WO2012049278A1 - Therapies for improving pulmonary function - Google Patents

Therapies for improving pulmonary function Download PDF

Info

Publication number
WO2012049278A1
WO2012049278A1 PCT/EP2011/067947 EP2011067947W WO2012049278A1 WO 2012049278 A1 WO2012049278 A1 WO 2012049278A1 EP 2011067947 W EP2011067947 W EP 2011067947W WO 2012049278 A1 WO2012049278 A1 WO 2012049278A1
Authority
WO
WIPO (PCT)
Prior art keywords
antagonist
seq
human
antibody
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2011/067947
Other languages
English (en)
French (fr)
Inventor
Raffaella Faggioni
Richard May
Chris Kell
Nestor Molfino
Lorin Roskos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MedImmune Ltd
Original Assignee
MedImmune Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MedImmune Ltd filed Critical MedImmune Ltd
Priority to US13/879,261 priority Critical patent/US20130281876A1/en
Priority to CN2011800498365A priority patent/CN103328506A/zh
Priority to DK11769881.1T priority patent/DK2627673T3/da
Priority to RU2013122123/10A priority patent/RU2013122123A/ru
Priority to JP2013533226A priority patent/JP2013544235A/ja
Priority to NO11769881A priority patent/NO2627673T3/no
Priority to MX2013004212A priority patent/MX2013004212A/es
Priority to EP11769881.1A priority patent/EP2627673B1/en
Priority to AU2011315499A priority patent/AU2011315499A1/en
Priority to CA2814431A priority patent/CA2814431A1/en
Priority to ES11769881.1T priority patent/ES2645368T3/es
Priority to PL11769881T priority patent/PL2627673T3/pl
Priority to BR112013009055A priority patent/BR112013009055A2/pt
Publication of WO2012049278A1 publication Critical patent/WO2012049278A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61BDIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00Measuring for diagnostic purposes; Identification of persons
    • A61B5/08Measuring devices for evaluating the respiratory organs
    • A61B5/087Measuring breath flow
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G01N33/6869Interleukin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52Assays involving cytokines
    • G01N2333/54Interleukins [IL]
    • G01N2333/5437IL-13
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/12Pulmonary diseases
    • G01N2800/122Chronic or obstructive airway disorders, e.g. asthma COPD

Definitions

  • the invention relates to the use of an IL- 13 antagonist, in particular an anti- IL- 13 antibody, for improving, maintaining or reducing the rate of decline of pulmonary function, as assessed by a spirometric method.
  • the invention further relates to the use of an IL- 13 antagonist for the treatment of asthma in a subject with detectable IL- 13 in sputum.
  • the invention further relates to a method for identification of a subject with asthma likely to benefit from treatment with an IL- 13 antagonist, said subject having detectable IL- 13 in sputum.
  • Respiratory disorders such as asthma, chronic obstructive pulmonary disease (COPD) and idiopathic pulmonary fibrosis are associated with a decrease in pulmonary function; this impairment of pulmonary function can be measured by spirometry.
  • Measurement of lung function provides an assessment of the severity of airflow limitation, its reversibility and its variability in diseases such as asthma, COPD, IPF and bronchiectasis important measures of pulmonary function these diseases are FEVi (forced expiratory volume in the first second), this is the volume of air that can be forced out in one second after taking a deep breath, and FVC (forced vital capacity) .
  • Asthma is a chronic airway disorder that is characterized by variable and reversible airway obstruction, airway inflammation, excessive mucus production and airway hyper-responsiveness (AHR) that leads to episodes of wheezing, breathlessness, chest tightness and coughing. Progressive pathological airway remodelling and scarring may occur in persistent asthma resulting in partially reversible or irreversible airway obstruction.
  • Airways hyper-responsiveness (AHR) is the exaggerated constriction of the airways to non-specific stimuli such as cold air. Both AHR and mucus overproduction are thought to be responsible for the variable airway obstruction that leads to the shortness of breath characteristic of asthma attacks (exacerbations) and which is responsible for the mortality associated with this disease (around 2000 deaths/year in the United Kingdom).
  • Human Interleukin (IL) - 13 is a 114 amino acid protein with an unmodified molecular mass of approximately 12 kDa. IL- 13 is most closely related to IL- 4 with which it shares 30% sequence similarity at the amino acid level. IL- 13 shares receptor components and many biological properties with interleukin 4 (IL-4). IL- 13 receptors (heterodimers of IL- 13Ral and IL-4Ra) are expressed on the leukocyte subsets (eosinophils, neutrophils, B cells, NKT cells) and structural cells (epithelial cells, fibroblasts, smooth muscle) considered relevant in asthma. The action of IL- 13 on these cells is to stimulate processes that promote airway hyperresponsiveness, inflammation, and underlying airway structural changes including fibrosis and mucus hypersecretion that are cardinal features of asthma (Hershey, 2003).
  • IL- 13 mRNA or protein levels are elevated in bronchial biopsies, sputum, and BAL fluid from asthmatics compared to control subjects (Humbert et al., 1997; Kotsimbos et al., 1996; Komai- Koma et al., 2001 ; Naseer et al., 1997) and further increased in BAL samples from allergen challenged asthmatics (Huang et al., 1995; Kroegel et al., 1996). IL- 13 protein expression in the lung is also correlated with both asthma severity and control.
  • Mild steroid- naive asthmatics have upregulated IL- 13 in the sputum compared to "normals", as do severe asthmatics who have poor control despite standard of care up to, and including, oral corticosteroids; moderate asthmatics (well controlled by inhaled corticosteroids) are not reported to have upregulated IL- 13 expression (Saha et al., 2008).
  • IL- 13 Q 130R has been associated with asthma, atopy, and raised serum IgE (Heinzmann et al., 2000; Liu et al., 2000; Kauppi et al., 2001) activating the signaling IL- 13 receptor (Ral) and downstream functions more efficiently, whilst binding to the decoy receptor (Ra2) less efficiently, than wild-type IL- 13 (Vladich et al., 2005).
  • IL 13 is a key mediator in the development and maintenance of the asthma phenotype.
  • Administration of recombinant IL 13 to the airway of allergen-na ' ive mice results in AHR, airway inflammation, and mucus production (Wills-Karp et al., 1998; Grunig et al., 1998; Venkayya et al., 2002).
  • Similar pathologies are seen in transgenic mice in which IL- 13 is selectively overexpressed in the lung although longer-term exposure to IL- 13 also results in fibrosis (Zhu et al., 1999).
  • Soluble IL- 13Ra2 a potent IL- 13 neutraliser, has been shown to inhibit AHR, mucus hypersecretion, and pulmonary inflammation (Wills-Karp et al., 1998; Grunig et al., 1998).
  • NHP segmental antigen challenge studies have also shown an anti-inflammatory effect for an IL- 13 neutralising antibody (Bree et al., 2007).
  • IL- 13 Given the range of cells involved in asthma on which IL- 13 is known to act, and the pathogenic functions ascribed to this interleukin, a significant role for IL- 13 in asthma can be expected. Coupled with the evidence of a relationship between IL- 13 expression and disease severity in patients (Saha et al., 2008), neutralisation of IL- 13 is a credible approach to the treatment of asthma.
  • COPD Chronic Obstructive Pulmonary Disease
  • IL- 13 Over-expression of IL- 13 in the mouse lung has been demonstrated to cause emphysema, elevated mucus production and inflammation, reflecting aspects of human COPD. Furthermore, AHR, an IL- 13 dependent response in murine models of allergic inflammation, has been shown to be predictive of lung function decline in smokers. A link has also been established between an IL- 13 promoter polymorphism and susceptibility to develop COPD. The signs are, therefore, that IL- 13 plays an important role in the pathogenesis of COPD, particularly in patients with asthma-like features, including AHR and eosinophilia. The mRNA levels of IL- 13 have been shown to be higher in autopsy tissue samples from subjects with a history of COPD when compared to lung samples from subjects with no reported lung disease. In another study, raised levels of IL- 13 were demonstrated by immunohistochemistry in peripheral lung sections from COPD patients.
  • IL- 13 has been associated with other fibrotic conditions. Increased levels of IL- 13 have been measured in the serum of patients with systemic sclerosis and in BAL samples from patients affected with other forms of pulmonary fibrosis. Correspondingly, over-expression of IL- 13 in the mouse lung has been reported to result in pronounced fibrosis. The contribution of IL- 13 to fibrosis in tissues other than the lung has been extensively studied in a mouse model of parasite-induced liver fibrosis.
  • Tralokinumab (an IgG4 monoclonal antibody) is a highly potent and specific IL- 13 -neutralising antibody, with a 165pM affinity for human IL- 13, that neutralises human and cynomolgus IL- 13 with near equivalent potency, but does not neutralise mouse IL- 13, nor the most homologous cytokine to IL- 13, IL-4.
  • CAT-354 also neutralises the variant IL- 13, Q 130R, which has been associated with atopy and asthma as well as endogenous (mammalian glycosylated) human IL- 13.
  • Tralokinumab (BAK502G9) is described in International Patent Application Publication No. WO 2005/007699, incorporated herein by reference.
  • IL- 13 antagonists in particular anti-IL- 13 antibodies such as tralokinumab, or IL- 13 neutralizing fragments thereof, for improvement, maintenance or reduction in decline of pulmonary function, in particular as assessed by FEVi, or FVC, in subjects with impaired pulmonary function, which may be due to asthma, COPD or pulmonary fibrosis.
  • an IL- 13 antagonist for the treatment of asthma in a subject wherein said subject has upregulated airway IL- 13, for example, based on detectable IL- 13 in sputum.
  • the invention provides an IL- 13 antagonist for improvement, maintenance or reduction in the rate of decline of pulmonary function in a subject with impaired pulmonary function.
  • the invention provides a method of treating a subject with impaired pulmonary function, said method comprising administering to said subject an IL- 13 antagonist in an amount sufficient to improve, maintain or reduce the rate of decline of pulmonary function.
  • the invention provides for the use of an IL- 13 antagonist in the manufacture of a medicament for the treatment of impaired pulmonary function to improve, maintain or reduce the rate of decline of pulmonary function in a subject in need thereof.
  • the invention provides a method of improving, maintaining or reducing the rate of decline in pulmonary function in a subject with impaired pulmonary function, said method comprising administering to said subject an IL- 13 antagonist.
  • the invention provides a composition for the treatment of impaired pulmonary function to improve, maintain or reduce the rate of decline of pulmonary function in a subject with impaired pulmonary function, said composition comprising an IL- 13 antagonist and a pharmaceutically acceptable excipient.
  • the invention provides an IL- 13 antagonist for the treatment of asthma in a subject, wherein said subject has upregulated airway IL- 13, for example, based on detectable IL- 13 in sputum.
  • the invention provides a method for treating asthma in a subject, wherein said subject has detectable IL- 13 in sputum, said method comprising administering to said subject an IL- 13 antagonist in an amount sufficient to ameliorate asthma symptoms.
  • the invention provides for the use of an IL- 13 antagonist in the manufacture of a medicament for the treatment of asthma in a subject, wherein said subject has detectable IL- 13 in sputum.
  • the invention provides a method for the identification of a subject with asthma likely to benefit from treatment with an IL- 13 antagonist, said method comprising testing for the presence of IL- 13 in a sample of sputum from said subject, wherein a subject with detectable IL- 13 in sputum is likely to benefit from treatment with an IL- 13 antagonist.
  • a beneficial response to treatment of asthma may be assessed by consideration of asthma symptoms, e.g. by an ACQ method, such as ACQ-6, and / or by spirometric assessments as described herein.
  • Subjects that benefit from treatment with an IL- 13 antagonist experience an amelioration of their asthma symptoms.
  • subjects with asthma who had detectable IL- 13 in their sputum experienced an amelioration of asthma symptoms following treatment with an IL- 13 antagonist.
  • Methods of treatment and uses described herein may comprise a step, performed prior to treatment of a subject with an IL- 13 antagonist, whereby a sample of sputum from the subject is tested for the presence of IL- 13.
  • compositions according to the present invention may comprise, in addition to active ingredient, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the carrier or other material will depend on the route of administration, which may be oral, or by injection, e.g. intravenous.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.
  • compositions of the present invention may be formulated in liquid or solid forms. Solid forms may be provided for reconstitution prior to administration by intravenous or subcutaneous injection, or for inhalation.
  • the composition employed will depend on the physicochemical properties of the molecule and the route of delivery.
  • Formulations may include excipients, or combinations of excipients, for example: sugars, amino acids and surfactants.
  • Liquid formulations may include a wide range of antibody concentrations and pH.
  • Solid formulations may be produced by lyophilisation, spray drying, or drying by supercritical fluid technology, for example. Formulations will depend upon the intended route of delivery: for example, formulations for pulmonary delivery may consist of particles with physical properties that ensure penetration into the deep lung upon inhalation.
  • tralokinumab is formulated at 150 mg/mL in 50 mM sodium acetate, 85 mM sodium chloride, 0.01% (w/v) plant-derived polysorbate 80 at pH 5.5.
  • a composition in accordance with the invention may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • Treatment may be given by injection, for example, subcutaneously, or intravenously, or by inhalation. It is envisaged that treatment will not be restricted to use in the clinic. Therefore, subcutaneous injection using an administration device is envisaged.
  • the invention also provides an administration device for the treatment of impaired pulmonary function to improve, maintain or reduce the rate of decline of pulmonary function in a subject in need thereof, said device comprising an IL- 13 antagonist.
  • An administration device may comprise a composition for the treatment of impaired pulmonary function to improve, maintain or reduce the rate of decline of pulmonary function in a subject in need thereof, said composition comprising an IL- 13 antagonist and a pharmaceutically acceptable excipient.
  • the invention also provides an administration device for the treatment of asthma in a subject, wherein said subject has detectable IL- 13 in sputum, said device comprising an IL- 13 antagonist.
  • An administration device may comprise a composition for the treatment of asthma in a subject, wherein said subject has detectable IL- 13 in sputum, said composition comprising an IL- 13 antagonist and a pharmaceutically acceptable excipient.
  • a detectable level of IL- 13 in sputum may be the presence of > lpg/mL IL- 13. The presence of IL- 13 in sputum can be detected using an ELISA method.
  • the limit of quantification using ELISA methods is about lpg/mL, hence subjects with a concentration of IL- 13 in sputum that is ⁇ 1 pg/ may be deemed to not have detectable IL- 13 in sputum.
  • Methods suitable for detection of IL- 13 in sputum include: western blot, proteomic techniques such as mass spectrometry, MALDI-TOF and 2D-DIGE; antibody- or receptor-based protein identification techniques, which include ELISAs in the format of Luminex® assays (Luminex Corp., Austin, TX, USA) based on xMAP technology (multi-analyte profiling beads) enabling the detection and quantitation of multiple RNA or protein targets simultaneously; the xMAP system combines a flow cytometer, fluorescent- dyed microspheres (beads), lasers and digital signal processing to efficiently allow multiplexing of up to 100 unique assays within a single sample and in the format of MSD® cytokine assays (Meso Scale Discovery, Gaithersburg, MD, USA) that employ electrochemiluminescent detection; sputum-driven cell-based assays to identify IL- 13 in sputum, such as TF1 proliferation blocked with an IL-
  • the amount corresponding to a detectable level of IL- 13 in sputum may vary due to the known limit of quantitation of a method known in the art such as any of those described above, or may be further refined based on improvement in the limits of quantitation of methods known in the art such as those described above, or other methods suitable to detect levels of a molecule such as IL- 13.
  • An administration device in accordance with the invention may be selected from a pre-filled syringe and an auto-injector device for sub-cutaneous administration, which may be designed to permit "home" administration.
  • pulmonary function tests are used to assess lung function and quantify the amount of damage to the lungs; PFT can also be used to assess the progression of lung disease and the effectiveness of treatment.
  • Spirometry testing is the most commonly used of all pulmonary function tests. It is a convenient non- invasive procedure, generally performed with a hand-held spirometer. It is normally the clinician's first choice when attempting to diagnose a respiratory problem. Spirometry requires the patient, after all air has been expelled, to inhale deeply; this is then followed by a rapid exhalation, so that all the air is expelled from the lungs. Results of spirometry tests vary, but are based on predicted values of a standardized, healthy population.
  • VC-Vital Capacity this is the amount of air that can be forcibly exhaled from the lungs after a full inhalation.
  • FVC-Forced Vital Capacity this is the amount of air that can be forcibly exhaled from the lungs after taking the deepest breath possible.
  • FEVi-Forced Expiratory Volume in One Second this is the amount of air which can be forcibly exhaled from the lungs in the first second of a forced exhalation.
  • FEVi/FVC the ratio of FEVi to FVC expressed as a fraction (previously this was expressed as a percentage), this indicates what fraction of the total amount of air is exhaled from the lungs during the first second of forced exhalation.
  • PEF Peak Expiratory Flow this is used as a measure to determine if treatment is effective in improving airway diseases, in particular in asthma and COPD.
  • FEF Forced Expiratory Flow this is a measure of how much air can be exhaled from the lungs; it is an indicator of large airway obstruction.
  • MW Maximal Voluntary Ventilation a value for this is determined by having the patient inhale and exhale as rapidly and fully as possible in 12 seconds. The results reflect the status of the muscles used for breathing, how stiff the lungs are and if there is any resistance in the airways when breathing. This test tells indicates how strong a patient's lungs are prior to surgery. If patients demonstrate poor performance on this test, it suggests that respiratory complications may occur after surgery.
  • spirometry in particular measurement of FEVi and / or Peak expiratory flow is used in both diagnosis and monitoring to confirm airflow limitation, and to demonstrate reversibility of lung function abnormalities following administration of a bronchodilator.
  • the degree of reversibility in forced expiratory volume in one second (FEVi) indicative of a diagnosis of asthma is usually accepted as >12% and >200 mL from the pre-bronchodilator value.
  • FEVi forced expiratory volume in one second
  • a useful assessment of airflow limitation in asthma is the ratio of FEVi to forced vital capacity (FVC).
  • the FEVi/FVC ratio is normally >0.75-0.80, and possibly >0.90 in children. Lower values suggest airflow limitation.
  • reversibility and “variability” refer to changes in symptoms accompanied by changes in airflow limitation that occur spontaneously or in response to treatment.
  • the term reversibility is generally applied to rapid improvements in FEVi (or PEF) measured within minutes after inhalation of a rapid-acting bronchodilator, e.g. after 200-400 g salbutamol (albuterol), or more sustained improvement over days or weeks after the introduction of effective controller treatment, such as inhaled glucocorticosteroids.
  • Variability refers to improvement or deterioration in symptoms and lung function occurring over time. Variability may be experienced over the course of 1 day (when it is called diurnal variability), from day to day, from month to month, or seasonally.
  • pulmonary function is assessed by spirometry, e.g. by measuring FEVi (asthma) and / or FVC (COPD / IPF), using methods standard in the art.
  • FEVi can be measured using the Masterscope® CT Spirometer using a protocol following the ATS / ERS recommendations 2005 (Eur Respir J; 26: 319-338).
  • FEVi is the maximal volume of air exhaled in the first second of a forced expiration from a position of full inspiration, expressed in litres at BTPS (Body temperature (i.e. 37°C), ambient pressure, saturated with water vapour).
  • FVC is the maximal volume of air exhaled with maximally forced effort from a maximal inspiration, i.e. vital capacity performed with a maximally forced expiratory effort, expressed in litres at body temperature and ambient pressure saturated with water vapour.
  • an IL- 13 antagonist in accordance with the invention may be employed to treat impaired pulmonary function to improve pulmonary function.
  • the improvement can be expressed as mean percent change in FEVi from baseline, preferably in the range of from 5% to 18%; for example, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18%; such as at least 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18%.
  • an IL- 13 antagonist in accordance with the invention may be employed to treat impaired pulmonary function to maintain or slow the rate of decline in pulmonary function.
  • amelioration of asthma in a subject is assessed by a composite measure of one or more asthma symptoms selected from the group consisting of: night-time waking, symptoms on waking, activity limitation, shortness of breath, wheezing, and short-acting 2-agonist use.
  • Amelioration of asthma in a subject can be assessed by asthma control questionnaire ACQ-6 (see Juniper EF, O'Byrne PM, Guyatt GH, Ferrie PJ, King DR. Development and validation of a questionnaire to measure asthma control. Eur Respir J 1999; 14: 902-7, the entire contents of which are incorporated herein by reference).
  • Amelioration of asthma in a subject can be assessed by reduction in ACQ-6 score compared to baseline ACQ-6 score before administration of the IL- 13 antagonist.
  • a reduction in mean ACQ-6 score of >0-5 relative to baseline score is considered to be indicative of a clinically meaningful of amelioration of asthma, whereas a score of > 1-5 indicates uncontrolled asthma.
  • the IL- 13 antagonist is an anti- human-IL- 13 antibody or a human-IL- 13-binding fragment thereof.
  • the anti- IL- 13 antagonist is an anti-human- IL- 13 antibody or a human-IL- 13-binding fragment thereof, selected from:
  • tralokinumab (BAK502G9, CAT-354) antibody; (b) a human-IL- 13 binding fragment of tralokinumab comprising an antibody antigen-binding site which is composed of a human antibody VH domain (SEQ ID NO: 15) and a human antibody VL domain (SEQ ID NO: 16) and which comprises a set of CDR's HCDRl , HCDR2, HCDR3, LCDRl, LCDR2 and LCDR3, wherein the VH domain comprises HCDR 1, HCDR2 and HCDR3 and the VL domain comprises LCDRl , LCDR2 and LCDR3, wherein the HCDRl has the amino acid sequence of SEQ ID NO: 7, the HCDR2 has the amino acid sequence of SEQ ID NO: 8, the HCDR3 has the amino acid sequence of SEQ ID NO: 9, the LCDR1 has the amino acid sequence of SEQ ID NO: 10, the LCDR2 has the amino acid sequence of SEQ ID NO: 11 , and the LCDR
  • a human-IL- 13 binding fragment of tralokinumab comprising an antibody antigen-binding site which is composed of a human antibody VH domain and a human antibody VL domain which comprises a set of CDR's HCDRl, HCDR2, HCDR3, LCDR1 , LCDR2 and LCDR3, wherein the VH domain comprises HCDR 1, HCDR2 and HCDR3 and the VL domain comprises LCDR1, LCDR2 and LCDR3, wherein the HCDRl has the amino acid sequence of SEQ ID NO: 7, the HCDR2 has the amino acid sequence of SEQ ID NO: 8, the HCDR3 has the amino acid sequence of SEQ ID NO: 9, the LCDR1 has the amino acid sequence of SEQ ID NO: 10, the LCDR2 has the amino acid sequence of SEQ ID NO: 11 , and the LCDR3 has the amino acid sequence of SEQ ID NO: 12;
  • an anti-IL- 13 antibody or a human-IL- 13 binding fragment thereof comprising an antibody antigen-binding site which is composed of a human antibody VH domain (SEQ ID NO: 15) and/or a human antibody VL domain (SEQ ID NO: 16);
  • an antibody or an IL- 13 binding fragment thereof capable of binding an epitope within the human IL- 13 amino acid sequence from aspartic acid at position 99 to C-terminal asparagine at position 132 (FSSLHVRDTKIEVAQFVKDLLLHLKKLFREGRFN) of human IL- 13 protein, or capable of binding an epitope within the human IL- 13 sequence from aspartic acid at position 106 to C-terminal asparagine at position 132 (DTKIEVAQFVKDLLLHLKKLFREGRFN) of human IL- 13 protein; and (g) an antibody or an IL- 13 binding fragment thereof that has one, two, three, four, five, or six CDRs (SEQ ID NOs: 7, 8, 9, 10, 1 1, 12) in common with tralokinumab.
  • the whole antibody is an IgG4.
  • an anti-human-IL- 13 antibody or a human-IL- 13 binding fragment thereof may comprise one or more CDRs, or a set of all 6 CDRs (HCDR1 , HCDR2, HCDR3, LCDR1, LCDR2, LCDR3), selected from the CDRs of:
  • BAK278D6 (SEQ ID NOS: 1, 2, 3, 4, 5, 6),
  • BAK1183H4 (SEQ ID NOS: 97, 98, 99, 100, 101 , 102),
  • BAK1167F02 (SEQ ID NOS: 64, 65, 66, 67, 68, 69),
  • BAK1111D 10 (SEQ ID NOS: 91 , 92, 93, 94, 95, 96),
  • BAK1166G02 (SEQ ID NOS: 67, 68, 69, 70, 71, 72),
  • BAK1167F04 (SEQ ID NOS: 85, 86, 87, 88, 89, 90),
  • BAK1184C8 (SEQ ID NOS: 73, 74, 75, 76, 77, 78),
  • BAK1185E1 (SEQ ID NOS: 79, 80, 81 , 82, 83, 84), and
  • BAK1185F8 (SEQ ID NOS: 103, 104, 105, 106, 107, 108).
  • a method, use, composition or device of the invention may comprise an anti- human-IL- 13 antibody or a human-IL- 13 binding fragment thereof comprising a VH domain comprising a set of CDRs and/or a VL domain comprising a set of CDRs selected from the set of HCDRs and / or set of LCDRs of BAK278D6, BAK1 183H4, BAK1 167F02, BAK1111D 10, BAK1 166G02, BAK1167F04, BAK1184C8, BAK1 185E1 , and BAK1185F8.
  • An anti-human-IL- 13 antibody or a human-IL- 13 binding fragment thereof may comprise a VH and VL of a clone selected from:
  • BAK1111D 10 (VH SEQ ID NO: 41 , VL SEQ ID NO: 42),
  • BAK1166G02 VH SEQ ID NO: 53, VL SEQ ID NO: 54
  • BAK1167F04 VH SEQ ID NO: 43, VL SEQ ID NO: 44
  • An anti-human- IL- 13 antibody or a human-IL- 13 binding fragment thereof may have HCDR1 , HCDR2 and HCDR3 of the VH domain within a germ-line framework and/ or LCDRl, LCDR2 and LCDR3 of the VL domain within a germ-line framework.
  • the VH germ-line framework can be VH1 DP14.
  • the VL germ-line framework can be VL y3 3H.
  • An anti-human- IL- 13 antibody or a human-IL- 13 binding fragment thereof may bind a human IL- 13 variant in which arginine at position 130 is replaced by glutamine.
  • An anti-human- IL- 13 antibody or a human-IL- 13 binding fragment thereof may bind a non-human primate IL- 13, such as rhesus or cynomolgus IL- 13.
  • IL- 13 antagonists that may be employed in accordance with the invention include:
  • Anti-human-IL- 13 antibodies such as Lebrikizumab (MILR1444A / RG3637, Roche / Genentech), ABT-308 (Abbott), GSK679586 (GlaxoSmithkline); QAX576 (Novartis),
  • IL- 13 - toxin conjugates such as IL- 13 PE38QQR ;
  • IL-4 muteins such as AerovantTM (Aerovance) (modified IL-4);
  • anti-IL-4Ra antibodies such as Regeneron-668 (Regeneron);
  • nucleic acids such as AIR645 (a double-stranded oligonucleotide directed against IL-4Ra); and,
  • IL-4 / IL- 13 bispecific antibodies such as Domantis' 09/ 10 and DOM- 1000P.
  • the anti-IL- 13 antagonist is not also an antagonist of the interaction between IL-4 and IL4Ra, preferably the IL- 13 antagonist is not an anti-IL-4Ra antibody, such as AMG317 (Amgen) .
  • the anti-IL- 13 antagonist is an anti-human-IL- 13 antibody or a human-IL- 13-binding fragment thereof.
  • an antibody or a binding fragment thereof employed in the invention is selected from the group consisting of; an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab', a F(ab')2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody, a diabody, a multispecific antibody, a dual- specific antibody, and a bispecific antibody.
  • an immunoglobulin molecule a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab', a F(ab')2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody, a diabody, a multispecific antibody, a dual- specific antibody, and a bispecific antibody.
  • the subject to be treated in accordance with the invention may have impaired pulmonary function associated with asthma, COPD, or idiopathic pulmonary fibrosis (IPF).
  • Asthma may be classified as atopic asthma non- atopic asthma, moderate to severe asthma, moderate to severe asthma uncontrolled by inhaled or oral corticosteroids and asthma at GINA score 5, 4, 3, 2, or 1.
  • Impaired pulmonary function may be associated with COPD, such as moderate to severe COPD defined by GOLD classification II, II and IV.
  • the spirometric criterion required for a diagnosis of COPD is an FEVl /FVC ratio below 0.7 after Bronchodilator) .
  • the GOLD spirometric criteria for COPD severity is as follows
  • Subjects with COPD may be undergoing concomitant therapy with one or more further therapeutic selected from an inhaled corticosteroid, LABA, theophylline, an oral corticosteroid, tiotropium and roflumilast.
  • Impaired pulmonary function may be associated with idiopathic pulmonary fibrosis; subjects with IPF may be undergoing concomitant therapy with one or more further therapeutic selected from an inhaled corticosteroid, LABA, theophylline, a leukotriene antagonist, an oral corticosteroid and pirfenidone.
  • an IL- 13 antagonist or composition comprising an IL- 13 antagonist as described herein may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.
  • the subject with impaired pulmonary function is steroid naive.
  • the IL- 13 antagonist which is an anti-human-IL- 13 antibody or a human-IL- 13-binding fragment thereof, is administered subcutaneously at a dose in the range of from 100 to 800mg, preferably at a dose in the range of from 100 to 600mg; or is administered intravenously at a dose in the range of from 100 to 1800mg, preferably at a dose in the range of from 200 to 1600mg, most preferably at about 1500mg.
  • the anti-human IL- 13 antibody is tralokinumab or a variant thereof or a human - IL- 13 binding fragment thereof, as described herein.
  • Suitable unit doses for sub-cutaneous administration may be selected from 150, 300, and 600 mg, preferably administered at 2 or 4 week intervals.
  • Suitable unit doses for intravenous administration may be selected from 1000, 1200, 1400, 1500, 1600 1700 and 1800 mg, preferably administered at 2 or 4 week intervals, most preferably administered at 4 week intervals.
  • the IL- 13 antagonist is an anti-human-IL- 13 antibody or human-IL- 13-binding fragment thereof, more preferably the anti-human IL- 13 antibody is tralokinumab or a variant thereof or a human-IL- 13 binding fragment thereof, as described herein, administered at a mg/kg dose in the range of from 1 mg / Kg to 30 mg /Kg.
  • the subject may be an adult, or a young adult (12 - 18 years' old) however the invention may also be employed to improve, maintain or reduce the rate of decline of pulmonary function in paediatric subjects, aged less than 12 years' old.
  • An IL- 13 antagonist preferably an anti-human-IL- 13 antibody or human-IL- 13-binding fragment thereof, more preferably the anti-human IL- 13 antibody is tralokinumab or a variant thereof or a human-IL- 13 binding fragment thereof, as described herein, may be administered in accordance with the invention at a frequency selected from every 1 , 2, 3, 4, 6, 8, 10 and 12 weeks, preferred dosing intervals are every two or every four weeks.
  • an improvement in pulmonary function in asthma subjects can be detected by 15 days following initiation of treatment in accordance with the invention.
  • the inventors found an improvement in pulmonary function as assessed by spirometry by measuring FEVi in moderate to severe asthma patients (GINA 4 or 5) to whom tralokinumab had been administered by subcutaneous administration, at doses of 150 mg, 300mg or 600mg, at dosing intervals of 2 weeks. It is believed that hitherto anti-human IL- 13 antibodies have not been reported to improve pulmonary function in asthmatic patients.
  • an improvement in pulmonary function as assessed by spirometry, e.g., by measuring FEVi, can be used as an indicator of a subjects' response to treatment of asthma using an anti- IL- 13 antagonist, preferably using an anti-human-IL- 13 antibody or human - IL- 13-binding fragment thereof, e.g. tralokinumab or a variant thereof or a human-IL- 13 binding fragment thereof as described herein.
  • the invention further provides a method for detecting a subject's response to an IL- 13 antagonist treatment in asthma, comprising:
  • pulmonary function is assessed by measuring FEVi and / or PEF.
  • assessment of pulmonary function after treatment is performed at least 15 days after initiation of treatment.
  • the IL- 13 antagonist is an anti-human- IL- 13 antibody, more preferably the anti-human IL- 13 antibody is tralukinumab or a variant thereof or a human-IL- 13 binding fragment thereof, as described herein, preferably administered by subcutaneous administration, preferred doses being 150 mg, 300mg or 600mg, with the preferred dosing interval being 2 or 4 weeks.
  • the improvement in pulmonary function following treatment compared to baseline is in the range of from 8% to 16%, measured at least 15 days after initiation of treatment and / or up to 12 weeks after cessation of treatment.
  • the improvement in pulmonary function from baseline, as assessed by FEVi measurement, following subcutaneous administration at two week intervals of 150mg tralokinumab or a variant thereof or a human - IL- 13 binding fragment thereof, as described herein, is in the range of from about 6 to about 10%, e.g., about 8%.
  • assessment of pulmonary function after treatment is performed at least 15 days after initiation of treatment and / or up to 12 weeks after cessation of treatment.
  • the improvement in pulmonary function from baseline, as assessed by FEVi measurement, following subcutaneous administration at two week intervals of 300mg tralokinumab or a variant thereof or a human- IL- 13 binding fragment thereof, as described herein, is in the range of from about 12 to about 14%, e.g., about 13.3 %.
  • assessment of pulmonary function after treatment is performed at least 15 days after initiation of treatment and / or up to 12 weeks after cessation of treatment.
  • the improvement in pulmonary function from baseline, as assessed by FEVi measurement, following subcutaneous administration at two week intervals of 600mg tralokinumab or a variant thereof or a human- IL- 13 binding fragment thereof, as described herein, is in the range of from about 14 to about 16%, e.g., about 15.2%.
  • assessment of pulmonary function after treatment is performed at least 15 days after initiation of treatment and / or up to 12 weeks after cessation of treatment. All subjects were followed for 12 weeks after the last dose of tralokinumab and underwent spirometry testing at days 127 and day 169.
  • the invention provides a dosing regimen wherein the IL- 13 antagonist (which is preferably an anti-human-IL- 13 antibody, more preferably the anti-human IL- 13 antibody is tralukinumab or a variant thereof or a human-IL- 13 binding fragment thereof, as described herein) is administered:
  • the dosing regimen may be such that it is administered at 300 mg (e.g., as 2 x 150 mg subcutaneous injections every 2 weeks (Q2W) for 12 weeks followed by every 4 weeks (Q4W).
  • Formulations of Tralokinumab suitable for use in such dosing regimens are described herein.
  • Figure 1 Study Flow Diagram: A Phase 2a, randomized, double-blinded placebo-controlled, parallel -arm study to evaluate the efficacy and safety of three subcutaneous treatment regimes of tralokinumab (CAT-354) in adult subjects with uncontrolled, moderate-to-severe, persistent asthma
  • Figure 2a Mean Change from Baseline in FEVi (Evaluable Population). Change from baseline in pre-bronchodilator FEVi to study day 92 for combined tralokinumab group and for placebo.
  • Figure 2b Change from baseline in FEVi. Change from baseline in pre- bronchodilator FEVi to study day 92 for individual tralokinumab treatment groups (150mg, 300mg, or 600mg administered subcutaneously every 2 weeks) and placebo.
  • Figure 4 Change from baseline in pre-bronchodilator FEVi (L) at study day day 92 in subjects classified as atopic at baseline.
  • Figure 5 Change from baseline in pre-bronchodilator FEVi at study day 92 in subjects classified as non-atopic at baseline.
  • Figure 7 Percentage of subjects showing a greater than, or equal to 10% change from baseline in pre-bronchodilator FEVi
  • Figure 8 Change from baseline in FVC at study day 92
  • Figure 9 Decrease from baseline in SABA use at study day 92. Change in the mean number of "puffs" of short acting beta agonist (rescue treatment) taken daily comparing
  • Figure 10a Mean change from baseline in FEVi (Evaluable Population), change from baseline in pre -bronchodilator FEVi to study day 169 for combined tralokinumab group (150mg, 300mg, or 600mg administered subcutaneously every 2 weeks) and for placebo.
  • Figure 10b Change from baseline in FEVi, change from baseline in pre- bronchodilator FEVi to study day 169 for individual tralokinumab treatment groups (150mg, 300mg, or 600mg administered subcutaneously every 2 weeks) and placebo.
  • FIG 11 Mean (SD) change from baseline in ACQ-6 score over time (evaluable population)
  • ACQ-6 Asthma Control Questionnaire, mean of 6 individual item scores.
  • ACQ-6 Asthma Control Questionnaire, mean of 6 individual item scores.
  • FEVi forced expiratory volume in 1 s. Examples
  • IL- 13 blockade may reduce exacerbations and improve disease control (as defined by improvements in asthma symptoms coupled with reduced need for rescue medications) in patients whose asthma is uncontrolled, moderate-to-severe, and persistent despite maximal therapy at GINA step 4 or 5.
  • SC subcutaneous
  • the study comprised a 2-week run-in period, a 12-week treatment period, and a 12-week follow-up period. Selection of dose regimen and treatment duration was based on pharmacokinetic modelling and simulations using data from previous clinical studies. This study is registered with ClinicalTrials.gov, number NCT00873860.
  • Phadiatop test Laboratoire Pasteur Cerba, France, a fluorescence enzyme immunoassay (FEIA) for allergen-specific immunoglobulin E (IgE) to the most frequent aero -allergens (mites, moulds, animals, grasses, weeds and trees) which determines presence of specific IgE antibodies to multiple inhaled allergens).
  • subjects were randomised according to a computer-generated randomisation list (1 : 1 : 1) to one of three arms ( 150 mg tralokinumab or placebo, 300 mg tralokinumab or placebo, 600 mg tralokinumab or placebo). Within each arm, subjects were then randomised according to a computer-generated randomisation list to active treatment or placebo (3: 1). Study treatment was administered every 2 weeks by SC injection in the anterior thigh. Subjects received one, two or four SC injections ( 150 mg/ 1 mL per injection) of tralokinumab at 7 visits over 12 weeks. All subjects were followed for 12 weeks after the last dose of investigational product (Study Day 169). Study medication was dispensed and administered by unblinded personnel, not otherwise involved in the study. Subjects continued their pre-study asthma controller therapy, as prescribed by their physician, during the study. Subjects and physicians were blinded to treatment allocation throughout.
  • An objective of this study was to evaluate the effect of the three (SC) treatment regimens of tralokinumab on asthma control at Study Day 92 versus placebo in adults with uncontrolled, moderate-to-severe, persistent asthma.
  • the primary endpoint of the study was the Asthma Control Questionnaire (ACQ-6) (Juniper et al. (1999). Measures of pulmonary function, rescue medication use, asthma exacerbation rate, patient-reported outcomes (PROs), and safety were secondary endpoints.
  • the secondary objectives included evaluating the effect of SC tralokinumab on the variability of airflow obstruction using the parameters of forced expiratory volume within 1 second (FEVi) and peak expiratory flow (PEF).
  • FEVi forced expiratory volume within 1 second
  • PEF peak expiratory flow
  • Subjects must have a body mass index (BMI) between 18 and 40 kg/m 2 .
  • Pre-bronchodilator FEVi value > 40% of individual predicted value at Visits 1 and 3.
  • Salbutamol use > 2 days/ week.
  • At least one occurrence of asthma exacerbation in the past year that required an unscheduled medical encounter At least one occurrence of asthma exacerbation in the past year that required an unscheduled medical encounter.
  • Women of childbearing potential unless surgically sterile (including tubal ligation) and/ or at least 2 years postmenopausal must have a negative pregnancy test prior to the first dose of investigational product, and must agree to use 2 effective methods of avoiding pregnancy (including oral, injectable, transdermal, or implanted contraceptives, intrauterine device, female condom with spermicide, diaphragm with spermicide, cervical cap, use of condom by male sexual partner); or abstinence or sterile sexual partner from screening through Study Day 169. Women of childbearing potential must continue to practice birth control during the study and for at least 2 months after completing the study.
  • a positive hepatitis B surface antigen, or hepatitis C virus antibody as determined by medical history and/or subject's verbal report.
  • a live or attenuated vaccination received within 4 weeks prior to screening Previous medical history, or evidence, of an intercurrent illness that may compromise the safety of the subject in the study.
  • COPD chronic obstructive pulmonary disease
  • the subjects in this study were adult male and female subjects, 18 to 65 years of age, with uncontrolled, moderate-to-severe, persistent asthma.
  • the ACQ-6 a composite measure of asthma symptoms (night-time waking, symptoms on waking, activity limitation, shortness of breath, wheezing, and short-acting 2-agonist use), was completed weekly using an electronic diary (eDiary).
  • the primary endpoint was the change from baseline to week 13 in mean ACQ-6 score. Reductions in mean ACQ-6 score of >05 are considered to be clinically meaningful whilst a score of > 1 ⁇ 5 indicates uncontrolled asthma (Juniper et al. (2006)).
  • an asthma exacerbation was defined as a deterioration that required the administration of a systemic corticosteroid burst; specifically in a more detailed definition for the purpose of this study an asthma exacerbation (relapse or de novo) was defined as either a progressive increase of asthma symptoms (cough, wheeze, chest tightness, and / or shortness of breath) or a reduction of >20% in peak expiratory flow (PEF) or forced expiratory volume in 1 s (FEVi) from baseline that did not resolve after the initiation of rescue medications and resulted in an administration of systemic corticosteroids by the investigator or healthcare provider.
  • PEF peak expiratory flow
  • FEVi forced expiratory volume in 1 s
  • OCS oral corticosteroids
  • Asthma exacerbations were reported at each study visit.
  • PROs recorded included a 4-item Daily Asthma Symptom Score and the Asthma Quality of Life Questionnaire with standardised activities (AQLQ(S)).
  • AEs Adverse events
  • Trough serum concentrations (C m in) of tralokinumab were determined using an immunoassay performed on the Gyrolab assay platform that detects free tralokinumab. This method has a lower limit of quantification in serum of 0-300 ⁇ g/mL, and exhibits accuracy of ⁇ 25% absolute relative error and precision of ⁇ 20% CV (coefficient of variation) .
  • Tralokinumab was formulated at 150 mg/mL in 50 mM sodium acetate, 85 mM sodium chloride, 0.01% (w/v) plant-derived polysorbate 80 at pH 5.5)
  • Intent-to-treat (ITT) Population included all subjects who were randomized into the study.
  • Evaluable Population included all subjects who received at least 4 doses of investigational product as well as subjects who received at least one dose of investigational product but discontinued treatment prior to receiving 4 doses due to safety reasons. The primary efficacy analysis was based on the Evaluable Population.
  • According-to-Protocol (ATP) Population included all subjects who received all doses of investigational product and had an ACQ score at Study Day 92.
  • the Safety Population included all subjects who received at least one dose of investigational product.
  • the PK Population included all subjects in the Safety Population who received SC tralokinumab and had a sufficient number of serum concentration measurements.
  • ATP According-to-Protocol
  • ITT Intent-to-Treat
  • PK Pharmacokinetic.
  • FEV1 was measured using the Masterscope® CT Spirometer using a protocol following the ATS / ERS recommendations 2005 (Eur Respir J; 26: 319- 338).
  • Sample size calculations based on the primary endpoint were conducted using statistical software nQuery Advisor ® 6 1. Change from baseline in mean ACQ-6 score at week 13 was assumed to be -0-5 and -1 ⁇ for the placebo and combined tralokinumab (150, 300, and 600 mg) groups, respectively, with a common SD of 0-9. A sample size of 144 was required to detect a statistically significant difference between combined tralokinumab groups and placebo at a 0 5 significance level with 80% power. To allow for dropouts it was planned to randomise 192 subjects.
  • the evaluable population included all subjects who received at least four doses of study medication and those who received at least one dose but discontinued prior to receiving four doses for safety reasons; the efficacy analyses reported are based on this population.
  • the intent-to-treat (ITT) population was defined as all randomised subjects; confirmatory efficacy analysis was undertaken on this population.
  • the safety population comprised all subjects who received at least one dose of study medication.
  • the primary endpoint was the comparison of the change from baseline to week 13 in mean ACQ-6 score between the combined tralokinumab group (i.e., 150, 300, and 600 mg) and placebo using analysis of variance.
  • the primary efficacy analysis was undertaken at an interim analysis after all subjects had completed the week 13 visit. Two-sample ⁇ tests were used to compare between treatment group changes from baseline to week 13 in spirometry parameters measured during study visits. Efficacy endpoints were collected through to week 24 and were also analysed as described above (both study team and sites remained blinded to week 24). Exploratory efficacy analyses to compare each tralokinumab dose with placebo were undertaken and no multiple comparison adjustment was performed.
  • Post- hoc analyses were conducted on the change from baseline to weeks 13 and 24 in rescue 2-agonist use in the combined tralokinumab group and for each dose compared with placebo (two-sample ⁇ test).
  • a post-hoc subgroup analysis defined by atopic asthma status was conducted on the change from baseline to week 13 in FEVi.
  • Baseline demographic characteristics are summarized in Table 2.
  • the mean age of the subject population was 47.3 years (18-65 years), with similar mean ages (43.4-49.8 years) seen across the placebo and SC tralokinumab treatment groups.
  • the majority of subjects was female (59.8%), with the exception of the 150 mg SC tralokinumab treatment group (40.4%).
  • Most subjects were White (91.8%).
  • Mean BMI was 27.082 kg/m2 (18.52- 35.29 kg/m2) , with similar mean BMI (26.548-27.536 kg/m2) seen across the placebo and SC tralokinumab treatment groups.
  • BMI body mass index
  • ITT intent-to-treat
  • Max maximum
  • Min minimum
  • SD standard deviation
  • Subjects were taking a range of asthma controller medications at baseline and the mean inhaled corticosteroid (ICS) dose, expressed as beclomethasone dipropionate (BDP) equivalent, ranged from 1058.9- 1254.3 meg per day across the placebo and SC Tralokinumab treatment groups, the median daily ICS dose, expressed as beclomethasone diproprionate equivalent, was 1000 g/day, 32% of subjects received high dose ICS (per GINA guideline 2009) and/or a regular daily dose of oral corticosteroid. Most subjects required rescue ⁇ 2 agonists (mean 2.5 puffs/day) and short-acting beta agonists (90.7% using SABAs at least 3 days per week).
  • ICS mean inhaled corticosteroid
  • BDP beclomethasone dipropionate
  • ICS inhaled corticosteroids
  • OCS oral corticosteroids;
  • This study was a Phase 2a study designed to establish whether blockade of IL- 13 by SC Tralokinumab resulted in improved asthma control in subjects with uncontrolled, moderate-to-severe, persistent asthma. Efficacy results are reported for the evaluable population; results based on the ITT population were consistent with those for the evaluable population.
  • Stage 1 (Study Day 92) of the analysis corresponded to the interim analysis specified by the protocol, i.e., the analysis of the primary endpoint was conducted after all subjects completed the Study Day 92 visit, with selected secondary endpoints included.
  • Stage 2 (Study Day 169) corresponded to the final analysis specified in the protocol, i.e., the analysis of the overall study safety endpoints together with the remaining efficacy endpoints.
  • Table 5 summarizes the change from baseline in spirometry parameters to Study Day 92.
  • the increases in FEVI in the combined SC tralokinumab treatment group compared to placebo were observed as early as day 15 after the start of dosing, at this time point, the mean change from baseline in FEVi was 0.019 L in the placebo group and 0.124 L in the combined SC tralokinumab treatment group.
  • the magnitude of the mean change from baseline in FEVi in the combined SC tralokinumab treatment group was similar in subjects irrespective of their atopic status at baseline.
  • the mean change from baseline in FEVi was 0.210 L in the combined SC tralokinumab treatment group; (this difference was not statistically significant compared to the placebo group).
  • Pre-bronchodilator FEVi, FVC, and PEF improved in all tralokinumab groups over the 12-week treatment period compared with placebo (table 8).
  • the mean [SD] percent increases from baseline to week 13 in FEVi (12-5% [20-7%] vs 4-3% [29-4%]) and FVC (7- 1% [16-8%] vs 1-5% [21-0%]) were greater for tralokinumab versus placebo.
  • the effect on FEVi was evident at 2 weeks and persisted until week 24 (figure 12).
  • Week 13 a dose response was evident, though qualitatively similar FEVi increases were observed in the tralokinumab 300 and 600 mg groups during the last 6 weeks of treatment.
  • Similar mean [SD] percent increases in FEVi were seen at week 13 in subjects with atopic (12-9% [21-2%]) and non-atopic (12-2% [20-2%]) asthma who received tralokinumab.
  • Table 7 summarizes the use of rescue beta2 agonist and the proportion of reliever-free days comparing the week preceding baseline and the week preceding Study Day 92 across the placebo and SC tralokinumab treatment groups.
  • the mean number of rescue beta2 agonist puffs was similar at both time points in the placebo group (2.58 puffs at baseline and 2.5 puffs at Study Day 92). In contrast, the mean number of rescue beta2 agonist puffs was lower at Study Day 92 as compared to baseline in the combined SC tralokinumab treatment group (2.48 puffs at baseline and 1.8 puffs at Study Day 92).
  • the mean proportion of reliever-free days in a week in the placebo group was 13.2% at baseline and 22.0% at Study Day 92 for a difference of 8.8%.
  • the mean proportion of reliever-free days in a week was 17.4% at baseline and 38.7% at Study Day 92 for a difference of 21.3%.
  • the mean proportion of reliever-free days/ week increased during the study in the combined tralokinumab versus placebo groups (17-4% vs 13-2%, 38-7% vs 22-0%, 38-6% vs 28-6% at baseline, week 13, week 24, respectively).
  • Min-Max (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100)
  • Min-Max (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100) (0- 100)
  • ACQ-6 Asthma Control Questionnaire, mean of 6 individual item scores.
  • CI confidence interval.
  • FEVi forced expiratory volume in 1 s.
  • FVC forced vital capacity.
  • PEF peak expiratory flow.
  • SD standard deviation.
  • IL- 13 A sub-set of subjects stratified into sputum IL- 13 positive or negative demonstrated an association between presence of IL- 13 in sputum and response to tralokinumab as assessed by ACQ-6.
  • a growing body of evidence implicates IL- 13 as a key mediator in the development and maintenance of asthma.
  • This study investigated the additive effect of tralokinumab, a potent and specific IL- 13-neutralising human IgG4 monoclonal antibody, to currently available asthma controller therapy in subjects with uncontrolled moderate-to-severe asthma.
  • the increases in FEVi and FVC and reduction in the use of short-acting 2- agonists in tralokinumab -treated subjects are indicative of a treatment effect.
  • Free IL- 13 was measured using the Luminex technology (Millipore, Billerica, MA) . Necessary reagents were supplied in the assay kit, all steps were conducted at room temperature, and the assay plate was sealed and placed on a plate shaker with moderate shaking for all incubation steps. Briefly, wells were pre-wet with 200 ⁇ 1/ ⁇ 11 of Assay Buffer for > 10 minutes. Anti-IL- 13 antibody-conjugated bead was prepared in Bead Dilution Buffer and added to the assay plate at 25 ⁇ 1/ ⁇ 11; vacuum was applied to remove the Bead Dilution Buffer.
  • Reference standards (RS) , quality controls (QC) , and negative control (NC) prepared in Assay Buffer were added to the assay plate at Test samples (neat serum) were added at The assay plate was incubated for 60 ⁇ 10 minutes. Unbound analyte was removed by washing the plate twice with lx Wash Buffer. To detect bound analyte, biotin-conjugated anti-IL- 13 detection antibody was added and the assay plate was incubated for 60 ⁇ 10 minutes. PE-conjugated Streptavidin dye (SA-PE) was then added at and the assay plate was incubated for an additional 30 ⁇ 5 minutes. Excess detection antibody and dye was removed by washing the plate twice with lx Wash Buffer.
  • SA-PE PE-conjugated Streptavidin dye
  • Luminex Sheath Fluid was added at and the plate was placed on a plate shaker for > 5 minutes prior to reading.
  • the fluorescent intensity measured in the Luminex200 Plate reader, was proportional to the IL- 13 concentration in the sample.
  • the presence of > lpg/ml IL- 13 in sputum from a subject with asthma was indicative that the subject had detectable IL- 13 in sputum ("sputum IL- 13 positive”) .
  • a value of ⁇ 1 pg/ml IL- 13 in sputum was indicative that the subject did not have detectable IL- 13 in sputum and thus that the subject was "sputum IL- 13-negative" .
  • MPXHCYTO-60K (Luminex Kit Cat# MPXHCYTO-60K) :
  • Anti-IL- 13 antibody-conjugated beads Cat# MXHIL- 13, bead region 50, 50x stock
  • Biotin-conjugated anti-IL- 13 detection antibody Cat# MXH 1060- 1 , lx stock
  • Streptavidin-Phycoerythrin detection dye Cat# L-SAPE9, lx stock
  • Buffers Assay Buffer ( lx) , Bead Dilution Buffer ( lx) , Wash Buffer (25x)
  • Assay reagents were equilibrated to room temperature. An aliquot of 200 ⁇ 1 of Assay Buffer was transferred to each well of a 96-well filter assay plate, the plate was sealed and incubated on a plate shaker for > 10 minutes. Eight levels of reference standard (RS) were prepared by diluting the recombinant human IL- 13 reference standards in Assay Buffer. The following concentrations were used: 2500.0, 833.3, 277.8, 92.6, 30.9, 10.3, 3.4 and 1. 1 pg/ml. Three 3 levels of quality control samples (QC) were prepared in Assay Buffer. The following concentrations were used: 1000.0, 10.0 pg/ml.
  • RS reference standard
  • QC quality control samples
  • the negative control (NC) (0.0 ng/ml) was prepared with the Assay Buffer.
  • the test serum samples were thawed on ice and vortexed briefly.
  • the anti- IL- 13 antibody-conjugated bead was diluted 1 :50 in Bead Dilution buffer. A vacuum was applied to remove the buffer, the bottom of the plate was blotted on absorbent paper. An aliquot of of the diluted bead solution was transferred to the plate. Vacuum was applied to the plate as above. Aliquots of of the RS, QC, NC, and serum samples were transferred to the plate; which was then sealed and incubated for 60 ⁇ 10 minutes on a rotating platform with moderate shaking.
  • IX Wash Buffer was prepared from the 25X Wash Buffer stock.
  • the plate was washed twice with 200
  • SAFE Streptavidin dye
  • Subjects will be stratified at screening by the number of asthma exacerbations in the past 12 months (2 versus > 2 but ⁇ 6 exacerbations) and by chronic oral corticosteroid (OCS) use (presence versus absence).
  • OCS chronic oral corticosteroid
  • a 5-week screening/run-in period (Week -5 to - 1 [Day - 1) will precede investigational product administration.
  • subjects will receive a fixed-dose combination product of fluticasone/salmeterol, either as an MDI (230 pg/21 g) at a dose of 2 inhalations twice per day or as a DPI (500 g/50 g) at a dose of one inhalation twice per day.
  • Sites/subjects will be permitted to use either presentation of fluticasone/salmeterol if approved and available for use in their country.
  • asthma controller medications including leukotriene modifiers, theophylline, cromones, or OCS ⁇ 20 mg/day
  • these medications should be continued at a stable dose during the screening/ run-in period.
  • inhaled reliever therapy eg, short-acting ⁇ 2 agonist or short-acting anticholinergic
  • Subjects will continue to receive the same fixed-dose combination product of fluticasone/salmeterol with or without additional asthma controller medications at a stable dose during the treatment period and through Week 53. Subjects who experience an asthma exacerbation during the treatment period will be treated accordingly and will remain in the study. Subjects will return to the clinic at Week 53 for an assessment of the efficacy endpoints. Subjects will have 3 additional follow-up visits at Weeks 59, 67, and 75. After the Week 53 visit, background medications may be changed as deemed necessary by the investigator. As part of the study, selected sites will take part in a sub-study using HRCT scanning to measure potential airway wall structural changes including airway wall thickness. Sites will be selected on their ability and willingness to carry out the scans.
  • Participation in this sub study is optional for subjects at the selected sites.
  • An adequate number of sites will be identified in order to target recruitment of approximately 40 subjects into each of the 2 cohorts for the HRCT sub-study.
  • Subjects will be in the study for 79 weeks, including a 5-week screening/run-in period (Week -5 to Week - 1), a 48- or 50-week treatment period (Weeks 1-51 for Cohort 1 and Weeks 1-49 for Cohort 2), and a 24-week follow-up period (Weeks 51- 75).
  • the subjects in this study will be adults aged 18-75 years with uncontrolled, severe asthma requiring high-dose ICS and LABA with or without additional controller medications.
  • a total of 390 subjects will be randomized in a 1 : 1 ratio to one of 2 cohorts. Within each cohort, subjects will be randomized in a 2: 1 ratio to receive SC tralokinumab (300 mg) or placebo. Investigational product (tralokinumab or placebo) will be administered as 2 SC injections of 1 mL either Q2W for 50 weeks for a total of 26 doses (Cohort 1) or Q2W for 12 weeks followed by Q4W for 38 weeks for a total of 16 doses (Cohort 2).
  • GINA Guidelines 2009 GINA report, Global strategy for asthma management and prevention.
  • Naseer T Minshall EM, Leung DY, Laberge S, Ernst P, Martin RJ, Hamid Q. Expression of IL- 12 and IL- 13 mRNA in asthma and their modulation in response to steroid therapy. Am J Respir Crit Care Med. 1997; 155(3): 845- 51.
  • Pulmonary expression of interleukin- 13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest 1999; 103: 779-88.
  • SEQ ID NO: 7 is HCDR1
  • SEQ ID NO: 8 is HCDR2
  • SEQ ID NO: 9 is HCDR3
  • SEQ ID NO: 10 is LCDR1;
  • SEQ ID NO: 1 1 is LCDR2;
  • SEQ ID NO: 12 is LCDR3.
  • SEQ ID NO: 15 is VH fragment
  • SEQ ID NO: 16 is VL fragment
  • BAK278D6 (SEQ ID NOS: 1 , 2, 3, 4, 5, 6)
  • BAK1183H4 (SEQ ID NOS: 97, 98, 99, 100, 101 , 102),
  • BAK1167F02 (SEQ ID NOS: 64, 65, 66, 67, 68, 69),
  • BAK1111D 10 (SEQ ID NOS: 91 , 92, 93, 94, 95, 96),
  • BAK1166G02 (SEQ ID NOS: 67, 68, 69, 70, 71, 72),
  • BAK1167F04 (SEQ ID NOS: 85, 86, 87, 88, 89, 90)
  • BAK1184C8 SEQ ID NOS: 73, 74, 75, 76, 77, 78
  • BAK1185E1 (SEQ ID NOS: 79, 80, 81 , 82, 83, 84), and
  • VH, VL Variants of tralokinumab (VH, VL) BAK278D6 (VH SEQ ID NO: 13, VL SEQ ID NO; 14) BAK1183H4 (VH SEQ ID NO: 37, VL SEQ ID NO: 38),
  • BAK1111D 10 (VH SEQ ID NO: 41 , VL SEQ ID NO: 42),
  • BAK1166G02 VH SEQ ID NO: 53, VL SEQ ID NO: 54
  • BAK1167F04 VH SEQ ID NO: 43, VL SEQ ID NO: 44
  • HEAVY CHAIN- SEQ ID NO: 1 15 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGG CCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACAAATTA TGGTCTCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGA TGGGATGGATCGCAACCCCAGACGGCCAGACAAGCTATGGACAGGAA TTCCAGGGCAGAGTCACCATGACCACAGATACATCCACGAGCACAGCC TACATGGAGTTGAGGAGCCTGAGATCTGACGACACGGCCGTTTATTAC TGTGCGAGACTCCAACAGCAGCTGGGCCCGCTGGTTTTTCGATCTC TGGGGCCGGGACACTGGTCACCGTCCTCA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Biotechnology (AREA)
  • Medical Informatics (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Endocrinology (AREA)
  • Mycology (AREA)
  • Physiology (AREA)
  • Surgery (AREA)
PCT/EP2011/067947 2010-10-15 2011-10-14 Therapies for improving pulmonary function Ceased WO2012049278A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
US13/879,261 US20130281876A1 (en) 2010-10-15 2011-10-14 Therapies for improving pulmonary function
CN2011800498365A CN103328506A (zh) 2010-10-15 2011-10-14 用于改善肺功能的疗法
DK11769881.1T DK2627673T3 (da) 2010-10-15 2011-10-14 Terapier til forbedring af lungefunktionen
RU2013122123/10A RU2013122123A (ru) 2010-10-15 2011-10-14 Терапевтические средства для улучшения легочной функции
JP2013533226A JP2013544235A (ja) 2010-10-15 2011-10-14 肺機能を改善する治療法
NO11769881A NO2627673T3 (https=) 2010-10-15 2011-10-14
MX2013004212A MX2013004212A (es) 2010-10-15 2011-10-14 Terapias para mejorar la funcion pulmonar.
EP11769881.1A EP2627673B1 (en) 2010-10-15 2011-10-14 Therapies for improving pulmonary function
AU2011315499A AU2011315499A1 (en) 2010-10-15 2011-10-14 Therapies for improving pulmonary function
CA2814431A CA2814431A1 (en) 2010-10-15 2011-10-14 Therapies for improving pulmonary function
ES11769881.1T ES2645368T3 (es) 2010-10-15 2011-10-14 Terapias para mejorar la función pulmonar
PL11769881T PL2627673T3 (pl) 2010-10-15 2011-10-14 Terapie poprawiające funkcje płuc
BR112013009055A BR112013009055A2 (pt) 2010-10-15 2011-10-14 antagonista de il-13, uso de um antagonista de il-13, e, método para detectar uma resposta do indivíduo a um tratamento de antagonista de il-13

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US39367710P 2010-10-15 2010-10-15
US61/393,677 2010-10-15
US201161508723P 2011-07-18 2011-07-18
US61/508,723 2011-07-18

Publications (1)

Publication Number Publication Date
WO2012049278A1 true WO2012049278A1 (en) 2012-04-19

Family

ID=44800047

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/067947 Ceased WO2012049278A1 (en) 2010-10-15 2011-10-14 Therapies for improving pulmonary function

Country Status (15)

Country Link
US (1) US20130281876A1 (https=)
EP (1) EP2627673B1 (https=)
JP (1) JP2013544235A (https=)
CN (1) CN103328506A (https=)
AU (1) AU2011315499A1 (https=)
BR (1) BR112013009055A2 (https=)
CA (1) CA2814431A1 (https=)
DK (1) DK2627673T3 (https=)
ES (1) ES2645368T3 (https=)
HU (1) HUE034005T2 (https=)
MX (1) MX2013004212A (https=)
NO (1) NO2627673T3 (https=)
PL (1) PL2627673T3 (https=)
RU (1) RU2013122123A (https=)
WO (1) WO2012049278A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015155710A1 (en) 2014-04-11 2015-10-15 Novartis Ag Methods of selectively treating asthma using il-13 antagonists
EP3057609A4 (en) * 2013-10-15 2017-03-22 Medlmmune, LLC Methods for treating chronic obstructive pulmonary disease using benralizumab
EP2888281B1 (en) * 2012-08-21 2018-09-19 Sanofi Biotechnology Methods for treating or preventing asthma by administering an il-4r antagonist
CN112341543A (zh) * 2021-01-11 2021-02-09 北京欣颂生物科技有限公司 包含间充质干细胞外泌体的药物组合物在治疗疾病中的应用
US20210322546A1 (en) * 2014-02-21 2021-10-21 Sanofi Biotechnology Methods for treating or preventing asthma by administering an il-4r antagonist
US12398212B2 (en) 2019-07-16 2025-08-26 Sanofi Biotechnology Methods for treating or preventing asthma by administering an IL-4R antagonist

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2937387A1 (en) * 2014-01-27 2015-07-30 Medimmune, Llc Dipeptidyl peptidase-4 (dpp4/cd26) as a peripheral biomarker of il-13 activation in asthmatic lung
AU2016205188A1 (en) 2015-01-09 2017-06-22 Medimmune, Llc Assay to detect human DPP-4
CN104605857A (zh) * 2015-02-12 2015-05-13 上海朔茂网络科技有限公司 一种肺功能测量方法
JP6871948B2 (ja) 2016-04-27 2021-05-19 アッヴィ・インコーポレイテッド 抗il−13抗体を使用する、il−13活性が有害である疾患の治療方法
BR112019018022A2 (pt) * 2017-03-01 2020-06-02 Medimmune Limited Formulações de anticorpos monoclonais
US11053309B2 (en) 2017-08-04 2021-07-06 Regeneron Pharmaceuticals, Inc. Methods for treating active eosinophilic esophagitis
MX2021010560A (es) 2019-03-06 2021-11-12 Regeneron Pharma Inhibidores de la via il-4/il-13 para una eficacia aumentada en el tratamiento de cancer.
CA3132587A1 (en) 2019-03-21 2020-09-24 Regeneron Pharmaceuticals, Inc. Combination of il-4/il-13 pathway inhibitors and plasma cell ablation for treating allergy
JP2023536159A (ja) * 2020-07-31 2023-08-23 ジェネンテック, インコーポレイテッド 炎症性呼吸器疾患の増悪を治療するための方法
US20230220089A1 (en) 2021-12-30 2023-07-13 Regeneron Pharmaceuticals, Inc. Methods for attenuating atopic march by administering an il-4/il-13 antagonist

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001062933A2 (en) 2000-02-22 2001-08-30 Royal Brompton And Harefield Nhs Trust Muteins of interleukin-13 (il-13)
GB2403952A (en) * 2003-07-15 2005-01-19 Cambridge Antibody Tech IL-13 binding molecules
WO2006055638A2 (en) * 2004-11-17 2006-05-26 Abgenix, Inc. Fully human monoclonal antibodies to il-13
WO2007080174A2 (en) * 2006-01-11 2007-07-19 Glaxo Group Limited Chimeric and humanised anti-human il-13 antibodies

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2140660A1 (en) * 1993-06-13 1994-12-22 Uwe R. Juergens Use of terpene compounds for reduced release of arachidonic acid and of inflammation mediators

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001062933A2 (en) 2000-02-22 2001-08-30 Royal Brompton And Harefield Nhs Trust Muteins of interleukin-13 (il-13)
GB2403952A (en) * 2003-07-15 2005-01-19 Cambridge Antibody Tech IL-13 binding molecules
WO2005007699A2 (en) 2003-07-15 2005-01-27 Cambridge Antibody Technology Limited Human antibody molecules for il-13
WO2006055638A2 (en) * 2004-11-17 2006-05-26 Abgenix, Inc. Fully human monoclonal antibodies to il-13
WO2007080174A2 (en) * 2006-01-11 2007-07-19 Glaxo Group Limited Chimeric and humanised anti-human il-13 antibodies

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
BLEASE KATE: "Therapeutics targeting IL-13 for the treatment of pulmonary inflammation and airway remodeling", CURRENT OPINION IN INVESTIGATIONAL DRUGS, PHARMAPRESS, US, vol. 9, no. 11, 1 November 2008 (2008-11-01), pages 1180 - 1184, XP008122454, ISSN: 1472-4472 *
BREE A, SCHLERMAN FJ, WADANOLI M, TCHISTIAKOVA L, MARQUETTE K, TAN X-Y, JACOBSON BA, WIDOM A, COOK TA, WOOD N: "IL-13 blockade reduces lung inflammation after ascaris suum challenge in cynomolgus monkeys", J. ALLERGY CLIN. IMMUNOL., vol. 119, no. 5, 2007, pages 1251 - 7
EUR RESPIR J, vol. 26, pages 319 - 338
GAOYUN YANG ET AL: "Therapeutic dosing with anti-interleukin-13 monoclonal antibody inhibits asthma progression in mice", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, AMERICAN SOCIETY FOR PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, US, vol. 313, no. 1, 1 April 2005 (2005-04-01), pages 8 - 15, XP002644930, ISSN: 0022-3565, [retrieved on 20050111], DOI: 10.1124/JPET.104.076133 *
GRUNIG G, WARNOCK M, WAKIL AE, VENKAYYA R, BROMBACHER F, RENNICK DM, SHEPPARD D, MOHRS M, DONALDSON DD, LOCKSLEY RM: "Requirement for IL-13 Independently of IL-4 in Experimental Asthma", SCIENCE, 1998, pages 2261 - 3
HEINZMANN A, MAO XQ, AKAIWA M, KREOMER RT, GAO PS, OHSHIMA K, UMESHITA R, ABE Y, BRAUN S, YAMASHITA T: "Genetic variants of IL-13 signalling and human asthma and atopy", HUM MOL GENET, vol. 9, no. 4, 2000, pages 549 - 59
HERSHEY GK: "IL-13 receptors and signaling pathways: an evolving web", J ALLERGY CLIN IMMUNOL, vol. 111, no. 4, 2003, pages 677 - 90
HOWARD TD, KOPPELMAN GH, XU J, ZHENG SL, POSTMA DS, MEYERS DA, BLEECKER ER: "Gene-gene interaction in asthma: IL4RA and IL13 in a Dutch population with asthma", AM J HUM GENET., vol. 70, no. 1, 2002, pages 230 - 6
HOWARD TD, WHITTAKER PA, ZAIMAN AL, KOPPELMAN GH, XU J, HANLEY MT, MEYERS DA, POSTMA DS, BLEECKER ER: "Identification and association of polymorphisms in the interleukin-13 gene with asthma and atopy in a Dutch population", AM J RESPIR CELL MOL BIOL., vol. 25, no. 3, 2001, pages 377 - 84
HUANG S-K, XIAO H-Q, KLEINE-TEBBE J, PACIOTTI GI, MARSH DG., LICHTENSTEIN LM, LIU MC, J IMMUNOL., vol. 155, no. 5, 1995, pages 2688 - 2694
HUMBERT M, DURHAM SR, KIMMITT P, POWELL N, ASSOUFI B, PFISTER R, MENZ G, KAY AB, CORRIGAN CJ: "Elevated expression of messenger ribonucleic acid encoding IL-13 in the bronchial mucosa of atopic and nonatopic subjects with asthma", J ALLERGY CLIN IMMUNOL., vol. 99, no. 5, 1997, pages 657 - 65
JUNIPER EF, BOUSQUET J, ABETZ L, BATEMAN ED: "Identifying 'well-controlled' and 'not well-controlled' asthma using the Asthma Control Questionnaire", RESPIR MED., vol. 100, 2006, pages 616 - 21
JUNIPER EF, O'BYRNE PM, GUYATT GH, FERRIE PJ, KING DR: "Development and validation of a questionnaire to measure asthma control", EUR RESPIR J, vol. 14, 1999, pages 902 - 7
KAUPPI P, LINDBLAD-TOH K, SEVON P, TOIVONEN HT, RIOUX JD, VILLAPAKKAM A, LAITINEN LA, HUDSON TJ, KERE J, LAITINEN T: "A second-generation association study of the 5q31 cytokine gene cluster and the interleukin-4 receptor in asthma", GENOMICS, vol. 77, no. 1-2, September 2001 (2001-09-01), pages 35 - 42
KOMAI-KOMA M, MCKAY A, THOMSON L, MCSHARRY C, CHALMERS GW, LIEW FY, THOMSON NC: "Immuno-regulatory cytokines in asthma: IL-15 and IL-13 in induced sputum", CLIN EXP ALLERGY, vol. 31, no. 9, 2001, pages 1441 - 8
KOTSIMBOS TC, ERNST P, HAMID QA: "Interleukin-13 and interleukin-4 are coexpressed in atopic asthma", PROC ASSOC AM PHYSICIANS, vol. 108, no. 5, 1996, pages 368 - 73
KROEGEL, JULIUS, MATTHYS, VIRCHOW, LUTTMANN: "Endobronchial secretion of interleukin-13 following local allergen challenge in atopic asthma: relationship to interleukin-4 and eosinophil counts", EUR RESPIR J., vol. 9, 1996, pages 899
LACHMAN H ET AL: "Efficacy and Safety of Canakinumab (ACZ885), a Fully Human Anti-Interleukin-1b-Antibody, in Cryopyrin Associated Periodic Fever Syndrome Results of a Multicenter, Randomized, Double-blind, Phase III Study", JOURNAL OF ALLERGY AND CLINICAL IMMUNOLOGY, MOSBY, INC, US, vol. 123, no. 3, 1 March 2009 (2009-03-01), pages 732, XP026033133, ISSN: 0091-6749, [retrieved on 20090301], DOI: 10.1016/J.JACI.2009.01.038 *
LIU X, NICKEL R, BEYER K, WAHN U, EHRLICH E, FREIDHOFF LR, BJORKSTEN B, BEATY TH, HUANG SK: "An IL13 coding region variant is associated with a high total serum IgE level and atopic dermatitis in the German multicenter atopy study (MAS-90", J ALLERGY CLIN IMMUNOL., vol. 106, 2000, pages 167 - 70
MEDIMMUNE,NCT00873860: "A Phase 2a, Randomized, Double-blind, Placebo-Controlled, Parallel-Arm, Multicenter Study to Evaluate the Efficacy and Safety of CAT-354, on Asthma Control in Adults", 24 August 2010 (2010-08-24), usa, pages 1 - 5, XP002665050, Retrieved from the Internet <URL:http://clinicaltrials.gov/archive/NCT00873860/2010_08_24> [retrieved on 20111129] *
MEDIMMUNE: "A Phase 2b, Randomized, Double-blind Study to Evaluate the Efficacy of Tralokinumab in Adults With Uncontrolled, Severe Asthma", 26 July 2011 (2011-07-26), usa, pages 1 - 4, XP002665051, Retrieved from the Internet <URL:http://clinicaltrials.gov/archive/NCT01402986/2011_07_26> [retrieved on 20111205] *
NASEER T, MINSHALL EM, LEUNG DY, LABERGE S, ERNST P, MARTIN RJ, HAMID Q: "Expression of IL-12 and IL-13 mRNA in asthma and their modulation in response to steroid therapy", AM J RESPIR CRIT CARE MED., vol. 155, no. 3, 1997, pages 845 - 51
REDDEL HK, TAYLOR DR, BATEMAN ED ET AL.: "An official American Thoracic Society/European Respiratory Society statement: asthma control and exacerbations: standardizing endpoints for clinical asthma trials and clinical practice", AM J RESPIR CRIT CARE MED, vol. 180, 2009, pages 59 - 99
SAHA SK, BERRY MA, PARKER D, SIDDIQUI S, MORGAN A, MAY R, MONK P, BRADDING P, WARDLAW AJ, PAVORD ID: "Increased sputum and bronchial biopsy IL-13 expression in severe asthma", J ALLERGY CLIN IMMUNOL., vol. 121, no. 3, March 2008 (2008-03-01), pages 685 - 91
SINGH DAVE ET AL: "A phase 1 study evaluating the pharmacokinetics, safety and tolerability of repeat dosing with a human IL-13 antibody (CAT-354) in subjects with asthma", BMC PULMONARY MEDICINE, BIOMED CENTRAL, LONDON, GB, vol. 10, no. 1, 8 January 2010 (2010-01-08), pages 3, XP021067289, ISSN: 1471-2466 *
TAMURA K, SUZUKI M, ARAKAWA H, TOKUYAMA K, MORIKAWA A: "Linkage and association studies of STAT6 gene polymorphisms and allergic diseases", INT ARCH ALLERGY IMMUNOL., vol. 131, no. 1, May 2003 (2003-05-01), pages 33 - 8
VAN DER POUW KRAAN TC, VAN VEEN A, BOEIJE LC, VAN TUYL SA, DE GROOT ER, STAPEL SO, BAKKER A, VERWEIJ CL, AARDEN LA, VAN DER ZEE JS: "An IL-13 promoter polymorphism associated with increased risk of allergic asthma", GENES IMMUN., vol. 1, no. 1, 1999, pages 61 - 5
VENKAYYA R, LAM M, WILLKOM M, GRUNIG G, CORRY DB, ERLE DJ: "The Th2 lymphocyte products IL-4 and IL-13 rapidly induce airway hyperresponsiveness through direct effects on resident airway cells", AM J RESPIR CELL MOL BIOL., vol. 26, no. 2, 2002, pages 202 - 8
VLADICH FD, BRAZILLE SM, STERN D, PECK ML, GHITTONI R, VERCELLI D: "IL-13 R130Q, a common variant associated with allergy and asthma, enhances effector mechanisms essential for human allergic inflammation", J CLIN INVEST., vol. 115, no. 3, 2005, pages 747 - 54
WILLS-KARP M, LUYIMBAZI J, XU X, SCHOFIELD B, NEBEN TY, KARP CL, DONALDSON D, INTERLEUKIN-13: CENTRAL MEDIATOR OF ALLERGIC ASTHMA SCIENCE, vol. 282, 1998, pages 2258 - 2261
YANG G ET AL: "Anti-IL-13 monoclonal antibody inhibits airway hyperresponsiveness, inflammation and airway remodeling", CYTOKINE, ACADEMIC PRESS LTD, PHILADELPHIA, PA, US, vol. 28, no. 6, 21 December 2004 (2004-12-21), pages 224 - 232, XP004654755, ISSN: 1043-4666, DOI: 10.1016/J.CYTO.2004.08.007 *
ZHU Z, HOMER RJ, WANG Z, CHEN Q, GEBA GP, WANG J ET AL.: "Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production", J CLIN INVEST, vol. 103, 1999, pages 779 - 88

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2888281B1 (en) * 2012-08-21 2018-09-19 Sanofi Biotechnology Methods for treating or preventing asthma by administering an il-4r antagonist
US11845800B2 (en) 2012-08-21 2023-12-19 Sanofi Biotechnology Methods for treating or preventing asthma by administering an IL-4R antagonist
EP3057609A4 (en) * 2013-10-15 2017-03-22 Medlmmune, LLC Methods for treating chronic obstructive pulmonary disease using benralizumab
EP3485902A1 (en) * 2013-10-15 2019-05-22 Astrazeneca AB Methods for treating chronic obstructive pulmonary disease using benralizumab
US20210322546A1 (en) * 2014-02-21 2021-10-21 Sanofi Biotechnology Methods for treating or preventing asthma by administering an il-4r antagonist
WO2015155710A1 (en) 2014-04-11 2015-10-15 Novartis Ag Methods of selectively treating asthma using il-13 antagonists
US12398212B2 (en) 2019-07-16 2025-08-26 Sanofi Biotechnology Methods for treating or preventing asthma by administering an IL-4R antagonist
CN112341543A (zh) * 2021-01-11 2021-02-09 北京欣颂生物科技有限公司 包含间充质干细胞外泌体的药物组合物在治疗疾病中的应用
CN112341543B (zh) * 2021-01-11 2021-04-23 广东赛尔生物科技有限公司 包含间充质干细胞外泌体的药物组合物在治疗疾病中的应用

Also Published As

Publication number Publication date
CN103328506A (zh) 2013-09-25
BR112013009055A2 (pt) 2016-07-19
ES2645368T3 (es) 2017-12-05
JP2013544235A (ja) 2013-12-12
PL2627673T3 (pl) 2018-01-31
EP2627673A1 (en) 2013-08-21
DK2627673T3 (da) 2017-11-06
EP2627673B1 (en) 2017-07-26
HUE034005T2 (en) 2018-01-29
CA2814431A1 (en) 2012-04-19
NO2627673T3 (https=) 2017-12-23
AU2011315499A1 (en) 2013-05-02
US20130281876A1 (en) 2013-10-24
MX2013004212A (es) 2013-09-02
RU2013122123A (ru) 2014-11-20

Similar Documents

Publication Publication Date Title
EP2627673B1 (en) Therapies for improving pulmonary function
US20250032608A1 (en) Treatment of asthma with anti-tsl p antibody
CN107073114B (zh) 使用瑞利珠单抗治疗中度到重度嗜酸细胞性哮喘
US20180319889A1 (en) Method and medicament for treating airway and/or lung diseases
JP2013544235A5 (https=)
KR20240049348A (ko) 항-인터루킨-33 항체를 사용한 만성 폐쇄성 폐질환의 치료
JP2025527762A (ja) 抗インターロイキン-33抗体を用いた喘息の治療
HK1188603B (en) Therapies for improving pulmonary function
HK1188603A (en) Therapies for improving pulmonary function
TW202544036A (zh) 用抗tslp抗體治療慢性阻塞性肺病
US20230091430A1 (en) TREATMENT OF ATOPIC DERMATITIS EMPLOYING ANTI-IL-13Ra1 ANTIBODY OR BINDING FRAGMENT THEREOF IN AN ALLERGIC POPULATION
EP4713357A1 (en) Treatment of corticosteroid dependent asthma with anti-tslp antibody
WO2025095864A1 (en) Treatment
WO2025120567A1 (en) Method of treatment of asthma
Shrimanker et al. Protein Therapeutics in Respiratory Medicine
HK1240824A1 (en) Use of reslizumab to treat moderate to severe eosinophilic asthma
HK1240824B (en) Use of reslizumab to treat moderate to severe eosinophilic asthma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11769881

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2814431

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2013533226

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: MX/A/2013/004212

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2011315499

Country of ref document: AU

Date of ref document: 20111014

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013122123

Country of ref document: RU

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2011769881

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011769881

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13879261

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013009055

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013009055

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130412