WO2011139372A1 - Sequence analysis of complex amplicons - Google Patents

Sequence analysis of complex amplicons Download PDF

Info

Publication number
WO2011139372A1
WO2011139372A1 PCT/US2011/000792 US2011000792W WO2011139372A1 WO 2011139372 A1 WO2011139372 A1 WO 2011139372A1 US 2011000792 W US2011000792 W US 2011000792W WO 2011139372 A1 WO2011139372 A1 WO 2011139372A1
Authority
WO
WIPO (PCT)
Prior art keywords
region
sequence
primers
molecules
sequencing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/000792
Other languages
English (en)
French (fr)
Inventor
Malek Faham
Martin Moorhead
Thomas Willis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sequenta Inc
Original Assignee
Sequenta Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=44903937&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2011139372(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Sequenta Inc filed Critical Sequenta Inc
Priority to JP2013509047A priority Critical patent/JP6085249B2/ja
Publication of WO2011139372A1 publication Critical patent/WO2011139372A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5091Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing the pathological state of an organism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047Cells of the immune system
    • G01N33/505Cells of the immune system involving T-cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047Cells of the immune system
    • G01N33/5052Cells of the immune system involving B-cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854Immunoglobulins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the invention relates generally to methods for characterizing complex populations of nucleic acid sequences, such as amplicons, and more particularly, to methods for constructing profiles of immune system molecules using high throughput DNA sequencing.
  • Such challenges include uniform amplification of target populations so that nucleic acid quality of sequence reads; and selection of the number, composition and positioning of sequencing primers, in view of unknown target sequence variability, for example, caused by somatic hypermutation, clonal evolution, or like phenomena, e.g. Li et al, Blood, 102(13): 4520-4526 (2003); Tichopad et al, Clin. Chem., 55: 1816-1823 (2009); Brockman et al, Genome Research, 18: 763-770 (2008).
  • the present invention is drawn to methods for producing sequence-based profiles of complex nucleic acid populations.
  • the invention is exemplified in a number of implementations and applications, some of which are summarized below and throughout the specification.
  • the invention is directed to a method for determining a clonotype profile of T cell receptors and/or B cell receptors of an individual comprising the following steps: (a) obtaining a nucleic acid sample from T-cells and/or B-cells of the individual; (b) spatially isolating individual molecules derived from such nucleic acid sample, the individual molecules comprising nested sets of templates each generated from a nucleic acid in the sample and each containing a somatically rearranged region or a portion thereof, each nested set being capable of producing a plurality of sequence reads each extending in the same direction and each starting from a different position on the nucleic acid from which the nested set was generated; (c) sequencing said spatially isolated individual molecules; and (d
  • the step of sequencing includes producing a plurality of sequence reads for each of the nested sets.
  • each of the somatically rearranged regions comprise a V region and a J region, and each of the plurality of sequence reads starts from a different position in the V region and extends in the direction of its associated J region.
  • the step of sequencing comprises bidirectionally sequencing each of the spatially isolated individual molecules to produce at least one forward sequence read and at least one reverse sequence read. Further to the latter embodiment, at least one of the forward sequence reads and at least one of the reverse sequence reads have an overlap region such that bases of such overlap region are determined by a reverse complementary relationship between such sequence reads.
  • each of the somatically rearranged regions comprise a V region and a J region and the step of sequencing further includes determining a sequence of each of the individual nucleic acid molecules from one or more of its forward sequence reads and at least one reverse sequence read starting from a position in a J region and extending in the direction of its associated V region.
  • individual molecules comprise nucleic acids selected from the group consisting of complete IgH molecules, incomplete IgH molecules, complete IgK complete, IgK inactive molecules, TCRJ3 molecules, TCRy molecules, complete TCR6 molecules, and incomplete TCR5 molecules.
  • the step of sequencing comprises generating the sequence reads having monotonically decreasing quality scores.
  • monotonically decreasing quality scores are such that the sequence reads have error rates no better than the following: 0.2 percent of sequence reads contain at least one error in base positions 1 to 50, 0.2 to 1.0 percent of sequence reads contain at least one error in positions 51 -75, 0.5 to 1.5 percent of sequence reads contain at least one error in positions 76- 100.
  • the step of sequencing spatially isolated individual molecules comprises disposing such molecules on a solid surface where they are sequenced. Further to the latter embodiment, the step of disposing includes amplifying such molecules on the solid surface by bridge PCR. Still further to the latter embodiment, the step of sequencing such molecules is carried out by a sequencing-by-synthesis technique.
  • the invention provides a method for characterizing a clonotype comprising a V(D)J region or a portion thereof comprising the following steps: (a) generating at least one J region sequence read that begins in a J region and extends through an NDN region to a V region and at least one V region sequence read that begins in the V region and extends through the NDN region to the J region, the J region sequence read and the V region sequence read overlapping, and the J region and the V region each having a codon structure; and (b) determining whether the codon structure of the J region extended into the NDN region is in frame with the codon structure of the V region extended into the NDN region.
  • FIG. 1 A is a flow diagram of an embodiment of a method of the provided invention for determining clonotype profiles.
  • FIG. 1 B illustrates the relative distribution of somatic mutations that occurs in immunoglobulins produced by B ceils.
  • FIGS. 2A-2B show a two-staged PCR scheme for amplifying TCRP genes.
  • FIG. 3A illustrates a PCR product to be sequenced that was amplified using the scheme of Figs 2A-2B.
  • FIG. 3B illustrates details of determining a nucleotide sequence of the PCR product of Fig. 3A.
  • FIG. 3C illustrates details of another embodiment of determining a nucleotide sequence of the PCR product of Fig. 3A.
  • FIG. 4A illustrates a PCR scheme for generating three sequencing templates from an IgH chain in a single reaction.
  • FIGS. 4B-4C illustrates a PCR scheme for generating three sequencing templates from an IgH chain in three separate reactions after which the resulting amplicons are combined for a secondary PCR to add P5 and P7 primer binding sites.
  • Fig. 4D illustrates the locations of sequence reads generated for an IgH chain.
  • Fig. 4E illustrates the use of the codon structure of V and J regions to improve base calls in the NDN region.
  • FIG. 5 shows data evidencing the reproducibility of multiplex PCRs of the invention.
  • FIG. 6 shows data that demonstrate that multiplex PCRs of the invention introduce minimal amplification bias.
  • FIG. 7A shows the logl O of the frequency of each clonotype in the two duplicate samples using Accuprime and cDNA corresponding to 500 ng of RNA as input template.
  • FIG. 7B depicts the logl O of the frequency of each clonotype using cDNA corresponding to 500 ng of RNA as input template and Accuprime (X axis) or High fidelity Taq (Y axis).
  • FIG. 7C shows the logl O of the frequency of each clonotype using cDNA corresponding to 50 ng of RNA as input template and Accuprime (X axis) or High fidelity Taq (Y axis).
  • FIG. 8 the number of TCR molecules from samples. 8A and 8B show data from IgH amplification from genomic DNA
  • FIG. 9 shows data indicating that multiplex amplifications in accordance with the invention have minimal amplification bias.
  • the practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, molecular biology (including recombinant techniques), cell biology, and biochemistry, which are within the skill of the art.
  • Such conventional techniques include, but are not limited to, sampling and analysis of blood cells, nucleic acid sequencing and analysis, and the like. Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used.
  • Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols. I-IV); PCR Primer: A Laboratory Manual; and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); and the like.
  • the invention utilizes next generation sequencing technologies to generate sequence profiles of complex nucleic acid populations, which, in turn, permit sequence-based identification of biological phenomena, such as organisms, disease conditions, histories of infection, and the like.
  • exemplary nucleic acid populations amenable to such analysis include amplicons of 16S rDNA of microbial communities, TCR or BCR rearrangements in a population of lymphocytes, and the like.
  • multiplex amplification to amplify all the different types of sequences of a specific portion of gene or transcript can be accomplished from a sample, such as from blood or bone marrow DNA, for measuring clonotype profiles.
  • Fig. 1A illustrates steps of such a method for an embodiment employing one class of DNA sequencers for profiling clonotypes of a sample of a TCR or BCR repertoire.
  • a sample containing B cells or T cells is obtained (100) after which DNA or RNA is extracted and amplified (102) in a reaction that preferentially amplifies clonotypes and attaches terminal sequences for subsequent amplification and sequencing.
  • a solid surface such as, a glass surface, which has been configured to permit a second in situ amplification to produce clonal populations (or polonies or clusters) of each individual molecule (106).
  • the molecules of each cluster are then sequenced (108), for example, using a sequencing-by-synthesis technique, after which the types and abundances of the sequences are tabulated to form a profile (1 10), such as a clonotype profile, or equivalently a repertoire profile.
  • the method can be performed with little amplification bias among the different sequences.
  • the invention is directed to methods of analyzing sequences of complex populations of nucleic acids, particularly those having sequence variability in confined regions, such as V(D)J regions of immunoglobulin genes and transcripts or hypervariable regions in the microbial 16S rDNA gene.
  • complex populations are amplified and/or sequenced by using redundant primers annealing to different sites in regions of sequence variability. This is particularly advantageous where a sequencing chemistry is employed that has a relatively high error rate or where such sequence variability is difficult or impossible to know beforehand, such as in regions of somatically hypermutated immunoglobulin genes or transcripts.
  • Fig. IB illustrates the distribution of mutations in IgH transcripts (120). Starting from promoter P (122) relative frequency shown by curve (128) climbs through leader region (124) to a maximum over the V(D)J region (126) of the transcript after which it drop to near zero.
  • a segment of recombined B cell nucleic acid is amplified by a PCR with a plurality of forward primers or a plurality of reverse primers to generate a nested set of templates (see Fig. 4A and 4B and their descriptions below).
  • Templates from such a set may be further amplified on a surface to form separate amplicons (e.g. by bridge PCR using a cBot instrument, Illumina, San Diego, CA). Templates from the same nested set may be associated with one another by sequence reads generated at their common ends. Nested sets of templates allow a sequencing chemistry with relative high error rates to be used to analyze longer sequences than otherwise would be possible, while at the same time maintaining high average quality scores over the entire length of the sequence. The nested sets also ensure that at least one sequence read is obtained from a V region even if it has been subjected to somatic hypermutation.
  • sequencing chemistries may be used for analyzing highly variable nucleic acids, such as IgH molecules, that have error rates no better than the following: 0.2 percent of sequence reads contain at least one error in positions 1-50; 0.2-1.0 percent of sequence reads contain at least one error in positions 51-75; 0.5-1.5 percent of sequence reads contain at least one error in positions 76-100; and 1-5 percent of sequence reads contain at least one error in positions 101-125.
  • sequencing primer binding sites are positioned so that when extended they produce a series of sequence reads where each sequence read except the last overlaps its immediately adjacent downstream primer binding site and/or sequence read, thereby providing continuous sequence coverage with higher quality scores than would be possible if a single long template were used to generate a single long sequence read.
  • Immune system repertoires may be obtained from samples of immune cells.
  • immune cells can include T-cells and/or B-cells.
  • T-cells include, for example, cells that express T cell receptors.
  • T-cells include Helper T cells (effector T cells or Th cells), cytotoxic T cells (CTLs), memory T cells, and regulatory T cells.
  • the sample can include a single cell in some applications or more generally at least 1,000, at least 10,000, at least 100,000, at least 250,000, at least 500,000, at least 750,000, or at least 1,000,000 T-cells.
  • B-cells include, for example, plasma B cells, memory B cells, Bl cells, B2 cells, marginal-zone B cells, and follicular B cells.
  • B-cells can express immunoglobulins (antibodies, B cell receptor).
  • the sample can include a single cell in some applications (e.g., a calibration test to define relevant B cells) or more generally at least 1,000, at least 10,000, at least 100,000, at least 250,000, at least 500,000, at least 750,000, or at least 1,000,000 B- cells.
  • the sample can include nucleic acid, for example, DNA (e.g., genomic DNA or mitochondrial DNA) or RNA (e.g., messenger RNA or microRNA).
  • the nucleic acid can be cell-free DNA or RNA, e.g. extracted from the circulatory system, Vlassov et al, Curr. Mol. Med., 10: 142-165 (2010); Swarup et al, FEBS Lett., 581 : 795- 799 (2007).
  • the amount of RNA or DNA from a subject that can be analyzed includes, for example, as low as a single cell in some applications (e.g., a calibration test) and as many as 10 million of cells or more translating to a range of DNA of 6pg-60ug, and RNA of approximately l pg-lOug.
  • a sample of lymphocytes is sufficiently large so that substantially every T cell or B cell with a distinct clonotype is represented therein, thereby forming a repertoire (as the term is used herein).
  • a sample is taken that contains with a probability of ninety-nine percent every clonotype of a population present at a frequency of .001 percent or greater.
  • a sample is taken that contains with a probability of ninety-nine percent every clonotype of a population present at a frequency of .0001 percent or greater.
  • a sample of B cells or T cells includes at least a half million cells, and in another embodiment such sample includes at least one million cells.
  • DNA from the material may be amplified by a non-biasing technique, such as whole genome amplification (WGA), multiple displacement amplification (MDA); or like technique, e.g. Hawkins et al, Curr. Opin. Biotech., 13: 65-67 (2002); Dean et al, Genome Research, 11 : 1095-1099 (2001); Wang et al, Nucleic Acids Research, 32: e76 (2004); Hosono et al, Genome Research, 13: 954-964 (2003); and the like.
  • WGA whole genome amplification
  • MDA multiple displacement amplification
  • Blood samples are of particular interest, especially in monitoring lymphoid neoplasms, such as lymphomas, leukemias, or the like, and may be obtained using conventional techniques, e.g. Innis et al, editors, PCR Protocols (Academic Press, 1990); or the like.
  • white blood cells may be separated from blood samples using convention techniques, e.g. RosetteSep kit (Stem Cell Technologies, Vancouver, Canada).
  • Blood samples may range in volume from 100 ⁇ - to 10 mL; in one aspect, blood sample volumes are in the range of from 200 100 ⁇ L ⁇ to 2 mL.
  • DNA and/or RNA may then be extracted from such blood sample using conventional techniques for use in methods of the invention, e.g. DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA).
  • subsets of white blood cells may be further isolated using conventional techniques, e.g. fluorescently activated cell sorting (FACS)(Becton Dickinson, San Jose, CA), magnetically activated cell sorting (MACS)(Miltenyi Biotec, Auburn, CA), or the like.
  • FACS fluorescently activated cell sorting
  • MCS magnetically activated cell sorting
  • nucleic acids are analyzed from a sample of a subset of cells.
  • a method to separate cells can be employed.
  • cells can be isolated by cell sorting flow-cytometry, flow-sorting, fluorescent activated cell sorting (FACS), bead based separation such as magnetic cell sorting (MACS; e.g., using antibody coated magnetic particles), size-based separation (e.g., a sieve, an array of obstacles, or a filter), sorting in a microfluidics device, antibody-based separation, sedimentation, affinity adsorption, affinity extraction, or density gradient centrifugation.
  • FACS fluorescent activated cell sorting
  • MCS magnetic cell sorting
  • size-based separation e.g., a sieve, an array of obstacles, or a filter
  • Sorting in a microfluidics device antibody-based separation, sedimentation, affinity adsorption, affinity extraction, or density gradient centrifugation.
  • Cells can be purified by laser capture microdissection.
  • Sorting can be based on cell size, morphology, or intracellular or extracellular markers. Methods for isolating or sorting tumor cells are described, for example, in Nagrath S. et al. (2007) Nature 450:1235-1239; US Patent Nos. 6008002, 7232653, and 7332288; PCT Publication No. WO2008157220A1; and US Patent Application Nos. US20080138805A 1 and US20090186065; and Rosenberg R. et al. (2002) Cytometry 49: 150- 158, each of which is herein incorporated by reference in their entireties.
  • RNA or DNA can be sequenced in the methods of the provided invention.
  • a recombined sequence from a T-cell or B-cell encoding a T cell receptor or immunoglobulin molecule, or a portion thereof, is referred to as a clonotype.
  • the DNA or RNA can correspond to sequences from T-cell receptor (TCR) genes or immunoglobulin (Ig) genes that encode antibodies.
  • TCR T-cell receptor
  • Ig immunoglobulin
  • the DNA and RNA can correspond to sequences encoding ⁇ , ⁇ , ⁇ , or ⁇ chains of a TCR.
  • the TCR is a heterodimer consisting of an ct-chain and ⁇ -chain.
  • the TCRct chain is generated by VJ recombination
  • the ⁇ chain receptor is generated by V(D)J recombination.
  • V(D)J recombination For the TCRP chain, in humans there are 48 V segments, 2 D segments, and 13 J segments. Several bases may be deleted and others added (called N and P nucleotides) at each of the two junctions.
  • the TCRs consist of ⁇ and ⁇ delta chains.
  • the TCR ⁇ chain is generated by VJ recombination, and the TCR ⁇ chain is generated by V(D)J recombination (Kenneth Murphy, Paul Travers, and Mark Walport, Janeway 's Immunology 7th edition, Garland Science, 2007, which is herein incorporated by reference in its entirety).
  • the DNA and RNA analyzed in the methods of the invention can correspond to sequences encoding heavy chain immunoglobulins (IgH) with constant regions ( ⁇ , ⁇ , ⁇ , ⁇ , or ⁇ ) or light chain immunoglobulins (IgK or IgL) with constant regions ⁇ or .
  • Each antibody has two identical light chains and two identical heavy chains.
  • Each chain is composed of a constant (C) and a variable region.
  • the variable region is composed of a variable (V), diversity (D), and joining (J) segments.
  • V variable
  • D diversity
  • J joining
  • Diversity in the light chain is generated in a similar fashion except that there is no D region so there is only VJ recombination. Somatic mutation often occurs close to the site of the recombination, causing the addition or deletion of several nucleotides, further increasing the diversity of heavy and light chains generated by B-cells. The possible diversity of the antibodies generated by a B-cell is then the product of the different heavy and light chains. The variable regions of the heavy and light chains contribute to form the antigen recognition (or binding) region or site. Added to this diversity is a process of somatic hypermutation which can occur after a specific response is mounted against some epitope.
  • primers may be selected to generate amplicons of subsets of recombined nucleic acids extracted from lymphocytes. Such subsets may be referred to herein as "somatically rearranged regions.” Somatically rearranged regions may comprise nucleic acids from developing or from fully developed lymphocytes, where developing lymphocytes are cells in which rearrangement of immune genes has not been completed to form molecules having full V(D)J regions. Exemplary incomplete somatically rearranged regions include incomplete IgH molecules (such as, molecules containing only D-J regions), incomplete TCR6 molecules (such as, molecules containing only D-J regions), and inactive IgK (for example, comprising Kde-V regions).
  • Adequate sampling of the cells is an important aspect of interpreting the repertoire data, as described further below in the definitions of "clonotype” and "repertoire.” For example, starting with 1,000 cells creates a minimum frequency that the assay is sensitive to regardless of how many sequencing reads are obtained.
  • one aspect of this invention is the development of methods to quantitate the number of input immune receptor molecules. This has been implemented this for TCR and IgH sequences. In either case the same set of primers are used that are capable of amplifying all the different sequences.
  • a real time PCR with the multiplex of primers is performed along with a standard with a known number of immune receptor copies.
  • An example of real time PCR data for the mouse vaccination example is shown in Fig. 9. This real time PCR measurement can be made from the amplification reaction that will subsequently be sequenced or can be done on a separate aliquot of the same sample.
  • the absolute number of rearranged immune receptor molecules can be readily converted to number of cells (within 2 fold as some cells will have 2 rearranged copies of the specific immune receptor assessed and others will have one).
  • the measured total number of rearranged molecules in the real time sample can be extrapolated to define the total number of these molecules used in another amplification reaction of the same sample.
  • this method can be combined with a method to determine the total amount of RNA to define the number of rearranged immune receptor molecules in a unit amount (say 1 ⁇ g) of RNA assuming a specific efficiency of cDNA synthesis. If the total amount of cDNA is measured then the efficiency of cDNA synthesis need not be considered.
  • the rearranged immune receptor copies per cell can be computed. If the number of cells is not known, one can estimate it from the total RNA as cells of specific type usually generate comparable amount of RNA. Therefore from the copies of rearranged immune receptor molecules per 1 ⁇ g one can estimate the number of these molecules per cell.
  • Another approach that can be utilized is to add a known amount of unique immune receptor rearranged molecules with a known sequence, i.e. known amounts of one or more internal standards, to the cDNA or genomic DNA from a sample of unknown quantity.
  • a known sequence i.e. known amounts of one or more internal standards
  • uch techniques for molecular counting are well-known, e.g. Brenner et al, U.S. patent 7,537,897, which is incorporated herein by reference).
  • Data from sequencing the added unique sequence can be used to distinguish the different possibilities if a real time PCR calibration is being used as well.
  • the invention provides methods for measuring clonotype expression at a cellular level. That is, as noted above, clonotypes may be used to count lymphocytes; therefore, by measuring clonotypes derived from genomic DNA and the same clonotypes derived from RNA, cell-based expression of clonotypes may be determined.
  • a method for simultaneously measuring lymphocyte numbers and clonotype expression levels in a sample may comprise the steps of: (a) obtaining from an individual a sample comprising T cells and/or B cells; (b) sequencing spatially isolated individual molecules derived from genomic DNA of said cells, such spatially isolated individual molecules comprising a number of clonotypes corresponding to a number of lymphocytes in the sample; (c) sequencing spatially isolated individual molecules derived from RNA of said cells, such spatially isolated individual molecules comprising numbers of clonotypes corresponding to expression levels thereof in the lymphocytes of the sample; and (d) determining clonotype expression levels in lymphocytes of the sample by comparing for each clonotype the number determined from isolated individual molecules derived from genomic DNA of said cells and the number determined from isolated individual molecules derived from RNA of said cells.
  • the step of determining further includes determining said number of lymphocytes in said sample by adding a known quantity of an internal standard to said genomic DNA.
  • the sample has a defined volume which permits a concentration of said lymphocytes to be determined in said sample. Typically, such a defined volume is in the range of from 1 mL to 50 mL, and more usually, in the range of from 1 mL to 10 mL.
  • numbers of the same clonotype derived from genomic DNA and RNA are compared by simply dividing the number of clonotypes determined from the isolated individual molecules derived from the RNA by the number of clonotypes determined from the isolated individual molecules derived from said genomic DNA.
  • Such two sets of clonotypes are readily distinguished in the same sequencing run by the use of labels, particularly oligonucleotide tags that are attached during the sample preparation process.
  • such labels may be incorporated with the tags used to identify different samples by (for example) adding a single nucleotide to the tag to indicate DNA or RNA, or simply using an additional tag so that each patient sample is labeled with two tags, one for the genomic DNA fraction and one for the RNA fraction.
  • said step of sequencing said spatially isolation individual molecules derived from said RNA may include labeling each of said spatially isolated individual molecules with a first label indicating its RNA origin and said step of sequencing said spatially isolation individual molecules derived from said genomic DNA may include labeling each of said spatially isolated individual molecules with a second label indicating its genomic DNA origin such that the first label is distinguishable from the second label.
  • such labels are distinct oligonucleotide tags that are identified by sequencing.
  • the invention may be used to provide simultaneously (this is, based on measurements on a single sample) lymphocyte number and clonality.
  • Such embodiment may be implemented with the following steps: (a) obtaining from an individual a sample comprising T cells and/or B cells; (b) sequencing spatially isolated individual molecules derived from nucleic acid of said cells, such spatially isolated individual molecules comprising a number of clonotypes corresponding to a number of lymphocytes in the sample; (c) determining the number of lymphocytes from the number of spatially isolated individual molecules; (d) determining abundances of different sequences of the spatially isolated individual molecules to generate a clonotype profile and a measure of clonality based thereon.
  • the nucleic acid from the lymphocytes may be genomic DNA and/or RNA; however, preferably the nucleic acid is genomic DNA.
  • the step of determining said number further includes determining said number of lymphocytes in said sample by adding a known quantity of an internal standard to said genomic DNA.
  • the sample is a peripheral blood sample it has a defined volume so that a concentration of said lymphocytes in said sample is determined.
  • only B cells are employed and in other embodiments only T cells are employed.
  • amplicons of target populations of nucleic acids may be generated by a variety of amplification techniques.
  • multiplex PCR is used to amplify members of a mixture of nucleic acids, particularly mixtures comprising recombined immune molecules such as T cell receptors, B cell receptors, or portions thereof.
  • Guidance for carrying out multiplex PCRs of such immune molecules is found in the following references, which are incorporated by reference: Morley, U.S. patent 5,296,351; Gorski, U.S. patent 5,837,447; Dau, U.S. patent 6,087,096; Von Dongen et al, U.S.
  • the step of spatially isolating individual nucleic acid molecules is achieved by carrying out a primary multiplex amplification of a preselected somatically rearranged region or portion thereof (i.e. target sequences) using forward and reverse primers that each have tails non-complementary to the target sequences to produce a first amplicon whose member sequences have common sequences at each end that allow further manipulation.
  • such common ends may include primer binding sites for continued amplification using just a single forward primer and a single reverse primer instead of multiples of each, or for bridge amplification of individual molecules on a solid surface, or the like.
  • Such common ends may be added in a single amplification as described above, or they may be added in a two-step procedure to avoid difficulties associated with manufacturing and exercising quality control over mixtures of long primers (e.g. 50-70 bases or more).
  • the primary amplification is carried out as described above, except that the primer tails are limited in length to provide only forward and reverse primer binding sites at the ends of the sequences of the first amplicon.
  • a secondary amplification is then carried out using secondary amplification primers specific to these primer binding sites to add further sequences to the ends of a second amplicon.
  • the secondary amplification primers have tails non-complementary to the target sequences, which form the ends of the second amplicon and which may be used in connection with sequencing the clonotypes of the second amplicon.
  • such added sequences may include primer binding sites for generating sequence reads and primer binding sites for carrying out bridge PCR on a solid surface to generate clonal populations of spatially isolated individual molecules, for example, when Solexa-based sequencing is used.
  • a sample of sequences from the second amplicon are disposed on a solid surface that has attached complementary oligonucleotides capable of annealing to sequences of the sample, after which cycles of primer extension, denaturation, annealing are implemented until clonal populations of templates are formed.
  • the size of the sample is selected so that (i) it includes an effective representation of clonotypes in the original sample, and (ii) the density of clonal populations on the solid surface is in a range that permits unambiguous sequence determination of clonotypes.
  • TCR or BCR sequences or portions thereof can be amplified from nucleic acid in a multiplex reaction using at least one primer that anneals to the C region and one or more primers that can anneal to one or more V segments (as illustrated in Figs. 2A-2B and Figs. 4A-4B and discussed more fully below).
  • the number of primers that anneal to V segments in a multiplex reaction can be, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80.
  • the number of primers that anneal to V segments in a multiplex reaction can be, for example, 10-60, 20-50, 30-50, 40-50, 20-40, 30-40, or 35-40.
  • the primers can anneal to different V segments.
  • multiple primers that anneal to each V segment can be used; for example, 1, 2, 3, 4, or 5 primers per V segment.
  • the number of primers that anneal to C segments in a multiplex reaction can include, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15.
  • the number of primers that anneal to C segments in a multiplex reaction can be 1 -10, 2-9, 3-8, 4-7, 3-8, or 3-6.
  • Amplification of TCR or immunoglobulin genes can occur as described in Example 3 and/or Example 4.
  • the region to be amplified can include the full clonal sequence or a subset of the clonal sequence, including the V-D junction, D-J junction of an immunoglobulin or T-cell receptor gene, the full variable region of an immunoglobulin or T-cell receptor gene, the antigen recognition region, or a CDR, e.g., complementarity determining region 3 (CDR3).
  • CDR3 complementarity determining region 3
  • the TCR or immunoglobulin sequence can amplified using a primary and a secondary amplification step.
  • Each of the different amplification steps can comprise different primers.
  • the different primers can introduce sequence not originally present in the immune gene sequence.
  • the amplification procedure can add new primer binding sites to the ends of the target sequences to convert a multiplex amplification to a singleplex amplification or the amplification procedure can add one or more tags to the 5' and/or 3' end of amplified TCR or immunoglobulin sequence (as illustrated in Figs. 3A-3B).
  • the tag can be sequence that facilitates subsequent sequencing of the amplified DNA.
  • the tag can be sequence that facilitates binding the amplified sequence to a solid support.
  • Other means of amplifying nucleic acid that can be used in the methods of the provided invention include, for example, reverse transcription-PCR, real-time PCR, quantitative real-time PCR, digital PCR (dPCR), digital emulsion PCR (dePCR), clonal PCR, amplified fragment length polymorphism PCR (AFLP PCR), allele specific PCR, assembly PCR, asymmetric PCR (in which a great excess of primers for a chosen strand is used), colony PCR, helicase-dependent amplification (HDA), Hot Start PCR, inverse PCR (IPCR), in situ PCR, long PCR (extension of DNA greater than about 5 kilobases), multiplex PCR, nested PCR (uses more than one pair of primers), single-cell PCR, touchdown PCR, loop-mediated isothermal PCR (LAMP), and nucleic acid sequence based amplification (NASBA).
  • Other amplification schemes include: Ligase Chain Reaction, Branch DNA Amplification, Roll
  • RNA in a sample can be converted to cDNA by using reverse transcription.
  • PolyA primers, random primers, and/or gene specific primers can be used in reverse transcription reactions in accordance with conventional protocols.
  • nucleic acid molecules After amplification of DNA from the genome (or amplification of nucleic acid in the form of cDNA by reverse transcribing RNA), the individual nucleic acid molecules can be isolated, optionally re-amplified, and then sequenced individually. Exemplary amplification protocols may be found in van Dongen et al, Leukemia, 17: 2257-2317 (2003) or van Dongen et al, U.S. patent publication 2006/0234234, which is incorporated by reference.
  • an exemplary protocol is as follows: Reaction buffer: ABI Buffer II or ABI Gold Buffer (Life Technologies, San Diego, CA); 50 ⁇ L ⁇ final reaction volume; 100 ng sample DNA; 10 pmol of each primer (subject to adjustments to balance amplification as described below); dNTPs at 200 ⁇ final concentration; MgCl 2 at 1.5 mM final concentration (subject to optimization depending on target sequences and polymerase); Taq polymerase (1-2 U/tube); cycling conditions: preactivation 7 min at 95oC; annealing at 60oC; cycling times: 30s denaturation; 30s annealing; 30s extension.
  • Polymerases that can be used for amplification in the methods of the invention are commercially available and include, for example, Taq polymerase, AccuPrime polymerase, or Pfu. The choice of polymerase to use can be based on whether fidelity or efficiency is preferred.
  • Methods for isolation of nucleic acids from a pool include subcloning nucleic acid into DNA vectors and transforming bacteria (bacterial cloning), spatial separation of the molecules in two dimensions on a solid substrate (e.g., glass slide), spatial separation of the molecules in three dimensions in a solution within micelles (such as can be achieved using oil emulsions with or without immobilizing the molecules on a solid surface such as beads), or using microreaction chambers in, for example, microfluidic or nano-fluidic chips. Dilution can be used to ensure that on average a single molecule is present in a given volume, spatial region, bead, or reaction chamber.
  • Methods for re-amplification of nucleic acids include bacterial growth of isolated colonies transformed with nucleic acid, amplification on a slide (e.g., PCR colonies (polonies)), and amplification on a bead (e.g. in an emulsion PCR). The same method can be used to amplify and re-amplify the nucleic acid or a different method can be used to amplify and reamplify the nucleic acid.
  • the subcloning steps include a step in which a common primer is attached to the DNA or RNA through an amplification or ligation step. This primer is then used to amplify the clones and as a recognition sequence for hybridization of a primer for sequencing (e.g. as illustrated in Figs. 2A-2B and 4A-4B, and discussed more fully below).
  • multiplex amplifications are carried out so that relative amounts of sequences in a starting population are substantially the same as those in the amplified population, or amplicon. That is, multiplex amplifications are carried out with minimal amplification bias among member sequences of a sample population. In one embodiment, such relative amounts are substantially the same if each relative amount in an amplicon is within five fold of its value in the starting sample. In another embodiment, such relative amounts are substantially the same if each relative amount in an amplicon is within two fold of its value in the starting sample. As discussed more fully below, amplification bias in PCR may be detected and corrected using conventional techniques so that a set of PCR primers may be selected for a predetermined repertoire that provide unbiased amplification of any sample.
  • a multiplex amplification optionally uses all the V segments.
  • the reaction is optimized to attempt to get amplification that maintains the relative abundance of the sequences amplified by different V segment primers.
  • Some of the primers are related, and hence many of the primers may "cross talk," amplifying templates that are not perfectly matched with it.
  • the conditions are optimized so that each template can be amplified in a similar fashion irrespective of which primer amplified it. In other words if there are two templates, then after 1,000 fold amplification both templates can be amplified approximately 1,000 fold, and it does not matter that for one of the templates half of the amplified products carried a different primer because of the cross talk.
  • the primer sequence is eliminated from the analysis, and hence it does not matter what primer is used in the amplification as long as the templates are amplified equally.
  • a set of standards may be generated using singleplex PCRs of a cDNA population of clonotypes. This was carried out for a repertoire of TCRp clonotypes.
  • the product in each of 34 such PCRs (using in the separate reactions primers of Example 3) comprised a plurality of sequences with one V primer. The different products were carefully quantitated to create a set of standards at the same concentration.
  • a pool of all 34 primers was used and 34 real time PCRs were performed using the pool of primers and each of the standard sequences as a template. Ideally without bias all the 34 standards will show equal efficiency of amplification by real time PCR.
  • Amplification bias may also be avoided by carrying out a two-stage amplification (as illustrated in Figs. 2A-2B) wherein a small number of amplification cycles are implemented in a first, or primary, stage using primers having tails non-complementary with the target sequences.
  • the tails include primer binding sites that are added to the ends of the sequences of the primary amplicon so that such sites are used in a second stage amplification using only a single forward primer and a single reverse primer, thereby eliminating a primary cause of amplification bias.
  • the primary PCR will have a small enough number of cycles (e.g. 5-10) to minimize the differential amplification by the different primers.
  • the secondary amplification is done with one pair of primers and hence the issue of differential amplification is minimal.
  • One percent of the primary PCR is taken directly to the secondary PCR. Thirty-five cycles (equivalent to -28 cycles without the 100 fold dilution step) used between the two amplifications were sufficient to show a robust amplification irrespective of whether the breakdown of cycles were: one cycle primary and 34 secondary or 25 primary and 10 secondary. Even though ideally doing only 1 cycle in the primary PCR may decrease the amplification bias, there are other considerations.
  • One aspect of this is representation. This plays a role when the starting input amount is not in excess to the number of reads ultimately obtained.
  • the 100 fold dilution between the 2 steps means that the representation is reduced unless the primary PCR amplification generated significantly more than 100 molecules. This indicates that a minimum 8 cycles (256 fold), but more comfortably 10 cycle (-1,000 fold), may be used.
  • the alternative to that is to take more than 1% of the primary PCR into the secondary but because of the high concentration of primer used in the primary PCR, a big dilution factor is can be used to ensure these primers do not interfere in the amplification and worsen the amplification bias between sequences.
  • Another alternative is to add a purification or enzymatic step to eliminate the primers from the primary PCR to allow a smaller dilution of it. In this example, the primary PCR was 10 cycles and the second 25 cycles.
  • the reproducibility of a multiplex PCR may be assessed as follows, as exemplified with the test set of primers from Example 2. Two primary PCR reactions are performed using the test set of primers, e.g. the pooled TCR primers and the C primer (of Example 2) and one cDNA sample as a template. The relative abundance in each amplified template is assessed using real time PCR. Using each of the two amplified products as a template, thirty four different real time PCR reactions were performed using the C primer and one of the V primers in each reaction. The data shown in Fig. 5 demonstrate that the relative abundance determined by real time PCR was highly reproducible using all the V primers for two samples, indicating that the multiplexed amplification is highly reproducible.
  • the cycle number (Ct value) for each of the real time PCR amplifications using the one multiplexed amplification product as a template is shown on the X axis and using the second multiplexed amplification product as a template is depicted on the Y axis.
  • the amount of amplification bias of a set of primers may be assessed using the following procedure, which is exemplified using the primer set of Example 2.
  • the test primer set (as above) is used to amplify a cDNA as a template (e.g. obtained from mRNA extracted from lymphocytes).
  • the amount of template amplified by each of the 34 different primers is determined using real time PCR and that amount is compared with the amount amplified using the same primers with the cDNA. Since there may be cross talk even if the relative abundance among the internal sequences in the amplified product and the cDNA were the same, only significant differences in amplification may be detected using this readout.
  • This possibility may be tested by synthesizing collection of primers to amplify internal segments of a number of the starting cDNA sequences. For example, 12 oligos were designed that can, when used with C segment primer, amplify sequences internal to the above V segment primers. If there is minimal amplification bias, then the concentration of these internal sequences should change little between the starting cDNA and the amplified products. Data from this example is shown in FIG.6. There, a cDNA sample was used as a template for a multiplexed amplification using the pooled TCRp primers and the C primer (from Example 2). The C primer and the downstream internal primers were used for the initial amplification of template material from the multiplex amplification.
  • the initial amplification can be done from DNA or RNA (e.g., after conversion to cDNA). Sequencing Nucleic Acid Populations
  • DNA sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, sequencing by synthesis using reversibly terminated labeled nucleotides, pyrosequencing, 454 sequencing, allele specific hybridization to a library of labeled oligonucleotide probes, sequencing by synthesis using allele specific hybridization to a library of labeled clones' that is followed by ligation, real time monitoring of the incorporation of labeled nucleotides during a polymerization step, polony sequencing, and SOLiD sequencing.
  • Sequencing of the separated molecules has more recently been demonstrated by sequential or single extension reactions using polymerases or ligases as well as by single or sequential differential hybridizations with libraries of probes. These reactions have been performed on many clonal sequences in parallel including demonstrations in current commercial applications of over 100 million sequences in parallel. These sequencing approaches can thus be used to study the repertoire of T-cell receptor (TCR) and/or B-cell receptor (BCR).
  • high-throughput methods of sequencing are employed that comprise a step of spatially isolating individual molecules on a solid surface where they are sequenced in parallel.
  • Such solid surfaces may include nonporous surfaces (such as in Solexa sequencing, e.g.
  • such methods comprise amplifying the isolated molecules either before or after they are spatially isolated on a solid surface.
  • Prior amplification may comprise emulsion- based amplification, such as emulsion PCR, or rolling circle amplification.
  • emulsion-based amplification such as emulsion PCR, or rolling circle amplification.
  • Solexa-based sequencing where individual template molecules are spatially isolated on a solid surface, after which they are amplified in parallel by bridge PCR to form separate clonal populations, or clusters, and then sequenced, as described in Bentley et al (cited above) and in manufacturer's instructions (e.g.
  • individual molecules disposed and amplified on a solid surface form clusters in a density of at least 10 5 clusters per cm 2 ; or in a density of at least 5xl0 5 per cm 2 ; or in a density of at least 10 6 clusters per cm 2 .
  • sequencing chemistries are employed having relatively high error rates.
  • the average quality scores produced by such chemistries are monotonically declining functions of sequence read lengths. In one embodiment, such decline corresponds to 0.5 percent of sequence reads have at least one error in positions 1-75; 1 percent of sequence reads have at least one error in positions 76-100; and 2 percent of sequence reads have at least one error in positions 101-125.
  • the sequencing technique used in the methods of the invention generates sequences of least 1000 clonotypes per run; in another aspect, such technique generates sequences of at least 10,000 clonotypes per run; in another aspect, such technique generates sequences of at least 100,000 clonotypes per run; in another aspect, such technique generates sequences of at least 500,000 clonotypes per run; and in another aspect, such technique generates sequences of at least 1,000,000 clonotypes per run. In still another aspect, such technique generates sequences of between 100,000 to 1,000,000 clonotypes per run per individual sample.
  • the sequencing technique used in the methods of the provided invention can generate about 30 bp, about 40 bp, about 50 bp, about 60 bp, about 70 bp, about 80 bp, about 90 bp, about 100 bp, about 110, about 120 bp per read, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, or about 600 bp per read.
  • the sequencing technique used in the methods of the provided invention can generate at least 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 bp per read.
  • a sequence-based clonotype profile of an individual is obtained using the following steps: (a) obtaining a nucleic acid sample from T-cells and/or B-cells of the individual; (b) spatially isolating individual molecules derived from such nucleic acid sample, the individual molecules comprising nested sets of templates each generated from a nucleic acid in the sample and each containing a somatically rearranged region or a portion thereof, each nested set being capable of producing a plurality of sequence reads each extending in the same direction and each starting from a different position on the nucleic acid from which the nested set was generated; (c) sequencing said spatially isolated individual molecules; and (d) determining abundances of different sequences of the nucleic acid molecules from the nucleic acid sample to generate the clonotype profile.
  • the step of sequencing includes producing a plurality of sequence reads for each of the nested sets.
  • each of the somatically rearranged regions comprise a V region and a J region, and each of the plurality of sequence reads starts from a different position in the V region and extends in the direction of its associated J region.
  • the step of sequencing comprises bidirectional ly sequencing each of the spatially isolated individual molecules to produce at least one forward sequence read and at least one reverse sequence read. Further to the latter embodiment, at least one of the forward sequence reads and at least one of the reverse sequence reads have an overlap region such that bases of such overlap region are determined by a reverse complementary relationship between such sequence reads.
  • each of the somatically rearranged regions comprise a V region and a J region and the step of sequencing further includes determining a sequence of each of the individual nucleic acid molecules from one or more of its forward sequence reads and at least one reverse sequence read starting from a position in a J region and extending in the direction of its associated V region.
  • individual molecules comprise nucleic acids selected from the group consisting of complete IgH molecules, incomplete IgH molecules, complete Ig complete, IgK inactive molecules, TCRp molecules, TCRy molecules, complete TCR5 molecules, and incomplete TCR5 molecules.
  • the step of sequencing comprises generating the sequence reads having monotonically decreasing quality scores.
  • monotonically decreasing quality scores are such that the sequence reads have error rates no better than the following: 0.2 percent of sequence reads contain at least one error in base positions 1 to 50, 0.2 to 1.0 percent of sequence reads contain at least one error in positions 51-75, 0.5 to 1.5 percent of sequence reads contain at least one error in positions 76-100.
  • variable regions can be sequenced.
  • the full sequence of the variable regions can be sequenced to identify and quantify a clonotype.
  • a unique subset of the full clonal sequences can be sequenced.
  • nucleotides comprising the VD and the DJ junctions are sequenced to uniquely identify and quantify a clonotype.
  • the fragment that can be sequenced is the full variable region.
  • the antigen recognition region or the complementarity determining region 3 (CDR3) is sequenced. A fragment containing the full CDR3 or the full variable region can be amplified to allow the sequencing of the CDR3 comprising parts of the V, D, and J segments.
  • the CDR3 is amplified and sequenced.
  • Amplification and sequencing of the CDR3 can be accomplished by using primers specific to one or more V segment sequences (as well as one or more primer(s) on the other side of the amplicon in the C segment).
  • Primers for each of the V segments can be utilized in one or more amplification reactions leading to the amplification of the full repertoire of sequences. This repertoire of sequences can then be mixed and subjected to separation, with or without amplification, and sequenced using any of the sequencing techniques described.
  • the amplification with the various V primers is done in separate tubes, the number of molecules carrying the different V segments can be "normalized" due to PCR saturation.
  • V segment had one or several clonal expansions leading to its representation more than other segments this information may be erased or decreased since the PCR reaction for each segment can be driven to saturation or close to it.
  • Real time PCR can be used to quantify how much of each V segment is present.
  • the full CDR3 can be sequenced, or a subset of the sequence CDR3 can be sequenced.
  • only a subset of clonotypes is analyzed. This can be accomplished by amplifying with a primer specific to the subset of clonotypes, for example, a primer that is specific to the V segment.
  • Unique clonotypes can be identified by sequencing with long contiguous reads that provide full connectivity.
  • a short read length across only one of the junctions can generate degenerate tags that are not unique to a specific clonotype but are shared among multiple clonotypes. For example sequencing across the V/J junction can lump all the sequences with the same V/J irrespective of the D segment as one clonotype.
  • Information on the full connectivity of all segments allows sequences to be distinguished that may share the same V and J segments but are connected to different D segments, for example.
  • sequences of clonotypes may be determined by combining information from one or more sequence reads, for example, along the V(D)J regions of the selected chains.
  • sequences of clonotypes are determined by combining information from a plurality of sequence reads.
  • sequence read is a sequence of data generated by a sequencing technique from which a sequence of nucleotides is determined.
  • sequence reads are made by extending a primer along a template nucleic acid, e.g.
  • sequence reads may include one or more sequence reads along a sense strand (i.e. "forward" sequence reads) and one or more sequence reads along its complementary strand (i.e. "reverse” sequence reads).
  • forward sequence reads i.e. "forward” sequence reads
  • reverse sequence reads i.e. "reverse" sequence reads.
  • Such amplifications may be carried out in the same reaction or in separate reactions.
  • separate amplification reactions are used for generating the separate templates which, in turn, are combined and used to generate multiple sequence reads along the same strand. This latter approach is preferable for avoiding the need to balance primer concentrations (and/or other reaction parameters) to ensure equal amplification of the multiple templates (sometimes referred to herein as "balanced amplification” or "unbias amplification").
  • balanced amplification or "unbias amplification”
  • sample containing IgH 400 is divided into three portions (472, 474, and 476) which are added to separate PCRs using J region primers (401) and V region primers (404, 406, and 408, respectively) to produce amplicons (420, 422 and 424, respectively).
  • the latter amplicons are then combined (478) in secondary PCR (480) using P5 and P7 primers to prepare the templates (482) for bridge PCR and sequencing on an Illumina GA sequencer, or like instrument.
  • Sequence reads of the invention may have a wide variety of lengths, depending in part on the sequencing technique being employed. For example, for some techniques, several trade-offs may arise in its implementation, for example, (i) the number and lengths of sequence reads per template and (ii) the cost and duration of a sequencing operation.
  • sequence reads are in the range of from 20 to 400 nucleotides; in another embodiment, sequence reads are in a range of from 30 to 200 nucleotides; in still another embodiment, sequence reads are in the range of from 30 to 120 nucleotides.
  • 1 to 4 sequence reads are generated for determining the sequence of each clonotype; in another embodiment, 2 to 4 sequence reads are generated for determining the sequence of each clonotype; and in another embodiment, 2 to 3 sequence reads are generated for determining the sequence of each clonotype.
  • the numbers given are exclusive of sequence reads used to identify samples from different individuals.
  • the lengths of the various sequence reads used in the embodiments described below may also vary based on the information that is sought to be captured by the read; for example, the starting location and length of a sequence read may be designed to provide the length of an NDN region as well as its nucleotide sequence; thus, sequence reads spanning the entire NDN region are selected.
  • one or more sequence reads encompasses the D and /or NDN regions.
  • sequences of clonotypes are determined in part by aligning sequence reads to one or more V region reference sequences and one or more J region reference sequences, and in part by base determination without alignment to reference sequences, such as in the highly variable NDN region.
  • a variety of alignment algorithms may be applied to the sequence reads and reference sequences. For example, guidance for selecting alignment methods is available in Batzoglou, Briefings in Bioinformatics, 6: 6-22 (2005), which is incorporated by reference.
  • a tree search algorithm is employed, e.g. Cormen et al,
  • an end of at least one forward read and an end of at least one reverse read overlap in an overlap region (e.g. 308 in Fig. 3B), so that the bases of the reads are in a reverse complementary relationship with one another.
  • an overlap region e.g. 308 in Fig. 3B
  • a forward read in the overlap region is "5'-acgttgc”
  • a reverse read in a reverse complementary relationship is "5'-gcaacgt" within the same overlap region.
  • bases within such an overlap region are determined, at least in part, from such a reverse complementary relationship. That is, a likelihood of a base call (or a related quality score) in a prospective overlap region is increased if it preserves, or is consistent with, a reverse complementary relationship between the two sequence reads.
  • clonotypes of TCR ⁇ and IgH chains are determined by at least one sequence read starting in its J region and extending in the direction of its associated V region (referred to herein as a "C read” (304)) and at least one sequence read starting in its V region and extending in the direction of its associated J region (referred to herein as a "V read” (306)).
  • Overlap region (308) may or may not encompass the NDN region (315) as shown in Fig. 3B. Overlap region (308) may be entirely in the J region, entirely in the NDN region, entirely in the V region, or it may encompass a J region-NDN region boundary or a V region-NDN region boundary, or both such boundaries (as illustrated in Fig. 3B).
  • sequence reads are generated by extending sequencing primers, e.g. (302) and (310) in Fig. 3B, with a polymerase in a sequencing-by-synthesis reaction, e.g. Metzger, Nature Reviews Genetics, 11: 31-46 (2010); Fuller et al, Nature Biotechnology, 27: 1013-1023 (2009).
  • the binding sites for primers (302) and (310) are predetermined, so that they can provide a starting point or anchoring point for initial alignment and analysis of the sequence reads.
  • a C read is positioned so that it encompasses the D and/or NDN region of the TCR ⁇ or IgH chain and includes a portion of the adjacent V region, e.g. as illustrated in Figs. 3B and 3C.
  • the overlap of the V read and the C read in the V region is used to align the reads with one another.
  • such alignment of sequence reads is not necessary, e.g. with TCRP chains, so that a V read may only be long enough to identify the particular V region of a clonotype.
  • Sequence read (330) is used to identify a V region, with or without overlapping another sequence read, and another sequence read (332) traverses the NDN region and is used to determine the sequence thereof. Portion (334) of sequence read (332) that extends into the V region is used to associate the sequence information of sequence read (332) with that of sequence read (330) to determine a clonotype. For some sequencing methods, such as base-by-base approaches like the Solexa sequencing method, sequencing run time and reagent costs are reduced by minimizing the number of sequencing cycles in an analysis. Optionally, as illustrated in Fig.
  • amplicon (300) is produced with sample tag (312) to distinguish between clonotypes originating from different biological samples, e.g. different patients.
  • Sample tag (312) may be identified by annealing a primer to primer binding region (316) and extending it (314) to produce a sequence read across tag (312), from which sample tag (312) is decoded.
  • the IgH chain is more challenging to analyze than TCRP chain because of at least two factors: i) the presence of somatic mutations makes the mapping or alignment more difficult, and ii) the NDN region is larger so that it is often not possible to map a portion of the V segment to the C read.
  • this problem is overcome by using a plurality of primer sets for generating V reads, which are located at different locations along the V region, preferably so that the primer binding sites are nonoverlapping and spaced apart, and with at least one primer binding site adjacent to the NDN region, e.g. in one embodiment from 5 to 50 bases from the V-NDN junction, or in another embodiment from 10 to 50 bases from the V-NDN junction.
  • the redundancy of a plurality of primer sets minimizes the risk of failing to detect a clonotype due to a failure of one or two primers having binding sites affected by somatic mutations.
  • the presence of at least one primer binding site adjacent to the NDN region makes it more likely that a V read will overlap with the C read and hence effectively extend the length of the C read.
  • This allows for the generation of a continuous sequence that spans all sizes of NDN regions and that can also map substantially the entire V and J regions on both sides of the NDN region.
  • Figs. 4A and 4D Embodiments for carrying out such a scheme are illustrated in Figs. 4A and 4D. In Fig.
  • a sample comprising IgH chains (400) are sequenced by generating a plurality amplicons for each chain by amplifying the chains with a single set of J region primers (401) and a plurality (three shown) of sets of V region (402) primers (404, 406, 408) to produce a plurality of nested amplicons (e.g., 410, 412, 416) all comprising the same NDN region and having different lengths encompassing successively larger portions (41 1, 413, 415) of V region (402).
  • nested amplicons e.g., 410, 412, 416
  • the plurality of primer sets may be a number in the range of from 2 to 5. In another embodiment the plurality is 2-3; and still another embodiment the plurality is 3.
  • the concentrations and positions of the primers in a plurality may vary widely. Concentrations of the V region primers may or may not be the same. In one embodiment, the primer closest to the NDN region has a higher concentration than the other primers of the plurality, e.g.
  • a concentration ratio of 60:20:20 is used.
  • One or more primers (e.g. 435 and 437 in Fig. 4B) adjacent to the NDN region (444) may be used to generate one or more sequence reads (e.g. 434 and 436) that overlap the sequence read (442) generated by J region primer (432), thereby improving the quality of base calls in overlap region (440).
  • Sequence reads from the plurality of primers may or may not overlap the adjacent downstream primer binding site and/or adjacent downstream sequence read.
  • sequence reads proximal to the NDN region e.g.
  • a secondary PCR may be performed to prepare the nested amplicons for sequencing, e.g. by amplifying with the P5 (401) and P7 (404, 406, 408) primers as illustrated to produce amplicons (420, 422, and 424), which may be distributed as single molecules on a solid surface, where they are further amplified by bridge PCR, or like technique.
  • NDN regions can be improved by using the codon structure of the flanking J and V regions, as illustrated in Fig. 4C.
  • “codon structure” means the codons of the natural reading frame of segments of TCR or BCR transcripts or genes outside of the NDN regions, e.g. the V region, J region, or the like.
  • amplicon (450) which is an enlarged view of the amplicon of Fig. 4B, is shown along with the relative positions of C read (442) and adjacent V read (434) above and the codon structures (452 and 454) of V region (430) and J region (446), respectively, below.
  • bases in NDN region (456) are called (or identified) one base at a time moving from J region (446) toward V region (430) and in the opposite direction from V region (430) toward J region (446) using sequence reads (434) and (442).
  • sequence reads (434) and (442) are used to identify bases in NDN region (456).
  • only the recombined TCR or IgH sequences that have in frame codons from the V region through the NDN region and to the J region are expressed as proteins. That is, of the variants generated somatically only ones expressed are those whose J region and V region codon frames are in-frame with one another and remain in-frame through the NDN region.
  • the correct frames of the V and J regions are determined from reference sequences. If an out-of-frame sequence is identified based one or more low quality base calls, the corresponding clonotype is flagged for re-evaluation or as a potential disease-related anomaly. If the sequence identified is in-frame and based on high quality base calls, then there is greater confidence that the corresponding clonotype has been correctly called.
  • the invention includes a method of determining V(D)J-based clonotypes from bidirectional sequence reads comprising the steps of: (a) generating at least one J region sequence read that begins in a J region and extends into an NDN region and at least one V region sequence read that begins in the V regions and extends toward the NDN region such that the J region sequence read and the V region sequence read are overlapping in an overlap region, and the J region and the V region each have a codon structure; (b) determining whether the codon structure of the J region extended into the NDN region is in frame with the codon structure of the V region extended toward the NDN region.
  • the step of generating includes generating at least one V region sequence read that begins in the V region and extends through the NDN region to the J region, such that the J region sequence read and the V region sequence read are overlapping in an overlap region.
  • Analyzing Sequence Reads Coalescing sequence reads into clonotypes. Constructing clonotypes from sequence read data depends in part on the sequencing method used to generate such data, as the different methods have different expected read lengths and data quality.
  • a Solexa sequencer is employed to generate sequence read data for analysis.
  • a sample is obtained that provides at least 0.5- l .OxlO 6 lymphocytes to produce at least 1 million template molecules, which after optional amplification may produce a corresponding one million or more clonal populations of template molecules (or clusters).
  • each template sequence is determined with a large degree of redundancy to increase the accuracy of sequence determination.
  • the sequence of each independent template is determined 10 times or more.
  • different levels of redundancy may be used for comparable accuracy of sequence determination.
  • coalescing of sequence reads depends on three factors: the number of sequences obtained for each of the two clonotypes of interest; the number of bases at which they differ; and the sequencing quality at the positions at which they are discordant.
  • a likelihood ratio is assessed that is based on the expected error rates and binomial distribution of errors. For example two clonotypes, one with 150 reads and the other with 2 reads with one difference between them in an area of poor sequencing quality will likely be coalesced as they are likely to be generated by sequencing error. On the other hand two clonotypes, one with 100 reads and the other with 50 reads with two differences between them are not coalesced as they are considered to be unlikely to be generated by sequencing error.
  • the algorithm described below may be used for determining clonotypes from sequence reads.
  • This cloud of reads surrounding each clonotype can be modeled using the binomial distribution and a simple model for the probability of a single base error.
  • This latter error model can be inferred from mapping V and J segments or from the clonotype finding algorithm itself, via self-consistency and convergence.
  • a model is constructed for the probability of a given 'cloud' sequence Y with read count C2 and E errors (with respect to sequence X) being part of a true clonotype sequence X with perfect read count CI under the null model that X is the only true clonotype in this region of sequence space.
  • a decision is made whether or not to coalesce sequence
  • Y into the clonotype X according the parameters CI, C2, and E.
  • CI parameters CI, C2, and E.
  • a max value C2 is pre- calculated for deciding to coalesce the sequence Y.
  • the max values for C2 are chosen so that the probability of failing to coalesce Y under the null hypothesis that Y is part of clonotype X is less than some value P after integrating over all possible sequences Y with error E in the neighborhood of sequence X.
  • the value P is controls the behavior of the algorithm and makes the coalescing more or less permissive.
  • the algorithm proceeds in a top down fashion by starting with the sequence X with the highest read count. This sequence seeds the first clonotype. Neighboring sequences are either coalesced into this clonotype if their counts are below the precalculated thresholds (see above), or left alone if they are above the threshold or 'closer' to another sequence that was not coalesced. After searching all neighboring sequences within a maximum error count, the process of coalescing reads into clonotype X is finished. Its reads and all reads that have been coalesced into it are accounted for and removed from the list of reads available for making other clonotypes. The next sequence is then moved on to with the highest read count.
  • Neighboring reads are coalesced into this clonotype as above and this process is continued until there are no more sequences with read counts above a given threshold, e.g. until all sequences with more than 1 count have been used as seeds for clonotypes.
  • a further test may be added for determining whether to coalesce a candidate sequence Y into an existing clonotype X, which takes into account quality score of the relevant sequence reads.
  • the average quality score(s) are determined for sequence(s) Y (averaged across all reads with sequence Y) were sequences Y and X differ. If the average score is above a predetermined value then it is more likely that the difference indicates a truly different clonotype that should not be coalesced and if the average score is below such predetermined value then it is more likely that sequence Y is caused by sequencing errors and therefore should be coalesced into X.
  • Sequence Tree The above algorithm of coalescing reads into clonotypes is dependent upon having an efficient way of finding all sequences with less than E errors from some input sequence X. This problem is solved using a sequence tree.
  • the implementation of this tree has some unusual features in that the nodes of the tree are not restricted to being single letters of DNA. The nodes can have arbitrarily long sequences. This allows for a more efficient use of computer memory.
  • All of the reads of a given sample are placed into the sequence tree.
  • Each leaf nodes holds pointers to its associated reads. It corresponds to a unique sequence given by traversing backwards in the tree from the leaf to the root node.
  • the first sequence is placed into a simple tree with one root node and one leaf node that contains the full sequence of the read. Sequences are next added one by one. For each added sequence either a new branch is formed at the last point of common sequence between the read and the existing tree or add the read to an existing leaf node if the tree already contains the sequence.
  • IgH-based clonotypes that have undergone somatic hypermutation are determined as follows.
  • a somatic mutation is defined as a sequenced base that is different from the corresponding base of a reference sequence (of the relevant segment, usually V, J or C) and that is present in a statistically significant number of reads.
  • C reads may be used to find somatic mutations with respect to the mapped J segment and likewise V reads for the V segment. Only pieces of the C and V reads are used that were either directly mapped to J or V segments or that were inside the clonotype extension up to the NDN boundary.
  • the NDN region is avoided and the same 'sequence information' is not used for mutation finding that was previously used for clonotype determination (to avoid erroneously classifying as mutations nucleotides that are really just different recombined NDN regions).
  • the mapped segment (major allele) is used as a scaffold and all reads are considered which have mapped to this allele during the read mapping phase.
  • Each position of the reference sequences where at least one read has mapped is analyzed for somatic mutations.
  • the criteria for accepting a non-reference base as a valid mutation include the following: 1) at least N reads with the given mutation base, 2) at least a given fraction N/M reads (where M is the total number of mapped reads at this base position) and 3) a statistical cut based on the binomial distribution, the average Q score of the N reads at the mutation base as well as the number ( -N) of reads with a non-mutation base.
  • the above parameters are selected so that the false discovery rate of mutations per clonotype is less than 1 in 1000, and more preferably, less than 1 in 10000.
  • Phylogenic Clonotypes (Clans).
  • cancers such as lymphoid neoplasms
  • a single lymphocyte progenitor may give rise to many related lymphocyte progeny, each possessing and/or expressing a slightly different TCR or BCR, and therefore a different clonotype, due to cancer-related somatic mutation(s), such as base substitutions, aberrant rearrangements, or the like.
  • phylogenic clones Cells producing such clonotypes are referred to herein as phylogenic clones, and a set of such related clones are referred to herein as a "clan.”
  • clonotypes of phylogenic clones are referred to as phylogenic clonotypes and a set of phylogenic clonotypes may be referred to as a clan of clonotypes.
  • methods of the invention comprise monitoring the frequency of a clan of clonotypes (i.e., the sum of frequencies of the constituent phylogenic clonotypes of the clan), rather than a frequency of an individual clonotype.
  • Phylogenic clonotypes may be identified by one or more measures of relatedness to a parent clonotype. In one embodiment, phylogenic clonotypes may be grouped into the same clan by percent homology, as described more fully below. In another embodiment, phylogenic clonotypes are identified by common usage of V regions, J regions, and/or NDN regions.
  • a clan may be defined by clonotypes having common J and ND regions but different V regions; or it may be defined by clonotypes having the same V and J regions (including identical base substitutions mutations) but with different NDN regions; or it may be defined by a clonotype that has undergone one or more insertions and/or deletions of from 1-10 bases, or from 1-5 bases, or from 1-3 bases, to generate clan members.
  • members of a clan are determined as follows.
  • Clonotypes are assigned to the same clan if they satisfy the following criteria: i) they are mapped to the same V and J reference segments, with the mappings occurring at the same relative positions in the clonotype sequence, and ii) their NDN regions are substantially identical. "Substantial" in reference to clan membership means that some small differences in the NDN region are allowed because somatic mutations may have occurred in this region. Preferably, in one embodiment, to avoid falsely calling a mutation in the NDN region, whether a base substitution is accepted as a cancer-related mutation depends directly on the size of the NDN region of the clan.
  • a method may accept a clonotype as a clan member if it has a one-base difference from clan NDN sequence(s) as a cancer-related mutation if the length of the clan NDN sequence(s) is m nucleotides or greater, e.g. 9 nucleotides or greater, otherwise it is not accepted, or if it has a two-base difference from clan NDN sequence(s) as cancer-related mutations if the length of the clan NDN sequence(s) is n nucleotides or greater, e.g.
  • members of a clan are determined using the following criteria: (a) V read maps to the same V region, (b) C read maps to the same J region, (c) NDN region substantially identical (as described above), and (d) position of NDN region between V-NDN boundary and J-NDN boundary is the same (or equivalently, the number of downstream base additions to D and the number of upstream base additions to D are the same).
  • Clonotypes of a single sample may be grouped into clans and clans from successive samples acquired at different times may be compared with one another.
  • clans containing clonotypes correlated with a disease are identified from clonotypes of each sample and compared with that of the immediately previous sample to determine disease status, such as, continued remission, incipient relapse, evidence of further clonal evolution, or the like.
  • PCR error is concentrated in some bases that were mutated in the early cycles of PCR. Sequencing error is expected to be distributed in many bases even though it is totally random as the error is likely to have some systematic biases. It is assumed that some bases will have sequencing error at a higher rate, say 5% (5 fold the average). Given these assumptions, sequencing error becomes the dominant type of error. Distinguish PCR errors from the occurrence of highly related clonotypes will play a role in analysis. Given the biological significance to determining that there are two or more highly related clonotypes, a conservative approach to making such calls is taken.
  • the detection of enough of the minor clonotypes so as to be sure with high confidence (say 99.9%) that there are more than one clonotype is considered. For example of clonotypes that are present at 100 copies/1,000,000, the minor variant is detected 14 or more times for it to be designated as an independent clonotype. Similarly, for clonotypes present at 1,000 copies/ 1,000,000 the minor variant can be detected 74 or more times to be designated as an independent clonotype. This algorithm can be enhanced by using the base quality score that is obtained with each sequenced base.
  • the quality score can be used to decide the number of reads that need to be present to call an independent clonotype.
  • the median quality score of the specific base in all the reads can be used, or more rigorously, the likelihood of being an error can be computed given the quality score of the specific base in each read, and then the probabilities can be combined (assuming independence) to estimate the likely number of sequencing error for that base.
  • kits for amplification of specific somatically rearranged regions or portions thereof are particularly useful. Such kits may be for carrying out one or two staged PCRs (as described above) for amplifying a predetermined somatically rearranged region or portion thereof for the purpose of preparing a sample of clonotypes for sequence analysis.
  • a kit typically comprises one or more reagents, such as, without limitation, nucleic acid primers, packaged in a container, such as, without limitation, a vial, tube or bottle, in a package suitable for commercial distribution, such as, without limitation, a box, a sealed pouch, a blister pack or a carton.
  • the package typically contains a label or packaging insert indicating that the packaged reagents can be used in a method for generating a clonotype profile from a tissue sample of a patient.
  • packaging materials includes any article used in the packaging for distribution of reagents in a kit, including without limitation containers, vials, tubes, bottles, pouches, blister packaging, labels, tags, instruction sheets and package inserts.
  • a kit includes reagents necessary for the amplification in one tube of TCRP sequences from DNA or RNA extracted T cells of a patient or peripheral blood lymphocytes of a patient or bone marrow of a patient, as described above.
  • kits includes reagents necessary for the amplification in a plurality of tubes IgH sequences from DNA or RNA extracted B cells of a patient or peripheral blood lymphocytes of a patient or bone marrow of a patient, as described above.
  • necessary reagents include a plurality of sets of primers for generating nested sets of templates, as described above.
  • such plurality is 2 or 3 or 4.
  • three sets of primers are provided; and more specifically, the following three sets of primers are provided: set 1 comprising forward primers from Table 5 and reverse primers from Table 8; set 2 comprising forward primers from Table 6 and reverse primers from Table 8; set 3 comprising forward primers from Table 7 and reverse primers from Table 8.
  • the kit would include the above-described reagents, including one or more PCR primer sets and a thermostable DNA polymerase, such as Taq polymerase, and if sequences are amplified from RNA, a reverse transcriptase.
  • the primers may be present in quantities that would yield a balanced amplification of individual clonotype sequences in a patient sample, as described above.
  • quantities of primers are provided to ensure a balanced amplification of clonotypes.
  • Such balancing of multiplex PCRs is well known by practitioners of ordinary skill in the art and includes, but is not limited to, adjusting the concentrations of primers in the reaction and or selecting the positions and lengths of primers in a region of interest to increase or decrease the rate of annealing of individual primers.
  • the quantities of primers are selected so that in the PCR their concentrations are such that the rate at which each primer anneals to its primer binding site is substantially identical.
  • quantities of primers are selected so that each sequence in a sample is amplified to an amount that is within 2-fold of the average amplification amount of a random sample of clonotypes.
  • such random sample contains at least 100 clonotypes.
  • kits may include: suitable reaction tubes or vials, a barrier composition, typically a wax bead, optionally including magnesium; reaction mixtures (often concentrated, for example 2X, 5X, 1 OX or 20X) for the PCR stages, including necessary buffers and reagents such as dNTPs; nuclease- or RNase- free water; RNase inhibitor; control nucleic acid(s) (i.e. such as internal standards), and/or any additional buffers, compounds, co- factors, ionic constituents, proteins and enzymes, polymers, and the like that may be used in multiplex PCR reactions.
  • kits are packaged in any manner that is commercially practicable.
  • PCR primers and/or reverse transcriptase may be packaged individually to facilitate flexibility in configuring the assay, or together to increase ease of use and to reduce contamination.
  • buffers, salts and co-factors can be packaged separately or together.
  • the kits also may include reagents and mechanical components suitable for the manual or automated extraction of nucleic acid from a tissue sample. These reagents are known to those skilled in the art and typically are a matter of design choice. For instance, in one embodiment of an automated process, tissue is disrupted ultrasonically in a suitable lysis solution provided in the kit.
  • TCR chains are analyzed.
  • the analysis includes amplification, sequencing, and analyzing the TCRP sequences.
  • One primer AGCGACCTCGGGTGGGAACA (SEQ ID NO: 1) is
  • V primers capable of amplifying all 48 V segments.
  • C ⁇ or C 2 differ from each other at position 10 and 14 from the J/C junction.
  • the primer for C l and Cp2 ends at position 16 bp and has no preference for Cpi or C 2.
  • the 34 V primers are modified from an original set of primers disclosed in Van Dongen et al, U.S. patent publication 2006/0234234, which is incorporated herein by reference.
  • V7-7 AACCCTTTATTGGTATCAACAG 14
  • V4-1, 4-3, 4-2B CGCTATGTATTGGTACAAGCA 16
  • VlO-l 10-2, 6-5, 6-9, 6-8, 27B ATATGTCCTGGTATCGACAAGA 25
  • VlO-l 10-2, 6-5, 6-9, 6-8, 27C ACATGTCCTGGTATCGACAAGA 26
  • Vll-1, 11-3, 11-2A CATGCTACCCTTTACTGGTACC 31
  • Vll-1, 11-3, 11-2B CACAATACCCTTTACTGGTACC 32
  • the Illumina Genome Analyzer is used to sequence the amplicon produced by the above primers.
  • a two-stage amplification is performed on messenger RNA transcripts (200), as illustrated in Figs. 2A-2B, the first stage employing the above primers and a second stage to add common primers for bridge amplification and sequencing.
  • a primary PCR is performed using on one side a 20 bp primer (202) whose 3' end is 16 bases from the J/C junction (204) and which is perfectly complementary to Cpi(203) and the two alleles of CP2.
  • primer set (212) is provided which contains primer sequences complementary to the different V region sequences (34 in one embodiment).
  • Primers of set (212) also contain a non-complementary tail (214) that produces amplicon (216) having primer binding site (218) specific for P7 primers (220).
  • amplicon (216) is formed that contains the highly diverse portion of the J(D)V region (206, 208, and 210) of the mRNA transcripts and common primer binding sites (203 and 218) for a secondary amplification to add a sample tag (221) and primers (220 and 222) for cluster formation by bridge PCR.
  • a primer 222 in Fig.
  • C10- 17-P5 2B and referred to herein as "C10- 17-P5"
  • C10-17-P5 primer anneals to the template generated from the first PCR
  • a 4 bp loop position 1 1-14 is created in the template, as the primer hybridizes to the sequence of the 10 bases closest to the J/C junction and bases at positions 15-31 from the J/C junction.
  • the looping of positions 1 1-14 eliminates differential amplification of templates carrying C i or ⁇ 2.
  • C10-17-P5 primer can be HPLC purified in order to ensure that all the amplified material has intact ends that can be efficiently utilized in the cluster formation.
  • the length of the overhang on the V primers (212) is preferably 14 bp.
  • the primary PCR is helped with a shorter overhang (214).
  • the overhang in the V primer is used in the primary PCR as long as possible because the secondary PCR is priming from this sequence.
  • a minimum size of overhang (214) that supports an efficient secondary PCR was investigated. Two series of V primers (for two different V segments) with overhang sizes from 10 to 30 with 2 bp steps were made. Using the appropriate synthetic sequences, the first PCR was performed with each of the primers in the series and gel electrophoresis was performed to show that all amplified.
  • the primary PCR uses 34 different V primers (212) that anneal to V region (206) of RNA templates (200) and contain a common 14 bp overhang on the 5' tail.
  • the 14 bp is the partial sequence of one of the Illumina sequencing primers (termed the Read 2 primer).
  • the secondary amplification primer (220) on the same side includes P7 sequence, a tag (221), and Read 2 primer sequence (223) (this primer is called Read2_tagX_P7).
  • the P7 sequence is used for cluster formation.
  • Read 2 primer and its complement are used for sequencing the V segment and the tag respectively.
  • a set of 96 of these primers with tags numbered 1 through 96 are created (see below). These primers are HPLC purified in order to ensure that all the amplified material has intact ends that can be efficiently utilized in the cluster formation.
  • the second stage primer, C- 10-17-P5 (222, FIG. 2B) has interrupted homology to the template generated in the first stage PCR.
  • the efficiency of amplification using this primer has been validated.
  • An alternative primer to C-10-17-P5, termed CsegP5 has perfect homology to the first stage C primer and a 5' tail carrying P5.
  • the efficiency of using C- 10- 17-P5 and CsegP5 in amplifying first stage PCR templates was compared by performing real time PCR. In several replicates, it was found that PCR using the C-10-17-P5 primer had little or no difference in efficiency compared with PCR using the CsegP5 primer.
  • CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 37) are used for solid phase amplification of the molecule (cluster formation). Three sequence reads are done per molecule. The first read of 100 bp is done with the C primer, which has a melting temperature that is appropriate for the lllumina sequencing process. The second read is 6 bp long only and is solely for the purpose of identifying the sample tag. It is generated using the lllumina Tag primer (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) (SEQ ID NO: 38). The final read is the Read 2 primer, an lllumina primer with the sequence
  • a set of 6 bp sequence tags to distinguish different samples run in the same sequencing lane was designed, where each tag is different from all the other tags in the set by at least 2 differences.
  • the 2 differences prevent misassignment of a read to the wrong sample if there is a sequencing error.
  • the alignment done to compare the tags allowed gaps and hence one deletion or insertion error by sequencing will also not assign the read to the wrong sample.
  • Additional features in selecting the tags was to limit single base runs (4 A or T and 3 G or C) as well as no similarity to the lllumina primers. In total 143 tags were generated, 96 of them are used.
  • FIGS. 5A-5C identical sequences in each sample were identified. Then to deal with sequencing errors some clonotypes were coalesced to form larger clonotypes using the general approaches described in the section of primary analysis of sequence. The counts of clonotypes were then computed in each sample. A fraction of the clonotypes (not shown in the figure) were present in one sample but not another, likely due to the algorithm coalescing them with another clonotype in one sample but not the other. The frequency of clonotypes in a sample is then computed as its number of counts divided by the total number of reads obtained for that sample.
  • FIG. 7A shows the log )0 of the frequency of each clonotype in the two duplicate samples using Accuprime and cDNA corresponding to 500 ng of RNA as input template. The correlation (r 2 ) between these duplicates is 0.944.
  • three primers are used to amplify V regions of IgH molecules.
  • the primers are in regions avoiding the CDRs, which have the highest frequency of somatic mutations.
  • Three different amplification reactions are performed. In each reaction, each of the V segments is amplified by one of the three primers and all will use the same C segment primers.
  • the primers in each of the separate reactions are approximately the same distance from the V-D joint and different distances with respect to the primers in different reactions, so that the primers of the three reactions are spaced apart along the V segment.
  • the first set of primers (frame A) have the 3' end at approximately -255
  • the second set (frame B) have the 3' end at approximately -160
  • the third set (frame C) have the 3' end at approximately -30.
  • IGHV5 1 GCTGGGTGCGCCAGATGCCC 64
  • IGHV1_1 GTGCGACAGGCCCCTGGACAA 67
  • IGHV1 2 GGGTGCGACAGGCCACTGGACAA 68
  • IGHV1 3 GTGCGCCAGGCCCCCGGACAA 69
  • IGHV1_4 GGGTGCGACAGGCTCGTGGACAA 70
  • IGHV1_6 GGGTGCGACAGGCTCCTGGAAAA 72
  • IGHV4 1 TCCGCCAGCCCCCAGGGAAGG 75
  • IGHV4 2 TCCGGCAGCCCCCAGGGAAGG 76
  • IGHV4 3 TCCGGCAGCCACCAGGGAAGG 77
  • IGHV4 4 TCCGCCAGCACCCAGGGAAGG 78
  • IGHV4 6 TCCGGCAGCCGCCGGGGAA 80
  • IGHV4 7 TCCGGCAGCCCGCTGGGAAGG 81
  • IGHV4 8 TCCGCCAGCCCCTAGGGAAGG 82
  • IGHV3_2 GTTCCGCCAGGCTCCAGGGAA 84
  • IGHV5 1 AGTGGAGCAGCCTGAAGGCCTC 98
  • IGHV1_1 ACATGGAGCTGAGCAGCCTGAGATC 100
  • IGHV1_2 ACATGGAGCTGAGCAGGCTGAGATC 101
  • IGHV1 3 ACATGGAGCTGAGCAGCCTGAGATC 102
  • IGHV1 4 ACATGGAGCTGAGGAGCCTAAGATCTGA 103
  • IGHV4 11 GAGCTCTGTGACCGCTGACACGG 114
  • IGHV3_1 CAAATGAACAGCCTGAGAGCCGAGGACA 115
  • IGHV3 2 CAAATGAACAGCCTGAAAACCGAGGACA 116
  • IGHV3_3 CAAATGAACAGTCTGAAAACCGAGGACA 117
  • IGHV3 4 CAAATGATCAGCCTGAAAACCGAGGACA 118
  • IGHV3_5 C AAAT GAAC AG T C T G G AC TGAGGACACC 119
  • IGHV3_6 CAAATGAACAGTCTGAGAGCCGAGGACA 120
  • IGHV3_7 CAAATGAACAGCCTGAGAGCTGAGGACA 121
  • IGHV3_8 C AAAT GAG CAGCCTGAGAGCTGAGGACA 122
  • IGHV3_9 CAAATGAACAGCCTGAGAGACGAGGACA 123
  • IGHV3_10 C AAAT GGGCAGCCTGAGAGCTGAGGACA 124
  • IGHV3 11 CAAATGAACAGCCTGAGAGCCGGGGA 125
  • IGHV3 12 CAAATGAACAGTCTGAGAGCTGAGGACA 126
  • IGHV3 13 CAAATGAGCAGTCTGAGAGCTGAGGACA 127
  • a multiplexed PCR using three pools of primers corresponding to the three frames was carried out using cDNA as a template. After primary and secondary PCRs, the products were run on an agarose gel. Single bands with the appropriate relative sizes were obtained from the three pools.
  • three different reactions from a single sample are mixed at equimolar ratio and subjected to sequencing. Sequencing is done from both directions using the two Illumina primers, such as described above. 100 bp is sequenced from each side. The maximal germ line sequences encompassing the D+J segments are -30 bp longer for BCR than TCR. Therefore if the net result of nucleotide removal and addition at the joints (N and P nucleotides) generate a similar distribution for IgH and TCR , on average 90 bp and maximally 120 bp of sequence after the C segment is sufficient to reach the 3' of the V segment. Therefore, in most cases, the sequence from the C primer is sufficient to reach the V segment.
  • Sequencing from one of the Illumina adapters identifies the V segment used as well as somatic hypermutations in the V segments. Different pieces of the V segments are sequenced depending on which of the three amplification reactions the sequence originated from. The full sequence of the BCR can be aligned from different reads that originated from different amplification reactions. The sequencing reaction from the one end showing the full CDR3 sequence greatly facilitates the accurate alignment of different reads.
  • amplification of IgH sequences from genomic DNA is described. Such amplification is advantageous because (1) the level of a clonotype in genomic DNA can be readily converted to number of cells, and (2) in some lymphoid neoplasms, RNA may not be expressed for the relevant immune receptor
  • Amplification of immune receptor rearrangement is important for the detection of lymphoid neoplasms.
  • B cell neoplasms are more common than T cell tumors and IgH is the most common rearranged immune receptor in B cell neoplasms.
  • reliability of amplifying of IgH from genomic DNA may be increase by amplifying with multiple primers for each V segment, although there is a risk of differential amplification.
  • the same V primers were used that were used in amplification from cDNA.
  • Each V segment is amplified by 3 primers (in 3 distinct regions of the V segment: A, B, and C) in three different reactions (Tables 5-7, respectively) (see Fig. 4A).
  • Amplification of IgH from genomic DNA has several differences from its amplification from cDNA.
  • the C segment gets attached to the VDJ region through splicing and hence sequences of the C segment can be used for amplification from cDNA but not genomic DNA.
  • the use of C segment allows the use of two distinct primers in the 1 st and 2 nd amplifications increasing the specificity.
  • primers that are complementary to the J sequences Table 8
  • the J segment primers used are common sequences that are appended to the sequence complementary to the J segment in order to allow the second stage amplification.
  • the position N signifies one random position in order to obtain diversity in the sequenced clusters.
  • the small letter sequence are in the intron, and the capital letter sequences in the 3' of the sequence are in the exon.
  • the letters in italics emphasize the bases that differ among the primers.
  • These primers span the exon-intron boundaries, and the four primers utilized amplify the different J segments and alleles described in the IMGT database. Primers of the second stage do not have any sequences complementary to genomic sequences.
  • the first stage PCR can be done using a set of constant region primers encompassing all the different classes (and the V segment primers on the other side as we have demonstrated).
  • the second stage PCR can be done with the J primers which are long enough to have high specificity for second stage PCR which is utilizing a low complexity template.
  • the products are then be sequenced.
  • the disadvantage compared with the scheme demonstrated for IgG is that somatic mutations in the J sequence may inhibit the amplification.
  • the advantage is that all the different classes are assessed, even though the information on the class of each clonotype is not fully determined.
  • IgG class specific amplification
  • IgM class specific amplification
  • IgD class specific amplification
  • IgA class specific amplification
  • IgE class specific amplification
  • J primers in cDNA also allows the direct comparison between the cDNA and genomic DNA results. This would provide expression level information at a clonotype level and can indeed have functional relevance.
  • One aspect of this invention is that comparing the clonotype profile of cDNA and genomic DNA from the same blood or other biological sample identifies clonotypes that have different frequencies indicating unusually high or low expression per cell. This functional information can be utilized to predict whether a clonotype is likely to be correlating with disease or not.
  • the level of expression per cell of a clonotype correlating with a disease can be used to determine the disease activity or the likelihood of a disease outcome.
  • obtaining the same level in the cDNA assay for a correlating clonotype in two individuals may still indicate the patients have different disease activities if the clonotypes level of expression per cell (as determined by comparison with the genomic DNA clonotype profiling) is different.
  • the second stage PCR is to attach the sequences necessary for the amplification.
  • the primers used in the second stage are listed in Table 9. Table 9
  • Third stage is an optional amplification stage for all the assays (e.g, mouse TCR and human IgH). It is done to ensure the integrity of the end sequences that hybridize to the oligonucleotides attached to the flow cell.
  • the common second stage primer is used in all the assays (e.g, mouse TCRP and human IgH). Note that use of N in the common second stage primer is to denote the fact that each of these primers contains a unique 6 base pair tag to allow samples to be later identified.
  • FIGs. 8A-8B show examples of such amplifications, which were successful at least in the range of genomic DNA 50- 2,000 ⁇ g in 20 ⁇ of input genomic DNA.
  • the assay needs to accommodate a large dynamic range of DNA. Biopsy samples may not have large amount of material, but given that the tumor is likely to be greatly enriched there is no need for a large amount of starting material. On the other hand, one million cells will have ⁇ 6 ⁇ g of genomic DNA. PBMC containing 1 million B cells will likely have ⁇ 20 ⁇ g of genomic DNA. To be able to assess 1 million B cells, -6.6 ⁇ g of genomic DNA is used in each of the 3 PCR reactions. Of note is that if there is a somatic mutation in the sequence complementary to one of the primers then in this example only -660 B cells are being interrogated. It is useful if the assay works over the range of 50 to 10,000 ng. The assay has been demonstrated to work in the range of 50- 2,000 ng of DNA in 20 ⁇ . By scaling up the reaction to 100 ⁇ , 10 ⁇ g of DNA can be used.
  • Amplicon means the product of a polynucleotide amplification reaction; that is, a clonal population of polynucleotides, which may be single stranded or double stranded, which are replicated from one or more starting sequences.
  • the one or more starting sequences may be one or more copies of the same sequence, or they may be a mixture of different sequences.
  • amplicons are formed by the amplification of a single starting sequence. Amplicons may be produced by a variety of amplification reactions whose products comprise replicates of the one or more starting, or target, nucleic acids.
  • amplification reactions producing amplicons are "template-driven" in that base pairing of reactants, either nucleotides or
  • oligonucleotides have complements in a template polynucleotide that are required for the creation of reaction products.
  • template-driven reactions are primer extensions with a nucleic acid polymerase or oligonucleotide ligations with a nucleic acid ligase.
  • Such reactions include, but are not limited to, polymerase chain reactions (PCRs), linear polymerase reactions, nucleic acid sequence-based amplification (NASBAs), rolling circle amplifications, and the like, disclosed in the following references that are incorporated herein by reference: Mullis et al, U.S. patents 4,683,195; 4,965, 188; 4,683,202; 4,800,159 (PCR); Gelfand et al, U.S.
  • amplicons of the invention are produced by PCRs.
  • An amplification reaction may be a "real-time” amplification if a detection chemistry is available that permits a reaction product to be measured as the amplification reaction progresses, e.g.
  • reaction mixture means a solution containing all the necessary reactants for performing a reaction, which may include, but not be limited to, buffering agents to maintain pH at a selected level during a reaction, salts, co-factors, scavengers, and the like.
  • “Clonality” as used herein means a measure of the degree to which the distribution of clonotype abundances among clonotypes of a repertoire is skewed to a single or a few clonotypes. Roughly, clonality is an inverse measure of clonotype diversity. Many measures or statistics are available from ecology describing species-abundance relationships that may be used for clonality measures in accordance with the invention, e.g. Chapters 17 & 18, in Pielou, An Introduction to Mathematical Ecology, (Wiley-Interscience, 1969).
  • a clonality measure used with the invention is a function of a clonotype profile (that is, the number of distinct clonotypes detected and their abundances), so that after a clonotype profile is measured, clonality may be computed from it to give a single number.
  • a clonality measure is Simpson's measure, which is simply the probability that two randomly drawn clonotypes will be the same.
  • Other clonality measures include information-based measures and Mcintosh's diversity index, disclosed in Pielou (cited above).
  • “Clonotype” means a recombined nucleotide sequence of a T cell or B cell encoding a T cell receptor (TCR) or B cell receptor (BCR), or a portion thereof.
  • TCR T cell receptor
  • BCR B cell receptor
  • a collection of all the distinct clonotypes of a population of lymphocytes of an individual is a repertoire of such population, e.g. Arstila et al, Science, 286: 958-961 (1999); Yassai et al, Immunogenetics, 61 : 493-502 (2009); Kedzierska et al, Mol. Immunol., 45(3): 607-618 (2008); and the like.
  • clonotype profile is a tabulation of clonotypes of a sample of T cells and/or B cells (such as a peripheral blood sample containing such cells) that includes substantially all of the repertoire's clonotypes and their relative abundances.
  • “Clonotype profile,” “repertoire profile,” and “repertoire” are used herein interchangeably. (That is, the term “repertoire,” as discussed more fully below, means a repertoire measured from a sample of lymphocytes).
  • clonotypes comprise portions of an immunoglobulin heavy chain (IgH) or a TCR ⁇ chain.
  • clonotypes may be based on other recombined molecules, such as immunoglobulin light chains or TCRa chains, or portions thereof.
  • CDRs Complementarity determining regions
  • T cell receptors and immunoglobulins each have three CDRs: CDR1 and CDR2 are found in the variable (V) domain, and CDR3 includes some of V, all of diverse (D) (heavy chains only) and joint (J), and some of the constant (C) domains.
  • Internal standard means a nucleic acid sequence that is amplified in the same amplification reaction as one or more target polynucleotides in order to permit absolute or relative quantification of the target polynucleotides in a sample.
  • An internal standard may be endogenous or exogenous. That is, an internal standard may occur naturally in the sample, or it may be added to the sample prior to amplification.
  • multiple exogenous internal standard sequences may be added to a reaction mixture in a series of predetermined concentrations to provide a calibration to which a target amplicon may be compared to determine the quantity of its corresponding target polynucleotide in a sample.
  • exogenous internal standards are sequences natural to a sample that correspond to minimally regulated genes that exhibit a constant and cell cycle-independent level of transcription, e.g. Selvey et al, Mol. Cell Probes, 15: 307-311 (2001).
  • Exemplary reference sequences include, but are not limited to, sequences from the following genes: GAPDH, ⁇ 2 - microglobulin, 18S ribosomal RNA, and ⁇ -actin (although see Selvey et al, cited above).
  • Kit refers to any delivery system for delivering materials or reagents for carrying out a method of the invention.
  • delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., primers, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another.
  • reaction reagents e.g., primers, enzymes, etc. in the appropriate containers
  • supporting materials e.g., buffers, written instructions for performing the assay etc.
  • kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials.
  • Such contents may be delivered to the intended recipient together or separately.
  • a first container may contain an enzyme for use in an assay, while a second container contains primers.
  • Lymphoid neoplasm means an abnormal proliferation of lymphocytes that may be malignant or non- malignant.
  • a lymphoid cancer is a malignant lymphoid neoplasm.
  • Lymphoid neoplasms are the result of, or are associated with, lymphoproliferative disorders, including but not limited to, follicular lymphoma, chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), hairy cell leukemia, lymphomas, multiple myeloma, post-transplant lymphoproliferative disorder, mantle cell lymphoma (MCL), diffuse large B cell lymphoma (DLBCL), T cell lymphoma, or the like, e.g.
  • “Pecent homologous,” “percent identical,” or like terms used in reference to the comparison of a reference sequence and another sequence mean that in an optimal alignment between the two sequences, the comparison sequence is identical to the reference sequence in a number of subunit positions equivalent to the indicated percentage, the subunits being nucleotides for polynucleotide comparisons or amino acids for polypeptide comparisons.
  • an "optimal alignment" of sequences being compared is one that maximizes matches between subunits and minimizes the number of gaps employed in constructing an alignment. Percent identities may be determined with commercially available implementations of algorithms, such as that described by Needleman and Wunsch, J. Mol.
  • a polynucleotide having a nucleotide sequence at least 95 percent identical to a reference nucleotide sequence up to five percent of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to five percent of the total number of nucleotides in the reference sequence may be inserted into the reference sequence.
  • PCR Polymerase chain reaction
  • PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates.
  • the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument.
  • a double stranded target nucleic acid may be denatured at a temperature >90°C, primers annealed at a temperature in the range 50-75°C, and primers extended at a temperature in the range 72-78°C.
  • PCR encompasses derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, and the like. Reaction volumes range from a few hundred nanoliters, e.g. 200 nL, to a few hundred ⁇ , e.g. 200 ⁇ .
  • Reverse transcription PCR or "RT-PCR,” means a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single stranded DNA, which is then amplified, e.g. Tecott et al, U.S. patent 5,168,038, which patent is incorporated herein by reference.
  • Real-time PCR means a PCR for which the amount of reaction product, i.e. amplicon, is monitored as the reaction proceeds.
  • Nested PCR means a two-stage PCR wherein the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an interior location of the first amplicon.
  • initial primers in reference to a nested amplification reaction mean the primers used to generate a first amplicon
  • secondary primers mean the one or more primers used to generate a second, or nested, amplicon.
  • Multiplexed PCR means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al, Anal. Biochem., 273: 221-228 (1999)(two-color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. Typically, the number of target sequences in a multiplex PCR is in the range of from 2 to 50, or from 2 to 40, or from 2 to 30.
  • Quantitative PCR means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Quantitative PCR includes both absolute quantitation and relative quantitation of such target sequences.
  • Quantitative measurements are made using one or more reference sequences or internal standards that may be assayed separately or together with a target sequence.
  • the reference sequence may be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise one or more competitor templates.
  • Typical endogenous reference sequences include segments of transcripts of the following genes: ⁇ -actin, GAPDH, p 2 -microglobulin, ribosomal RNA, and the like.
  • Primer means an oligonucleotide, either natural or synthetic that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed.
  • Extension of a primer is usually carried out with a nucleic acid polymerase, such as a DNA or RNA polymerase.
  • the sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide.
  • primers are extended by a DNA polymerase. Primers usually have a length in the range of from 14 to 40 nucleotides, or in the range of from 18 to 36 nucleotides.
  • Primers are employed in a variety of nucleic amplification reactions, for example, linear amplification reactions using a single primer, or polymerase chain reactions, employing two or more primers.
  • Guidance for selecting the lengths and sequences of primers for particular applications is well known to those of ordinary skill in the art, as evidenced by the following references that are incorporated by reference: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2 nd Edition (Cold Spring Harbor Press, New York, 2003).
  • Quality score means a measure of the probability that a base assignment at a particular sequence location is correct.
  • a variety methods are well known to those of ordinary skill for calculating quality scores for particular circumstances, such as, for bases called as a result of different sequencing chemistries, detection systems, base-calling algorithms, and so on.
  • quality score values are monotonically related to probabilities of correct base calling. For example, a quality score, or Q, of 10 may mean that there is a 90 percent chance that a base is called correctly, a Q of 20 may mean that there is a 99 percent chance that a base is called correctly, and so on.
  • average quality scores decrease as a function of sequence read length, so that quality scores at the beginning of a sequence read are higher than those at the end of a sequence read, such declines being due to phenomena such as incomplete extensions, carry forward extensions, loss of template, loss of polymerase, capping failures, deprotection failures, and the like.
  • Repertoire or “immune repertoire” means a set of distinct recombined nucleotide sequences that encode T cell receptors (TCRs) or B cell receptors (BCRs), or fragments thereof, respectively, in a population of lymphocytes of an individual, wherein the nucleotide sequences of the set have a one-to-one correspondence with distinct lymphocytes or their clonal subpopulations for substantially all of the lymphocytes of the population.
  • a population of lymphocytes from which a repertoire is determined is taken from one or more tissue samples, such as one or more blood samples.
  • clonotypes of a repertoire comprises any segment of nucleic acid common to a T cell or a B cell population which has undergone somatic recombination during the development of TCRs or BCRs, including normal or aberrant (e.g. associated with cancers) precursor molecules thereof, including, but not limited to, any of the following: an immunoglobulin heavy chain (IgH) or subsets thereof (e.g. an IgH variable region, CDR3 region, or the like), incomplete IgH molecules, an immunoglobulin light chain or subsets thereof (e.g.
  • IgH immunoglobulin heavy chain
  • subsets thereof e.g. an IgH variable region, CDR3 region, or the like
  • incomplete IgH molecules e.g.
  • nucleic acid segments defining clonotypes of a repertoire are selected so that their diversity (i.e.
  • the number of distinct nucleic acid sequences in the set is large enough so that substantially every T cell or B cell or clone thereof in an individual carries a unique nucleic acid sequence of such repertoire. That is, in accordance with the invention, a practitioner may select for defining clonotypes a particular segment or region of recombined nucleic acids that encode TCRs or BCRs that do not reflect the full diversity of a population of T cells or B cells; however, preferably, clonotypes are defined so that they do reflect the diversity of the population of T cells and/or B cells from which they are derived. That is, preferably each different clone of a sample has different clonotype.
  • the population of lymphocytes corresponding to a repertoire may be circulating B cells, or may be circulating T cells, or may be subpopulations of either of the foregoing populations, including but not limited to, CD4+ T cells, or CD8+ T cells, or other subpopulations defined by cell surface markers, or the like.
  • Such subpopulations may be acquired by taking samples from particular tissues, e.g.
  • the population of lymphocytes corresponding to a repertoire may be derived from disease tissues, such as a tumor tissue, an infected tissue, or the like.
  • a repertoire comprising human TCR ⁇ chains or fragments thereof comprises a number of distinct nucleotide sequences in the range of from 0.1 x 10 6 to 1.8 x 10 6 , or in the range of from 0.5 x 10 6 to 1.5 x 10 6 , or in the range of from 0.8 x 10 6 to 1.2 x 10 6 .
  • a repertoire comprising human IgH chains or fragments thereof comprises a number of distinct nucleotide sequences in the range of from 0.1 x 10 6 to 1.8 x 10 6 , or in the range of from 0.5 x 10 6 to 1.5 x 10 6 , or in the range of from 0.8 x 10* to 1.2 x 10 6 .
  • a repertoire of the invention comprises a set of nucleotide sequences encoding substantially all segments of the V(D)J region of an IgH chain.
  • a repertoire of the invention comprises a set of nucleotide sequences that encodes substantially all segments of the V(D)J region of a TCR ⁇ chain.
  • a repertoire of the invention comprises a set of nucleotide sequences having lengths in the range of from 25-200 nucleotides and including segments of the V, D, and J regions of a TCR ⁇ chain.
  • a repertoire of the invention comprises a set of nucleotide sequences having lengths in the range of from 25-200 nucleotides and including segments of the V, D, and J regions of an IgH chain.
  • a repertoire of the invention comprises a number of distinct nucleotide sequences that is substantially equivalent to the number of lymphocytes expressing a distinct IgH chain.
  • a repertoire of the invention comprises a number of distinct nucleotide sequences that is substantially equivalent to the number of lymphocytes expressing a distinct TCR ⁇ chain.
  • substantially equivalent means that with ninety-nine percent probability a repertoire of nucleotide sequences will include a nucleotide sequence encoding an IgH or TCR ⁇ or portion thereof carried or expressed by every lymphocyte of a population of an individual at a frequency of .001 percent or greater. In still another embodiment, “substantially equivalent” means that with ninety-nine percent probability a repertoire of nucleotide sequences will include a nucleotide sequence encoding an IgH or TCR ⁇ or portion thereof carried or expressed by every lymphocyte present at a frequency of .0001 percent or greater.
  • the sets of clonotypes described in the foregoing two sentences are sometimes referred to herein as representing the "full repertoire" of IgH and/or TCR ⁇ sequences.
  • a sufficiently large sample of lymphocytes is obtained so that such profile provides a reasonably accurate representation of a repertoire for a particular application.
  • samples comprising from 10 s to 10 7 lymphocytes are employed, especially when obtained from peripheral blood samples of from 1-10 itiL.
  • Sequence tag means an oligonucleotide that is attached to a polynucleotide or template and is used to identify and/or track the polynucleotide or template in a reaction.
  • An oligonucleotide tag may be attached to the 3'- or 5'-end of a polynucleotide or template or it may be inserted into the interior of such polynucleotide template to form a linear conjugate, sometime referred to herein as a "tagged polynucleotide,” or “tagged template,” or “tag-polynucleotide conjugate,” or the like.
  • Oligonucleotide tags may vary widely in size and compositions; the following references provide guidance for selecting sets of oligonucleotide tags appropriate for particular embodiments: Brenner, U.S. patent 5,635,400; Brenner et al, Proc. Natl. Acad. Sci., 97: 1665-1670 (2000); Church et al, European patent publication 0 303 459; Shoemaker et al, Nature Genetics, 14: 450-456 (1996); Morris et al, European patent publication 0799897A 1 ; Wallace, U.S. patent 5,981,179; and the like.
  • Lengths and compositions of oligonucleotide tags can vary widely, and the selection of particular lengths and/or compositions depends on several factors including, without limitation, how tags are used to generate a readout, e.g. via a hybridization reaction or via an enzymatic reaction, such as sequencing; whether they are labeled, e.g. with a fluorescent dye or the like; the number of distinguishable oligonucleotide tags required to unambiguously identify a set of polynucleotides, and the like, and how different must tags of a set be in order to ensure reliable identification, e.g. freedom from cross hybridization or misidentification from sequencing errors.
  • oligonucleotide tags can each have a length within a range of from 2 to 36 nucleotides, or from 4 to 30 nucleotides, or from 8 to 20 nucleotides, or from 6 to 10 nucleotides, respectively.
  • sets of tags are used wherein each oligonucleotide tag of a set has a unique nucleotide sequence that differs from that of every other tag of the same set by at least two bases; in another aspect, sets of tags are used wherein the sequence of each tag of a set differs from that of every other tag of the same set by at least three bases.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Physiology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2011/000792 2010-05-06 2011-05-04 Sequence analysis of complex amplicons Ceased WO2011139372A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2013509047A JP6085249B2 (ja) 2010-05-06 2011-05-04 複雑なアンプリコンの配列解析

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US33217510P 2010-05-06 2010-05-06
US61/332,175 2010-05-06
US45574310P 2010-10-25 2010-10-25
US61/455,743 2010-10-25
US201161446822P 2011-02-25 2011-02-25
US61/446,822 2011-02-25

Publications (1)

Publication Number Publication Date
WO2011139372A1 true WO2011139372A1 (en) 2011-11-10

Family

ID=44903937

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2011/000792 Ceased WO2011139372A1 (en) 2010-05-06 2011-05-04 Sequence analysis of complex amplicons
PCT/US2011/000791 Ceased WO2011139371A1 (en) 2010-05-06 2011-05-04 Monitoring health and disease status using clonotype profiles

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2011/000791 Ceased WO2011139371A1 (en) 2010-05-06 2011-05-04 Monitoring health and disease status using clonotype profiles

Country Status (9)

Country Link
EP (4) EP2567226B1 (https=)
JP (4) JP6158080B2 (https=)
CN (2) CN104673899A (https=)
AU (1) AU2011249041B2 (https=)
CA (1) CA2798431C (https=)
DK (2) DK2567226T3 (https=)
ES (2) ES2593614T3 (https=)
SG (2) SG10201503534RA (https=)
WO (2) WO2011139372A1 (https=)

Cited By (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2483810A (en) * 2008-11-07 2012-03-21 Sequenta Inc Correlating T-cell and/or B-cell clonotypes with disease state outcomes
US8628927B2 (en) 2008-11-07 2014-01-14 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
US8691510B2 (en) 2008-11-07 2014-04-08 Sequenta, Inc. Sequence analysis of complex amplicons
US8748103B2 (en) 2008-11-07 2014-06-10 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
US9043160B1 (en) 2009-11-09 2015-05-26 Sequenta, Inc. Method of determining clonotypes and clonotype profiles
WO2013181428A3 (en) * 2012-05-31 2015-07-02 Sequenta, Inc. Predicting relapse of chronic lymphocytic leukemia patients treated by allogeneic stem cell transplantation
JP2015521023A (ja) * 2012-03-05 2015-07-27 シーケンタ インコーポレイテッド 頻度が一致したサブユニットからの、対をなす免疫受容体鎖の決定
JP2015524282A (ja) * 2012-08-10 2015-08-24 シーケンタ インコーポレイテッド 配列タグを用いた高感度突然変異検出
US9150905B2 (en) 2012-05-08 2015-10-06 Adaptive Biotechnologies Corporation Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US9181590B2 (en) 2011-10-21 2015-11-10 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US9365901B2 (en) 2008-11-07 2016-06-14 Adaptive Biotechnologies Corp. Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia
US9394567B2 (en) 2008-11-07 2016-07-19 Adaptive Biotechnologies Corporation Detection and quantification of sample contamination in immune repertoire analysis
US9499865B2 (en) 2011-12-13 2016-11-22 Adaptive Biotechnologies Corp. Detection and measurement of tissue-infiltrating lymphocytes
US9506119B2 (en) 2008-11-07 2016-11-29 Adaptive Biotechnologies Corp. Method of sequence determination using sequence tags
US9528160B2 (en) 2008-11-07 2016-12-27 Adaptive Biotechnolgies Corp. Rare clonotypes and uses thereof
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
US9809813B2 (en) 2009-06-25 2017-11-07 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US9824179B2 (en) 2011-12-09 2017-11-21 Adaptive Biotechnologies Corp. Diagnosis of lymphoid malignancies and minimal residual disease detection
US10066265B2 (en) 2014-04-01 2018-09-04 Adaptive Biotechnologies Corp. Determining antigen-specific t-cells
US10150996B2 (en) 2012-10-19 2018-12-11 Adaptive Biotechnologies Corp. Quantification of adaptive immune cell genomes in a complex mixture of cells
US10202640B2 (en) 2014-05-07 2019-02-12 The Board Of Trustees Of The Leland Stanford Junior University Single cell analysis of T cells using high-throughput multiplex amplification and deep sequencing
US10221461B2 (en) 2012-10-01 2019-03-05 Adaptive Biotechnologies Corp. Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US10246701B2 (en) 2014-11-14 2019-04-02 Adaptive Biotechnologies Corp. Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture
US10323276B2 (en) 2009-01-15 2019-06-18 Adaptive Biotechnologies Corporation Adaptive immunity profiling and methods for generation of monoclonal antibodies
US10385475B2 (en) 2011-09-12 2019-08-20 Adaptive Biotechnologies Corp. Random array sequencing of low-complexity libraries
US10392663B2 (en) 2014-10-29 2019-08-27 Adaptive Biotechnologies Corp. Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples
US10428325B1 (en) 2016-09-21 2019-10-01 Adaptive Biotechnologies Corporation Identification of antigen-specific B cell receptors
US11008609B2 (en) 2017-09-01 2021-05-18 Life Technologies Corporation Compositions and methods for immune repertoire sequencing
US11041202B2 (en) 2015-04-01 2021-06-22 Adaptive Biotechnologies Corporation Method of identifying human compatible T cell receptors specific for an antigenic target
US11047008B2 (en) 2015-02-24 2021-06-29 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
US11066705B2 (en) 2014-11-25 2021-07-20 Adaptive Biotechnologies Corporation Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing
US11203783B2 (en) 2013-11-21 2021-12-21 Repertoire Genesis Incorporation T cell receptor and B cell receptor repertoire analysis system, and use of same in treatment and diagnosis
US11248253B2 (en) 2014-03-05 2022-02-15 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
US11254980B1 (en) 2017-11-29 2022-02-22 Adaptive Biotechnologies Corporation Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements
WO2022204443A1 (en) 2021-03-24 2022-09-29 Genentech, Inc. Efficient tcr gene editing in t lymphocytes
WO2025122939A1 (en) * 2023-12-08 2025-06-12 Dana-Farber Cancer Institute, Inc. Detection and classification of b-cell malignancies
US12473663B2 (en) 2018-07-18 2025-11-18 Life Technologies Corporation Compositions and methods for immune repertoiresequencing

Families Citing this family (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012083225A2 (en) 2010-12-16 2012-06-21 Gigagen, Inc. System and methods for massively parallel analysis of nycleic acids in single cells
KR102759126B1 (ko) 2010-12-30 2025-01-24 파운데이션 메디신 인코포레이티드 종양 샘플의 다유전자 분석의 최적화
EP2663864B8 (en) * 2011-01-14 2019-06-05 iRepertoire, Inc. Immunodiversity assessment method and its use
WO2013096480A2 (en) * 2011-12-20 2013-06-27 Sequenta, Inc. Monitoring transformation of follicular lymphoma to diffuse large b-cell lymphoma by immune repertoire analysis
EP2836611A4 (en) * 2012-04-13 2015-12-30 Sequenta Inc DETECTION AND QUANTIFICATION OF SAMPLE CONTAMINATION IN AN IMMUNOLOGICAL DIRECTORY ANALYSIS
SG11201408128WA (en) * 2012-06-15 2015-01-29 Adaptive Biotechnologies Corp Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set
CA2888514A1 (en) * 2012-10-19 2014-04-24 Sequenta, Inc. Monitoring clonotypes of plasma cell proliferative disorders in peripheral blood
US20150299800A1 (en) * 2012-10-22 2015-10-22 Sequenta, Inc. Monitoring mantle cell lymphoma clonotypes in peripheral blood after immunotransplant
KR102228488B1 (ko) * 2013-02-11 2021-03-15 씨비 바이오테크놀로지스, 인크. 면역 레퍼토리를 평가하기 위한 방법
JP6513035B2 (ja) * 2013-02-22 2019-05-15 アダプティヴ バイオテクノロジーズ コーポレーション 希少クロノタイプおよびその用途
KR20150132479A (ko) * 2013-03-15 2015-11-25 어댑티브 바이오테크놀로지스 코포레이션 복합 유전자 세트에서의 독특하게 태그되고 재배열된 적응 면역 수용체 유전자
GB2525568B (en) 2013-03-15 2020-10-14 Abvitro Llc Single cell barcoding for antibody discovery
EP3950944A1 (en) 2014-09-15 2022-02-09 AbVitro LLC High-throughput nucleotide library sequencing
EP3227464B1 (en) * 2014-12-05 2022-04-20 Foundation Medicine, Inc. Multigene analysis of tumor samples
US9422547B1 (en) 2015-06-09 2016-08-23 Gigagen, Inc. Recombinant fusion proteins and libraries from immune cell repertoires
CN106557536B (zh) * 2015-09-30 2021-12-21 松下知识产权经营株式会社 控制方法
US10130658B2 (en) * 2015-12-18 2018-11-20 Provectus Pharmatech, Inc. Method of ex vivo enhancement of immune cell activity for cancer immunotherapy with a small molecule ablative compound
CN107955831A (zh) * 2016-10-13 2018-04-24 深圳华大基因研究院 用于淋巴细胞定量检测的标记物和淋巴细胞定量检测方法
GB201618485D0 (en) * 2016-11-02 2016-12-14 Ucl Business Plc Method of detecting tumour recurrence
CN110168105B (zh) * 2016-12-09 2024-05-24 瑞泽恩制药公司 用于对t细胞受体进行测序的系统和方法及其用途
RU2674994C2 (ru) * 2016-12-29 2018-12-14 Федеральное государственное бюджетное учреждение науки институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук (ИБХ РАН) Способ определения маркеров наличия опухолевых т-лимфобластов
JP7207661B2 (ja) * 2017-10-10 2023-01-18 国立大学法人広島大学 Platinum TALENを用いたT細胞受容体の完全置換技術
EP3702454A4 (en) 2017-10-10 2021-08-04 Hiroshima University METHOD FOR GENERATING ANTIGEN-SPECIFIC REGULATORY T-CELLS (TREG) WITH EFFECTOR T-CELL (TEFF) ANTIGEN RECEPTORS
WO2019196088A1 (en) 2018-04-13 2019-10-17 Syz Cell Therapy Co. Methods of obtaining tumor-specific t cell receptors
BR112020024727A2 (pt) 2018-06-11 2021-03-23 Foundation Medicine, Inc. composições e métodos para avaliação de alterações genômicas
WO2019238939A1 (en) * 2018-06-15 2019-12-19 F. Hoffmann-La Roche Ag A system for identification of antigens recognized by t cell receptors expressed on tumor infiltrating lymphocytes
CN109002689B (zh) * 2018-07-23 2020-10-09 西安交通大学医学院第一附属医院 T细胞数据处理方法及装置
WO2020102721A1 (en) * 2018-11-16 2020-05-22 Rapa Therapeutics, Llc Immune monitoring of neuro-inflammatory amyotrophic lateral sclerosis (als)
EP3899039A4 (en) * 2018-12-20 2022-09-14 The Johns Hopkins University TREATMENT OF TYPE 1 DIABETES, AND OTHER AUTOIMMUNE DISEASES
WO2020191365A1 (en) 2019-03-21 2020-09-24 Gigamune, Inc. Engineered cells expressing anti-viral t cell receptors and methods of use thereof
CN110988364A (zh) * 2019-12-31 2020-04-10 天津美瑞特医疗科技有限公司 一种应用流式细胞术检测移植后gvhd相关细胞因子的方法及检测试剂盒
EP4093887A1 (en) * 2020-01-22 2022-11-30 Life Technologies Corporation Immune repertoire biomarkers in autoimmune disease and immunodeficiency disorders
CN111808195A (zh) * 2020-06-30 2020-10-23 中国科学院心理研究所 抗n-甲基-d-天冬氨酸受体脑炎的b细胞抗体基因获取方法及其免疫组库研究
CN111524548B (zh) * 2020-07-03 2020-10-23 至本医疗科技(上海)有限公司 用于检测igh重排的方法、计算设备和计算机存储介质
CN113637741B (zh) * 2021-09-29 2023-12-01 成都二十三魔方生物科技有限公司 一种早发性白发遗传风险基因检测试剂盒、以及一种早发性白发遗传风险评估系统和方法
EP4726393A1 (en) * 2023-06-12 2026-04-15 National University Corporation Kobe University Immune reaction evaluation method
CN117867121A (zh) * 2024-01-12 2024-04-12 广州华银医学检验中心有限公司 一种检测肿瘤免疫组库微小残留的引物组合和方法
WO2025243303A1 (en) * 2024-05-22 2025-11-27 Technion Research & Development Foundation Limited Improved methods of determining immune age
CN120432008B (zh) * 2025-05-07 2026-02-06 博德生物技术(德州)有限公司 CellRanger单细胞RNA测序数据分析方法
CN120290752B (zh) * 2025-06-13 2025-09-16 北京大学成都前沿交叉生物技术研究院 捕获探针、包含其的试剂盒及利用其在空间分辨率下检测t细胞和b细胞免疫组库中的用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6258568B1 (en) * 1996-12-23 2001-07-10 Pyrosequencing Ab Method of sequencing DNA based on the detection of the release of pyrophosphate and enzymatic nucleotide degradation
US20090226975A1 (en) * 2008-03-10 2009-09-10 Illumina, Inc. Constant cluster seeding

Family Cites Families (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4942124A (en) 1987-08-11 1990-07-17 President And Fellows Of Harvard College Multiplex sequencing
US5168038A (en) 1988-06-17 1992-12-01 The Board Of Trustees Of The Leland Stanford Junior University In situ transcription in cells and tissues
WO1990004648A1 (en) 1988-10-20 1990-05-03 Alexander Alan Morley Method for diagnosis of monoclonality in leukaemia and lymphoma
CA2020958C (en) 1989-07-11 2005-01-11 Daniel L. Kacian Nucleic acid sequence amplification methods
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
JP3080178B2 (ja) 1991-02-18 2000-08-21 東洋紡績株式会社 核酸配列の増幅方法およびそのための試薬キット
US5981179A (en) 1991-11-14 1999-11-09 Digene Diagnostics, Inc. Continuous amplification reaction
US5837447A (en) 1992-04-15 1998-11-17 Blood Center Research Foundation, Inc., The Monitoring an immune response by analysis of amplified immunoglobulin or T-cell-receptor nucleic acid
US5925517A (en) 1993-11-12 1999-07-20 The Public Health Research Institute Of The City Of New York, Inc. Detectably labeled dual conformation oligonucleotide probes, assays and kits
US6090592A (en) 1994-08-03 2000-07-18 Mosaic Technologies, Inc. Method for performing amplification of nucleic acid on supports
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5635363A (en) 1995-02-28 1997-06-03 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for the detection, quantitation and purification of antigen-specific T cells
US6087096A (en) 1995-11-13 2000-07-11 Dau; Peter C. Method of intrafamily fragment analysis of the T cell receptor α and β chain CDR3 regions
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
KR19990087749A (ko) * 1996-03-13 1999-12-27 시오노 요시히코 류마티스성 관절염에 특이적인 인간 티 세포 클론
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
US6416948B1 (en) * 1996-06-03 2002-07-09 The Governors Of The University Of Alberta Methods for detection of rearranged DNA
JP4540754B2 (ja) 1996-06-04 2010-09-08 ユニバーシティ オブ ユタ リサーチ ファウンデーション Pcr中のハイブリダイゼーションのモニタリング
US5846928A (en) 1996-08-01 1998-12-08 Pasken Products Co., Ltd. Method for treating cancer patients
DE69737028T2 (de) 1996-09-06 2007-06-28 Ortho-Mcneil Pharmaceutical, Inc. Reinigung von antigenspezifischen t-zellen
JP2002503954A (ja) * 1997-04-01 2002-02-05 グラクソ、グループ、リミテッド 核酸増幅法
US6008002A (en) 1997-09-29 1999-12-28 Bodey; Bela Immunomagnetic detection and isolation of cancer cells
BR9907852A (pt) 1998-02-12 2000-10-24 Immunivest Corp Processos para detectar e enumerar células raras e cancerosas em uma população celular mista, para diagnosticar câncer de estágio precoce em um paciente de teste, para determinar a probabilidade de recorrência de câncer em um paciente humano anteriormente tratado de câncer, para distinguir um carcinoma confinado ao órgão de um carcinoma com propriedades metastáticas, para acompanhar a situação de remissão em um paciente humano com câncer que passa pelo tratamento de terapia contra o câncer e para aumentar quantidades de células epiteliais circulantes em uma amostra de sangue, partìcula magnética revestida, composição, conjuntos de teste para avaliar uma amostra de paciente quanto a presença de células raras circulantes, quanto a presença de células de tumor circulantes, quanto a presença de células de câncer de mama circulantes, quanto a presença de células de câncer de próstata circulantes, quanto a presença de células de câncer de cólon circulantes, quanto a presença de células de câncer de bexiga circulantes e para monitorar um paciente quanto a recorrência de câncer, e, fração de sangue periférico enriquecido quanto a células neoplásticas circulantes
DE19833738A1 (de) 1998-07-27 2000-02-03 Michael Giesing Verfahren zur Isolierung von Krebszellen aus zellhaltigen Körperflüssigkeiten sowie Sets zur Durchführung dieses Verfahrens
AR021833A1 (es) 1998-09-30 2002-08-07 Applied Research Systems Metodos de amplificacion y secuenciacion de acido nucleico
US6300070B1 (en) 1999-06-04 2001-10-09 Mosaic Technologies, Inc. Solid phase methods for amplifying multiple nucleic acids
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
EP1227321A1 (en) 2000-12-28 2002-07-31 Institut für Bioanalytik GmbH Reversible MHC multimer staining for functional purification of antigen-specific T cells
GB0128153D0 (en) 2001-11-23 2002-01-16 Bayer Ag Profiling of the immune gene repertoire
EP2418287B1 (en) 2002-10-11 2013-09-18 Erasmus Universiteit Rotterdam Nucleic acid amplification primers for PCR-based clonality studies of the TCR-beta gene
CA2513899C (en) 2003-01-29 2013-03-26 454 Corporation Methods of amplifying and sequencing nucleic acids
AU2003902299A0 (en) 2003-05-13 2003-05-29 Flinders Medical Centre A method of analysing a marker nucleic acid molecule
DE60326052D1 (de) 2003-12-15 2009-03-19 Pasteur Institut Ermittlung des Repertoires von B-Lymphozyten Populationen
WO2006017635A2 (en) 2004-08-11 2006-02-16 Albert Einstein College Of Medicine Of Yeshiva University Isolation, gene expression, and chemotherapeutic resistance of motile cancer cells
US8426146B2 (en) * 2005-06-03 2013-04-23 University of Pittsburgh—of the Commonwealth System of Higher Education Multiparameteric method for assessing immune system status
US7993821B2 (en) 2005-08-11 2011-08-09 University Of Washington Methods and apparatus for the isolation and enrichment of circulating tumor cells
US7375211B2 (en) 2005-11-18 2008-05-20 Kou Zhong C Method for detection and quantification of T-cell receptor Vβ repertoire
WO2007087312A2 (en) 2006-01-23 2007-08-02 Population Genetics Technologies Ltd. Molecular counting
CN101225441B (zh) * 2007-12-05 2010-12-01 浙江大学 一种检测克隆特异性t淋巴细胞tcr bv cdr3基因组成的方法
US11051733B2 (en) 2008-01-18 2021-07-06 Wake Forest University Health Sciences Isolating and purifying cells for therapy
EP2088205A1 (en) * 2008-02-11 2009-08-12 Institut National De La Sante Et De La Recherche Medicale (Inserm) PSMB10: A diagnosis marker and therapeutic target of chronic rejection.
US20100137143A1 (en) 2008-10-22 2010-06-03 Ion Torrent Systems Incorporated Methods and apparatus for measuring analytes
EP2364368B1 (en) 2008-11-07 2014-01-15 Sequenta, Inc. Methods of monitoring conditions by sequence analysis
US8574835B2 (en) 2009-05-29 2013-11-05 Life Technologies Corporation Scaffolded nucleic acid polymer particles and methods of making and using
WO2011106738A2 (en) * 2010-02-25 2011-09-01 Fred Hutchinson Cancer Research Center Use of tcr clonotypes as biomarkers for disease

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6258568B1 (en) * 1996-12-23 2001-07-10 Pyrosequencing Ab Method of sequencing DNA based on the detection of the release of pyrophosphate and enzymatic nucleotide degradation
US20090226975A1 (en) * 2008-03-10 2009-09-10 Illumina, Inc. Constant cluster seeding

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BOYD ET AL.: "Measurement and clinical monitoring of human lymphocyte clonality by massively parallel VDJ pyrosequencing", SCI. TRANSL. MED., vol. 1, no. 12, 23 December 2009 (2009-12-23), pages 1 - 16 *
MARGULIES ET AL.: "Genome sequencing in microfabricated high-density picolitre reactors", NATURE, vol. 437, no. 7057, 15 September 2005 (2005-09-15), pages 376 - 380 *
VAN DONGEN ET AL.: "Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 Concerted Action.BMH4-CT98-3936", LEUKEMIA, vol. 17, no. 12, December 2003 (2003-12-01), pages 2257 - 2631 *

Cited By (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9365901B2 (en) 2008-11-07 2016-06-14 Adaptive Biotechnologies Corp. Monitoring immunoglobulin heavy chain evolution in B-cell acute lymphoblastic leukemia
US8236503B2 (en) 2008-11-07 2012-08-07 Sequenta, Inc. Methods of monitoring conditions by sequence analysis
GB2483810B (en) * 2008-11-07 2012-09-05 Sequenta Inc Methods for correlating clonotypes with diseases in a population
US8507205B2 (en) 2008-11-07 2013-08-13 Sequenta, Inc. Single cell analysis by polymerase cycling assembly
US8628927B2 (en) 2008-11-07 2014-01-14 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
US8691510B2 (en) 2008-11-07 2014-04-08 Sequenta, Inc. Sequence analysis of complex amplicons
US8748103B2 (en) 2008-11-07 2014-06-10 Sequenta, Inc. Monitoring health and disease status using clonotype profiles
US8795970B2 (en) 2008-11-07 2014-08-05 Sequenta, Inc. Methods of monitoring conditions by sequence analysis
US11001895B2 (en) 2008-11-07 2021-05-11 Adaptive Biotechnologies Corporation Methods of monitoring conditions by sequence analysis
US10760133B2 (en) 2008-11-07 2020-09-01 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US10865453B2 (en) 2008-11-07 2020-12-15 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US10155992B2 (en) 2008-11-07 2018-12-18 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US11021757B2 (en) 2008-11-07 2021-06-01 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US10246752B2 (en) 2008-11-07 2019-04-02 Adaptive Biotechnologies Corp. Methods of monitoring conditions by sequence analysis
US9217176B2 (en) 2008-11-07 2015-12-22 Sequenta, Llc Methods of monitoring conditions by sequence analysis
US9228232B2 (en) 2008-11-07 2016-01-05 Sequenta, LLC. Methods of monitoring conditions by sequence analysis
US9347099B2 (en) 2008-11-07 2016-05-24 Adaptive Biotechnologies Corp. Single cell analysis by polymerase cycling assembly
US12209282B2 (en) 2008-11-07 2025-01-28 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
GB2483810A (en) * 2008-11-07 2012-03-21 Sequenta Inc Correlating T-cell and/or B-cell clonotypes with disease state outcomes
US10266901B2 (en) 2008-11-07 2019-04-23 Adaptive Biotechnologies Corp. Methods of monitoring conditions by sequence analysis
US9394567B2 (en) 2008-11-07 2016-07-19 Adaptive Biotechnologies Corporation Detection and quantification of sample contamination in immune repertoire analysis
US9416420B2 (en) 2008-11-07 2016-08-16 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US10519511B2 (en) 2008-11-07 2019-12-31 Adaptive Biotechnologies Corporation Monitoring health and disease status using clonotype profiles
US9506119B2 (en) 2008-11-07 2016-11-29 Adaptive Biotechnologies Corp. Method of sequence determination using sequence tags
US9512487B2 (en) 2008-11-07 2016-12-06 Adaptive Biotechnologies Corp. Monitoring health and disease status using clonotype profiles
US9523129B2 (en) 2008-11-07 2016-12-20 Adaptive Biotechnologies Corp. Sequence analysis of complex amplicons
US9528160B2 (en) 2008-11-07 2016-12-27 Adaptive Biotechnolgies Corp. Rare clonotypes and uses thereof
US12606870B2 (en) 2008-11-07 2026-04-21 Adaptive Biotechnologies Corporation Methods of monitoring conditions by sequence analysis
US10323276B2 (en) 2009-01-15 2019-06-18 Adaptive Biotechnologies Corporation Adaptive immunity profiling and methods for generation of monoclonal antibodies
US9809813B2 (en) 2009-06-25 2017-11-07 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US11214793B2 (en) 2009-06-25 2022-01-04 Fred Hutchinson Cancer Research Center Method of measuring adaptive immunity
US9043160B1 (en) 2009-11-09 2015-05-26 Sequenta, Inc. Method of determining clonotypes and clonotype profiles
US10385475B2 (en) 2011-09-12 2019-08-20 Adaptive Biotechnologies Corp. Random array sequencing of low-complexity libraries
US9279159B2 (en) 2011-10-21 2016-03-08 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US9181590B2 (en) 2011-10-21 2015-11-10 Adaptive Biotechnologies Corporation Quantification of adaptive immune cell genomes in a complex mixture of cells
US9824179B2 (en) 2011-12-09 2017-11-21 Adaptive Biotechnologies Corp. Diagnosis of lymphoid malignancies and minimal residual disease detection
US9499865B2 (en) 2011-12-13 2016-11-22 Adaptive Biotechnologies Corp. Detection and measurement of tissue-infiltrating lymphocytes
US10077478B2 (en) 2012-03-05 2018-09-18 Adaptive Biotechnologies Corp. Determining paired immune receptor chains from frequency matched subunits
JP2015521023A (ja) * 2012-03-05 2015-07-27 シーケンタ インコーポレイテッド 頻度が一致したサブユニットからの、対をなす免疫受容体鎖の決定
US10214770B2 (en) 2012-05-08 2019-02-26 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US10894977B2 (en) 2012-05-08 2021-01-19 Adaptive Biotechnologies Corporation Compositions and methods for measuring and calibrating amplification bias in multiplexed PCR reactions
US9371558B2 (en) 2012-05-08 2016-06-21 Adaptive Biotechnologies Corp. Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
US9150905B2 (en) 2012-05-08 2015-10-06 Adaptive Biotechnologies Corporation Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions
WO2013181428A3 (en) * 2012-05-31 2015-07-02 Sequenta, Inc. Predicting relapse of chronic lymphocytic leukemia patients treated by allogeneic stem cell transplantation
JP2015524282A (ja) * 2012-08-10 2015-08-24 シーケンタ インコーポレイテッド 配列タグを用いた高感度突然変異検出
US10221461B2 (en) 2012-10-01 2019-03-05 Adaptive Biotechnologies Corp. Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US12104211B2 (en) 2012-10-01 2024-10-01 Adaptive Biotechnologies Corporation Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US11180813B2 (en) 2012-10-01 2021-11-23 Adaptive Biotechnologies Corporation Immunocompetence assessment by adaptive immune receptor diversity and clonality characterization
US10150996B2 (en) 2012-10-19 2018-12-11 Adaptive Biotechnologies Corp. Quantification of adaptive immune cell genomes in a complex mixture of cells
US10526650B2 (en) 2013-07-01 2020-01-07 Adaptive Biotechnologies Corporation Method for genotyping clonotype profiles using sequence tags
US9708657B2 (en) 2013-07-01 2017-07-18 Adaptive Biotechnologies Corp. Method for generating clonotype profiles using sequence tags
US10077473B2 (en) 2013-07-01 2018-09-18 Adaptive Biotechnologies Corp. Method for genotyping clonotype profiles using sequence tags
US11203783B2 (en) 2013-11-21 2021-12-21 Repertoire Genesis Incorporation T cell receptor and B cell receptor repertoire analysis system, and use of same in treatment and diagnosis
US11248253B2 (en) 2014-03-05 2022-02-15 Adaptive Biotechnologies Corporation Methods using randomer-containing synthetic molecules
US10435745B2 (en) 2014-04-01 2019-10-08 Adaptive Biotechnologies Corp. Determining antigen-specific T-cells
US12351872B2 (en) 2014-04-01 2025-07-08 Adaptive Biotechnologies Corporation Determining antigen-specific T-cells
US10066265B2 (en) 2014-04-01 2018-09-04 Adaptive Biotechnologies Corp. Determining antigen-specific t-cells
US11261490B2 (en) 2014-04-01 2022-03-01 Adaptive Biotechnologies Corporation Determining antigen-specific T-cells
US10202640B2 (en) 2014-05-07 2019-02-12 The Board Of Trustees Of The Leland Stanford Junior University Single cell analysis of T cells using high-throughput multiplex amplification and deep sequencing
US10392663B2 (en) 2014-10-29 2019-08-27 Adaptive Biotechnologies Corp. Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples
US10246701B2 (en) 2014-11-14 2019-04-02 Adaptive Biotechnologies Corp. Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture
US11066705B2 (en) 2014-11-25 2021-07-20 Adaptive Biotechnologies Corporation Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing
US12428682B2 (en) 2015-02-24 2025-09-30 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
US11047008B2 (en) 2015-02-24 2021-06-29 Adaptive Biotechnologies Corporation Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing
US11041202B2 (en) 2015-04-01 2021-06-22 Adaptive Biotechnologies Corporation Method of identifying human compatible T cell receptors specific for an antigenic target
US10428325B1 (en) 2016-09-21 2019-10-01 Adaptive Biotechnologies Corporation Identification of antigen-specific B cell receptors
US11008609B2 (en) 2017-09-01 2021-05-18 Life Technologies Corporation Compositions and methods for immune repertoire sequencing
US12227878B2 (en) 2017-09-01 2025-02-18 Life Technologies Corporation Compositions and methods for immune repertoire sequencing
US11254980B1 (en) 2017-11-29 2022-02-22 Adaptive Biotechnologies Corporation Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements
US12473663B2 (en) 2018-07-18 2025-11-18 Life Technologies Corporation Compositions and methods for immune repertoiresequencing
WO2022204443A1 (en) 2021-03-24 2022-09-29 Genentech, Inc. Efficient tcr gene editing in t lymphocytes
US12239664B2 (en) 2021-03-24 2025-03-04 Genentech, Inc. Efficient TCR gene editing in T lymphocytes
WO2025122939A1 (en) * 2023-12-08 2025-06-12 Dana-Farber Cancer Institute, Inc. Detection and classification of b-cell malignancies

Also Published As

Publication number Publication date
ES2740802T3 (es) 2020-02-06
CN104673899A (zh) 2015-06-03
AU2011249041A1 (en) 2012-11-22
DK2567226T3 (en) 2016-10-10
JP6246971B2 (ja) 2017-12-13
EP4219759A2 (en) 2023-08-02
CN103097888A (zh) 2013-05-08
JP2018068300A (ja) 2018-05-10
EP2567226B1 (en) 2016-08-10
JP2013524848A (ja) 2013-06-20
EP3144673A1 (en) 2017-03-22
EP3456847C0 (en) 2024-12-25
JP2013524849A (ja) 2013-06-20
EP3456847A1 (en) 2019-03-20
SG185128A1 (en) 2012-12-28
CA2798431A1 (en) 2011-11-10
EP2567226A4 (en) 2013-08-28
CN103097888B (zh) 2016-03-09
JP2017205112A (ja) 2017-11-24
AU2011249041B2 (en) 2014-10-30
EP2567226A1 (en) 2013-03-13
DK3144673T3 (da) 2019-09-09
JP6533272B2 (ja) 2019-06-19
WO2011139371A1 (en) 2011-11-10
EP4219759A3 (en) 2023-09-06
SG10201503534RA (en) 2015-06-29
ES2593614T3 (es) 2016-12-12
CA2798431C (en) 2018-10-23
JP6085249B2 (ja) 2017-02-22
EP3144673B1 (en) 2019-07-10
EP3456847B1 (en) 2024-12-25
JP6158080B2 (ja) 2017-07-05

Similar Documents

Publication Publication Date Title
US9523129B2 (en) Sequence analysis of complex amplicons
US8691510B2 (en) Sequence analysis of complex amplicons
JP6085249B2 (ja) 複雑なアンプリコンの配列解析
US9043160B1 (en) Method of determining clonotypes and clonotype profiles
US10526650B2 (en) Method for genotyping clonotype profiles using sequence tags
US10385475B2 (en) Random array sequencing of low-complexity libraries
AU2013246050B2 (en) Detection and quantitation of sample contamination in immune repertoire analysis
US9394567B2 (en) Detection and quantification of sample contamination in immune repertoire analysis
US9506119B2 (en) Method of sequence determination using sequence tags
EP2959020B1 (en) Method to select rare clonotypes
US20140349883A1 (en) Monitoring transformation of follicular lymphoma to diffuse large b-cell lymphoma by immune repertoire analysis
US20150299800A1 (en) Monitoring mantle cell lymphoma clonotypes in peripheral blood after immunotransplant
US20140342360A1 (en) Method of measuring immune activation
US20150031553A1 (en) Method of measuring immune activation
US20140356339A1 (en) Sequence-based measures of immune response
US20150031043A1 (en) Determining paired immune receptor chains from frequency matched subunits
US20150247201A1 (en) Predicting relapse of chronic lymphocytic leukemia patients treated by allogeneic stem cell transplantation
WO2013090469A1 (en) Detection and measurement of tissue-infiltrating lymphocytes
EP2859123A2 (en) Method of sequence determination using sequence tags
WO2013134302A1 (en) Monitoring immune responsiveness to cancer vaccination

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11777705

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2013509047

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11777705

Country of ref document: EP

Kind code of ref document: A1