WO2012121451A1 - 줄기세포의 인 비보 이동 유도방법 - Google Patents

줄기세포의 인 비보 이동 유도방법 Download PDF

Info

Publication number
WO2012121451A1
WO2012121451A1 PCT/KR2011/003732 KR2011003732W WO2012121451A1 WO 2012121451 A1 WO2012121451 A1 WO 2012121451A1 KR 2011003732 W KR2011003732 W KR 2011003732W WO 2012121451 A1 WO2012121451 A1 WO 2012121451A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
damaged
cartilage
composition
biodegradable
Prior art date
Application number
PCT/KR2011/003732
Other languages
English (en)
French (fr)
Inventor
이진우
박민성
김윤희
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2012121451A1 publication Critical patent/WO2012121451A1/ko

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2053—IL-8
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/195—Chemokines, e.g. RANTES
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/54—Biologically active materials, e.g. therapeutic substances
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/56—Porous materials, e.g. foams or sponges
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
    • A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
    • A61L27/58—Materials at least partially resorbable by the body
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • C07K14/523—Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1, LDCF-2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5421—IL-8
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/02—Peptides being immobilised on, or in, an organic carrier
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
    • A61L2300/20—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices containing or releasing organic materials
    • A61L2300/252—Polypeptides, proteins, e.g. glycoproteins, lipoproteins, cytokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
    • A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
    • A61L2300/412—Tissue-regenerating or healing or proliferative agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
    • A61L2430/00—Materials or treatment for tissue regeneration
    • A61L2430/24—Materials or treatment for tissue regeneration for joint reconstruction

Definitions

  • the present invention relates to a method of inducing the movement of stem cells in tij i in vivo) with damaged articular cartilage (damaged joi nt or cart i lage) and a therapeutically grafted composition using the same.
  • Articular cartilage is an avascular tissue composed mainly of protein polysaccharide and type 2 collagen, and contains cartilage cells of about 5% of the tissue volume [1]. Articular cartilage injuries have the disadvantage that the migration of chondrocytes to the defect site rarely occurs and damaged articular cartilage does not cause spontaneous healing [2]. Representative biological methods for treating damaged articular cartilage include autologous chondrocyte transplantation and bone marrow perforation. Autologous chondrocyte transplantation is a method of culturing autologous chondrocytes and transplanting them into defective areas, but the disadvantage of repeated surgery and donor limitation is disadvantage.
  • Bone marrow puncture is a method of treating damaged cartilage by using bone marrow-derived mesenchymal stem cells that have been perforated to the subchondral bone of the cartilage defect and introduced into the defect site along with the bone marrow.
  • This method is relatively simple and economical, but the result is inconsistent, and tissue regeneration is not smooth when the number of incoming mesenchymal stem cells is insufficient [3-7].
  • Mesenchymal stem cells are able to differentiate into bone, cartilage and adipocytes, and because they proliferate faster than cartilage cells, they are an important cell source for articular cartilage regeneration, and also to overcome the disadvantages of conventional articular cartilage therapy. Attention.
  • mesenchymal stem cells In order for damaged articular cartilage to be regenerated by mesenchymal stem cells, a large number of mesenchymal stem cells enter the cartilage defect area, and the collected mesenchymal stem cells attach to articular cartilage matrix and proliferate and differentiate into cartilage cells. A substrate must be created. During natural healing, mesenchymal stem cells migrate to the joint cartilage injury site and differentiate into cartilage cells.
  • chemokines are small cytokines of about 8-10 kDa. To date, about 50 chemokines have been known and function to induce chemotaxis of various cells [18-20]. Chemokines induce cell chemotaxis by attaching to chemokine receptors, a type of G-protein receptor. Currently, about 19 chemokine receptors have been reported, and tissue regeneration such as skin using chemokine has been reported in mesenchymal stem cells [21-23].
  • chondrocyte transplantation is performed to complement the sufficient number of chondrocytes required for transplantation or regeneration of autologous or allogeneic bone-cartilage tissue in consideration of the physical characteristics of the implant. Due to the limitation of the donor or donor, there are many difficulties in the actual implementation, the patient has a high cost of treatment, has to undergo two or more surgeries, and the disadvantages of remarkably decreasing the function of the transplanted cells are not overcome.
  • the present inventors have tried to develop a method for effectively inducing mesenchymal stem cells to damaged bone or cartilage for the treatment of articular cartilage.
  • the present inventors have found a high influx of mesenchymal stem cells (preferably bone marrow-derived mesenchymal stem cells) to joint sites where the chemokines IL (inter leukin) -8 and MIP (Macrophage Inflammatory Protein) -3a are damaged.
  • the present invention has been completed by discovering that it is easy and effective to promote efficiency and to implant the biodegradable scaffolds containing the chemokine in the damaged area.
  • the present invention provides a method for inducing in vivo migration of stem cells to an injured joint site comprising the following steps: (a) a solution comprising chemotactic factors on Dipping biodegradable scaffolds; And (b) implanting the biodegradable support into the damaged joint site.
  • the present invention is to implant a biodegradable scaffolds with IL (Inter leukin) -8, MIPC Macrophage Inflaatory Protein (3a) or derivatives thereof to a damaged joint or cartilage It provides a method of treating a damaged joint comprising the step of.
  • the present inventors have tried to develop a method for effectively inducing mesenchymal stem cells to damaged bone or cartilage for the treatment of articular cartilage.
  • the present inventors have promoted the influx of mesenchymal stem cells (preferably bone marrow-derived mesenchymal stem cells) to the joint site where the chemokines IL-8 and ⁇ -3 ⁇ are damaged, and contain the chemokines.
  • cartilage damage treatment agent mesenchymal stem cells have been noted as a cartilage damage treatment agent.
  • MSCs Mesenchymal stem cells
  • stromal eel Is that can differentiate and regenerate into mesenchymal tissues such as bone, cartilage, muscle, ligaments, tendons, and " fats.
  • MSCs may have the ability to multiply and multiply by multiples while maintaining growth and multisystem differentiation.
  • MSCs appear to migrate to damaged tissues, their trafficking and tissue homing are processes that are not accurately understood.
  • CXCR4 is important for hematopoietic stem cell and cancer cell metastasis.
  • the present invention selects chemokine receptors that are expressed in human bone marrow-derived mesenchymal stem cells and whose expression is increased under in vitro conditions of cartilage damage, and implants a biodegradable support comprising a ligand thereof into the damaged joint. Thereby inducing homing of mesenchymal stem cells to show effective treatment of joint damage (see FIG. 5).
  • the present invention provides a method for in vivo n vivo migration of stem cells to damaged joint sites.
  • the chemotactic factors are secreted proteins and extracellular matrix molecules that diffuse from tissues, for example, the trans forming growth factor (TGF) family, the bone morphogenetic protein (BMP) family, and the carti 1 age-derived morphogenetic ic. proteins), fibroblast growth factor (FGF) family, connect ive tissue growth factors (CTGF), iate let-derived growth factor (PDGF) family, VEGF vascular endothelial growth factor (PDGF) family, extracellular matrix molecules (e.g. osteopontin Fibronectin, hyaluronic acid, heparin, thrombospondin, collagen, vitronectin, etc.) and chemokines.
  • the chemotactic factor of the present invention includes chemokines.
  • Chemokines are proteins (5-20 kDa) that play important physiological functions in a variety of processes, such as hematopoietic function of blood stem cells and chemotaxis of white blood cells. Terminology herein
  • “Chemotaxis” means the positive (ie, direction towards the stimulus) or negative (ie, away from the stimulus) migration of mobile cells induced by chemical stimuli, whereby the cell membrane has a corresponding chemotactic factor (chemotactic substances (chemokines), which are mediated by corresponding cell surface receptors (chemokine receptors).
  • chemokines chemotactic substances
  • the amino acid sequence of all chemokines is similar and can be characterized by a contiguous arrangement of four cysteines.
  • the chemokine family is divided into four subfamily: (a) CCL; (b) CXCL; (c) CX3CL; And (d) XCL (Murphy, et al., International union of pharmacology, XXII, Nomenclature of chemokine receptors, Pharmacol Rev, 52: 145-176 (2000)).
  • the chemokines that can be used in the present invention are CCL20 (MIP-3a), CCL19, CCL21, CCL27, CCL28, CXCL8 (IL-8) ( CXCL9, CXCL10, CXCL11, CXCL12 (SDF- 1), CXCL16, CXCL13, CXCL5, CXCL6, CCL2 (MCP-1), CCL8, CCL13, CCL25, CCL3, CCL4, CCL5, CCL7, CCL14, CCL15, CCL 16, CCL23, CX3CL1, XCL1, XCL2, CCL1, CCL17 , CCL22, CCL11, CCL24, CCL26, CXCL1, CXCL2, CXCL3 and CXCL7, more preferably CCL20, CCL19, CCL21, CCL27, CCL28, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL16, more preferably CCL20, CCL
  • amino acid sequences of CCL20 and CXCL8 are described in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.
  • the concentration of chemokine used in the present invention is 10-1,000 ng / ml per biodegradable support (1 g), more preferably 20-800 ng per biodegradable support (1 g) / ml, more than Preferably 35-700 ng / ml per biodegradable support (1 g) and most preferably 50-500 ng / ml per biodegradable support (1 g).
  • biodegradable scaffolds refers to a three-dimensional structure consisting of a biodegradable polymer containing said chemotactic factors, and is a fungal cell, preferably implanted into a target position (eg, damaged articular cartilage) through implantation.
  • a target position eg, damaged articular cartilage
  • the biodegradable scaffold of the present invention is a biocompatible material, generally providing a physical scaffold for the cells to migrate by forming a porous micro scaffold, more preferably, the stem cells (preferably, Mesenchymal stem cells).
  • the biodegradable support that can be used in the present invention can be used in any size, shape or composition under conditions that can be degraded in vivo.
  • the biodegradable support that can be used in the present invention is PLGA (poly (lactic-co-glycolic acid)), PLA (polylactic acid), PGA (polyglycolic acid), PCL (poly- ⁇ -capro lactone (PAA), poly (amino acid), polyanhydrides, polyisoesters, derivatives, copolymers and mixtures thereof, collagen gels, polyvinyl alcohol sponges, polysaccharides (e.g.
  • biodegradable support into an injured joint site.
  • the biodegradable scaffold of the present invention has chemotaxis, thereby promoting homing of stem cells (preferably mesenchymal stem cells).
  • stem cells preferably mesenchymal stem cells.
  • the introduced stem cells exert regenerative efficacy at the damaged target site.
  • the implantation of the biodegradable scaffolds of the present invention significantly increased the number of migrated cells (see FIG. 2B), and also significantly increased the distance of travel and the rate of movement (FIG. 2C).
  • the transplantation only cell migration Only increased, no effect on cell differentiation (FIG. 3). This means that the biodegradable support of the present invention promotes only the influx of autologous mesenchymal enjoyment cells necessary for damaged articular cartilage regeneration.
  • the joint site to which the biodegradable support of the present invention can be implanted includes the knee, hip, shoulder, ankle, wrist, elbow, ankle, ulna, vertebra, carpal bone, long bone and jaw joint.
  • the present invention is not limited thereto.
  • the implantation of the biodegradable scaffold of the present invention increases the cell migration capacity of stem cells to the damaged joint site.
  • the stem cells induced inflow in the present invention include autologous stem cells or non-auto logous stem cells, more preferably autologous stem cells, Preferred are autologous mesenchymal stem cells, most preferably bone marrow-derived mesenchymal stem cells.
  • the present invention is a damaged joint comprising a biodegradable scaffolds (IL) with interleukin (IL) -8, Macrophage Inflammatory Protein (MIP) -3a or derivatives thereof as an active ingredient or cartilage) Implantable compos itions are provided.
  • IL biodegradable scaffolds
  • IL interleukin
  • MIP Macrophage Inflammatory Protein
  • composition of the present invention includes the above-described biodegradable support of the present invention as an active ingredient, the contents common between the two are omitted in order to avoid excessive complexity of the present specification.
  • the biodegradable scaffolds of the invention can be implanted in living mammals, more preferably in damaged joint sites (eg articular cartilage).
  • the mammal is not particularly limited and is preferably a mammal, more preferably human, mouse, rat, rabbit, animal, pig, horse, cow, sheep, antelope , Dogs and cats, even more preferably humans and mice.
  • the damaged articular cartilage site of the present invention is a hyaline cartilage (e.g., glass cartilage in the joint, nose, larynx or sternum), an elastic cartilage (e.g. ear). Elastic cartilage) and fibrocartilage (eg, intervertebral discs), but are not limited thereto.
  • the articular cartilage disease that can be treated by the composition of the present invention is osteoarthritis and osteoarthritis, including osteoarthritis and rheumatoid arthritis, osteoporosis, osteochondrosis, osteochondritis, incomplete osteoplasia, osteomyelitis, osteoproliferation Tissue damage due to sieve, cartilage dysplasia, chondritis, chondroma, chondrosarcoma, intervertebral disc herniation, Kleepel-pile syndrome, deformative osteoarthritis, cystic fibrosis, and accidents, fractures, wounds, joint damage, autoimmune diseases, diabetes Articular cartilage disease associated with, but not limited to.
  • composition of the present invention comprises (a) a biodegradable support as described above. Pharmaceutically effective amount; And (b) a pharmaceutically acceptable carrier.
  • pharmaceutically effective amount means an amount sufficient to achieve the efficacy or activity of the biodegradable support described above.
  • the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in the preparation, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline 3 ⁇ 4 fluorosulfone, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, stearic acid magnesium and minerals Oils and the like, but are not limited thereto.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, a sulfate, a glycerol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannito
  • compositions of the present invention can be administered directly to the injured site, for example by subcutaneous injection, intramuscular injection, transdermal administration, intraarticular injection, or the like.
  • Suitable dosages of the pharmaceutical compositions of the present invention may vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and reaction in response to the patient. It may be prescribed.
  • the pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
  • the formulation may be in the form of solutions, suspensions, syrups or emulsions in oil or aqueous media, or may be in the form of extracts, powders, powders, granules, tablets or accelerators, and may further comprise dispersants or stabilizers.
  • the present invention relates to a method for inducing in vivo migration of stem cells with a damaged joint or cartilage, and a therapeutic graft composition using the same.
  • stem cells preferably, by implanting a biodegradable scaffold with the chemotactic factor of the present invention (eg, IL-8 or ⁇ -3 ⁇ )
  • a biodegradable scaffold with the chemotactic factor of the present invention eg, IL-8 or ⁇ -3 ⁇
  • an injured position eg, articular cartilage
  • Injured articular cartilage can be treated by inducing / promoting homing of mesenchymal stem cells).
  • the biodegradable support of the present invention can be applied to the treatment of damaged articular cartilage more simply and efficiently compared to the prior art.
  • chemokine receptors in human bone marrow-derived mesenchymal stem cells stimulated by proinflammatory cytokines.
  • A RT-PCR; B: reverse dot-blot.
  • Control normal mesenchymal stem cell group; IL-4h, IL- ⁇ -stimulated group for 4 hours; IL-24h, IL- ⁇ -stimulated group for 24 hours; IL-48h, IL- ⁇ -stimulated group for 48 hours; TNF-4h, TNF- ⁇ -stimulated group for 4 hours; TNF-24h, TNF- ⁇ -stimulated group for 24 hours; And TNF-48h, TNF-a—stimulated group for 48 hours.
  • FIG. 2 is a result showing the effect of chemokines (chemokines) on cell proliferation and migration.
  • Figure 2a is a result showing the cell proliferation (cell proliferation)
  • Figure 2b is a result showing the wound healing effect
  • Figure 2c is a result showing the migratory capacity (migratory capacity).
  • FIG. 3 is a result showing the effect of chemokines on cell differentiation.
  • the upper panel of Figure 3a shows the results of the Masson tri chrome staining, the lower panel is the result of examining the expression of the cartilage marker gene.
  • Figure 3b is a result showing the von kossa staining results. Abbreviations: N.C, negative control; And P.C., positive control.
  • FIG. 5 shows the in vivo chemotaxis of bMSCs.
  • the upper panel shows the results of animal experiments (W, Note), and the lower panel shows a schematic of PLGA support transplantation containing chemokines.
  • Figure 6 is a result showing the visual observation (A) and pathological findings (B) after in vivo chemotactic observation of bMSCs.
  • Human bone marrow-derived mesenchymal stem cells undergo IRB deliberation with the consent of patients requiring autogenous iliac bone graft and then aspirate the bone marrow in the posterior iliac crest and centrifuge to precipitate the cells in the bone marrow to make pellets.
  • DMEM-LG Dulbecco's modified eagle's medium-low glucose
  • FBS fetal bovine serum
  • GIBCO BRL Grand Island, NY, USA
  • T-75 cm 2 cell culture flasks T-75 cm 2 cell culture flasks (Falcon, Germany) after washing with basal medium supplemented with 100 units / ml penicillin G (GIBCO) and 0.1 mg / ml streptomycin (GIBCO) Were aliquoted and incubated for 4 days.
  • In vitro cartilage damage conditions were prepared by treatment of pro-inflammatory cytokine IL-ip (R & D Systems Inc., Minneapolis, USA) or TNF- ⁇ ( ⁇ Systems Inc.).
  • Mesenchymal stem cells were cultured in DMEM-LG culture without fetal bovine serum ⁇ for 12 hours, and then IL- ⁇ or TNF- ⁇ was added to the culture at a concentration of 10 ng / ml for 4, 24, 48 hours. The cells were cultured and used for the experiment.
  • RNeasy kitCQiagen Valencia, Calif., USA
  • chemokine receptor genes were reverse transcriptase-polymerase chain reaction.
  • Expression was analyzed 19 total chemokine receptors, CCR1-10, CXCR1-7, CX3CR and XCR1 (Table 1) .
  • the DNA of the amplified chemokine receptor was 3100 Genetic Analyser (Applied Biosystem slnc., Foster City, CA, USA) using the DNA sequencing method was confirmed that there is no overlapping sequence with each other.
  • chemokine receptors with increased expression by IL- ⁇ or TNF- ⁇
  • DNAs of 19 chemokine receptors were synthesized using reverse transcriptase-polymerase chain reaction and used as sample DNA.
  • the cDNAs of mesenchymal stem cells stimulated with IL- ⁇ or TNF— ⁇ were synthesized using Omniscript RT Kit (Qiagen) and used as probe cDNAs.
  • the DNA of the chemokine receptor was immobilized on the nylon membrane (Amersham, GE healthcare, UK) and irradiated with ultraviolet (1200X100 ujuies) to fix the cDNA of mesenchymal stem cells stimulated with proinflammatory cytokines. Labeling was performed using a prime labeling system (GE Healthcare UK Limited.
  • osteoblast differentiation culture [10 mM ⁇ -glycophosphate (Sigma), 100 ⁇ dexamethasone (Sigma), 50 ⁇ g / ml ascorbic acid_2-phosphate (Sigma) added to induce osteoblast differentiation After differentiation induction, the cells were compared with the mesenchymal stem cells cultured in the basal culture medium. Wound Healing and Real-time Cell Migration Rates
  • MSC was cultured using a silicon culture insert (IBIDI, —Germany) for wound formation, and 500 ng / mL chemokine stimulation was applied to the cells to count the number of cells that shifted the extent of wound healing. Tracking the moving cells in real time to measure the distance and speed.
  • In vitro cell chemotaxis was assessed by culturing the cells using an 8-hole sized transwell insert (Falcon, Germany) and counting the cells that migrated through the micropores toward chemokines.
  • In vitro cellular chemotaxis was performed by fluorescence-labeled 1.5X10 6 MSCs in the tail vein.
  • Real-time imaging equipment Opt ix, ART
  • PLGA scaffolds provided by Dr. Kim Soo-hyun, Biomaterials Center, Korea Institute of Science and Technology
  • chemokines IL-8, MIP-3a
  • Primer sequences for human chemokine receptors prepared for the reverse transcriptase-polymerase chain reaction method are as follows (Table 1). The nucleotide sequences of the genes amplified by the primers of Table 1 did not overlap each other with the sequences of other chemokine receptors through DNA sequencing (not shown). The expression of 19 chemokine receptors in human bone marrow-derived normal mesenchymal stem cells was analyzed by RT-PCR (FIG. 1). Analysis of chemokine receptor expression in mesenchymal stem cells from three or more donors revealed that CCR2, CCR6, CCR7, CCR8, CCR9, CCR10, CXCR1, CXCR5 and CXCR7 are common in three or more mesenchymal enjoyment cells. It was expressed as. Chemokine Receptor Increases Expression in Bone Marrow-derived Mesenchymal Stem Cells During Articular Cartilage Injury
  • the receptors such as CCR2, CCR4, CCR6 and CXCR1 were significantly expressed in normal mesenchymal stem cells, and their expression was significantly increased in mesenchymal stem cells of three donors by proinflammatory cytokines. (More than twice). Effect on cell migration
  • the chemotaxis of mesenchymal stem cells of in vitro and phosphorus selected candidates was evaluated. First, cytochemistry towards TNFa was observed in vitro using a transwell insert (FIG. 4A). Meanwhile, among the four candidates selected, IL-8 and MIP-3a induce the most cytochemistry in phosphorus / ⁇ ⁇ (Fig. 4b). Therefore, we tried to confirm the cytochemistry induced by IL-8 and ⁇ -3 ⁇ in phosphorus. The PLGA scaffold was soaked in PBS or IL-8 and ⁇ -3 ⁇ for 24 hours, and then implanted in subcutaneous cells such as nude mice. Confirmed. Injected mesenchymal stem cells at about 2 weeks were identified in IL-8 and ⁇ -3 ⁇ and cell migration increased until 6 weeks (Fig. 5). Visual observation and pathological findings
  • the scaffolds were recovered at 6 weeks and visually examined and stained with ⁇ & ⁇ .
  • the support of IL8 and ⁇ 3 ⁇ group was well fused with the surrounding tissues of the implanted site and the angiogenesis was much higher than that of the PBS group (Fig. 6a).
  • the PBS group showed the most of the implanted support.
  • Pr idie A method of resurfacing osteoarthritis knee joints. J Bone Joint Surg Br 1959; 41: 618-9.
  • Kessler MW Acker man G, Dines JS, Grande D. Emerging technologies and fourth generation issues in cartilage repair. Sports med arthrosc

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Dermatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Transplantation (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biomedical Technology (AREA)
  • Dispersion Chemistry (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Inorganic Chemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Materials For Medical Uses (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 다음의 단계를 포함하는 손상된 관절 부위로 줄기세포의 인 비보(in vivo) 이동 유도방법을 제공한다: (a) 화학주성인자(chemotactic factors)를 포함하는 용액에 생분해성 지지체(biodegradable scaffolds)를 담그는 단계; 및 (b) 상기 생분해성 지지체를 손상된 관절 부위에 이식시키는 단계. 또한, 본 발명은 IL(interleukin)-8, MIP(Macrophage Inflammatory Protein)-3α 또는 이의 유도체를 가진 생분해성 지지체를 손상된 관절(damaged joint or cartilage)에 이식하는 단계를 포함하는 손상된 관절 치료방법을 제공하고, IL-8, MIP-3α 또는 이의 유도체를 가진 생분해성 지지체를 유효성분으로 포함하는 손상된 관절 치료용 이식 조성물(implantable compositions)을 제공한다. 본 발명에 따르면, 본 발명의 화학주성인자(예컨대, IL-8 또는 MIP-3α)와 반응시킨 생분해성 지지체를 손상된 위치(예컨대, 관절연골)에 이식하여 줄기세포(바람직하게는, 중간엽 줄기세포)의 호밍을 유도/촉진함으로써 손상된 관절연골을 치료할 수 있다. 따라서, 본 발명의 생분해성 지지체는 종래 기술과 비교하여 보다 간편하고 효율적으로 손상된 관절연골의 치료에 적용될 수 있다.

Description

【명세서】
【발명의 명칭】
줄기세포의 인 비보 이동 유도방법 【기술 분야】
본 발명은 손상된 관절연골 (damaged joi nt or cart i lage)로 줄기세포의 인 tij i in vivo) 이동 유도방법 및 이를 이용한 치료용 이식 조성물에 관한 것이다. 【배경 기술】
관절연골은 단백다당과 제 2 형 교원질로 주로 구성된 무혈성 조직이며， 조직부피의 약 5%의 연골세포를 포함하고 있다 [ 1] . 관절연골 손상시， 결손 부위로의 연골세포의 이동이 거 의 일어나지 않으며 손상된 관절연골은 자발적인 치유가 일어나지 않는 단점이 있다 [2] . 손상된 관절연골을 치료하기 위한 대표적인 생물학적 방법으로 자가연골세포이식법과 골수천공술 등이 있다. 자가연골세포 이식법은 자가연골세포를 배양하여 결손부위로 이식하는 방법으로써 비교적 좋은 결과를 보이나， 반복된 수술과 공여부의 제한성 이 단점이다. 골수천공술은 연골결손부의 연골하골을 천공하여 골수와 함께 결손부위로 유입된 골수유래 증간엽 줄기세포 (bone marrow-der ived mesenchymal stem cel l )를 이용하여 손상된 연골을 치료하는 방법이다. 이 방법은 비교적 간단하고 경제적 이나 결과가 일정하지 못하며 유입되는 중간엽 줄기세포의 수가 충분치 못할 경우 조직재생이 원활하지 못하다는 단점 이 있다 [3-7] . 중간엽 줄기세포는 뼈， 연골， 지방세포로 분화할 수 있으며 연골세포에 비해 빠르게 증식하기 때문에 관절연골재생을 위해 중요한 세포원이며， 또한 기존 관절연골 치료법의 단점을 극복하기 위하여 중간엽 줄기세포를 주목하고 있다. 손상된 관절연골이 중간엽 줄기세포에 의해 재생되기 위해서는 층분한 수의 중간엽 줄기세포가 연골결손부위로 유입되고， 모여든 중간엽줄기세포가 관절연골기질에 부착하여 증식 및 연골세포로 분화하여 연골기질을 생성해야 한다. 자연치유과정에서 중간엽 줄기세포는 관절연골손상부위로 이동하여 연골세포로의 분화과정올
대 체 용지 (규칙 제 26조) 거치게 된다. 중간엽 줄기세포의 연골분화를 위해서는 모여든 중간엽 즐기세포의 응집과 세포 -세포 및 세포—연골기질 간의 상호작용이 필수적이다 [8]. 중간엽 줄기세포의 연골분화에 있어서 세포주위 미세환경은 중요한 역할을 한다. 중간엽 줄기세포와 세포와 인접한 교원질의 상호작용이 간엽 줄기세포의 연골분화를 촉진시킨다 [9， 10].
연골을 포함한 여러가지 손상된 조직의 치료를 위해서는 조직손상부 내로의 골수 -유래 중간엽 줄기세포의 층분한 유입이 매우 중요하다 [11-13]. 혈액 또는 골수내 순환하던 중간엽 줄기세포가 조직손상부로 모여드는 현상을 호밍 (homing)이라고 하며 , 간엽 줄기세포의 호밍은 여러 단계에 걸쳐 세포부착단백과 케모카인 (chemokine)에 의해 이루어진다 [14-17] · 케모카인 (chemokine)는 약 8-10 kDa 의 작은 사이토카인이다. 현재까지， 약 50 여 가지의 케모카인이 알려졌으며, 다양한 세포들의 주화성을 유도하는 기능을 한다 [18-20]. 케모카인은 G-단백 수용체의 일종인 케모카인 수용체 (chemokine receptor)에 부착하여 세포주화성을 유도한다. 현재， 약 19 가지의 케모카인 수용체가 보고되었으며, 중간엽 줄기세포에서도 케모카인을 이용한 피부 등의 조직재생이 보고된 바 있다 [21-23].
현재 사용되고 있는 관절 손상에 대한 치료법 (예를 들어， 약물 치료법， 수술, 유전자 치료법， 등)은 관절연골 손상 부위에서 정상 관절연골로의 회복을 가져오지 못하고 있다. 이 외에도， 이식물의 물리적 특성을 고려하여 자가 또는 동종 간 골 -연골조직을 이식하거나 재생에 필요한 층분한 수의 연골세포를 보층해주기 위하여 자가연골세포 이식술이 시행되고 있으며 다른 치료법에 비해 좋은 치료효과를 보이나 공여부 또는 공여자의 제한으로 실제 시행에 어려움이 많으며 환자에게는 치료비용이 많이 들고 2 회 이상의 수술을 받아야 하며 이식되는 세포의 기능이 현저히 떨어지는 단점들이 극복되지 못하는 실정이다.
최근에는 이러한 단점을 극복하고자 생분해성 합성 고분자에 세포를 도포한 복합체로 구성된 인공대체물이 활발히 연구되어 임상적용에 시도되는 단계이나 이 방법 또한 기존의 문제점을 극복하지 못하고 있다. 이처럼 손상된 관절연골조직의 재생을 위해 세포와 생체 재료의 접목 기술등의 다양한 치료방법이 개발되었으나， 세포와 생체재료 복합유도체는 임상적으로 적용하기에 제한적이고 아직 미흡하다.
따라서, 세포를 이용하되 그 성질을 최대한 유지하며 기존의 단점을 극복할 수 있는 치료방법의 개발이 절실한 상황이다. 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
【발명의 상세한 설명】
본 발명자들은 관절연골 치료를 위해 중간엽 줄기세포를 손상된 골 또는 연골부위로 효과적으로 유도할 수 있는 방법을 개발하고자 노력하였다. 그 결과， 본 발명자들은 케모카인인 IL( inter leukin)-8 및 MIP(Macrophage Inflammatory Protein)-3a가 손상된 관절 부위로 중간엽 줄기세포 (바람직하게는， 골수 -유래 중간엽 줄기세포)의 유입을 높은 효율로 촉진시키고 상기 케모카인을 포함하는 생분해성 지지체 (biodegradable scaffolds)를 손상된 부위에 이식시켜 간편하고 효과적으로 치료할 수 있다는 것올 발견함으로써， 본 발명을 완성하게 되었다.
따라서， 본 발명의 목적은 손상된 관절 부위로 줄기세포의 인 비보 in vivo) 이동 유도방법을 제공한다.
본 발명의 다른 목적은 손상된 관절 치료방법을 제공하는 데 있다. 본 발명의 또 다른 목적은 손상된 관절 (damaged joint or cartilage) 치료용 이식 조성물 (implantable compositions)을 제공하는 데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명， 청구범위 및 도면에 의해 보다 명확하게 된다. 본 발명의 일 양태에 따르면， 본 발명은 다음의 단계를 포함하는 손상된 관절 부위로 줄기세포의 인 비보 Un vivo) 이동 유도방법을 제공한다: (a) 화학주성인자 (chemotactic factors)을 포함하는 용액에 생분해성 지지체 (biodegradable scaffolds)를 담그는 단계; 및 (b) 상기 생분해성 지지체를 손상된 관절 부위에 이식시키는 단계.
본 발명의 다른 양태에 따르면， 본 발명은 IL( inter leukin)-8, MIPCMacrophage Infla國 atory Protein)-3a 또는 이의 유도체를 가진 생분해성 지지체 (biodegradable scaffolds)를 손상된 관절 (damaged joint or cartilage)에 이식하는 단계를 포함하는 손상된 관절 치료방법을 제공한다. 본 발명자들은 관절연골 치료를 위해 중간엽 줄기세포를 손상된 골 또는 연골부위로 효과적으로 유도할 수 있는 방법을 개발하고자 노력하였다. 그 결과， 본 발명자들은 케모카인인 IL-8 및 ΜΙΡ-3α가 손상된 관절 부위로 중간엽 줄기세포 (바람직하게는， 골수 -유래 중간엽 줄기세포)의 유입을 높은 효율로 촉진시키고 상기 케모카인을 포함하는 생분해성 지자체를 손상된 부위에 이식시켜 간편하고 효과적으로 치료할 수 있다는 것을 발견하였다. 관절연골 손상 (joint or cartilage injury)은 손상 부위로 연골세포의 이동이 거의 일어나지 않아 자발적으로 치유되지 않는다. 관절연골 손상의 치료법으로는 자가연골세포이식법 및 골수천공술 등이 있으나， 다음과 같은 단점이 있다: (a) 반복된 수술; (b) 공여부의 제한성; 및 (c) 층분한 중간엽 줄기세포의 유입의 어려움.
최근에는， 종래의 관절연골 손상 치료법의 단점을 극복하기 위해 중간엽 줄기세포를 연골 손상 치료원으로 주목하고 있다.
중간엽 줄기세포 (mesenchymal stem cells, MSCs)는 골， 연골， 근육, 인대， 힘줄 및" 지방 같은 중간엽 조직 (mesenchymal tissues)으로 분화 및 재생할 수 있는 비조혈 기질세포 (nonhematopoietic stromal eel Is)로， 여러 조직에 존재한다. 예를 들어， MSCs 는 골수에 적은 수 (예컨대，
10,000 개의 단핵세포 당 약 1 개)로 존재하는 것으로 알려져 있다. 또한， 비록 불멸화될 수 없을 지라도 MSCs는 성장 및 다계통 분화능을 유지하면서 수십배로 배양되어 증식하는 능력을 가질 수 있다. 또한， 비록 MSC 가 손상된 조직으로 이동하는 것처럼 보일 지라도， 이들의 이동 (trafficking) 및 조직 호밍은 정확하게 이해되지 않는 과정이다. 예를 들어， 케모카인 및 이의 수용체들 중 CXCR4 는 조혈모 줄기세포 및 암세포 전이에 중요한 것으로 알려져 있지만 (Zou YR, et al. , Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development , Nature, 393： 595-599(1998)), MSC 인 비트로 이동 및 MSC 인 비보 호밍에서 CXCR4 발현의 필요성은 평가되지 않았다. 또한, 여러 보고에서 손상된 조직으로 운반된 MSCs 가 회복을 유도할 수 있다는 것이 알려져 있지만, 제한된 MSCs 만이 복구된 조직으로 분화된다는 것이 증명되었다. 이러한 불일치는 다음과 같은 이유로 설명될 수 있다: (a) 복구된 조직에서 MSCs 의 분리의 기술적 어려움; (b) 치유 단계에서 에 주안점을 포함된 세포로의 MSC 분화 정도의 동정 ; (c) MSC 활성 기작으로, 분화가 아닌 MSC의 재생 유도 가능성 . 상술한 바와 같이 , 임상적으로 MSCs 를 적용하기 위한 수많은 연구들이 있었지만， MSCs 이 연골 손상 부위로 회귀 (recruit)하여 생존함으로써 인 비보 치료 효능을 발휘하기 위한 효과적인 방법의 개발은 아직까지 불층분한 상태이다.
본 발명은 사람의 골수 -유래 중간엽 줄기세포에서 발현하고 연골손상 인 비트로 조건 (/? vitro injury) 하에서 발현이 증가하는 케모카인 수용체를 선별하고， 이의 리간드를 포함하는 생분해성 지지체를 손상된 관절에 이식함으로써 중간엽 줄기세포의 호밍을 유도하여 관절 손상을 효과적으로 치료할 수 있다는 것을 보여준다 (참고: 도 5).
본 발명은 손상된 관절 부위로 줄기세포의 인 비보 n vivo) 이동 유도방법을 제공한다.
(a) 화학주성인자 (chemotactic factors)를 포함하는 용액에 생분해성 지지체 (biodegradable scaffolds)를 담그는 단계.
상기 화학주성인자는 조직으로부터 확산되는 세포외 매트릭스 분자들 및 분비된 단백질로， 예를 들어 TGF( trans forming growth factor) 패밀리， BMP (bone morphogenetic protein) 패밀리， CDMP (cart i 1 age-derived morphogenet i c proteins) , FGF( fibroblast growth factor) 패밀리, CTGF( connect ive tissue growth factors) , PDGF ( i ate let -derived growth factor) 패밀리， VEGF vascular endothelial growth factor) 패밀리, 세포외 매트릭스 분자 (예컨대, 오스테오폰틴， 파이브로넥틴, 히알루론산, 헤파린, 트롬보스폰딘， 콜라겐, 비트로넥틴， 등) 및 케모카인을 포함한다. 본 발명의 바람직한 구현예에 따르면， 본 발명의 화학주성인자는 케모카인을 포함한다.
케모카인은 혈액 줄기세포의 조혈기능 및 백혈구의 화학주성 (chemotaxis) 같은 다양한 과정들에서 중요한 생리학적 기능을 하는 단백질 (5-20 kDa)이다. 본 명세서의 용어
"화학주성 (chemotaxis)" 은 화학적 자극들에 의해 유도되는 이동성 세포의 양성 (즉， 자극을 향하는 방향) 또는 음성 (즉, 자극으로부터 멀어지는 방향) 이동을 의미하며， 세포막이 상응하는 화학주성인자 (chemotactic substances; 케모카인)에 의해 활성화되고， 이는 상응하는 세포 표면 수용체 (케모카인 수용체)에 의해 매개된다.
모든 케모카인의 아미노산 서열은 유사하고 4 개의 시스테인의 연속적인 배열에 의해 특징화될 수 있다. 케모카인 패밀리는 4 개의 서브패밀리로 구분된다: (a) CCL; (b) CXCL; (c) CX3CL; 및 (d) XCL( Murphy, et al . , International union of pharmacology, XXII , Nomenclature of chemokine receptors, Pharmacol Rev, 52: 145-176(2000)) . 본 발명의 바람직한 구현예에 따르면, 본 발명에서 이용될 수 있는 케모카인은 CCL20(MIP-3a), CCL19, CCL21, CCL27, CCL28, CXCL8(IL-8)( CXCL9, CXCL10, CXCL11, CXCL12(SDF-1) , CXCL16, CXCL13, CXCL5, CXCL6, CCL2(MCP-1), CCL8, CCL13, CCL25, CCL3, CCL4, CCL5, CCL7, CCL14, CCL15, CCL 16, CCL23, CX3CL1, XCL1, XCL2, CCL1, CCL17, CCL22, CCL11, CCL24, CCL26, CXCL1, CXCL2, CXCL3 및 CXCL7 을 포함하고, 보다 바람직하게는 CCL20, CCL19, CCL21, CCL27, CCL28, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL16, CXCL13, CXCL5, CXCL6, CCL2, CCL8, CCL13 및 CCL25 를 포함하며 , 보다 더 바람직하게는 CCL20, CXCL8, CCL2 및 CXCL12를 포함하고, 가장 바람직하게는 CCL20 및 CXCL8을 포함한다.
상기 CCL20 및 CXCL8의 아미노산 서열은 각각 서열목록 제 1서열 및 서열목록 제 2서열에 기재되어 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명에서 이용되는 케모카인의 농도는 생분해성 지지체 (1 g) 당 10-1,000 ng/ml 이며， 보다 바람직하게는 생분해성 지지체 (1 g) 당 20-800 ng/ml 이고, 보다 더 바람직하게는 생분해성 지지체 (1 g) 당 35-700 ng/ml 이며， 가장 바람직하게는 생분해성 지지체 (1 g) 당 50-500 ng/ml이다.
본 명세서의 용어 "생분해성 지지체 (biodegradable scaffolds)" 는 상기 화학주성인자를 함유한 생분해성 폴리머로 이루어진 3 차원 구조체를 의미하고, 이식을 통해 타겟 위치 (예컨대， 손상된 관절연골)로 즐기세포, 바람직하게는 중간엽 줄기세포의 이동을 유도하는 지지체로서 기능한다. 바람직하게는, 본 발명의 생분해성 지지체는 생체적합성 물질로, 일반적으로 다공성 미세 지지체를 형성하여 이동하는 세포를 위한 물리적 지지체를 제공하며, 보다 바람직하게는 이식된 위치로 줄기세포 (바람직하게는, 중간엽 줄기세포)의 유입을 위해 제공된다.
본 발명의 바람직한 구현예에 따르면， 본 발명에서 이용될 수 있는 생분해성 지지체는 생체 내에서 분해될 수 있는 조건 하에서 어떠한 크기, 형태 또는 조성물로도 이용될 수 있다.
본 발명의 바람직한 구현예에 따르면， 본 발명에서 이용될 수 있는 생분해성 지지체는 PLGA(poly(lactic-co-glycolic acid)), PLA(polylactic acid) , PGA(polyglycol ic acid) , PCL(poly- ε -capro lactone) , PAA(poly( amino acid)), 폴리안하이드라이드, 폴리오소에스테르， 이의 유도체, 공중합체 및 흔합물， 콜라겐 젤， 폴리비닐 알코올 스폰지, 폴리사카라이드 (예를 들어， 알기네이트), 폴리포스파젠， 폴리아크릴레이트 및 폴리에틸렌 옥사이드-폴리프로필렌 글라콜 블랏 공중합체를 포함하고， 보다 바람직하게는 PLGA, PLA, PGA, PCL, PAA, 폴리안하이드라이드, 폴리오소에스테르 및 이의 유도체， 공중합체 및 흔합물을 포함하며, 가장 바람직하게는 PLGA이다. (b) 상기 생분해성 지지체를 손상된 관절 부위로 이식시키는 단계. 본 발명의 생분해성 지지체는 화학주성을 가지며， 이로 인해 줄기세포 (바람직하게는， 중간엽 줄기세포)의 호밍을 촉진시킨다. 유입된 줄기세포는 손상된 타겟 부위에서 재생 효능을 발휘한다.
본 발명에 따르면, 본 발명의 생분해성 지지체의 이식은 이동된 세포수를 현저하게 증가시켰으며 (참고: 도 2b), 이동 거리 및 이동 속도 (도 2c)도 뚜렷하게 증가시켰다. 또한, 상기 이식은 세포이동 만을 증가시켰을 뿐 세포분화 상에 어떠한 영향도 주지 않았다 (도 3). 이는 본 발명의 생분해성 지지체가 손상된 관절연골 재생을 위해 필요한 자가 중간엽 즐기세포의 유입만을 촉진시킨다는 것을 의미한다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 생분해성 지지체가 이식될 수 있는 관절 부위는 무릎, 엉덩이, 어깨， 발목， 손목， 팔꿈치， 족근골, 척골, 척추골， 손목뼈, 장골 및 턱관절을 포함하지만， 이에 한정되는 것은 아니다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 생분해성 지지체의 이식은 손상된 관절 부위로 줄기세포의 세포 이동능을 증대시킨다.
본 발명의 바람직한 구현예에 따르면， 본 발명에서 유입이 유도된 줄기세포는 자가 (autologous ) 줄기세포 또는 비자가 (non-auto logous) 줄기세포를 포함하고， 보다 바람직하게는 자가 줄기세포이고， 보다 바람직하게는 자가 중간엽 줄기세포이며, 가장 바람직하게는 골수 -유래 중간엽 줄기세포이다. 본 발명의 또 다른 양태에 따르면, 본 발명은 IL(interleukin)-8, MIP(Macrophage Inflammatory Protein)-3a 또는 이의 유도체를 가진 생분해성 지지체 (biodegradable scaffolds)를 유효성분으로 포함하는 손상된 관절 (damaged joint or cartilage) 치료용 이식 조성물 (implantable compos it ions)을 제공한다.
본 발명의 조성물은 유효성분으로써 상술한 본 발명의 생분해성 지지체를 포함하기 때문에， 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을ᅳ피하기 위하여 그 기재를 생략한다.
본 발명에 따르면, 본 발명의 생분해성 지지체는 살아있는 포유동물에 이식될 수 있으며， 보다 바람직하게는 손상된 관절 부위 (예컨대， 관절연골)에 이식될 수 있다.
본 발명의 바람직한 구현예에 따르면， 상기 포유동물은 특별하게 제한되지 않으며， 바람직하게는 포유동물이고， 보다 바람직하게는 인간， 마우스, 래트， 토끼， 원승이, 돼지, 말， 소, 양， 영양， 개 및 고양이를 포함하며， 보다 더 바람직하게는 인간 및 마우스를 포함한다. 본 발명의 바람직한 구현예에 따르면， 본 발명의 손상된 관절연골 부위는 유리질연골 (hyaline cartilage; 예를 들어， 관절， 코， 후두 또는 흉골에 있는 유리질 연골), 탄성연골 (elastic cartilage; 예를 들어 귀에 있는 탄성연골) 및 섬유연골 (fibrocartilage; 예를 들어， 추간판)을 포함하지만， 이에 한정되는 것은 아니다.
본 발명의 바람직한 구현예에 따르면， 본 발명의 조성물에 의해 치료될 수 있는 관절연골 질환은 골관절염 및 류마티스 관절염을 포함하는 관절염， 골다공증， 골연골증， 골연골염， 불완전 골형성증， 골수염, 골증식체, 연골형성부전증, 연골염， 연골종, 연골육종， 추간판 탈출증, 클리펠 -파일 증후군， 변형성 골염， 낭성 섬유뼈염， 및 사고， 골절， 상처， 관절 손상， 자가면역질환， 당뇨병 및 암으로 인한 조직 손상과 연관된 관절연골 질환을 포함하지만， 이에 한정되는 것은 아니다.
본 발명의 조성물은 (a) 상술한 생분해성 지지체의. 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 약제학적 조성물로도 제공될 수 있다.
본 명세서에서 용어 "약제학적 유효량" 은 상술한 생분해성 지지체의 효능 또는 활성을 달성하는 데 층분한 양을 의미한다.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우， 본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함한다. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비를， 만니를, 전분, 아카시아 고무， 인산 칼슘, 알기네이트, 젤라틴， 규산 칼슘， 미세결정성 ¾를ᅳ로스， 폴리비닐피를리돈, 샐를로스， 물, 시럽， 메틸 셀를로스, 메틸히드록시벤조에이트， 프로필히드록시벤조에이트， 활석， 스테아르산 마그네슴 및 미네랄 오일 등을 포함하나， 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제， 감미제， 향미제， 유화제， 현탁제， 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's
Pharmaceutical Sciences (19th ed. , 1995)에 상세히 기재되어 있다. 본 발명의 약제학적 조성물은 손상된 부위에 직접적으로 투여하며， 예를 들어 피하 주입， 근육 주입, 경피 투여， 관절강내 주사， 등으로 투여할 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법， 투여 방식， 환자의 연령, 체중， 성, 병적 상태， 음식， 투여 시간， 투여 경로， 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액， 현탁액， 시럽제 또는 유화액 형태이거나 엑스제， 산제， 분말제， 과립제， 정제 또는 갑셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다. 본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 손상된 관절연골 (damaged joint or cartilage)로 줄기세포의 인 비보 {in vivo) 이동 유도방법 및 이를 이용한 치료용 이식 조성물에 관한 것이다.
(b) 본 발명에 따르면， 본 발명의 화학주성인자 (예컨대, IL-8 또는 ΜΙΡ-3α)와 반웅시킨 생분해성 지지체를 손상된 위치 (예컨대， 관절연골)에 이식하여 줄기세포 (바람직하게는， 중간엽 줄기세포)의 호밍을 유도 /촉진함으로써 손상된 관절연골을 치료할 수 있다.
(c) 따리 "서， 본 발명의 생분해성 지지체는 종래 기술과 비교하여 보다 간편하고 효율적으로 손상된 관절연골의 치료에 적용될 수 있다.
【도면의 간단한 설명】
도 1 은 친염증성 사이토카인에 의해 자극된 인간 골수 -유래 중간엽줄기세포에서 케모카인 수용체들의 변화된 유전자 발현을 나타내는 결과이다. A: RT-PCR; B: 역반점 -탁본 (reverse dot-blot). 대조군, 정상 중간엽 줄기세포군; IL-4h, 4시간 동안 IL-Ιβ-자극된 군; IL-24h, 24시간 동안 IL-Ιβ-자극된 군; IL-48h, 48 시간 동안 IL-Ιβ-자극된 군; TNF-4h, 4 시간 동안 TNF- α-자극된 군; TNF-24h, 24 시간 동안 TNF-α-자극된 군; 및 TNF-48h, 48시간 동안 TNF-a—자극된 군.
도 2 는 세포 증식 및 이동에서 케모카인 (chemokines)의 효과를 나타내는 결과이다. 도 2a 는 세포 증식 (cell proliferation)을 보여주는 결과이며, 도 2b 는 상처 치유 효과를 나타내는 결과이고， 도 2c 는 이동능 (migratory capacity)을 나타내는 결과이다.
도 3 는 세포 분화 상에 케모카인의 효과를 나타내는 결과이다. 도 3a의 위쪽 패널은 마슨 트라이콤 (Masson tri chrome) 염색 결과를 보여주며， 아래쪽 패널은 연골 표지 유전자의 발현을 조사한 결과이다. 도 3b 는 폰 코사 (Von kossa) 염색 결과를 보여주는 결과이다. 약어: N.C, 음성대조군; 및 P.C., 양성대조군.
도 4은 bMSCs의 인 비트로화학주성을 보여주는 결과이다.
도 5 는 bMSCs 의 인 비보 화학주성을 보여주는 결과이다. 위쪽 패널은 동물실험 결과를 나타내며 (W, 주)， 아래쪽 패널은 케모카인을 함유한 PLGA지지체 이식 모식도를 나타낸다.
도 6 는 bMSCs 의 인 비보 화학주성관찰 후 육안관찰 (A) 및 병리학적 소견 (B)을 보여주는 결과이다.
【실시예】
이하， 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 ≤ 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. 실시예
대상 및 방법
세포배양
사람의 골수유래 중간엽 줄기세포는 자가장골 이식술이 필요한 환자의 동의 하에 IRB 심의를 거쳐 후 장골능 (posterior iliac crest)에서 골수를 흡인하고 원심 분리를 하여 골수 내 세포를 침전시켜 펠렛을 만들고, 상층액을 제거한 후 DMEM-LG(Dulbecco's modified eagle's medium- low glucose; GIBCO-BRL, Grand Island, NY, USA) 배양액에 10%(v/v) 우태아혈청 (FBS, fetal bovine serum; GIBCO BRL, Grand Island, NY, USA), 100 units/ml 의 페니실린 G(GIBCO) 및 0.1 mg/ml 스트렙토마이신 (GIBCO)이 첨가된 기본 배양액으로 세척한 후 T-75 cm2 세포 배양 플라스크 (Falcon, Germany)에 분주시켰으며， 4 일 동안 배양하였다. 이후， 플라스크 바닥에 부착되지 않은 세포들은 제거하였고, 바닥에 부착된 중간엽 줄기세포는 3일 간격으로 배양액을 교환하여 플라스크에 약 90% 정도 차게 되면 계대 배양을 시행하였다. 분리된 골수 유래 중간엽 줄기세포는 2 또는 3 계대 배양까지 세포를 증식시켰으며, 모든 실험은 2 또는 3 계대의 세포를 사용하였다. 체외 연골손상조건 형성
체외 연골손상 조건은 전염증성사이토카인인 IL-ip(R&D Systems Inc. , Minneapolis, 丽， USA) 또는 TNF- α (翻 Systems Inc.)를 처리함으로써 조성하였다. 중간엽 줄기세포를 12 시간 동안 우태아혈청^ 포함되지 않은 DMEM-LG 배양액에서 배양한 후, 10 ng/ml 의 농도로 IL-Ιβ 또는 TNF-α를 배양액에 첨가하여 4, 24， 48 시간동안 세포를 배양한 후 실험에 사용하였다. 역전사-중합효소 연쇄반웅기법 (Reverse Transcriptase-Polymerase Chain Reaction)
정상 중간" 줄기세포에서 발현하는 케모카인 수용체를 선별하기 위해 RNeasy kitCQiagen, Valencia, CA, USA)를 이용하여 중간엽 줄기세포의 총 RNA 를 추출하여， 역전사-중합효소 연쇄반응기법을 통해 케모카인 수용체의 유전자 발현을 분석하였다. 분석한 케모카인 수용체는 CCR1-10, CXCR1-7, CX3CR, XCR1 로써 총 19 개이다 (표 1). 증폭된 케모카인 수용체의 DNA는 3100 Genetic Analyser (Applied Biosystemslnc . , Foster City, CA, USA)를 이용한 DNA 염기서열분석법기법을 이용하여 서로 중복된 서열이 없음을 확인하였.다.
【표 1】 RT-PCR 에 이용된 프라이머 서 열
Figure imgf000015_0001
역방향 CTCGGTGATGGAAATCCACT
정방향 GAAACGCATGCCTGGTTCAC
CXCR5 490
역방향 ACCTAGAACGTGGTGAGAGA
정방향 TTCTTCTGCCACTGCTCAC
CXCR6 518
역방향 AAACAAAGCCTGCCTCACCA
정방향 AACTTCTCGGACATCAGCTG
CXCR7 516
역방향 GGTCTTCAGGTAGTAGGTGT
정방향 GATCTGCTGTTTGTAGCCAC
CX3CR 539
역방향 CATAGAGCTTAAGCGTCTCC
정방향 GAGTCCCTCACCAACATCTT
XCR 550
역방향 ACAGGGTGAAGTTGTAGGGA
정방향 ATCACTGCCACCCAGAAGAC
GAPDH 444
역방향 ATGAGTCCACCACCCTGTT 역반점 -탁본 부합법 (Reverse Dot-Blot Hybridization)
IL-Ιβ 또는 TNF-α에 의해 발현이 증가하는 케모카인 수용체를 선별하기 위해 역전사-중합효소 연쇄반웅기법을 이용하여 19 개의 케모카인 수용체의 DNA를 합성하여 시료 DNA로 사용하였고, 4， 24 또는 48시간 동안 IL-Ιβ 또는 TNF— α의 자극을 받은 중간엽 줄기세포의 cDNA 를 Omniscript RT Kit(Qiagen)를 이용하여 합성하여 프로브 cDNA 로 사용하였다. 케모카인 수용체의 DNA 를 나일론 막 (Amersham, GE healthcare, UK)에 듯팅 (dotting)하여 자외선 (1200X100 ujuies)을 조사하여 고정하였고, 전염증성사이토카인의 자극을 받은 중간엽 줄기세포의 cDNA를 Rediprime II random prime labeling system(GE Healthcare UK Limited. Amersham Place, Little Chalfont, Buckinghamshire, UK)과 γ 32P_dCTP(NEN Life Sciences, Boston, USA)를 이용하여 표지하였다. 막에 고정된 케모카인 수용체의 DNA 와 표지된 중간엽 즐기세포의 cDNA 는 42°C에서 15 시간 동안 흔성화하였다. 막을 세척한 후， 형광 이미지 분석기 (FLA-7000, Fujifilm, Japan)로 시그널을 검출하여 밀도계측기 (TINA pixel analyzer version 2.10, Raytest I sot open megerate GmbH, Straubenhardt , Germany)를 이용하여 정량화하였다. 정량화된 결과값은 쌍 t-검정 (paired t_tests)을 이용하여 통계학적 유의성을 검증하였다 ( 값 < 0.05). 세포증식에 대한 영향
세포증식에 대한 영향을 확인하기 위해 MSC 에 50—500 ng/ml 의 케모카인이 처리되어 1 일부터 4 일 동안 배양하였다. 케모카인 자극 후 각 날짜별로 MTT법을 이용하여 세포증식률올 측정하였다. 세포분화에 대한 영향
연골아세포로의 분화 유도를 위해 10 ng/ml TGF-p3(R & D system
Inc, Minneapolis, 丽， USA) 및 30 ^g/ml 아스코르빈산 (Sigma Co., St. Louis, MO, USA)이 첨가된 기본 배양액 [10% 우태아 혈청 (GIBC0), 1% 항생제 (antibiotic-antimycotic) 용액 (GIBC0)이 함유된 DMEM- LG(GIBCO)]에서 14 일 동안 연골 분화를 유도하였으며， TGF-P3 를 처리 하지 않은 중간엽 줄기 세포와 비교하여 연골 분화 상태를 검사하였다. 골아세포로의 분화 유도를 위해 골아세포 분화 배양액 [10 mM β- glycerophosphate(Sigma) , 100 μΜ dexamethasone( Sigma) , 50 μ g/ml ascorbic acid_2-phosphate(Sigma)가 첨가된 기본배양액]에서 14 일 동안 분화유도 후 기본배양액에서 배양한 중간엽줄기세포와 비교하였다. 상처 치유 및 실시간 세포이동 속도의 측정
상처 형성을 위해 실리콘 배양 삽입 (silicon culture insert; IBIDI, —Germany)를 이용하여 MSC 를 배양한 후， 세포에 500 ng/mL 의 케모카인 자극을 가하여 상처 치유 정도를 이동한 세포수를 세어 분석하였고, 이동하는 세포를 실시간 추적하여 이동거리 및 속도를 측정하였다. 세포 화학주성 확인
인 비트로 세포 화학주성은 8 -구멍 크기의 트랜스웰 인서트 (Falcon, Germany)를 이용하여 세포를 배양한 후, 마이크로포어를 통과하여 케모카인을 향해 이동한 세포를 카운팅하여 평가하였다. 인 비트로 세포 화학주성은 형광표지된 1.5X106 개의 MSC 가 꼬리 혈관에 주입되어 누드마우스 피하에 이식된 케모카인 (IL-8, MIP-3a)올 함유한 PLGA 지지체 (한국과학기술연구원 바이오소재센터 김수현 박사로부터 제공받음)를 향해 이동함을 실시간 촬영장비 (Opt ix, ART 사, USA)로 관찰하였다. 실험결과
중간엽 줄기세포에서 발현하는 케모카인 수용체
역전사-중합효소 연쇄반웅기법을 수행하기 위해 제작한 사람의 케모카인 수용체에 대한 프라이머 서열은 다음과 같다 (표 1). 표 1 의 프라이머에 의해 증폭된 유전자의 염기서열은 DNA 염기서열분석법을 통해 다른 케모카인 수용체의 서열과 서로 중복되지 않음을 확인하였다 (결과를 보이지 않음). RT-PCR 을 통해 사람의 골수 유래 정상 중간엽 줄기세포에서 19개의 케모카인 수용체의 발현을 분석하였다 (도 1). 세 명 이상의 공여자 (donor)로부터 얻은 중간엽 줄기세포에서 케모카인 수용체의 발현을 분석한 결과， CCR2, CCR6, CCR7, CCR8, CCR9, CCR10, CXCR1, CXCR5 및 CXCR7이 세 명 이상의 중간엽 즐기세포에서 공통적으로 발현하였다. 관절연골 손상시 골수 유래 중간엽 줄기세포에서 발현이 증가하는 케모카인 수용체
관절연골이 손상되면 전염증성사이토카인들 (IL-Ιβ 또는 TNF-α)이 분비되고 이에 자극받은 연골세포 등에 의해 다양한 화학주성인자의 분비가 증가한다 [23]. 따라서， 관절연골 손상모델에서 중간엽 줄기세포에서 발현하는 케모카인 수 "용체 중에서 어떤 수용체가 증가하는지 알아보기 위하여 역반점 -탁본 부합법을 이용하여 세 명의 공여자로부터 얻은 중간엽 줄기세포에서 4， 24 및 48 시간째에 IL— 1β 또는 TNF- a의 자극에 의해 증가하는 케모카인 수용체를 분석하였다. 본 논문에서는 대표 공여자 1 인에 대한 결과만을 보였으나 반복실험을 통해 세 명의 공여자로부터 유래한 중간엽 줄기세포에서 케모카인 수용체의 발현 양상이 모두 유사함을 확인하였다 (도 2). 역반점 -탁본 부합법의 결과를 각 공여자의 중간엽 줄기세포에 대한 결과를 밀도계측기 (densitometry TINA Pixel Analyzer version 2.10 (Ray test Isotopenmegerate GmbH, Straubenhardt , Germany)를 이용하여 정량하여 2 배 이상 (fold change > 2) 증가한 수용체를 자극시간에 따라 정리한 결과, 각 공여자의 중간엽 줄기세포에서 세 명의 공여자의 중간엽 줄기세포에서 공통으로 전염증성사이토카인에 의해 2 배 이상 증가하는 케모카인 수용체를 정리하면, CCR2, CCR4, CCR6, CXCR1, CXCR2, CXCR3 등이 세 명의 공여자의 중간엽 줄기세포에서 공통으로 발현이 증가하였으며 이 외의 수용체들은 발현 증가율이 통계적으로 유의하지 않았다.
상술한 결과들을 종합하면， CCR2, CCR4, CCR6, CXCR1 등의 수용체들이 정상 중간엽 줄기세포에서 유의하게 발현하고， 전염증성사이토카인에 의해 그 발현이 세 공여자의 중간엽 줄기세포에서 유의하게 증가하였다 (2배 이상). 세포이동에 대한 영향
선별된 후보물질들의 세포이동에 대한 영향을 평가하기 위해 상처 치유 기법을 실시하였다. 기존 보고된 바에 의하면， SDF1 은 CXCR4 와 CXCR7 을 통하여 중간엽 줄기세포의 화학주성을 유도하는 것으로 알려져 있다 [17]. 따라서， 본 연구에서 선별된 후보인자와 SDF1 을 함께 비교하였다. 먼저, 상처 치유 효과가 세포증식이 아님을 확인하기 위해 세포증식에 대한 영향을 살펴본 결과， 50, 100 또는 500 ng/ml 의 농도에서 세포 독성 및 세포증식에 대해 아무런 영향을 주지 않았다 (도 2a). 네 가지 후보물질들 중 IL-8 과 ΜΙΡ-3α가 가장 빠른 상처 치유 결과를 보였으며 다양한 농도 중에서 500 ng/ml 의 농도에서 가장 좋은 결과를 확―인하였다 (도 2b). 다음으로， 움직이는 세포를 실시간으로 추적하여 세포의 이동거리 및 속도를 측정하였다. MIP-3a가 가장 빠른 속도로 가장 많은 거리를 세포를 움직이는 것으로 확인되었다 (도 2c)/ 세포분화에 대한 영향
14 일 동안의 중간엽 줄기세포의 골， 연골 분화유도 동안 후보인자에 의한 영향을 살펴본 결과 분화에 대해 영향을 주지 않는 것으로 확인되었다 (도 3). 따라서， 본 연구에서 발굴된 케모카인은 손상된 관절연골 재생을 위해 필요한 자가 중간엽 줄기세포의 유입을 촉진하는 것으로 사료된다. 화학주성 평가
인 비트로 및 인 에서 선별된 후보물질들의 중간엽 줄기세포에 대한 화학주성을 평가하였다. 먼저， 트랜스웰 인서트를 이용한 인 비트로 실험에서 TNFa를 향한 세포화학주성이 관찰되었다 (도 4a). 한편, 선별된 네 가지 후보물질들 중 IL-8 과 MIP-3a 가 인 /^^에서 세포화학주성을 가장 많이 유도하였다 (도 4b). 따라서， IL-8 과 ΜΙΡ-3α에 의해 유도된 세포화학주성을 인 에서도 확인하고자 하였다. PLGA 지지체를 PBS 또는 IL-8 및 ΜΙΡ-3α에 각각 24시간 동안 담근 후 누드마우스 등의 피하에 이식한 후， 꼬리 혈관을 통해 주입된 중간엽 줄기세포의 이동을 세포에 표지된 형광을 이용하여 확인하였다. 약 2주째 주입된 중간엽 줄기세포가 IL-8 및 ΜΙΡ-3α에서 확인되었으며 6 주째까지 세포의 이동이 증가하여 관찰되었다 (도 5). 육안관찰및 병리학적소견
지지체와 함께 이식된 화학주성인자에 의한 염증세포의 유입 정도를 살피고 염증반웅을 확인하기 위해 6주 째에 이식된 지지체를 회수하여 육안 관찰 및 Η&Ε 염색법을 실시하였다. 육안 관찰 결과， PBS군에 비해 IL8 및 ΜΙΡ3α군의 지지체는 이식된 부위의 주변조직과 융합이 잘 되어있고 혈관형성이 많았다 (도 6a) · H&E 염색결과, PBS 군은 이식된 지지체의 ¬¬가장차리 부위에만 일부 혈관형성이 되었고 그 주변에 동공 (pore)를 따라 다양한 세포들이 침투하였으나， IL8 또는 ΜΙΡ3α군에서 혈관이 지지체의 중앙 부위까지 많이 형성되어 있었고 주입된 사람의 중간엽 줄기세포가 지지체 중앙부위까지 침투하여 세포외 기질을 형성하였다. PBS, IL8, ΜΙΡ3α군 모두 대식세포 등을 비롯한 염증성 세포가 혈관주변에서 일부 관찰은 되었으나 군간의 차이가 없었으며 세 군 모두 염증반웅소견을 확인할 수 없었다 (도 6b). 이상으로 본 발명의 특정한 부분을 상세히 기술하였는바， 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며， 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. 참고문헌
1. Hunter W. Of the structure and disease of articulating cartilages. 1743. Phil os Trans R SocLond 1995； 42b :514-21.
2. Buckwalter JA, Mankin HJ . Articular cartilage repair and transplantation. Arthritis Rheum 1998;41:1331-42.
3. Pr idie . A method of resurfacing osteoarthritis knee joints. J Bone Joint Surg Br 1959； 41： 618-9.
4. Steadman JR, Rodkey WG, Briggs KK, Rodrigo JJ. The microfracture technic in the management of com lete cartilage defects in the knee joint. Orthopade 1999； 28： 26-32
5. Brittberg M, Lindahl A, Nilsson A, Oh Is son C, Isaksson 0， Peterson L. Treatment of deep cart i 1 age defects in the knee with autologous chondrocyte transplantation. N Engl J Med 1994;331:889-95.
6. Pelttar i K, Lorenz H, Boeuf S, Tempi in MF, Bischel 0， Goetzke , et al . Secret ion of matrix metal loproteinase 3 by expanded articular chondrocytes as a predictor of ectopic cartilage formation capacity in vivo. Arthritis Rheum 2008； 58： 467-74.
7. Kessler MW, Acker man G, Dines JS, Grande D. Emerging technologies and fourth generation issues in cartilage repair . Sports Med Arthrosc
2008；16：246-54.
8. DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cart i 1 age development . Osteoarthritis Cartilage 2000 ;8 :309-34.
9. Dickhut A, Gottwald E, Steck E, Heisel C, Richter W. Chondrogenesis of mesenchymal stem eel Is in gel-1 ike biomaterials in vitro and in vivo. Front Biosci 2008; 13 :451그 28. 10. Steck E, Fischer J, Lorenz H, Got ter barm T, Jung M, Richter W. Mesenchymal stem cell differentiation in an experimental cartilage defect: restriction of hypertrophy to bone-close neocarti lage. Stem Cells Dev 2009;18:969-78.
11. Zhao LR, Duan 丽， Reyes M, Keene CD, Verfaillie CM, Low WC. Human bone marrow stem eel Is exhibit neural phenotypes and ameliorate neurological deficits after grafting into the ischemic brain of rats. ExpNeurol 2002;174:11-20.
12. Jin HK, Carter JE, Huntley GW, Schuchman EH. Intracerebral transplantation of mesenchymal stem eel Is into acid sphingomyelinase deficient mice delays the onset of neurological abnormalities and extends their life span. J Clin Invest 2002;109:1183-91.
13. Turgeman G, Pittman DD, Muller R, Kurkalli BG, Zhou S, Pel led G, et al . Engineered human mesenchymal stem cells: a novel platform for skeletal cell mediated gene therapy. J Gene Med 2001 ;3:240—51.
14. La i dot T, Dar A, Kol let 0. How do stem eel Is find their way home? Blood 2005；106：1901-10.
15. Frenette PS, Subbarao S, Mazo IB, vonAndr i an UH, Wagner DD. Endothelial select ins and vascular cell adhesion molecule- 1 promote hematopoietic progenitor homing to bone marrow. ProcNat lAcadSci USA 1998；95：14423-8.
16. Papayannopoulou T, Priestley GV, Nakamoto B, Zaf iropoulos V, Scott LM. Molecular pathways in bone marrow homing: dominant role of a(4)b(l) over b(2)-integrins and select ins. Blood 2001 ;98 :2403-11.
17. Lap i dot T, Kol let 0. The essential roles of the chemokine SDF-1 and its receptor CXCR4 in human stem cell homing and repopulation of transplanted immune-deficient N0D/SCID and N0D/SCID/B2m (null) mice. Leukemia 2002； 16： 1992-2003.
18. Baggiol ini M. Chemokines in pathology and medicine. J Intern Med 2001；250：91-104. 19. Luster AD. Chemokines— chemotactic cytokines that mediate inflammation. N Engl J Med 1998； 338： 436-45.
20. Rollins BJ. Chemokines. Blood 1997;90:909-28.
21. Richard H. Chemokine receptors . Cytokine and Growth Factor Reviews 2001 ;12 ;313-35.
22. Ponte AL, Marais E, Gal lay N, Langonne A, Delorme B, Herault 0， et al. The in vitro .migration capacity of human bone marrow mesenchymal stem cells: comparison of chemokine and growth factor chemotactic activities. Stem Cells 2007； 25： 1737-45.
23. Sasaki M, Abe R, Fuj ita Y, Ando S, Inokuma D, Shimizu H. Mesenchymal stem eel Is are recruited into wounded skin and contribute to wound repair by transdi f f erent i at ion into multiple skin cell type. J I匪 unol 2008；15：2581-7.

Claims

【청구의 범위】
【청구항 1】
다음의 단계를 포함하는 손상된 관절 부위로 줄기세포의 인 비보 in vivo) 이동 유도방법 :
(a) 화학주성인자 (chemotactic factors)를 포함하는 용액에 생분해성 지지체 (biodegradable scaffolds)를 담그는 단계; 및
(b) 상기 생분해성 지지체를 손상된 관절 부위에 이식시키는 단계.
【청구항 2]
제 1 항에 있어서， 상기 화학주성인자는 IL(interleukin)-8,
MIPCMacrophage Inflammatory Protein)-3a 또는 이의 유도체인 것을 특징으로 하는 방법 .
【청구항 3】
제 1 항에 있어서， 상기 생분해성 지지체는 PLGA(poly(lactic-co- glycol ic acid)) , PLACpolylactic acid) , PGA(polyglycol ic acid) , PCL(poly- ε -caprolactone) , PAA(poly(amino acid)), 폴리안하이드라이드， 폴리오소에스테르 또는 이의 유도체， 공중합체 및 흔합물을 포함하는 것을 특징으로 하는 방법 .
【청구항 4】
제 1 항에 있어서， 상기 손상된 관절은 무릎， 엉덩이， 어깨， 발목， 손목， 팔꿈치, 족근골， 척골， 척추골, 손목뼈， 장골 또는 턱관절인 것을 특징으로 하는 방법 .
【청구항 5】
제 1 항에 있어서， 상기 이식은 손상된 관절 부위로 줄기세포의 세포 이동능을 증대시키는 것을 특징으로 하는 방법 .
【청구항 6】 제 1 항에 있어서, 상기 줄기세포는 자가 (autologous ) 줄기세포 또는 비자가 (non-autologous) 줄기세포인 것을 특징으로 하는 방법.
【청구항 7]
제 6 항에 있어서， 상기 줄기세포는 자가 줄기세포인 것을 특징으로 하는 방법ᅳ
【청구항 8]
제 1 항에 있어서， 상기 줄기세포는 중간엽 줄기세포인 것을 특징으로 하는 방법 .
【청구항 9】
제 1 항에 있어서, 상기 방법은 포유동물에 적용될 수 있는 것을 특징으로 하는 방법 .
【청구항 10】
제 9 항에 있어서， 상기 포유동물은 인간， 마우스， 래트， 토끼， 원숭이， 돼지， 말， 소， 양， 영양， 개 또는 고양이를 포함하는 것을 특징으로 하는 방법 .
【청구항 111
IL( inter leukin)-8, MIP(Macrophage Inflammatory Protein)-3a SE^- 이의 —유도체를ᅮ가진 생분해성 지지체 (biodegradable scaffolds)를 손상된 관절 (damaged joint or cartilage)에 이식하는 단계를 포함하는 손상된 관절 치료방법 .
【청구항 12】
제 11 항에 있어서， 상기 생분해성 지지체는 PLGA(poly(lactic-co- glycol ic acid)) , PLA(polylact ic acid) , PGA(polyglycol ic acid), PCL(poly- ε -capro lactone) , PAA(poly(amino acid)), 폴리안하아드라이드， 폴리오소에스테르 또는 이의 유도체， 공중합체 및 흔합물을 포함하는 것을 특징으로 하는 치료방법 .
【청구항 13]
제 11 항에 있어서， 상기 손상된 관절은 무릎， 엉덩이， 어깨, 발목， 손목, 팔꿈치, 족근골, 척골， 척추골, 손목뼈， 장골 또는 턱관절인 것을 특징으로 하는 치료방법 .
【청구항 14]
제 11 항에 있어서, 상기 방법은 이식 부위로 줄기세포의 세포 이동능을 증대시키는 것을 특징으로 하는 치료방법 .
【청구항 15】
제 14 항에 있어서， 상기 줄기세포는 자가 (autologous ) 줄기세포 또는 비자가 (non— autologous) 줄기세포인 것을 특징으로 하는 치료방법 .
【청구항 16】
제 15 항에 있어서， 상기 줄기세포는 자가 줄기세포인 것을 특징으로 하는 치료방법 .
【청구항 17]
제 14 항에 있어서, 상기 줄기세포는 중간엽 줄기세포인 것올 특징으로 는 치료방법 .
【청구항 18】
제 11 항에 있어서, 상기 방법은 포유동물에 적용될 수 있는 것을 특징으로 하는 치료방법 .
【청구항 19] 제 18 항에 있어서， 상기 포유동물은 인간， 마우스， 래트, 토끼, 원숭이， 돼지， 말， 소, 양， 영양， 개 또는 고양이를 포함하는 것을 특징으로 하는 치료방법 .
【청구항 20]
IL( inter leukin)-8, MIP(Macrophage Inflammatory Protein)-3a 또는 이의 유도체를 가진 생분해성 지지체 (biodegradable scaffolds)를 유효성분으로 포함하는 손상된 관절 (damaged joint or cartilage) 치료용 이식 조성물 (implantable composition) .
【청구항 21】
제 20 항에 있어서， 상기 생분해성 지지체는 PLGA(poly(lactic-co- glycolic acid)) , PLA(polylact ic acid) , PGA(polyglycol ic acid) , PCL(poly- ε -caprolactone) , PAA(poly(amino acid)), 폴리안하이드라이드， 폴리오소에스테르 또는 이의 유도체， 공중합체 및 흔합물을 포함하는 것을 특징으로 하는 조성물.
【청구항 22】
제 20 항에 있어서， 상기 손상된 관절은 무릎, 엉덩이， 어깨, 발목， 손목， 팔꿈치， 족근골， 척골， 척추골， 손목뼈， 장골 또는 턱관절인 것을 특징으로 하는 조성물.
【청구항 23]
제 20 항에 있어서, 상기 조성물은 이식 부위로 줄기세포의 세포 이동능을 증대시키는 것을 특징으로 하는 조성물.
【청구항 24】
제 23 항에 있어서, 상기 줄기세포는 자가 (autologous ) 줄기세포 또는 비자가 (non-autologous) 줄기세포인 것을 특징으로 하는 조성물.
【청구항 25】 제 24 항에 있어서 , 상기 줄기세포는 자가 줄기세포인 것을 특징으로 하는 조성물.
【청구항 26】
제 23 항에 있어서， 상기 줄기세포는 중간엽 줄기세포인 것을 특징으로 하는 조성물.
【청구항 27】
제 20 항에 있어서， 상기 조성물은 포유동물에 적용될 수 있는 것을 특징으로 하는 조성물.
【청구항 28】
제 27 항에 있어서， 상기 포유동물은 인간， 마우스， 래트， 토끼， 원숭이, 돼지， 말, 소， 양, 영양, 개 또는 고양이를 포함하는 것을 특징으로 하는 조성물.
PCT/KR2011/003732 2011-03-08 2011-05-20 줄기세포의 인 비보 이동 유도방법 WO2012121451A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20110020221 2011-03-08
KR10-2011-0020221 2011-03-08

Publications (1)

Publication Number Publication Date
WO2012121451A1 true WO2012121451A1 (ko) 2012-09-13

Family

ID=46798389

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/003732 WO2012121451A1 (ko) 2011-03-08 2011-05-20 줄기세포의 인 비보 이동 유도방법

Country Status (6)

Country Link
US (1) US9220757B2 (ko)
EP (1) EP2684575B1 (ko)
JP (1) JP5828916B2 (ko)
KR (2) KR101466811B1 (ko)
CN (1) CN103561788B (ko)
WO (1) WO2012121451A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2684575A2 (en) * 2011-03-08 2014-01-15 Tego Science Inc. Method for inducing in vivo migration of stem cell

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11027047B2 (en) 2015-03-31 2021-06-08 The University Of North Carolina At Chapel Hill Delivery vehicles for stem cells and uses thereof
WO2018008941A1 (ko) * 2016-07-04 2018-01-11 주식회사 강스템바이오텍 연골 무세포 파쇄물 및 줄기세포를 포함하는 연골분화 촉진용 복합체 및 그의 용도
KR101994177B1 (ko) * 2016-07-15 2019-06-28 연세대학교 산학협력단 Il-8 및 골수농축액의 조합을 이용한 연골 재생
KR101698447B1 (ko) * 2016-08-10 2017-01-20 테고사이언스 (주) 케모카인을 유효성분으로 포함하는 피부개선용 조성물
US10004830B2 (en) 2016-11-28 2018-06-26 DATT MEDIPRODUCTS LIMITED and DATT LIFE SCIENCE PVT. LTD. Ready to use biodegradable and biocompatible artificial skin substitute and a method of preparation thereof
CN108355167A (zh) * 2018-04-27 2018-08-03 昆明医科大学第附属医院 一种缓释sdf-1的壳聚糖包被bcbb骨修复支架材料及其制备方法
CN111206018A (zh) * 2020-02-25 2020-05-29 无锡市人民医院 一种用于治疗急性肝衰竭的间充质干细胞的制备方法
KR102604981B1 (ko) 2020-11-11 2023-11-23 고려대학교 산학협력단 Cxcr4와 상호작용하여 줄기세포 이동을 유도하는 신규한 sdp-4 펩타이드
KR102515415B1 (ko) 2020-11-11 2023-03-30 고려대학교 산학협력단 Cxcr4와 상호작용하여 줄기세포 이동을 유도하는 신규한 펩타이드
KR102537675B1 (ko) 2020-11-13 2023-05-31 고려대학교 산학협력단 포밀 펩타이드 수용체에 결합하는 줄기세포 이동용 펩타이드
KR102647353B1 (ko) 2021-02-19 2024-03-13 한국화학연구원 중간엽 줄기세포 증식 및/또는 이동 촉진용 조성물
KR20230013415A (ko) 2021-07-19 2023-01-26 한국화학연구원 중간엽 줄기세포 이동 촉진용 조성물
CA3233658A1 (en) 2021-10-06 2023-04-13 Ursula Gompels Novel immune regulator

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100520944B1 (ko) * 2000-05-26 2005-10-17 꼴레띠까 인공조직 및 생체재료 제조용 콜라겐 지지체
US20090017096A1 (en) * 2005-08-15 2009-01-15 Anthony Lowman Porous non-biodegradable hydrogel admixed with a chemoattractant for tissue replacement
KR20100059367A (ko) * 2008-11-26 2010-06-04 한국과학기술연구원 인 시튜 조직재생용 지능형 다공성 생분해 고분자 지지체 및 이의 제조방법

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11003A (en) * 1854-06-06 Combination of railroad tracks and wheels
US5504003A (en) * 1994-03-08 1996-04-02 Human Genome Sciences, Inc. Macrophage inflammatory protein-3 and -4
CA2379909C (en) * 1999-08-06 2011-01-04 Board Of Regents, The University Of Texas System Drug releasing biodegradable fiber implant
DE10350654A1 (de) * 2003-10-29 2005-06-02 Dr. Suwelack Skin & Health Care Ag Collagen-Träger-Wirkstoff-Zusammensetzung
WO2005074836A1 (en) * 2004-01-29 2005-08-18 Brown University Methods for progenitor cell recruitment and isolation
US8932620B2 (en) * 2005-06-17 2015-01-13 Drexel University Three-dimensional scaffolds for tissue engineering made by processing complex extracts of natural extracellular matrices
EP2390312A1 (en) * 2005-11-29 2011-11-30 Gamida Cell Ltd. Methods of improving stem cell homing and engraftment
US20070184087A1 (en) * 2006-02-06 2007-08-09 Bioform Medical, Inc. Polysaccharide compositions for use in tissue augmentation
US7741273B2 (en) * 2006-04-13 2010-06-22 Warsaw Orthopedic, Inc. Drug depot implant designs
WO2008008266A2 (en) * 2006-07-07 2008-01-17 University Of Pittsburgh- Of The Commonwealth System Of Higher Education Biohybrid elastomeric scaffolds and methods of use thereof
US20080082168A1 (en) * 2007-07-31 2008-04-03 Marc Peterman Surgical scaffold to enhance fibrous tissue response
US8828354B2 (en) * 2008-03-27 2014-09-09 Warsaw Orthopedic, Inc. Pharmaceutical gels and methods for delivering therapeutic agents to a site beneath the skin
US9012399B2 (en) * 2008-05-30 2015-04-21 President And Fellows Of Harvard College Controlled release of growth factors and signaling molecules for promoting angiogenesis
CN101507835B (zh) * 2009-03-10 2013-05-22 广州迈普再生医学科技有限公司 一种纳米仿生创面覆盖物及其制备方法
CN101829361B (zh) * 2009-03-10 2013-08-21 广州迈普再生医学科技有限公司 一种用于组织修复的纳米仿生材料及其制备方法
US20120100185A1 (en) * 2009-04-13 2012-04-26 Xuejun Wen Regeneration of tissue without cell transplantation
CN101574543B (zh) * 2009-06-09 2014-10-29 广州迈普再生医学科技有限公司 一种基于自体细胞的人工关节软骨及其制备方法
US20110038921A1 (en) * 2009-08-13 2011-02-17 Clemson University Research Foundation Methods and compositions for temporal release of agents from a biodegradable scaffold
WO2012121451A1 (ko) * 2011-03-08 2012-09-13 연세대학교 산학협력단 줄기세포의 인 비보 이동 유도방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100520944B1 (ko) * 2000-05-26 2005-10-17 꼴레띠까 인공조직 및 생체재료 제조용 콜라겐 지지체
US20090017096A1 (en) * 2005-08-15 2009-01-15 Anthony Lowman Porous non-biodegradable hydrogel admixed with a chemoattractant for tissue replacement
KR20100059367A (ko) * 2008-11-26 2010-06-04 한국과학기술연구원 인 시튜 조직재생용 지능형 다공성 생분해 고분자 지지체 및 이의 제조방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
INOKUMA ET AL.: "CTACK/CCL27 accelerates skin regeneration via accumulation of bone marrow-derived keratinocytes", STEM CELLS, vol. 24, 2006, pages 2810 - 2816 *
RINGE ET AL.: "Towards in situ tissue repair: human mesenchymal stem cells express chemokine receptors CXCRl, CXCR2 and CCR2, and migrate upon stimulation with CXCL8 but not CCL2", JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 101, 2007, pages 135 - 146 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2684575A2 (en) * 2011-03-08 2014-01-15 Tego Science Inc. Method for inducing in vivo migration of stem cell
EP2684575A4 (en) * 2011-03-08 2014-08-13 Tego Science Inc METHOD FOR INDUCING IN VIVO MIGRATION OF STEM CELLS

Also Published As

Publication number Publication date
CN103561788A (zh) 2014-02-05
KR20120102501A (ko) 2012-09-18
US20130344119A1 (en) 2013-12-26
KR101466811B1 (ko) 2014-11-28
CN103561788B (zh) 2016-03-16
KR20130124264A (ko) 2013-11-13
US9220757B2 (en) 2015-12-29
JP5828916B2 (ja) 2015-12-09
EP2684575A2 (en) 2014-01-15
KR101493252B1 (ko) 2015-02-23
JP2014508776A (ja) 2014-04-10
EP2684575B1 (en) 2016-08-10
EP2684575A4 (en) 2014-08-13

Similar Documents

Publication Publication Date Title
KR101493252B1 (ko) 줄기세포의 인 비보(ｉｎ ｖｉｖｏ) 이동 유도방법
US7842502B2 (en) Use of CXCL6 chemokine for inducing precursor cells into chondrocytes
Park et al. In situ recruitment of human bone marrow-derived mesenchymal stem cells using chemokines for articular cartilage regeneration
Nair et al. The effect of erythropoietin on autologous stem cell-mediated bone regeneration
Alsberg et al. Environmental cues to guide stem cell fate decision for tissue engineering applications
Wang et al. Stromal cell-derived factor-1 accelerates cartilage defect repairing by recruiting bone marrow mesenchymal stem cells and promoting chondrogenic differentiation
Noh et al. A dual delivery of substance P and bone morphogenetic protein-2 for mesenchymal stem cell recruitment and bone regeneration
Evenbratt et al. Insights into the present and future of cartilage regeneration and joint repair
JP7335222B2 (ja) 効力検定
CN113631173A (zh) 治疗腰痛的方法
Patrick et al. Licensing microgels prolong the immunomodulatory phenotype of mesenchymal stromal cells
Dikina et al. Scaffolds derived from ECM produced by chondrogenically induced human MSC condensates support human MSC chondrogenesis
US20070020230A1 (en) Use of chemokines, and pharmaceutical preparations containing the same
Cristino et al. Expression of CXC chemokines and their receptors is modulated during chondrogenic differentiation of human mesenchymal stem cells grown in three-dimensional scaffold: evidence in native cartilage
Zhang et al. CXCL chemokines-mediated communication between macrophages and BMSCs on titanium surface promotes osteogenesis via the actin cytoskeleton pathway
WO2012121485A2 (ko) 줄기세포의 인 비보(in vivo) 이동 유도방법
CN111343997A (zh) 组织再生用药物和其制造方法
KR20180008137A (ko) Il-8 및 골수농축액의 조합을 이용한 연골 재생
Yu Articular cartilage tissue engineering using chondrogenic progenitor cell homing and 3D bioprinting
Hakamivala Application of Tissue Engineering Techniques for Treating Cartilage Injury and Diagnosing Cancer Metastasis
Lauretta Study of Novel Approaches in Tissue Engineering for Cartilage Repair and Prevention of Osteoarthritis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11860250

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11860250

Country of ref document: EP

Kind code of ref document: A1