol. 265, 1990, pages 16337 - 42
ROMER ET AL., SCIENCE, vol. 318, 2007, pages 645
ROSENECKER ET AL., INFECTION, vol. 24, 1996, pages 15 - 10
RUBEN ET AL., SCIENCE, vol. 251, 1991, pages 1490 - 93
SADOWSKI ET AL., NATURE, vol. 335, 1988, pages 563 - 564
SAMBROOK ET AL.: "Molecular Cloning 3d ed.", 2001, article "A Laboratory Manual"
SAMBROOK ET AL.: "Molecular Cloning; A Laboratory Manual 3d ed.", 2001
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 28
SCHMIDT ET AL., FEBS LETT., vol. 584, 2010, pages 1806 - 13
SCHONTHAL; SEMIN, CANCER BIOL, vol. 6, 1995, pages 239 - 48
SCHORNACK ET AL., J. PLANT PHYSIOL., vol. 163, 2006, pages 256
SEBO ET AL., INFECT. IMMUN., vol. 63, 1995, pages 3851 - 57
See also references of EP2732038A1
SIPIONE ET AL., DIABETOLOGIA, vol. 47, 2004, pages 499 - 508
SKINNER ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 15163 - 66
SOMMERFELT ET AL., VIROLOLGY, vol. 176, 1990, pages 58 - 59
STENMARK ET AL., J. CELL BIOL., vol. 113, 1991, pages 1025 - 32
STERMAN ET AL., HUM. GENE THER, vol. 7, 1998, pages 1083 - 89
STERMAN ET AL., HUM. GENE THER., vol. 7, 1998, pages 1083 - 89
STERMAN ET AL., HUM. GENE THER., vol. 9, no. 7, 1998, pages 1083 - 89
SUGIO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 104, 2007, pages 10720
SZOKA ET AL., ANNU. REV. BIOPHYS. BIOENG., vol. 9, 1980, pages 467
THIESEN ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 3996
TING ET AL., NUCLEIC ACIDS RES, vol. 39, no. 14, 2011, pages 6315 - 6325
TOPF ET AL., GENE THER., vol. 5, 1998, pages 507 - 513
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072 - 81
TRATSCHIN ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 3251 - 60
URNOV ET AL., NATURE, vol. 435, 2005, pages 646 - 651
VAN BRUNT, BIOTECHNOLOGY, vol. 6, 1988, pages 1149 - 54
VAN DER BRULLE ET AL., BIOTECHNIQUES, vol. 45, no. 3, September 2008 (2008-09-01), pages 340 - 343
VIGNE, RESTORAT. NEUROL. NEUROSCI., vol. 8, 1995, pages 35 - 36
VOGELSTEIN; KINZLER, NAT. MED., vol. 10, 2004, pages 789 - 799
WAGNER ET AL., LANCET, vol. 351, 1998, pages 1702 - 1703
WANG ET AL., GENE THER., vol. 4, 1997, pages 432 - 441
WEISING ET AL., ANN. REV. GENET., vol. 22, 1988, pages 421 - 477
WELSH ET AL., HUM. GENE THER., vol. 2, 1995, pages 205 - 218
WEST ET AL., VIROLOGY, vol. 160, 1987, pages 38 - 47
WILLIAMS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 242 - 246
WILSON ET AL., J. VIROL., vol. 63, 1989, pages 2374 - 78
WRIGHT ET AL., NAT. PROTOC, vol. 1, 2006, pages 1637 - 52
XU ET AL., NAT. GENET., vol. 17, 1997, pages 376 - 378
YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 10503
YU ET AL., GENE THER., vol. 1, 1994, pages 13 - 26

Cited By (134)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10273271B2 (en) 2011-07-15 2019-04-30 The General Hospital Corporation Methods of transcription activator like effector assembly
US11472849B2 (en) 2011-07-15 2022-10-18 The General Hospital Corporation Methods of transcription activator like effector assembly
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US9322006B2 (en) 2011-07-22 2016-04-26 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US12152254B2 (en) 2012-05-29 2024-11-26 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
US10894950B2 (en) 2012-05-29 2021-01-19 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
US9890364B2 (en) 2012-05-29 2018-02-13 The General Hospital Corporation TAL-Tet1 fusion proteins and methods of use thereof
US11891631B2 (en) 2012-10-12 2024-02-06 The General Hospital Corporation Transcription activator-like effector (tale) - lysine-specific demethylase 1 (LSD1) fusion proteins
WO2014124284A1 (en) * 2013-02-07 2014-08-14 The General Hospital Corporation Tale transcriptional activators
US10731167B2 (en) 2013-02-07 2020-08-04 The General Hospital Corporation Tale transcriptional activators
US10676749B2 (en) 2013-02-07 2020-06-09 The General Hospital Corporation Tale transcriptional activators
JP2021192624A (ja) * 2013-03-15 2021-12-23 ザ ジェネラル ホスピタル コーポレイション 特定のゲノム遺伝子座へのゲノムおよびエピゲノム調節タンパク質のrna誘導型標的化
US11168338B2 (en) 2013-03-15 2021-11-09 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US10844403B2 (en) 2013-03-15 2020-11-24 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
US10760064B2 (en) 2013-03-15 2020-09-01 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US10544433B2 (en) 2013-03-15 2020-01-28 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US9567603B2 (en) 2013-03-15 2017-02-14 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US9567604B2 (en) 2013-03-15 2017-02-14 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US11098326B2 (en) 2013-03-15 2021-08-24 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US10526589B2 (en) 2013-03-15 2020-01-07 The General Hospital Corporation Multiplex guide RNAs
US11920152B2 (en) 2013-03-15 2024-03-05 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
US9885033B2 (en) 2013-03-15 2018-02-06 The General Hospital Corporation Increasing specificity for RNA-guided genome editing
JP2016512264A (ja) * 2013-03-15 2016-04-25 ザ ジェネラル ホスピタル コーポレイション 特定のゲノム遺伝子座へのゲノムおよびエピゲノム調節タンパク質のrna誘導型標的化
US12065668B2 (en) 2013-03-15 2024-08-20 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
JP2016512691A (ja) * 2013-03-15 2016-05-09 ザ ジェネラル ホスピタル コーポレイション 短縮ガイドRNA(tru−gRNA)を用いたRNA誘導型ゲノム編集の特異性の増大
US10415059B2 (en) 2013-03-15 2019-09-17 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US10378027B2 (en) 2013-03-15 2019-08-13 The General Hospital Corporation RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
JP2024012446A (ja) * 2013-03-15 2024-01-30 ザ ジェネラル ホスピタル コーポレイション 短縮ガイドRNA(tru-gRNA)を用いたRNA誘導型ゲノム編集の特異性の増大
JP2023061983A (ja) * 2013-03-15 2023-05-02 ザ ジェネラル ホスピタル コーポレイション 特定のゲノム遺伝子座へのゲノムおよびエピゲノム調節タンパク質のrna誘導型標的化
US11634731B2 (en) 2013-03-15 2023-04-25 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US10119133B2 (en) 2013-03-15 2018-11-06 The General Hospital Corporation Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing
US10138476B2 (en) 2013-03-15 2018-11-27 The General Hospital Corporation Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
US10011850B2 (en) 2013-06-21 2018-07-03 The General Hospital Corporation Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9340800B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College Extended DNA-sensing GRNAS
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9228207B2 (en) 2013-09-06 2016-01-05 President And Fellows Of Harvard College Switchable gRNAs comprising aptamers
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US11390887B2 (en) 2013-11-07 2022-07-19 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10190137B2 (en) 2013-11-07 2019-01-29 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US10640788B2 (en) 2013-11-07 2020-05-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAs
US9834791B2 (en) 2013-11-07 2017-12-05 Editas Medicine, Inc. CRISPR-related methods and compositions with governing gRNAS
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US9068179B1 (en) 2013-12-12 2015-06-30 President And Fellows Of Harvard College Methods for correcting presenilin point mutations
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
CN103789840A (zh) * 2014-02-07 2014-05-14 赛业(广州)生物科技有限公司 一种tale聚体库的构建方法
US11028388B2 (en) 2014-03-05 2021-06-08 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa
US10253312B2 (en) 2014-03-10 2019-04-09 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10)
US11339437B2 (en) 2014-03-10 2022-05-24 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US11141493B2 (en) 2014-03-10 2021-10-12 Editas Medicine, Inc. Compositions and methods for treating CEP290-associated disease
US12234449B2 (en) 2014-03-10 2025-02-25 Editas Medicine, Inc. CRISPR/Cas-related methods and compositions for treating Leber's congenital amaurosis 10 (LCA10)
US9938521B2 (en) 2014-03-10 2018-04-10 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10)
US11268086B2 (en) 2014-03-10 2022-03-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10)
US11242525B2 (en) 2014-03-26 2022-02-08 Editas Medicine, Inc. CRISPR/CAS-related methods and compositions for treating sickle cell disease
US10507232B2 (en) 2014-04-02 2019-12-17 University Of Florida Research Foundation, Incorporated Materials and methods for the treatment of latent viral infection
WO2015153889A3 (en) * 2014-04-02 2015-12-10 University Of Florida Research Foundation, Incorporated Materials and methods for the treatment of latent viral infection
US12460231B2 (en) 2014-04-02 2025-11-04 Editas Medicine, Inc. Crispr/CAS-related methods and compositions for treating primary open angle glaucoma
WO2015173436A1 (en) * 2014-05-16 2015-11-19 Vrije Universiteit Brussel Genetic correction of myotonic dystrophy type 1
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11180793B2 (en) 2015-04-24 2021-11-23 Editas Medicine, Inc. Evaluation of Cas9 molecule/guide RNA molecule complexes
US10633642B2 (en) 2015-08-28 2020-04-28 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US11060078B2 (en) 2015-08-28 2021-07-13 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9926546B2 (en) 2015-08-28 2018-03-27 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US9512446B1 (en) 2015-08-28 2016-12-06 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US10526591B2 (en) 2015-08-28 2020-01-07 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US10093910B2 (en) 2015-08-28 2018-10-09 The General Hospital Corporation Engineered CRISPR-Cas9 nucleases
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11512311B2 (en) 2016-03-25 2022-11-29 Editas Medicine, Inc. Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency
US11566263B2 (en) 2016-08-02 2023-01-31 Editas Medicine, Inc. Compositions and methods for treating CEP290 associated disease
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11851690B2 (en) 2017-03-14 2023-12-26 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11963982B2 (en) 2017-05-10 2024-04-23 Editas Medicine, Inc. CRISPR/RNA-guided nuclease systems and methods
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US11667941B2 (en) 2018-01-12 2023-06-06 Camena Bioscience Limited Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
WO2019140353A1 (en) * 2018-01-12 2019-07-18 Camena Bioscience Limited Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
US12031132B2 (en) 2018-03-14 2024-07-09 Editas Medicine, Inc. Systems and methods for the treatment of hemoglobinopathies
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12509680B2 (en) 2023-05-31 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences

Also Published As

Publication number Publication date
US10273271B2 (en) 2019-04-30
CA2841710A1 (en) 2013-01-24
JP2019122392A (ja) 2019-07-25
JP6214530B2 (ja) 2017-10-18
EP2732038A1 (en) 2014-05-21
EP3461896B1 (en) 2023-11-29
AU2012284365A1 (en) 2014-01-30
EP3461896A3 (en) 2019-06-26
US20190177374A1 (en) 2019-06-13
US11472849B2 (en) 2022-10-18
EP2732038A4 (en) 2015-07-29
EP2732038B1 (en) 2018-09-05
AU2012284365B2 (en) 2017-04-20
EP3461896A2 (en) 2019-04-03
JP2014521317A (ja) 2014-08-28
US20140274812A1 (en) 2014-09-18
AU2019226213A1 (en) 2019-09-26
CA2841710C (en) 2021-03-16
US20160318978A1 (en) 2016-11-03
JP2017212998A (ja) 2017-12-07
AU2017204819A1 (en) 2017-08-03

Similar Documents

Publication Publication Date Title
US11472849B2 (en) Methods of transcription activator like effector assembly
JP7399710B2 (ja) エピジェネティックに調節される部位特異的ヌクレアーゼ
US20120178647A1 (en) Engineering of zinc finger arrays by context-dependent assembly
CA2615532C (en) Targeted integration and expression of exogenous nucleic acid sequences
AU2005220148B2 (en) Methods and compostions for targeted cleavage and recombination
US7972854B2 (en) Methods and compositions for targeted cleavage and recombination
CA2534296C (en) Methods and compositions for targeted cleavage and recombination
EP3744835B1 (en) Dna modifying fusion proteins and methods of use thereof
CN103764820A (zh) 序列特异性工程改造的核糖核酸酶h和用于确定dna-rna杂交物结合蛋白序列偏好的方法
HK40005778A (en) Methods of transcription activator like effector assembly
AU2012245168B2 (en) Targeted Integration and Expression of Exogenous Nucleic Acid Sequences
Sepp et al. Cell-Free Protein-Evolution Systems for Engineering of Novel Sequence-Specific DNA-Binding and-Modifying Activities
AU2007201649A1 (en) Methods and Compositions for Targeted Cleavage and Recombination

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12814750

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2841710

Country of ref document: CA

Ref document number: 2014520317

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2012284365

Country of ref document: AU

Date of ref document: 20120712

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012814750

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 14232067

Country of ref document: US