WO2013012138A1 - 염증표적 수용체 및 염증 질환 치료용 약물 운반체 - Google Patents

염증표적 수용체 및 염증 질환 치료용 약물 운반체 Download PDF

Info

Publication number
WO2013012138A1
WO2013012138A1 PCT/KR2011/009755 KR2011009755W WO2013012138A1 WO 2013012138 A1 WO2013012138 A1 WO 2013012138A1 KR 2011009755 W KR2011009755 W KR 2011009755W WO 2013012138 A1 WO2013012138 A1 WO 2013012138A1
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
interleukin
il21r
seq
fragment
Prior art date
Application number
PCT/KR2011/009755
Other languages
English (en)
French (fr)
Inventor
유석호
윤선하
김동진
박재은
장명희
김혜난
Original Assignee
주식회사 에이앤알쎄라퓨틱스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 에이앤알쎄라퓨틱스 filed Critical 주식회사 에이앤알쎄라퓨틱스
Publication of WO2013012138A1 publication Critical patent/WO2013012138A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1793—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70542—CD106
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"

Definitions

  • the present invention relates to an inflammatory target receptor and a drug carrier for treating an inflammatory disease. Specifically, the present invention relates to a fragment comprising an extracellular region of IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB protein. It relates to a pharmaceutical composition for the treatment of inflammatory diseases or immunomodulatory therapy comprising as an ingredient.
  • the immune system protects the body from harmful foreign antigens. These types of antigens include bacteria, viruses, toxins, cancer cells and blood and tissues from other people or animals.
  • the immune system produces antibodies to destroy these harmful substances.
  • autoimmune disorders occur, the immune system cannot distinguish between organs of its healthy body and harmful antigens, destroying normal tissues, and this reaction is called autoimmune disease. These reactions are allergic to hypersensitivity reactions. Allergies respond to foreign substances that do not harm the body.However, when autoimmune disorders occur, the reaction occurs in normal tissues of the body. do.
  • Interleukin is a type of cytokine that acts as a chemical signal between red blood cells.
  • IL-2 When IL-2 was approved by the FDA for the treatment of late stage cancer in 1992, it was the first single immunotherapy to be used to treat cancer. Since then, IL-2 has also been used for metastatic melanoma. IL-2 alone has been used to treat cancer and has been treated with vaccines. IL-2 helps the immune system to grow and divide cells faster. However, treatment with IL-2 showed side effects such as colds, chills, fever, fatigue and confusion.
  • IL-15 and IL-21 which belong to the IL-2 family, are also being studied as single agents or adjuvants as cancer therapeutics.
  • IL-21 is a type of cytokine with alpha-helix structure, which causes an inflammatory response through signaling through the receptor and gamma chain of IL-21.
  • IL-21 has been reported to induce maturation of NK cell precursors from bone marrow (Parrish-Novak J., et al., Nature, 408: 57-63, 2000), in particular cytokine production and apoptosis of NK cells It has been reported to increase effector functions such as performance (Strengell M, et al., J Immunol., 170: 5464-5469, 2003; Brady J, et al., J Immunol., 172: 2048-).
  • VcamI also known as CD106, functions as a cell adhesion molecule (Cybulsky M., et al., Cytogenet. Cell Genet. 58: 1852, 1991).
  • the structure consists of 6-7 immunoglobulin domains (immunoglobulin doamin) and has been reported to be expressed in large and small blood vessels of endothelial cells stimulated by several cytokines (Barreiro, et al., J. Cell Biol. (United States) 157 (7): 123345. 2002).
  • lymphocytes In addition, lymphocytes, monocytes, eosinophilic leukocytes and basophils contribute to adhesion to vascular endothelial tissues, and signal transduction of leukocytes into endothelial cells has been reported, and is important in the development of atherosclerosis or rheumatoid arthritis. It is reported to play a role (Yonekawa K ,. et al ,. J. Leukoc. Biol. 77 (2): 129-40. 2005).
  • Interleukin-2 is an interleukin, an immune system signaling molecule that binds to the IL-2 receptor expressed by lymphocytes, the cells that produce immune responses, mediates the immune response and reacts from pathogenic bacterial invasion.
  • the secretion of IL-2 and the expression of the IL-2 receptor are achieved by stimulation of antigens that bind to T cells. And, the interaction of the two has been reported to stimulate the survival, differentiation and growth of antigen-selected cytotoxic T cells (Beadling C ,.
  • IL-2 has been shown to have a function similar to IL-15 and has been reported to be a cytokine that induces differentiation and proliferation of natural killer cells and promotes the production of immunoglobulins produced by B cells (Waldmann TA, et al. Nature Rev. Immun. 6 (8): 595601. 2006).
  • IL-10 Interleukin-10
  • Interleukin-10 is an anti-inflammatory cytokine well known to inhibit cytokine synthesis in the human body and is encoded by the IL-10 gene (Eskdale J .. et al, Immunogenetics 46 (2): 1208 1997).
  • IL-10 has been shown to have a pleiotropic effect on immunomodulation and inflammatory responses, and down-regulates the expression of Th1 cytokines, MHC Class II antigens and macrophage stimulatory molecules, and improves B cell survival, differentiation and antibody production. Enhances and blocks NF-kB activity in the JAK-STAT signaling pathway.
  • it has been reported to play an important role in neutralizing excessive immune responses in the human body (Braat H ,.
  • IFN- ⁇ IFN- ⁇
  • IL-2 IFN- ⁇
  • IL-3 TNF-alpha
  • GM-CSF Grimbaldeston MA ,. et al, Nat. Immunol. 8 (10): 1095104. 2007.
  • inflammation-related immune cells have the ability to recognize the site of inflammation and reach the site of inflammation.
  • the ability of immune cells to target these inflammatory sites can be caused by receptors on the cell membranes of immune cells and by ligands of these receptors.
  • the present inventors focus on the ability of targeting the inflammatory sites of the receptors present in the cell membranes of these immune cells to express ligand binding sites of the receptors present in the major inflammation-related human cells as soluble receptors and label them with quantum dots.
  • the present invention is completed by discovering a water-soluble receptor having the best inflammation targeting ability in an inflammation-induced mouse and combining the discovered water-soluble receptor with various drugs to use as a carrier for drug delivery to an inflammation site. It was.
  • the present inventors confirmed the effect of inflammatory site targeting on IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB, and identified the potential of IL21R as an existing anti-inflammatory drug carrier having the best inflammation targeting ability.
  • IL21R-TNFR2-Fc fusion receptor and Humira-IL21R fusion antibody were prepared. Quantum-dot was labeled on the fusion receptor and the fusion antibody, and in vivo inflammation targeting ability was confirmed.
  • IL21R was used for treating inflammatory diseases.
  • the present invention has been completed by confirming that it can be used as a carrier for drugs.
  • An object of the present invention is a drug carrier for treating inflammatory target receptors and inflammatory diseases comprising IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB protein or a fragment comprising an extracellular region of the protein as an active ingredient. It is intended to provide such.
  • the present invention is an interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), IL13RA1 (Interleukin 13 one or more selected from the group consisting of receptor, alpha 1), cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta)
  • IL21R interlukin 21 receptor
  • VcamI Interleukin-2 receptor subunit beta
  • IL3RA Interleukin 3 receptor
  • IL13RA1 Interleukin 13 one or more selected from the group consisting of receptor, alpha 1, cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor
  • the present invention is an interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor (alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), Extracellular regions of one or more proteins selected from the group consisting of Cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta).
  • IL21R interlukin 21 receptor
  • VcamI Vascular cell adhesion molecule 1
  • IL2RB Interleukin-2 receptor subunit beta
  • alpha Interleukin 3 receptor
  • IL13RA1 Interleukin 13 receptor, alpha 1
  • the fusion protein or the fusion antibody of the present invention has excellent inflammation targeting ability and has a significantly superior inflammation targeting effect compared to the representative anti-inflammatory receptor drug, TNFR2-Fc fusion protein (Enbrel), and thus delivers the drug to the site of inflammation ( It can be used as a carrier) and has the effect of enhancing the effect of treating an inflammatory disease or an immunomodulatory therapy of a fused inflammatory disease inhibitor or immune enhancer.
  • TNFR2-Fc fusion protein Enbrel
  • Figure 2 shows the structure of the expression vector (pYK602-His-Fc :: IL21R) cloned the extracellular IL21R domain.
  • FIG. 3 shows Western blot results (a) and QC test results (b) of IL21R expressed.
  • Figure 4 shows the structure of the expression vector (pYK602-His-Fc :: IL21R-D1) cloned IL21R extracellular domain I (IL21R-D1).
  • FIG. 5 is a Western blot result (a) and a QC test result (b) of IL21R-D1.
  • Figure 6 shows the structure of the expression vector (pYK602-His-Fc :: IL21R-D2) cloned IL21R extracellular domain II (IL21R-D2).
  • FIG. 7 shows Western blot results (a) and QC test results (b) of IL21R-D2 expressed.
  • FIG. 8 shows the structure of an expression vector (pYK602-His-Fc :: VcamI) cloned from the VcamI extracellular domain.
  • FIG. 10 shows the structure of an expression vector (pYK602-His-Fc :: IL2RB) cloned from the IL2RB extracellular domain.
  • FIG. 11 shows Western blot results (a) and QC test results (b) of IL2RB expressed.
  • FIG. 12 shows the structure of an expression vector (pYK602-His-Fc :: IL3RA) cloned from the IL3RA extracellular domain.
  • FIG. 13 shows Western blot results (a) and QC test results (b) of expressed IL3RA.
  • Fig. 14 shows the structure of the expression vector (pYK602-His-Fc :: IL13RA1) cloned from the IL13RA1 extracellular domain.
  • Figure 15 shows Western blot results (a) and QC test results (b) of IL13RA1 expressed.
  • Figure 16 shows the structure of the expression vector (pYK602-His-Fc :: CRLF1) cloned from the CRLF1 extracellular domain.
  • FIG. 17 shows Western blot results (a) and QC test results (b) of CRLF1 expressed.
  • Fig. 18 shows the structure of an expression vector (pYK602-His-Fc :: IL17RA) cloned from the IL17RA extracellular domain.
  • FIG. 20 shows the structure of an expression vector (pYK602-His-Fc :: IL2RG) cloned from the IL2RG extracellular domain.
  • FIG. 21 shows Western blot results (a) and QC test results (b) of expressed IL2RG.
  • Fig. 22 shows the structure of an expression vector (pYK602-His-Fc :: IL10RB) cloned from the IL10RB extracellular domain.
  • Figure 23 shows Western blot results (a) and QC test results (b) of expressed IL10RB.
  • Figure 24 shows the structure of the expression vector (pNATABL) cloned in the light chain (light chain) of the Humira antibody.
  • Figure 25 shows the structure of the expression vector (pNATABH) cloned in the heavy chain (heavy chain) of the Humira antibody.
  • FIG. 26 shows Western blot results (a) and QC test results (b) of expressed Humira antibodies.
  • FIG. 27 shows the structure of an expression vector cloned from Humira HC / IL21R (pNATABH :: Humira HC / IL21R).
  • FIG. 29 shows the structure of an expression vector cloned from IL21R / Humira HC (pNATABH :: IL21R / Humira HC).
  • FIG. 30 shows Western blot results (a) and QC test results (b) of IL21R / Humira HC expressed.
  • 31 is a fusion structure of IL21R and TNFR2 (IL21R / TNFR2).
  • FIG. 32 shows the structure of an expression vector (pYK602-His-Fc :: IL21R + TNFR2) cloned from the IL21R / TNFR2 fusion receptor.
  • FIG. 33 shows Western blot results (a) and QC test results (b) of expressed IL21R / TNFR2.
  • 34 shows a nanocrystal structure of a quantum dot.
  • 36 is a schematic diagram showing the process of binding Qdot and biomolecule.
  • FIG. 39 is a graph showing the results of a diagnosis of a living body using a CIA animal model (A), a wavelength of the Q-DOT 800 used for confirming in vivo imaging (B), and 5 days after the intravenous injection. QDs are released to the body (C).
  • FIG. 40 is a table showing the results of FIG. 39. The stronger the inflammation targeting, the more positive values were given.
  • Fig. 41 is a bioimaging result showing that Qdot-labeled IL21R, IL21R-DomainI and IL21R-DomainII are capable of targeting inflammation in vivo.
  • FIG. 43 is a bioimaging result showing that Qdot labeled Humira, Humira / IL21R and IL21R / Humira have the ability to target inflammation in vivo.
  • the present invention relates to Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor, alpha (IL3RA), Interleukin 13 receptor, alpha 1 (IL13RA1), CRLF1 ( Comprising an extracellular region of at least one protein selected from the group consisting of cytokine receptor like factor 1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta). It provides a pharmaceutical composition for treating inflammatory diseases or immunomodulatory therapy comprising a fusion protein linked to an inflammatory disease inhibitor or immune enhancer as an active ingredient.
  • the fragment comprising the extracellular region of IL21R (Interlukin 21 receptor) is SEQ ID NO: 4, the fragment comprising the extracellular region of Vascular cell adhesion molecule (VcamI) SEQ ID NO: 14, IL2RB (Interleukin- The fragment comprising the extracellular region of 2 receptor subunit beta is SEQ ID NO: 18, the fragment comprising the extracellular region of Interleukin 3 receptor (alpha) is SEQ ID NO: 22, cells of IL13RA1 (Interleukin 13 receptor, alpha 1) A fragment comprising an extraregion is SEQ ID NO: 26, a fragment comprising an extracellular region of Cytokine receptor like factor 1 (CRLF1) is SEQ ID NO: 30, a fragment comprising an extracellular region of Interleukin 17 receptor A (IL17RA) is SEQ ID NO: 34, The fragment comprising the extracellular region of Interleukin-2 receptor subunit gamma (IL2RG) is SEQ ID NO: 38, The fragment comprising the extracellular region of Interleukin
  • the inflammatory disease inhibitor is an extracellular region of Tumor necrosis factor receptor type 2 (TNFR2), an extracellular region of CTLA-4 (Orencia), an IL-1 antagonist, an Humira antibody, an anti-CXCL10 antibody, It may include but is not limited to anti IL6R antibody or anti IL6 antibody.
  • TNFR2 Tumor necrosis factor receptor type 2
  • CTLA-4 Orencia
  • IL-1 antagonist an extracellular region of CTLA-4 (Orencia)
  • Humira antibody an anti-CXCL10 antibody
  • It may include but is not limited to anti IL6R antibody or anti IL6 antibody.
  • fragment comprising the extracellular region of the protein in the present invention is characterized in that the fusion disease inhibitor or immune enhancer fusion in the C-term direction or N-term direction.
  • the invention also relates to Interlukin 21 receptor (IL21R), Vascular cell adhesion molecule 1 (VcamI), Interleukin-2 receptor subunit beta (IL2RB), Interleukin 3 receptor (alpha), IL13RA1 (Interleukin 13 receptor, alpha 1), Extracellular regions of one or more proteins selected from the group consisting of Cytokine receptor like factor 1 (CRLF1), Interleukin 17 receptor A (IL17RA), Interleukin-2 receptor subunit gamma (IL2RG), and Interleukin 10 receptor (beta).
  • CRLF1 Cytokine receptor like factor 1
  • IL17RA Interleukin 17 receptor A
  • IL2RG Interleukin-2 receptor subunit gamma
  • Beta Interleukin 10 receptor
  • a fragment comprising, and a fusion protein linked with an inflammatory disease inhibitor or an immune enhancer as an active ingredient, a method for enhancing an inflammatory disease or an immunomodulatory therapeutic effect.
  • the fragment comprising the extracellular region of the protein is as described above of SEQ ID NO: 4, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 30, SEQ ID NO: 34, SEQ ID NO: 38 or SEQ ID NO: 42 It is characterized by comprising a polypeptide having an amino acid sequence.
  • the inflammatory disease inhibitor in the present invention is as described above, the fragment comprising the extracellular region of the protein is characterized in that the fusion disease inhibitor or immune enhancer fusion in the C-term direction or N-term direction .
  • the inventors confirmed the effect of inflammation targeting on IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB.
  • IL21R and other cytokines showed the degree of inflammation targeting the ability to target the inflammation site compared with Enbrel's inflammation targeting ability.
  • IL21R, VcamI, IL21RB, IL2RG, and IL10RB showed excellent specific binding ability to the inflammation site.
  • IL13RA1, IL17RA was excellent
  • IL3RA, CRLF1 was confirmed to be normal.
  • IL21R all of the inflammation-related receptors we selected, IL21R, VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, and IL17RA, targeted inflammation sites.
  • IL21R, VcamI, IL21RB, IL2RG, and IL10RB which are inflammation-insoluble water-soluble receptors whose capacity is similar or very strong with Enbrel.
  • IL21R-TNFR2-Fc was prepared by fusing with a representative anti-inflammatory receptor drug, TNFR2-Fc fusion protein (Enbrel).
  • cDNA Library mix Kidney, placenta, pancrease, liver
  • PCR polymerase chain reaction
  • PCR reaction conditions were 50 ⁇ l of the total reaction solution, the template was put to 100 ng, 2.5 units of pfu polymerase (Gennote, Korea), 10 pmole / 50 ⁇ l of the forward and reverse primer, respectively, and the remaining volume After filling with distilled water to form a total of 50 ⁇ l of the reaction solution, after 2 minutes at 94 °C, amplify the gene by repeating 30 cycles at 94 °C 30 seconds, 58 °C 30 seconds, 72 °C 1 minutes, and then at 10 °C 72 The reaction was carried out for a minute to obtain a PCR product.
  • Restriction enzyme cleavage reaction cuts 1 ⁇ g DNA. After mixing 1 ⁇ l of SfiI (10 unit) and 5 ⁇ l of 10x reaction buffer, add sterile distilled water to make 50 ⁇ l of total volume, After reacting for 6 hours, separation and purification were performed from an agarose gel.
  • ligation was performed using a T4 DNA ligase (# M001S, Enzynomics, Korea) to insert the insert into the pYK602-Fc vector, a mammalian expression vector.
  • the ligation reaction involves mixing 1 ⁇ l of ligase (10 units) and 1 ⁇ l of 10 ⁇ reaction buffer with a vector and insert ratio of 1 (50 ng): 3 (150 ng). After that, the expression vector into which the gene was inserted was obtained by ligation at 16 ° C. for at least 16 hours.
  • restriction enzyme cleavage reactions and ligation reactions in the examples of the present invention were performed under the same conditions as described above.
  • the cloned genes were transformed into E. coli cells, and the formed colonies were sequenced to obtain clones correctly inserted into the pYK602-Fc expression vector. .
  • transfecting 293E cells which are animal cells, confirmed the expression rate of soluble receptors related to inflammation, Culture was performed to obtain each of the inflammation-related soluble receptor proteins.
  • fusion-soluble receptors such as IL21R / TNFR2 were fused by overlapping PCR, a molecular biological method, to obtain the fusion protein by performing expression and culture and stabilization by the same method as above.
  • Humira, the antibody and Humira / IL21R, IL21R / Humira, were obtained by synthesis through gene synthesis, and fusion antibody protein was also obtained using the same method as above.
  • Examples 2 to 14 are structures for IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL21R / TNFR2, IL2RG, IL10RB and Humira, Humira / IL21R, IL21R / Humira to be inserted into the vector. PCR amplification, purification, and QC procedures were shown. All procedures were performed under the same conditions.
  • Interlukin 21 receptor consists of two domains, and the structure of IL21R is briefly shown in FIG.
  • the extracellular domain of IL21R is a cytokine composed of domains I and II.
  • the total length of the extracellular domain of IL21R is 636bp, which is composed of 212 amino acids, domain I is 300bp, 100 amino acids, and domain II is 411bp, which is 137 amino acids.
  • extra-cellular domain full length of IL21R, extracellular domain I of IL21R and extracellular domain II of IL21R were cloned into pYK602-His Fc, respectively.
  • FIG. 2 is an animal cell expression vector pYK602-His-Fc.
  • IL21R is inserted into the vector and IL21R are cut with restriction enzyme SfiI, and the vector structure expected when IL21R is inserted is shown.
  • the forward primer (SEQ ID NO: 1) and reverse primer (SEQ ID NO: 2) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.
  • IL21R-F (SfiI): aggg ggccgtgggggcc cccgacctcgtctgctacac
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • FIG. 4 is a diagram in which IL21R-D1 is inserted into pYK602-His-Fc, which is an animal cell expression vector, and after cutting the vector and IL21R-D1 with restriction enzyme SfiI, the vector structure is expected when IL21R-D1 is inserted.
  • the forward primer (SEQ ID NO: 1) and reverse primer (SEQ ID NO: 5) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 6 or the amino acid sequence of SEQ ID NO: 7.
  • IL21R-F (SfiI): aggg ggccgtgggggcc cccgacctcgtctgctacac
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL21R-D1 inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in a medium obtained after 2, 5, and 7 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL21R-D1 obtained through Agilent 230 kit assay were measured. The purity of IL21R-D1 was confirmed to be 96%, and Western blot results (a) and QC test results (b) of IL21R-D1 are shown in FIG. 5.
  • FIG. 6 is a diagram in which IL21R-D2 is inserted into pYK602-His-Fc, which is an animal cell expression vector.
  • the forward primer (SEQ ID NO: 8) and reverse primer (SEQ ID NO: 2) sequences including the SfiI restriction enzyme sequences used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 9 or the amino acid sequence of SEQ ID NO: 10.
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL21R-D2 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 5, and 7 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of IL21R-D2 obtained through Agilent 230 kit assay were measured. The purity of IL21R-D2 was found to be 92%, and Western blot results (a) and QC test results (b) of IL21R-D2 are shown in FIG. 7.
  • FIG. 8 shows a structure of an expression vector obtained by cloning an extra-cellular domain of VcamI (Vascular cell adhesion molecule 1) to pYK602-His-Fc.
  • VcamI Vascular cell adhesion molecule 1
  • FIG. 8 is a diagram in which VcamI is inserted into pYK602-His-Fc, an animal cell expression vector, and the vector and VcamI are cut with restriction enzyme SfiI, and then the vector structure is expected when VcamI is inserted.
  • the forward primer (SEQ ID NO: 11) and reverse primer (SEQ ID NO: 12) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows. Extracellular domain I of IL21R is described by the DNA sequence of SEQ ID NO: 13 or the amino acid sequence of SEQ ID NO: 14.
  • VcamI-F (SfiI): aggg ggccgtgggggcc ccagaatctagatatcttgct
  • VcamI-R (SfiI): tagc ggccgacgcggcc aatccttgaacatcaagtgttaa
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • a total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates.
  • the whole supernatant was first filtered using a 0.22 ⁇ m top-filter (# PR02890 Millipore USA), followed by 500 ⁇ l of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C.
  • VcamI inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of VcamI obtained through Agilent 230 kit assay were measured. Purity of VcamI was confirmed to be 97.5%, and the results of Western blot (a) and QC test (b) of VcamI are shown in FIG. 9.
  • FIG. 10 is a diagram illustrating the insertion of IL2RB into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected after cutting the vector and IL2RB with restriction enzyme SfiI and inserting IL2RB1.
  • the forward primer (SEQ ID NO: 15) and reverse primer (SEQ ID NO: 16) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL2RB is described by the DNA sequence of SEQ ID NO: 17 or the amino acid sequence of SEQ ID NO: 18.
  • IL2RB-F (SfiI): aggg ggccgtgggggcc gcagcggtgaatggcacttcc
  • IL2RB-R (SfiI): tagc ggccgacgcggcc aacctgaaggccaggggctg
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • 1.6 mg of IL2RB was obtained from 2.0 L of the culture supernatant as shown in FIG.
  • IL2RB inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 9 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of IL2RB obtained through Agilent 230 kit assay were measured. The purity of IL2RB was found to be 98%, and Western blot results (a) and QC test results (b) of IL2RB are shown in FIG. 11.
  • FIG. 12 shows the structure of an expression vector obtained by cloning an extra-cellular domain of IL3RA (Interleukin 3 receptor, alpha) to pYK602-His-Fc.
  • FIG. 12 is a diagram illustrating the insertion of IL3RA into pYK602-His-Fc, an animal cell expression vector.
  • the vector and IL3RA are cut with restriction enzyme SfiI, and then the vector structure is expected when IL3RA is inserted.
  • the forward primer (SEQ ID NO: 19) and reverse primer (SEQ ID NO: 20) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL3RA is described by the DNA sequence of SEQ ID NO: 21 or the amino acid sequence of SEQ ID NO: 22.
  • IL3RA-F (SfiI): aggg ggccgtgggggcca aggaagatccaaacccacca
  • IL3RA-R (SfiI): tagc ggccgacgcggcc aagcgctggggtgctccag
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL3RA inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then western-tested in media obtained after 2, 5, and 7 days to confirm protein expression. After purification using beads (protein bead), the protein purity and quantitation of IL3RA obtained through the Agilent 230 kit assay was measured. The purity of IL3RA was confirmed to be 95.3%, and Western blot results (a) and QC test results (b) of IL3RA are shown in FIG. 13.
  • FIG. 14 shows the structure of an expression vector obtained by cloning an extra-cellular domain of IL13RA1 (Interleukin 13 receptor, alpha 1) to pYK602-His-Fc.
  • FIG. 14 is a diagram showing the insertion of IL13RA1 into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected after cutting IL13RA1 into restriction enzyme SfiI and inserting IL13RA1.
  • the forward primer (SEQ ID NO: 23) and reverse primer (SEQ ID NO: 24) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL13RA1 is described by the DNA sequence of SEQ ID NO: 25 or the amino acid sequence of SEQ ID NO: 26.
  • IL13RA1-F (SfiI): aggg ggccgtgggggcc gacaccgagataaaagttaa
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • a total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates.
  • the whole supernatant was first filtered using a 0.22 ⁇ m top-filter (# PR02890 Millipore USA), followed by 500 ⁇ l of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C.
  • IL13RA1 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL13RA1 obtained through Agilent 230 kit assay were measured. The purity of IL13RA1 was found to be 95.4%, and Western blot results (a) and QC test results (b) of IL13RA1 are shown in FIG. 15.
  • FIG. 16 shows a structure of an expression vector obtained by cloning an extra-cellular domain of Cytokine receptor like factor 1 (CRLF1) to pYK602-His-Fc.
  • FIG. 16 is a diagram illustrating the insertion of CRLF1 into pYK602-His-Fc, an animal cell expression vector, which is a vector structure predicted when CRLF1 is inserted into the vector and CRLF1 by restriction enzyme SfiI.
  • the forward primer (SEQ ID NO: 27) and reverse primer (SEQ ID NO: 28) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of CRLF1 is described by the DNA sequence of SEQ ID NO: 29 or the amino acid sequence of SEQ ID NO: 30.
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • a total of 2.0 liters of supernatant taken at 2, 4, 6, and 8 days were purified in 50 150 mm plates.
  • the whole supernatant was first filtered using a 0.22 ⁇ m top-filter (# PR02890 Millipore USA), followed by 500 ⁇ l of protein A bead (# 17-1279-03, packed in a 5 ml column). GE healthcare, Sweden). After binding at 4 ° C.
  • CRLF1 inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantitation of CRLF1 obtained through Agilent 230 kit assay were measured. Purity of CRLF1 was confirmed to be 94.4%, and Western blot results (a) and QC test results (b) of CRLF12 are shown in FIG. 17.
  • FIG. 18 is a diagram illustrating the insertion of IL17RA into pYK602-His-Fc, which is an animal cell expression vector.
  • the vector and IL17RA are cut with restriction enzyme SfiI, and the vector structure is expected when IL17RA is inserted.
  • the forward primer (SEQ ID NO: 31) and reverse primer (SEQ ID NO: 32) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL17RA is described by the DNA sequence of SEQ ID NO: 33 or the amino acid sequence of SEQ ID NO: 34.
  • IL17RA-F (SfiI): aggg ggccgtgggggcc ctgcgactcctggaccaccg
  • IL17RA-R (SfiI): tagc ggccgacgcggcc aatggagtgtctggcatttctg
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 150 mm plate (# 430599 Corning USA) to cover 70 to 80% of the area, and 20 ⁇ g of DNA and 40 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL17RA inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL17RA obtained through Agilent 230 kit assay were measured. The purity of IL17RA was found to be 89.4%, and Western blot results (a) and QC test results (b) of IL17RA are shown in FIG. 19.
  • FIG. 20 illustrates the structure of an expression vector obtained by cloning an extra-cellular domain of IL2RG (Interleukin-2 receptor subunit gamma) into pYK602-His-Fc.
  • FIG. 20 is a diagram illustrating the insertion of IL2RG into pYK602-His-Fc, an animal cell expression vector.
  • the vector and IL2RG are cut with restriction enzyme SfiI, and are expected when the IL2RG is inserted.
  • the forward primer (SEQ ID NO: 35) and reverse primer (SEQ ID NO: 36) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL2RG is described by the DNA sequence of SEQ ID NO: 37 or the amino acid sequence of SEQ ID NO: 38.
  • IL2RG-F (SfiI): aggg ggccgtgggggcc aacacgacaattctgacgcccaa
  • IL2RG-R (SfiI): tagc ggccgacgcggcc aaagtattgctcccccagtggatt
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 100 mm plate (# 430599 Corning USA) to cover 80 to 90% of the area, and 13 ⁇ g of DNA and 26 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL2RG inserted into pYK602-His-Fc was transfected into 293E cells, which are animal cells, and tested western in a medium obtained after 2, 4, 6, and 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL2RG obtained through Agilent 230 kit assay were measured. The purity of IL2RG was confirmed to be 93.6%, and Western blot results (a) and QC test results (b) of IL2RG are shown in FIG. 21.
  • FIG. 22 is a diagram illustrating the insertion of IL10RB into pYK602-His-Fc, an animal cell expression vector, which is a vector structure expected when the vector and IL10RB are cut with restriction enzyme SfiI, and then IL10RB is inserted.
  • the forward primer (SEQ ID NO: 39) and reverse primer (SEQ ID NO: 40) sequences including the SfiI restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL10RB is described by the DNA sequence of SEQ ID NO: 41 or the amino acid sequence of SEQ ID NO: 42.
  • IL10RB-F (SfiI): aggg ggccgtgggggcc catgggacagagctgcccag
  • IL10RB-R (SfiI): tagc ggccgacgcggcc aaatactgcctggtgagggagat
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • 293E cells were plated in a 100 mm plate (# 430599 Corning USA) to cover 80 to 90% of the area, and 13 ⁇ g of DNA and 26 ⁇ g of PEI (# 23966, Polysciences, USA) were mixed at a ratio of 1: 2. After reacting at room temperature for about 20 minutes, the cells were dropped and transfected. After 16 to 20 hours, the cells are replaced with serum-free DMEM medium (Serum Free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA)), and the supernatant of cells is changed every 2 to 3 days. Obtained.
  • serum-free DMEM medium serum-free Media, No FBS DMEM (# SH30243.01 Hyclone Thermo. USA
  • IL10RB inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 4, 6, and 8 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL10RB obtained through Agilent 230 kit assay were measured. The purity of IL10RB was confirmed to be 95%, and Western blot results (a) and QC test results (b) of IL10RB are shown in FIG. 23.
  • FIG. 24 is a diagram in which a Humira light chain is inserted into an animal cell expression vector pNATABL, and the vector and Humira light chain are cut with restriction enzymes SfiI and BglII, and are expected when the Humira light chain is inserted.
  • NATVK1-1 (SfiI): ttggt ggccacagcggcc gatgtccactcggacatccagatgacccagtc
  • NATJK-R4 gaggag agatct tttgatttccaccttggt
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • FIG. 25 is a diagram in which a Humira heavy chain is inserted into an animal cell expression vector pNATABL, and the vector and Humira heavy chain are cut with restriction enzymes SfiI and NheI, and then the vector structure is expected when the Humira heavy chain is inserted.
  • NATVH3-4 (SfiI): TTGGT GGCCACAGCGGCC GATGTCCACTCGGAGGTGCAGCTGGTGCAGTC
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • the transgenic light and heavy chains of Humira inserted into the heavy and light chain expression vectors were transfected into 293E cells, which are animal cells, and then tested Western in a medium obtained after 3 or 5 days to confirm the protein expression rate. After purification using protein beads, protein purity and quantitation of Humira antibodies obtained through the Agilent 230 kit assay were measured. The purity of the Humira antibody was found to be 96.8%, and Western blot results (a) and QC test results (b) of the Humira antibody are shown in FIG. 26.
  • FIG. 27 is a diagram illustrating the insertion of the C-terminal fusion of Humira heavy chain and IL21R into the heavy chain expression vector pNATABH of animal cell antibody.
  • the C-terminal fusion of the vector and Humira heavy chain and IL21R was cut with restriction enzymes SfiI, NheI, This is the expected vector structure when the C-terminal fusion of Humira heavy chain and IL21R is inserted.
  • the reverse primer (SEQ ID NO: 52) sequence including the IL21R forward primer (SEQ ID NO: 51) and the XhoI (# R007S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction is as follows.
  • the extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.
  • IL21R-F tgccccgacctcgtctgctaca
  • IL21R-R (XhoI): ccag ctcgag cggccgtcgcactcattcctttaactcctct
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • a medium obtained after 4 days of transfection of the Humira heavy chain, the C-terminal fusion of IL21R, and the Humira light chain inserted into the heavy chain expression vector and the light chain expression vector to 293E cells, which are animal cells (media) ) was tested in western, purified using protein beads, and protein purity and quantitation of fusion antibodies of Humira and IL21R obtained through Agilent 230 kit assay were measured.
  • the purity of the fusion antibody of Humira and IL21R was found to be 95.1%, and Western blot results (a) and QC test results (b) of the fusion antibody of Humira and IL21R are shown in FIG. 28.
  • the supernatant samples of Humira / IL21R antibody were obtained on days 2, 4, 6, and 8, and the Western blot was only obtained from supernatant samples collected after 4 days.In the case of antibodies, when they are fused with other proteins, they are denaturated and precipitate. The supernatant was precipitated with and without to check for solubility.
  • FIG. 29 is a diagram in which the N-terminal fusion of Humira heavy chain and IL21R is inserted into the heavy chain expression vector pNATABH of an animal cell antibody.
  • the N-terminal fusion of the vector and Humira heavy chain and IL21R is cut with restriction enzymes SfiI and NheI, The vector structure is expected when the N-terminal fusion of Humira heavy chain and IL21R is inserted.
  • IL21R forward primer (SEQ ID NO: 53) and reverse primer (SEQ ID NO: 54) sequences including the SfiI (# R033S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction are as follows.
  • the extracellular domain of IL21R is described by the DNA sequence of SEQ ID NO: 3 or the amino acid sequence of SEQ ID NO: 4.
  • IL21R-R agctgcacctgcgagtggacatcttcctttaactcc
  • the PCR reaction was carried out under the same conditions as in Example 1, and the DNA obtained by PCR was transfected and purified in the following manner.
  • IL21R and Humira light chain inserted into the heavy chain expression vector and the light chain expression vector into 293E cells which are animal cells (media ) were tested in western, purified using protein beads, and protein purity and quantitation of fusion antibodies of Humira and IL21R obtained through Agilent 230 kit assay were measured.
  • the purity of the fusion antibody of Humira and IL21R was confirmed to be 97%, and Western blot results (a) and QC test results (b) of the fusion antibody of Humira and IL21R are shown in FIG. 30.
  • the supernatant samples of IL21R / Humira antibodies were obtained on days 2, 4, 6, and 8, and the Western blot was only obtained from supernatant samples collected after 4 days.In the case of antibodies, they are denaturated and precipitated when fused with other proteins. The supernatant was precipitated with and without to check for solubility.
  • FIG. 6 is a diagram in which IL21R-D2 is inserted into pYK602-His-Fc, an animal cell expression vector, and the vector and IL21R-D2 are cut with restriction enzyme SfiI, and then the vector structure is expected when IL21R-D1 is inserted.
  • a DNA structure fused to IL21R and TNFR2 was prepared, and then inserted into pYK602-Fc to produce a fusion receptor.
  • an overlapping PCR technique was performed to make a fusion protein of two cytokines of IL21R and TNFR2.
  • the primer was overlapped by 30mer between the C-terminus of IL21R and the N-terminus of TNFR2.
  • Two fragments were fused with primers to form an IL21R / TNFR2 fusion structure.
  • the fusion structure of IL21R and TNFR2 is shown in FIG. 31.
  • IL21R / TNFR2 was inserted into pYK602-His-Fc, an animal cell expression vector.
  • the vector and IL21R / TNFR2 were cut with restriction enzyme SfiI, and the vector structure expected when IL21R / TNFR2 was inserted is shown in FIG. 32. It was.
  • IL21R forward primer (SEQ ID NO: 55), reverse primer (SEQ ID NO: 56), TNFR2 forward primer (SEQ ID NO: 57) and reverse primer (SEQ ID NO: 55) containing the SfiI (# R033S, enzynomics, Korea) restriction enzyme sequence used in the PCR reaction No. 58)
  • SfiI # R033S, enzynomics, Korea
  • the sequence is as follows.
  • IL21R / TNFR2 fusion receptors are described by the DNA sequence of SEQ ID NO: 59 or the amino acid sequence of SEQ ID NO: 60.
  • IL21R-F caggg ggccgtgggggcc cccgacctcgtctgctacac
  • IL21R-R tagcggccgacgcggccaattcctttaactcctctgact
  • TNFR2-F cagggggccgtgggggggccttgcccgcccaggtggcatt
  • PCR reaction was carried out under the same conditions as in Example 1, but after 2 minutes of IL21R and TNFR2 at 94 °C, respectively, amplified the gene by repeating 30 cycles at 94 °C 30 seconds, 55 °C 30 seconds, 72 °C 1 minute After the reaction was conducted at 72 ° C. for 10 minutes, a PCR product was obtained.
  • IL21R PCR product and the TNFR2 PCR product were purified by agarose gel under the same conditions, and then the template was mixed 1: 1.
  • PCR was performed using IL21R-F (StifI) and TNFR2 (StifI) as primers.
  • DNA obtained by PCR was transfected and purified in the following manner.
  • IL21R / TNFR2 inserted in pYK602-His-Fc was transfected into 293E cells, which are animal cells, and then tested western in media obtained after 2, 5, 7, 9 days to confirm protein expression. After purification using protein beads, protein purity and quantification of IL21R / TNFR2 obtained through Agilent 230 kit assay were measured. The purity of IL21R / TNFR2 was confirmed to be 97%, and Western blot results (a) and QC test results (b) of IL21R / TNFR2 are shown in FIG. 33.
  • the quantum dots were selected by selecting only those with purity greater than 90%.
  • QD nanoparticles (Quantum dot nanocrystals) (see FIGS. 34 and 35) were labeled to IL-21R receptor conjugates that bind to the receptor of IL-21 overexpressed in autoimmune arthritis tissue. Labeling methods were Qdot 800 ITK carbosylquantum dots (Invitrogen, # MOP-Q21371MP) and 16 proteins (IL21R, IL21R-DomainI (D1), IL21R-DomainII (D2), VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, 11 inflammation-related water-soluble receptors including CRLF1 and IL17RA; IL21R / TNFR2 fused with IL21R and TNFR2 (Enbrel), an inflammatory drug; Enbrel, an anti-inflammatory drug; Humira, an inflammatory antibody Humira; fused with Humira antibody For IL21R / Humira and Humira / IL
  • EDC of each of the reactants, the water-soluble receptor, the fusion receptor, and the fusion antibody was reacted at a molar ratio of 1: 40: 1500, and the binding process of the QD and the biomolecule is briefly shown in FIG.
  • the unlabeled protein was purified by washing several times with 50 mM borate buffer (pH 8.3) using an ultrafiltration membrane (Urafiltration filter 100kDa, Millipore, # UFC910024).
  • Collagen primary injection connects a 3-way stopcock with 2 mg / ml Type II collagen (Chondrex, # 20022, USA) and 2 mg / ml CFA (Chondrex, # 7009, USA) at a ratio of 1: 1.
  • the second injection of collagen was performed 18 days after the first injection of collagen, and a collagen mixture was prepared in the same manner as in the first injection, and booster injection was performed at the upper tail region rather than the first immunization position. From day 18 after the initial immunization, the progression of arthritis was assessed by the standard arthritis index (criteria arthritic index) from 0 to 3 (see Table 1). In addition, when the inflammation level reached a peak, inflammation targeting in-vivo experiments were performed on various inflammation-related receptor drugs including IL21R, and the results are shown in FIG. 37.
  • A shows that inflammation occurs at 18 days after the first and second injections of collagen, and the inflammation level reaches its peak at 28 days, and B is 0 to 3 in the degree of inflammation when the inflammation occurs.
  • the scores are given to the point, and the higher the score, the more severe the inflammation.
  • Table 1 Score Condition 0 Normal One Mild, but definite redness and swelling of the ankle or wrist, or apparent redness and swelling limited to individual digits, regardless of the number of affected digits 2 Severe redness and swelling of the entire paw including digits 3 Maximally inflamed limb with involvement of multiple joints
  • Example 17 Inflammation targeting ability observed in CIA animal model for quantum dot labeled Enbrel and Fc (comparative experiment)
  • the present inventors have identified Qdot-labeled IL21R, IL21R-Domain I, IL21R-Domain II receptor, inflammation-related receptors (VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA), and IL21R / TNFR2 (Enbrel).
  • In vivo imaging system was performed to observe inflammatory targeting ability of the fusion receptor, Humira, and the fusion IL21R / Humira and Humira / IL21R. Imaging equipment was used Maestro 2 In-vivo imaging system (Korea Basic Research Institute).
  • Enbrel which is currently sold as a therapeutic agent for rheumatoid arthritis.
  • Enbrel was used as a positive control and only Fc was used as a negative control.
  • IL21R, VACM1, IL21RB, IL2RG, and IL10RB labeled QDs had the most excellent inflammation targeting ability, IL13RA1 and IL17RA were excellent, and IL3RA and CRLF1 were normal. It was.
  • the present inventors have shown the wavelength of the Q-DOT 800 used to confirm in vivo imaging as a red graph in B of FIG. 39, and also after 5 days of intravenous injection in C of FIG. 39. It was confirmed that it was discharged in vitro.
  • IL21R has superior inflammation targeting ability than that of Enbrel, a therapeutic agent for arthritis, and therefore, when two domains of IL21R are separated, IL21R and IL21R-Domain I, IL21R-
  • Example 20 Bioimaging Diagnosis Using a CIA Animal Model of a Fusion Protein of IL21R with an Arthritis Therapeutic Drug
  • IL21R having the best inflammation targeting ability as a carrier of existing anti-inflammatory drugs
  • the present inventors first fused ILN-R2-Tc fusion protein (Enbrel), a representative anti-inflammatory receptor drug, to prepare IL21R-TNFR2-Fc.
  • MAESTRO fluorescence imaging system
  • Inflammation targeting ability was diagnosed in vivo using the Korea Research Institute of Basic Support Science) and the results are shown in FIG. 42.
  • the inflammation targeting ability of the IL21R / TNFR2 fusion receptor was much stronger than the inflammation targeting ability of Enbrel, and it could be used as a carrier of the inflammation site targeting of IL21R. This is believed to show stronger inflammation targeting ability as the inflammation targeting ability of TNFR2 is added to the inflammation targeting ability of IL21R itself.
  • IL21R a neutralizing antibody of TNF-alpha.
  • Humira a neutralizing antibody of TNF-alpha.
  • Quantum-dot was labeled on the fusion protein of the N-terminus (IL21R / Humira) of the Humira antibody heavy chain and the C-terminus (Humira / IL21R) of the Humira antibody heavy chain, and then the in-vivo inflammation targeting ability was measured.
  • Humira / IL21R had better inflammation targeting ability than Humira
  • IL21R / Humira was similar to Humira.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 염증표적 수용체 및 염증 질환 치료용 약물 운반체에 관한 것으로서, 구체적으로 본 발명은 IL2IR, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB 단백질 또는 상기 단백질의 세포 외 영역을 포함하는 단편을 유효성분으로 포함하는 염증표적 수용체 등에 관한 것이다. 본 발명의 염증표적 수용성 수용체, 융합 단백질 또는 융합 항체는 대표적인 항 염증 수용체 약물은 TNFR2-Fc 융합단백질(Enbrel)에 비하여 현저히 우수한 염증 타겟팅 효과를 가지며, 따라서 염증 부위로 약물을 전달하는 운반체(carrier)로서 사용될 수있다.

Description

염증표적 수용체 및 염증 질환 치료용 약물 운반체
본 발명은 염증표적 수용체 및 염증 질환 치료용 약물 운반체에 관한 것으로서, 구체적으로 본 발명은 IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB 단백질의 세포 외 영역을 포함하는 단편을 유효성분으로 포함하는 염증 질환 치료용 또는 면역조절 치료용 약학 조성물 등에 관한 것이다.
면역체계는 해로운 외부물질인 항원(antigen)으로부터 신체를 보호하는 역할을 한다. 이러한 항원의 종류로는 박테리아, 바이러스, 독소, 암세포와 다른 사람 혹은 동물로의 혈액과 조직이 이에 해당된다. 면역체계는 이러한 해로운 물질들을 파괴하기 위하여 항체를 생산한다. 그러나 자가 면역에 이상이 생긴 경우, 면역체계는 자신의 건강한 신체의 장기와 해로운 항원을 구분하지 못하여, 정상적인 조직을 파괴하게 되며, 이러한 반응을 자가 면역 질환(autoimmune disease)라고 부른다. 이러한 반응은 알레르기하게 과민반응(hypersensitivity reaction)을 보이는 것으로서, 알레르기의 경우 신체에 해가 되지 않는 외부 물질에 대해서 반응을 하지만, 자가 면역에 이상이 생긴 경우에는 신체의 정상적인 조직을 대상으로 반응이 일어나게 된다.
인터루킨(Interleukin, IL)은 사이토카인의 한 종류로서, 적혈구 세포 사이의 화학신호의 역할을 수행한다. IL-2가 FDA에 의해서 1992년 말기간암의 치료에 승인되었을 때, 암을 치료하는데 사용된 최초의 단일 면역치료제였다. 그 후로, IL-2의 경우 전이된 흑생종(metastatic melanoma)에도 사용되었다. IL-2 하나로 암을 치료하는 데에 사용되기도 하였으며, 백신과 함께 치료되기도 하였다. IL-2는 면역체계를 도와서 세포가 빨리 자라고 분열하게 만든다. 그러나 IL-2를 이용한 치료는 감기와 비슷한 오한, 열, 피로 및 착란증상(confusion)과 같은 부작용을 나타내었다. IL-2 패밀리(family)에 속하는 IL-15과 IL-21 역시 암 치료제로서 단일제 혹은 보조제로서 연구되고 있다.
IL-21은 알파-헬릭스(α-helix) 구조를 갖는 사이토카인의 한 종류로서, IL-21의 수용체와 감마쇄(γ-chain)를 이용한 신호전달과정을 통해서 염증성 반응을 일으킨다. IL-21은 골수로부터의 NK세포 전구체의 성숙을 유도하는 것으로 보고되었으며 (Parrish-Novak J., et al., Nature, 408: 57-63, 2000), 특히 NK세포의 사이토카인 생성능과 세포사멸능과 같은 효과 기능(effector functions)을 증가시키는 것으로 보고되었고 (Strengell M, et al., J Immunol., 170: 5464-5469, 2003;Brady J, et al., J Immunol., 172: 2048-2058, 2004), CD8+ T 세포의 효과 기능도 증가시킴으로써 내재, 적응면역계의 항암반응을 촉진시키는 것으로 보고되었다 (Takaki R., et al., J Immunol., 175: 2167-2173, 2005; Moroz A., et al., J Immunol, 173: 900-909, 2004). 또한, 인간의 말초혈액에서 분리한 NK세포를 활성화시키며 (Parrish-Novak J., et al., Nature, 408: 57-63, 2000), 제대혈에서 분리한 조혈줄기세포로부터 성숙한 NK세포를 유도하는데 중요한 역할을 하는 것이 보고되었다 (Sonia A. P, et al., Int. immunol., 18: 49-58, 2006).
VcamI은 CD106으로도 알려져 있으며, 세포 부착분자로써 기능을 가지고 있다 (Cybulsky M., et al., Cytogenet. Cell Genet. 58: 1852, 1991). 구조는 6~7개의 면역글로불린 도메인(immunoglobulin doamin)으로 구성되어 있으며, 여러 사이토카인들에 의해 자극된 내피세포의 크고 작은 혈관에서 발현된다고 보고되었다 (Barreiro,. et al,. J. Cell Biol. (United States) 157 (7): 123345. 2002). 그리고, 림프구, 단핵세포, 호산 백혈구, 호염기성 세포가 혈관내포조직에 부착하는데 기여를 하고, 백혈구의 내피세포에 대한 신호형질도입기능을 한다고 보고되었으며, 아테롬성 동맥경화증이나 류마티즘성 관절염의 발달에서 중요한 역할을 하는 것으로 보고되어 있다 (Yonekawa K,. et al,. J. Leukoc. Biol. 77 (2): 129-40. 2005).
IL-2(Interleukin-2)는 면역반응을 일으키는 세포인 림프구에 의해서 발현되는 IL-2 수용체와 결합을 하여 면역반응을 중재하고, 병원성 세균 침입으로부터 반응을 하는 면역계 신호분자 형태인 인터루킨으로 면역반응을 하는 동안 신체에서 정상적으로 생산된다는 보고가 있다 (Smith KA,. Science. 240 (4856): 116976. 1988. Stern J,. et al,. Science. 233 (4760): 2036. 1986). IL-2의 분비와 IL-2 수용체의 발현은 T세포에 결합하는 항원의 자극에 의해서 이루어진다. 그리고, 이 둘의 상호작용은 항원선택성 세포독성 T세포(antigen-selected cytotoxic T cell)의 생존, 분화, 성장을 자극하게 한다는 보고 (Beadling C,. et al,. Proc. Nat. Acad. Sci. U.S.A. 90 (7): 271923. 1993. Beadling CB,. et al,. Med. Immunol. 1 (1): 2. 2002.)가 있으며, 조절유전자 T세포의 성숙분열을 위해 흉선에서 T세포의 분화에 필수적이라는 보고가 있다 (Sakaguchi S,. et al,. J. Immunol. 155 (3): 115164. 1995. Shevach EM,. et al,. J. Exp. Med. 188 (2): 28796. 1998). IL-2는 IL-15와 유사한 기능을 갖는 것으로 밝혀졌으며, 자연 살해 세포의 분화와 증식을 유도하고 B세포에 의해 만들어지는 면역글로불린의 생산을 촉진시키는 사이토카인으로 보고되고 있다 (Waldmann TA,. Nature Rev. Immun. 6 (8): 595601. 2006).
IL-10(Interleukin-10)은 인체에서 사이토카인 합성을 저해하는 것으로 잘 알려진 항 염증사이토카인이며, IL-10 유전자에 의해 암호화 된다 (Eskdale J,. et al,. Immunogenetics 46 (2): 1208. 1997). 그리고, 면역조절과 염증반응에서 다면발현적 효과를 나타내는 것으로 밝혀졌으며, Th1 사이토카인들, MHC ClassⅡ 항원들, 대식세포의 자극분자들의 발현을 하향 조절 하며, B세포의 생존, 분화, 항체생산을 향상시키며, JAK-STAT 신호전달 경로에서 NF-kB의 활동을 차단한다. 또한, 인체에서 과도하게 일어나는 면역반응을 중화하는데 중요한 작용을 한다는 보고가 있으며 (Braat H,. et al,. Clin. Gastroenterol. Hepatol. 4 (6): 7549. 2006), IFN-γ, IL-2, IL-3, TNF-alpha, GM-CSF와 같은 염증사이토카인들의 합성을 저해하는 것으로 보고되어 있다 (Grimbaldeston MA,. et al,. Nat. Immunol. 8 (10): 1095104. 2007).
염증관련 면역세포들이 염증부위를 인지하여 염증이 일어난 병변부위로 찾아갈 수 있는 능력을 갖고 있는 사실은 잘 알려져 있다. 면역세포의 이러한 염증부위의 타겟팅 능력은 면역세포의 세포막에 존재하는 수용체와 이 수용체의 리간드에 의해서 일어날 수 있다.
이에 본 발명자들은 이러한 면역세포의 세포막에 존재하는 수용체의 염증부위 타겟팅 능력에 착안하여 주요 염증관련 인간세포에 존재하는 수용체들의 리간드 결합부위를 수용성 수용체(soluble receptor)로 발현한 뒤 이들을 Quantum dot으로 표지함으로써 염증이 유도된 마우스에서 가장 우수한 염증 타겟팅 능력을 갖는 수용성 수용체를 발굴하고, 또한 발굴된 수용성 수용체를 다양한 약물과 결합시켜 염증부위로의 약물전달을 위한 운반체(carrier)로 사용하고자 본 발명을 완성하였다.
본 발명자들은 IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB에 대한 염증 부위 타겟팅 효과를 확인하였으며, 염증 타겟팅 능력이 가장 우수한 IL21R의 기존의 염증억제 약물 운반체(carrier)로서의 가능성을 알아보기 위하여, IL21R-TNFR2-Fc 융합 수용체 및 Humira-IL21R 융합 항체를 제조하였으며, 상기 융합 수용체 및 융합 항체에 Quantum-dot을 표지한 후 생체 내 염증 타겟팅 능력을 확인한 결과, IL21R가 염증 질환 치료용 약물의 운반체로 사용할 수 있음을 확인함으로써, 본 발명을 완성하였다.
본 발명의 목적은 IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB 단백질 또는 상기 단백질의 세포 외 영역을 포함하는 단편을 유효성분으로 포함하는 염증표적 수용체 및 염증 질환 치료용 약물 운반체 등을 제공하고자 하는 것이다.
상기의 목적을 달성하기 위하여, 본 발명은 IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편에 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물을 제공한다.
또한, 본 발명은 IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편, 및 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법을 제공한다
본 발명의 융합 단백질 또는 융합 항체는 염증 표적 능력이 우수하며, 대표적인 항 염증 수용체 약물인 TNFR2-Fc 융합단백질(Enbrel)에 비하여 현저히 우수한 염증 타겟팅 효과를 가지며, 따라서 염증 부위로 약물을 전달하는 운반체(carrier)로서 사용될 수 있는바, 융합된 염증 질환 억제제 또는 면역 증강제의 염증 질환 치료 또는 면역조절 치료 효과를 상승시키는 효과를 갖는다.
도 1은 IL21R의 구조를 나타낸 것이다.
도 2는 IL21R 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL21R)의 구조를 나타낸 것이다.
도 3은 발현된 IL21R의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 4는 IL21R 세포외 도메인Ⅰ(IL21R-D1)을 클로닝한 발현벡터(pYK602-His-Fc::IL21R-D1)의 구조를 나타낸 것이다.
도 5는 IL21R-D1의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 6은 IL21R 세포외 도메인Ⅱ(IL21R-D2)를 클로닝한 발현벡터(pYK602-His-Fc::IL21R-D2)의 구조를 나타낸 것이다.
도 7은 발현된 IL21R-D2의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 8은 VcamI 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::VcamI)의 구조를 나타낸 것이다.
도 9는 발현된 VcamI의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 10은 IL2RB 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL2RB)의 구조를 나타낸 것이다.
도 11은 발현된 IL2RB의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 12는 IL3RA 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL3RA)의 구조를 나타낸 것이다.
도 13은 발현된 IL3RA의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 14는 IL13RA1 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL13RA1)의 구조를 나타낸 것이다.
도 15는 발현된 IL13RA1의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 16은 CRLF1 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::CRLF1)의 구조를 나타낸 것이다.
도 17은 발현된 CRLF1의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 18은 IL17RA 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL17RA)의 구조를 나타낸 것이다.
도 19는 발현된 IL17RA의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 20은 IL2RG 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL2RG)의 구조를 나타낸 것이다.
도 21은 발현된 IL2RG의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 22는 IL10RB 세포외 도메인을 클로닝한 발현벡터(pYK602-His-Fc::IL10RB)의 구조를 나타낸 것이다.
도 23은 발현된 IL10RB의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 24는 Humira 항체의 경쇄 영역(light chain)을 클로닝한 발현벡터(pNATABL)의 구조를 나타낸 것이다.
도 25는 Humira 항체의 중쇄 영역(heavy chain)을 클로닝한 발현벡터(pNATABH)의 구조를 나타낸 것이다.
도 26은 발현된 Humira 항체의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 27은 Humira HC/IL21R를 클로닝한 발현벡터(pNATABH:: Humira HC/IL21R)의 구조를 나타낸 것이다.
도 28은 발현된 Humira HC/IL21R의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 29는 IL21R/Humira HC을 클로닝한 발현벡터(pNATABH:: IL21R/Humira HC)의 구조를 나타낸 것이다.
도 30은 발현된 IL21R/Humira HC의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 31은 IL21R과 TNFR2의 융합 구조(IL21R/TNFR2)이다.
도 32는 IL21R/TNFR2 융합 수용체를 클로닝한 발현벡터(pYK602-His-Fc::IL21R+TNFR2)의 구조를 나타낸 것이다.
도 33은 발현된 IL21R/TNFR2의 웨스턴 블롯 결과(a) 및 QC 테스트 결과(b)이다.
도 34는 Quantum Dot의 나노결정 구조를 나타낸 그림이다.
도 35는 Quantum Dot의 나노결정의 상대적인 크기를 비교한 것이다.
도 36은 Qdot과 biomolecule의 결합하는 과정을 나타낸 모식도이다.
도 37은 CIA 동물 모델을 만드는 과정을 나타낸 것이다.
도 38은 Control 실험으로 Q-dot을 붙인 Enbrel과 Fc control을 in vivo imaging 수행한 결과를 나타낸 것이다.
도 39는 CIA 동물 모델을 이용한 생체 영상 진단 결과(A), 생체 내 이미징(in vivo imaging)을 확인하기 위해 사용한 Q-DOT 800의 파장을 나타낸 그래프(B) 및 미정맥내 주사한 5일 후엔 QDs이 체외로 배출되는 것(C)을 나타낸 것이다.
도 40은 도 39의 결과를 표로 나타낸 것으로 염증 타겟팅이 강할수록 +를 많이 부여하였다.
도 41은 Qdot 표지된 IL21R, IL21R-DomainI 및 IL21R-DomainⅡ 가 생체 내에서 염증 타겟팅 능력이 있음을 나타내는 생체 이미징 결과이다.
도 42는 Qdot 표지된 IL21R/TNFR2가 생체 내에서 염증 타겟팅 능력이 있음을 나타내는 생체 이미징 결과이다.
도 43은 Qdot 표지된 Humira, Humira/IL21R 및 IL21R/Humira가 생체 내에서 염증 타겟팅 능력이 있음을 나타내는 생체 이미징 결과이다.
본 발명은 IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편에 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물을 제공한다.
본 발명에 있어서, 상기 IL21R(Interlukin 21 receptor)의 세포외 영역을 포함하는 단편은 서열번호 4, VcamI(Vascular cell adhesion molecule 1)의 세포외 영역을 포함하는 단편은 서열번호 14, IL2RB(Interleukin-2 receptor subunit beta)의 세포외 영역을 포함하는 단편은 서열번호 18, IL3RA(Interleukin 3 receptor, alpha)의 세포외 영역을 포함하는 단편은 서열번호 22, IL13RA1(Interleukin 13 receptor, alpha 1)의 세포외 영역을 포함하는 단편은 서열번호 26, CRLF1(Cytokine receptor like factor 1)의 세포외 영역을 포함하는 단편은 서열번호 30, IL17RA(Interleukin 17 receptor A)의 세포외 영역을 포함하는 단편은 서열번호 34, IL2RG(Interleukin-2 receptor subunit gamma)의 세포외 영역을 포함하는 단편은 서열번호 38, IL10RB(Interleukin 10 receptor, beta)의 세포외 영역을 포함하는 단편은 서열번호 42의 아미노산 서열을 갖는 폴리펩티드를 포함하는 것을 특징으로 한다.
또한, 본 발명에서 상기 염증 질환 억제제는 TNFR2(Tumor necrosis factor receptor type 2)의 세포외 영역, CTLA-4(Orencia)의 세포외 영역, IL-1 길항제(antagonist), Humira 항체, 항 CXCL10 항체, 항 IL6R 항체 또는 항 IL6 항체를 포함할 수 있으나 이에 한정되지 않는다.
또한, 본 발명에서 상기 단백질의 세포외 영역을 포함하는 단편은 염증 질환 억제제 또는 면역 증강제의 C-term 방향 또는 N-term 방향으로 융합하는 것을 특징으로 한다.
본 발명은 또한, IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편, 및 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법을 제공한다.
본 발명에서 상기 단백질의 세포 외 영역을 포함하는 단편은 상기와 같이 각각 서열번호 4, 서열번호 18, 서열번호 22, 서열번호 26, 서열번호 30, 서열번호 34, 서열번호 38 또는 서열번호 42의 아미노산 서열을 갖는 폴리펩티드를 포함하는 것을 특징으로 한다.
또한, 본 발명에서 염증 질환 억제제는 상기 기재한 바와 같으며, 상기 단백질의 세포외 영역을 포함하는 단편은 염증 질환 억제제 또는 면역 증강제의 C-term 방향 또는 N-term 방향으로 융합하는 것을 특징으로 한다.
본 발명의 구체적인 실시예에서, 본 발명자들은 IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL2RG, IL10RB에 대한 염증 타겟팅 효과를 확인하였다. IL21R을 비롯한 여러 사이토카인들이 염증부위를 타겟팅함으로써 발생하는 능력을 Enbrel의 염증 타겟팅 능력과 비교하여 염증 타겟팅 정도를 나타낸 결과 IL21R, VcamI, IL21RB, IL2RG, IL10RB가 염증 부위에 특이적 결합력이 매우 우수하였고, IL13RA1, IL17RA는 우수하였으며, IL3RA, CRLF1는 보통인 것을 확인하였다. 따라서, 이 결과를 통해 우리가 선별한 염증관련 수용체들인 IL21R, VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA 모두 염증부위를 타겟팅 하는 것을 관찰 하였으며, 이중에서 Enbrel과 비교하였을 때 염증 타겟팅 능력이 Enbrel과 비슷하거나 매우 강하게 나타내는 염증관련 수용성 수용체인 IL21R, VcamI, IL21RB, IL2RG, IL10RB를 확인하였다. 특히, 염증 타겟팅 능력이 가장 우수한 IL21R을 기존의 염증억제 약물의 케리어로서의 가능성을 알아보기 위하여, 먼저 대표적인 항 염증 수용체 약물인 TNFR2-Fc 융합단백질(Enbrel)과 융합 하여 IL21R-TNFR2-Fc를 제조하였으며, 이 융합수용체에 Quantum-dot을 표지한 후 생체 내 염증 타겟팅 능력을 확인해 본 결과, Enbrel의 염증 타겟팅 능력보다 IL21R/TNFR2 융합수용체의 염증 타겟팅 능력이 훨씬 강한 것을 확인하였으며, 이러한 IL21R의 염증부위 타겟팅 을 위한 케리어로서의 능력은 TNF-알파의 중화 항체인 Humira에서도 검증되었다. 즉 humira 항체의 중쇄의 N-말단(IL21R-Humira) 및 humira 항체의 중쇄의 C-말단(Humira-IL21R)의 융합 단백질에 Quantum-dot을 표지한 후 in-vivo 염증 타겟팅 능력을 확인해 본 결과 Humira-IL21R이 humira 대비 우수한 염증 타겟팅 능력을 확인함으로써, IL21R의 염증부위 타겟팅의 케리어로 사용할수 있음을 함으로써, 본 발명을 완성하였다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 염증성 사이토카인의 수용성 수용체 제조
본 발명자들은 IL21R을 비롯한 염증관련 수용체인 VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA를 수용성 수용체로 얻기 위하여, 아래와 같이 사이토카인 각각의 세포외 도메인(extracellular domain)만을 취하여 발현시켰다.
위의 여러 유전자들의 세포외 도메인(extracellular domain)을 확보하기 위해 적절한 프라이머(primer)를 디자인한 후, cDNA Library mix (Kidney, placenta, pancrease, liver)를 주형으로 하여 중합효소 연쇄 반응(PCR, polymerase chain reaction)을 함으로써 증폭된 산물을 얻었다.
PCR 반응 조건은 전체 반응액이 50 ㎕일 때, 주형은 100 ng이 되도록 넣어 주었고, pfu 폴리머라제(제노텍, Korea) 2.5 unit, 정방향과 역방향 프라이머를 각각 10 pmole/50 ㎕ 넣고, 남은 부피를 증류수로 채워 총 50 ㎕의 반응액을 조성한 후, 94℃에서 2분 후, 94℃ 30초, 58℃ 30초, 72℃ 1분으로 30 사이클을 반복하여 유전자를 증폭시킨 후, 72℃에서 10분간 반응시켜 PCR 산물을 얻었다.
다음으로, SfiI(#R033S, Enzynomics, Korea) 제한효소로 자르고, 아가로스 겔 (#9002-18-0, BIO BASIC INC, USA)에 로딩(loading) 한 다음, 겔 정제 키트(Gel Purification kit)(#1014876, QIAGEN, USA)를 이용하여 벡터에 삽입할 인서트(insert)를 확보하였다.
제한효소 절단 반응은 1 ㎍ DNA를 자르는데, SfiI(10 unit) 1 ㎕와 10x 반응버퍼(reaction buffer) 5 ㎕를 혼합한 후 멸균증류수를 넣어 총 부피가 50 ㎕ 되게 하고, 37℃ 온탕기에서 6시간 동안 반응을 시킨 다음 아가로스 겔(agarose gel)로부터 분리 정제를 수행하였다.
그런 다음, 상기 인서트를 포유류(mammalian) 발현 벡터인 pYK602-Fc 벡터에 삽입하기 위해, T4 DNA ligase(#M001S, Enzynomics, korea)를 이용하여 라이게이션(ligation)을 수행하였다. 라이게이션(ligation) 반응은 벡터와 인서트(insert)를 1(50 ng) : 3(150 ng) 비로 하여, 리가아제(ligase, 10 unit) 1 ㎕와 10x 반응버퍼(reaction buffer) 1 ㎕를 혼합한 후, 16℃에서 16시간 이상 라이게이션 과정을 거쳐 유전자가 삽입된 발현 벡터를 확보하였다.
이하 본 발명의 실시예에서 제한효소 절단 반응과 라이게이션(ligation) 반응은 상기와 같은 조건하에서 동일하게 수행하였다.
상기 확보된 유전자가 삽입된 벡터(ligates)를 E.coli 세포에 형질전환 시킨 후, 형성된 콜로니(colony)를 서열분석(sequencing)함으로써 pYK602-Fc 발현 벡터에 올바르게 삽입된 클론(clone)을 확보하였다. 상기 확보된 클론으로 midi prep (#740 410.100, MACHERY-NAGEL, Germany)을 수행한 후, 동물세포(mammalian cell)인 293E 세포에 형질주입(transfection)함으로써 염증관련 수용성 수용체들의 발현률을 확인하고, 대량 배양하여 각각의 염증관련 수용성 수용체 단백질들을 확보하였다.
그리고, IL21R/TNFR2와 같은 융합 수용성 수용체는 분자생물학적인 방법인 overlapping PCR로 융합을 하여 위의 동일한 방법으로 발현 및 배양 과 정체를 수행하여 융합 단백질을 확보하였다. 항체인 Humira와 융합항체인 Humira/IL21R, IL21R/Humira는 유전자 합성을 통하여 합성을 통해 확보하였고, 융합항체 단백질도 위와 같은 동일한 방법을 이용하여 확보하였다.
이하 실시예2 내지 실시예14는 벡터에 삽입할 IL21R, VcamI, IL2RB, IL3RA, IL13RA1, CRLF1, IL17RA, IL21R/TNFR2, IL2RG, IL10RB 및 Humira, Humira/IL21R, IL21R/Humira에 대한 구조(construction)와 PCR 증폭, 정제 과정 및 QC 과정을 나타낸 것으로 모든 과정은 동일한 조건하에서 수행하였다.
실시예 2. IL21R(Interlukin 21 receptor) 수용성 수용체 제조
IL21R(Interlukin 21 receptor)은 2개의 도메인(domain)으로 이루어져 있으며, IL21R의 구조를 도 1에 간략히 나타내었다.
도 1에 나타난 바와 같이, IL21R의 세포외 도메인(Domain)은 도메인I과 도메인Ⅱ로 구성된 사이토카인이다. IL21R의 세포외 도메인의 전체 길이는 636bp로 212 amino acid로 되어 있으며, 도메인I은 300bp로 100 amino acid, 그리고, 도메인Ⅱ는 411bp로 137 amino acid로 되어 있다.
본 발명에서는 IL21R의 세포외 도메인 전체 부분(extra-cellular domain full length), IL21R의 세포외 도메인I 및 IL21R의 세포외 도메인Ⅱ를 각각 pYK602-His Fc에 클로닝 하였다.
2-1. IL21R-Fc의 제조 (IL21R extra-cellular domain full length)
IL21R의 세포외 도메인 전체 부분 (extra-cellular domain full length)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 2에 나타내었으며, 구체적으로 도 2는 동물세포 발현벡터인 pYK602-His-Fc에 IL21R을 삽입한 도면으로 벡터와 IL21R을 제한효소 SfiI으로 자른 다음, IL21R을 삽입 했을 때 예상되는 벡터 구조를 나타낸다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 1) 및 역방향 프라이머(서열번호 2) 서열은 아래와 같다. IL21R의 세포 외 도메인은 서열번호 3의 DNA 서열 또는 서열번호 4의 아미노산 서열로 기재된다.
IL21R-F(SfiI) : agggggccgtgggggcccccgacctcgtctgctacac
IL21R-R(SfiI) : tagcggccgacgcggccaattcctttaactcctctgact
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
20개의 150 mm 플레이트에서 2일, 5일, 7일, 9일 때에 걷은 상층액 총 0.6 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL21R)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 배양 상층액 600 ㎖에서 IL21R을 총 1.0 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL21R을 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2일 후, 5일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL21R의 단백질 순수도와 정량을 측정하였다. IL21R의 순수도는 98%로 확인되었으며, IL21R의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 3에 나타내었다.
2-2. IL21R-D1-Fc의 제조 (IL21R extra-cellular domain Ⅰ)
IL21R의 세포외 도메인 Ⅰ(extra-cellular domain Ⅰ:D1)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 4에 나타내었다. 구체적으로 도 4는 동물세포 발현벡터인 pYK602-His-Fc에 IL21R-D1을 삽입한 도면으로 벡터와 IL21R-D1을 제한효소 SfiI으로 자른 다음, IL21R-D1을 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 1) 및 역방향 프라이머(서열번호 5) 서열은 아래와 같다. IL21R의 세포 외 도메인Ⅰ은 서열번호 6의 DNA 서열 또는 서열번호 7의 아미노산 서열로 기재된다.
IL21R-F(SfiI) : agggggccgtgggggcccccgacctcgtctgctacac
IL21R-D1-R(SfiI) : tagcggccgacgcggccaacttgatgctctcagccagga
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
20개의 150 mm 플레이트에서 2일, 5일, 7일 때에 걷은 상층액 총 1.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL21R-D1)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 배양 상층액 1.0 ℓ에서 IL21R-D1를 총 1.6 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL21R-D1을 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL21R-D1의 단백질 순수도와 정량을 측정하였다. IL21R-D1의 순수도는 96%로 확인되었으며, IL21R-D1의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 5에 나타내었다.
2-3. IL21R-D2-Fc의 제조 (IL21R extra-cellular domain Ⅱ)
IL21R의 세포외 도메인 Ⅱ(extra-cellular domain Ⅱ:D2)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 6에 나타내었다. 구체적으로 도 6은 동물세포 발현벡터인 pYK602-His-Fc에 IL21R-D2를 삽입한 도면으로 벡터와 IL21R-D2를 제한효소 SfiI으로 자른 다음, IL21R-D2를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 8) 및 역방향 프라이머(서열번호 2) 서열은 아래와 같다. IL21R의 세포 외 도메인Ⅰ은 서열번호 9의 DNA 서열 또는 서열번호 10의 아미노산 서열로 기재된다.
IL21R-D2-F(SfiI) : agggggccgtgggggccgtcaacatcacagaccagtct
IL21R-R(SfiI) : tagcggccgacgcggccaattcctttaactcctctgact
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 5일, 7일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL21R-D2)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 7에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL21R-D2를 총 2.0 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL21R-D2를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL21R-D2의 단백질 순수도와 정량을 측정하였다. IL21R-D2의 순수도는 92%로 확인되었으며, IL21R-D2의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 7에 나타내었다.
실시예 3. VcamI(Vascular cell adhesion molecule 1)-Fc 제조
VcamI(Vascular cell adhesion molecule 1)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 8에 나타내었다. 구체적으로 도 8은 동물세포 발현벡터인 pYK602-His-Fc에 VcamI을 삽입한 도면으로 벡터와 VcamI을 제한효소 SfiI으로 자른 다음, VcamI을 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 11) 및 역방향 프라이머(서열번호 12) 서열은 아래와 같다. IL21R의 세포 외 도메인Ⅰ은 서열번호 13의 DNA 서열 또는 서열번호 14의 아미노산 서열로 기재된다.
VcamI-F(SfiI) : agggggccgtgggggccccagaatctagatatcttgct
VcamI-R(SfiI) : tagcggccgacgcggccaatccttgaacatcaagtgttaa
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 4일, 6일, 8일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(VcamI)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 9에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 VcamI을 2.0 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 VcamI을 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 4, 6, 8일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 VcamI의 단백질 순수도와 정량을 측정하였다. VcamI의 순수도는 97.5%로 확인되었으며, VcamI의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 9에 나타내었다.
실시예 4. IL2RB(Interleukin-2 receptor subunit beta)-Fc 제조
IL2RB(Interleukin-2 receptor subunit beta)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 10에 나타내었다. 구체적으로 도 10은 동물세포 발현벡터인 pYK602-His-Fc에 IL2RB를 삽입한 도면으로 벡터와 IL2RB를 제한효소 SfiI으로 자른 다음, IL2RB1를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 15) 및 역방향 프라이머(서열번호 16) 서열은 아래와 같다. IL2RB의 세포 외 도메인은 서열번호 17의 DNA 서열 또는 서열번호 18의 아미노산 서열로 기재된다.
IL2RB-F(SfiI) : agggggccgtgggggccgcagcggtgaatggcacttcc
IL2RB-R(SfiI) : tagcggccgacgcggccaacctgaaggccaggggctg
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 4일, 6일, 9일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL2RB)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 11에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL2RB를 1.6 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL2RB를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 4, 6, 9일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL2RB의 단백질 순수도와 정량을 측정하였다. IL2RB의 순수도는 98%로 확인되었으며, IL2RB의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 11에 나타내었다.
실시예 5. IL3RA(Interleukin 3 receptor, alpha)-Fc 제조
IL3RA(Interleukin 3 receptor, alpha)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 12에 나타내었다. 구체적으로 도 12는 동물세포 발현벡터인 pYK602-His-Fc에 IL3RA를 삽입한 도면으로 벡터와 IL3RA를 제한효소 SfiI으로 자른 다음, IL3RA를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 19) 및 역방향 프라이머(서열번호 20) 서열은 아래와 같다. IL3RA의 세포 외 도메인은 서열번호 21의 DNA 서열 또는 서열번호 22의 아미노산 서열로 기재된다.
IL3RA-F(SfiI) : agggggccgtgggggccaaggaagatccaaacccacca
IL3RA-R(SfiI) : tagcggccgacgcggccaagcgctggggggtgctccag
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 5일, 7일, 9일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL3RA)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 13에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL3RA를 1.2 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL3RA를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL3RA의 단백질 순수도와 정량을 측정하였다. IL3RA의 순수도는 95.3%로 확인되었으며, IL3RA의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 13에 나타내었다.
실시예 6. IL13RA1(Interleukin 13 receptor, alpha 1)-Fc 제조
IL13RA1(Interleukin 13 receptor, alpha 1)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 14에 나타내었다. 구체적으로 도 14는 동물세포 발현벡터인 pYK602-His-Fc에 IL13RA1을 삽입한 도면으로 벡터와 IL13RA1을 제한효소 SfiI으로 자른 다음, IL13RA1을 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 23) 및 역방향 프라이머(서열번호 24) 서열은 아래와 같다. IL13RA1의 세포 외 도메인은 서열번호 25의 DNA 서열 또는 서열번호 26의 아미노산 서열로 기재된다.
IL13RA1-F(SfiI) : agggggccgtgggggccgacaccgagataaaagttaa
IL13RA1-R(SfiI) : tagcggccgacgcggccaagcattgtttatcactccact
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 4일, 6일, 8일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL13RA1)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 15에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL13RA1를 1.1 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL13RA1을 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 4, 6, 8일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL13RA1의 단백질 순수도와 정량을 측정하였다. IL13RA1의 순수도는 95.4%로 확인되었으며, IL13RA1의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 15에 나타내었다.
실시예 7. CRLF1(Cytokine receptor like factor 1)-Fc 제조
CRLF1(Cytokine receptor like factor 1)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 16에 나타내었다. 구체적으로 도 16은 동물세포 발현벡터인 pYK602-His-Fc에 CRLF1을 삽입한 도면으로 벡터와 CRLF1을 제한효소 SfiI으로 자른 다음, CRLF1을 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 27) 및 역방향 프라이머(서열번호 28) 서열은 아래와 같다. CRLF1의 세포 외 도메인은 서열번호 29의 DNA 서열 또는 서열번호 30의 아미노산 서열로 기재된다.
CRLF1-F(SfiI) : agggggccgtgggggccgcccacacagctgtgatcag
CRAF1-R(SfiI) : tagcggccgacgcggccaaactgcggggagtggaggcg
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 4일, 6일, 8일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(CRLF1)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 17에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 CRLF1를 1.8 ㎎를 얻었다.
pYK602-His-Fc에 삽입된 CRLF1을 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7, 9일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 CRLF1의 단백질 순수도와 정량을 측정하였다. CRLF1의 순수도는 94.4%로 확인되었으며, CRLF12의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 17에 나타내었다.
실시예 8. IL17RA(Interleukin 17 receptor A)-Fc 제조
IL17RA(Interleukin 17 receptor A)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 18에 나타내었다. 구체적으로 도 18은 동물세포 발현벡터인 pYK602-His-Fc에 IL17RA를 삽입한 도면으로 벡터와 IL17RA를 제한효소 SfiI으로 자른 다음, IL17RA를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 31) 및 역방향 프라이머(서열번호 32) 서열은 아래와 같다. IL17RA의 세포 외 도메인은 서열번호 33의 DNA 서열 또는 서열번호 34의 아미노산 서열로 기재된다.
IL17RA-F(SfiI) : agggggccgtgggggccctgcgactcctggaccaccg
IL17RA-R(SfiI) : tagcggccgacgcggccaatggagtgtctggcatttctg
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트(# 430599 Corning USA)에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 150 mm 플레이트에서 2일, 5일, 7일, 9일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL17RA)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 19에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL17RA를 1.8 ㎎를 얻었다.
pYK602-His-Fc에 삽입된 IL17RA를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7, 9일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL17RA의 단백질 순수도와 정량을 측정하였다. IL17RA의 순수도는 89.4%로 확인되었으며, IL17RA의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 19에 나타내었다.
실시예 9. IL2RG(Interleukin-2 receptor subunit gamma)-Fc 제조
IL2RG(Interleukin-2 receptor subunit gamma)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 20에 나타내었다. 구체적으로 도 20은 동물세포 발현벡터인 pYK602-His-Fc에 IL2RG를 삽입한 도면으로 벡터와 IL2RG를 제한효소 SfiI으로 자른 다음, IL2RG를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 35) 및 역방향 프라이머(서열번호 36) 서열은 아래와 같다. IL2RG의 세포 외 도메인은 서열번호 37의 DNA 서열 또는 서열번호 38의 아미노산 서열로 기재된다.
IL2RG-F(SfiI) : agggggccgtgggggccaacacgacaattctgacgcccaa
IL2RG-R(SfiI) : tagcggccgacgcggccaaagtattgctcccccagtggatt
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 100 mm 플레이트(# 430599 Corning USA)에 80~90% 면적을 차지할 정도로 심은(plating) 후, DNA 13 ㎍과 PEI(#23966, Polysciences, USA) 26 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 100 mm 플레이트에서 2일, 4일, 6일, 9일 때에 걷은 상층액 총 2.0L를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL2RG)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 21에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL2RG를 2.2 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL2RG를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 4, 6, 9일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL2RG의 단백질 순수도와 정량을 측정하였다. IL2RG의 순수도는 93.6%로 확인되었으며, IL2RG의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 21에 나타내었다.
실시예 10. IL10RB(Interleukin 10 receptor, beta)-Fc 제조
IL10RB(Interleukin 10 receptor, beta)의 세포외 도메인(extra-cellular domain)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 22에 나타내었다. 구체적으로 도 22는 동물세포 발현벡터인 pYK602-His-Fc에 IL10RB를 삽입한 도면으로 벡터와 IL10RB를 제한효소 SfiI으로 자른 다음, IL10RB를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI 제한효소 서열을 포함하는 정방향 프라이머(서열번호 39) 및 역방향 프라이머(서열번호 40) 서열은 아래와 같다. IL10RB의 세포 외 도메인은 서열번호 41의 DNA 서열 또는 서열번호 42의 아미노산 서열로 기재된다.
IL10RB-F(SfiI) : agggggccgtgggggcccatgggacagagctgcccag
IL10RB-R(SfiI) : tagcggccgacgcggccaaatactgcctggtgagggagat
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 100 mm 플레이트(# 430599 Corning USA)에 80~90% 면적을 차지할 정도로 심은(plating) 후, DNA 13 ㎍과 PEI(#23966, Polysciences, USA) 26 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 100 mm 플레이트에서 2일, 4일, 6일, 9일 때에 걷은 상층액 총 2.0L를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL10RB)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 23에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL10RB를 1.5 ㎎을 얻었다.
pYK602-His-Fc에 삽입된 IL10RB를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 4, 6, 8일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL10RB의 단백질 순수도와 정량을 측정하였다. IL10RB의 순수도는 95%로 확인되었으며, IL10RB의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 23에 나타내었다.
실시예 11. Humira 항체의 제조
11-1.Humira light chain
Humira 항체의 경쇄 영역을 pNATABL에 클로닝한 발현 벡터의 구조를 도 24에 나타내었다. 구체적으로 도 24는 동물세포 발현벡터인 pNATABL에 Humira 경쇄를 삽입한 도면으로 벡터와 Humira 경쇄를 제한효소 SfiI, BglⅡ으로 자른 다음, Humira 경쇄를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI(#R033S, enzynomic, korea) 제한효소 서열을 포함하는 정방향 프라이머(서열번호 43) 및 BglⅡ(#R010s, enzynomics, Korea) 제한효소 서열을 포함하는 역방향 프라이머(서열번호 44) 서열은 아래와 같다. Humira 항체 경쇄 영역은 서열번호 45의 DNA 서열 또는 서열번호 46의 아미노산 서열로 기재된다.
NATVK1-1(SfiI) : ttggtggccacagcggccgatgtccactcggacatccagatgacccagtc
NATJK-R4(BglⅡ) : gaggagagatcttttgatttccaccttggt
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
11-2.Humira heavy chain
Humira 항체의 중쇄 영역을 pNATABL에 클로닝한 발현 벡터의 구조를 도 25에 나타내었다. 구체적으로 도 25는 동물세포 발현벡터인 pNATABL에 Humira 중쇄를 삽입한 도면으로 벡터와 Humira 중쇄를 제한효소 SfiI, NheI으로 자른 다음, Humira 중쇄를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI(#R033S, enzynomic, korea) 제한효소 서열을 포함하는 정방향 프라이머(서열번호 47) 및 NheI(#R016s, enzynomics, Korea) 제한효소 서열을 포함하는 역방향 프라이머(서열번호 48) 서열은 아래와 같다. Humira 항체 중쇄 영역은 서열번호 49의 DNA 서열 또는 서열번호 50의 아미노산 서열로 기재된다.
NATVH3-4(SfiI) : TTGGTGGCCACAGCGGCCGATGTCCACTCGGAGGTGCAGCTGGTGCAGTC
NATJH-all(NheI) : GAGGAGGCTAGCTGAGGAGACGGTGA
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 100 mm 플레이트에 80~90% 면적을 차지할 정도로 심은(plating) 후, DNA(중쇄 : 경쇄 = 4 : 6) 13 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 100 mm 플레이트에서 3일, 5일, 7일, 9일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(Humira 항체)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 26에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 Humira 항체를 8.7 ㎎을 얻었다.
중쇄발현 벡터와 경쇄발현 벡터에 삽입된 Humira의 경쇄와 중쇄를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 3, 5일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 Humira 항체의 단백질 순수도와 정량을 측정하였다. Humira 항체의 순수도는 96.8%로 확인되었으며, Humira 항체의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 26에 나타내었다.
실시예 12. Humira/IL21R 융합 항체의 제조
Humira 항체의 중쇄 영역이 삽입된 pNATABL에 C-term 방향으로 IL21R을 삽입함으로써 Humira와 IL21R의 융합 항체를 제작하였으며, 클로닝한 발현 벡터의 구조를 도 27에 나타내었다. 구체적으로 도 27은 동물세포 항체의 중쇄 발현벡터 pNATABH에 Humira 중쇄와 IL21R의 C-말단 융합체를 삽입한 도면으로 벡터와 Humira 중쇄와 IL21R의 C-말단 융합체를 제한효소인 SfiI, NheI으로 자른 다음, Humira 중쇄와 IL21R의 C-말단 융합체를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 IL21R 정방향 프라이머(서열번호 51) 및 XhoI(#R007S, enzynomics, korea) 제한효소 서열을 포함하는 역방향 프라이머(서열번호 52) 서열은 아래와 같다. IL21R의 세포 외 도메인은 서열번호 3의 DNA 서열 또는 서열번호 4의 아미노산 서열로 기재된다.
IL21R-F : tgccccgacctcgtctgctaca
IL21R-R(XhoI) : ccagctcgagcggccgtcgcactcattcctttaactcctct
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 100 mm 플레이트에 80~90% 면적을 차지할 정도로 심은(plating) 후, DNA(중쇄 : 경쇄 = 4 : 6) 13 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 100 mm 플레이트에서 2일, 4일, 6일, 8일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(Humira/IL21R 융합항체)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 28에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 Humira/IL21R 융합 항체를 4.3 ㎎ 얻었다.
중쇄 발현 벡터와 경쇄 발현 벡터에 삽입된 Humira 중쇄와 IL21R의 C-말단 융합체와 Humira 경쇄를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 4일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 Humira와 IL21R의 융합 항체의 단백질 순수도와 정량을 측정하였다. Humira와 IL21R의 융합 항체의 순수도는 95.1%로 확인되었으며, Humira와 IL21R의 융합 항체의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 28에 나타내었다. Humira/IL21R 항체의 상등액 시료 수득은 2, 4, 6, 8일에 하였으며 웨스턴 블롯은 4일 후에 거둔 상등액 시료로만 한 것인데, 항체의 경우 다른 단백질과 융합하였을 때 변성이 되어 침전되는 경우가 많기 때문에 용해성이 있는지 확인하기 위하여 상등액을 침전시킨 것과 그렇지 않은 것을 같이 걸었다.
실시예 13. IL21R/Humira 융합 항체의 제조
Humira 항체의 중쇄 영역이 삽입된 pNATABL에 N-term 방향으로 IL21R을 삽입함으로써 Humira와 IL21R의 융합 항체를 제작하였으며, 클로닝한 발현 벡터의 구조를 도 29에 나타내었다. 구체적으로 도 29는 동물세포 항체의 중쇄 발현벡터 pNATABH에 Humira 중쇄와 IL21R의 N-말단 융합체를 삽입한 도면으로 벡터와 Humira 중쇄와 IL21R의 N-말단 융합체를 제한효소인 SfiI, NheI으로 자른 다음, Humira 중쇄와 IL21R의 N-말단 융합체를 삽입 했을 때 예상되는 벡터 구조이다.
PCR 반응에 사용된 SfiI(#R033S, enzynomics, korea) 제한효소 서열을 포함하는 IL21R 정방향 프라이머(서열번호 53) 및 역방향 프라이머(서열번호 54) 서열은 아래와 같다. IL21R의 세포 외 도메인은 서열번호 3의 DNA 서열 또는 서열번호 4의 아미노산 서열로 기재된다.
IL21R-F(SfiI) : tggtggccacagcggcctgccccgacctcgtctgctac
IL21R-R : agctgcacctgcgagtggacatcttcctttaactcc
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하였으며, PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 100 mm 플레이트에 80~90% 면적을 차지할 정도로 심은(plating) 후, DNA(중쇄 : 경쇄 = 4 : 6) 13 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
50개의 100 mm 플레이트에서 2일, 4일, 6일, 8일 때에 걷은 상층액 총 2.0 ℓ를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL21R/Humira 융합항체 )을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 30에서 나타난 바와 같이 배양 상층액 2.0 ℓ에서 IL21R/Humira 융합 항체를 2.9 ㎎을 얻었다.
중쇄 발현 벡터와 경쇄 발현 벡터에 삽입된 Humira 중쇄와 IL21R의 N-말단 융합체와 Humira 경쇄를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 4일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 Humira와 IL21R의 융합 항체의 단백질 순수도와 정량을 측정하였다. Humira와 IL21R의 융합 항체의 순수도는 97%로 확인되었으며, Humira와 IL21R의 융합 항체의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 30에 나타내었다. IL21R/Humira 항체의 상등액 시료 수득은 2, 4, 6, 8일에 하였으며 웨스턴 블롯은 4일 후에 거둔 상등액 시료로만 한 것인데, 항체의 경우 다른 단백질과 융합하였을 때 변성이 되어 침전되는 경우가 많기 때문에 용해성이 있는지 확인하기 위하여 상등액을 침전시킨 것과 그렇지 않은 것을 같이 걸었다.
실시예 14. IL21R/TNFR2 융합 수용체의 제조
IL21R의 세포외 도메인 Ⅱ(extra-cellular domain Ⅱ:D2)을 pYK602-His-Fc에 클로닝한 발현 벡터의 구조를 도 6에 나타내었다. 구체적으로 도 6은 동물세포 발현벡터인 pYK602-His-Fc에 IL21R-D2를 삽입한 도면으로 벡터와 IL21R-D2를 제한효소 SfiI으로 자른 다음, IL21R-D1를 삽입 했을 때 예상되는 벡터 구조이다.
오버랩핑 PCR을 수행함으로써 IL21R과 TNFR2를 융합한 DNA 구조를 제작한 후, 이를 pYK602-Fc에 삽입하여 융합 수용체를 제작하였다.
구체적으로 IL21R과 TNFR2 두 사이토카인의 융합 단백질을 만들기 위해 오버랩핑 PCR(overlapping PCR) 기법을 수행을 한 것으로 IL21R의 C-말단과 TNFR2의 N-말단을 30mer정도 오버랩(overlap) 되도록 프라이머(primer)를 디자인하여 IL21R-SfiI과 overlap IL21R primer로 IL21R을 증폭하고, overlap TNFR2와 TNFR2-SfiI primer로 TNFR2를 증폭하한 후, 각각 증폭된 IL21R과 TNFR2 단편을 합하여 주형으로 하고 이를 IL21R-SfiI과 TNFR2-SfiI primer로 두 단편을 융합하여 IL21R/TNFR2 융합구조를 만들었으며, IL21R과 TNFR2의 융합 구조는 도 31에 나타내었다.
또한, 동물세포 발현벡터인 pYK602-His-Fc에 IL21R/TNFR2를 삽입한 도면으로 벡터와 IL21R/TNFR2를 제한효소 SfiI으로 자른 다음, IL21R/TNFR2를 삽입 했을 때 예상되는 벡터 구조를 도 32에 나타내었다.
PCR 반응에 사용된 SfiI(#R033S, enzynomics, korea) 제한효소 서열을 포함하는 IL21R 정방향 프라이머(서열번호 55), 역방향 프라이머(서열번호 56), TNFR2 정방향 프라이머(서열번호 57) 및 역방향 프라이머(서열번호 58) 서열은 아래와 같다. IL21R/TNFR2 융합 수용체는 서열번호 59의 DNA 서열 또는 서열번호 60의 아미노산 서열로 기재된다.
IL21R-F(SfiI) : cagggggccgtgggggcccccgacctcgtctgctacac
IL21R-R : tagcggccgacgcggccaattcctttaactcctctgact
TNFR2-F : cagggggccgtgggggccttgcccgcccaggtggcatt
TNFR2-R(SfiI) : tagcggccgacgcggccaacgtgcagactgcatccatgc
PCR 반응은 상기 실시예 1에서와 동일한 조건에서 실시하되, IL21R과 TNFR2를 각각 94℃에서 2분 후, 94℃ 30초, 55℃ 30초, 72℃ 1분으로 30 사이클을 반복하여 유전자를 증폭시킨 후, 72℃에서 10분간 반응시켜 PCR 산물을 얻었다.
그 다음 같은 조건에서 IL21R PCR 산물과 TNFR2 PCR 산물을 아가로스 겔로 정제한 다음 주형을 1 : 1로 혼합하고, IL21R-F(StifI)와 TNFR2(StifI)을 프라이머로 사용하여 PCR을 수행하였다.
PCR로 수득된 DNA를 아래와 같은 방법으로 트랜스펙션(transfection), 정제(purification)하였다.
293E 세포를 150 mm 플레이트에 70~80% 면적을 차지할 정도로 심은(plating) 후, DNA 20 ㎍과 PEI(#23966, Polysciences, USA) 40 ㎍을 1 : 2 비율로 혼합하여 상온에서 20분 정도 반응시킨 후, 세포에 떨어뜨려 형질감염시켰다. 16~20시간 경과 후, 혈청이 포함되지 않은 DMEM 배지(Serum Free Media, No FBS DMEM(#SH30243.01 Hyclone Thermo. USA))로 교환해 주며, 2~3일마다 한 번씩 세포의 상층액을 수득하였다.
20개의 150 mm 플레이트에서 2일, 5일, 7일 때에 걷은 상층액 총 600 ㎖를 정제하였다. 먼저 전체 상층액을 0.22 ㎛ top-filter(#PR02890 Millipore USA)를 사용하여 필터링한 후, 5 ㎖ 칼럼(column)에 패킹(packing) 되어 있는 500 ㎕의 protein A bead (#17-1279-03, GE healthcare, Sweden)에 결합(binding)시켜준다. Peri-start pump를 사용하여 0.9 ㎖/분으로 4℃ 오버나잇(overnight)으로 결합시킨 후, 100 ㎖ 이상의 PBS(#70011 Gibco USA)로 칼럼을 세척하고, 0.1 M 글리신-염산(Glycine-HCl, #G7126, Sigma, USA)을 이용하여 6개 분획(fraction)으로 나누어 용리(elution)하고, 1M Tris(#T-1503-5KG, Sigma, USA)(pH 9.0)로 중화시켜준다. 그 다음 단백질(IL21R/TNFR2-Fc)을 정량하고 단백질의 발현이 있는 분획 2~3개를 모아 amicon ultra(#UFC805024, Millipore, USA)를 사용하여 농축한 후 PBS(#70011, Gibco, USA)로 10번 정도 버퍼를 교환하였다.
그 결과, 도 33에서 나타난 바와 같이 배양 상층액 600 ㎖에서 IL21R/TNFR2-Fc 융합 수용체를 1.0 ㎎ 얻었다.
pYK602-His-Fc에 삽입된 IL21R/TNFR2를 동물세포인 293E세포에 형질주입(transfection)시킨 후 단백질 발현율을 확인하기 위해 2, 5, 7, 9일 후에 확보한 배지(media)에서 western으로 test를 하고, 단백질 비드(protein bead)를 이용해 정제를 한 다음, Agilent 230 kit assay를 통해 확보된 IL21R/TNFR2의 단백질 순수도와 정량을 측정하였다. IL21R/TNFR2의 순수도는 97%로 확인되었으며, IL21R/TNFR2의 웨스턴블롯 결과(a) 및 QC 테스트 결과(b)를 도 33에 나타내었다.
실시예 15. IL21R 및 VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA 단백질에 Quantum dot 표지
위에서 동물 세포(mammalian cell)인 293E 세포에서 순간적으로(transient) 형질주입(transfection) 시킨 뒤 확보한 단백질들 중 순도가 90%이상 되는 것만 선택하여 Quantum dot을 표지하였다.
자가 면역 관절염 조직에서 과발현하는 IL-21의 수용체에 결합하는 IL-21R 수용체 결합체에 QD 나노입자(Quantum dot nanocrystals)(도 34 및 35 참조)를 표지하였다. 표지 방법은 Qdot 800 ITK carbosylquantum dots(Invitrogen, #MOP-Q21371MP)과 16종의 단백질(IL21R, IL21R-DomainI(D1), IL21R-DomainⅡ(D2), VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, 및 IL17RA를 포함하는 염증 관련 수용성 수용체 11종; IL21R과 염증치료 약물인 TNFR2(Enbrel)을 융합시킨 IL21R/TNFR2; 염증치료약물인 Enbrel; 염증치료 항체인 Humira; IL21R과 Humira 항체를 융합시킨 IL21R/Humira 및 Humira/IL21R)에 대해, 10 mM borate buffer(pH7.4)를 이용하여 활성화시켜 혼합하고, QDs을 각각의 수용성 수용체, 융합수용체, 융합항체에 연결시켜주기 위한 링커(linker)로 EDC (N-ehyl-N-dimethylaminopropyl-carbodiimide, Sigma, #424331)를 첨가한 후, 2시간 동안 상온에서 혼탁 반응시켜 QDs이 표지된 수용체와 융합수용체 및 융합항체를 합성하였다.
각 반응물인 수용성 수용체, 융합수용체, 융합항체의 EDC는 1 : 40 : 1500의 몰비로 반응시켰으며, QD와 바이오분자의 결합 과정을 도 36에서 간략히 나타내었다. 다음으로 한외여과막(Urafiltration filter 100kDa, Millipore, #UFC910024)을 이용하여 표지되지 않은 단백질은 50 mM borate buffer(pH 8.3)로 수 회 세척하여 정제하였다.
실시예 16. CIA(Collagen Induced Arthritis) 동물 모델 확립
CIA 동물 모델을 만들기 위해 7주령의 male DBA/1J를 구입하여 3~4일간 동물사육실에서 적응을 시켰다.
콜라겐(collagen) 1차 주입은 2 mg/ml Type Ⅱ collagen(Chondrex, #20022, USA)과 2 mg/ml CFA(Chondrex, #7009, USA)를 1 : 1의 비율로 3-way stopcock를 연결한 glass syringe(Hamilton, #1010, USA)에 넣어 4℃를 유지하면서 섞어 혼합액을 제조한 후, 미리 차갑게 식힌 1 ml glass syringe(Hamilton, #1001, USA)로 7주령, male, DBA/1J NCrljOri 마우스(오리엔트바이오) 꼬리에 준비한 혼합액을 마우스 당 100 ㎕씩 피하 주사하였다.
콜라겐 2차 주입은 콜라겐 1차 주입 18일 후, 1차 주입 시와 동일한 방법으로 콜라겐 혼합액을 만들어 1차 면역화(immunization) 위치보다 꼬리 상단 부위에 booster 주사하였다. 초기 면역화(immunization) 후, 18일째부터 관절염의 진행 정도를 0에서 3등급으로 표준 관절염 지표(criteria arthritic index)에 의해 평가하였다(표 1 참조). 그리고, 염증수치가 최고점에 도달 하였을 때, IL21R을 비롯한 여러 염증 관련 수용체 약물들에 대한 염증 타겟팅 in-vivo 실험을 수행하였으며, 그 결과를 도 37에 나타내었다.
도 37에서, A는 콜라겐을 1, 2차 주입한 후 18일 경과했을 때 염증이 생겨나서 28일에는 염증 수치가 최고점에 도달하는 것을 보여주고 있으며, B는 염증 발생시 염증의 정도에 0에서 3점까지 점수를 부여하여 나타낸 것으로 점수가 높을 수록 염증이 심한 것을 나타낸다.
표 1
Score Condition
0 Normal
1 Mild, but definite redness and swelling of the ankle or wrist, or apparent redness and swelling limited to individual digits, regardless of the number of affected digits
2 Severe redness and swelling of the entire paw including digits
3 Maximally inflamed limb with involvement of multiple joints
실시예 17. Qutum dot이 표지된 Enbrel과 Fc에 대한 CIA 동물 모델에서 염증 타겟팅 능력 관찰 (비교실험)
본 발명자들은 CIA 동물모델에 Qdot을 표지한 IL21R, IL21R-Domain I, IL21R-Domain Ⅱ 수용체, 염증관련 수용체(VcamI, IL2RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA), IL21R/TNFR2(Enbrel) 융합수용체, Humira, 및 융합체인 IL21R/Humira, Humira/IL21R에 대해 염증 타겟팅 능력을 관찰하기 위해 in vivo imaging system을 도입하여 수행하였다. Imaging 장비는 Maestro 2 In-vivo imaging system(한국기초지원과학연구원)을 사용하였다.
우선, Qdot conjugation에 의한 In vivo imaging system을 이용한 염증 타겟팅이 잘 되는지 확인하기 위한 대조(control) 실험으로 현재 류마티스 관절염 치료제로 판매가 되고 있는 Enbrel을 이용하여 실험을 수행하였다. 이때, Enbrel은 양성 대조군(positive control)으로 사용하고, 음성 대조군(negative control)으로는 Fc 만을 사용하였다.
Enbrel과 Fc only에 상기 실시예 15와 같은 방법으로 Qdot을 표지하고, 상기 실시예 16에서 만든 CIA 동물모델에서 염증반응이 최고점(arthritis score=15)에 도달했을 때, 동물의 꼬리 부위 정맥에 100 ㎍씩 주입하였다. 주입 한지 30분 후 maestro in vivo imaging 장비로 염증 타겟팅 능력을 관찰하였으며, 그 결과를 도 38에 나타내었다.
도 38에 나타난 결과를 보면, Enbrel 경우 주입한 후 30분에 정확히 염증이 생긴 부위를 표적하는 것을 볼 수 있었다. 무릎, 발목, 발가락 등 염증이 발생한 부위에서 염증 타겟팅 신호(signal)가 강하게 나타나는 것을 볼 수 있다. 반면에, Fc only control은 염증부위에서는 발견되지 않고 간에서만 발견되는 것으로 보아 염증부위를 전혀 표적하지 못하는 것을 알 수 있다. Enbrel이나 Fc only가 모두 공통적으로 간에서 발견되는데, 이것은 Qdot의 독성(toxic) 때문에 간에서 해독 대사되는 과정이 공통적으로 일어나는 것으로 생각된다.
실시예 18. CIA 동물 모델을 이용한 생체 영상 진단
본 발명자들은 60 nmol의 Qdot conjugation시킨 IL21R 수용체 및 염증관련 수용체(VcamI, IL21RB, IL2RG, IL10RB, IL3RA, IL13RA1, CRLF1, IL17RA)을 관절염 지표 3등급(arthritis score=15)에 도달했을 때 정맥 내 주입하여 30분 후, 형광 이미징 시스템인 MAESTRO(한국기초지원과학연구원)를 이용하여 염증 타겟팅 능력을 생체 영상 진단하였다. 그 결과 모두 염증부위를 정확하게 타겟팅 하는 것을 확인하였고, 그 결과를 도 39 및 40에 나타내었다.
도 39의 A 및 도 40에 나타난 바와 같이, QDs을 표지한 IL21R, VACM1, IL21RB, IL2RG, IL10RB가 가장 염증 타겟팅 능력이 매우 우수하였고, IL13RA1, IL17RA는 우수하였으며, IL3RA, CRLF1는 보통인 것을 확인하였다. 본 발명자들은 생체 내 이미징(in vivo imaging)을 확인하기 위해 사용한 Q-DOT 800의 파장을 도 39의 B에서 빨간색 그래프로 나타내었으며, 또한 도 39의 C에 미정맥 내 주사한 5일 후엔 QDs이 체외로 배출된 것을 확인하였다.
실시예 19. IL21R, IL21R-DomainI, IL21R-DomainⅡ에 대한 CIA 동물 모델을 이용한 생체 영상 진단
본 발명자들은 염증 타겟팅 능력이 우수한 염증관련 수용성 수용체 중에서 IL21R 경우 관절염 치료제인 Enbrel보다 염증 타겟팅 능력이 우수하게 나타나기 때문에, IL21R을 이루고 있는 2개의 도메인을 분리하였을 때, IL21R과 IL21R-Domain I, IL21R-Domain Ⅱ에 대하여 염증 타겟팅 능력이 어느 정도 되는지를 확인하고자 하였다. 60 nmol Qdot conjugation시킨 IL21R, IL21R-Domain I, IL21R-Domain Ⅱ 수용체를 관절염 지표에 3등급(arthritis score=15)에 도달했을 때 정맥 내 주입하여 30분 후, 형광 이미징 시스템인 MAESTRO(한국기초지원과학연구원)를 이용하여 염증 타겟팅 능력을 생체 영상 진단하였다.
그 결과를 도 41에 나타내었으며, IL21R domain I과 IL21R domain Ⅱ 모두 IL21R처럼 염증부위에 정확하게 타겟팅하는 것을 확인하였다. 특히, IL21R-Domain I은 IL21R과 IL21R-Domain Ⅱ보다도 염증부위 타겟팅 능력이 가장 강함을 볼 수 있었다. 상기 결과로부터 IL21R 단백질을 인체에 투여하였을 경우 부작용을 최소화할 수 있으므로, 이를 저분자 약물 (small molecule drug)로서 이용할 때 더욱 효과적인 장점을 가지고 있는 것을 알 수 있다.
실시예 20. IL21R과 관절염 치료제 약물과의 융합단백질에 대한 CIA 동물 모델을 이용한 생체 영상 진단
본 발명자들은 염증 타겟팅 능력이 가장 우수한 IL21R을 기존의 염증억제 약물의 케리어로서의 가능성을 알아보기 위하여, 먼저 대표적인 항 염증 수용체 약물인 TNFR2-Fc 융합단백질(Enbrel)과 융합 하여 IL21R-TNFR2-Fc를 제조하였으며, CIA 동물모델에 60 nmol의 Qdot conjugation시킨 IL21R/TNFR2(Enbrel) 융합수용체를 관절염 지표에 3등급(arthritis score=15)에 도달했을 때 정맥 내 주입하여 30분 후, 형광 이미징 시스템인 MAESTRO(한국기초지원과학연구원)를 이용하여 염증 타겟팅 능력을 생체 영상 진단하였으며 그 결과를 도 42에 나타내었다.
도 42에 나타난 바와 같이, Enbrel의 염증 타겟팅 능력보다 IL21R/TNFR2 융합 수용체의 염증 타겟팅 능력이 훨씬 강한 것을 확인하였으며, IL21R의 염증부위 타겟팅의 케리어로 사용할 수 있음을 확인하였다. 이것은, IL21R 자체가 가지고 있는 염증 타겟팅 능력에 TNFR2가 가지고 있는 염증 타겟팅 능력이 더해지면서, 더 강력한 염증 타겟팅 능력을 보여주는 것으로 판단된다.
또한 IL21R의 염증 부위 타겟팅을 위한 케리어로서의 능력은 TNF-알파의 중화 항체인 Humira에서도 검증되었다. 도 43에 나타난 바와 같이, Humira 항체 중쇄의 N-말단(IL21R/Humira) 및 Humira 항체 중쇄의 C-말단(Humira/IL21R)의 융합 단백질에 Quantum-dot을 표지한 후 in-vivo 염증 타겟팅 능력을 확인해 본 결과 Humira/IL21R이 Humira에 비해 염증 타겟팅 능력이 우수함을 확인하였으며, IL21R/Humira는 Humira와 비슷한 수준인 것을 알 수 있었다. Humira항체에 IL21R을 융합시킬 때 Humira 중쇄의 N-말단에 융합하는 것보다 중쇄의 C-말단에 융합하는 것이 염증 타겟팅에 더 효과적인 것을 알 수 있으며, 이는 IL21R 자체가 가지고 있는 염증타깃팅 능력에 Humira가 가지고 있는 염증타깃팅 능력이 더해지면서, 더 강력한 염증타깃팅 능력을 보여주는 것으로 판단된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다

Claims (24)

  1. IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편에 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  2. 제 1항에 있어서,
    IL21R(Interlukin 21 receptor)의 세포외 영역을 포함하는 단편은 서열번호 4의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  3. 제 1항에 있어서,
    VcamI(Vascular cell adhesion molecule 1)의 세포외 영역을 포함하는 단편은 서열번호 14의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  4. 제 1항에 있어서,
    IL2RB(Interleukin-2 receptor subunit beta)의 세포외 영역을 포함하는 단편은 서열번호 18의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  5. 제 1항에 있어서,
    IL3RA(Interleukin 3 receptor, alpha)의 세포외 영역을 포함하는 단편은 서열번호 22의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  6. 제 1항에 있어서,
    IL13RA1(Interleukin 13 receptor, alpha 1)의 세포외 영역을 포함하는 단편은 서열번호 26의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  7. 제 1항에 있어서,
    CRLF1(Cytokine receptor like factor 1)의 세포외 영역을 포함하는 단편은 서열번호 30의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  8. 제 1항에 있어서,
    IL17RA(Interleukin 17 receptor A)의 세포외 영역을 포함하는 단편은 서열번호 34의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  9. 제 1항에 있어서,
    IL2RG(Interleukin-2 receptor subunit gamma)의 세포외 영역을 포함하는 단편은 서열번호 38의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  10. 제 1항에 있어서,
    IL10RB(Interleukin 10 receptor, beta)의 세포외 영역을 포함하는 단편은 서열번호 42의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  11. 제 1항에 있어서,
    상기 염증 질환 억제제는 TNFR2(Tumor necrosis factor receptor type 2)의 세포외 영역, CTLA-4(Orencia)의 세포외 영역, IL-1 길항제(antagonist), Humira 항체, 항 CXCL10 항체, 항 IL6R 항체, 및 항 IL6 항체로 이루어진 군에서 선택되는 하나 이상인, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  12. 제 1항에 있어서,
    상기 융합 단백질은 IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편을 염증 질환 억제제 또는 면역 증강제의 C-term 방향 또는 N-term 방향으로 융합하는 것을 특징으로 하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  13. IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편, 및 염증질환 억제제 또는 면역 증강제가 연결된 융합 단백질을 유효성분으로 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  14. 제 13항에 있어서,
    IL21R(Interlukin 21 receptor)의 세포외 영역을 포함하는 단편은 서열번호 4의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  15. 제 13항에 있어서,
    VcamI(Vascular cell adhesion molecule 1)의 세포외 영역을 포함하는 단편은 서열번호 14의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  16. 제 13항에 있어서,
    IL2RB(Interleukin-2 receptor subunit beta)의 세포외 영역을 포함하는 단편은 서열번호 18의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  17. 제 13항에 있어서,
    IL3RA(Interleukin 3 receptor, alpha)의 세포외 영역을 포함하는 단편은 서열번호 22의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  18. 제 13항에 있어서,
    IL13RA1(Interleukin 13 receptor, alpha 1)의 세포외 영역을 포함하는 단편은 서열번호 26의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  19. 제 13항에 있어서,
    CRLF1(Cytokine receptor like factor 1)의 세포외 영역을 포함하는 단편은 서열번호 30의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  20. 제 13항에 있어서,
    IL17RA(Interleukin 17 receptor A)의 세포외 영역을 포함하는 단편은 서열번호 34의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 치료용 또는 면역조절 치료용 약학 조성물.
  21. 제 13항에 있어서,
    IL2RG(Interleukin-2 receptor subunit gamma)의 세포외 영역을 포함하는 단편은 서열번호 38의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  22. 제 13항에 있어서,
    IL10RB(Interleukin 10 receptor, beta)의 세포외 영역을 포함하는 단편은 서열번호 42의 아미노산 서열을 갖는 폴리펩티드를 포함하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  23. 제 13항에 있어서,
    상기 염증 질환 억제제는 TNFR2(Tumor necrosis factor receptor type 2)의 세포외 영역, CTLA-4(Orencia)의 세포외 영역, IL-1 길항제(antagonist), Humira 항체, 항 CXCL10 항체, 항 IL6R 항체, 및 항 IL6 항체로 이루어진 군에서 선택되는 하나 이상인, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
  24. 제 13항에 있어서,
    상기 융합 단백질은 IL21R(Interlukin 21 receptor), VcamI(Vascular cell adhesion molecule 1), IL2RB(Interleukin-2 receptor subunit beta), IL3RA(Interleukin 3 receptor, alpha), IL13RA1(Interleukin 13 receptor, alpha 1), CRLF1(Cytokine receptor like factor 1), IL17RA(Interleukin 17 receptor A), IL2RG(Interleukin-2 receptor subunit gamma), 및 IL10RB(Interleukin 10 receptor, beta)로 이루어진 군에서 선택되는 하나 이상의 단백질의 세포 외 영역을 포함하는 단편을 염증 질환 억제제 또는 면역 증강제의 C-term 방향 또는 N-term 방향으로 융합하는 것을 특징으로 하는, 염증 질환 또는 면역조절 치료 효과를 높이는 방법.
PCT/KR2011/009755 2011-07-20 2011-12-16 염증표적 수용체 및 염증 질환 치료용 약물 운반체 WO2013012138A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020110071937A KR20130011056A (ko) 2011-07-20 2011-07-20 염증표적 수용체 및 염증 질환 치료용 약물 운반체
KR10-2011-0071937 2011-07-20

Publications (1)

Publication Number Publication Date
WO2013012138A1 true WO2013012138A1 (ko) 2013-01-24

Family

ID=47558293

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/009755 WO2013012138A1 (ko) 2011-07-20 2011-12-16 염증표적 수용체 및 염증 질환 치료용 약물 운반체

Country Status (2)

Country Link
KR (1) KR20130011056A (ko)
WO (1) WO2013012138A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3480212B1 (en) 2017-11-03 2023-09-27 Consejo Superior De Investigaciones Científicas Il13ralpha2 peptide and its uses

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050037552A (ko) * 2002-07-15 2005-04-22 와이어쓰 Ｔ 헬퍼(ｔｈ) 세포 발생 및 기능을 조절하는 방법 및조성물
US20060039902A1 (en) * 2004-08-05 2006-02-23 Young Deborah A Antagonizing interleukin-21 receptor activity
KR101004363B1 (ko) * 2010-03-19 2010-12-28 가톨릭대학교 산학협력단 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＩＬ－２１ 이중 길항제
KR20110021919A (ko) * 2008-05-23 2011-03-04 와이어쓰 엘엘씨 인터루킨-21 수용체의 결합 단백질을 사용하는 치료 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050037552A (ko) * 2002-07-15 2005-04-22 와이어쓰 Ｔ 헬퍼(ｔｈ) 세포 발생 및 기능을 조절하는 방법 및조성물
US20060039902A1 (en) * 2004-08-05 2006-02-23 Young Deborah A Antagonizing interleukin-21 receptor activity
KR20110021919A (ko) * 2008-05-23 2011-03-04 와이어쓰 엘엘씨 인터루킨-21 수용체의 결합 단백질을 사용하는 치료 방법
KR101004363B1 (ko) * 2010-03-19 2010-12-28 가톨릭대학교 산학협력단 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＩＬ－２１ 이중 길항제

Also Published As

Publication number Publication date
KR20130011056A (ko) 2013-01-30

Similar Documents

Publication Publication Date Title
WO2020060122A1 (ko) Il-2 단백질 및 cd80 단백질을 포함하는 융합단백질 및 이의 용도
WO2018124766A2 (ko) 키메라 항원 수용체 및 이를 발현하는 자연 살해 세포
WO2017023138A1 (ko) 키메라 항원 수용체 및 키메라 항원 수용체가 발현된 t 세포
WO2018030806A1 (ko) 항체 중쇄불변부위 이종이중체에 융합된 사이토카인 및 이를 포함하는 약제학적 조성물
WO2019182425A1 (ko) 신규 키메라 항원 수용체 암호화 유전자가 형질도입된 유전자 변형 nk 세포주 및 그의 용도
WO2014025199A2 (ko) 스테필로코칼 엔테로톡신 유래의 초항원 변이체 및 이에 표적 특이적 폴리펩타이드가 연결된 융합단백질 및 그 용도
WO2020032784A1 (ko) Hla-dr에 결합하는 키메라 항원 수용체 및 car-t 세포
WO2011142514A1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
WO2021235696A1 (ko) Cd22에 특이적인 항체 및 이의 용도
WO2021107689A1 (ko) Il-2 단백질 및 cd80 단백질을 포함하는 융합단백질 및 면역관문 억제제를 포함하는 암 치료용 약학 조성물
WO2017030370A1 (ko) 항-코티닌 항체가 연결된 키메라 항체 수용체 및 이의 용도
WO2020153605A1 (ko) 메소텔린 특이적인 키메라 항원 수용체 및 이를 발현하는 t 세포
WO2020080908A1 (ko) 항-l1cam 항체 또는 그의 항원결합 단편, 및 이를 포함하는 키메라 항원 수용체
WO2011115456A2 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＴＷＥＡＫ 이중 길항제
WO2023277361A1 (ko) 메소텔린 특이적 항체 및 이의 용도
WO2022025638A1 (ko) 면역시냅스를 안정화시키는 키메라 항원 수용체(car) t 세포
WO2017034244A1 (ko) 중추신경계 질환에 대한 예방 또는 치료효과를 갖는 펩타이드 및 이를 유효성분으로 하는 중추신경계 질환 예방 및 치료용 약학적 조성물
WO2021153979A1 (ko) 항-taa 항체, 항-pd-l1 항체 및 il-2를 포함하는 융합단백질 및 이의 용도
WO2019125070A1 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2013012138A1 (ko) 염증표적 수용체 및 염증 질환 치료용 약물 운반체
WO2012087017A2 (ko) 변형된 인간 종양 괴사 인자 수용체-1 폴리펩티드 또는 그의 절편 및 그의 제조방법
WO2011115458A2 (ko) 자가 면역 질환 예방 및 치료용 ＴＮＦ－α와 ＩＬ－２１ 이중 길항제
WO2022124866A1 (ko) 항-pd-1 항체 및 이의 용도
WO2022145739A1 (en) Humanized antibody specific for cd22 and chimeric antigen receptor using the same
WO2022035200A1 (ko) Il-12 및 항-cd20 항체를 포함하는 융합단백질 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11869596

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11869596

Country of ref document: EP

Kind code of ref document: A1