WO2011143124A2 - Endoribonuclease compositions and methods of use thereof - Google Patents
Endoribonuclease compositions and methods of use thereof Download PDFInfo
- Publication number
- WO2011143124A2 WO2011143124A2 PCT/US2011/035775 US2011035775W WO2011143124A2 WO 2011143124 A2 WO2011143124 A2 WO 2011143124A2 US 2011035775 W US2011035775 W US 2011035775W WO 2011143124 A2 WO2011143124 A2 WO 2011143124A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- endoribonuclease
- rna
- target
- specific
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 *CCCCCN Chemical compound *CCCCCN 0.000 description 3
- XDTMQSROBMDMFD-UHFFFAOYSA-N C1CCCCC1 Chemical compound C1CCCCC1 XDTMQSROBMDMFD-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6823—Release of bound markers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
- C07K1/14—Extraction; Separation; Purification
- C07K1/16—Extraction; Separation; Purification by chromatography
- C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8114—Kunitz type inhibitors
- C07K14/8117—Bovine/basic pancreatic trypsin inhibitor (BPTI, aprotinin)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
- C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
- C12N9/224—Class 1 CAS enzyme complex, e.g. multi-enzyme
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
Definitions
- the present disclosure provides variant Csy4 endoribonucleases, nucleic acids encoding the variant Csy4 endoribonucleases, and host cells genetically modified with the nucleic acids.
- the variant Csy4 endoribonucleases find use in a variety of applications, which are also provided.
- the present disclosure also provides methods of detecting a specific sequence in a target polyribonucleotide; and methods of regulating production of a target RNA in a eukaryotic cell.
- Figures 1A-C depict specific recognition of a pre-crRNA substrate by Pal4Csy4.
- Figures 2A-C depict crystal structures of Csy4 bound to RNA substrate.
- Figures 3A and 3B depict: a detailed view of the catalytic center of Csy4 (Figure
- Figure 4 depicts invariant amino acids among 12 Csy4 sequences.
- Figures 5A-5BD present an amino acid sequence alignment of various Csy4 polypeptides, as well as the nucleotide sequences of RNA sequences recognized by each
- Figure 6 depicts examples of amino acid sequences of enzymatically inactive, sequence-specific endoribonucleases.
- Figure 7 depicts an example of a method for detecting a specific sequence in a target polyribonucleotide.
- Figure 8 depicts the effect of imidazole on activation of various enzymatically inactive Csy4 variants.
- Figure 9 depicts an exemplary method of isolating a target RNA.
- a Csy4 target stem-loop (SEQ ID NO: 103) is shown.
- Figure 10 depicts an exemplary method of regulating expression of a target RNA in a eukaryotic cell.
- a Csy4 RNA substrate sequence (SEQ ID NO: 103) is shown.
- polyribonucleotide refers to a polymeric form of
- ribonucleotides and includes RNA, RNA containing deoxyribonucleotide(s), and DNA containing ribonucleotide(s).
- a polyribonucleotide can in some cases include one or more modified nucleotides (e.g., deoxyinosine, deoxyuridine or
- a polyribonucleotide consists of a ribonucleotides only (i.e., does not include any deoxyribonucleotides). In some cases, a polyribonucleotide comprises ribonucleotides, and one or more modified
- a polyribonucleotide comprises ribonucleotides, and may comprise one or more modified ribonucleotides, and one or more deoxyribonucleotides (including modified
- deoxyribonucleotides comprise from about 50% to about 40%, from about 40% to about 30%, from about 30% to about 20%, from about 20% to about 10%, from about 10% to about 1%, or less than 1%, of the total nucleotides in the polyribonucleotide.
- nucleic acid and “polynucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
- Non-limiting examples of polynucleotides include linear and circular nucleic acids, messenger RNA (mRNA), cDNA, recombinant polynucleotides, vectors, probes, and primers.
- a "biological sample” encompasses a variety of sample types obtained from a cell, extracellular matter, a tissue, or a multicellular organism. The definition
- biological sample encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
- the definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as polynucleotides.
- biological sample encompasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid (e.g., cerebrospinal fluid, bronchoalveolar lavage fluid, urine, blood, a blood fraction (e.g., plasma; serum), sputum, and the like), and tissue samples.
- a biological sample comprises cells.
- a biological sample is cell free.
- operably linked refers to functional linkage between molecules to provide a desired function.
- “operably linked” in the context of nucleic acids refers to a functional linkage between nucleic acids to provide a desired function such as transcription, translation, and the like, e.g., a functional linkage between a nucleic acid expression control sequence (such as a promoter, signal sequence, or array of transcription factor binding sites) and a second polynucleotide, wherein the expression control sequence affects transcription and/or translation of the second polynucleotide.
- “Operably linked” in the context of a polypeptide refers to a functional linkage between amino acid sequences (e.g., of different domains) to provide for a described activity of the polypeptide.
- isolated refers to a protein or nucleic acid that, if naturally occurring, is in an environment different from that in which it may naturally occur. "Isolated” is meant to include proteins or nucleic acids that are within samples that are substantially enriched for the protein or nucleic acid of interest and/or in which the protein or nucleic acid of interest is partially or substantially purified. Where the protein or nucleic acid is not naturally occurring, “isolated” indicates the protein or nucleic acid has been separated from an environment in which it was made by either synthetic or recombinant means.
- substantially pure indicates that an entity (e.g., polypeptide or a nucleic acid) makes up greater than about 50% of the total content of the composition (e.g., total protein of the composition) and typically, greater than about 60% of the total protein content.
- substantially pure refers to compositions in which at least 75%, at least 85%, at least 90% or more of the total composition is the entity of interest (e.g. 95%, of the total protein).
- the protein or nucleic acid of interest will make up greater than about 90%, greater than about 95%, greater than about 98%, or greater than about 99%, of the total protein or nucleic acid in the composition.
- polyribonucleotide includes reference to one or more target polyribonucleotides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
- the present disclosure provides variant Csy4 endoribonucleases, nucleic acids encoding the variant Csy4 endoribonucleases, and host cells genetically modified with the nucleic acids.
- the variant Csy4 endoribonucleases find use in a variety of applications, which are also provided.
- the present disclosure also provides methods of detecting a specific sequence in a target polyribonucleotide; and methods of regulating production of a target RNA in a eukaryotic cell.
- the present disclosure provides a method of detecting a sequence in a target polyribonucleotide.
- the methods are useful for detecting the presence of a particular sequence in a polyribonucleotide, and can therefore be used to detect a
- polyribonucleotide comprising a particular sequence.
- the method can be used to detect the presence of a polyribonucleotide of a pathogen in a sample (e.g., in a biological sample).
- a subject method can detect as few as 100 copies, down to a single copy, of a target polyribonucleotide.
- a subject method can detect from 1 to about 5, from about 5 to about 10, from about 10 to about 50, or from about 50 to about 100, or more than 100, copies of a target polyribonucleotide in a sample (e.g., in a single cell, in a single embryo, or other biological sample).
- a subject method is thus useful for various forensic, research, and diagnostic applications.
- a subject method of detecting a specific sequence in a target polyribonucleotide comprises: a) contacting the target polyribonucleotide with a oligonucleotide probe comprising the specific sequence and an enzymatically active sequence-specific Csy4 endoribonuclease under conditions that favor duplex formation between the oligonucleotide probe and the target polyribonucleotide, wherein the duplex is cleaved by the Csy4 endoribonuclease; and b) detecting specific binding between the oligonucleotide probe and the target polyribonucleotide, wherein detection of duplex formation between the oligonucleotide probe and the target polyribonucleotide indicates the presence of the specific sequence in the target polyribonucleotide.
- the oligonucleotide probe is linked to a peptide, and the peptide is released upon cleavage of the duplex by the Csy4 endoribonuclease; in these cases, the detection step involves detection of the released peptide.
- the released peptide is detected by binding to an antibody specific for the peptide, e.g., where the antibody is immobilized.
- the target polyribonucleotide is immobilized on a solid support.
- Target polyribonucleotides include any of a variety of polynucleotides, e.g., the target polyribonucleotide can be a polyribonucleotide of a pathogen.
- the antibody or the target polynucleotide is immobilized on a solid support (insoluble support).
- insoluble supports include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
- the insoluble support can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
- substances glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite
- agarose beads e.g., polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and
- the method generally involves: a) contacting a target polyribonucleotide with a sequence-specific endoribonuclease; and b) detecting cleavage fragments produced by site-specific cleavage of the target polyribonucleotide, where production of cleavage fragments expected upon cleavage at a specific sequence in the polyribonucleotide indicates the presence of the specific sequence.
- a subject method of detecting a sequence in a target is a subject method of detecting a sequence in a target
- polyribonucleotide involves: a) contacting a target polyribonucleotide with: i) a sequence-specific endoribonuclease; and ii) an oligonucleotide probe comprising a linked detection moiety, where the oligonucleotide probe comprises a specific, known nucleotide sequence; wherein the oligonucleotide probe forms a duplex with a complementary sequence in the target polyribonucleotide based on binding of the known nucleotide sequence present in the oligonucleotide probe to a complementary sequence in the target polyribonucleotide, and where the sequence-specific endoribonuclease cleaves the duplex in a sequence- specific manner, thereby releasing the detection moiety from the oligonucleotide probe; and b) detecting the released detection moiety, where release of the detection moiety indicates the presence of the specific sequence.
- the detection moiety is a polypeptide.
- the polypeptide can be detected using an immunological assay (e.g., an enzyme-linked immunosorbent assay (ELISA); a radioimmunoassay (RIA); etc.), using an antibody specific for the polypeptide detection moiety.
- the antibody specific for the polypeptide detection moiety can comprise a detectable label.
- the immunological assay can be carried out on a test strip (e.g., in a lateral flow assay) or other suitable medium such as a multi-well plate.
- the detection moiety is a fluorescent protein
- luciferin or other substrate for luciferase.
- Suitable luciferins or other luciferase substrates include, e.g., luciferin (e.g., a firefly luciferin); an aminoluciferin;
- coelenterazine a modified coelenterazine as described in U.S. Patent No. 7,537,912
- a coelenterazine analog as described in U.S. Patent Publication No. 2009/0081129 (e.g., a membrane permeant coelenterazine analog as described in U.S. Patent Publication No. 2009/0081129, e.g., one of Structures II, III, IV, V, and VI of U.S. Patent Publication No. 2009/0081129); aminoluciferin; dihydroluciferin; luciferin 6' methylether; or luciferin 6' chloroethylether. See, e.g., Branchini, B.R. et al.
- FIG. 7 A non-limiting example of a subject detection method is illustrated schematically in Figure 7.
- small oligonucleotides that bind discrete regions of a target polynucleotide e.g., a viral RNA
- the oligonucleotides comprise detectable moieties (e.g., ligands; peptides; etc.).
- An enzymatically active, sequence- specific restriction endonuclease (RRE) that targets the oligonucleotide/viral RNA duplex is added.
- RRE sequence-specific restriction endonuclease
- the enzyme cleaves the oligonucleotide/viral RNA duplex; and ligands are released for detection.
- the enzyme cleaves further duplexes, thereby amplifying the signal. Released ligands are detected using a lateral flow (e.g., test strip) or an immunological based assay (e.g., ELISA).
- a lateral flow e.g., test strip
- an immunological based assay e.g., ELISA
- a suitable sequence-specific endoribonuclease is an enzymatically active
- Endoribonucleases that are suitable for use in a subject detection method include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence- specific manner include enzymatically active polypeptides and that have at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 4 (Csy4 amino acid sequences).
- Endoribonucleases that are suitable for use in a subject detection method include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence- specific manner include enzymatically active polypeptides and that have at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 5 (Csy4 amino acid sequences).
- Figure 5 provides sequences specifically bound by the various endoribonucleases.
- a suitable enzymatically active sequence- specific Csy4 endoribonuclease can comprise an amino acid sequence of a Csy4 amino acid sequence depicted in Figure 5.
- Endoribonucleases that are suitable for use in a subject detection method include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence- specific manner include enzymatically active polypeptides and that differ from an amino acid sequence set forth in any one of Figures 4 or 5 by from 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions and/or insertions and/or deletions.
- 1 to 20 e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions and/or insertions and/or deletions.
- the target polyribonucleotide to be detected can be present in a sample, e.g., a biological sample such as blood, a blood product (e.g., plasma), urine, cerebrospinal fluid, bronchoalveolar lavage fluid, saliva, a tissue, cells, etc.
- a biological sample such as blood, a blood product (e.g., plasma), urine, cerebrospinal fluid, bronchoalveolar lavage fluid, saliva, a tissue, cells, etc.
- the polyribonucleotide can be isolated or purified.
- the target polyribonucleotide can be a messenger RNA (mRNA), a viral RNA, bacterial RNA, parasite RNA, or other RNA species.
- Viral RNAs include, but are not limited to, any member of the Flaviviridae, e.g., hepatitis C virus, Dengue virus, Yellow Fever Virus, West Nile Virus, etc.; any member of Retro viridae; an immunodeficiency virus (e.g., human immunodeficiency virus); etc.
- the target polyribonucleotide to be detected can be present in a cell of a
- multicellular organism or can be obtained from a cell of a multicellular organism.
- the target polyribonucleotide to be detected can be present in or obtained from a cell or organism of any of the six kingdoms, e.g., Bacteria (e.g., Eubacteria);
- Suitable sources of target polyribonucleotides include plant-like members of the kingdom Protista, including, but not limited to, algae (e.g., green algae, red algae, glaucophytes, cyanobacteria); fungus- like members of Protista, e.g., slime molds, water molds, etc.; animal-like members of Protista, e.g., flagellates (e.g., Euglena), amoeboids (e.g., amoeba), sporozoans (e.g, Apicomplexa, Myxozoa, Microsporidia), and ciliates (e.g., Paramecium).
- algae e.g., green algae, red algae, glaucophytes, cyanobacteria
- fungus- like members of Protista e.g., slime molds, water molds, etc.
- animal-like members of Protista e.g., flagellates
- Suitable sources of target polyribonucleotides include members of the kingdom Fungi, including, but not limited to, members of any of the phyla: Basidiomycota (club fungi; e.g., members of Agaricus, Amanita, Boletus, Cantherellus, etc.); Ascomycota (sac fungi, including, e.g., Saccharomyces); Mycophycophyta (lichens); Zygomycota (conjugation fungi); and Deuteromycota.
- Basidiomycota club fungi; e.g., members of Agaricus, Amanita, Boletus, Cantherellus, etc.
- Ascomycota fungi, including, e.g., Saccharomyces
- Mycophycophyta lichens
- Zygomycota conjuggation fungi
- Deuteromycota Deuteromycota.
- Suitable sources of target polyribonucleotides include members of the kingdom Plantae, including, but not limited to, members of any of the following divisions: Bryophyta (e.g., mosses), Anthocerotophyta (e.g., hornworts), Hepaticophyta (e.g., liverworts), Lycophyta (e.g., club mosses), Sphenophyta (e.g., horsetails), Psilophyta (e.g., whisk ferns), Ophioglossophyta, Pterophyta (e.g., ferns), Cycadophyta, Gingkophyta, Pinophyta, Gnetophyta, and Magnoliophyta (e.g., flowering plants).
- Bryophyta e.g., mosses
- Anthocerotophyta e.g., hornworts
- Suitable sources of target polyribonucleotides include members of the kingdom Animalia, including, but not limited to, members of any of the following phyla: Porifera (sponges); Placozoa; Orthonectida (parasites of marine invertebrates); Rhombozoa; Cnidaria (corals, anemones, jellyfish, sea pens, sea pansies, sea wasps); Ctenophora (comb jellies); Platyhelminthes (flatworms); Nemertina (ribbon worms);
- Ngathostomulida jawed worms
- Gastrotricha Rotifera
- Priapulida Yamarhyncha
- Loricifera Acanthocephala
- Entoprocta Nemotoda; Nematomorpha; Cycliophora; Mollusca (mollusks); Sipuncula (peanut worms); Annelida (segmented worms);
- Tardigrada water bears
- Onychophora velvet worms
- Arthropoda including the subphyla: Chelicerata, Myriapoda, Hexapoda, and Crustacea
- Chelicerata include, e.g., arachnids, Merostomata, and Pycnogonida
- Myriapoda include, e.g., Chilopoda (centipedes), Diplopoda (millipedes), Paropoda, and Symphyla
- the Hexapoda include insects
- the Crustacea include shrimp, krill, barnacles, etc.
- Phoronida Ectoprocta (moss animals); Brachiopoda
- Echinodermata e.g.
- Suitable members of Chordata include any member of the following subphyla: Urochordata (sea squirts; including Ascidiacea, Thaliacea, and Larvacea); Cephalochordata (lancelets); Myxini (hagfish); and Vertebrata, where members of Vertebrata include, e.g., members of Petromyzontida (lampreys), Chondrichthyces (cartilaginous fish), Actinopterygii (ray- finned fish), Actinista (coelocanths), Dipnoi (lungfish), Reptilia (reptiles, e.g., snakes, alligators, crocodiles, lizards, etc.), Ave
- a target polyribonucleotide can be present in or obtained from cells from organisms that include, but are not limited to, a protozoan, a plant, a fungus, an algal cell, a yeast, a reptile, an amphibian, a mammal, a marine microorganism, a marine invertebrate, an arthropod, an isopod, an insect, an arachnid, an archaebacterium, and a eubacterium.
- organisms that include, but are not limited to, a protozoan, a plant, a fungus, an algal cell, a yeast, a reptile, an amphibian, a mammal, a marine microorganism, a marine invertebrate, an arthropod, an isopod, an insect, an arachnid, an archaebacterium, and a eubacterium.
- a target polyribonucleotide can be present in or obtained from a non-human embryo, e.g., a Drosophila embryo; a zebrafish embryo; a mouse embryo; etc.
- a target polyribonucleotide can be present in or obtained from a stem cell, e.g., an in vitro stem cell; a non-human stem cell; etc.
- Suitable stem cells include embryonic stem cells, adult stem cells, and induced pluripotent stem (iPS) cells.
- target polyribonucleotide will be isolated from a tissue taken from an organism; from a particular cell or group of cells isolated from an organism; etc.
- the target polyribonucleotide will in some embodiments be isolated from the xylem, the phloem, the cambium layer, leaves, roots, etc.
- the target polyribonucleotide will in some embodiments be isolated from a particular tissue (e.g., lung, liver, heart, kidney, brain, spleen, skin, fetal tissue, etc.), or a particular cell type (e.g., neuronal cells, epithelial cells, endothelial cells, astrocytes, macrophages, glial cells, islet cells, T lymphocytes, B lymphocytes, etc.).
- tissue e.g., lung, liver, heart, kidney, brain, spleen, skin, fetal tissue, etc.
- a particular cell type e.g., neuronal cells, epithelial cells, endothelial cells, astrocytes, macrophages, glial cells, islet cells, T lymphocytes, B lymphocytes, etc.
- the present disclosure provides a method of regulating production of a target
- the method generally involves contacting a genetically modified host cell with an agent that activates an inducible promoter, where the genetically modified host cell is genetically modified with a recombinant expression vector comprising a nucleotide sequence encoding an enzyme that catalyzes cleavage at a sequence-specific cleavage site in a substrate polyribonucleotide, where the enzyme-encoding nucleotide sequence is operably linked to the inducible promoter, and where, upon activation of the inducible promoter, the enzyme is produced in the cell and cleaves said target RNA from a precursor RNA.
- FIG 10 provides a schematic depiction of an exemplary method of regulating production of a target RNA.
- an endogenous target RNA is modified to include a Csy4 RNA substrate (e.g., GUUCACUGCCGUAUAGGCAG (SEQ ID NO: 103); or SEQ ID NO: l) in the 3' untranslated region (3' UTR).
- Cys4 expression in the host cell leads to binding and cleavage of the RNA substrate.
- the cleaved RNA now lacks its polyA tail and will be degraded.
- the present disclosure provides a method of regulating production of a target RNA in a eukaryotic cell, where the method involves contacting a genetically modified host cell with an agent that activates an inducible promoter, where the genetically modified host cell is genetically modified with a recombinant expression vector comprising a nucleotide sequence encoding an enzymatically active sequence- specific Csy4 endoribonuclease that catalyzes cleavage at a sequence- specific cleavage site in a substrate polyribonucleotide, where the enzyme- encoding nucleotide sequence is operably linked to the inducible promoter, and where, upon activation of the inducible promoter, the enzyme is produced in the cell and cleaves said target RNA from a precursor RNA.
- the target RNA species is a regulatory RNA.
- cleavage of said target RNA from a precursor RNA inactivates the
- a suitable sequence-specific endoribonuclease is an enzymatically active
- Endoribonucleases that are suitable for use in a subject method of regulating production of a target RNA include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides and that have at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 4 (Csy4 amino acid sequences).
- Endoribonucleases that are suitable for use in a subject method of regulating production of a target RNA include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence- specific manner include enzymatically active polypeptides and that have at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 5 (Csy4 amino acid sequences).
- Figure 5 provides sequences specifically bound by the various endoribonucleases.
- Endoribonucleases that are suitable for use in a subject method of regulating production of a target RNA include endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence- specific manner include enzymatically active polypeptides and that differ from an amino acid sequence set forth in any one of Figures 4 or 5 by from 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions and/or insertions and/or deletions.
- 1 to 20 e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions and/or insertions and/or deletions.
- a suitable inducible promoter can include a promoter that is functional in a
- suitable inducible promoters include, but are not limited to, a GAL1 promoter, a GAL10 promoter, an ADH2 promoter, a PH05 promoter, a CUP1 promoter, a GAL7 promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HIS 3 promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URA3 promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1.
- Suitable inducible promoters include tetracycline-inducible promoters; a metallothionein promoter; tetracycline-inducible promoters, methionine-inducible promoters; and galactose-inducible promoters, which promoters are all well known in the art.
- Other suitable promoters include the ADH2 alcohol dehydrogenase promoter (repressed in glucose, induced when glucose is exhausted and ethanol is made) and the CUP1 metallothionein promoter (induced in the presence of Cu 2 +, Zn 2 +).
- tetracycline -regulatable promoters can be regulated by tetracycline or doxycycline; carbohydrates can be used to induce a carbohydrate-inducible promoter (e.g., galactose for a galactose-inducible promoter); methionine can be used to induce a methionine- inducible promoter; metals can be used to induce a metallothionein promoter.
- carbohydrates can be used to induce a carbohydrate-inducible promoter (e.g., galactose for a galactose-inducible promoter)
- methionine can be used to induce a methionine- inducible promoter
- metals can be used to induce a metallothionein promoter.
- the target RNA can be a regulatory RNA.
- Regulator RNAs are well known in the art and include, e.g., micro-RNAs, short hairpin RNAs (shRNAs), and the like.
- the genetically modified host cell can be an in vitro cell, e.g., a prokaryotic cell, or a eukaryotic cell (e.g., a mammalian cell, including primary cells, transformed cell lines, and the like).
- the genetically modified host cell can be an in vivo cell.
- the in vivo cell is a non-human cell.
- the genetically modified host cell can be a cell of a multicellular organism (or can be obtained from a cell of a multicellular organism).
- the genetically modified host cell can be a cell obtained from or present in an organism of any of the six kingdoms, e.g., Bacteria (e.g., Eubacteria); Archaebacteria; Protista; Fungi; Plantae; and Animalia.
- Bacteria e.g., Eubacteria
- Archaebacteria e.g., Protista
- Fungi e.g., Plantae
- Animalia e.g., Animalia.
- Suitable organisms include plant-like members of the kingdom Protista, including, but not limited to, algae (e.g., green algae, red algae, glaucophytes, cyanobacteria); fungus-like members of Protista, e.g., slime molds, water molds, etc.; animal-like members of Protista, e.g., flagellates (e.g., Euglena), amoeboids (e.g., amoeba), sporozoans (e.g, Apicomplexa, Myxozoa, Microsporidia), and ciliates (e.g., Paramecium).
- algae e.g., green algae, red algae, glaucophytes, cyanobacteria
- fungus-like members of Protista e.g., slime molds, water molds, etc.
- animal-like members of Protista e.g., flagellates (e.g., Euglen
- Suitable organisms include members of the kingdom Fungi, including, but not limited to, members of any of the phyla: Basidiomycota (club fungi; e.g., members of Agaricus, Amanita, Boletus, Cantherellus, etc.); Ascomycota (sac fungi, including, e.g., Saccharomyces); Mycophycophyta (lichens); Zygomycota
- Suitable organisms include members of the kingdom Plantae, including, but not limited to, members of any of the following divisions: Bryophyta (e.g., mosses), Anthocerotophyta (e.g., hornworts), Hepaticophyta (e.g., liverworts), Lycophyta (e.g., club mosses), Sphenophyta (e.g., horsetails),
- Bryophyta e.g., mosses
- Anthocerotophyta e.g., hornworts
- Hepaticophyta e.g., liverworts
- Lycophyta e.g., club mosses
- Sphenophyta e.g., horsetails
- Psilophyta e.g., whisk ferns
- Ophioglossophyta e.g., ferns
- Pterophyta e.g., ferns
- Cycadophyta Gingkophyta, Pinophyta, Gnetophyta, and Magnoliophyta (e.g., flowering plants).
- Suitable organisms include members of the kingdom Animalia, including, but not limited to, members of any of the following phyla: Porifera (sponges); Placozoa;
- Orthonectida parasites of marine invertebrates); Rhombozoa; Cnidaria (corals, anemones, jellyfish, sea pens, sea pansies, sea wasps); Ctenophora (comb jellies);
- Platyhelminthes flatworms
- Nemertina ribbon worms
- Ngathostomulida jawed worms
- Gastrotricha Rotifera; Priapulida; Kinorhyncha; Loricifera; Acanthocephala; Entoprocta; Nemotoda; Nematomorpha; Cycliophora; Mollusca (mollusks); Sipuncula (peanut worms); Annelida (segmented worms); Tardigrada (water bears); Onychophora (velvet worms); Arthropoda (including the subphyla: Chelicerata, Myriapoda, Hexapoda, and Crustacea, where the Chelicerata include, e.g., arachnids, Merostomata, and
- Myriapoda include, e.g., Chilopoda (centipedes), Diplopoda (millipedes), Paropoda, and Symphyla, where the Hexapoda include insects, and where the Crustacea include shrimp, krill, barnacles, etc.; Phoronida; Ectoprocta (moss animals); Brachiopoda; Echinodermata (e.g. starfish, sea daisies, feather stars, sea urchins, sea cucumbers, brittle stars, brittle baskets, etc.); Chaetognatha (arrow worms); Hemichordata (acorn worms); and Chordata.
- Chilopoda centipedes
- Diplopoda millipedes
- Paropoda Paropoda
- Symphyla where the Hexapoda include insects, and where the Crustacea include shrimp, krill, barnacles, etc.
- Phoronida Ectoproct
- Suitable members of Chordata include any member of the following subphyla: Urochordata (sea squirts; including Ascidiacea, Thaliacea, and Larvacea); Cephalochordata (lancelets); Myxini (hagfish); and
- Vertebrata where members of Vertebrata include, e.g., members of Petromyzontida (lampreys), Chondrichthyces (cartilaginous fish), Actinopterygii (ray-finned fish), Actinista (coelocanths), Dipnoi (lungfish), Reptilia (reptiles, e.g., snakes, alligators, crocodiles, lizards, etc.), Aves (birds); and Mammalian (mammals). Suitable plants include any monocotyledon and any dicotyledon.
- a genetically modified host cell can be a cell obtained from or present in a protozoan, a plant, a fungus, an algal cell, a yeast, a reptile, an amphibian, a mammal, a marine microorganism, a marine invertebrate, an arthropod, an isopod, an insect, an arachnid, an archaebacterium, and a eubacterium.
- Suitable mammalian cells include primary cells and immortalized cell lines.
- Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like.
- Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No.
- HeLa cells e.g., American Type Culture Collection (ATCC) No. CCL-2
- CHO cells e.g.,
- CCLI.3 human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
- the genetically modified host cell can be a cell obtained from or present in a non-human embryo, e.g., a Drosophila embryo; a zebrafish embryo; a mouse embryo; etc.
- the genetically modified host cell can be a stem cell, e.g., an in vitro stem cell; a non-human stem cell; etc. Suitable stem cells include embryonic stem cells, adult stem cells, and induced pluripotent stem (iPS) cells.
- the present disclosure provides methods of isolating a target nucleic acid from a mixed population of nucleic acids.
- the methods generally involve: a) contacting a mixed population of nucleic acids with an immobilized sequence-specific, enzymatically inactive endoribonuclease, wherein the mixed population of nucleic acids includes a target nucleic acid comprising a "tag" (or "recognition") nucleotide sequence that is specifically bound by the immobilized sequence- specific, enzymatically inactive endoribonuclease, such that the target nucleic acid comprising the tag nucleotide sequence ("tagged target nucleic acid”) binds to the immobilized sequence-specific, enzymatically inactive endoribonuclease, forming a tagged target nucleic
- a liquid solution a "binding solution”
- imidazole to the liquid solution to a final concentration of from about 100 mM to about 500 mM (e.g., from about 100 mM to about 150 mM, from about 150 mM to about 200 mM, from about 200 mM to about 250 mM, from about 250 mM to about 300 mM, from about 300 mM to about 350 mM, from about 350 mM to about 400 mM, from about 400 mM to about 450 mM, or from about 450 mM to about 500 mM), thereby forming a reactivation solution that enzymatically reactivates the enzymatically inactive endoribonuclease such that the endoribonuclease becomes enzymatically active and cleaves the target nucleic acid from a liquid solution (a "binding solution”); and b) adding imidazole to the liquid solution to a final concentration of from about 100 m
- the method can further include one or more washing steps. For example, after step (a) and before step (b), the immobilized sequence-specific, enzymatically inactive endoribonuclease that comprises a bound target nucleic acid comprising a "tag" nucleotide sequence can be washed one or more times with the binding solution, such that the target nucleic acid remains bound to the sequence-specific, enzymatically inactive endoribonuclease, and any unbound nucleic acids are washed away.
- the mixed population of nucleic acids can include RNA and DNA.
- the target nucleic acid is an RNA that comprises a "tag" or "recognition” nucleotide sequence that is specifically bound by the sequence-specific endoribonuclease.
- the endoribonuclease In its enzymatically inactive state (“uninduced” state), the endoribonuclease can bind, but cannot cleave, the tagged target RNA.
- the endoribonuclease In its enzymatically active state (“induced” state) (e.g., in the presence of imidazole in a concentration of from about 100 mM to about 500 mM), the endoribonuclease can both bind and cleave the recognition nucleotide sequence in the tagged target nucleic acid, thereby releasing the target nucleic acid from the tag.
- the binding solution can include a buffer and a salt; and lacks imidazole.
- the reactivation solution can include imidazole in a final concentration of from about 100 mM to about 500 mM, e.g., from about 100 mM to about 150 mM, from about 150 mM to about 200 mM, from about 250 mM to about 350 mM, from about 350 mM to about 400 mM, or from about 400 mM to about 500 mM.
- the presence of imidazole reactivates the sequence-specific, enzymatically inactive endoribonuclease such that the endoribonuclease becomes enzymatically active, e.g., the endoribonuclease exhibits at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more than 95%, of wild-type sequence- specific endoribonuclease (e.g., an amino acid sequence as depicted in Figure 5 (e.g., SEQ ID NO:6, 8, or 9)).
- wild-type sequence-specific endoribonuclease e.g., an amino acid sequence as depicted in Figure 5 (e.g., SEQ ID NO:6, 8, or 9).
- the sequence-specific, enzymatically inactive endoribonuclease is an H29A mutant of Csy4 (as described below; and as depicted in Figure 6); contacting the Csy4(H29A) mutant with imidazole, as described above, reactivates the endoribonuclease such that it is capable of cleaving, in a sequence- specific manner, a recognition sequence in a target ribonucleic acid.
- an H29A, S50C double mutant of Csy4 (as described below).
- the "tag" or recognition sequence comprises the nucleotide sequence 5'- GUUCACUGCCGUAUAGGCAGCUAAGAAA-3 ' (SEQ ID NO: l).
- the "tag” or "recognition" nucleotide sequence can be introduced into a nucleic acid using standard recombinant methods.
- the tagged target nucleic acid will include a tag that is enzymatically cleaved, thereby releasing the target nucleic acid.
- the tagged target nucleic acid will have one or more polypeptides bound thereto.
- a tagged target RNA that has one or more
- RNA protein complex polypeptides bound thereto is referred to herein as a RNA protein complex.
- target RNA that is isolated using a subject method is an RNA protein complex.
- a subject method can further comprise analyzing the polypeptide(s) bound to the isolated target RNA.
- a subject method provides for isolation of a target RNA (or RNA protein
- a subject method provides for purification of a target RNA (or RNA protein complex) such that the target RNA (or RNA protein complex) is at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 80% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or greater than 98% pure.
- a protein bound to a target RNA in a target RNA/protein complex can be eluted from the RNA/protein complex.
- the eluted protein can be further characterized, e.g., by sequencing, enzymatic digestion, a functional assay, etc.
- the mixed population of nucleic acids can be present in a cell lysate.
- an expression vector comprising a nucleotide sequence encoding a tagged target RNA is introduced into a cell (e.g., in vitro or in vivo), such that the cell synthesizes the tagged target RNA.
- a lysate is made from the cell and the lysate (optionally subjected to one or more steps to enrich for nucleic acids) is applied to the immobilized sequence-specific enzymatically-inactive endoribonuclease.
- sequence-specific enzymatically-inactive endoribonuclease can be any sequence-specific enzymatically-inactive endoribonuclease.
- Suitable insoluble supports include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
- the insoluble support can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
- the present disclosure also provides a method of isolating a polypeptide that binds a target RNA, where the method comprises: a) contacting an immobilized complex with a liquid solution comprising a polypeptide that binds the target RNA, where the immobilized complex comprises the variant Csy4 endoribonuclease and a tagged target RNA comprising a recognition nucleotide sequence that is specifically bound by the variant Csy4 endoribonuclease, where said contacting results in binding of the polypeptide to the target RNA, where said contacting is carried out in a binding solution lacking imidazole; and b) eluting the bound polypeptide.
- the present disclosure provides a sequence-specific endoribonuclease.
- the present disclosure provides a sequence-specific endoribonuclease that binds to a recognition sequence in a target polyribonucleotide, but that does not cleave the target polyribonucleotide, i.e., the sequence-specific endoribonuclease is
- the present disclosure provides a sequence-specific endoribonuclease that binds to a recognition sequence in a target polyribonucleotide, and cleaves the target polyribonucleotide within or near the recognition sequence, i.e., the sequence-specific endoribonuclease is enzymatically active in hydrolyzing the target polyribonucleotide.
- a subject sequence-specific endoribonuclease is
- Suitable insoluble substrates include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
- the insoluble substrate can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
- the present disclosure provides an enzymatically inactive, sequence-specific endoribonuclease, wherein the enzymatically inactive sequence-specific
- endoribonuclease binds to a target sequence in a polyribonucleotide in a sequence- specific manner.
- a subject enzymatically inactive, sequence-specific endoribonuclease binds a target polyribonucleotide in a sequence- specific manner, but does not cleave the target polyribonucleotide.
- a subject enzymatically inactive, sequence- specific endoribonuclease is useful for isolating a target RNA from a mixed population of nucleic acids, as described above.
- a subject enzymatically inactive, sequence-specific
- endoribonuclease comprises one or more amino acid substitutions compared to a naturally-occurring, enzymatically active, Csy4, CasE, or Cas6 polypeptide.
- a subject enzymatically inactive, sequence-specific
- endoribonuclease comprises an amino acid substitution at His-29 of a Csy4 polypeptide, or at an equivalent position in a CasE or a Cas6 polypeptide.
- a subject enzymatically inactive, sequence-specific endoribonuclease comprises an amino acid substitution at Ser-148 of a Csy4 polypeptide, or at an equivalent position in a CasE or a Cas6 polypeptide.
- Figure 6 depicts non-limiting examples of suitable enzymatically inactive
- sequence-specific endoribonuclease amino acid sequences comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity with an amino acid sequence depicted in Figure 6, where the amino acid sequence includes a substitution at His-29, Ser-50, or both His-29 and Ser- 50.
- the variant Csy4 endoribonuclease can include a H29A (His-29 to Ala- 29) substitution, a S50C (Ser-50 to Cys-50) substitution, or both a H29A and a S50C substitution.
- H29A His-29 to Ala- 29
- S50C Ser-50 to Cys-50
- a subject enzymatically inactive, sequence-specific
- endoribonuclease is a variant Csy4 endoribonuclease.
- a subject variant Csy4 endoribonuclease comprises an amino acid sequence having at least about 95% amino acid sequence identity to the amino acid sequence set forth in Figure 6, where the endoribonuclease comprises an amino acid substitution at His-29, where the variant Csy4 endoribonuclease is enzymatically inactive in the absence of imidazole, and where the variant Csy4 endoribonuclease is activatable in the presence of imidazole.
- the amino acid substitution is a His29 to Ala29 substitution.
- variant Csy4 endoribonuclease also includes a Ser-50 substitution.
- a subject variant Csy4 endoribonuclease binds an RNA substrate that comprises the nucleotide sequence 5'-GUUCACUGCCGUAUAGGCAGCUAAGAAA-3' (SEQ ID NO: l).
- a subject enzymatically inactive, sequence-specific endoribonuclease is
- conditionally enzymatically inactive, e.g., a subject enzymatically inactive, sequence- specific endoribonuclease (e.g., a subject variant Csy4 endoribonuclease) is
- the enzymatically inactive, sequence-specific endoribonuclease e.g., subject variant Csy4 endoribonuclease
- the enzymatically inactive, sequence-specific endoribonuclease can be enzymatically activated by contacting the endoribonuclease with imidazole at a concentration of from about 100 mM to about 500 mM.
- imidazole e.g., in a concentration range of from about 100 mM to about 500 mM reactivates the sequence-specific, enzymatically inactive
- endoribonuclease such that the endoribonuclease becomes enzymatically active, e.g., the endoribonuclease exhibits at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more than 95%, of wild-type sequence-specific endoribonuclease (e.g., an amino acid sequence as depicted in Figure 5 (e.g., SEQ ID NO:6, 8, or 9)).
- wild-type sequence-specific endoribonuclease e.g., an amino acid sequence as depicted in Figure 5 (e.g., SEQ ID NO:6, 8, or 9).
- a subject enzymatically inactive, sequence-specific
- endoribonuclease (e.g., a subject variant Csy4 endoribonuclease) comprises a detectable label, including a moiety that provides a detectable signal.
- Suitable detectable labels and/or moieties that provide a detectable signal include, but are not limited to, an enzyme, a radioisotope, a member of a FRET pair, a member of a specific binding pair; a fluorophore; a fluorescent protein; a quantum dot; and the like.
- FRET pairs (donor/acceptor) suitable for use include, but are not limited to,
- EDANS/fluorescein IAEDANS/fluorescein, fluorescein/tetramethylrhodamine, fluorescein/Cy 5, IEDANS/DABCYL, fluorescein/QSY-7, fluorescein/LC Red 640, fluorescein/Cy 5.5 and fluorescein/LC Red 705.
- a fluorophore/quantum dot donor/acceptor pair can be used.
- Suitable fluorophores include any molecule that may be detected via its inherent fluorescent properties, which include fluorescence detectable upon excitation.
- Suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade BlueTM, Texas Red,
- Suitable optical dyes are described in the 2002 Molecular Probes Handbook, 9th Ed., by Richard P. Haugland, hereby expressly incorporated by reference.
- Suitable enzymes include, but are not limited to, horse radish peroxidase,
- luciferase luciferase, ⁇ -galactosidase, and the like.
- Suitable fluorescent proteins include, but are not limited to, a green fluorescent protein (GFP), e.g., a GFP from Aequoria victoria or a mutant or derivative thereof e.g., as described in U.S. Patent No. 6,066,476; 6,020,192; 5,985,577; 5,976,796; 5,968,750; 5,968,738; 5,958,713; 5,919,445; 5,874,304; a red fluorescent protein; a yellow fluorescent protein; any of a variety of fluorescent and colored proteins from Anthozoan species, as described in, e.g., Matz et al. (1999) Nature Biotechnol. 17:969-973; and the like.
- GFP green fluorescent protein
- Suitable nanoparticles include, e.g., quantum dots (QDs), fluorescent or
- luminescent nanoparticles and magnetic nanoparticles. Any optical or magnetic property or characteristic of the nanoparticle(s) can be detected.
- QDs can be rendered water soluble by applying coating layers comprising a variety of different materials (see, e.g., U.S. Pat. Nos. 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; and 6,649,138).
- QDs can be solubilized using amphiphilic polymers.
- Exemplary polymers that have been employed include octylamine-modified low molecular weight polyacrylic acid, polyethylene-glycol (PEG)-derivatized phospholipids, polyanhydrides, block copolymers, etc.
- QDs can be conjugated to a polypeptide via any of a number of different functional groups or linking agents that can be directly or indirectly linked to a coating layer (see, e.g., U.S. Pat. Nos. 5,990,479; 6,207,392; 6,251,303; 6,306,610; 6,325,144; and 6,423,551).
- QDs with a wide variety of absorption and emission spectra are commercially available, e.g., from Quantum Dot Corp. (Hayward Calif.; now owned by Invitrogen) or from Evident Technologies (Troy, N.Y.).
- QDs having peak emission wavelengths of approximately 525, 535, 545, 565, 585, 605, 655, 705, and 800 nm are available.
- the QDs can have a range of different colors across the visible portion of the spectrum and in some cases even beyond.
- Suitable radioisotopes include, but are not limited to 14 C, 3 H, 32 P, 33 P, 35 S, 125 1, and 1 1 3 J 1 1 I.
- the use of radioisotopes as labels is well known in the art.
- a subject enzymatically inactive, sequence-specific
- endoribonuclease e.g., a subject variant Csy4 endoribonuclease
- Suitable insoluble substrates include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
- the insoluble substrate can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc.
- substances glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite
- agarose beads e.g., polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and
- a subject enzymatically inactive, sequence-specific
- endoribonuclease e.g., a subject variant Csy4 endoribonuclease
- is purified e.g., is at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, at least 98% pure, at least 99% pure, or greater than 99% pure.
- compositions comprising a subject sequence- specific, enzymatically inactive, endoribonuclease.
- a subject composition can comprise, in addition to a subject sequence-specific, enzymatically inactive, endoribonuclease, one or more of: a salt, e.g., NaCl, MgCl, KC1, MgS0 4 , etc.; a buffering agent, e.g., a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N- Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N- tris[Hydroxymethyl]methyl-3-aminopropanesulfonic acid (TA)
- a subject enzymatically active sequence-specific
- endoribonuclease comprises a moiety that provides for detection.
- a subject enzymatically active sequence- specific endoribonuclease can comprise a covalently or non-covalently linked moiety that provides for detection.
- Suitable detectable labels include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
- Moieties that provide for detection include, but are not limited to, a fluorescent molecule; a quantum dot; an enzyme (other than the endoribonuclease), where the enzyme catalyzes conversion of a substrate to a detectable product, where the product is directly detectable; a nanoparticle; and the like.
- Suitable fluorescent proteins that can be linked to a subject enzymatically active sequence-specific endoribonuclease include, but are not limited to, a green fluorescent protein (GFP), e.g., a GFP from Aequoria victoria or a mutant or derivative thereof e.g., as described in U.S. Patent No. 6,066,476; 6,020,192; 5,985,577; 5,976,796; 5,968,750; 5,968,738; 5,958,713; 5,919,445; 5,874,304; a red fluorescent protein; a yellow fluorescent protein; any of a variety of fluorescent and colored proteins from Anthozoan species, as described in, e.g., Matz et al. (1999) Nature Biotechnol. 17:969-973; and the like.
- GFP green fluorescent protein
- Suitable nanoparticles include, e.g., quantum dots (QDs), fluorescent or
- luminescent nanoparticles and magnetic nanoparticles. Any optical or magnetic property or characteristic of the nanoparticle(s) can be detected.
- QDs can be rendered water soluble by applying coating layers comprising a variety of different materials (see, e.g., U.S. Pat. Nos. 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; and 6,649,138).
- QDs can be solubilized using amphiphilic polymers.
- Exemplary polymers that have been employed include octylamine-modified low molecular weight polyacrylic acid, polyethylene-glycol (PEG)-derivatized phospholipids, polyanhydrides, block copolymers, etc.
- QDs can be conjugated to a polypeptide via any of a number of different functional groups or linking agents that can be directly or indirectly linked to a coating layer (see, e.g., U.S. Pat. Nos. 5,990,479; 6,207,392; 6,251,303; 6,306,610; 6,325,144; and 6,423,551).
- QDs with a wide variety of absorption and emission spectra are commercially available, e.g., from Quantum Dot Corp. (Hayward Calif.; now owned by Invitrogen) or from Evident Technologies (Troy, N.Y.).
- QDs having peak emission wavelengths of approximately 525, 535, 545, 565, 585, 605, 655, 705, and 800 nm are available.
- the QDs can have a range of different colors across the visible portion of the spectrum and in some cases even beyond.
- a subject enzymatically active, sequence-specific
- endoribonuclease is purified, e.g., is at least 80% pure, at least 85% pure, at least 90% pure, at least 95% pure, at least 98% pure, at least 99% pure, or greater than 99% pure.
- compositions comprising a subject sequence- specific, enzymatically active endoribonuclease.
- a subject composition can comprise, in addition to a subject sequence- specific enzymatically active, endoribonuclease, one or more of: a salt, e.g., NaCl, MgCl, KC1, MgS0 4 , etc.; a buffering agent, e.g., a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N- Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N- tris[Hydroxymethyl]methyl-3-aminopropanesulfonic acid (TAPS), etc.
- a salt
- compositions comprising a subject sequence-specific, enzymatically inactive endoribonuclease (e.g., a subject variant Csy4 endoribonuclease).
- a subject composition can comprise, in addition to a subject sequence-specific enzymatically inactive endoribonuclease (e.g., a subject variant Csy4 endoribonuclease), one or more of: a salt, e.g., NaCl, MgCl, KC1, MgS0 4 , etc.; a buffering agent, e.g., a Tris buffer, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N-Morpholino)ethanesulfonic acid (MES), 2-(N- Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morphol
- a subject sequence-specific endoribonuclease (e.g., a subject sequence- specific enzymatically active, endoribonuclease; a subject sequence- specific enzymatically inactive, endoribonuclease) can be produced by any known method, e.g., conventional synthetic methods for protein synthesis; recombinant DNA methods; etc.
- a subject sequence-specific endoribonuclease is chemically synthesized
- the synthesis may proceed via liquid-phase or solid-phase.
- Solid phase polypeptide synthesis SPPS
- Fmoc and Boc Various forms of SPPS, such as Fmoc and Boc, are available for synthesizing a subject sequence-specific endoribonuclease.
- Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis; pp.
- Standard recombinant methods can be used for production of a subject sequence-specific endoribonuclease.
- nucleic acids encoding a subject sequence- specific endoribonuclease are inserted into expression vectors.
- the DNA segments encoding a subject sequence- specific endoribonuclease are operably linked to control sequences in the expression vector(s) that ensure the expression of the encoded polypeptides.
- Expression control sequences include, but are not limited to, promoters (e.g., naturally- associated or heterologous promoters), signal sequences, enhancer elements, and transcription termination sequences.
- the expression control sequences can be eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells (e.g., COS or CHO cells). Once the vector has been incorporated into the appropriate host, the host is maintained under conditions suitable for high level expression of the nucleotide sequences, and the collection and purification of the endoribonuclease.
- eukaryotic host cells e.g., COS or CHO cells
- the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a subject sequence-specific endoribonuclease (e.g., a subject sequence- specific, enzymatically active endoribonuclease; a subject sequence-specific, enzymatically inactive endoribonuclease).
- a subject sequence-specific endoribonuclease e.g., a subject sequence- specific, enzymatically active endoribonuclease; a subject sequence-specific, enzymatically inactive endoribonuclease.
- the nucleic acid is an expression vector, where the expression vector can provide for production of the sequence-specific endoribonuclease, e.g., in a cell.
- a subject sequence-specific, enzymatically active endoribonuclease e.g., a subject sequence-specific, enzymatically active endoribonuclease; a subject sequence-specific, enzymatically inactive endoribonuclease
- a regulatory element such as a promoter and enhancer, that allow expression of the nucleotide sequence in the intended target cells (e.g., a cell that is genetically modified to synthesize the encoded endoribonuclease).
- a subject nucleic acid comprises a nucleotide sequence encoding a polypeptide having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, with an amino acid sequence set forth in Figure 4 or Figure 5.
- a subject nucleic acid comprises a nucleotide sequence encoding a variant Csy4 polypeptide, as described above.
- a transcription control element e.g., a promoter, an enhancer, etc.
- suitable promoter and enhancer elements are known in the art.
- suitable promoters include, but are not limited to, lacl, lacZ, T3, T7, gpt, lambda P and trc.
- suitable promoters include, but are not limited to, cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters.
- a suitable promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promoter, an ENO promoter, a PYK1 promoter and the like; or a regulatable promoter such as a GAL1 promoter, a GAL 10 promoter, an ADH2 promoter, a PH05 promoter, a CUP1 promoter, a GAL7 promoter, a MET25 promoter, a MET3 promoter, a CYC1 promoter, a HIS 3 promoter, an ADH1 promoter, a PGK promoter, a GAPDH promoter, an ADC1 promoter, a TRP1 promoter, a URA3 promoter, a LEU2 promoter, an ENO promoter, a TP1 promoter, and AOX1 (e.g., for use in Pichia). Selection of the appropriate vector and promoter is a constitutive promoter such as an ADH1 promoter, a PGK1 promote
- Suitable promoters for use in prokaryotic host cells include, but are not limited to, a bacteriophage T7 RNA polymerase promoter; a trp promoter; a lac operon promoter; a hybrid promoter, e.g., a lac/tac hybrid promoter, a tac/trc hybrid promoter, a trp/lac promoter, a T7/lac promoter; a trc promoter; a tac promoter, and the like; an araBAD promoter; in vivo regulated promoters, such as an ssaG promoter or a related promoter ⁇ see, e.g., U.S. Patent Publication No.
- sigma70 promoter e.g., a consensus sigma70 promoter (see, e.g., GenBank Accession Nos.
- a stationary phase promoter e.g., a dps promoter, an spv promoter, and the like; a promoter derived from the pathogenicity island SPI-2 ⁇ see, e.g., W096/17951); an actA promoter ⁇ see, e.g., Shetron-Rama et al. (2002) Infect. Immun. 70: 1087-1096); an rpsM promoter ⁇ see, e.g., Valdivia and Falkow (1996). Mol. Microbiol. 22:367); a tet promoter ⁇ see, e.g.,
- Suitable strong promoters for use in prokaryotes include, but are not limited to Trc, Tac, T5, T7, and PLambda.
- Non-limiting examples of operators for use in bacterial host cells include a lactose promoter operator (Lacl repressor protein changes conformation when contacted with lactose, thereby preventing the Lacl repressor protein from binding to the operator), a tryptophan promoter operator (when complexed with tryptophan, TrpR repressor protein has a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein has a conformation that does not bind to the operator), and a tac promoter operator (see, for example, deBoer et al. (1983) Proc. Natl. Acad. Sci. U.S.A. 80:21-25).
- a lactose promoter operator Lacl repressor protein changes conformation when contacted with lactose, thereby preventing the Lacl repressor protein from binding to the operator
- TrpR repressor protein when complexed with tryptophan, TrpR
- An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and/or maintenance of the vector.
- vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct.
- the following vectors are provided by way of example.
- Bacterial pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden).
- Eukaryotic pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG and pSVL (Pharmacia).
- Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins.
- a selectable marker operative in the expression host may be present.
- Suitable expression vectors include, but are not limited to, viral vectors (e.g.
- viral vectors based on vaccinia virus; poliovirus; adenovirus see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5: 1088 1097, 1999; WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655); adeno-associated virus (see, e.g., Ali et al., Hum Gene Ther 9:81 86, 1998, Flannery et al., PNAS 94:6916 6921, 1997; Bennett et al., Invest Opthalmol Vis Sci 38:2857 2863, 1997; Jomary et al., Gene Ther
- SV40 herpes simplex virus
- human immunodeficiency virus see, e.g., Miyoshi et al., PNAS 94: 10319 23, 1997; Takahashi et al., J Virol 73:7812 7816, 1999
- a retroviral vector e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human
- immunodeficiency virus myeloproliferative sarcoma virus, and mammary tumor virus
- the present disclosure provides isolated genetically modified host cells (e.g., in vitro cells) that are genetically modified with a subject nucleic acid.
- isolated genetically modified host cells e.g., in vitro cells
- a subject nucleic acid e.g., in vitro cells
- a subject isolated genetically modified host cell can produce a subject sequence-specific endoribonuclease (e.g., a subject sequence-specific, enzymatically active endoribonuclease; a subject sequence-specific, enzymatically inactive
- a subject sequence-specific endoribonuclease e.g., a subject sequence-specific, enzymatically active endoribonuclease; a subject sequence-specific, enzymatically inactive
- Suitable host cells include eukaryotic host cells, such as a mammalian cell, an insect host cell, a yeast cell; and prokaryotic cells, such as a bacterial cell.
- eukaryotic host cells such as a mammalian cell, an insect host cell, a yeast cell
- prokaryotic cells such as a bacterial cell.
- Introduction of a subject nucleic acid into the host cell can be effected, for example by calcium phosphate precipitation, DEAE dextran mediated transfection, liposome-mediated transfection, electroporation, or other known method.
- Suitable mammalian cells include primary cells and immortalized cell lines.
- Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like.
- Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No.
- HeLa cells e.g., American Type Culture Collection (ATCC) No. CCL-2
- CHO cells e.g.,
- CCLI.3 human embryonic kidney (HEK) cells (ATCC No. CRL1573), HLHepG2 cells, and the like.
- Suitable yeast cells include, but are not limited to, Pichia pastoris, Pichia
- Pichia trehalophila Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae,
- Trichoderma reesei Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum, Neurospora crassa, Chlamydomonas reinhardtii, and the like.
- Suitable prokaryotic cells include, but are not limited to, any of a variety of laboratory strains of Escherichia coli, Lactobacillus sp., Salmonella sp., Shigella sp., and the like. See, e.g., Carrier et al. (1992) J. Immunol. 148: 1176-1181; U.S. Patent No. 6,447,784; and Sizemore et al. (1995) Science 270:299-302.
- Salmonella strains which can be employed in the present invention include, but are not limited to, Salmonella typhi and S. typhimurium.
- Suitable Shigella strains include, but are not limited to, Shigella flexneri, Shigella sonnei, and Shigella disenteriae.
- the laboratory strain is one that is non-pathogenic.
- suitable bacteria include, but are not limited to, Bacillus subtilis, Pseudomonas pudita,
- Rhodobacter capsulatus Rhodospirillum rubrum, Rhodococcus sp., and the like.
- the host cell is Escherichia coli.
- the present disclosure also provides kits for determining the nucleotide sequence of a target polyribonucleotide.
- the present disclosure provides kits for carrying out sequence-specific cleavage of a substrate polyribonucleotide.
- the present disclosure provides kits for carrying out detection of an RNA sequence in a target
- kits for carrying out isolation of a target RNA The present disclosure provides kits for carrying out isolation of a polypeptide that binds a target RNA.
- a subject kit for carrying out direct sequencing of a polyribonucleotide includes at least a subject sequence- specific, enzymatically inactive endoribonuclease, where the sequence-specific, enzymatically inactive endoribonuclease is purified.
- the enzymatically inactive, sequence- specific endoribonuclease is linked to an acceptor molecule or a donor molecule, for FRET detection.
- a subject kit for carrying out direct sequencing of a polyribonucleotide includes at least a subject sequence- specific, enzymatically inactive endoribonuclease; and can include one or more additional components, where the one or more additional components can be: 1) a buffer; 2) a probe oligonucleotide comprising a defined sequence; 3) a probe oligonucleotide comprising a defined sequence, where the probe oligonucleotide is linked to an acceptor molecule or a donor molecule, for FRET detection; 4) an insoluble support, for linking to a target polyribonucleotide; 5) a positive control polyribonucleotide, where the positive control polyribonucleotide comprises a known nucleotide sequence; 6) a positive control probe oligonucleotide that binds to and forms a duplex with the known sequence of the positive control polyribonucleotide.
- a subject kit can further include instructions for using the components of the kit to practice the subject methods.
- the instructions for practicing the subject methods are generally recorded on a suitable recording medium.
- the instructions may be printed on a substrate, such as paper or plastic, etc.
- the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc.
- the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc.
- the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided.
- An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
- polyribonucleotide includes at least a purified sequence- specific endoribonuclease and/or a nucleic acid comprising a nucleotide sequence encoding the sequence- specific endoribonuclease.
- a subject kit for carrying out sequence- specific cleavage of a substrate polyribonucleotide can include, in addition to a purified sequence- specific endoribonuclease (and/or a nucleic acid comprising a nucleotide sequence encoding the sequence-specific endoribonuclease), one or more additional components.
- Suitable additional components include, e.g., a buffer; a polyribonucleotide substrate that serves as a positive control; polyribonucleotide size standards; a negative control substrate; and the like.
- the components can each be in separate containers.
- the kit can further include one or more positive and negative controls.
- a subject kit can further include instructions for using the components of the kit to practice the subject methods.
- the instructions for practicing the subject methods are generally recorded on a suitable recording medium.
- the instructions may be printed on a substrate, such as paper or plastic, etc.
- the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc.
- the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc.
- the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided.
- An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
- polyribonucleotide (e.g., for carrying out detection of a polyribonucleotide) can include an oligonucleotide probe comprising a known sequence.
- the kit will include an oligonucleotide probe comprising a known sequence and comprising a detectable moiety, e.g., a polypeptide that can be detected using an immunological assay; a fluorescent protein; a luciferin; etc.
- the kit can further include a positive control polyribonucleotide that comprises a nucleotide sequence capable of forming a duplex with the oligonucleotide probe.
- the kit can further include an enzymatically active, sequence-specific endoribonuclease that specifically detects and cleaves a duplex formed by the oligonucleotide probe and a target polyribonucleotide.
- the kit can further include one or more of a buffer; components for detecting the detectable moiety; a test strip; and the like.
- the kit can further include one or more positive and negative controls.
- a subject kit can further include instructions for using the components of the kit to practice the subject methods.
- the instructions for practicing the subject methods are generally recorded on a suitable recording medium.
- the instructions may be printed on a substrate, such as paper or plastic, etc.
- the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc.
- the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc.
- the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided.
- An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
- a subject kit for carrying out isolation (e.g., purification) of a target RNA can include one or more of: 1) a subject sequence-specific, enzymatically inactive endoribonuclease; 2) an expression construct comprising a "tag" nucleotide sequence, i.e., a nucleotide sequence that is specifically bound by the sequence-specific, enzymatically inactive endoribonuclease, where a nucleotide sequence encoding a target RNA of choice can be inserted 3' of the "tag" nucleotide sequence; and 3) imidazole.
- the sequence- specific, enzymatically inactive endoribonuclease can be immobilized on an insoluble support.
- the kit can further include a liquid composition for contacting a mixed population of nucleic acids with the immobilized sequence-specific,
- the kit can further include a wash buffer.
- the kit can further include one or more positive and negative controls.
- a positive control could include an expression vector comprising a nucleotide sequence encoding a tagged target RNA, where the tag is specifically bound by the sequence-specific, enzymatically inactive endoribonuclease.
- the components can each be in separate containers.
- a subject kit can include a subject sequence-specific, enzymatically inactive endoribonuclease.
- a subject kit can further include a recombinant expression vector comprising, in order from 5' to 3' and in operable linkage: a) a nucleotide sequence encoding an RNA substrate that is specifically bound by a subject variant Csy4 endoribonuclease; and b) a multiple cloning site suitable for insertion of a nucleic acid encoding the target RNA.
- the nucleotide sequence encoding the RNA substrate can be operably linked to a promoter. In some instances, the promoter is an inducible promoter.
- the RNA substrate can comprise the nucleotide sequence 5'-
- the recombinant expression vector comprises, inserted into the multiple cloning site, a nucleotide sequence encoding the target RNA.
- the kit can further include a buffer that lacks imidazole.
- the kit can further include imidazole or an imidazole solution.
- the kit can further include one or more wash buffers.
- the kit will include a positive control expression vector.
- the variant Csy4 endoribonuclease can be
- insoluble supports include, but are not limited to agarose beads, magnetic beads, a test strip, a multi-well dish, and the like.
- the insoluble support can comprise a variety of substances (glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amylose, natural and modified celluloses, polyacrylamides, agaroses, and magnetite) and can be provided in a variety of forms, including, e.g., agarose beads, polystyrene beads, latex beads, magnetic beads, colloid metal particles, glass and/or silicon chips and surfaces, nitrocellulose strips, nylon membranes, sheets, wells of reaction trays (e.g., multi-well plates), plastic tubes, etc..
- a subject kit can further include instructions for using the components of the kit to practice the subject methods.
- the instructions for practicing the subject methods are generally recorded on a suitable recording medium.
- the instructions may be printed on a substrate, such as paper or plastic, etc.
- the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc.
- the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc.
- the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g.
- An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
- the present disclosure provides a method of directly determining the nucleotide sequence of a target polyribonucleotide.
- the method does not require synthesis of a polydeoxyribonucleotide counterpart of a target polyribonucleotide in order to determine the nucleotide sequence of the target polyribonucleotide.
- Viral diagnostics, personalized medicine, single-cell transcript analysis, and translational profiling are all fields in which direct RNA detection and sequencing find use.
- a subject polyribonucleotide sequencing method generally involves: a)
- oligonucleotide probe comprising a specific known sequence and an enzymatically inactive sequence- specific
- oligonucleotide probe and the target polyribonucleotide wherein the enzymatically inactive sequence- specific endoribonuclease binds the specific sequence in the duplex; and b) detecting specific binding between the oligonucleotide probe and the target polyribonucleotide, where specific binding of the enzymatically inactive sequence- specific endoribonuclease to the duplex indicates the presence of the specific sequence in the target polyribonucleotide.
- the enzymatically inactive sequence-specific endoribonuclease is linked (covalently or non-covalently) to an emissive label.
- emissive label is meant any molecule that may be detected via its inherent emission properties, which include emission detectable upon excitation.
- Suitable emissive labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl- coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade BlueTM, Texas Red, IAEDANS, EDANS, BODIPY FL, LC Red 640, Cy 5, Cy 5.5, LC Red 705 and Oregon green. Suitable optical dyes are described in the 2002 Molecular Probes Handbook, 9th Ed., by Richard P. Haugland.
- the oligonucleotide probe used in a subject polyribonucleotide sequencing method is linked to a donor molecule, the enzymatically inactive sequence- specific endoribonuclease is linked to an acceptor molecule, and detection of duplex formation is by fluorescence resonance energy transfer (also referred to as "Forster resonance energy transfer” or "FRET").
- FRET Forster resonance energy transfer
- a FRET pair consists of a donor chromophore and an acceptor chromophore (where the acceptor chromophore may be a quencher molecule).
- the emission spectrum of the donor and the absorption spectrum of the acceptor must overlap, and the two molecules must be in close proximity.
- the distance between donor and acceptor at which 50% of donors are deactivated (transfer energy to the acceptor) is defined by the Forster radius, which is typically 10-100 angstroms. Changes in the emission spectrum comprising FRET pairs can be detected, indicating changes in the number of that are in close proximity (i.e., within 100 angstroms of each other). This will typically result from the binding or dissociation of two molecules, one of which is labeled with a FRET donor and the other of which is labeled with a FRET acceptor, wherein such binding brings the FRET pair in close proximity.
- (donor/acceptor) suitable for use include, but are not limited to, EDANS/fluorescein, IAEDANS/fluorescein, fluorescein/tetramethylrhodamine, fluorescein/Cy 5,
- IEDANS/DABCYL fluorescein/QSY-7, fluorescein/LC Red 640, fluorescein/Cy 5.5 and fluorescein/LC Red 705.
- a fluorophore/quantum dot donor/acceptor pair can be used.
- EDANS is (5-((2-Aminoethyl)amino)naphthalene-l-sulfonic acid);
- IAEDANS is 5-( ⁇ 2-[(iodoacetyl)amino]ethyl ⁇ amino)naphthalene-l-sulfonic acid); DABCYL is 4-(4-dimethylaminophenyl) diazenylbenzoic acid.
- Cy3, Cy5, Cy 5.5, and the like are cyanines.
- Cy3 and Cy5 are reactive water-soluble fluorescent dyes of the cyanine dye family. Cy3 dyes are red (-550 nm excitation, -570 nm emission and therefore appear green), while Cy5 is fluorescent in the red region (-650/670 nm) but absorbs in the orange region (-649 nm). Alexa Fluor dyes, Dylight, IRIS Dyes, Seta dyes, SeTau dyes, SRfluor dyes and Square dyes dyes can also be used.
- quencher acceptor molecule
- emission of the donor will increase when quencher is displaced from close proximity to the donor and emission will decrease when the quencher is brought into close proximity to the donor.
- Useful quenchers include, but are not limited to, DABCYL, QSY 7 and QSY 33.
- Useful fluorescent donor/quencher pairs include, but are not limited to EDANS/DABCYL, Texas Red/DABCYL, BODIPY/DABCYL, Lucifer yellow/DABCYL,
- the enzymatically inactive sequence-specific endoribonuclease is linked (covalently or non-covalently) to a label enzyme.
- label enzyme is meant an enzyme which may be reacted in the presence of a label enzyme substrate which produces a detectable product.
- Suitable label enzymes also include optically detectable labels (e.g., in the case of horse radish peroxidase (HRP)).
- Suitable label enzymes include but are not limited to, HRP, alkaline phosphatase, luciferase, ⁇ -galactosidase, and glucose oxidase. Methods for the use of such substrates are well known in the art.
- the presence of the label enzyme is generally revealed through the enzyme's catalysis of a reaction with a label enzyme substrate, producing an identifiable product.
- Such products may be opaque, such as the reaction of horseradish peroxidase with tetramethyl benzedine, and may have a variety of colors.
- Other label enzyme substrates such as Luminol (available from Pierce Chemical Co.), have been developed that produce fluorescent reaction products. Methods for identifying label enzymes with label enzyme substrates are well known in the art and many commercial kits are available. Examples and methods for the use of various label enzymes are described in Savage et al., Previews 247:6-9 (1998), Young, J. Virol. Methods 24:227-236 (1989).
- the enzymatically inactive sequence-specific endoribonuclease comprises a radioisotope.
- radioisotope is meant any radioactive molecule. Suitable radioisotopes for use in the invention include, but are not limited to 14 C, 3 H, 32 P, 33 P, 35 S,
- the enzymatically inactive sequence-specific endoribonuclease is linked (covalently or non-covalently) to a member of a specific binding pair ("partner of a binding pair").
- partner of a binding pair or “member of a binding pair” is meant one of a first and a second moiety, wherein the first and the second moiety have a specific binding affinity for each other.
- Suitable binding pairs include, but are not limited to, antigen/antibodies (for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fhiorescein, lucifer yellow/anti- lucifer yellow, and rhodamine anti-rhodamine), biotin/avidin (or biotin/streptavidin) and calmodulin binding protein (CBP)/calmodulin.
- antigen/antibodies for example, digoxigenin/anti-digoxigenin, dinitrophenyl (DNP)/anti-DNP, dansyl-X-anti-dansyl, fluorescein/anti-fhiorescein, lucifer yellow/anti- lucifer yellow, and rhodamine anti-rhodamine
- biotin/avidin or biotin/streptavidin
- CBP
- the oligonucleotide probe comprises a modification that provides for increased resistance to non-specific hydrolysis.
- modifications are well known in the art and include, e.g., nuclease-resistant internucleosidic linkages, modified backbones, base modifications, base substitutions, sugar modifications, and the like.
- phosphorodithioates phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino
- oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most intemucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof).
- salts such as, for example, potassium or sodium
- mixed salts and free acid forms are also included.
- a modified oligonucleotide can comprise one or more phosphorothioate and/or heteroatom intemucleoside linkages, in particular -CH 2 -NH-0-CH 2 -, -CH 2 -N(CH 3 )-0- CH 2 - (known as a methylene (methylimino) or MMI backbone), -CH 2 -0-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 - and -0-N(CH 3 )-CH 2 -CH 2 - (wherein the native
- MMI type intemucleoside linkages are disclosed in the above referenced U.S. Pat. No.
- a modified oligonucleotide can comprise one or more morpholino backbone structures as described in, e.g., U.S. Pat. No. 5,034,506.
- a modified oligonucleotide comprises a 6-membered morpholino ring in place of a ribose ring.
- a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage.
- Morpholino nucleic acids include bases bound to morpholine rings instead of deoxyribose rings; in addition, the phosphate backbone can include a non- phosphate group, e.g., a phosphorodiamidate group instead of phosphates.
- a modified oligonucleotide can comprise a modified backbone. Modified
- polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and
- methylenehydrazino backbones sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
- a modified oligonucleotide can comprise one or more substituted sugar moieties.
- Suitable oligonucleotides comprise a sugar substituent group selected from: OH; F; 0-, S-, or N- alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Q to C 10 alkyl or C 2 to Cio alkenyl and alkynyl. Also suitable are 0((CH 2 ) n O) m CH 3 , 0(CH 2 ) n OCH 3 ,
- n and m are from 1 to about 10.
- oligonucleotides comprise a sugar substituent group selected from: Ci to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, and the like.
- a sugar substituent group selected from: Ci to C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN
- a suitable modification includes 2'-methoxyethoxy (2'-0-CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al, Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
- a further suitable modification includes 2'-dimethylaminooxyethoxy, i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'- O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-0-CH 2 -0-CH 2 -N(CH 3 ) 2 .
- 2'-dimethylaminooxyethoxy i.e., a 0(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE
- 2'-dimethylaminoethoxyethoxy also known in the art as 2'- O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE
- a modified oligonucleotide can comprise one or more nucleobase (often referred to in the art simply as "base”) modifications or substitutions.
- base often referred to in the art simply as “base”
- nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(lH-pyrimido(5,4-b)(l,4)benzoxazin-2(3H)- one), phenothiazine cytidine (lH-pyrimido(5,4-b)(l,4)benzothiazin-2(3H)-one), G- clamps such as a substituted phenoxazine cytidine (e.g.
- Heterocyclic base moieties may also include those in which the purine or
- pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone.
- a suitable enzymatically inactive sequence- specific endoribonuclease includes an enzymatically inactive sequence- specific endoribonuclease described hereinbelow.
- an enzymatically inactive sequence- specific endoribonuclease as depicted in Figure 6 can be used.
- the target polyribonucleotide is linked (covalently or non- covalently) to a solid support (an insoluble support).
- Suitable insoluble supports include, but are not limited to, beads, plates (e.g., multi-well plates), strips, etc., where the insoluble support can comprise various materials including, but not limited to, polystyrene, polypropylene, agarose, and the like.
- Oligonucleotide probes can be RNA, DNA, or any chemically modified version of an RNA or DNA, e.g., peptide nucleic acids (PNAs), locked nucleic acids (LNAs), and the like.
- PNAs peptide nucleic acids
- LNAs locked nucleic acids
- a subject polyribonucleotide sequencing method can include one or more
- washing steps e.g., to remove non-specific ally bound components such as non- specifically bound oligonucleotide probes, any non- specifically bound detectable moieties, and the like.
- a target polyribonucleotide bound to a solid support is bound to a target polyribonucleotide bound to a solid support.
- the target polyribonucleotide is of unknown sequence and is the "RNA to be
- oligonucleotide probes of four different known nucleotide sequences each comprise a different fluorophore (fluorophores 1-4).
- the fluorophores are members of FRET pairs.
- the counterpart members of the FRET pairs are quantum dots.
- the quantum dot is linked to an enzymatically inactive sequence-specific endoribonuclease.
- the enzymatically inactive sequence-specific endoribonuclease binds, but does not cleave, the duplex formed between an oligonucleotide probe and the target
- oligonucleotide probe-fluorophore2 Binding of oligonucleotide probe-fluorophore2 results in duplex formation with the target polyribonucleotide. Fluorophore2 is thus brought into proximity to the quantum dot linked to the enzymatically inactive sequence- specific endoribonuclease, and fluorescence is quenched.
- the present disclosure provides a method of cleaving a polyribonucleotide in a sequence-specific manner.
- the method generally involves contacting a substrate polyribonucleotide with an enzymatically active sequence-specific endoribonuclease (e.g., a Csy4 endoribonuclease) under conditions that favor sequence- specific cleavage of the polyribonucleotide substrate.
- an enzymatically active sequence-specific endoribonuclease e.g., a Csy4 endoribonuclease
- a subject method of cleaving a polyribonucleotide in a sequence-specific manner can be used to: 1) remove an affinity tag from a substrate polyribonucleotide; 2) to generate a population of product polyribonucleotides having homogeneity at the 5' end, e.g., where the substrate polyribonucleotides are in vitro transcribed mRNAs; and 3) to regulate gene expression in a cell in vitro or in vivo.
- substrate polyribonucleotide and “target polyribonucleotide” are used interchangeably herein to refer to a polyribonucleotide that is bound by a sequence- specific endoribonuclease in a sequence- specific manner.
- a substrate polyribonucleotide can be single stranded. In some instances, a substrate polyribonucleotide is double stranded.
- An endoribonuclease binds to and cleaves a substrate polyribonucleotide in a sequence-specific manner.
- an endoribonuclease binds to and cleaves a substrate polyribonucleotide at a specific sequence, referred to herein as a "recognition sequence” or a "recognition site.”
- a recognition sequence can be a tetranucleotide sequence, a pentanucleotide sequence, a hexanucleotide sequence, a heptanucleotide sequence, an octanucleotide sequence, or longer than an octanucleotide.
- the recognition sequence is 9 ribonucleotides, 10 ribonucleotides, 11 ribonucleotides, 12 ribonucleotides, 13 ribonucleotides, 14 ribonucleotides, 15 ribonucleotides, 16 ribonucleotides, 17 ribonucleotides, 18 ribonucleotides, 19 ribonucleotides, or 20 ribonucleotides in length.
- a sequence- specific endoribonuclease cleaves immediately 5' of a recognition sequence.
- a sequence-specific endoribonuclease cleaves immediately 3' of a recognition sequence. In some embodiments, a sequence-specific endoribonuclease cleaves within a recognition sequence. In some cases, a recognition sequence is immediately 5' of a secondary structure. In some cases, a recognition sequence is located 5' of a secondary structure and within 1 nucleotide (nt), 2 nt, 3 nt, 4 nt, 5 nt, or 5 nt to 10 nt of the secondary structure. In some cases, a recognition sequence is immediately 3' of a secondary structure.
- a recognition sequence is located 3' of a secondary structure and within 1 nucleotide (nt), 2 nt, 3 nt, 4 nt, 5 nt, or 5 nt to 10 nt of the secondary structure.
- a substrate polyribonucleotide comprises the structure
- the substrate polyribonucleotide comprises an affinity tag; and a subject method provides for removal of the affinity tag from the substrate polyribonucleotide.
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that cleave
- Structural features of an endoribonuclease that binds to and cleaves a substrate polyribonucleotide in a sequence- specific and metal ion-independent manner can include one or more of the following: 1) a highly basic alpha helix for sequence non-specific recognition of the phosphate backbone of RNA through the RNA major groove, e.g., Rl 14, Rl 15, Rl 18, Rl 19, or equivalents thereof; 2) R102 and/or Q104, or equivalents thereof, making hydrogen bonding contacts with the major groove of the RNA stem; 3) and one or more of His29, Serl48, and Tyrl76, or equivalents thereof, involved in catalysis; and 4) F155, or an equivalent thereof.
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 4 (Csy4 amino acid sequences).
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to an amino acid sequence set forth in Figure 5 (Csy4 amino acid sequences).
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a Cas6 amino acid sequence.
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to a CasE amino acid sequence.
- Endoribonucleases that bind to and cleave a substrate polyribonucleotide in a sequence-specific manner include enzymatically active polypeptides that differ from an amino acid sequence set forth in any one of Figures 4 or 5 by from 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions and/or insertions and/or deletions.
- a sequence-specific endoribonuclease can hydrolyze a substrate
- polyribonucleotide in a sequence- specific manner at a temperature in a range from about 15°C to about 100 °C, e.g., in a range of from about 15°C to about 17°C, from about 17°C to about 20°C, from about 20°C to about 25°C, from about 25°C to about 30°C, from about 30°C to about 40°C, from about 40°C to about 50°C, from about 50°C to about 60°C, from about 60°C to about 70°C, from about 70°C to about 80°C, from about 80°C to about 90°C, or from about 90°C to about 100°C.
- a sequence-specific endoribonuclease can hydrolyze a substrate
- polyribonucleotide in a sequence- specific manner in a pH range of from about 4.0 to about 8.0, e.g., from about pH 4.0 to about 4.5, from about pH 4.5 to about 5.0, from about pH 5.0 to about 5.5, from about pH 5.5 to about 6.0, from about pH 6.0 to about 6.5, from about pH 6.5 to about 7.0, from about pH 7.0 to about 7.5, from about pH 6.5 to about 7.5, from about pH 7.5 to about 8.0, from about pH 6.5 to about 8.0, or from about pH 5.5 to about 7.5.
- EXAMPLES EXAMPLES
- Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal (ly); s.c, subcutaneous (ly); and the like.
- [00175] Wild-type Csy4, point mutants and selenomethionine (SeMet)-substituted Csy4 were expressed in Rosetta 2(DE3) cells as either a His 6 -maltose binding protein (MBP) fusion or a His 6 fusion protein and purified by Ni-affinity chromatography, followed by proteolytic removal of the His(MBP) tag, a further Ni-affinity step, and size exclusion chromatography.
- the pre-crRNAs were transcribed in vitro with T7 polymerase and purified on a denaturing gel. The complex was formed by incubating RNA with Csy4 at a 2: 1 ratio for 30 minutes at 30°C followed by size exclusion chromatography.
- the complex was crystallized using the hanging-drop method in 200mM sodium citrate pH 5.0, lOOmM magnesium chloride, 20% (w/v) polyethylene glycol) (PEG)-4000 (wild- type (WT) complex) or 150mM sodium acetate pH 4.6, 17% PEG4000 or 160mM sodium acetate pH 4.6, 18% PEG4000 (S22C-containing complex).
- the structure of the WT Csy4-RNA complex was determined by the multiwavelength anomalous dispersion (MAD) method using SeMet-substituted crystals.
- the structure of the Csy4(S22C)-RNA complex was determined by molecular replacement.
- IPTG isopropyl ⁇ -D-l-thiogalactopyranoside
- TCEP isopropyl ⁇ -D-l-thiogalactopyranoside
- Lysate was clarified by centrifugation (24,000 x g, 30 minutes) and incubated with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin in batch (Qiagen).
- Ni-NTA nickel-nitrilotriacetic acid
- the bound protein was eluted with high imidazole buffer (15.5mM disodium hydrogen phosphate, 4.5mM sodium dihydrogen phosphate, 500mM sodium chloride, 300mM imidazole, ImM TCEP, 5% glycerol, pH 7.4) and dialyzed overnight in dialysis buffer (elution buffer with only 20mM imidazole) in the presence of tobacco etch virus (TEV) to cleave the His 6 or His 6 MBP tag.
- TSV tobacco etch virus
- the protein was concentrated (Amicon) and purified on a nickel affinity column (GE) followed by tandem Sup75 (16/60) columns in gel filtration buffer (lOOmM HEPES pH7.5, 500mM KC1, 5% glycerol, ImM TCEP).
- Hybrid Substructure Search HySS
- Phenix package Grosse-Kunstleve, and Adams. Acta Cry stallo gr D Biol Cry stallogr 59, 1966-1973 (2003).
- Substructure refinement, phasing and density modification were performed using AutoSHARP. Vonrhein, et al. Methods Mol Biol 364, 215-230 (2007).
- the resulting electron density map exhibited clear layers of density attributable to protein and RNA alternating along the c-axis, with the RNA layer made up of two coaxially- stacked RNA helices engaged in a "kissing loop" interaction.
- An initial atomic model for the Csy4 protein was obtained by automatic building using the Phenix AutoBuild module. Terwilliger, et al. Acta Crystallogr D Biol Crystallogr 64, 61-69, (2008). The complex model was completed by iterative cycles of manual building in COOT (Emsley, and Cowtan, Acta Crystallogr D Biol Crystallogr 60, 2126-2132 (2004)) and refinement using
- the model includes RNA nucleotides C1-G15 and the phosphate group of nucleotide C16 and protein residues 1-104, 109-120 and 139-187.
- the RNA Owing to the layered arrangement of protein and RNA in the crystal lattice and the lack of lateral crystal contacts within the RNA layer, the RNA exhibits significant disorder, as evidenced by markedly elevated temperature factors (>100 A ) and the absence of interpretable density for the nucleotide base of U9.
- the disorder is also evident in protein residues 109-120, corresponding to the arginine-rich helix inserted in the major groove of the RNA, for which only the polypeptide backbone could be built (except for residues Arg 115 and Arg 118).
- orthorhombic crystal forms were determined by molecular replacement in Phaser (McCoy, et al. JAppl Crystallogr 40, 658-674 (2007)), using the Csy4 protein (lacking the arginine-rich helix) and RNA models from the monoclinic crystal form as separate search ensembles.
- electron density for the arginine-rich helix and the linker region comprising Csy4 residues 105-108 was immediately noticeable in 2F 0 - F c maps obtained from the molecular replacement solutions.
- the structure of the Csy4(S22C)-RNA complex in the hexagonal form was refined to an R work factor of
- the final model includes Csy4 residues 1- 120 and 139-187 and RNA nucleotides C1-G15 plus the phosphate group of nucleotide C16.
- the orthorhombic crystal form of the Csy4(S22C)-RNA complex has been solved at 1.8 A resolution and refined to an R work factor of 18.7% and R free of 22.0%, with excellent stereochemistry.
- complex 1 contains Csy4 residues 1-187 and RNA nucleotides C1-G15 plus the phosphate group of nucleotide CI 6, while the less ordered complex 2 (chains B and D) comprises Csy4 residues 1-187 with the exception of residues 13-15 and 135-138, which show no ordered electron density, and RNA nucleotides C1-G15 and the phosphate group of nucleotide C16.
- the two copies of Csy4 superpose with an rmsd of 1.15 A over 179 Ccc atoms, the greatest differences coming from the slightly different positions of the arginine-rich helix.
- CRISPR-associated (Cas) proteins belonging to the eight known CRISPR/Cas subtypes are highly divergent at the primary sequence level, obscuring identification of functional homologues. Haft, et al. PLoS Comput Biol 1, e60 (2005); Makarova, et al.
- Pseudomonas aeruginosa UCBPP-PA14 (hereafter Pal4), a Gram-negative opportunistic pathogen harboring a CRISPR/Cas system of the Yersinia subtype, contains six Cas genes flanked by two CRISPR elements (Fig. 1A). Although Casl is found universally among CRISPR-containing organisms, and Cas3 is evident in most subtypes, Csyl-4 are unique to the Yersinia subtype.
- Both CRISPR elements comprise a characteristic arrangement of 28-nucleotide repeats identical within both CRISPRs (save for one nucleotide) interspersed with ⁇ 32-nucleotide unique spacers, some of which match sequences found in bacteriophage or plasmids. Grissa, et al. BMC Bioinformatics 8, 172 (2007). In many organisms it has been shown that CRISPR loci are transcribed as long single units and are post-transcriptionally processed to yield crRNAs that each contain one unique sequence flanked by sequences derived from the repeat element. Brouns et al. Science 321, 960-964 (2008); Carte, et al.
- each of the six Cas proteins from Pa 14 was recombinantly expressed, and the recombinantly expressed proteins were tested for endoribonucleolytic function using an in vitro transcribed pre-crRNA. Based on sequence-specific pre-crRNA processing activity, it was found that Csy4 is the endoribonuclease responsible for crRNA biogenesis. As observed for crRNA processing within two other CRISPR/Cas subtypes (Brouns et al. (2008) supra; Carte et al.
- CRISPR transcript cleavage is a rapid, metal ion-independent reaction.
- Csy4 cleaves pre-crRNA within the repeat element at the base of a predicted stem-loop structure, generating -60 nucleotide crRNAs consisting of a 32-nucleotide unique (phage-derived) sequence flanked on the 5' and 3' ends by eight and 20 nucleotides, respectively, of repeat sequence (Fig. 1A).
- Csy4 was expressed in E. coli alone or co-expressed with a Pal4 CRISPR RNA.
- PI isoelectric point
- Csy4 does not associate with cellular nucleic acids; however, when co-expressed with a Pal4 CRISPR, the protein is associated with a crRNA (Fig. 1B,C).
- Csy4 binding and activity assays were performed in vitro using RNA oligonucleotides corresponding to different regions of the 28-nucleotide Pal4 CRISPR repeat sequence. Using this approach, a minimal RNA fragment recognized by Csy4 consisting of the repeat-derived stem-loop and one downstream nucleotide was identified. Cleavage assays utilizing this minimal RNA as a substrate showed that Csy4 activity requires a 2 ⁇ on the ribose immediately upstream of the cleavage site. A 2' -deoxyribose at this position completely abrogates cleavage, but does not disrupt Csy4 binding.
- Csy4 was co-crystallized in complex with a minimal RNA substrate.
- Csy4 was bound to the non-cleavable 16-nucleotide minimal RNA substrate described above in which the nucleotide preceding the cleavage site is a 2' -deoxynucleotide. Crystals of the complex were obtained in three unique space groups, each exhibiting different crystal packing; one contained wild-type Csy4 and two contained a Csy4 point mutant .
- the crystal structure of the Csy4-RNA complex was solved to a resolution of 1.8 A (Fig. 2A, Table 1), revealing an unanticipated
- Csy4 makes sequence- specific contacts in the major groove of the stem-loop of the CRISPR repeat sequence and additional sequence non-specific contacts with the phosphate backbone of the RNA stem.
- the majority of characterized protein/RNA interactions are mediated via the minor groove of an RNA helix; the recognition of the RNA major groove by Csy4 is a highly unusual mechanism of protein/RNA interaction.
- Csy4 is highly dissimilar from the other known endoribonucleases involved in crRNA biogenesis (CasE from Thermus thermophiles (Ebihara, et al. Protein Sci 15, 1494-1499 (2006)) and Cas6 from Pyrococcus furiosus Carte et al. (2008) supra), sharing only -10% identity.
- the crystal structures of both CasE and Cas6 indicate that these proteins adopt tandem ferrodoxin-like folds.
- Csy4 shares this fold with these enzymes; in the Csy4-RNA complex, the N-terminal domain (residues 1-94) of Csy4 indeed adopts a ferredoxin-like fold.
- the C-terminal domain (residues 95-187) shares the same secondary structure connectivity as a ferredoxin-like fold, but its conformation is markedly different.
- Cas6 with root- mean-square deviation (rmsd) of 3.8 A (over 111 Ca atoms) and 3.9 A (over 104 Ca atoms), respectively.
- Csy4, CasE and Cas6 could be descendants of a single ancestral endoribonuclease that has diverged markedly at the sequence level as it co-evolved with the repeat sequence of the CRISPR locus, while maintaining a similar protein fold.
- the crRNA substrate forms a hairpin structure, as predicted for this subclass of crRNA repeats (Kunin, et al. Genome Biol 8, R61 (2007)), with nucleotides 1-5 and 11- 15 base pairing to produce a regular A-form helical stem.
- the GUAUA pentaloop contains a sheared G6-A10 base pair and a bulged-out nucleotide U9, its structure reminiscent of GNR(N)A pentaloops found in the yeast U6 small nuclear RNA intramolecular stem-loop (Huppler, et al. Nat Struct Biol 9, 431-435 (2002)) and in bacteriophage lamda BoxB RNA (Legault, et al.
- RNA stem-loop straddles the ⁇ -hairpin formed by strands ⁇ 7- ⁇ 8 of Csy4, with the C1-G15 base-pair directly stacking onto the aromatic side chain of Phel55 (Fig. 2B). This anchors the RNA stem and orients it at the proper angle to permit sequence-specific interactions in the major groove.
- Argl 15 engages the base of G6 as the only sequence- specific interaction between the arginine- rich helix and the RNA hairpin.
- this interaction is highly pronounced of how certain viral proteins interact with the major groove of dsRNA molecules, for example the Tat/Tar interaction in human immunodeficiency virus (HIV) 2"3 and the lambda-N/boxB complex in lambdoid phages (Cai, et al. Nature Structural Biology 5, 203-212 (1998)).
- HIV human immunodeficiency virus
- a-N/boxB complex in lambdoid phages
- Csy4 recognizes the hairpin element of the CRISPR repeat sequence and cleaves immediately downstream of it.
- the structure described in this Example contains a substrate-mimic RNA, which is not competent for cleavage. In the active site, density was observed only for the phosphate group 3' of the penultimate nucleotide, but no density for the terminal sugar or base, presumably due to the flexibility of this nucleotide (Fig. 3A).
- the scissile phosphate binds in a pocket located between the ⁇ -turn of the ⁇ 7- ⁇ 8 hairpin on one side and helix al and a glycine-rich loop, previously identified in Cas6 and CasE, on the other.
- CRISPRs are the genetic memory of a nucleic acid-based immune system that relies on small CRISPR-derived RNAs for guiding the immune system to cognate sequences associated with invading genetic elements.
- Phylogenetic analysis of CRISPR repeat sequences has identified distinct CRISPR categories (Kunin, et al. Genome Biol 8, R61 (2007)) that correlate with a particular set of Cas genes.
- the co-variation of Cas genes with specific CRISPR repeat sequence types suggests that CRISPR repeats have co-evolved with the Cas genes that are responsible for CRISPR adaptation, the generation of crRNAs and the silencing of invading genetic elements.
- the structure described here details an unusual recognition mechanism that discriminates crRNA substrates based on both sequence- and structure- specificity, providing great insight into the ability of Csy4 and its homologues to readily distinguish substrate RNA from among all cellular RNAs.
- FIG. 1A-C Pal4Csy4 specifically recognizes only its pre-crRNA substrate, a, Schematic of CRISPR/Cas locus in Pal4. The six Cas genes are flanked on both sides by CRISPR loci. Enlarged is a schematic showing the predicted stem-loop in the 28- nucleotide direct repeat (black lettering) separated by 32-nucleotide spacer sequences (blue). The red arrows note the bond cleaved by Csy4.
- b,c Comparison of protein (b) and RNA content (c) after Pal4Csy4 expression in E. coli with (+) and without (-) a plasmid containing a Pal4 CRISPR locus.
- FIGS. 2A-C The crystal structure of Csy4 bound to RNA substrate, a, Front and back views of the complex. Csy4 is colored in blue and the RNA backbone is colored in orange, b, Detailed interactions between residues R102 and Q104 and nucleotides A 14 and G15. Hydrogen bonding is depicted with dashed lines, c, Detailed interactions between an arginine-rich alpha helix and the RNA backbone and G6.
- FIGS 3A and 3B Putative active site, a, Detailed view of the catalytic center, b, Cleavage activity of Csy4. Wild-type (WT) Csy4 and a series of single point mutants were incubated with in vitro transcribed pre-crRNA for 5 minutes at 25 C. Products were acid phenol-chloroform extracted and resolved on UREA-PAGE and visualized by SYBR Gold staining.
- WT Wild-type
- RNA can be sequenced at the single-molecule level using Forster Resonant
- the RNA to be sequenced will be attached to a solid surface through its 3' ribose.
- the RNA should be spaced far enough from neighboring RNA molecules on the surface to allow detection at the single-molecule level.
- the spacing is dictated by diffraction-limited methods, dependent on the wavelength of emitted light. Alternatively, the RNA spacing can be closer than the diffraction limit, if super- resolution imaging methods are used.
- a Csy4 family protein of known nucleic acid binding specificity is added to the RNA to be sequenced, along with a pool of detection oligonucleotides.
- the Csy4 protein will only bind to the RNA to be sequenced if one of the detection oligonucleotides can form a 4 base pair double helix with the RNA to be sequenced.
- the detection nucleotide must base pair with an additional 3 nucleotides 3' of the 4 base pair recognition sequence in the RNA to be sequenced, in order for the Csy4 protein to bind stably.
- the detection oligonucleotides will contain an extension of 3 nucleotides 3' of the 4-nucleotide recognition sequence.
- the 3-nucleotide extension will have a defined 5' nucleotide followed by two random nucleotide positions; or a random nucleotide at the 5' position followed by a defined nucleotide and a random nucleotide; or 2 random nucleotides at the 5' end, followed by a defined nucleotide.
- the defined nucleotide is known based on an attached fluorescent molecule, the emission or excitation spectrum of which is defined by the nucleotide.
- the Csy4 protein will be attached to a quantum dot whose excitation spectrum overlaps with the emission spectrum of the fluorescent molecule attached to the detection oligonucleotide.
- oligonucleotides will be removed from the sample using chemical and/or heat denaturation and washing. In subsequent sequencing steps, other Csy4 proteins of different sequence specificity and their corresponding detection oligonucleotides will be incubated with the RNA to be sequenced, in a similar manner.
- Other variations of the 3- nucleotide extension on the detection oligonucleotide can be envisioned, such as extensions of different lengths, at either the 5' end or 3' end of the detection
- the detection oligonucleotide could be RNA, DNA, or any chemically modified version of these polymers, such as PNAs or LNAs.
- Csy4(H29A) mutant An example is the above-described Csy4(H29A) mutant.
- the otherwise catalytically inactive Csy4(H29A) mutant can be reactivated in the presence of exogenous imidazole. Addition of between 150mM and 300mM imidazole to the reaction buffer is sufficient to stimulate near- wild type cleavage activity.
- Figure 8 shows a cleavage activity assay depicting the imidazole rescue.
- Csy4H29A is a catalytically inactive mutant of Csy4 that retains the ability to bind its substrate with a kd of ⁇ 1 nM.
- Each 10 ⁇ reaction contains 5pmol of the in vitro transcribed pre-crRNA substrate, lOOpmol of Csy4 (WT or H29A, as indicated in Figure 8), 20mM HEPES pH 7.5, lOOmM KC1, and 150-300mM imidazole, as indicated. Reactions were carried out for 30 minutes at 25°C.) Products were acid phenol-chloroform extracted, separated on a 15% denaturing gel, and visualized with SYBR Gold. Biochemical characterization of Csy4(H29A) shows that it binds to its RNA substrate with ⁇ 1 nM affinity.
- Csy4(H29A) is useful for both in vivo and in vitro applications for which there is no current alternative approach.
- Csy4(H29A) (also referred to herein as "inducible” Csy4), is useful for purifying a particular RNA/protein complex (RNP) from a complex mixture of RNAs and RNPs (RNA/protein complexes).
- RNP RNA/protein complex
- researchers may be interested in understanding which proteins bind to a particular RNA transcript. Using this system, the researchers could engineer an expression construct for their RNA of choice that would include a 5' tag consisting of the stem-loop Csy4 target sequence. The researchers would then transfect this expression construct into their cell type of choice, leading to the generation of many RNAs and RNPs.
- RNAs or RNPs that have the Csy4 target sequence will bind.
- a subsequent wash step will remove non- specifically bound RNAs.
- a wash with imidazole ( ⁇ 300mM) will activate inducible Csy4, which will cleave the target sequence and release the bound RNA/RNP. This method is illustrated schematically in Figure 9.
- RNA of choice could be transcribed in vitro using a construct similar to the expression plasmid designed for the above experiment. (The construct must introduce the Csy4 stem-loop target sequence at the 5' end of the transcribed RNA.) This in vitro transcribed product could then be incubated with proteins known or suspected to bind the particular transcript. The inducible Csy4-containing column could be used to purify the in vitro formed RNPs away from free protein.
- This structure reveals numerous sequence specific contacts between the protein and RNA, including several interactions in the major groove of the RNA.
- the terminal base-pair in the stem- loop in disrupted, with A22 flipped out of the helix and base- stacked with U23.
- This conformation is partially stabilized by interactions with S34 and E38, which also confer sequence specificity for substrate recognition.
- Further stabilization of the A22 and U23 conformation is achieved by positioning of the terminal nucleotide, G24, which flips back into register with the stem-loop, but resides well below the helix in a binding pocket made up of residues D18, E24, and K31, with R27 contacting the backbone between U23 and G24.
- the 2.5 A structure contained 8 molecules in the asymmetric unit. All 8 molecules revealed that A22 base stacks with G21, maintaining A-form geometry with the rest of the stem-loop.
- the protein structure also differs from the catalytic conformation observed in the 2.0 A structure. In that structure, a loop containing R158 and K160 is juxtaposed with the active site, suggesting that these residues may play a role in catalysis or in stabilization of a transition- state intermediate.
- this loop is distal from the active site and partially disordered, suggesting that the positioning of the loop is flexible.
- this loop is also disordered in the apo structure of CasE (Ebihara et al., Protein Sci. 15, 1494-9 (2006)), suggesting that the correct RNA conformation is required for stabilization of this loop.
- the second crystal form (P2 1 2 1 2 1 ) obtained for the CasE/19-nucleotide RNA complex was used to determine a 1.5 A structure, which revealed the RNA bound in the catalytic conformation with A22 and U23 flipped out of the helix.
- the loop containing R158 and K160 remains disordered in this structure, suggesting that G24 binding may also be required for stabilization of this protein structure.
- the observation of two different RNA conformations for the same complex suggests that the RNA may sample several structural states, and that it may require G24 to lock it into the catalytically competent conformation.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- General Chemical & Material Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EA201291024A EA024121B9 (ru) | 2010-05-10 | 2011-05-09 | Композиции эндорибонуклеаз и способы их использования |
| SG2012082426A SG185481A1 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease compositions and methods of use thereof |
| AU2011253222A AU2011253222B2 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease compositions and methods of use thereof |
| MX2012013037A MX2012013037A (es) | 2010-05-10 | 2011-05-09 | Composiciones de endorribonucleasa y metodos de uso de las mismas. |
| CA2798703A CA2798703A1 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease compositions and methods of use thereof |
| JP2013510211A JP5926242B2 (ja) | 2010-05-10 | 2011-05-09 | エンドリボヌクレアーゼ組成物およびその使用方法 |
| CN201180033802.7A CN103038338B (zh) | 2010-05-10 | 2011-05-09 | 核糖核酸内切酶组合物及其使用方法 |
| ES11781086.1T ES2590343T3 (es) | 2010-05-10 | 2011-05-09 | Composiciones de endorribonucleasas y métodos de uso de las mismas |
| KR1020127031818A KR101867359B1 (ko) | 2010-05-10 | 2011-05-09 | 엔도리보뉴클레아제 조성물들 및 이들의 사용 방법들 |
| BR112012028805-9A BR112012028805A2 (pt) | 2010-05-10 | 2011-05-09 | composições de endorribonuclease e métodos de uso das mesmas. |
| DK11781086.1T DK2569425T3 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease COMPOSITIONS AND METHODS OF USE THEREOF |
| EP11781086.1A EP2569425B1 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease compositions and methods of use thereof |
| US13/671,120 US9115348B2 (en) | 2010-05-10 | 2012-11-07 | Endoribonuclease compositions and methods of use thereof |
| AU2014259510A AU2014259510B2 (en) | 2010-05-10 | 2014-11-06 | Endoribonuclease compositions and methods of use thereof |
| US14/735,383 US9605246B2 (en) | 2010-05-10 | 2015-06-10 | Endoribonuclease compositions and methods of use thereof |
| US15/430,054 US9708646B2 (en) | 2010-05-10 | 2017-02-10 | Endoribonuclease compositions and methods of use thereof |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US33316310P | 2010-05-10 | 2010-05-10 | |
| US61/333,163 | 2010-05-10 | ||
| US36562710P | 2010-07-19 | 2010-07-19 | |
| US61/365,627 | 2010-07-19 | ||
| US41328710P | 2010-11-12 | 2010-11-12 | |
| US61/413,287 | 2010-11-12 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/671,120 Continuation-In-Part US9115348B2 (en) | 2010-05-10 | 2012-11-07 | Endoribonuclease compositions and methods of use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011143124A2 true WO2011143124A2 (en) | 2011-11-17 |
| WO2011143124A3 WO2011143124A3 (en) | 2012-04-19 |
Family
ID=44914921
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/035775 Ceased WO2011143124A2 (en) | 2010-05-10 | 2011-05-09 | Endoribonuclease compositions and methods of use thereof |
Country Status (14)
| Country | Link |
|---|---|
| US (3) | US9115348B2 (cg-RX-API-DMAC7.html) |
| EP (2) | EP2569425B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP5926242B2 (cg-RX-API-DMAC7.html) |
| KR (1) | KR101867359B1 (cg-RX-API-DMAC7.html) |
| CN (1) | CN103038338B (cg-RX-API-DMAC7.html) |
| AU (1) | AU2011253222B2 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112012028805A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2798703A1 (cg-RX-API-DMAC7.html) |
| DK (1) | DK2569425T3 (cg-RX-API-DMAC7.html) |
| EA (1) | EA024121B9 (cg-RX-API-DMAC7.html) |
| ES (1) | ES2590343T3 (cg-RX-API-DMAC7.html) |
| MX (1) | MX2012013037A (cg-RX-API-DMAC7.html) |
| SG (1) | SG185481A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2011143124A2 (cg-RX-API-DMAC7.html) |
Cited By (128)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014022702A2 (en) | 2012-08-03 | 2014-02-06 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by rna processing |
| WO2013188638A3 (en) * | 2012-06-15 | 2014-03-20 | The Regents Of The University Of California | Endoribonucleases and methods of use thereof |
| WO2014150624A1 (en) * | 2013-03-14 | 2014-09-25 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9023649B2 (en) | 2012-12-17 | 2015-05-05 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| WO2015048707A3 (en) * | 2013-09-30 | 2015-05-21 | Regents Of The University Of Minnesota | Conferring resistance to geminiviruses in plants using crispr/cas systems |
| EP2877213A2 (en) | 2012-07-25 | 2015-06-03 | The Broad Institute, Inc. | Inducible dna binding proteins and genome perturbation tools and applications thereof |
| WO2013188037A3 (en) * | 2012-06-11 | 2015-06-25 | Agilent Technologies, Inc | Method of adaptor-dimer subtraction using a crispr cas6 protein |
| WO2015099850A1 (en) * | 2013-12-26 | 2015-07-02 | The General Hospital Corporation | Multiplex guide rnas |
| US9074199B1 (en) | 2013-11-19 | 2015-07-07 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US9115348B2 (en) | 2010-05-10 | 2015-08-25 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| US9267135B2 (en) | 2013-06-04 | 2016-02-23 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9567603B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| US9580701B2 (en) | 2015-01-28 | 2017-02-28 | Pioneer Hi-Bred International, Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US9587252B2 (en) | 2013-07-10 | 2017-03-07 | President And Fellows Of Harvard College | Orthogonal Cas9 proteins for RNA-guided gene regulation and editing |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US9902973B2 (en) | 2013-04-11 | 2018-02-27 | Caribou Biosciences, Inc. | Methods of modifying a target nucleic acid with an argonaute |
| US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10450576B2 (en) | 2015-03-27 | 2019-10-22 | E I Du Pont De Nemours And Company | Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants |
| US10501738B2 (en) | 2018-04-24 | 2019-12-10 | Inscripta, Inc. | Automated instrumentation for production of peptide libraries |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10508288B1 (en) | 2017-09-30 | 2019-12-17 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems comprising flow-through electroporation devices |
| US10519437B1 (en) | 2017-06-30 | 2019-12-31 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10519457B2 (en) | 2013-08-22 | 2019-12-31 | E I Du Pont De Nemours And Company | Soybean U6 polymerase III promoter and methods of use |
| US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
| US10526598B2 (en) | 2018-04-24 | 2020-01-07 | Inscripta, Inc. | Methods for identifying T-cell receptor antigens |
| US10532324B1 (en) | 2018-08-14 | 2020-01-14 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10563225B2 (en) | 2013-07-26 | 2020-02-18 | President And Fellows Of Harvard College | Genome engineering |
| US10576474B2 (en) | 2018-04-13 | 2020-03-03 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
| US10590375B2 (en) | 2018-03-29 | 2020-03-17 | Inscripta, Inc. | Methods for controlling the growth of prokaryotic and eukaryotic cells |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10604746B1 (en) | 2018-10-22 | 2020-03-31 | Inscripta, Inc. | Engineered enzymes |
| US10633627B2 (en) | 2018-08-14 | 2020-04-28 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10676754B2 (en) | 2014-07-11 | 2020-06-09 | E I Du Pont De Nemours And Company | Compositions and methods for producing plants resistant to glyphosate herbicide |
| US10689669B1 (en) | 2020-01-11 | 2020-06-23 | Inscripta, Inc. | Automated multi-module cell processing methods, instruments, and systems |
| US10704033B1 (en) | 2019-12-13 | 2020-07-07 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10752874B2 (en) | 2018-08-14 | 2020-08-25 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10787683B1 (en) | 2017-08-28 | 2020-09-29 | Inscripta, Inc. | Electroporation cuvettes for automation |
| US10787684B2 (en) | 2013-11-19 | 2020-09-29 | President And Fellows Of Harvard College | Large gene excision and insertion |
| US10815467B2 (en) | 2019-03-25 | 2020-10-27 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US10837021B1 (en) | 2019-06-06 | 2020-11-17 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10858761B2 (en) | 2018-04-24 | 2020-12-08 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US10883095B1 (en) | 2019-12-10 | 2021-01-05 | Inscripta, Inc. | Mad nucleases |
| US10907125B2 (en) | 2019-06-20 | 2021-02-02 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
| US10920189B2 (en) | 2019-06-21 | 2021-02-16 | Inscripta, Inc. | Genome-wide rationally-designed mutations leading to enhanced lysine production in E. coli |
| US10927385B2 (en) | 2019-06-25 | 2021-02-23 | Inscripta, Inc. | Increased nucleic-acid guided cell editing in yeast |
| US10934536B2 (en) | 2018-12-14 | 2021-03-02 | Pioneer Hi-Bred International, Inc. | CRISPR-CAS systems for genome editing |
| US11001831B2 (en) | 2019-03-25 | 2021-05-11 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11008557B1 (en) | 2019-12-18 | 2021-05-18 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11111521B2 (en) | 2011-12-22 | 2021-09-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11130970B2 (en) | 2017-06-23 | 2021-09-28 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11142740B2 (en) | 2018-08-14 | 2021-10-12 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
| US11203762B2 (en) | 2019-11-19 | 2021-12-21 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
| US11214781B2 (en) | 2018-10-22 | 2022-01-04 | Inscripta, Inc. | Engineered enzyme |
| US11225674B2 (en) | 2020-01-27 | 2022-01-18 | Inscripta, Inc. | Electroporation modules and instrumentation |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| US11268088B2 (en) | 2020-04-24 | 2022-03-08 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells via viral delivery |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11293021B1 (en) | 2016-06-23 | 2022-04-05 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US11299767B2 (en) | 2013-03-12 | 2022-04-12 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US11299731B1 (en) | 2020-09-15 | 2022-04-12 | Inscripta, Inc. | CRISPR editing to embed nucleic acid landing pads into genomes of live cells |
| US11306298B1 (en) | 2021-01-04 | 2022-04-19 | Inscripta, Inc. | Mad nucleases |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11332742B1 (en) | 2021-01-07 | 2022-05-17 | Inscripta, Inc. | Mad nucleases |
| US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US11384360B2 (en) | 2012-06-19 | 2022-07-12 | Regents Of The University Of Minnesota | Gene targeting in plants using DNA viruses |
| US11408012B2 (en) | 2017-06-23 | 2022-08-09 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US20220267807A1 (en) * | 2012-05-25 | 2022-08-25 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11512297B2 (en) | 2020-11-09 | 2022-11-29 | Inscripta, Inc. | Affinity tag for recombination protein recruitment |
| US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542554B2 (en) | 2015-11-03 | 2023-01-03 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560568B2 (en) | 2014-09-12 | 2023-01-24 | E. I. Du Pont De Nemours And Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11787841B2 (en) | 2020-05-19 | 2023-10-17 | Inscripta, Inc. | Rationally-designed mutations to the thrA gene for enhanced lysine production in E. coli |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11814689B2 (en) | 2021-07-21 | 2023-11-14 | Montana State University | Nucleic acid detection using type III CRISPR complex |
| US11840711B2 (en) | 2017-04-12 | 2023-12-12 | The Broad Institute, Inc. | Type VI CRISPR orthologs and systems |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US11884924B2 (en) | 2021-02-16 | 2024-01-30 | Inscripta, Inc. | Dual strand nucleic acid-guided nickase editing |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11965154B2 (en) | 2018-08-30 | 2024-04-23 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US11981917B2 (en) | 2013-06-04 | 2024-05-14 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US12058986B2 (en) | 2017-04-20 | 2024-08-13 | Egenesis, Inc. | Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements |
| US12084676B2 (en) | 2018-02-23 | 2024-09-10 | Pioneer Hi-Bred International, Inc. | Cas9 orthologs |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| US12139731B2 (en) | 2021-07-08 | 2024-11-12 | National Institutes Of Health (Nih), U.S. Dept. Of Health And Human Services (Dhhs) U.S. Government | CRISPR-based programmable RNA editing |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12331347B2 (en) | 2014-07-11 | 2025-06-17 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US12338444B2 (en) | 2011-03-23 | 2025-06-24 | Pioneer Hi-Bred International, Inc. | Methods for producing a complex transgenic trait locus |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12460231B2 (en) | 2014-04-02 | 2025-11-04 | Editas Medicine, Inc. | Crispr/CAS-related methods and compositions for treating primary open angle glaucoma |
| US12467086B2 (en) | 2011-10-14 | 2025-11-11 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
| US12565671B2 (en) | 2016-08-31 | 2026-03-03 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| US12618099B2 (en) | 2024-11-04 | 2026-05-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
Families Citing this family (70)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2013335451C1 (en) * | 2012-10-23 | 2024-07-04 | Toolgen Incorporated | Composition for cleaving a target DNA comprising a guide RNA specific for the target DNA and Cas protein-encoding nucleic acid or Cas protein, and use thereof |
| PL3360964T3 (pl) | 2012-12-06 | 2020-03-31 | Sigma-Aldrich Co. Llc | Modyfikacja i regulacja genomu oparta na crispr |
| WO2014093655A2 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| EP2931899A1 (en) | 2012-12-12 | 2015-10-21 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| EP2840140B2 (en) | 2012-12-12 | 2023-02-22 | The Broad Institute, Inc. | Crispr-Cas based method for mutation of prokaryotic cells |
| US20140310830A1 (en) | 2012-12-12 | 2014-10-16 | Feng Zhang | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| CN113355357B (zh) | 2012-12-12 | 2024-12-03 | 布罗德研究所有限公司 | 对用于序列操纵的改进的系统、方法和酶组合物进行的工程化和优化 |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| EP3031921B1 (en) | 2012-12-12 | 2025-03-12 | The Broad Institute, Inc. | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| IL239344B2 (en) | 2012-12-12 | 2024-06-01 | Broad Inst Inc | Systems engineering, methods and optimal guiding components for sequence manipulation |
| WO2014093709A1 (en) | 2012-12-12 | 2014-06-19 | The Broad Institute, Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| MX374532B (es) | 2013-06-17 | 2025-03-06 | Broad Inst Inc | Suministro, uso y aplicaciones terapéuticas de los sistemas y composiciones crispr-cas, para actuar sobre trastornos y enfermedades utilizando componentes víricos. |
| WO2014204724A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation |
| EP3725885A1 (en) | 2013-06-17 | 2020-10-21 | The Broad Institute, Inc. | Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof |
| CN105492611A (zh) | 2013-06-17 | 2016-04-13 | 布罗德研究所有限公司 | 用于序列操纵的优化的crispr-cas双切口酶系统、方法以及组合物 |
| RU2716420C2 (ru) | 2013-06-17 | 2020-03-11 | Те Брод Инститьют Инк. | Доставка и применение систем crispr-cas, векторов и композиций для целенаправленного воздействия и терапии в печени |
| EP3988649B1 (en) | 2013-09-18 | 2024-11-27 | Kymab Limited | Methods, cells and organisms |
| WO2015065964A1 (en) | 2013-10-28 | 2015-05-07 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, screens and applications thereof |
| JP7103750B2 (ja) | 2013-12-12 | 2022-07-20 | ザ・ブロード・インスティテュート・インコーポレイテッド | ゲノム編集のためのCRISPR-Cas系及び組成物の送達、使用及び治療適用 |
| WO2015089364A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crystal structure of a crispr-cas system, and uses thereof |
| EP3080259B1 (en) | 2013-12-12 | 2023-02-01 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions with new architectures for sequence manipulation |
| JP6712948B2 (ja) | 2013-12-12 | 2020-06-24 | ザ・ブロード・インスティテュート・インコーポレイテッド | 組成物、及びヌクレオチドリピート障害におけるcrispr−cas系の使用方法 |
| JP6793547B2 (ja) | 2013-12-12 | 2020-12-02 | ザ・ブロード・インスティテュート・インコーポレイテッド | 最適化機能CRISPR−Cas系による配列操作のための系、方法および組成物 |
| SG10201804975PA (en) | 2013-12-12 | 2018-07-30 | Broad Inst Inc | Delivery, Use and Therapeutic Applications of the Crispr-Cas Systems and Compositions for HBV and Viral Diseases and Disorders |
| WO2015089427A1 (en) | 2013-12-12 | 2015-06-18 | The Broad Institute Inc. | Crispr-cas systems and methods for altering expression of gene products, structural information and inducible modular cas enzymes |
| CN106604994B (zh) | 2014-06-23 | 2021-12-14 | 通用医疗公司 | 通过测序评估的DSBs的全基因组无偏鉴定(GUIDE-Seq) |
| US10435685B2 (en) | 2014-08-19 | 2019-10-08 | Pacific Biosciences Of California, Inc. | Compositions and methods for enrichment of nucleic acids |
| SG11201701245QA (en) | 2014-08-27 | 2017-03-30 | Caribou Biosciences Inc | Methods for increasing cas9-mediated engineering efficiency |
| US10040048B1 (en) | 2014-09-25 | 2018-08-07 | Synthego Corporation | Automated modular system and method for production of biopolymers |
| EP3889260A1 (en) | 2014-12-12 | 2021-10-06 | The Broad Institute, Inc. | Protected guide rnas (pgrnas) |
| CA2970370A1 (en) | 2014-12-24 | 2016-06-30 | Massachusetts Institute Of Technology | Crispr having or associated with destabilization domains |
| KR20230156800A (ko) | 2015-03-03 | 2023-11-14 | 더 제너럴 하스피탈 코포레이션 | 변경된 PAM 특이성을 갖는 조작된 CRISPR-Cas9 뉴클레아제 |
| EP3929291A1 (en) | 2015-03-17 | 2021-12-29 | Bio-Rad Laboratories, Inc. | Detection of genome editing |
| EP3302525A2 (en) | 2015-06-05 | 2018-04-11 | Novartis AG | Methods and compositions for diagnosing, treating, and monitoring treatment of shank3 deficiency associated disorders |
| US20160362667A1 (en) | 2015-06-10 | 2016-12-15 | Caribou Biosciences, Inc. | CRISPR-Cas Compositions and Methods |
| WO2016205759A1 (en) | 2015-06-18 | 2016-12-22 | The Broad Institute Inc. | Engineering and optimization of systems, methods, enzymes and guide scaffolds of cas9 orthologs and variants for sequence manipulation |
| TWI906646B (zh) | 2015-06-18 | 2025-12-01 | 美商博得學院股份有限公司 | 降低脫靶效應的crispr酶突變 |
| US9580727B1 (en) | 2015-08-07 | 2017-02-28 | Caribou Biosciences, Inc. | Compositions and methods of engineered CRISPR-Cas9 systems using split-nexus Cas9-associated polynucleotides |
| JP6799586B2 (ja) | 2015-08-28 | 2020-12-16 | ザ ジェネラル ホスピタル コーポレイション | 遺伝子操作CRISPR−Cas9ヌクレアーゼ |
| WO2017044843A1 (en) | 2015-09-11 | 2017-03-16 | The General Hospital Corporation | Full interrogation of nuclease dsbs and sequencing (find-seq) |
| JP2018529353A (ja) | 2015-09-30 | 2018-10-11 | ザ ジェネラル ホスピタル コーポレイション | 配列決定法による切断事象の包括的生体外報告(CIRCLE−seq) |
| WO2017070598A1 (en) | 2015-10-23 | 2017-04-27 | Caribou Biosciences, Inc. | Engineered crispr class 2 cross-type nucleic-acid targeting nucleic acids |
| CN108473981B (zh) | 2015-12-04 | 2022-04-12 | 卡里布生物科学公司 | 工程化靶向核酸的核酸 |
| US10876129B2 (en) | 2016-02-12 | 2020-12-29 | Ceres, Inc. | Methods and materials for high throughput testing of mutagenized allele combinations |
| CA3209273A1 (en) | 2016-06-02 | 2017-12-07 | Sigma-Aldrich Co. Llc | Using programmable dna binding proteins to enhance targeted genome modification |
| KR20190067209A (ko) | 2016-10-14 | 2019-06-14 | 더 제너럴 하스피탈 코포레이션 | 후성적으로 조절되는 부위-특이적 뉴클레아제 |
| US9816093B1 (en) | 2016-12-06 | 2017-11-14 | Caribou Biosciences, Inc. | Engineered nucleic acid-targeting nucleic acids |
| US11591589B2 (en) | 2017-04-21 | 2023-02-28 | The General Hospital Corporation | Variants of Cpf1 (Cas12a) with altered PAM specificity |
| EP3630849A4 (en) | 2017-05-25 | 2021-01-13 | The General Hospital Corporation | BIPARTITE BASIC EDITOR (BBE) AND TYPE II-C-CAS9 ZINC FINGER EDITOR ARCHITECTURES |
| CA3073448A1 (en) | 2017-08-23 | 2019-02-28 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
| US20190076814A1 (en) | 2017-09-11 | 2019-03-14 | Synthego Corporation | Biopolymer synthesis system and method |
| WO2019075197A1 (en) | 2017-10-11 | 2019-04-18 | The General Hospital Corporation | METHODS OF DETECTION OF INDIVIDUAL SITE-SPECIFIC PARASITE GENOMIC DEAMINATION BY BASE EDITING TECHNOLOGIES |
| GB2568255A (en) * | 2017-11-08 | 2019-05-15 | Evox Therapeutics Ltd | Exosomes comprising RNA therapeutics |
| US11661599B1 (en) | 2017-12-14 | 2023-05-30 | National Technology & Engineering Solutions Of Sandia, Llc | CRISPR-Cas based system for targeting single-stranded sequences |
| WO2019147743A1 (en) | 2018-01-26 | 2019-08-01 | Massachusetts Institute Of Technology | Structure-guided chemical modification of guide rna and its applications |
| CN108486098B (zh) * | 2018-03-06 | 2021-07-06 | 中山大学肿瘤防治中心(中山大学附属肿瘤医院、中山大学肿瘤研究所) | 一种用SLFN13从总RNA中纯化总mRNA的方法 |
| US11898203B2 (en) | 2018-04-17 | 2024-02-13 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents |
| US12227776B2 (en) | 2018-06-13 | 2025-02-18 | Caribou Biosciences, Inc. | Engineered cascade components and cascade complexes |
| US10227576B1 (en) | 2018-06-13 | 2019-03-12 | Caribou Biosciences, Inc. | Engineered cascade components and cascade complexes |
| US11946040B2 (en) | 2019-02-04 | 2024-04-02 | The General Hospital Corporation | Adenine DNA base editor variants with reduced off-target RNA editing |
| RU2707542C1 (ru) | 2019-03-28 | 2019-11-27 | Федеральное бюджетное учреждение науки "Центральный научно-исследовательский институт эпидемиологии" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора) | Способ получения препарата рекомбинантной нуклеазы CAS, по существу, свободного от бактериальных эндотоксинов, полученный данным способом препарат и содержащий его набор для использования в системе CRISPR/Cas |
| US11767524B2 (en) * | 2019-09-24 | 2023-09-26 | Abclonal Science, Inc. | His-MBP tagged DNA endonuclease for facilitated enzyme removal |
| WO2021151073A2 (en) | 2020-01-24 | 2021-07-29 | The General Hospital Corporation | Unconstrained genome targeting with near-pamless engineered crispr-cas9 variants |
| WO2021151085A2 (en) | 2020-01-24 | 2021-07-29 | The General Hospital Corporation | Crispr-cas enzymes with enhanced on-target activity |
| EP4596696A3 (en) | 2021-09-28 | 2025-08-27 | Acrigen Biosciences | Compositions and methods for nucleic acid modifications |
| US20230279442A1 (en) | 2021-12-15 | 2023-09-07 | Versitech Limited | Engineered cas9-nucleases and method of use thereof |
| CN114410635B (zh) * | 2022-03-29 | 2022-06-14 | 中国科学院天津工业生物技术研究所 | 威尼斯镰刀菌内源U6启动子及其基于CRISPR/Cas9的基因编辑方法 |
| CN115976080B (zh) * | 2022-11-28 | 2024-04-19 | 南方医科大学南方医院 | 一种鉴定与人脑lncRNA互作蛋白的载体及其应用 |
| WO2025213179A1 (en) * | 2024-04-05 | 2025-10-09 | New England Biolabs, Inc. | Compositions and methods for characterizing rna |
| WO2026006542A2 (en) | 2024-06-26 | 2026-01-02 | Yale University | Compositions and methods for crispr/cas9 based reactivation of human angelman syndrome |
Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5874304A (en) | 1996-01-18 | 1999-02-23 | University Of Florida Research Foundation, Inc. | Humanized green fluorescent protein genes and methods |
| US5919445A (en) | 1996-10-09 | 1999-07-06 | Council Of Agriculture Executive Yuan | Use of green fluorescent protein to trace the infection of baculovirus in insects and to increase viral UV stability |
| US5958713A (en) | 1995-01-31 | 1999-09-28 | Novo Nordisk A/S | Method of detecting biologically active substances by using green fluorescent protein |
| US5968738A (en) | 1995-12-06 | 1999-10-19 | The Board Of Trustees Of The Leland Stanford Junior University | Two-reporter FACS analysis of mammalian cells using green fluorescent proteins |
| US5976796A (en) | 1996-10-04 | 1999-11-02 | Loma Linda University | Construction and expression of renilla luciferase and green fluorescent protein fusion genes |
| US5985577A (en) | 1998-10-14 | 1999-11-16 | The Trustees Of Columbia University In The City Of New York | Protein conjugates containing multimers of green fluorescent protein |
| US5990479A (en) | 1997-11-25 | 1999-11-23 | Regents Of The University Of California | Organo Luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US6020192A (en) | 1996-01-18 | 2000-02-01 | University Of Florida | Humanized green fluorescent protein genes and methods |
| US6066476A (en) | 1994-11-10 | 2000-05-23 | The Regents Of The University Of California | Modified green fluorescent proteins |
| US6207392B1 (en) | 1997-11-25 | 2001-03-27 | The Regents Of The University Of California | Semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US6251303B1 (en) | 1998-09-18 | 2001-06-26 | Massachusetts Institute Of Technology | Water-soluble fluorescent nanocrystals |
| US6306610B1 (en) | 1998-09-18 | 2001-10-23 | Massachusetts Institute Of Technology | Biological applications of quantum dots |
| US6322901B1 (en) | 1997-11-13 | 2001-11-27 | Massachusetts Institute Of Technology | Highly luminescent color-selective nano-crystalline materials |
| US6325144B1 (en) | 2000-06-09 | 2001-12-04 | Baker Hughes, Inc. | Inflatable packer with feed-thru conduits |
| US6426513B1 (en) | 1998-09-18 | 2002-07-30 | Massachusetts Institute Of Technology | Water-soluble thiol-capped nanocrystals |
| US6576291B2 (en) | 2000-12-08 | 2003-06-10 | Massachusetts Institute Of Technology | Preparation of nanocrystallites |
| US6649138B2 (en) | 2000-10-13 | 2003-11-18 | Quantum Dot Corporation | Surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media |
| US6815064B2 (en) | 2001-07-20 | 2004-11-09 | Quantum Dot Corporation | Luminescent nanoparticles and methods for their preparation |
Family Cites Families (35)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5585362A (en) | 1989-08-22 | 1996-12-17 | The Regents Of The University Of Michigan | Adenovirus vectors for gene therapy |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| DE69233013T2 (de) | 1991-08-20 | 2004-03-04 | The Government Of The United States Of America As Represented By The Secretary Of National Institute Of Health, Office Of Technology Transfer | Adenovirus vermittelter gentransfer in den gastrointestinaltrakt |
| US5252479A (en) | 1991-11-08 | 1993-10-12 | Research Corporation Technologies, Inc. | Safe vector for gene therapy |
| FR2688514A1 (fr) | 1992-03-16 | 1993-09-17 | Centre Nat Rech Scient | Adenovirus recombinants defectifs exprimant des cytokines et medicaments antitumoraux les contenant. |
| EP1024198A3 (en) | 1992-12-03 | 2002-05-29 | Genzyme Corporation | Pseudo-adenoviral vectors for the gene therapy of haemophiliae |
| EP0705344B8 (en) | 1993-06-24 | 2006-05-10 | Advec Inc. | Adenovirus vectors for gene therapy |
| AU687117B2 (en) | 1993-10-25 | 1998-02-19 | Canji, Inc. | Recombinant adenoviral vector and methods of use |
| KR100551104B1 (ko) | 1994-12-09 | 2006-02-09 | 임페리얼 컬리지 이노베이션스 리미티드 | 유전자의 동정 |
| US6080849A (en) | 1997-09-10 | 2000-06-27 | Vion Pharmaceuticals, Inc. | Genetically modified tumor-targeted bacteria with reduced virulence |
| GB0105924D0 (en) | 2001-03-09 | 2001-04-25 | Microscience Ltd | Promoter |
| AU2002306849A1 (en) * | 2001-03-21 | 2002-10-08 | Elitra Pharmaceuticals, Inc. | Identification of essential genes in microorganisms |
| US7268229B2 (en) | 2001-11-02 | 2007-09-11 | Promega Corporation | Compounds to co-localize luminophores with luminescent proteins |
| EP2298869A1 (en) * | 2003-06-13 | 2011-03-23 | University Of Medicine And Dentistry Of New Jersey | Recombinant protein production in the presence of mRNA interferase |
| WO2005074986A2 (en) * | 2004-02-10 | 2005-08-18 | Genobiotix Aps | Bioactive species capable of interfering with a microbial toxin-antitoxin complex and methods for evaluation and use of said bioactive species |
| US7919277B2 (en) | 2004-04-28 | 2011-04-05 | Danisco A/S | Detection and typing of bacterial strains |
| JPWO2006123537A1 (ja) * | 2005-05-16 | 2008-12-25 | タカラバイオ株式会社 | 新規なエンドリボヌクレア−ゼ |
| US8017356B2 (en) | 2005-07-26 | 2011-09-13 | Takara Bio Inc. | Endoribonuclease |
| DK2341149T3 (en) | 2005-08-26 | 2017-02-27 | Dupont Nutrition Biosci Aps | Use of CRISPR-associated genes (Cas) |
| US7745190B2 (en) * | 2005-09-21 | 2010-06-29 | Takara Bio Inc. | Endoribonuclease |
| DK2426220T3 (en) | 2006-05-19 | 2016-09-26 | Dupont Nutrition Biosci Aps | Labeled microorganisms, and methods for labeling |
| US8431698B2 (en) | 2007-08-29 | 2013-04-30 | Biolume Inc. | Bioluminescent endoscopy methods and compounds |
| WO2010011961A2 (en) * | 2008-07-25 | 2010-01-28 | University Of Georgia Research Foundation, Inc. | Prokaryotic rnai-like system and methods of use |
| US9404098B2 (en) | 2008-11-06 | 2016-08-02 | University Of Georgia Research Foundation, Inc. | Method for cleaving a target RNA using a Cas6 polypeptide |
| US10662227B2 (en) | 2008-11-07 | 2020-05-26 | Dupont Nutrition Biosciences Aps | Bifidobacteria CRISPR sequences |
| WO2010066907A1 (en) | 2008-12-12 | 2010-06-17 | Danisco A/S | Genetic cluster of strains of streptococcus thermophilus having unique rheological properties for dairy fermentation |
| MX2012013037A (es) | 2010-05-10 | 2013-07-29 | Univ California | Composiciones de endorribonucleasa y metodos de uso de las mismas. |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| UA115772C2 (uk) | 2011-12-16 | 2017-12-26 | Таргітджин Байотекнолоджиз Лтд | Композиція програмованого нуклеопротеїнового молекулярного комплексу і спосіб модифікування заданої послідовності нуклеїнової кислоти-мішені |
| GB201122458D0 (en) | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
| WO2013141680A1 (en) | 2012-03-20 | 2013-09-26 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US9637739B2 (en) | 2012-03-20 | 2017-05-02 | Vilnius University | RNA-directed DNA cleavage by the Cas9-crRNA complex |
| WO2014022702A2 (en) | 2012-08-03 | 2014-02-06 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by rna processing |
-
2011
- 2011-05-09 MX MX2012013037A patent/MX2012013037A/es active IP Right Grant
- 2011-05-09 JP JP2013510211A patent/JP5926242B2/ja not_active Expired - Fee Related
- 2011-05-09 EP EP11781086.1A patent/EP2569425B1/en not_active Not-in-force
- 2011-05-09 SG SG2012082426A patent/SG185481A1/en unknown
- 2011-05-09 WO PCT/US2011/035775 patent/WO2011143124A2/en not_active Ceased
- 2011-05-09 DK DK11781086.1T patent/DK2569425T3/en active
- 2011-05-09 CN CN201180033802.7A patent/CN103038338B/zh not_active Expired - Fee Related
- 2011-05-09 AU AU2011253222A patent/AU2011253222B2/en not_active Ceased
- 2011-05-09 EP EP16167704.2A patent/EP3078753B1/en not_active Not-in-force
- 2011-05-09 BR BR112012028805-9A patent/BR112012028805A2/pt not_active IP Right Cessation
- 2011-05-09 KR KR1020127031818A patent/KR101867359B1/ko not_active Expired - Fee Related
- 2011-05-09 CA CA2798703A patent/CA2798703A1/en not_active Abandoned
- 2011-05-09 ES ES11781086.1T patent/ES2590343T3/es active Active
- 2011-05-09 EA EA201291024A patent/EA024121B9/ru not_active IP Right Cessation
-
2012
- 2012-11-07 US US13/671,120 patent/US9115348B2/en active Active
-
2015
- 2015-06-10 US US14/735,383 patent/US9605246B2/en not_active Expired - Fee Related
-
2017
- 2017-02-10 US US15/430,054 patent/US9708646B2/en not_active Expired - Fee Related
Patent Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6066476A (en) | 1994-11-10 | 2000-05-23 | The Regents Of The University Of California | Modified green fluorescent proteins |
| US5958713A (en) | 1995-01-31 | 1999-09-28 | Novo Nordisk A/S | Method of detecting biologically active substances by using green fluorescent protein |
| US5968738A (en) | 1995-12-06 | 1999-10-19 | The Board Of Trustees Of The Leland Stanford Junior University | Two-reporter FACS analysis of mammalian cells using green fluorescent proteins |
| US5968750A (en) | 1996-01-18 | 1999-10-19 | The University Of Florida Research Foundation Inc. | Humanized green fluorescent protein genes and methods |
| US5874304A (en) | 1996-01-18 | 1999-02-23 | University Of Florida Research Foundation, Inc. | Humanized green fluorescent protein genes and methods |
| US6020192A (en) | 1996-01-18 | 2000-02-01 | University Of Florida | Humanized green fluorescent protein genes and methods |
| US5976796A (en) | 1996-10-04 | 1999-11-02 | Loma Linda University | Construction and expression of renilla luciferase and green fluorescent protein fusion genes |
| US5919445A (en) | 1996-10-09 | 1999-07-06 | Council Of Agriculture Executive Yuan | Use of green fluorescent protein to trace the infection of baculovirus in insects and to increase viral UV stability |
| US6322901B1 (en) | 1997-11-13 | 2001-11-27 | Massachusetts Institute Of Technology | Highly luminescent color-selective nano-crystalline materials |
| US6207392B1 (en) | 1997-11-25 | 2001-03-27 | The Regents Of The University Of California | Semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US5990479A (en) | 1997-11-25 | 1999-11-23 | Regents Of The University Of California | Organo Luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US6423551B1 (en) | 1997-11-25 | 2002-07-23 | The Regents Of The University Of California | Organo luminescent semiconductor nanocrystal probes for biological applications and process for making and using such probes |
| US6251303B1 (en) | 1998-09-18 | 2001-06-26 | Massachusetts Institute Of Technology | Water-soluble fluorescent nanocrystals |
| US6306610B1 (en) | 1998-09-18 | 2001-10-23 | Massachusetts Institute Of Technology | Biological applications of quantum dots |
| US6319426B1 (en) | 1998-09-18 | 2001-11-20 | Massachusetts Institute Of Technology | Water-soluble fluorescent semiconductor nanocrystals |
| US6426513B1 (en) | 1998-09-18 | 2002-07-30 | Massachusetts Institute Of Technology | Water-soluble thiol-capped nanocrystals |
| US6444143B2 (en) | 1998-09-18 | 2002-09-03 | Massachusetts Institute Of Technology | Water-soluble fluorescent nanocrystals |
| US5985577A (en) | 1998-10-14 | 1999-11-16 | The Trustees Of Columbia University In The City Of New York | Protein conjugates containing multimers of green fluorescent protein |
| US6325144B1 (en) | 2000-06-09 | 2001-12-04 | Baker Hughes, Inc. | Inflatable packer with feed-thru conduits |
| US6649138B2 (en) | 2000-10-13 | 2003-11-18 | Quantum Dot Corporation | Surface-modified semiconductive and metallic nanoparticles having enhanced dispersibility in aqueous media |
| US6576291B2 (en) | 2000-12-08 | 2003-06-10 | Massachusetts Institute Of Technology | Preparation of nanocrystallites |
| US6815064B2 (en) | 2001-07-20 | 2004-11-09 | Quantum Dot Corporation | Luminescent nanoparticles and methods for their preparation |
Non-Patent Citations (3)
| Title |
|---|
| EBIHARA ET AL., PROTEIN SCI., vol. 15, 2006, pages 1494 - 9 |
| MATZ ET AL., NATURE BIOTECHNOL., vol. 17, 1999, pages 969 - 973 |
| See also references of EP2569425A4 |
Cited By (355)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9605246B2 (en) | 2010-05-10 | 2017-03-28 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| US9708646B2 (en) | 2010-05-10 | 2017-07-18 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| US9115348B2 (en) | 2010-05-10 | 2015-08-25 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| US12338444B2 (en) | 2011-03-23 | 2025-06-24 | Pioneer Hi-Bred International, Inc. | Methods for producing a complex transgenic trait locus |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12467086B2 (en) | 2011-10-14 | 2025-11-11 | President And Fellows Of Harvard College | Sequencing by structure assembly |
| US11566276B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293052B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11566277B2 (en) | 2011-12-22 | 2023-01-31 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11549136B2 (en) | 2011-12-22 | 2023-01-10 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11111521B2 (en) | 2011-12-22 | 2021-09-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11639518B2 (en) | 2011-12-22 | 2023-05-02 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11976318B2 (en) | 2011-12-22 | 2024-05-07 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11293051B2 (en) | 2011-12-22 | 2022-04-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
| US11939604B2 (en) | 2011-12-30 | 2024-03-26 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10435678B2 (en) | 2011-12-30 | 2019-10-08 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10711257B2 (en) | 2011-12-30 | 2020-07-14 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10954498B2 (en) | 2011-12-30 | 2021-03-23 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US12123015B2 (en) | 2012-05-25 | 2024-10-22 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US20220267807A1 (en) * | 2012-05-25 | 2022-08-25 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US12180504B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180503B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12215343B2 (en) | 2012-05-25 | 2025-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| WO2013188037A3 (en) * | 2012-06-11 | 2015-06-25 | Agilent Technologies, Inc | Method of adaptor-dimer subtraction using a crispr cas6 protein |
| US9102936B2 (en) | 2012-06-11 | 2015-08-11 | Agilent Technologies, Inc. | Method of adaptor-dimer subtraction using a CRISPR CAS6 protein |
| WO2013188638A3 (en) * | 2012-06-15 | 2014-03-20 | The Regents Of The University Of California | Endoribonucleases and methods of use thereof |
| US9688971B2 (en) | 2012-06-15 | 2017-06-27 | The Regents Of The University Of California | Endoribonuclease and methods of use thereof |
| US11384360B2 (en) | 2012-06-19 | 2022-07-12 | Regents Of The University Of Minnesota | Gene targeting in plants using DNA viruses |
| EP2877213A2 (en) | 2012-07-25 | 2015-06-03 | The Broad Institute, Inc. | Inducible dna binding proteins and genome perturbation tools and applications thereof |
| WO2014022702A2 (en) | 2012-08-03 | 2014-02-06 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by rna processing |
| WO2014022702A3 (en) * | 2012-08-03 | 2014-05-01 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by rna processing |
| EP2880171A4 (en) * | 2012-08-03 | 2016-03-09 | Univ California | METHOD AND COMPOSITIONS FOR CONTROLLING GENE EXPRESSION BY RNA PROCESSING |
| US9745610B2 (en) | 2012-08-03 | 2017-08-29 | The Regents Of The University Of California | Methods and compositions for controlling gene expression by RNA processing |
| US11236359B2 (en) | 2012-12-17 | 2022-02-01 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US10273501B2 (en) | 2012-12-17 | 2019-04-30 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11512325B2 (en) | 2012-12-17 | 2022-11-29 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11365429B2 (en) | 2012-12-17 | 2022-06-21 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9023649B2 (en) | 2012-12-17 | 2015-05-05 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US10435708B2 (en) | 2012-12-17 | 2019-10-08 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US12612643B2 (en) | 2012-12-17 | 2026-04-28 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11359211B2 (en) | 2012-12-17 | 2022-06-14 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US10717990B2 (en) | 2012-12-17 | 2020-07-21 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US11535863B2 (en) | 2012-12-17 | 2022-12-27 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9970024B2 (en) | 2012-12-17 | 2018-05-15 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US9260723B2 (en) | 2012-12-17 | 2016-02-16 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US12018272B2 (en) | 2012-12-17 | 2024-06-25 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| US12264358B2 (en) | 2013-03-12 | 2025-04-01 | President And Fellows Of Harvard College | Method of selectively sequencing amplicons in a biological sample |
| US11299767B2 (en) | 2013-03-12 | 2022-04-12 | President And Fellows Of Harvard College | Method for generating a three-dimensional nucleic acid containing matrix |
| US11312953B2 (en) | 2013-03-14 | 2022-04-26 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9809814B1 (en) | 2013-03-14 | 2017-11-07 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| WO2014150624A1 (en) * | 2013-03-14 | 2014-09-25 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10125361B2 (en) | 2013-03-14 | 2018-11-13 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| GB2527450A (en) * | 2013-03-14 | 2015-12-23 | Caribou Biosciences Inc | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9410198B2 (en) | 2013-03-14 | 2016-08-09 | Caribou Biosciences, Inc. | Compostions and methods of nucleic acid-targeting nucleic acids |
| US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9909122B2 (en) | 2013-03-14 | 2018-03-06 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| KR101780885B1 (ko) | 2013-03-14 | 2017-10-11 | 카리부 바이오사이언시스 인코포레이티드 | 핵산-표적화 핵산의 조성물 및 방법 |
| US9803194B2 (en) | 2013-03-14 | 2017-10-31 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US11098326B2 (en) | 2013-03-15 | 2021-08-24 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| US10138476B2 (en) | 2013-03-15 | 2018-11-27 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| US9885033B2 (en) | 2013-03-15 | 2018-02-06 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
| US10119133B2 (en) | 2013-03-15 | 2018-11-06 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
| US12065668B2 (en) | 2013-03-15 | 2024-08-20 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US10844403B2 (en) | 2013-03-15 | 2020-11-24 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
| US10378027B2 (en) | 2013-03-15 | 2019-08-13 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US11634731B2 (en) | 2013-03-15 | 2023-04-25 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
| US11920152B2 (en) | 2013-03-15 | 2024-03-05 | The General Hospital Corporation | Increasing specificity for RNA-guided genome editing |
| US10544433B2 (en) | 2013-03-15 | 2020-01-28 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| US10760064B2 (en) | 2013-03-15 | 2020-09-01 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US10415059B2 (en) | 2013-03-15 | 2019-09-17 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
| US11168338B2 (en) | 2013-03-15 | 2021-11-09 | The General Hospital Corporation | RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US9567603B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing |
| US9567604B2 (en) | 2013-03-15 | 2017-02-14 | The General Hospital Corporation | Using truncated guide RNAs (tru-gRNAs) to increase specificity for RNA-guided genome editing |
| US10526589B2 (en) | 2013-03-15 | 2020-01-07 | The General Hospital Corporation | Multiplex guide RNAs |
| US9902973B2 (en) | 2013-04-11 | 2018-02-27 | Caribou Biosciences, Inc. | Methods of modifying a target nucleic acid with an argonaute |
| US9267135B2 (en) | 2013-06-04 | 2016-02-23 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US10640789B2 (en) | 2013-06-04 | 2020-05-05 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US10767194B2 (en) | 2013-06-04 | 2020-09-08 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US11981917B2 (en) | 2013-06-04 | 2024-05-14 | President And Fellows Of Harvard College | RNA-guided transcriptional regulation |
| US10011850B2 (en) | 2013-06-21 | 2018-07-03 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to increase specificity for RNA-Guided Genome Editing |
| US12577590B2 (en) | 2013-07-10 | 2026-03-17 | President And Fellows Of Harvard College | Orthogonal Cas9 proteins for RNA-guided gene regulation and editing |
| US9587252B2 (en) | 2013-07-10 | 2017-03-07 | President And Fellows Of Harvard College | Orthogonal Cas9 proteins for RNA-guided gene regulation and editing |
| US11649469B2 (en) | 2013-07-10 | 2023-05-16 | President And Fellows Of Harvard College | Orthogonal Cas9 proteins for RNA-guided gene regulation and editing |
| US10329587B2 (en) | 2013-07-10 | 2019-06-25 | President And Fellows Of Harvard College | Orthogonal Cas9 proteins for RNA-guided gene regulation and editing |
| US10563225B2 (en) | 2013-07-26 | 2020-02-18 | President And Fellows Of Harvard College | Genome engineering |
| US12473575B2 (en) | 2013-07-26 | 2025-11-18 | President And Fellows Of Harvard College | Genome engineering |
| US11306328B2 (en) | 2013-07-26 | 2022-04-19 | President And Fellows Of Harvard College | Genome engineering |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US12378566B2 (en) | 2013-08-22 | 2025-08-05 | Pioneer Hi-Bred International, Inc. | Plant genome modification using guide RNA/Cas endonuclease systems and methods of use |
| US11773400B2 (en) | 2013-08-22 | 2023-10-03 | E.I. Du Pont De Nemours And Company | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US10519457B2 (en) | 2013-08-22 | 2019-12-31 | E I Du Pont De Nemours And Company | Soybean U6 polymerase III promoter and methods of use |
| US12428645B2 (en) | 2013-08-22 | 2025-09-30 | Pioneer Hi-Bred International, Inc. | Methods for producing genetic modifications in a plant genome without incorporating a selectable transgene marker, and compositions thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12559737B2 (en) | 2013-09-06 | 2026-02-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US20160237451A1 (en) * | 2013-09-30 | 2016-08-18 | Regents Of The University Of Minnesota | Conferring resistance to geminiviruses in plants using crispr/cas systems |
| WO2015048707A3 (en) * | 2013-09-30 | 2015-05-21 | Regents Of The University Of Minnesota | Conferring resistance to geminiviruses in plants using crispr/cas systems |
| US10640788B2 (en) | 2013-11-07 | 2020-05-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAs |
| US9834791B2 (en) | 2013-11-07 | 2017-12-05 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10190137B2 (en) | 2013-11-07 | 2019-01-29 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US11390887B2 (en) | 2013-11-07 | 2022-07-19 | Editas Medicine, Inc. | CRISPR-related methods and compositions with governing gRNAS |
| US10100291B2 (en) | 2013-11-19 | 2018-10-16 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US10683490B2 (en) | 2013-11-19 | 2020-06-16 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US10435679B2 (en) | 2013-11-19 | 2019-10-08 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US11286470B2 (en) | 2013-11-19 | 2022-03-29 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US9074199B1 (en) | 2013-11-19 | 2015-07-07 | President And Fellows Of Harvard College | Mutant Cas9 proteins |
| US10787684B2 (en) | 2013-11-19 | 2020-09-29 | President And Fellows Of Harvard College | Large gene excision and insertion |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| CN113684205A (zh) * | 2013-12-26 | 2021-11-23 | 通用医疗公司 | 多重引导rna |
| CN106103706A (zh) * | 2013-12-26 | 2016-11-09 | 通用医疗公司 | 多重引导rna |
| EP3985124A1 (en) * | 2013-12-26 | 2022-04-20 | The General Hospital Corporation | Multiplex guide rnas |
| CN113684205B (zh) * | 2013-12-26 | 2024-11-12 | 通用医疗公司 | 多重引导rna |
| US20200165587A1 (en) * | 2013-12-26 | 2020-05-28 | The General Hospital Corporation | Multiplex Guide RNAS |
| WO2015099850A1 (en) * | 2013-12-26 | 2015-07-02 | The General Hospital Corporation | Multiplex guide rnas |
| AU2014370416B2 (en) * | 2013-12-26 | 2021-03-11 | The General Hospital Corporation | Multiplex guide RNAs |
| US11028388B2 (en) | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
| US11268086B2 (en) | 2014-03-10 | 2022-03-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
| US9938521B2 (en) | 2014-03-10 | 2018-04-10 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating leber's congenital amaurosis 10 (LCA10) |
| US12234449B2 (en) | 2014-03-10 | 2025-02-25 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Leber's congenital amaurosis 10 (LCA10) |
| US11141493B2 (en) | 2014-03-10 | 2021-10-12 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US10253312B2 (en) | 2014-03-10 | 2019-04-09 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating Leber's Congenital Amaurosis 10 (LCA10) |
| US11339437B2 (en) | 2014-03-10 | 2022-05-24 | Editas Medicine, Inc. | Compositions and methods for treating CEP290-associated disease |
| US11242525B2 (en) | 2014-03-26 | 2022-02-08 | Editas Medicine, Inc. | CRISPR/CAS-related methods and compositions for treating sickle cell disease |
| US12460231B2 (en) | 2014-04-02 | 2025-11-04 | Editas Medicine, Inc. | Crispr/CAS-related methods and compositions for treating primary open angle glaucoma |
| US12331347B2 (en) | 2014-07-11 | 2025-06-17 | President And Fellows Of Harvard College | Methods for high-throughput labelling and detection of biological features in situ using microscopy |
| US10676754B2 (en) | 2014-07-11 | 2020-06-09 | E I Du Pont De Nemours And Company | Compositions and methods for producing plants resistant to glyphosate herbicide |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12173294B2 (en) | 2014-09-12 | 2024-12-24 | Corteva Agriscience Llc | Generation of site specific integration sites for complex trait loci in corn and soybean, and methods of use |
| US11560568B2 (en) | 2014-09-12 | 2023-01-24 | E. I. Du Pont De Nemours And Company | Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use |
| US9650617B2 (en) | 2015-01-28 | 2017-05-16 | Pioneer Hi-Bred International. Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US9688972B2 (en) | 2015-01-28 | 2017-06-27 | Pioneer Hi-Bred International, Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US9771601B2 (en) | 2015-01-28 | 2017-09-26 | Pioneer Hi-Bred International. Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US9580701B2 (en) | 2015-01-28 | 2017-02-28 | Pioneer Hi-Bred International, Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US11236364B2 (en) | 2015-01-28 | 2022-02-01 | Caribou Biosciences, Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US10519468B2 (en) | 2015-01-28 | 2019-12-31 | Pioneer Hi-Bred International, Inc. | Cells containing CRISPR hybrid DNA/RNA polynucleotides |
| US10988781B2 (en) | 2015-01-28 | 2021-04-27 | Caribou Biosciences, Inc. | Method of target cleaving using CRISPR hybrid DNA/RNA polynucleotides |
| US11459588B2 (en) | 2015-01-28 | 2022-10-04 | Caribou Biosciences, Inc. | Methods of use of CRISPR CPF1 hybrid DNA/RNA polynucleotides |
| US9868962B2 (en) | 2015-01-28 | 2018-01-16 | Pioneer Hi-Bred International, Inc. | CRISPR hybrid DNA/RNA polynucleotides and methods of use |
| US10450576B2 (en) | 2015-03-27 | 2019-10-22 | E I Du Pont De Nemours And Company | Soybean U6 small nuclear RNA gene promoters and their use in constitutive expression of small RNA genes in plants |
| US11180793B2 (en) | 2015-04-24 | 2021-11-23 | Editas Medicine, Inc. | Evaluation of Cas9 molecule/guide RNA molecule complexes |
| US10526591B2 (en) | 2015-08-28 | 2020-01-07 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US10633642B2 (en) | 2015-08-28 | 2020-04-28 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US10093910B2 (en) | 2015-08-28 | 2018-10-09 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US9512446B1 (en) | 2015-08-28 | 2016-12-06 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US11060078B2 (en) | 2015-08-28 | 2021-07-13 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11542554B2 (en) | 2015-11-03 | 2023-01-03 | President And Fellows Of Harvard College | Method and apparatus for volumetric imaging |
| US11512311B2 (en) | 2016-03-25 | 2022-11-29 | Editas Medicine, Inc. | Systems and methods for treating alpha 1-antitrypsin (A1AT) deficiency |
| US11713485B2 (en) | 2016-04-25 | 2023-08-01 | President And Fellows Of Harvard College | Hybridization chain reaction methods for in situ molecular detection |
| US11293021B1 (en) | 2016-06-23 | 2022-04-05 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US11566263B2 (en) | 2016-08-02 | 2023-01-31 | Editas Medicine, Inc. | Compositions and methods for treating CEP290 associated disease |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12565671B2 (en) | 2016-08-31 | 2026-03-03 | President And Fellows Of Harvard College | Methods of combining the detection of biomolecules into a single assay using fluorescent in situ sequencing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11851690B2 (en) | 2017-03-14 | 2023-12-26 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11840711B2 (en) | 2017-04-12 | 2023-12-12 | The Broad Institute, Inc. | Type VI CRISPR orthologs and systems |
| US12058986B2 (en) | 2017-04-20 | 2024-08-13 | Egenesis, Inc. | Method for generating a genetically modified pig with inactivated porcine endogenous retrovirus (PERV) elements |
| US11963982B2 (en) | 2017-05-10 | 2024-04-23 | Editas Medicine, Inc. | CRISPR/RNA-guided nuclease systems and methods |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12180502B2 (en) | 2017-06-23 | 2024-12-31 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11408012B2 (en) | 2017-06-23 | 2022-08-09 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11697826B2 (en) | 2017-06-23 | 2023-07-11 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11130970B2 (en) | 2017-06-23 | 2021-09-28 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11220697B2 (en) | 2017-06-23 | 2022-01-11 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11306327B1 (en) | 2017-06-23 | 2022-04-19 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US12195749B2 (en) | 2017-06-23 | 2025-01-14 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11034953B1 (en) | 2017-06-30 | 2021-06-15 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10689645B1 (en) | 2017-06-30 | 2020-06-23 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10519437B1 (en) | 2017-06-30 | 2019-12-31 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10738301B1 (en) | 2017-06-30 | 2020-08-11 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US11597921B2 (en) | 2017-06-30 | 2023-03-07 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10954512B1 (en) | 2017-06-30 | 2021-03-23 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US11203751B2 (en) | 2017-06-30 | 2021-12-21 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10894958B1 (en) | 2017-06-30 | 2021-01-19 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10584333B1 (en) | 2017-06-30 | 2020-03-10 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10647982B1 (en) | 2017-06-30 | 2020-05-12 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10584334B1 (en) | 2017-06-30 | 2020-03-10 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US10787663B1 (en) | 2017-06-30 | 2020-09-29 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US10787683B1 (en) | 2017-08-28 | 2020-09-29 | Inscripta, Inc. | Electroporation cuvettes for automation |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US10822621B2 (en) | 2017-09-30 | 2020-11-03 | Inscripta, Inc. | Automated nucleic acid assembly and introduction of nucleic acids into cells |
| US10508288B1 (en) | 2017-09-30 | 2019-12-17 | Inscripta, Inc. | Automated cell processing methods, modules, instruments, and systems comprising flow-through electroporation devices |
| US10851389B2 (en) | 2017-09-30 | 2020-12-01 | Inscripta, Inc. | Modification of cells by introduction of exogenous material |
| US10557150B1 (en) | 2017-09-30 | 2020-02-11 | Inscripta, Inc. | Automated nucleic acid assembly and introduction of nucleic acids into cells |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12084676B2 (en) | 2018-02-23 | 2024-09-10 | Pioneer Hi-Bred International, Inc. | Cas9 orthologs |
| US12031132B2 (en) | 2018-03-14 | 2024-07-09 | Editas Medicine, Inc. | Systems and methods for the treatment of hemoglobinopathies |
| US10883077B2 (en) | 2018-03-29 | 2021-01-05 | Inscripta, Inc. | Methods for controlling the growth of prokaryotic and eukaryotic cells |
| US10590375B2 (en) | 2018-03-29 | 2020-03-17 | Inscripta, Inc. | Methods for controlling the growth of prokaryotic and eukaryotic cells |
| US10717959B2 (en) | 2018-03-29 | 2020-07-21 | Inscripta, Inc. | Methods for controlling the growth of prokaryotic and eukaryotic cells |
| US10639637B1 (en) | 2018-04-13 | 2020-05-05 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
| US10737271B1 (en) | 2018-04-13 | 2020-08-11 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
| US10576474B2 (en) | 2018-04-13 | 2020-03-03 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
| US10799868B1 (en) | 2018-04-13 | 2020-10-13 | Inscripta, Inc. | Automated cell processing instruments comprising reagent cartridges |
| US10858761B2 (en) | 2018-04-24 | 2020-12-08 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US11542633B2 (en) | 2018-04-24 | 2023-01-03 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US10774324B2 (en) | 2018-04-24 | 2020-09-15 | Inscripta, Inc. | Automated instrumentation for production of peptide libraries |
| US11332850B2 (en) | 2018-04-24 | 2022-05-17 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US10774446B1 (en) | 2018-04-24 | 2020-09-15 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US10501738B2 (en) | 2018-04-24 | 2019-12-10 | Inscripta, Inc. | Automated instrumentation for production of peptide libraries |
| US11473214B2 (en) | 2018-04-24 | 2022-10-18 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US10711374B1 (en) | 2018-04-24 | 2020-07-14 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US11293117B2 (en) | 2018-04-24 | 2022-04-05 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US10676842B2 (en) | 2018-04-24 | 2020-06-09 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US10557216B2 (en) | 2018-04-24 | 2020-02-11 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US10995424B2 (en) | 2018-04-24 | 2021-05-04 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US10526598B2 (en) | 2018-04-24 | 2020-01-07 | Inscripta, Inc. | Methods for identifying T-cell receptor antigens |
| US11396718B2 (en) | 2018-04-24 | 2022-07-26 | Inscripta, Inc. | Automated instrumentation for production of T-cell receptor peptide libraries |
| US11236441B2 (en) | 2018-04-24 | 2022-02-01 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US10508273B2 (en) | 2018-04-24 | 2019-12-17 | Inscripta, Inc. | Methods for identifying selective binding pairs |
| US11555184B2 (en) | 2018-04-24 | 2023-01-17 | Inscripta, Inc. | Methods for identifying selective binding pairs |
| US11085131B1 (en) | 2018-04-24 | 2021-08-10 | Inscripta, Inc. | Nucleic acid-guided editing of exogenous polynucleotides in heterologous cells |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US10625212B2 (en) | 2018-08-14 | 2020-04-21 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11142740B2 (en) | 2018-08-14 | 2021-10-12 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US11072774B2 (en) | 2018-08-14 | 2021-07-27 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10532324B1 (en) | 2018-08-14 | 2020-01-14 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10801008B1 (en) | 2018-08-14 | 2020-10-13 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10633627B2 (en) | 2018-08-14 | 2020-04-28 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11046928B2 (en) | 2018-08-14 | 2021-06-29 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11365383B1 (en) | 2018-08-14 | 2022-06-21 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US10633626B2 (en) | 2018-08-14 | 2020-04-28 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10760043B2 (en) | 2018-08-14 | 2020-09-01 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10954485B1 (en) | 2018-08-14 | 2021-03-23 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10835869B1 (en) | 2018-08-14 | 2020-11-17 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10647958B2 (en) | 2018-08-14 | 2020-05-12 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11685889B2 (en) | 2018-08-14 | 2023-06-27 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US10844344B2 (en) | 2018-08-14 | 2020-11-24 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11268061B2 (en) | 2018-08-14 | 2022-03-08 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US10723995B1 (en) | 2018-08-14 | 2020-07-28 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10744463B2 (en) | 2018-08-14 | 2020-08-18 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11739290B2 (en) | 2018-08-14 | 2023-08-29 | Inscripta, Inc | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US10752874B2 (en) | 2018-08-14 | 2020-08-25 | Inscripta, Inc. | Instruments, modules, and methods for improved detection of edited sequences in live cells |
| US11965154B2 (en) | 2018-08-30 | 2024-04-23 | Inscripta, Inc. | Detection of nuclease edited sequences in automated modules and instruments |
| US12098425B2 (en) | 2018-10-10 | 2024-09-24 | Readcoor, Llc | Three-dimensional spatial molecular indexing |
| US10640754B1 (en) | 2018-10-22 | 2020-05-05 | Inscripta, Inc. | Engineered enzymes |
| US11345903B2 (en) | 2018-10-22 | 2022-05-31 | Inscripta, Inc. | Engineered enzymes |
| US10604746B1 (en) | 2018-10-22 | 2020-03-31 | Inscripta, Inc. | Engineered enzymes |
| US10655114B1 (en) | 2018-10-22 | 2020-05-19 | Inscripta, Inc. | Engineered enzymes |
| US10876102B2 (en) | 2018-10-22 | 2020-12-29 | Inscripta, Inc. | Engineered enzymes |
| US12146170B2 (en) | 2018-10-22 | 2024-11-19 | Inscripta, Inc. | Engineered enzyme |
| US11214781B2 (en) | 2018-10-22 | 2022-01-04 | Inscripta, Inc. | Engineered enzyme |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US11807878B2 (en) | 2018-12-14 | 2023-11-07 | Pioneer Hi-Bred International, Inc. | CRISPR-Cas systems for genome editing |
| US12365888B2 (en) | 2018-12-14 | 2025-07-22 | Pioneer Hi-Bred International, Inc. | CRISPR-Cas systems for genome editing |
| US12215364B2 (en) | 2018-12-14 | 2025-02-04 | Pioneer Hi-Bred International, Inc. | CRISPR-cas systems for genome editing |
| US10934536B2 (en) | 2018-12-14 | 2021-03-02 | Pioneer Hi-Bred International, Inc. | CRISPR-CAS systems for genome editing |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11274296B2 (en) | 2019-03-25 | 2022-03-15 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US10815467B2 (en) | 2019-03-25 | 2020-10-27 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11136572B2 (en) | 2019-03-25 | 2021-10-05 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11279919B2 (en) | 2019-03-25 | 2022-03-22 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11746347B2 (en) | 2019-03-25 | 2023-09-05 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11001831B2 (en) | 2019-03-25 | 2021-05-11 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11034945B2 (en) | 2019-03-25 | 2021-06-15 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11149260B2 (en) | 2019-03-25 | 2021-10-19 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US11306299B2 (en) | 2019-03-25 | 2022-04-19 | Inscripta, Inc. | Simultaneous multiplex genome editing in yeast |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US11053507B2 (en) | 2019-06-06 | 2021-07-06 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
| US11254942B2 (en) | 2019-06-06 | 2022-02-22 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
| US10837021B1 (en) | 2019-06-06 | 2020-11-17 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
| US11634719B2 (en) | 2019-06-06 | 2023-04-25 | Inscripta, Inc. | Curing for recursive nucleic acid-guided cell editing |
| US11015162B1 (en) | 2019-06-20 | 2021-05-25 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
| US10907125B2 (en) | 2019-06-20 | 2021-02-02 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
| US11118153B2 (en) | 2019-06-20 | 2021-09-14 | Inscripta, Inc. | Flow through electroporation modules and instrumentation |
| US11078458B2 (en) | 2019-06-21 | 2021-08-03 | Inscripta, Inc. | Genome-wide rationally-designed mutations leading to enhanced lysine production in E. coli |
| US10920189B2 (en) | 2019-06-21 | 2021-02-16 | Inscripta, Inc. | Genome-wide rationally-designed mutations leading to enhanced lysine production in E. coli |
| US11066675B2 (en) | 2019-06-25 | 2021-07-20 | Inscripta, Inc. | Increased nucleic-acid guided cell editing in yeast |
| US10927385B2 (en) | 2019-06-25 | 2021-02-23 | Inscripta, Inc. | Increased nucleic-acid guided cell editing in yeast |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US11319542B2 (en) | 2019-11-19 | 2022-05-03 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
| US11203762B2 (en) | 2019-11-19 | 2021-12-21 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
| US11891609B2 (en) | 2019-11-19 | 2024-02-06 | Inscripta, Inc. | Methods for increasing observed editing in bacteria |
| US11085030B2 (en) | 2019-12-10 | 2021-08-10 | Inscripta, Inc. | MAD nucleases |
| US11174471B2 (en) | 2019-12-10 | 2021-11-16 | Inscripta, Inc. | Mad nucleases |
| US11193115B2 (en) | 2019-12-10 | 2021-12-07 | Inscripta, Inc. | Mad nucleases |
| US10883095B1 (en) | 2019-12-10 | 2021-01-05 | Inscripta, Inc. | Mad nucleases |
| US11053485B2 (en) | 2019-12-10 | 2021-07-06 | Inscripta, Inc. | MAD nucleases |
| US10745678B1 (en) | 2019-12-13 | 2020-08-18 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10704033B1 (en) | 2019-12-13 | 2020-07-07 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US10724021B1 (en) | 2019-12-13 | 2020-07-28 | Inscripta, Inc. | Nucleic acid-guided nucleases |
| US11008557B1 (en) | 2019-12-18 | 2021-05-18 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US11359187B1 (en) | 2019-12-18 | 2022-06-14 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US11104890B1 (en) | 2019-12-18 | 2021-08-31 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US11286471B1 (en) | 2019-12-18 | 2022-03-29 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US11198857B2 (en) | 2019-12-18 | 2021-12-14 | Inscripta, Inc. | Cascade/dCas3 complementation assays for in vivo detection of nucleic acid-guided nuclease edited cells |
| US10689669B1 (en) | 2020-01-11 | 2020-06-23 | Inscripta, Inc. | Automated multi-module cell processing methods, instruments, and systems |
| US11667932B2 (en) | 2020-01-27 | 2023-06-06 | Inscripta, Inc. | Electroporation modules and instrumentation |
| US11225674B2 (en) | 2020-01-27 | 2022-01-18 | Inscripta, Inc. | Electroporation modules and instrumentation |
| US12559790B2 (en) | 2020-01-29 | 2026-02-24 | 10X Genomics, Inc. | Compositions and methods for analyte detection |
| US11268088B2 (en) | 2020-04-24 | 2022-03-08 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells via viral delivery |
| US11591592B2 (en) | 2020-04-24 | 2023-02-28 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells using microcarriers |
| US11407994B2 (en) | 2020-04-24 | 2022-08-09 | Inscripta, Inc. | Compositions, methods, modules and instruments for automated nucleic acid-guided nuclease editing in mammalian cells via viral delivery |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11787841B2 (en) | 2020-05-19 | 2023-10-17 | Inscripta, Inc. | Rationally-designed mutations to the thrA gene for enhanced lysine production in E. coli |
| US12203136B2 (en) | 2020-08-17 | 2025-01-21 | Readcoor, Llc | Methods and systems for spatial mapping of genetic variants |
| US11299731B1 (en) | 2020-09-15 | 2022-04-12 | Inscripta, Inc. | CRISPR editing to embed nucleic acid landing pads into genomes of live cells |
| US11597923B2 (en) | 2020-09-15 | 2023-03-07 | Inscripta, Inc. | CRISPR editing to embed nucleic acid landing pads into genomes of live cells |
| US11512297B2 (en) | 2020-11-09 | 2022-11-29 | Inscripta, Inc. | Affinity tag for recombination protein recruitment |
| US11306298B1 (en) | 2021-01-04 | 2022-04-19 | Inscripta, Inc. | Mad nucleases |
| US11965186B2 (en) | 2021-01-04 | 2024-04-23 | Inscripta, Inc. | Nucleic acid-guided nickases |
| US11332742B1 (en) | 2021-01-07 | 2022-05-17 | Inscripta, Inc. | Mad nucleases |
| US11884924B2 (en) | 2021-02-16 | 2024-01-30 | Inscripta, Inc. | Dual strand nucleic acid-guided nickase editing |
| US12139731B2 (en) | 2021-07-08 | 2024-11-12 | National Institutes Of Health (Nih), U.S. Dept. Of Health And Human Services (Dhhs) U.S. Government | CRISPR-based programmable RNA editing |
| US11814689B2 (en) | 2021-07-21 | 2023-11-14 | Montana State University | Nucleic acid detection using type III CRISPR complex |
| US12618099B2 (en) | 2024-11-04 | 2026-05-05 | President And Fellows Of Harvard College | Compositions and methods for analyte detection |
Also Published As
| Publication number | Publication date |
|---|---|
| US20150284697A1 (en) | 2015-10-08 |
| US9708646B2 (en) | 2017-07-18 |
| EA024121B9 (ru) | 2017-01-30 |
| MX2012013037A (es) | 2013-07-29 |
| KR101867359B1 (ko) | 2018-07-23 |
| AU2011253222B2 (en) | 2014-08-21 |
| JP2013528372A (ja) | 2013-07-11 |
| EP2569425A2 (en) | 2013-03-20 |
| WO2011143124A3 (en) | 2012-04-19 |
| EP2569425B1 (en) | 2016-07-06 |
| EA024121B1 (ru) | 2016-08-31 |
| SG185481A1 (en) | 2012-12-28 |
| US9605246B2 (en) | 2017-03-28 |
| BR112012028805A2 (pt) | 2019-09-24 |
| US9115348B2 (en) | 2015-08-25 |
| CA2798703A1 (en) | 2011-11-17 |
| EP3078753A1 (en) | 2016-10-12 |
| US20170166958A1 (en) | 2017-06-15 |
| US20130130248A1 (en) | 2013-05-23 |
| AU2011253222A1 (en) | 2012-12-06 |
| EP3078753B1 (en) | 2018-04-18 |
| JP5926242B2 (ja) | 2016-05-25 |
| EP2569425A4 (en) | 2014-03-12 |
| KR20130079420A (ko) | 2013-07-10 |
| DK2569425T3 (en) | 2016-10-03 |
| CN103038338B (zh) | 2017-03-08 |
| EA201291024A1 (ru) | 2013-11-29 |
| ES2590343T3 (es) | 2016-11-21 |
| CN103038338A (zh) | 2013-04-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9708646B2 (en) | Endoribonuclease compositions and methods of use thereof | |
| US9688971B2 (en) | Endoribonuclease and methods of use thereof | |
| EP3471749B1 (en) | Methods and compositions for detecting a target rna | |
| US8137906B2 (en) | Method for the synthesis of DNA fragments | |
| KR20190059966A (ko) | S. 피오게네스 cas9 돌연변이 유전자 및 이에 의해 암호화되는 폴리펩티드 | |
| US12203107B2 (en) | Non-LTR-retroelement reverse transcriptase and uses thereof | |
| AU2014259510B2 (en) | Endoribonuclease compositions and methods of use thereof | |
| HK1230246A1 (en) | Endoribonuclease compositions and methods of use thereof | |
| HK1176965B (en) | Endoribonuclease compositions and methods of use thereof | |
| KR102684067B1 (ko) | DNA 및 RNA 동시 검출을 위한 Cas 복합체 및 이의 용도 | |
| CN113913406B (zh) | 一种用于检测SARS-CoV-2 69:70del位点的方法 | |
| Jalal et al. | Structural and biochemical analyses of Caulobacter crescentus ParB reveal the role of its N-terminal domain in chromosome segregation | |
| US20250361494A1 (en) | Engineered tn5 transposase complexes, methods of preparing the same, systems and methods of profiling co-occurring chromatin feature in a cell | |
| Tong | A study of early functional polypeptides: Method development for the selection of protocell-binding peptides and the effect of domain fusion on a primordial-like enzyme | |
| HK40073374A (en) | Methods and compositions for detecting a target rna | |
| CA2921654A1 (en) | Modified epstein-barr virus dna polymerase and methods for isothermal dna amplification | |
| Kimoto et al. | Unit Title | |
| Moore | Finding the Molecular Partners of Ccm1p, A Saccaromyces cerevisiae PPR Protein Involved in Mitoribosome Biogenesis | |
| HK40007733B (en) | Methods and compositions for detecting a target rna | |
| HK40007733A (en) | Methods and compositions for detecting a target rna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201180033802.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11781086 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2798703 Country of ref document: CA Ref document number: 2013510211 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201291024 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2012/013037 Country of ref document: MX |
|
| REEP | Request for entry into the european phase |
Ref document number: 2011781086 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011781086 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 9897/DELNP/2012 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20127031818 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2011253222 Country of ref document: AU Date of ref document: 20110509 Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012028805 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012028805 Country of ref document: BR Kind code of ref document: A2 Effective date: 20121109 |