WO2011132872A2 - 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 - Google Patents

결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 Download PDF

Info

Publication number
WO2011132872A2
WO2011132872A2 PCT/KR2011/002499 KR2011002499W WO2011132872A2 WO 2011132872 A2 WO2011132872 A2 WO 2011132872A2 KR 2011002499 W KR2011002499 W KR 2011002499W WO 2011132872 A2 WO2011132872 A2 WO 2011132872A2
Authority
WO
WIPO (PCT)
Prior art keywords
tuberculosis
ifn
seq
probe
primer pair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2011/002499
Other languages
English (en)
French (fr)
Other versions
WO2011132872A9 (ko
WO2011132872A3 (ko
Inventor
이혜영
조상래
김태우
김성현
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Yonsei University
Original Assignee
Industry Academic Cooperation Foundation of Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020100036177A external-priority patent/KR20110116644A/ko
Application filed by Industry Academic Cooperation Foundation of Yonsei University filed Critical Industry Academic Cooperation Foundation of Yonsei University
Publication of WO2011132872A2 publication Critical patent/WO2011132872A2/ko
Publication of WO2011132872A3 publication Critical patent/WO2011132872A3/ko
Publication of WO2011132872A9 publication Critical patent/WO2011132872A9/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to a method for providing information for the diagnosis of tuberculosis and tuberculosis diagnostic kit for the same, and more specifically, to provide information for the diagnosis of tuberculosis with significantly reduced blood volume and processing time used compared to the conventional tuberculosis diagnostic kit It relates to a method and a kit for diagnosing tuberculosis.
  • Tuberculosis is a chronic infectious disease caused by infection with Mycobacterium M. tuberculosis, which is not only a major disease in developing countries but also increases its severity in developed countries around the world. New onset and about 3 million patients die. Although tuberculosis may be asymptomatic for a significant time even after infection, the disease most commonly manifests as acute inflammation of the lungs, resulting in fever and unproductive cough, which if not treated usually leads to serious complications and death.
  • TST tuberculin skin test
  • NTM non-tuberculosis mycobacteria
  • tuberculosis In addition, some patients with tuberculosis responded negatively, reducing their credibility as a criterion for screening TB infection. However, due to its low specificity, high sensitivity, and low cost, it is still widely used as a method for detecting tuberculosis infection in developing and developing countries.
  • a commonly used method is a culture method.
  • the bacteria are directly isolated from the patient's specimen in the laboratory and tested, the risk of infection is very high, and since the tuberculosis bacteria take at least 4-6 weeks to grow, there is a considerable time and cost.
  • the detection method using the blood of the patient is safer, faster, and can be performed using a part of the blood necessary for a general clinical test because it detects the immune response caused by the infection of Mycobacterium tuberculosis rather than Mycobacterium tuberculosis. It's a convenient way for everyone.
  • the test methods for blood developed so far include serological methods for detecting antibodies to Mycobacterium tuberculosis antigens and IGRA assays for detecting the amount of IFN- ⁇ secreted by Mycobacterium tuberculosis infection (NCBI ACCESSION NO: NM_000619).
  • the serological diagnostic method has the advantage of being very easy to use, easy and quick to interpret the results, but has the disadvantage that the specificity and sensitivity are very low and the quantitative test cannot be performed.
  • the IGRA test which is a method of quantitatively analyzing IFN- ⁇ protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, was performed by QuantiFERON (ELISA) and T-Spot.TB (ELISPOT) using a single antibody against IFN- ⁇ . It is widely used in developed countries because of its high specificity compared to the existing test method. However, IGRA tests have the following disadvantages that are difficult to commercialize worldwide.
  • the IGRA test requires about 3ml of whole blood of the patient, but it is very difficult to obtain the blood volume for the test in the case of children or the elderly who have difficulty in collecting blood through the syringe to obtain this blood volume. There was a very troublesome problem.
  • the present invention has been made to solve the above problems, the first problem to be solved of the present invention is to provide a method for providing information for the diagnosis of tuberculosis that can significantly reduce the test time while significantly reducing the required blood volume will be.
  • the second problem to be solved of the present invention is to provide a tuberculosis diagnostic kit that can significantly lower the production cost while requiring less blood than the conventional tuberculosis diagnostic kit.
  • the present invention to achieve the first object, a) treating the tuberculosis specific antigen in the blood of suspected tuberculosis, b) separating the full-length RNA from the blood treated with the tuberculosis specific antigen, c) the isolated Synthesizing cDNA from the full-length RNA, d) RT-PCR using a primer capable of amplifying the synthesized cDNA IFN- ⁇ and a control gene to amplify the control gene to contrast with the expression level of IFN- ⁇ And it provides a method for providing information for the diagnosis of tuberculosis, and e) measuring the mRNA expression level of the amplified IFN- ⁇ and the mRNA expression level of the control gene.
  • step d) comprises combining the synthesized cDNA with a first primer pair capable of amplifying IFN- ⁇ , a first probe capable of binding to the amplified site, and IFN-
  • a first primer pair capable of amplifying IFN- ⁇ a first probe capable of binding to the amplified site
  • IFN- a first probe capable of binding to the amplified site
  • realtime RT-PCR is performed using a second primer pair capable of amplifying a control gene for contrast with the expression level of ⁇ and a second probe capable of binding to the amplified control gene region.
  • the blood may be whole blood.
  • step a) may further comprise the step of collecting blood of suspected tuberculosis patients.
  • the blood collection may be to collect blood of 1 ml or less, more preferably 0.2 to 0.5 ml, most preferably 0.3 ml of blood, but It is not limited.
  • the Mycobacterium tuberculosis specific antigen of step b) may be any one or more of ESAT-6, CFP-10 and TB7.7, but is not limited thereto.
  • control gene may be GAPDH, but is not limited thereto.
  • the primer capable of amplifying the GAPDH may comprise a primer pair consisting of SEQ ID NOs: 4 and 5.
  • the primer capable of amplifying the IFN- ⁇ may include, but is not limited to, a primer pair consisting of SEQ ID NO: 1 and 2 or SEQ ID NO: 7 and 8.
  • the first probe is preferably represented by SEQ ID NO: 3 or 9, but is not limited thereto.
  • the second probe may be represented by SEQ ID NO: 6.
  • the step e may further comprise the step of comparing the mRNA expression level of IFN- ⁇ relative to the mRNA expression level of the control gene.
  • a diagnostic composition for tuberculosis comprising a primer specifically binding to the gene for measuring the mRNA expression level of the human IFN- ⁇ gene.
  • the primer may comprise a primer pair consisting of SEQ ID NO: 1 and 2 or SEQ ID NO: 7 and 8.
  • the primer in order to measure the mRNA expression level of GAPDH may further comprise a primer specifically binding to the gene, more preferably the primer consists of SEQ ID NOs: 4 and 5 Primer pairs may be included.
  • a diagnostic kit for tuberculosis comprising the tuberculosis diagnostic composition and RT-PCR kit comprising the same.
  • a primer pair consisting of SEQ ID NO: 1 and 2 or SEQ ID NO: 7 and 8 capable of amplifying IFN- ⁇ for the diagnosis of tuberculosis;
  • a primer pair consisting of a fluorescence-labeled probe represented by SEQ ID NO: 3 or 9 capable of binding to the amplified IFN- ⁇ , and SEQ ID NOs: 4 and 5 capable of amplifying GAPDH for contrast with the expression level of IFN- ⁇ .
  • a fluorescent labeled probe represented by SEQ ID NO: 6 capable of binding to the amplified GAPDH.
  • method of providing information for diagnosis is a preliminary step for diagnosis and provides objective basic information necessary for the diagnosis of tuberculosis, excluding the clinical judgment or findings of the doctor.
  • the term "information method for diagnosing tuberculosis using real-time reverse transcriptase amplification” is a preliminary step for diagnosis and provides objective basic information necessary for the diagnosis of tuberculosis, and excludes the clinical judgment or findings of the doctor.
  • primer refers to a short nucleic acid sequence that is capable of forming base pairs with complementary templates with nucleic acid sequences having short free 3-terminal hydroxyl groups and that serves as a starting point for template strand copying.
  • Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
  • Primers of the invention are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers can incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.
  • probe It is a single chain nucleic acid molecule and comprises a sequence that is complementary to a target nucleic acid sequence.
  • mRNA expression level is a measure of the presence and expression of mRNA in a biological sample to provide information for diagnosing tuberculosis.
  • RT-PCR reverse transcriptase polymerase reaction
  • realtime RT-PCR refers to a target primer and label using cDNA produced after reverse transcription of RNA into complementary DNA (cDNA) using reverse transcriptase. It is a molecular biological polymerization method that amplifies a target using a target probe and simultaneously detects a signal generated from a label of a target probe on the amplified target.
  • the conventional IGRA method for testing IFN- [gamma] protein requires blood collection through a syringe because at least 3 ml or more of blood is required.
  • a very small amount of blood of 1 ml preferably 0.5 ml or less
  • the existing total test time can be reduced, so that TB patients can be identified more quickly.
  • another labeled probe may bind to the inside of the site amplified by the primer pair, and thus may have a higher specificity for the target.
  • FIG. 1 is a schematic diagram showing an information providing method for diagnosing tuberculosis according to an embodiment of the present invention.
  • Figure 2 is a tube containing Mycobacterium tuberculosis specific antigen for performing RT-PCR according to an embodiment of the present invention.
  • 3 and 4 is a table showing a comparison result according to a conventional QuatiFERON (IFN- ⁇ ELISA) test results and blood samples according to a preferred embodiment of the present invention.
  • Figure 5 is an electrophoresis picture of the RT-PCR according to a preferred embodiment of the present invention according to the reaction time of the tuberculosis bacteria specific antigen and blood.
  • FIG. 6 is an electrophoretic photograph of a small amount of blood and RT-PCR according to a preferred embodiment of the present invention.
  • FIG. 7 is a flowchart illustrating a method of providing information of a real-time reverse transcriptase amplification method for diagnosing tuberculosis according to an exemplary embodiment of the present invention.
  • 8 to 12 are the results of realtime RT-PCR of the present invention using the blood of five tuberculosis patients.
  • 13 to 17 are the results of realtime RT-PCR of the present invention using the blood of five non-tuberculosis.
  • FIG. 18 shows the results of experiments using conventional IFN- ⁇ ELISA (commercial kit), RT-PCR, and blood from tuberculosis patients with positive and negative results from hospital tests.
  • 19 and 20 show the RTN-PCR of Example 4 and the IFN- ⁇ of Example 4 by the combination of the (1) IFN- ⁇ primer and probe pair of Example 4 and the primer and probe pair of (2) under the same specimen and conditions ( RT-PCR was performed by the combination of 3) primer and probe pair and (2) primer and probe pair to compare the results.
  • 19 and 20 show the results of using the IFN- ⁇ primer and probe pair (1) of Example 4, and the graph on the right shows the IFN- ⁇ (3) primers and probe of Example 4 This is the result of using a pair.
  • the conventional IGRA test for the diagnosis of tuberculosis has a problem that it is difficult to be widely used because the amount of blood required and the test time is at least 24 hours or more, and the price of the manufactured kit is significantly high.
  • a) treating the tuberculosis-specific antigen in the blood of suspected tuberculosis b) separating the full-length RNA from the blood treated with the tuberculosis-specific antigen, c) synthesizing cDNA from the isolated full-length RNA Step, d) performing RT-PCR using a primer capable of amplifying the synthesized cDNA with a primer capable of amplifying IFN- ⁇ and a control gene for contrast with the expression level of IFN- ⁇ , and e)
  • an information providing method for diagnosing tuberculosis comprising measuring the mRNA expression level of the amplified IFN- ⁇ and the mRNA expression level of the control gene was sought to solve the above problems.
  • IFN- ⁇ is quantitatively analyzed at the mRNA expression level, not at the protein expression level, blood volume, test time, and test cost required for the TB test can be significantly reduced.
  • blood of a suspected tuberculosis patient may be collected as a preliminary step for step a).
  • the minimum amount of blood required is more than 3 ml.
  • blood In order to collect this amount of blood, blood must be drawn from a suspected tuberculosis patient through a syringe. Due to the difficulty of blood collection, the elderly, young children and women had a problem that the tuberculosis test is difficult.
  • the required blood volume is 1 ml or less, preferably 0.3 to 0.5 ml can provide information to determine whether tuberculosis, simply by a method such as a blood needle rather than a syringe Blood can be collected, which can relieve much of the psychological burden of blood collection.
  • the blood used in the present invention may preferably be whole blood.
  • the tuberculosis-specific antigen is treated in the blood of the suspected tuberculosis tuberculosis patient as step a). This is to provide information for judging tuberculosis through the mRNA expression level of IFN- ⁇ secreted by T cells in response to Mycobacterium tuberculosis specific antigen.
  • IFN- ⁇ is not a quantification of the expression level of IFN- ⁇ protein.
  • the Mycobacterium tuberculosis-specific antigen that can be used in step a) can be used for the IGRA test, and is specifically present only in Mycobacterium tuberculosis, and any conventional Mycobacterium tuberculosis specific antigen known to induce an immune response in the host can be used.
  • ESAT-6 NCBI ACCESSION NO: YP_178023
  • CFP-10 NCBI ACCESSION NO: NP_218391
  • TB7.7 NCBI ACCESSION NO: NP_217171
  • ESAT-6 NCBI ACCESSION NO: YP_178023
  • CFP-10 NCBI ACCESSION NO: NP_218391
  • TB7.7 NCBI ACCESSION NO: NP_217171
  • tuberculosis-specific antigen should be treated immediately after blood collection without isolation of full-length RNA.
  • Patients exposed to tuberculosis have information about tuberculosis in memory T cells. This is because the T cell remembers the immune response stronger than normal and can express more IFN- ⁇ .
  • Steps b) and c) of the present invention are a method for separating total RNA, which is generally used as a preliminary step for performing RT-PCR or real-time RT-PCR, and a method for synthesizing cDNA therefrom. Method, and a detailed description of this process can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, K. F. et al., Which may be incorporated by reference of the present invention.
  • RT-PCR is performed using a primer capable of amplifying the synthesized cDNA with a primer capable of amplifying IFN- ⁇ and a control gene for contrast with the expression level of IFN- ⁇ .
  • the realtime RT-PCR used in the present invention does not require electrophoresis and EtBr staining, the existing total examination time can be reduced, so that TB patients can be identified more quickly.
  • the instrument can be a more sensitive test than the conventional test.
  • another labeled probe may bind to the inside of the site amplified by the primer pair, and thus may have a higher specificity for the target.
  • the synthesized cDNA is a first primer pair capable of amplifying IFN- ⁇ , a first probe capable of binding to the amplified site, and a foot of IFN- ⁇ .
  • the above-described problem was solved by performing realtime RT-PCR using a second primer pair capable of amplifying a control gene to be contrasted with the amount and a second probe capable of binding to an amplified control gene region.
  • Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.).
  • Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the amplified target sequence (IFN- ⁇ , control gene) can be labeled with a detectable labeling substance.
  • the labeling material may be a fluorescent, phosphorescent, chemiluminescent or radioactive material, but is not limited thereto.
  • the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3.
  • real-time RT-PCR may be performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer to label the target sequence with a detectable fluorescent label. .
  • the label using radioactive material is added to the PCR reaction solution by adding radioactive isotopes such as 32 P or 35 S to the PCR reaction solution during real-time RT-PCR, and the amplification product is radioactively incorporated into the amplification product.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification product is radioactively incorporated into the amplification product.
  • One or more sets of oligonucleotide primers used to amplify a target sequence can be used.
  • Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham” (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.
  • IFN- ⁇ is a protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, and in the present invention, the expression level is measured at the mRNA level rather than the protein through RT-PCR.
  • a primer that specifically binds to the IFN- ⁇ gene is required, and in the present invention, as a front primer, [5 'TGCAGGTCATTCAGATGTAGCGGATA 3' (SEQ ID NO: 1)] or 5'tgaatgtccaacgcaaagca3 '(SEQ ID NO: 7) and a rear primer
  • a novel primer pair [5 'TCATGTATTGCTTTGCGTTGGACA 3' (SEQ ID NO: 2)] or 5'cgacctcgaaacagcatctga3 '(SEQ ID NO: 8) can be used.
  • [5'-FAM-TGGAGACCATCAAGGAAGACATGA-Quen-3 '(SEQ ID NO: 3)] or 5'cgccagcagctaaaacagggaagcg3' (SEQ ID NO: 9) may be used as the fluorescent labeling probe that binds to the amplification site of IFN- ⁇ , but is not limited thereto. As long as it can perform real-time RT-PCR by binding specifically to IFN- ⁇ and providing a detectable signal, it can be used without limitation.
  • FAM and Quen (Quencher) means a fluorescent dye.
  • RT-PCR may be performed using a primer capable of amplifying a control gene for contrast with the expression level of IFN- ⁇ .
  • the control gene that can be applied to the present invention is a reference gene for relatively determining the expression level of IFN- ⁇ .
  • the GAPDH gene NCBI ACCESSION NO: NM_002046
  • RT-PCR can be performed to express mRNA.
  • GAPDH gene is a housekeeping gene, which is a gene that is constantly expressed in a constant amount to maintain minimal function in human cells. There are many genes besides GAPDH, but quantitative RT-PCR or real-time RT-PCR analysis GAPDH is the most used in the world.
  • the present invention is not limited thereto, and genes that may be used as criteria for relatively determining the expression level of IFN- ⁇ may be applied to the present invention.
  • a primer capable of specifically binding to the gene is required, and in the present invention, as a front primer [5 'CGGGAAGCTTGTGATCAATGG 3' (SEQ ID NO: 4)] and a rear primer [ [5'-FAM-ACTGGCGTCTTCACCACCAT-Quen-3 '(SEQ ID NO: 6)] can be used as a novel primer pair and a fluorescently labeled probe of 5' GGCAGTGATGGCATGGACTG 3 '(SEQ ID NO: 5).
  • RT-PCR method applied to the present invention can be carried out through known procedures commonly used in the art.
  • step e the mRNA expression level of the amplified IFN- ⁇ and mRNA expression level of the control gene is measured as step e).
  • This step is to relatively measure the expression level of mRNA of the mRNA and the control gene of the IFN- ⁇ can be used without limitation as long as it is a method for measuring the normal mRNA expression level, preferably the RT-PCR PCR products amplified through the electrophoresis by measuring the mRNA expression level of IFN- ⁇ and mRNA level of the control gene by a densitometer (Densitometer) or by electrophoresis to confirm the band pattern and band thickness by FN- ⁇ MRNA expression level and mRNA expression level of the control gene can be measured.
  • a densitometer Densitometer
  • step e) may be performed through radioactivity measurement, fluorescence measurement or phosphorescence measurement according to the type of probe label used, but is not limited thereto.
  • the fluorescence measurement method uses Cy-5 or Cy-3 at the 5'-end of a primer to perform real-time RT-PCR to label the target sequence with a detectable fluorescent label.
  • the labeled fluorescence can be measured using a fluorimeter.
  • the radioactivity measuring method is to add a radioisotope such as 32 P or 35 S to the PCR reaction solution when real-time RT-PCR is performed to label the amplification product, and then radioactive measuring apparatus, for example, Geiger counter (Geiger Radioactivity can be measured using a counter or a liquid scintillation counter.
  • a radioisotope such as 32 P or 35 S
  • radioactive measuring apparatus for example, Geiger counter (Geiger Radioactivity can be measured using a counter or a liquid scintillation counter.
  • a fluorescent-labeled probe is attached to the PCR product amplified by the realtime RT-PCR to emit a fluorescence of a specific wavelength, and at the same time, the IFN- ⁇ in the fluorescence measuring device of the realtime PCR device.
  • MRNA expression level of the control gene and mRNA expression level of the control gene is measured in real time, the measured value is calculated and visualized through the PC, the examiner can easily check the expression level.
  • the amount of IFN- ⁇ and GAPDH mRNA expression was calculated for each blood sample (sample), and the amount of IFN- ⁇ mRNA expression increased and decreased compared to GAPDH mRNA expression in multiples of several times. Relative quantification of increases and decreases can provide information that can be used to determine tuberculosis.
  • the diagnostic kit may be a kit for diagnosing tuberculosis, characterized in that it includes essential elements necessary to perform reverse transcriptase.
  • the reverse transcription polymerase kit may comprise each primer pair specific for the human IFN- [gamma] gene.
  • the primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length, and more preferably SEQ ID NOs: 1 and 2 It may include a novel primer pair represented by or a novel primer pair represented by SEQ ID NO: 1 and 2 or SEQ ID NO: 7 and 8 and a fluorescently labeled probe represented by SEQ ID NO: 3 or SEQ ID NO: 9.
  • a primer specific for the nucleic acid sequence of the control gene may be included.
  • the primer may further include a primer specifically binding to the gene for measuring the mRNA expression level of GAPDH, more preferably the primer.
  • reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • reaction buffers pH and magnesium concentrations vary
  • enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase
  • DNAse DNAse
  • RNAse inhibitor DEPC - May include DEPC-water, sterile water, and the like.
  • the conventional IGRA method for testing IFN- [gamma] protein requires at least 3 ml or more of blood, so the blood must be drawn through a syringe.
  • a very small amount of 1 ml (preferably 0.5 ml or less) of tuberculosis test can Since it is possible to test the patient with a small amount of blood detected after poking a needle such as a blood needle rather than a syringe, the burden of the syringe can be significantly reduced.
  • the reduced antigen processing time (within 4 hours) compared to the conventional method (16 to 24 hours)
  • the existing total test time can be reduced, so that TB patients can be identified more quickly.
  • Example 1 Mycobacterium tuberculosis specific antigen treatment in whole blood of patient
  • the TB antigen tube is a tube containing three antigens, ESAT-6, CFP-10, and TB7.7, which are specific to Mycobacterium tuberculosis and induce an immune response in the host.
  • the TB mitogen tube contains phytohaemagglutinin (PHA) that acts as a mitogen and was used as a positive control in the IGRA test.
  • PHA phytohaemagglutinin
  • the antigen treatment time and blood volume were reduced as follows.
  • Example 2 Isolation of total RNA from antigen-treated blood
  • Example 1 the antigen-treated blood was placed in about 5 times RBC lysis buffer, and all RBCs were removed, and then the QIAamp Blood RNA Mini kit (Qiagen) and the Easy-spin total RNA extraction kit (Intron) were used from the remaining WBCs. Total RNA was isolated.
  • the composition of the RT-PCR reactants was KCl 50 mM, Tris-HCl 10 mM (pH8.3), MgCl 2 1.5 mM, gelatin 0.001% (w / v), 250 uM dNTP, 1 unit Tag DNA polymerase (Solgent) and each of the front primer and the back primer 10 pmole. 2 ⁇ l of the synthesized cDNA was added thereto, and the final volume was 20 ⁇ l.
  • the base sequence of each primer added is as follows.
  • IFN- ⁇ primer size of amplified product-287bp
  • RT-PCR reaction (Applied Biosystems (GeneAmp PCR System 2700), MJ Research Inc. (PTC-100)) was performed once at a denaturation temperature of 95 ° C. for 5 minutes, at a denaturation temperature of 95 ° C. for 30 seconds, and at an annealing temperature of 55 ° C. 35 cycles of 30 seconds at 30 seconds, elongation temperature at 72 ° C. and finally a final extension reaction at 72 ° C. for 10 minutes.
  • the composition of the RT-PCR reactants was KCl 50 mM, Tris-HCl 10 mM (pH8.3), MgCl 2 1.5 mM, gelatin 0.001% (w / v), 250 uM dNTP, 1 unit Tag DNA polymerase (Solgent) and each of the front primer and the back primer 10 pmole.
  • oligo probes labeled with fluorescent probes were added to 5 pmole.
  • 3 ⁇ l of the synthesized cDNA was added thereto, and the final volume was 20 ⁇ l.
  • the base sequence of each primer added is as follows.
  • the real time RT-PCR was performed by a combination of the following (1) and (2) or a combination of the following (2) and (3).
  • IFN- ⁇ primer size of amplified product-140 bp
  • Probe-5 'FAM-ACTGGCGTCTTCACCACCAT-Quen 3' (SEQ ID NO: 6)
  • Probe-5 'FAM-cgccagcagctaaaacagggaagcg-Quen 3' (SEQ ID NO: 9)
  • the real-time RT-PCR reaction (MJ opticon real time PCR system, Bio Rad) is performed once at a denaturation temperature of 95 ° C. for 5 minutes, 40 cycles of 30 seconds at denaturation temperature of 95 ° C., and 30 seconds at annealing temperature of 60 ° C. Repeated times were performed.
  • IFN- ⁇ and GAPDH were quantified from three tubes, TB mitogen tube, TB antigen tube, and Nil tube, which were used in the embodiment of the present invention.
  • TB Ag / Nil obtained by substitution in the above formula 1 can be determined as tuberculosis positive if 1.5 or more, and tuberculosis negative if 1.5 or less.
  • the difference between the positive control TB mitogen tube value and the negative control Nil tube value is determined to determine whether or not the sound is negative. Equation 1 above and the determination of tuberculosis infection according to the standard of the general IGRA test.
  • ⁇ Ct method As an example of analyzing the amount of gene expression, one of the comparative quantitative methods, ⁇ Ct method, will be used.
  • ⁇ Ct TB or Mitogen IFN- ⁇ Ct value of TB or Mitogen-reference gene Ct value of TB or Mitogen
  • Figure 3 is tested with a product called QuatiFERON sold as a commercial kit, the result of the tuberculosis-positive patient sample treated with TB-specific antigen under the same conditions as the existing IGRA test and RT-PCR based IGRA assay of the present invention Is a table comparing the results. As a result, it can be confirmed that the RT-PCR based IGRA assay of the present invention shows the same test results as the conventional commercial kit, compared to the conventional commercial kit.
  • FIG. 4 shows the results of RT-PCR based IGRA assay of the present invention after subjecting the patient specimens with tuberculosis negative and uninterpretable results as a result of testing with QuatiFERON, which is sold as a commercial kit. Is a table comparing the results. As a result, it can be seen that each of the positive and negative samples from the existing commercial kits were not interpretable results, and the other tuberculosis-negative samples were all the same.
  • Each graph shows the Ct value according to the amplification of IFN- ⁇ mRNA, and shows that the expression level of the target increases from the point where the graph rises, and the value of the point is the Ct value. Therefore, the lower the Ct value, the higher the expression level was shown even when fewer cycles were performed. Thus, the lower Ct value indicates the higher expression level of the gene.
  • Each graph below shows the result of each patient with tuberculosis. There are two lines.
  • the line on the front is the Ct value for the treatment of Mycobacterium tuberculosis antigen
  • the line on the back is the nil control without the treatment of Mycobacterium tuberculosis antigen. Therefore, the greater the distance between two lines, that is, the greater the difference in Ct values, the greater the response to Mycobacterium tuberculosis antigens. Therefore, since the difference is small, it can be seen that the graphs in FIG. 3 are all TB patients.
  • FIGS. 13 to 17 show the results of newly developed realtime RT-PCR using blood of non-tuberculosis. Notice that the spacing between the two lines in each graph is very narrow. This means that the expression of IFN- ⁇ mRNA for tuberculosis antigens does not increase as the difference between the Ct values of the two front and back lines decreases, so that each graph in FIGS. 13 to 17 represents a normal person. It can be seen that the graph is very narrow compared to the interval between two lines existing in the graphs in FIGS. 8 to 12.
  • Table 1 shows the Ct obtained by performing experiments with conventional IFN- ⁇ ELISA (commercial kit), RT-PCR and blood from tuberculosis patients with positive and negative results from hospital tests.
  • a comparative quantitative value using the ABI's 7500 v2.04 software that is, the R value according to the above relation, was easily quantified in a graph in FIG. 18. It shows the expression amount of and shows high R value on the graph, and low R value on the graph for non-TB. R value immediately represents the expression level of IFN- ⁇ , it can be seen that the patient group on the left side where the R value is high is TB patient group.
  • Table 1 Sample Expression rate with ABI 7500 Expression rate with RT-PCR ELISA Nil TB2 17.14 13.29, + positive One TB3 94.25 3.43, + positive One TB4 234.82 5.38, + positive One TB5 16.19 7.28, + positive One Normal1 1.82 0.53,- negative One Normal2 1.08 0.52,- negative One Normal3 6.95 0.85,- negative One Normal 4 0.66 0.64,- negative One Normal 5 1.65 0.75,- negative One
  • TB tuberculosis patients
  • Normal represents a healthy person, not tuberculosis.
  • the real time RT-PCR based IGRA assay of the present invention shows the same test results as the conventional commercial kits and recently developed molecular biological tests, compared with the conventional commercial kits.
  • the existing IGRA test for IFN- ⁇ protein took two days to obtain the final test results due to the long TB-specific antigen treatment time.
  • the target is an IFN- ⁇ protein, but in the present invention, since the IFN- ⁇ mRNA is a target, it is hypothesized that the expression can be confirmed at a faster time, and the existing RTF-PCR based IGRA assay for establishing conditions Using the same amount of blood (3 ml each; 1 ml each of mitogen (M), TB Ag, and Nil (N) tubes), the reaction time of the TB-specific antigen and blood was 4 and 8 hours, respectively. , And changed to 12 hours to perform RT-PCR based IGRA assay (FIG. 5).
  • M denotes TB mitogen
  • TB denotes TB Ag
  • N denotes Nil
  • RT-PCR is performed after not treating these antigens by time, 4 hours treatment, 8 hours treatment, and 16 hours treatment.
  • the results confirmed that the expression of IFN- ⁇ mRNA even after 4 hours of antigen treatment.
  • the antigen treatment time which was 16 hours to 24 hours when performing the existing IFN- ⁇ ELISA, can be shortened to within 4 hours.
  • M denotes TB mitogen
  • TB denotes TB Ag
  • N denotes Nil.
  • the method of providing information for diagnosing tuberculosis of the present invention and the tuberculosis diagnostic kit therefor are very useful in the medical industry because tuberculosis can be diagnosed in a short time through a very small amount of blood.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Pulse, Heart Rate, Blood Pressure Or Blood Flow (AREA)
  • Medical Treatment And Welfare Office Work (AREA)

Abstract

본 발명은 종래의 결핵 진단용 키트에 비하여 사용되는 혈액량 및 처리시간이 현저하게 저감된 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트에 관한 것이다.

Description

결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
본 발명은 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트에 관한 것으로, 보다 상세하게는 종래의 결핵 진단용 키트에 비하여 사용되는 혈액량 및 처리시간이 현저하게 저감된 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트에 관한 것이다.
결핵은 마이코박테리움.튜베르쿨로시스(M. tuberculosis)로 감염되어 유발되는 만성 감염성 질병으로, 개발도상국에서 주요 질병일 뿐 아니라 세계 선진국에서도 그 심각성이 증가하고 있으며, 매년 약 8백만명의 환자가 새로 발병하며 약 3백 만명의 환자가 사망한다. 결핵은 감염되어도 상당한 시간 동안 증상이 없을 수 있지만, 이 질병은 가장 통상적으로 폐의 급성 염증으로 나타나서 열 및 비생산적 기침을 초래하며, 이를 치료하지 않으면, 통상적으로 심각한 합병증을 초래하고 사망에 이르게 된다.
따라서, 결핵의 조기 진단 및 치료가 무엇보다도 중요하며, 종래에 결핵균 감염의 모니터링에는 투베르쿨린 피부반응검사(Tuberculin Skin Test; TST)가 전 세계적으로 통용되어 왔다. TST는 결핵균 배양액을 가열 멸균한 후 여과하여 얻은 배양액을 정제한 투베르쿨린을 주사하고 2-3일 이후에 주사부위에 나타나는 반응(지연형 과민반응)의 정도를 측정하는 항원특이 반응이다. 그러나 TST는 비결핵항산균(NTM)에 감작되었던 사람들에게서 교차반응을 보이며, 우리나라와 같이 BCG 백신접종이 보편화되어 있는 경우에는 위양성의 확률이 매우 높다. 또한, 결핵환자 중에는 음성반응을 보이는 환자들도 있어 결핵 감염을 가리는 기준으로써 신빙성이 감소하였다. 그러나 특이도는 낮지만 민감도가 높고 저렴한 비용 때문에 아직도 개발도상국이나 후진국에서는 결핵균 감염을 검출하기 위한 방법으로써 널리 사용되고 있다.
통상적으로 많이 사용되던 방법은 배양법이다. 그러나 검사실에서 환자의 검체로부터 직접 균을 분리, 배양하여 검사를 할 경우 감염의 위험성이 매우 높으며, 결핵균이 자라는데 최소 4-6주 이상 소요되기 때문에 상당히 많은 시간과 비용이 소모되는 문제가 있었다.
반면에, 환자의 혈액을 이용한 검출방법은 결핵균이 아닌 결핵균 감염에 의한 면역반응을 보는 것이기 때문에 보다 안전하고, 빠르며, 또한 일반적인 임상 검사 시 필요한 혈액의 일부를 사용해 검사를 진행할 수 있기 때문에 환자와 검사자 입장에서 모두 편리한 방법이다.
현재까지 개발된 혈액을 대상으로 한 검사법에는 결핵균 항원에 대한 항체를 검출하는 혈청학적인 방법과, 결핵균 감염에 의해 분비되는 IFN-γ(NCBI ACCESSION NO : NM_000619)의 양을 검출하는 IGRA검사법이 있다. 구체적으로 혈청학적 진단법은 사용이 아주 간편하고 쉽고 빠르게 결과를 해석할 수 있다는 장점이 있으나 특이도와 민감도가 매우 낮고 정량적인 검사를 할 수 없다는 단점이 있다.
이에 결핵균 특이항원에 의해 자극된 T세포가 분비하는 IFN-γ 단백질을 정량적으로 분석하는 방법인 IGRA검사는 IFN-γ에 대한 단일항체를 이용한 ELISA법인 QuantiFERON과 ELISPOT법을 이용한 T-Spot.TB가 기존의 검사법에 비해 높은 특이도를 보이기 때문에 선진국을 중심으로 널리 사용되어 지고 있다. 그러나 IGRA검사는 세계적으로 상용화되기에 어려운 다음과 같은 단점들이 있다.
첫째, IGRA검사를 위해서는 환자의 전혈이 약 3ml 정도 필요하지만 이 정도 혈액량을 얻기 위해서는 주사기를 통해 혈액을 채취하여야 하기 어려운 소아나 노인의 경우 검사에 필요한 혈액량을 얻기가 매우 어려울 뿐 아니라, 일반인들에게도 매우 번거로운 문제가 있었다.
둘째, 검사 시, 채취한 혈액에 결핵 특이 항원을 처리하는 시간이 16-24 시간 정도 소요되기 때문에 검사결과가 나오기까지 약 이틀의 시간이 소요된다.
셋째, 상업용 키트의 경우 전량 수입에 의존하고 있으며, 가격 역시 100테스트 당 500만원 정도로 현저하게 비싼 문제가 있다.
넷째, ELISA방법을 이용한 IGRA검사의 경우 검사시 마다 표준검량선 (standard)을 설정해야 하기 때문에, 적은 수의 검체를 검사하기에 비용적인 부담이 있고, 한 번에 많은 수의 검체를 검사할 때에는 검사에 사용되는 발색 시약의 작용이 지연될 수 있기 때문에 일정한 결과를 얻기 어려운 문제가 있다.
본 발명은 상술한 문제를 해결하기 위하여 안출된 것으로, 본 발명의 첫번째 해결하려는 과제는 요구되는 혈액량을 현저하게 줄이면서도 검사시간을 획기적으로 저감할 수 있는 결핵의 진단을 위한 정보제공방법을 제공하는 것이다.
본 발명의 두번째 해결하려는 과제는 종래의 결핵 진단용 키트보다 요구되는 혈액량은 적으면서 제작비용을 획기적으로 낮출 수 있는 결핵 진단용 키트를 제공하는 것이다.
본 발명은 상기 첫번째 과제를 달성하기 위하여, a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계, b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계, c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계, d) 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 프라이머 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 프라이머를 이용하여 RT-PCR을 수행하는 단계, 및 e) 상기 증폭된 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계를 포함하는 결핵의 진단을 위한 정보제공방법을 제공한다.
본 발명의 다른 구현예에 있어서, 상기 방법에 있어서, d)단계는 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하는 단계인 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 바람직한 일 실시예에 따르면, 상기 혈액은 전혈일 수 있다.
본 발명의 바람직한 다른 일 실시예에 따르면, 상기 a) 단계 이전에 결핵 의심환자의 혈액을 채혈하는 단계를 더 포함할 수 있다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 채혈은 1㎖ 이하의 혈액을 채혈하는 것일 수 있으며, 보다 바람직하게는 0.2 ~ 0.5㎖, 가장 바람직하게는 0.3㎖의 혈액을 채혈할 수 있으나 이에 한정되지 아니한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 b) 단계의 결핵균 특이항원은 ESAT-6, CFP-10 및 TB7.7 중 어느 하나 이상일 수 있으나 이에 한정되지 아니한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 대조군 유전자는 GAPDH일 수 있으나 이에 한정되지 아니한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 GAPDH를 증폭할 수 있는 프라이머는 서열번호 4 및 5로 구성되는 프라이머쌍을 포함할 수 있다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 IFN-γ를 증폭할 수 있는 프라이머는 서열번호 1 및 2 또는 서열번호 7 및 8로 구성되는 프라이머쌍을 포함할 수 있으나 이에 한정되지 아니한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 제 1 프로브는 서열번호 3 또는 9로 표시되는 것이 바람직하나 이에 한정되지 아니한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 제2 프로브는 서열번호 6으로 표시되는 것일 수 있다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 e) 단계 이후, 대조군 유전자의 mRNA 발현수준을 기준으로 IFN-γ의 mRNA 발현수준을 상대적으로 비교하는 단계를 더 포함할 수 있다.
상기 두번째 과제를 달성하기 위하여, 인간 IFN-γ 유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머를 포함하는 결핵 진단용 조성물을 제공한다.
본 발명의 바람직한 일 실시예에 따르면, 상기 프라이머는 서열번호 1 및 2 또는 서열번호 7 및 8로 구성되는 프라이머쌍을 포함할 수 있다.
본 발명의 바람직한 다른 일 실시예에 따르면, GAPDH의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머를 더 포함할 수 있으며, 보다 바람직하게는 상기 프라이머는 서열번호 4 및 5로 구성되는 프라이머쌍을 포함할 수 있다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 상기 결핵 진단용 조성물을 포함하는 결핵 진단용 키트 및 이를 포함하는 RT-PCR 키트을 제공한다.
본 발명의 바람직한 또 다른 일 실시예에 따르면, 결핵의 진단을 위하여 IFN-γ를 증폭할 수 있는 서열번호 1 및 2 또는 서열번호 7 및 8로 구성되는 프라이머쌍; 상기 증폭된 IFN-γ에 결합할 수 있는 서열번호 3 또는 9로 표시되는 형광이 표지된 프로브, IFN-γ의 발현량과 대비하기 위한 GAPDH를 증폭할 수 있는 서열번호 4 및 5로 구성되는 프라이머 쌍 및 상기 증폭된 GAPDH에 결합할 수 있는 서열번호 6으로 표시되는 형광이 표지된 프로브를 포함하는 결핵 진단용 조성물을 제공한다
이하, 본 발명에 사용된 용어를 설명한다.
용어 "진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로서 결핵의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.
용어 "실시간 역전사 효소 증폭법을 이용한 결핵 진단을 위한 정보제공방법"은 진단을 위한 예비적 단계로서 결핵의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다.
용어 "프라이머"는 짧은 자유 3말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다. 본 발명의 프라이머는, 각 마커 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산이다. 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.
용어 "프로브"는 단일쇄 핵산 분자이며, 타깃 핵산 서열에 상보적인 서열을 포함한다.
용어 mRNA 발현수준 측정이란 결핵을 진단하기 위한 정보를 제공하기 위하여 생물학적 시료에서 mRNA 존재 여부와 발현 정도를 확인하는 과정으로 mRNA의 양을 측정한다.
용어 "역전사 중합효소 반응(RT-PCR)"이라 함은 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template) 으로하여 증폭해 내는 분자생물학적 중합방법이다.
용어 "실시간 역전사 중합효소 반응(realtime RT-PCR)"이라 함은 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template) 으로하여 타겟 프라이머와 표지를 포함하는 타겟 프로브를 이용해 타겟을 증폭함과 동시에 증폭된 타겟에 타겟 프로프의 표지에서 발생하는 신호를 정량적으로 검출해 내는 분자생물학적 중합방법이다.
종래의 IFN-γ 단백질을 검사하는 IGRA 방법은 최소 3㎖ 이상의 혈액을 요구하므로 주사기를 통해 채혈하여야 하지만, 본 발명에서는 1㎖(바람직하게는 0.5㎖ 이하)의 매우 적은 혈액만으로도 결핵검사가 가능하므로 주사기가 아닌 사혈침 등을 환자에게 찌른 후 검출되는 소량의 혈액만으로 검사가 가능하여 주사기의 부담을 현저하게 저감할 수 있다.
또한 기존의 방법(16~24시간)에 비해 줄어든 항원처리 시간(4시간 이내)으로 인해 기존 총 검사 시간을 줄일 수 있으므로, 보다 빠르게 결핵 환자를 판별해낼 수 있다.
또한, 전기영동과 EtBr염색과정이 필요 없으므로, 기존 총 검사 시간을 줄일 수 있으므로, 보다 빠르게 결핵 환자를 판별해낼 수 있다. 또한 증폭된 산물에 표지된 프로브에 의해 나오는 신호를 기계가 민감하게 읽어냄으로써, 기존 검사에 비해 보다 민감도가 좋은 검사가 될 수 있다.
나아가, 추가로 형광 등이 표지된 프로브를 사용함으로써, 프라이머쌍에 의해 증폭된 부위의 내부에 또 다른 표지 프로브가 결합할 수 있으므로, 타겟에 대한 보다 높은 특이도를 가질 수 있다.
도 1은 본 발명의 바람직한 일실시예에 따른 결핵의 진단을 위한 정보제공방법을 나타내는 모식도이다.
도 2는 본 발명의 바람직한 일실시예에 따른 RT-PCR을 수행하기 위한 결핵균 특이항원이 포함된 튜브이다.
도 3 및 도 4는 혈액샘플에 대하여 종래의 QuatiFERON(IFN-γELISA) 검사결과와 본 발명의 바람직한 일실시예에 따른 비교결과를 나타낸 표이다.
도 5는 결핵균 특이 항원과 혈액의 반응시간에 따라 본 발명의 바람직한 일실시예에 따른 RT-PCR을 수행한 전기영동 사진이다.
도 6은 혈액을 극소량을 투입하고 본 발명의 바람직한 일실시예에 따른 RT-PCR을 수행한 전기영동 사진이다.
도 7은 본 발명의 바람직한 일실시예에 따른 결핵의 진단을 위한 실시간 역전사 효소 증폭법의 정보제공방법을 나타내는 흐름도이다.
도 8 ~ 12는 결핵환자 5명의 혈액을 이용해 본 발명의 realtime RT-PCR을 수행한 결과이다.
도 13 ~ 17은 결핵이 아닌 사람 5명의 혈액을 이용해 본 발명의 realtime RT-PCR을 수행한 결과이다.
도 18은 기존의 IFN-γ ELISA(상업킷트), RT-PCR 그리고 병원검사결과 양성과 음성이 나온 결핵환자의 혈액을 가지고 실험을 수행한 결과이다.
도 19 및 20은 동일한 검체와 조건으로 실시예 4의 (1)번 IFN-γ 프라이머 및 프로브 쌍과 (2)번의 프라이머 및 프로브 쌍의 조합에 의한 RT-PCR과 실시예 4의 IFN-γ (3)번 프라이머 및 프로브 쌍과 (2)번의 프라이머 및 프로브 쌍의 조합에 의한 RT-PCR를 수행하여 그 결과를 비교한 것이다.
도 19 및 20에서 좌측의 그래프는 실시예 4의 (1)번 IFN-γ 프라이머 및 프로브 쌍을 이용했을때의 결과이며, 우측의 그래프는 실시예 4의 IFN-γ (3)번 프라이머 및 프로브 쌍을 이용했을 때의 결과이다.
그 결과를 보면 실시예 4의 IFN-γ (3)번 primer와 probe를 사용했을 때 형광의 강도를 나타내는 delta Rn의 값이 현저하게 상승함을 볼 수 있다. 따라서 형광을 읽는 detector가 보다 정확하게 형광값을 읽어 수치화 할 수 있으므로, 발현량이 적은 검체의 경우 실시예 4의 IFN-γ (3)번 primer와 probe를 이용할 경우 보다 민감하고 정확한 결과를 제공할 수 있을 것이다.
이하, 본 발명을 보다 상세히 설명한다.
상술한 바와 같이 종래의 결핵의 진단을 위한 IGRA 검사는 요구되는 혈액량이 많고 검사시간이 최소 24시간 이상 소요될 뿐 아니라 제조된 키트의 가격이 현저하게 비싸 널리 활용되기 어려운 문제가 있었다.
이에 본 발명에서는 a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계, b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계, c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계, d) 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 프라이머 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 프라이머를 이용하여 RT-PCR을 수행하는 단계, 및 e) 상기 증폭된 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계를 포함하는 결핵의 진단을 위한 정보제공방법을 제공하여 상술한 문제의 해결을 모색하였다.
본 발명의 다른 실시예에서는,a) 결핵 의심환자의 혈액을 채취하여 결핵균 특이항원을 처리하는 단계; b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계; c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계; d) 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하는 단계; 및 e) 상기 증폭된 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계를 포함하는 결핵의 진단을 위한 정보제공방법을 제공하여 상술한 문제의 해결을 모색하였다.
특히 IFN-γ을 단백질 발현수준이 아닌 mRNA 발현수준에서 정량적으로 분석하기 때문에 결핵검사 시 요구되는 혈액량, 검사시간 및 검사비용을 현저하게 저감할 수 있다.
먼저, 상기 a) 단계를 위한 예비단계로서 결핵 의심환자의 혈액을 채혈할 수 있다. 종래의 IGRA 검사에서는 필요로하는 최소한의 혈액량이 3㎖ 이상이며 이 정도의 혈액을 채혈하기 위해서는 주사기를 통해 결핵 의심환자로부터 혈액을 채취하여야만 하였다. 상술한 채혈의 어려움으로 인하여 노인, 어린아이 및 여성들이 결핵검사를 받기 어려운 문제가 있었다. 그러나, 본 발명의 한 특징에 따르면 요구되는 혈액량이 1㎖ 이하로서 바람직하게는 0.3 ~ 0.5㎖를 통해 결핵여부를 판단할 수 있는 정보를 제공할 수 있으므로, 주사기가 아닌 사혈침 등을 통한 방법으로 간편하게 채혈할 수 있어 채혈의 심리적 부담감을 상당부분 해소할 수 있다. 한편, 본 발명에 사용되는 혈액은 바람직하게는 전혈일 수 있다.
다음, a) 단계로서 상기 채혈된 결핵 의심환자의 혈액에 결핵균 특이항원을 처리한다. 이는 결핵균 특이항원에 반응한 T 세포가 분비하는 IFN-γ의 mRNA 발현수준을 통해 결핵을 판단하는 정보를 제공하기 위한 것으로서, 본 발명에서는 IFN-γ의 단백질의 발현수준의 정량이 아닌 IFN-γ의 mRNA 발현수준의 정량을 통해 결핵을 진단하기 위한 정보를 제공한다. 그러므로, 상기 a) 단계에서 사용될 수 있는 결핵균 특이항원은 통상적으로 IGRA 검사에 사용될 수 있는 것으로서, 결핵균에만 특이하게 존재하며, 숙주에서 면역반응을 유도한다고 알려진 통상의 결핵균 특이항원은 모두 사용될 수 있다. 바람직하게는 결핵균 특이항원으로서 ESAT-6(NCBI ACCESSION NO : YP_178023), CFP-10(NCBI ACCESSION NO : NP_218391) 및 TB7.7(NCBI ACCESSION NO : NP_217171)를 약 4시간 이내로 단독 또는 혼합하여 처리할 수 있다.
한편, 환자들에게 채혈 후 곧바로 전장 RNA를 분리하지 않고 상기 결핵균 특이항원을 처리하여야 하는데 이는 결핵에 노출된 환자의 경우 기억 T 세포에서 결핵에대한 정보를 가지고 있기 때문에 결핵에 노출된 환자의 혈액에 결핵항원을 처리해주면 정상인에 비해 T cell이 기억하고 있다가 면역반응을 강하게 나타내기 때문에 더욱 많은 IFN-γ를 발현해낼 수 있기 때문이다
다음, b) 단계 및 c) 단계로서 구체적으로 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA(Total RNA)를 분리하는 단계, c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계를 포함한다. 본 발명의 b), c) 단계는 RT-PCR 또는 실시간 RT-PCR 을 수행하기 위한 예비단계로서 일반적으로 사용되는 전장 RNA(Total RNA)를 분리하는 방법 및 이로부터 cDNA를 합성하는 방법은 공지된 방법을 통해 수행될 수 있으며, 이 과정에 대한 자세한 설명은 Joseph Sambrook 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); 및 Noonan, K. F. 등에 개시되어 있어 본 발명의 참조로서 삽입될 수 있다.
다음, d) 단계로서 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 프라이머 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 프라이머를 이용하여 RT-PCR을 수행한다.
본 발명에서 사용되는 realtime RT-PCR은 전기영동과 EtBr염색과정이 필요 없으므로, 기존 총 검사 시간을 줄일 수 있으므로, 보다 빠르게 결핵 환자를 판별해낼 수 있다. 또한 증폭된 산물에 표지된 프로브에 의해 나오는 신호를 기계가 민감하게 읽어 냄으로써, 기존 검사에 비해 보다 민감도가 좋은 검사가 될 수 있다. 나아가, 추가로 형광 등이 표지된 프로브를 사용함으로써, 프라이머쌍에 의해 증폭된 부위의 내부에 또 다른 표지 프로브가 결합할 수 있으므로, 타겟에 대한 보다 높은 특이도를 가질 수 있다.
realtime RT-PCR를 위하여, 본 발명에서는 d) 단계로서, 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하여 상술한 문제를 해결하였다.
본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, "캡화", 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속,철, 산화성 금속 등), 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열(IFN-γ, 대조군 유전자)은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광, 화학발광단 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 루오리신(fluorescein), 피코에리트린 (phycoerythrin), 로다민, 리사민 (lissamine) Cy-5 또는 Cy-3일 수 있다. 표적 서열의 증폭시 프라이머의 5'-말단 및/또는 3' 말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다.
또한, 방사성 물질을 이용한 표지는 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 이용할 수 있다.
표지는 당업계에서 통상적으로 실시되는 다양한 방법, 예컨대, 닉 트랜스레이션 (nick translation) 방법, 무작위 프라이밍 방법 (Multiprime DNA labelling systems booklet, "Amersham"(1989)) 및 카이네이션 방법 (Maxam & Gilbert, Methods in Enzymology, 65:499(1986))을 통해 실시될 수 있다. 표지는 형광, 방사능, 발색 측정, 중량 측정, X-선 회절 또는 흡수, 자기, 효소적 활성, 매스 분석, 결합 친화도, 혼성화 고주파, 나노크리스탈에 의하여 검출할 수 있는 시그널을 제공한다.
본 발명의 한 측면에 따르면, IFN-γ는 결핵균 특이항원에 의해 자극된 T세포가 분비하는 단백질로서 본 발명에서는 RT-PCR을 통해 이를 단백질이 아닌 mRNA 수준에서 발현수준을 측정하게 된다. 이를 위하여 상기 IFN-γ 유전자에 특이적으로 결합하는 프라이머가 요구되며, 본 발명에서는 전방 프라이머로서 [5' TGCAGGTCATTCAGATGTAGCGGATA 3'(서열번호 1)] 또는 5'tgaatgtccaacgcaaagca3'(서열번호 7) 그리고, 후방 프라이머로서 [5' TCATGTATTGCTTTGCGTTGGACA 3'(서열번호 2)] 또는 5'cgacctcgaaacagcatctga3'(서열번호 8)인 신규한 프라이머쌍을 사용할 수 있다.
IFN-γ의 증폭부위에 결합하는 형광표지 프로브로서 [5'-FAM-TGGAGACCATCAAGGAAGACATGA-Quen-3'(서열번호 3)] 또는 5'cgccagcagctaaaacagggaagcg3' (서열번호 9)을 사용할 수 있으나 이에 제한되는 것은 아니며, IFN-γ에 특이적으로 결합하여 검출가능한 시그널을 제공하여 real-time RT-PCR을 수행할 수 있는 것이면, 제한 없이 사용될 수 있다. 상기에서 FAM과 Quen(Quencher)는 형광염료를 의미한다
본 발명의 다른 측면에 따르면, IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 프라이머를 이용하여 RT-PCR을 수행할 수 있다. 이 때 본 발명에 적용될 수 있는 대조군 유전자는 IFN-γ의 발현수준을 상대적으로 판단하기 위하여 기준이 되는 유전자로서, 본 발명에서는 상기 대조군 유전자의 일례로서 GAPDH 유전자(NCBI ACCESSION NO : NM_002046)를 사용하여 RT-PCR을 수행하여 mRNA를 발현시킬 수 있다. GAPDH 유전자는 housekeeping gene으로써 일반적으로 인체의 세포내에서 최소한의 기능을 유지하기위해 일정한 양이 지속적으로 발현이 되고 있는 유전자로써, GAPDH 외에도 많은 유전자들이 존재하지만 정량적인 RT-PCR 또는 실시간 RT-PCR 분석에서는 GAPDH가 가장 많이 사용되고 있다. 그러므로 이에 제한되는 것은 아니며, IFN-γ의 발현수준을 상대적으로 판단하기 위하여 기준이 될 수 있는 유전자는 본 발명에 적용될 수 있다. 한편 본 발명에서는 대조 유전자로서 GAPDH 유전자를 사용하였으므로 상기 유전자에 특이적으로 결합할 수 있는 프라이머가 요구되며, 본 발명에서는 전방 프라이머로서 [5' CGGGAAGCTTGTGATCAATGG 3'(서열번호 4)] 및 후방 프라이머로서 [5' GGCAGTGATGGCATGGACTG 3'(서열번호 5)]인 신규한 프라이머쌍 그리고 형광표지 프로브로서 [5'-FAM-ACTGGCGTCTTCACCACCAT-Quen-3'(서열번호 6)] 을 사용할 수 있다.
본 발명에 적용되는 RT-PCR 방법은 당업계에서 통상적으로 사용되는 공지의 과정을 통해 수행될 수 있다.
다음, e) 단계로서 상기 증폭된 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정한다. 본 단계는 IFN-γ의 mRNA 및 대조군 유전자의 mRNA의 발현수준을 상대적으로 측정하기 위한 것으로서, 통상의 mRNA 발현수준을 측정할 수 있는 방법이면 제한없이 사용될 수 있으나, 바람직하게는 상기 RT-PCR을 통해 증폭된 PCR 산물을 전기영동하여 농도계(Densitometer)를 통해 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA의 발현수준을 측정하거나 전기영동하여 밴드 패턴과 밴드의 두께를 확인하는 것을 통해 FN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA의 발현수준을 측정할 수 있다.
본 발명의 다른 구현예에 있어서, e)단계는 사용한 프로브 표지의 종류에 따라 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 real-time RT-PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 real-time RT-PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
본 발명의 바람직한 일구현예에 따르면, 상기 realtime RT-PCR을 통해 증폭된 PCR 산물에 형광이 표지된 프로브가 붙어 특정 파장의 형광을 내게 되고, 증폭과 동시에 realtime PCR 장치의 형광 측정기에서 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA의 발현수준을 실시간으로 측정하고, 측정된 값이 계산되어 PC를 통해 시각화 되게 되어 검사자는 쉽게 그 발현정도를 확인할 수 있다.
다시 말해, 각각의 혈액 샘플(시료)마다 IFN-γ와 GAPDH mRNA의 발현량을 계산하고, IFN-γ의 mRNA 발현양이 GAPDH의 mRNA 발현양에 비해 얼마나 증가했고 감소하였는지의 정도를 배수로 몇배가 증가하고 감소하였는지 상대적으로 정량하는 방법을 통해 결핵환자임을 판별할 수 있는 정보를 제공할 수 있는 것이다.
본 발명의 다른 측면에 따르면 인간 IFN-γ 유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머를 포함하는 결핵 진단용 조성물을 포함한다. 구체적인 일 양태로서, 상기 진단 키트는 역전사 중합효소반응을 수행하기 위해 필요한 필수 요소를 포함하는 것을 특징으로 하는 결핵 진단용 키트일 수 있다. 역전사 중합효소반응 키트는 상기 인간 IFN-γ 유전자에 대한 특이적인 각각의 프라이머 쌍을 포함할 수 있다. 프라이머는 각 마커 유전자의 핵산서열에 특이적인 서열을 가지는 뉴클레오타이드로서, 약 7 bp 내지 50 bp의 길이, 보다 바람직하게는 약 10 bp 내지 30 bp 의 길이일 수 있으며 보다 바람직하게는 서열번호 1 및 2로 표시되는 신규한 프라이머 쌍 또는 서열번호 1 및 2 또는 서열번호 7 및 8로 표시되는 신규한 프라이머 쌍 및 서열번호 3 또는 서열번호 9로 표시되는 형광표지된 프로브를 포함할 수 있다.
또한 대조군 유전자의 핵산 서열에 특이적인 프라이머를 포함할 수 있으며, 바람직하게는 GAPDH의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머를 더 포함할 수 있으며, 보다 바람직하게는 상기 프라이머는 서열번호 4 및 5 또는 상기 신규한 프라이머 쌍 및 서열번호 6으로 표시되는 형광표지된 프로브를 포함할 수 있다.
그 외 역전사 중합효소반응 키트는 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNAse, RNAse 억제제 DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.
결국, 종래의 IFN-γ 단백질을 검사하는 IGRA 방법은 최소 3㎖ 이상의 혈액을 요구하므로 주사기를 통해 채혈하여야 하지만, 본 발명에서는 1㎖(바람직하게는 0.5㎖ 이하)의 매우 적은 혈액만으로도 결핵검사가 가능하므로 주사기가 아닌 사혈침 등을 환자에게 찌른 후 검출되는 소량의 혈액만으로 검사가 가능하여 주사기의 부담을 현저하게 저감할 수 있다. 또한 기존의 방법(16~24시간)에 비해 줄어든 항원처리 시간(4시간 이내)으로 인해 기존 총 검사 시간을 줄일 수 있으므로, 보다 빠르게 결핵 환자를 판별해낼 수 있다.
이하 실시예를 통하여 본 발명의 구성을 보다 구체적으로 설명하지만, 본 발명의 범위가 하기 실시예의 내용으로 한정되는 것은 아니다.
실시예 1: 환자의 혈액(whole blood)에 결핵균 특이항원 처리
환자로부터 혈액을 채혈한 후, IGRA검사에 사용되는 항원이 포함된 튜브를 호주의 Cellestis 사에서 수입하여 각 3개의 튜브에 혈액을 1 ml을 넣었다(도 2). Nil tube는 아무런 항원을 포함하지 않는 튜브로써 IGRA검사에서 음성대조군으로 사용된다. TB antigen 튜브는 결핵균에만 특이하게 존재하면서 숙주에서 면역반응을 유도한다고 알려진 3가지항원 ESAT-6, CFP-10, TB7.7이 포함된 튜브이다. TB mitogen 튜브는 mitogen 작용을 하는 phytohaemagglutinin(PHA)이 포함된 튜브로써 IGRA검사에서 양성대조로 사용하였다.
본 발명에서는 IGRA검사의 단점을 보완하기 위해서 본 단계에서 항원처리 시간 및 혈액량을 다음과 같이 감소시켰다.
1) 항원처리시간 : 12시간, 8시간, 4시간, 2시간, 1시간, 30분
2) 혈액량 : 1 ml, 0.3 ml
실시예 2: 항원 처리된 혈액으로부터 total RNA의 분리
실시예 1에서 항원처리가 끝난 혈액을 약 5배의 RBC lysis buffer에 넣고 RBC를 모두 제거해준 후 남아있는 WBC로부터 QIAamp Blood RNA Mini kit (Qiagen)와 Easy-spin total RNA extraction kit (Intron)를 사용하여 total RNA를 분리하였다.
실시예 3: 분리된 total RNA로부터 상보적인 cDNA의 합성
분리된 total RNA 9 ㎕, random primer(Invitrogen) 0.25ug, dNTP(Cosmo gene tech) 250uM, Tris-HCl(pH 8.3) 50mM, KCl 75mM, MgCl2 3mM, DTT 8mM 와 MMLV 역전사 중합효소 200units(Invitrogen)을 첨가하고 최종부피를 25 ul가 되도록 DEPC treated DW를 넣고 교반하였다. 그 뒤 cDNA 합성 반응액을 thermocycler(ABI)에서 25℃에서 10 분, 37℃에서 50 분, 70℃에서 15 분간 반응시켜 cDNA를 합성하였다.
실시예 4: 합성된 cDNA를 주형으로 하여 IFN-γ 및 GAPDH 증폭
4-1: RT - PCR ;
RT-PCR 반응물의 조성은 KCl 50 mM, Tris-HCl 10 mM(pH8.3), MgCl2 1.5 mM, 젤라틴 0.001%(w/v), 250 uM dNTP, 1 unit Tag DNA중합효소(Solgent)와 각각의 전방 프라이머와 후방 프라이머 10 pmole이다. 여기에 합성된 cDNA 2 ㎕를 넣고 최종부피가 20 ㎕가 되도록 하였다. 첨가된 각각의 프라이머의 염기서열은 다음과 같다.
(1) IFN-γ primer(증폭산물의 크기-287bp)
Forward - 5' TGCAGGTCATTCAGATGTAGCGGATA 3'(서열번호 1)
Reverse - 5' TCATGTATTGCTTTGCGTTGGACA 3'(서열번호 2)
(2) GAPDH primer(증폭산물의 크기-357bp)
Forward - 5' CGGGAAGCTTGTGATCAATGG 3'(서열번호 4)
Reverse - 5' GGCAGTGATGGCATGGACTG 3'(서열번호 5)
RT-PCR 반응(Applied Biosystems(GeneAmp PCR System 2700), MJ Research Inc.(PTC-100))은 변성 온도 95℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 55℃에서 30초, 연장(elongation) 온도 72℃에서 30초인 사이클을 35회 반복하고 마지막으로 최종 연장 반응을 72℃에서 10분간 수행하였다.
4-2: 실시간 RT - PCR ;
RT-PCR 반응물의 조성은 KCl 50 mM, Tris-HCl 10 mM(pH8.3), MgCl2 1.5 mM, 젤라틴 0.001%(w/v), 250 uM dNTP, 1 unit Tag DNA중합효소(Solgent)와 각각의 전방 프라이머와 후방 프라이머 10 pmole이다. 덧붙여 형광 프로브가 표지된 올리고 프로브를 5pmole이 되게 첨가해준다. 여기에 합성된 cDNA 3 ㎕를 넣고 최종부피가 20 ㎕가 되도록 하였다. 첨가된 각각의 프라이머의 염기서열은 다음과 같다.
상기 실시간 RT-PCR은 하기 (1)과 (2)의 조합 또는 하기 (2)와 (3)의 조합에 의하여 수행되었다.
(1) IFN-γ primer(증폭산물의 크기-140bp)
Forward - 5' TGCAGGTCATTCAGATGTAGCGGATA 3'(서열번호 1)
Reverse - 5' TCATGTATTGCTTTGCGTTGGACA 3'(서열번호 2)
Probe - 5' FAM-TGGAGACCATCAAGGAAGACATGA-Quen 3' (서열번호 3)
(2) GAPDH primer(증폭산물의 크기-91bp)
Forward - 5' CGGGAAGCTTGTGATCAATGG 3'(서열번호 4)
Reverse - 5' GGCAGTGATGGCATGGACTG 3'(서열번호 5)
Probe - 5' FAM-ACTGGCGTCTTCACCACCAT-Quen 3' (서열번호 6)
(3) 다른 IFN-γ primer 및 프로브(-110bp)
IFN-γ Forward - 5'tgaatgtccaacgcaaagca3'(서열번호 7)
IFN-γ Reverse - 5'cgacctcgaaacagcatctga3'(서열번호 8)
Probe - 5' FAM-cgccagcagctaaaacagggaagcg-Quen 3' (서열번호 9)
Real-time RT-PCR 반응 (MJ opticon real time PCR system, Bio Rad)은 변성 온도 95℃에서 5분 동안 1회 수행하고, 변성 온도 95℃에서 30초, 어닐링 온도 60℃에서 30초인 사이클을 40회 반복 수행하였다.
실시예 5: 전기영동을 통한 증폭여부 확인 및 증폭된 산물의 정량
5-1: RT - PCR
RT-PCR이 끝난 후, 5 ㎕의 PCR산물을 취하여 2% 아가로스 겔 전기영동을 행함으로써 IFN-γ와 GAPDH PCR 산물의 증폭을 확인하였다. 그리고 전기영동의 결과를 densitometer를 통해 IFN-γ mRNA가 발현되었는지를 정량하였으며 비교정량을 위해 항상 일정하게 발현되는 house keeping gene인 GAPDH mRNA의 발현량으로 normalization 하였다.
한편 본 발명의 실시예에서 사용되는 세 가지 튜브인 TB mitogen튜브, TB antigen 튜브, Nil튜브로부터 IFN-γ 와 GAPDH의 값을 정량하고 하기 관계식 1을 통해 결핵균 감염을 진단하였다.
[관계식 1]
(TB antigen튜브의 IFN-γ 발현 값 - 동일한 튜브의 GAPDH 발현 값) / (Nil 튜브의 IFN-γ 발현 값 - 동일한 튜브의 GAPDH 발현 값)
상기 관계식 1에 대입해 얻은 TB Ag/Nil 값이 1.5 이상이면 결핵양성, 1.5 이하이면 결핵음성으로 판정할 수 있다. 또한 positive control인 TB mitogen 튜브의 값과 negative control인 Nil 튜브 값의 차이를 고려하여 확 실한 음성의 여부를 결정짓게 된다. 상기 관계식 1 및 그에 따른 결핵 감염의 판정은 일반적인 IGRA검사의 기준을 따랐다.
5-2:실시간 RT - PCR
Realtime RT-PCR이 끝난 후, Opticon monitor 3(Bio Rad) 시스템을 통해 산물의 증폭을 확인하였다. 그리고 PCR효율 및 cT값을 통해 결과를 분석 및 정량하였다.
한편 본 발명의 실시예에서 사용되는 세 가지 튜브인 TB mitogen튜브, TB antigen 튜브, Nil튜브로부터의 cT 값을 확인하였다.
[관계식 1]
주로 유전자 발현양을 분석하는 예로 비교 정량법 중 하나인 △Ct 법을 사용하게 되는데 관계식은 아래와 같다.
△Ct TB 또는 Mitogen = TB 또는 Mitogen의 IFN-γ Ct 값 - TB 또는 Mitogen의 reference gene Ct 값
△Ct Nil = Nil control의 IFN-γ Ct 값 - Nil conrol 의 reference gene Ct 값
R = △Ct TB 또는 Mitogen - △Ct Nil
<평가예 1> 항원 처리된 혈액으로부터 분리된 IFN-γ mRNA 정량을 통한 결핵진단법의 가능성 평가
신촌 세브란스병원으로부터 약 16개의 임상검체와 QuatiFERON(IFN-γELISA)검사결과를 제공받아 기존의 IFN-γ 단백질을 검사하는 IGRA검사에서 쓰이는 동일한 조건(3 ml 혈액과, 16시간의 항원처리)으로 결핵 특이항원을 처리하여 본 발명의 RT-PCR based IGRA assay를 수행하고 그 결과를 비교하였다(도 3, 도 4).
구체적으로 도 3은 상업적 킷트로 판매되고 있는 QuatiFERON이라는 상품으로 검사하고 그 결과가 결핵양성으로 나온 환자 검체를 기존의 IGRA검사와 동일한 조건으로 결핵특이항원을 처리하고 본 발명의 RT-PCR based IGRA assay를 수행하여 그 결과를 비교한 표이다. 그 결과, 기존의 상업적 킷트와 비교했을 때, 본 발명의 RT-PCR based IGRA assay 가 기존의 상업적 킷트와 동일한 검사 결과를 나타내는 것을 확인할 수 있다.
도 4는 상업적 킷트로 판매되고 있는 QuatiFERON이라는 상품으로 검사한 결과, 결핵음성 및 해석 불가능한 결과를 나타낸 환자 검체를 기존의 IGRA검사와 동일한 조건으로 항원처리한 후, 본 발명의 RT-PCR based IGRA assay를 수행하여 그 결과를 비교한 표이다. 그 결과, 기존의 상업적 킷트에서 해석 불가능한 결과가 나왔던 검체에서 각각 양성과, 음성이 하나씩 나왔고, 나머지 결핵음성 검체는 모두 동일하게 음성이 나왔음을 알 수 있다.
도 3 및 도 4에서 알 수 있듯이 기존의 단백질을 검사하는 IGRA검사와 동일한 조건(3 ml 혈액과, 16시간의 항원처리)에서 항원처리한 후, RT-PCR based IGRA assay를 수행함으로써 IFN-γ mRNA 정량을 통한 결핵진단법의 가능성 평가해본 결과, 본 발명의 RT-PCR을 이용한 IFN-γ mRNA정량을 통한 결핵 정보제공방법이 유의성이 있음을 확인할 수 있다.
또한 실시간 RT-PCR을 수행한 평가 결과는 아래와 같다.
연세대학교 원주기독병원으로부터 약 40개의 임상검체와 QuatiFERON(IFN-γELISA)검사결과를 제공받고 본 연구실에서 기존의 RT-PCR based IGRA를 통해 확인된 환자의 혈액(1ml)에 결핵 특이항원을 처리하여 본 발명의 Real time RT-PCR based IGRA assay를 수행하고 그 결과를 비교하였다(도 8 내지 도 17).
도 8 내지 12는 결핵환자의 혈액을 이용해 새로이 개발된 realtime RT-PCR을 수행한 결과이다. 각각의 그래프는 IFN-γ mRNA의 증폭에 따른 Ct 값을 나타내며, 그래프가 상승하는 지점부터 타겟의 발현양이 증가함을 보여주며 그 지점의 값이 Ct값인 것이다. 따라서 Ct 값이 낮을수록 적은 싸이클을 수행하였을 때도 발현양이 증가하였음을 보여주므로, 낮은 Ct값은 보다 높은 유전자의 발현양을 나타낸다.아래의 각각 그래프는 결핵환자 한명 한명의 결과를 나타내며, 그래프 내에서 두 라인이 존재한다. 앞에 있는 라인은 결핵균 항원을 처리했을 때의 Ct 값이고, 뒤에 있는라인은 결핵균 항원을 처리하지않은 nil control 의 값이다. 따라서 두 라인의 간격이 멀 수록, 즉 Ct 값의 차이가 클수록 결핵균 항원에 대한 반응이 많이 증가한것을 알 수 있기 때문에 결핵에 노출된 환자의 경우 두 Ct 값의 차이가 크고, 정상인의 경우 두 Ct 값의 차이가 작기 때문에 따라서 도 3에 있는 그래프들은 모두 결핵환자임을 알 수 있다.
도 13 내지 17은 결핵이 아닌 사람의 혈액을 이용해 새로이 개발된 realtime RT-PCR을 수행한 결과이다. 각각의 그래프에 있는 두 라인의 간격이 매우 좁은 것을 알 수있다. 이는 즉 앞, 뒤 두 라인의 Ct값의 차가 작을 수록 결핵항원에대한 IFN-γ mRNA의 발현이 증가하지 않음을 나타내므로, 도 13 내지 17에 존재하는 각각의 그래프는 정상인의 나타낸다. 도 8 내지 12에 있는 그래프 내에 존재하는 두 라인간의 간격에 비해 매우 좁은 그래프 양상을 보여줌을 알 수 있다.
표 1은 기존의 IFN-γ ELISA(상업킷트), RT-PCR 그리고 병원검사결과 양성과 음성이 나온 결핵환자의 혈액을 가지고 상기 도 8 내지 12 및 도 13 내지 17과 같이 실험을 수행하여 얻은 Ct값으로 ABI사의 7500 v2.04 software 를 이용하여 비교정량한 값 즉 위의 관계식에 따른 R값을 도 18에서 그래프로 보기 쉽게 수치화하였으며, patient의 경우 결핵환자에서의 결핵균 항원에 대한 IFN-γ mRNA의 발현양을 나타내며 그래프 상에서 높은 R값을 보여주며, non-TB의 경우 그래프 상에서 낮은 R값을 보여준다. R 값은 곧 IFN-γ의 발현양을 나타냄으로, R 값이 높게나온 좌측의 Patient군이 결핵 환자군임을 알 수 있다.
표 1
Sample Expression rate with ABI 7500 Expression rate with RT-PCR ELISA Nil
TB2 17.14 13.29, + positive 1
TB3 94.25 3.43, + positive 1
TB4 234.82 5.38, + positive 1
TB5 16.19 7.28, + positive 1
Normal1 1.82 0.53, - negative 1
Normal2 1.08 0.52, - negative 1
Normal3 6.95 0.85, - negative 1
Normal4 0.66 0.64, - negative 1
Normal5 1.65 0.75, - negative 1
상기 표 1에서 TB : 결핵환자, Normal : 결핵이 아닌 건강한 사람를 나타냄.
그 결과, 기존의 상업적 킷트와 비교했을 때, 본 발명의 Real time RT-PCR based IGRA assay 가 기존의 상업적 킷트 및 최근 개발된 분자생물학적 검사와 동일한 검사 결과를 나타내는 것을 확인할 수 있다.
RNA 정량을 통한 결핵진단법의 가능성 평가해본 결과, 본 발명의 Real time RT-PCR을 이용한 IFN-γ mRNA정량을 통한 결핵 정보제공방법이 유의성이 있음을 확인할 수 있다.
<평가예 2> 신속 검사법으로써의 RT-PCR based IGRA assay의 조건 확립
기존의 IFN-γ 단백질을 검사하는 IGRA검사의 경우 긴 결핵특이항원 처리시간 때문에 최종 검사결과를 얻는데 이틀의 시간이 소요되었다. 기존의 IGRA같은 경우 타겟이 IFN-γ 단백질 이지만, 본 발명에서는 IFN-γ mRNA가 타겟이기 때문에 보다 빠른 시간에 발현을 확인할 수 있을 것이라고 가설을 세우고 신속 RT-PCR based IGRA assay의 조건확립을 위해서 기존의 IGRA 검사와 동일한 양의 혈액(총 3 ml ; mitogen(M), TB Ag, Nil(N) tube 각각 1 ml 씩 사용됨)을 사용하여 결핵균 특이 항원과 혈액의 반응시간을 각각 4시간, 8시간, 12시간으로 변화시켜 RT-PCR based IGRA assay를 수행하였다(도 5).
그 결과, 새로 개발된 RT-PCR based assay의 경우 동일한 양의 혈액으로 짧은 시간동안 항원을 처리하였을 때 약 4시간의 항원처리만으로도 의미있는 검사 결과를 얻을 수 있었다.
도 5에서 M은 TB mitogen, TB는 TB Ag, N은 Nil을 나타내며, 시간별로 이런 항원들을 처리 안한것, 4시간처리, 8시간처리, 16시간처리를 한 뒤 RT-PCR을 수행한 결과이다. 결과를 보면 4시간의 항원처리에도 IFN-γ mRNA의 발현이 되는 것을 확인하였다. 이를 통해 기존의 IFN-γ ELISA를 수행할 때 16시간~24시간 걸리던 항원처리시간을 4시간 이내로 단축할 수 있음을 알 수 있다.
<평가예 3> 적은 양의 혈액을 이용하는 조건 수립
종래의 IFN-γ 단백질을 검사하는 IGRA검사의 경우, 검사를 수행하기 위해서는 3ml 혈액을 필요로 하였다. 그러나 소아와 노인과 같이 혈액채취가 어려운 환자는 3ml의 혈액을 채취하는 것이 어렵다는 단점이 있었다. 따라서 본 발명자들은 이러한 단점을 극복하고자 극소량의 혈액(0.3ml)으로 RT-PCR based IGRA assay를 수행하였다(도 6). 그 결과, 기존의 IGRA 검사에 필요한 혈액량보다 약 1/10정도 되는 소량의 혈액양으로 IFN-γ의 발현양을 확인할 수 있었으며, 의미있는 결과를 얻을 수 있었다.
도 6에서 M은 TB mitogen, TB는 TB Ag, N은 Nil을 나타내며, 도 5에서의결과를 기반으로 실제 결핵환자의 혈액 총 1ml(각 튜브별 0.3ml)을 이용하고 항원처리시간을 4시간(본발명의 조건)으로 앞당겨 실험을 수행하였다.
도 5와 도 6의 결과를 통해서 본 발명의 RT-PCR based IGRA assay는 소량의 혈액(0.3ml)과 짧은 항원처리시간(4시간)으로도 IFN-γ mRNA의 발현이 유도되며 이를 RT-PCR based IGRA assay를 통해 검출할 수 있음을 확인하였다.
본 발명의 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트는 매우 적은량의 혈액을 통해 짧은 시간내에 결핵을 진단할 수 있으므로 의료산업에 대단히 유용하다.

Claims (14)

  1. a) 결핵 의심환자의 혈액에 결핵균 특이항원을 처리하는 단계;
    b) 상기 결핵균 특이항원이 처리된 혈액에서 전장 RNA를 분리하는 단계;
    c) 상기 분리된 전장 RNA로부터 cDNA를 합성하는 단계;
    d) 상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 제 1 프라이머 쌍 및 IFN-γ의 발현량과 대비하기 위한 대조군 유전자를 증폭시킬 수 있는 제 2 프라이머 쌍을 이용하여 RT-PCR을 수행하는 단계; 및
    e) 상기 증폭된 IFN-γ의 mRNA 발현수준 및 대조군 유전자의 mRNA 발현수준을 측정하는 단계;를 포함하는 결핵의 진단을 위한 정보제공방법.
  2. 제1항에 있어서, 상기 d) 단계는
    상기 합성된 cDNA를 IFN-γ를 증폭할 수 있는 제1 프라이머 쌍, 증폭된 부위에 결합할 수 있는 제1 프로브 및 대조군 유전자를 증폭시킬 수 있는 제2 프라이머 쌍과 증폭된 대조군 유전자 부위에 결합할 수 있는 제2 프로브를 이용하여 realtime RT-PCR을 수행하는 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  3. 제1항에 있어서, 상기 a) 단계 이전에 결핵 의심환자의 혈액을 채혈하는 단계를 더 포함하는 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  4. 제1항에 있어서,상기 b) 단계의 결핵균 특이항원은 ESAT-6, CFP-10 및 TB7.7 중 어느 하나 이상인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  5. 제1항에 있어서,상기 대조군 유전자는 GAPDH인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  6. 제1항 또는 제2항에 있어서,
    상기 IFN-γ를 증폭할 수 있는 제 1 프라이머 쌍은 서열번호 1 및 2 또는 서열번호 7 및 8로 구성되는 프라이머쌍이고, 상기 대조군 유전자를 증폭할 수 있는 제 2 프라이머 쌍은 서열번호 3 및 4로 구성되는 프라이머 쌍인 것을 특징으로 하는 결핵의 진단을 위한 정보제공방법.
  7. 제1항에 있어서,상기 e) 단계 이후, 대조군 유전자의 mRNA 발현수준을 기준으로 IFN-γ의 mRNA 발현수준을 상대적으로 비교하는 단계를 더 포함하는 결핵의 진단을 위한 정보제공방법.
  8. 제 2항에 있어서,
    상기 제 1 프로브는 서열번호 3 또는 서열번호 9로 표시된 프로브이고, 제2 프로브는 서열번호 6으로 표시된 프로브인 결핵의 진단을 위한 정보제공방법.
  9. 인간 IFN-γ 유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머 쌍을 포함하는 결핵 진단용 조성물.
  10. 제 9항에 있어서, 상기 프라이머 쌍은 서열번호 1 및 2 또는 서열번호 7 및 8로 구성되는 프라이머 쌍을 포함하는 결핵 진단용 조성물.
  11. 제9항에 있어서, 상기 조성물은 대조유전자의 mRNA 발현수준을 측정하기 위하여 상기 유전자에 특이적으로 결합하는 프라이머 쌍을 더욱 포함하는 결핵 진단용 조성물.
  12. 제11항에 있어서, 상기 프라이머 쌍은 서열번호 3 및 4로 구성되는 프라이머쌍인 것을 특징으로 하는 결핵 진단용 조성물.
  13. 제9항에 있어서, 상기 조성물은 제 1 프로브 및 제 2 프로브를 더욱 포함하는 결핵 진단용 조성물.
  14. 제 13항에 있어서, 상기 제 1 프로브는 서열번호 3 또는 9로 표시된 프로브이고, 제2 프로브는 서열번호 6으로 표시된 프로브인 결핵 진단용 조성물.
PCT/KR2011/002499 2010-04-20 2011-04-08 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트 Ceased WO2011132872A2 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR1020100036177A KR20110116644A (ko) 2010-04-20 2010-04-20 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
KR10-2010-0036177 2010-04-20
KR20110021499 2011-03-10
KR10-2011-0021499 2011-03-10

Publications (3)

Publication Number Publication Date
WO2011132872A2 true WO2011132872A2 (ko) 2011-10-27
WO2011132872A3 WO2011132872A3 (ko) 2012-03-01
WO2011132872A9 WO2011132872A9 (ko) 2012-04-19

Family

ID=44834596

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/002499 Ceased WO2011132872A2 (ko) 2010-04-20 2011-04-08 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트

Country Status (1)

Country Link
WO (1) WO2011132872A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3710032A4 (en) * 2017-11-15 2021-12-15 The Translational Genomics Research Institute BIOMARKER PROXY TESTS AND PROCEDURES FOR STANDARD BLOOD ANALYSIS
US20230358749A1 (en) * 2022-05-06 2023-11-09 Diogene Co., Ltd. Early cancer diagnosis method and diagnostic kit using interferon gamma gene concentration measurement in exosomes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HARRINGTON, N. P. ET AL.: 'Development and evaluation of a real-time reverse transcription-PCR assay for quantification of gamma interferon mRNA to diagnose tuberculosis in multiple animal species' CLINICAL VACCINE IMMUNOLOGY. vol. 14, no. 12, 17 October 2007, pages 1563 - 1571 *
LISTVANOVA, S. ET AL.: 'Optimal kinetics for quantification of antigen-induced cytokines in human peripheral blood mononuclear cells by real-time PCR and by ELISA' JOURNAL OF IMMUNOLOGICAL METHODS. vol. 281, no. 1-2, 01 October 2003, pages 27 - 35 *
SARGENTINI, V. ET AL.: 'Cytometric detection of antigen-specific IFN-gamma/IL-2 secreting cells in the diagnosis of tuberculosis' BMC INFECTIOUS DISEASES. vol. 9, 23 June 2009, page 99 *
SAWYER, J. ET AL.: 'Development and evaluation of a test for tuberculosis in live European badgers (Meles meles) based on measurement of gamma interferon mRNA by real-time PCR' JOURNAL OF CLINICAL MICROBIOLOGY vol. 45, no. 8, 30 May 2007, pages 2398 - 2403 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3710032A4 (en) * 2017-11-15 2021-12-15 The Translational Genomics Research Institute BIOMARKER PROXY TESTS AND PROCEDURES FOR STANDARD BLOOD ANALYSIS
US20230358749A1 (en) * 2022-05-06 2023-11-09 Diogene Co., Ltd. Early cancer diagnosis method and diagnostic kit using interferon gamma gene concentration measurement in exosomes

Also Published As

Publication number Publication date
WO2011132872A9 (ko) 2012-04-19
WO2011132872A3 (ko) 2012-03-01

Similar Documents

Publication Publication Date Title
Menounos et al. Direct detection of Blastocystis sp. in human faecal samples and subtype assignment using single strand conformational polymorphism and sequencing
AU2011227110B2 (en) Methods, kits and compositions for detection of MRSA
Koltas et al. A comparative analysis of different molecular targets using PCR for diagnosis of old world leishmaniasis
CN112941210A (zh) 结核分枝杆菌利福平和异烟肼耐药突变检测试剂盒及方法
WO2010102460A1 (zh) 定性定量检测病原微生物遗传物质的方法及其试剂盒
WO2011025262A2 (ko) 결핵균군 및 마이코박테리아 속 구분 검출용 조성물 및 이를 이용한 실시간 다중 중합효소 연쇄반응에 의한 결핵균 및 마이코박테리아 속의 동시 분석 방법
CN108048584A (zh) Raa荧光法检测布鲁氏杆菌的探针及试剂盒
WO2014010806A1 (ko) 아이피-10 엠 알엔에이 표적 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
WO2012161385A1 (ko) 실시간 중합반응을 이용한 암의 진단을 위한 정보제공방법 및 이를 위한 암 진단용 키트
KR102274011B1 (ko) 결핵균 및 비결핵항산균을 동시에 감별하여 검출할 수 있는 고감도 다중 등온증폭반응용 프라이머 세트
WO2021066464A2 (ko) 핵산 검출 시스템
KR101336862B1 (ko) 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
WO2021141179A1 (ko) 뎅기 바이러스의 4종류 혈청형 동시 검출용 올리고뉴클레오티드 및 플라스미드와 이를 이용한 뎅기 바이러스 혈청형 분석 방법
WO2011132872A2 (ko) 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
CN117305521B (zh) 一种基于mira检测样品中单纯疱疹病毒的试剂盒及其用途
WO2023128429A1 (ko) 대장암 및 진행 선종의 선별 검사 방법 및 그 응용
WO2006121134A1 (ja) マイコバクテリウム・カンサシ検出用プライマー及びプローブ、並びにこれを用いたマイコバクテリウム・カンサシの検出方法
KR20110116644A (ko) 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
WO2005030027A2 (en) Salmonella detection identification
WO2011142646A9 (ko) 인유두종바이러스 검출 및 유전형 확인 방법
JP2023020631A (ja) 全身性エリテマトーデスを検査する方法
JP2022025456A (ja) 多発性硬化症を検査する方法
KR20220040834A (ko) 분자 비콘 프로브를 포함하는 covid-19 진단 멀티플렉스 lamp 조성물
WO2020171604A1 (ko) Ganoderma 속 미생물 검출 및 뿌리 썩음병 진단을 위한 조성물 및 이를 이용한 방법
CN102776275B (zh) 一种用于结核杆菌目视检测引物组及其试剂盒

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11772161

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11772161

Country of ref document: EP

Kind code of ref document: A2