Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/62—DNA sequences coding for fusion proteins
  • C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/04—Antibacterial agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
  • A61P37/02—Immunomodulators
  • A61P37/04—Immunostimulants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

• the invention relates to chimeric polynucleotides and polypeptides for the secretion of a polypeptide of interest in association with exosomes, and their use in particular for the production of immunogenic compositions based on chimeric polypeptides, DNA or exosomes, for the screening of protein interactions, or for the transport of proteins or nucleic acids.
• the present invention provides a chimeric polypeptide capable of being secreted in association with exosomes when expressed in appropriate eukaryotic cells, wherein said chimeric polypeptide comprises a plurality of polypeptide domains.
• the invention also relates to a membrane vesicle, in particular an exosome, which comprises a polypeptide of the invention, an immunogenic composition based on such exosomes and a process for producing such exosomes.
• the subject of the invention is also a polynucleotide encoding a polypeptide of the invention and an immunogenic composition comprising it, in particular a DNA vaccine comprising it.
• the present invention also relates to the use of the properties of membrane vesicles and immunogenic compositions of the invention for the prophylaxis and / or treatment of an infection with a pathogen, a pathogenic organism, a tumor antigen or a cytoplasmic antigen. , in particular for eliciting or promoting in vivo, in a host (human or non-human), a humoral and / or cellular response against a virus, a bacterium, a parasite or a tumor.
• the present invention further relates to the use of exosomes comprising a polypeptide of the invention as a diagnostic tool.
• the present invention also relates to the use of the properties of membrane vesicles and protein compositions of the invention for the prophylaxis and / or treatment of a disease due to a functional or metabolic, in particular for transporting a protein or a nucleic acid, in particular for compensating for or supplementing enzyme deficiency, or in particular for inducing a transcriptional or translational modification in the targeted cells or organs, or for modifying cellular metabolism.
• the present invention is also directed to the use of membrane vesicles of the invention to produce antibodies directed against the peptide or polypeptide of interest.
• the present invention also relates to the use of membrane vesicles of the invention to study interactions between proteins and to study molecules interacting with proteins of interest.
• Exosomes are in the form of small spheres bounded by a lipid bilayer. These membrane vesicles are naturally secreted by different types of cells, in particular by the epithelial cells, tumor cells and certain cells of the immune system (mast cells, T and B lymphocytes, dendritic cells, in particular Langerhans cells). Exosomes are distinguished from other membrane vesicles secreted by cells, in particular by their small size (50 to 100 nm in diameter) and their membrane protein composition (adhesion, transport, signal transduction and molecules of the major histocompatibility complex among others).
• the exosomes could notably correspond to internal vesicles of the multivesicular endosomes (in particular late endosomes) secreted by the cell during the fusion of these endosomes with the plasma membrane; multivesicular endosomes are generally involved in the transport of molecules in lysosomal compartments (pathway of protein degradation) but, in some cells such as reticulocytes and some antigen presenting cells, they could be directed to the plasma membrane, with which they would fuse to release exosomes in the extracellular environment.
• exosomes are capable of inducing humoral and / or cellular immune responses (Delcayre et al., 2002).
• Exosomes are considered as antigen vectors capable of directly stimulating antigen-cell T cells in vitro specific. Indeed, the exosomes secreted by the dendritic cells express molecules of the major histocompatibility complex (MHC) of class I and II.
• MHC major histocompatibility complex
• the functional peptide / MHC complexes carried by the exosomes would be transferred from one dendritic cell to another that has never seen the antigen from which the peptides associated with the MHC molecules are derived.
• the exosomes secreted and presenting on their surface an antigenic peptide would contribute to the amplification of the specific CD4 T and T CD8 response (Delcayre and Le Pecq, 2006).
• these exosomes are able to promote a strong immune response and to regress pre-established solid tumors (Zitvogel et al., 1998).
• Exosomes are able to present exogenous antigens either in the form of native whole proteins or in the form of peptides associated with MHC I and II molecules (Colino and Snapper 2006). Antigen presentation on the surface of exosomes is similar to membrane presentation of an enveloped cell or virus. However, the exosomes are neither live nor infectious, they have the advantage of being handled as an ordinary product and without containment precautions, unlike a virus. Exosomes can therefore be used as antigenic peptide or polypeptide presenters for immunization purposes. This so-called “exosome display” technique does not necessarily require the direct presentation of the antigen by the MHC (Chaput et al., 2004). Nevertheless, the development of this unprecedented vaccination technique presupposes the availability of an effective molecular "tool” for targeting antigenic proteins with exosomes. However, to date, such a "tool” has not been described.
• retroviruses and more particularly of the human immunodeficiency virus (HIV) revealed their ability to divert cell biogenesis machinery from multivesicular endosomes in order to bud in the plasma membrane (Pornillos et al., 2002). These viruses can also use this machinery at the level of the endosomal membrane, its normal functioning site (Raposo et al., 2002). Thus, according to the "exosome Trojan horses" hypothesis (Trojan Exosomes, Gould et al., 2003), these viruses would use the preexisting pathway of exosome biogenesis, for the formation of particles. viral.
• the retrovirus envelope consists of the outer envelope glycoprotein (SU) and the trans-membrane glycoprotein (TM). These envelope glycoproteins are derived from the cleavage of the precursor protein named ENV.
• the expression of the env gene results in the synthesis of the envelope glycoproteins of the retroviruses, in the form of a protein precursor that passes through the Golgi before reaching the membrane portion (endosomal or plasma), which will serve as a viral envelope during the budding of virions.
• this oligomeric precursor is glycosylated and cleaved into surface (SU) and transmembrane (TM) glycoproteins.
• the SU and TM proteins remain associated and are anchored in the vesicular or cellular membrane via a hydrophobic transmembrane helix of the TM protein.
• the glycoprotein TM of retroviruses has many facets due to the association of its external domains, transmembrane and cytoplasmic (CD TM), which make it the only protein of the retroviruses allowing a communication on both sides of the membranes of the virus and of the infected cell (Cann et al., 1992; Delamarre et al., 1996). It is particularly involved in the phenomenon of penetration of the virus into the target cell, causing fusion between the viral and cellular membranes.
• CD TM transmembrane and cytoplasmic
• the TM protein is likely to influence the sorting, fate, targeting and budding of the viral particles, by interactions with the cytoskeleton, as well as with the machineries of ubiquitination and budding (Cann et al., 1992, Delamarre et al., 1996, Straub and Levy, 1999).
• Cells of the K562 line (a erythroleukemic cell line of human origin), which constitutively secrete exosomes, have been transfected with retroviral vectors which make it possible, in the eukaryotic system, to express two types of chimeric protein: (i) a chimera comprising the extracellular domain of the murine CD8 protein and the transmembrane and cytoplasmic domains of the BLV glycoprotein TM (chimera TM-BLV / CD8, De Gassart et al., 2004; 2009), and (ii) a chimera comprising the extracellular and transmembrane domains of the murine CD8 protein and the cytoplasmic domain of the HIV TM protein (TM-HIV / CD8 chimera, De Gassart et al., 2004).
• Both chimeras are expressed both in the transfected K562 cells and in the exosomes secreted by these cells.
• the expression of the TM-BLV / CD8 chimeric protein in the cells of the K562 line disappears rapidly after transit into the trans-Golgian network and late endosomal compartments to end up in the exosomes secreted by these cells. It appears that the chimera with the cytoplasmic domain of the BLV TM protein is more strongly directed towards the exosomes than the chimera with the cytoplasmic domain of the HIV TM protein.
• exosomes carrying the chimeric TM-BLV / CD8 construct described by De Gassart et al. are efficiently produced only in cells of the K562 line, and are little or not efficiently produced in other cell types such as cells of the HEK293 line.
• the present invention relates to novel chimeric polypeptides having addressing properties in exosomes.
• the chimeric polypeptides of the invention comprise only cytosolic domains and / or nuclear domains and are anchored in the membrane of the membrane vesicles, in particular exosomes, without being inserted into the lipid bilayer of a vesicular or cellular membrane, nor cross this lipid bilayer.
• the present application also describes other chimeric polypeptides capable of anchoring in the membrane of membrane vesicles, in particular exosomes.
• These additional chimeric polypeptides comprise one or more membrane domain (s), in particular at least one transmembrane domain.
• the anchoring function in the vesicular or cellular membranes of these additional chimeric polypeptides is ensured by their membrane domain (s), which allow them to be inserted into the lipid bilayer of a vesicular or cellular membrane, and the if necessary to cross it in part.
• these additional chimeric polypeptides are used together with the chimeric polypeptides of the invention.
• chimeric polypeptides described in this application and in particular the chimeric polypeptides of the invention are distinguished in particular from those described in the prior art and, in particular, those described in De Gassart et al, in that they make it possible to address much more efficiently a peptide or a polypeptide of interest to exosomes produced by the cells of the HEK293 line and thus, to amplify very strongly (10 to 100 times) the production of exosomes comprising said peptide or polypeptide. 'interest.
• these polypeptides can be sent to the membrane of exosomes and secreted in association with membrane vesicles, in particular exosomes produced by different cell types, in particular HEK293 cells or T cells or B cells, and not only cells of the K562 line.
• the present invention makes it possible in particular to produce large quantities of membrane vesicles, in particular exosomes, which can be used as research tools but also in diagnostics, in medical applications and in particular in immunization and in particular in vaccination.
• Such membrane vesicles could also be produced in vivo by a human or non-human host (in particular a human or non-human mammal or a bird), which it is desired, for example, to immunize, and in particular to vaccinate, administering to said host a composition and in particular an immunogenic composition whose active principle is a polynucleotide encoding a polypeptide of the invention, in particular a DNA-based immunogenic composition, and more particularly a DNA vaccine, or an immunogenic composition whose active principle consists of membrane vesicles (in particular exosomes) containing a polypeptide of the invention.
• a human or non-human host in particular a human or non-human mammal or a bird
• an immunogenic composition whose active principle is a polynucleotide encoding a polypeptide of the invention, in particular a DNA-based immunogenic composition, and more particularly a DNA vaccine, or an immunogenic composition whose active principle consists of membrane ves
• a sub-membrane targeting domain (ii) a sub-membrane targeting domain; and (iii) a cytoplasmic domain (CD) of a membrane protein, allowing, in eukaryotic cells, the targeting of said chimeric polypeptide to the membrane vesicles, in particular to the vesicles forming exosomes, and / or to the (s) cell compartment (s) involved in the formation of membrane vesicles, and in particular vesicles forming the exosomes, or a mutated derivative of this CD domain, this mutated derivative being defined by substitution, deletion and / or or inserting one or more residue (s) in the sequence of the reference CD domain and this mutated derivative retaining the aforementioned addressability of the CD domain, the CD domain or its mutated derivative comprising at least one YxxL motif, and a pattern PxxP, in x represents any residue,
• the domains present in the chimeric polypeptide are cytosolic or nuclear domains (for example, domains (i) and (iii) are cytosolic) and said chimeric polypeptide lacks import signal peptide in the endoplasmic reticulum.
• the term "residue” as used in this application refers to an amino acid residue. These residues are indicated using the abbreviated one-letter code, for example, Y for a tyrosine residue, L for a leucine residue, P for a proline residue and x for any residue.
• the PXXP motif in the CD domain or its mutated derivative is preferably the PSAP motif (SEQ ID NO: 88) or the PTAP motif (SEQ ID NO: 89).
• the chimeric polypeptide of the invention is particularly capable of being secreted in association with membrane vesicles, particularly with exosomes, when expressed in appropriate eukaryotic cells.
• exosomes containing the polypeptide of the invention are secreted, the peptide or polypeptide of interest is included (in full) in the cytosolic fraction of these exosomes. This allows to attest in particular that the chimeric polypeptide of the invention is free of signal peptide that would allow the import into the endoplasmic reticulum.
• the domains (i) to (iii) are positioned successively in the following order, from the N-terminal end to the C-terminal end in the chimeric polypeptide of the invention: sub-membrane targeting (ii) - peptide or polypeptide of interest (i) - CD domain or its mutated derivative (iii).
• the domains (i) to (iii) can be positioned in a different order, for example in the following order: sub-membrane targeting domain (ii) - CD domain or its mutated derivative (iii) - peptide or polypeptide of interest (i).
• Either of the domains (ii) or (iii) or the two domains (ii) and (iii) can also be positioned between two different or identical domains of type (i), they can also be inserted into the within a domain (i), for example in the N-terminal order of (i) - (ii) [or (iii)] - (iii) [or (ii)] - remaining C-terminal fragment of (i).
• chimeric here designates a polypeptide which associates several domains, of at least two different types by their function and / or by their cellular localization, at least two of these domains coming from distinct molecules, in particular originating from different proteins. of the same species or different species of the same protein of different species.
• a "chimeric polypeptide” as defined herein may be the expression product of a recombinant polynucleotide and may be expressed recombinantly in a host cell.
• the said chimeric polypeptide is therefore, for example, a fusion polypeptide.
• domain of a protein or polypeptide is meant a region having a functional property and / or a cellular location for said protein or polypeptide.
• sub-membrane targeting domain or “membrane targeting domain” or “membrane recruitment domain” (or association with cell and vesicular membranes) refers in this application to a domain capable of , in a cell and in particular in a eukaryotic cell (for example an exosome-producing cell), to anchor itself to a cell membrane and / or a vesicular membrane without being inserted into said membrane (s), the anchoring to the membrane or membranes which can be provided by means of one or more anchoring molecule (s) (said domain being capable of binding said anchoring molecule (s)) and / or by interactions (in particular electrostatic interactions) between said sub-membrane targeting domain and said membrane (s).
• a eukaryotic cell for example an exosome-producing cell
• said domain is capable, in a cell and in particular in a eukaryotic cell (for example an exosome producing cell), of binding to or interacting with the internal (ie cytoplasmic) face of the plasma membrane and / or membrane vesicles, via one or more anchoring molecule (s) and / or through interactions (in particular electrostatic interactions).
• a eukaryotic cell for example an exosome producing cell
• sub-membrane targeting when applied to the domain (ii) present in the chimeric polypeptide of the invention, implies an ability to interact (by via one or more anchoring molecule (s) and / or through interactions, in particular electrostatic interactions) with a cell membrane (in particular the plasma membrane) and / or a vesicular membrane. If necessary (but not necessarily), this term also implies active cellular management making it possible to bring said domain (ii) and, consequently, a chimeric polypeptide comprising said domain (ii), close to a cell membrane. (in particular the plasma membrane) or vesicular, so that interactions with said membrane become possible.
• the sub-membrane targeting domain is sufficient to allow the chimeric polypeptide of the invention to be anchored to the lipid bilayer of cellular or vesicular membranes (via one or more anchoring molecule (s) and / or through interactions).
• the sub-membrane targeting domain allows the chimeric polypeptide of the invention expressed in a cell and in particular a eukaryotic cell, to be anchored to (sometimes indicated by the expression "anchored in”) a cell or vesicular membrane, without said polypeptide being inserted into said membrane.
• the sub-membrane targeting domain confers on the chimeric polypeptide of the invention the property of binding (via one or more molecule (s) of anchoring and / or or by interactions, in particular electrostatic interactions) at the vesicular and cellular membrane and in particular at the inner face of the plasma membrane and membrane vesicles.
• the field of Sub-membrane targeting has 5 to 40 residues, preferably 8 to 25 or 12 to 25 residues and more preferably 14 to 25 or 16 to 23 residues, for example 8, 9, 10, 1 1, 12, 13, 14, 15 , 17, 18, 19, 20, 21, 22, 23, 24, or 25 residues.
• anchoring molecule is meant, in the present application, any molecule capable of being inserted into the lipid bilayer (in particular in at least one layer of the lipid bilayer) of a cell or vesicular membrane and in particular a lipid or a lipid molecule (i.e., a molecule having one or more lipid (s)); the sub-membrane targeting domain and the chimeric polypeptide of the invention are then called "lipid-anchored”.
• the anchoring molecule within the meaning of the invention comprises or consists of one or more lipids, said lipid or said lipids comprising a hydrophobic carbon chain which allows them to encapsulate in the lipid bilayer of a cell or vesicular membrane.
• the lipid (s) present in the anchoring molecule is (are) chosen from fatty acids, for example from myristic acids, palmitic acids, and isoprenoids, especially geranyl-geranyl and farnesyl.
• the anchoring molecule (s) is (are) linked to the sub-membrane targeting domain present in the chimeric polypeptide of the invention by a covalent bond.
• the term "sub-membrane targeting domain” allows the chimeric polypeptide of the invention to be anchored to the lipid bilayer via one or more fatty acids, in particular one or more fatty acids chosen from myristic acids, palmitic acids and geranyl-geranyl, and / or via a peptide or a peptide structure capable of interacting with one or more lipid (s) or lipid unit (s) present in a lipid bilayer, in particular with a phospholipid.
• the chimeric polypeptide of the invention is anchored to cell and vesicular membranes without being inserted into said membranes.
• this domain is sufficient to bind a fatty acid and in particular a myristic acid, a palmitic acid or a geranyl-geranyl.
• This binding can be done in particular on a residue G (for example in the case of a myristic acid), C or S of the sub-membrane targeting domain. It may especially be an amide or thioester bond.
• the fatty acid, in particular myristic acid can bind to the sub-membrane targeting domain by a covalent bond.
• the sub-membrane targeting domain comprises or consists of a peptide or a peptide structure (that is to say a structure comprising one or more residues of amino acids and of preferably one or more chains (s) of at least two consecutive amino acid residues) capable of interacting with one or more lipid (s) (particularly one or more fatty acid (s)) or with a or more lipid moiety (s) (especially one or more lipid moiety (s) comprising or consisting of one or more fatty acids) present in a lipid bilayer, particularly with a phospholipid.
• a peptide or a peptide structure that is to say a structure comprising one or more residues of amino acids and of preferably one or more chains (s) of at least two consecutive amino acid residues
• the sub-membrane targeting domain and the peptide or polypeptide of interest of the chimeric polypeptide of the invention may or may not be derived from the same entity, in particular from the same protein.
• the sub-membrane targeting domain is that of an extrinsic membrane protein or is a mutated derivative of the sub-membrane targeting domain of an extrinsic membrane protein.
• the "sub-membrane targeting domain” comprises or consists of a consensus sequence allowing the attachment, for example by acylation or by prenylation, of a fatty acid and in particular myristic acid, of an acid. palmitic or geranyl-geranyl.
• Said consensus sequence may comprise or consist of the following sequence: MG-X1-X2-X3-S / C (wherein X1, X2, and X 3 independently denote any residue), particularly in the case where it allows the attachment of a myristic acid.
• a fatty acid binds to this consensus sequence, it is generally on the residue G, for example in position 2.
• - Xi is selected from C, S and L; and or X 2 is selected from S, I, V, M and L; and or
• X 3 is selected from K, Q, H, F, C and S.
• said consensus sequence makes it possible to attach a myristic acid
• it is preferably located in the N-terminal position (for example in the 2-position) in the sub-membrane targeting domain, and therefore in the polypeptide of the invention.
• the "sub-membrane targeting domain” comprises several basic amino acid residues, in particular several residues chosen from K, R and H. "Several” here means at least two, and preferably at least minus three, for example, two, three, four, five, or more than five.
• amino acids may in particular be involved in interactions with lipids of cell or vesicular membranes, especially with choline (for example with phosphatidylcholine) and thus make it possible to increase the affinity of the sub-membrane targeting for these membranes.
• the basic amino acids of the sub-membrane targeting domain may be located in the consensus sequence described above and / or outside this consensus sequence.
• the sub-membrane targeting domain of the invention is:
• a sequence chosen from the following sequences: M-G-x-x-K-S / C-K-x-K and M-G-x-x-K-S / C-K-x-K-x-x-x-x-R-R-R in which x denotes any residue); such a sequence may for example allow the attachment of a myristic acid (for example in position 2), or
• the sub-membrane targeting domain may in particular be derived from a protein of the Src family of proteins, in particular from a protein chosen from Src, Yes, Lyn, Fyn, Lck, Blk, Fgr, Hck and Yrk proteins ( Resh, 1994), and more particularly the N-terminal portion of one of these proteins.
• this domain may be derived from the c-Src or v-Src protein (preferably c-Src).
• This domain can for example comprise or consist of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 N-terminal amino acids of one of these proteins, and in particular Src protein.
• the sub-membrane targeting domain may be derived from other acylated proteins, in particular viral capsid proteins, for example human immunodeficiency virus (HIV) MA protein, or filovirus proteins.
• viral capsid proteins for example human immunodeficiency virus (HIV) MA protein, or filovirus proteins.
• the sub-membrane targeting domain may be derived from a Src protein, and in particular comprise or consist of the following sequence: M-GSSKSKPKDPSQRRR (SEQ ID NO.:104) or MGSSKSKPKD-PSQRRRKSRGPGG (SEQ ID NO .: 105) or consist of a mutated derivative of the sequence domain MGSSKSKPKDPSQRRR or MGSSKS-KPKDPSQRRRKSRGPGG.
• derived from a particular protein indicates, in the present application, that the targeted peptide or polypeptide comprises or consists of that particular protein, or a fragment thereof, or a mutated derivative of said protein or fragment by substitution or deletion of amino acids.
• the sub-membrane targeting domain comprises or consists of one or more FYVE domain (s).
• membrane vesicle as used herein means any vesicle composed of a lipid bilayer containing a cytosolic fraction as produced by eukaryotic cells. This expression includes in particular the vesicles secreted in the extracellular space, that is to say the exosomes.
• exosomes is meant, in the present application, nanovesicles of cell membranes as defined above. These exosomes can be purified from cell culture supernatants by differential centrifugation, ultrafiltration, or adsorption on a support or by any other method, as illustrated in the examples.
• the expression "secreted in association with membrane vesicles, in particular with exosomes” means, in the present application, that a chimeric polypeptide of the invention and / or at least one of its degradation products is secreted into the body. extracellular space, not in soluble form in this extracellular space, but in a form anchored to the inner surface of the membrane of the membrane vesicles, in particular exosomes.
• the chimeric polypeptide of the invention does not contain an import signal peptide in the endoplasmic reticulum, it is a permanent resident of the cytosol or nucleus (it remains localized in the cytosol or in the nucleus) and will therefore not to be integrated in the membrane or on the surface of a membrane vesicle and in particular of an exosome secreted by an exosome-producing cell, but inside (ie in the light ) of this membrane vesicle.
• this polypeptide is addressed to the membrane and anchored to the membrane of the membrane vesicles and in particular exosomes via a peptide capable of interacting with one or more lipid (s) or a lipidic unit present (s).
• lipid bilayer in particular a phospholipid, or, preferably, via one or more fatty acids (in particular one or more selected fatty acid (s)) among myristic acids, palmitic acids and geranyl-geranyl), which interact with the sub-membrane targeting domain.
• fatty acids in particular one or more selected fatty acid (s)
• myristic acids palmitic acids
• geranyl-geranyl which interact with the sub-membrane targeting domain.
• fatty acid (s) can be co-translational attached and allow the chimeric polypeptide produced in the cytoplasm of a cell to anchor posttranslationally in cell or vesicular membranes.
• the chimeric polypeptide of the invention is produced with and is integrated in the exosomes before leaving the cell.
• the secretion of a peptide or a polypeptide in association with membrane vesicles requires, in particular, (1) the addressing of said peptide or polypeptide to the site (s) of formation of the vesicles membrane and in particular exosomes, and (2) vesicular budding from the membrane in which said peptide or polypeptide is anchored.
• addressing also referred to as “sorting”, “referral” or “intracellular routing” refers in this application to the process that allows a polypeptide, whose synthesis begins in the cytosol, to be directed to and to reach the compartments involved in the budding of membrane vesicles, in particular vesicles forming the exosomes and / or to reach the membrane vesicles, in particular the vesicles forming the exosomes.
• secretion refers, in the context of the invention, to the process by which membrane vesicles, then called “exosomes”, are secreted, that is to say released into the extracellular space from a or more cell (s). This process can occur especially when multivesicular endosomes fuse with the plasma membrane of a cell, releasing the membrane vesicles they contain outside the cell.
• a test for highlighting the addressing and secretion properties of a chimeric polypeptide as defined in the present application consists in verifying that said chimeric polypeptide and / or its degradation products are found to be well associated with membrane vesicles (particularly exosomes) when said polypeptide is expressed in appropriate eukaryotic cells.
• An "appropriate" eukaryotic cell is advantageously a eukaryotic cell having internal secretory vesicles, which is culturable, capable of exocytosis, genetically modifiable and, preferably, whose internal vesicles can be secreted under the effect of external stimulation. It is in particular a mammalian cell and more particularly a cell of human origin or a cell originating from a non-human mammal. It can also be primary cultures or immortalized lines.
• Such "appropriate" eukaryotic cells include, in particular, eukaryotic cells naturally capable of producing exosomes, in particular mast cells, T and B lymphocytes and dendritic cells (for example Langerhans cells) or cells derived from these cell types, as well as eukaryotic cells or eukaryotic cell lines engineered to make them capable of secreting exosomes.
• the term "lipid bilayer” denotes the basic structure of the plasma membrane and any biological membrane, that is to say any assembly of amphiphilic lipids in a double layer (or double layer) separating a cell or a vesicle from its environment and delimiting the cytoplasm of a cell or vesicle, or delimiting organelles within the cytoplasm.
• This term therefore encompasses any membrane of the cell, that is to say both the plasma membrane and the membranes of the various intracellular compartments, in particular those of the endoplasmic reticulum, those of the Golgi apparatus, or that of the membrane vesicles, for example that of exosomes or endosomes.
• cytoplasmic domain is meant, in the present application, a particular cytoplasmic domain capable of being addressed to the membrane vesicles, in particular to the vesicles forming exosomes, or to the compartment (s).
• this domain makes it possible, when integrated with a chimeric polypeptide comprising a peptide or a polypeptide of interest, to address said chimeric polypeptide to the membrane vesicles and / or to their formation site (s) and in particular to address said chimeric polypeptide to membrane membrane vesicles, so that said polypeptide can be secreted in association with membrane vesicles (in particular exosomes) by a cell, in particular an appropriate eukaryotic cell.
• a “mutated derivative” of a domain within the meaning of the present application refers to any polypeptide or peptide modified with respect to the original or reference domain, provided that this mutated derivative retains the function normally involving said domain: this function is by for example the ability to address membrane vesicles (and in particular to exosomes) normally attached to the reference CD domain, the anchoring function to a lipid bilayer normally attached to the sub-membrane targeting domain, and, for peptides additional chimeric insertion function and anchoring in a lipid bilayer normally involving a membrane domain and in particular the ability to fully cross and anchor in a lipid bilayer normally involving a transmembrane domain.
• Such a mutated derivative may therefore correspond for example to a fragment composed of contiguous residues of said original or reference domain (this derivative being obtained in particular by deletion and optionally substitution of one or more residue (s) in the original sequence) or, at contrary to a polypeptide of larger size than the original or reference domain, in particular a polypeptide comprising the original or reference domain (this derivative being obtained in particular by insertion of one or more residue (s) in the original sequence).
• the "mutated derivative" differs from the original or reference sequence by the substitution of at least one residue, preferably one, two, three, four, five or more than five residue (s). , consecutive or not, in the sequence of the original domain, these substitutions may be conservative, semi-conservative or non-conservative, and / or by the deletion of at least one residue, preferably one, two, three, four, five, or more than five residues, consecutive or not, and / or by the insertion of at least one residue, preferably one, two, three, four, five or more than five residues, consecutive or not, in the sequence of the original domain.
• the sequence of this "mutated derivative” may have at least 60 or 70%, in particular at least 80%, 90% or 95%, of similarity or identity with the original domain from which it derives, with reference to the complete sequence from the original domain.
• percentage of identity is meant, in the present application, the number of identical residues relative to the total number of residues of the peptide or polypeptide studied.
• percentage of similarity defines the number of identical or chemically similar residues relative to the total number of residues of the peptide or polypeptide studied.
• the percent identity or similarity is determined by aligning the two sequences to be compared and using the Needleman and Wunsch algorithm, which allows for global alignment between two sequences. The percentage of similarity or identity is then calculated over the entire length of these two sequences.
• the CD domain or its mutated derivative comprises two or three YxxL motifs, in which x represents a residue any.
• the motif or one of the YxxL motifs present in the CD domain may be, for example, the YINL (SEQ ID NO: 91) or YSHL (SEQ ID NO: 97) motif.
• the CD domain or its mutated derivative comprises a DYxxL motif, in which x represents any residue.
• DYxxL motif SEQ ID No. 93.
• the CD domain comprises at least one unit equivalent to a YxxL unit or a DYxxL unit, for example a YxxF or DYxxF unit, respectively, in which x represents any residue.
• the transferrin receptor which is a cellular protein, has a YxxF domain.
• the CD domain or its mutated derivative further comprises two, three or four PxxP motif (s), in which x represents any residue, at least one of these motifs PxxP being the PSAP motif (SEQ ID No. 88) or PTAP (SEQ ID NO: 89).
• the PxxP pattern of the CD domain or its mutated derivative is PSAP or PTAP (more preferably PSAP) and the YxxL pattern is YINL or YSHL.
• the YxxL motif of the CD domain (for example the YINL or YSHL motif), or one of the motifs is YxxL, is located in the C-terminal position with respect to the PxxP motif (for example the PSAP motif).
• the YxxL pattern of the CD domain (for example the YINL or YSHL motif) is located in the N-terminal position relative to the PxxP motif (for example the PSAP motif).
• proteins having a CD domain comprising at least one YxxL motif there are notably cellular proteins and viral proteins.
• viral proteins are in particular enveloped virus proteins, in particular the TM glycoproteins of enveloped viruses and in particular retroviruses.
• the CD domain is that of a Bovine leukemia virus (BLV) TM protein.
• BLV Bovine leukemia virus
• This retrovirus which is part of Oncovirinae (it is an Oncovirus), induces, in cattle, a proliferation of B cells that can cause leukemia.
• the CD domain of the BLV TM protein is composed of 58 residues and has the sequence SEQ ID No. 6.
• the CD domain of the chimeric polypeptide of the invention or its mutated derivative then corresponds either to the domain of sequence SEQ ID No. 6 or to a mutated derivative of the domain of sequence SEQ ID No. 6.
• the mutated derivative of the CD domain is a native CD domain fragment consisting essentially of an amino acid sequence extending from the PSAP motif (or PTAP) to the YxxL motif (by example YINL or YSHL) which, in a particular embodiment, follows it in part C-terminal.
• the YxxL motif by example YINL or YSHL
• the CD domain of the chimeric polypeptide of the invention or its mutated derivative, in particular the mutated derivative of the CD domain is devoid of the KCLTSRLLKLLRQ sequence.
• the mutated derivative of the CD domain may differ from the original CD domain in that its sequence is devoid of the sequence: KCLTSRLLKLLRQ.
• sequence of the mutated derivative of the CD domain may have at least 60 or 70%, in particular at least 80%, 90% or 95%, of similarity or identity with the original CD domain sequence devoid of of the KCLTSRLLKLLRQ sequence.
• the CD domain or its mutated derivative, and in particular its mutated derivative may also be preferable for the CD domain or its mutated derivative, and in particular its mutated derivative, to be devoid of the PC sequence and / or the CP sequence.
• said CD domain or its mutated derivative, in particular its mutated derivative is in particular devoid of the PCP sequence.
• its mutated derivative can be obtained in particular by deleting, in the sequence of the original CD domain, the cysteine residue of said PCP sequence, or by substituting it with another residue, preferably by a non palmitoyiable residue, for example an alanine residue.
• the CD domain or its derivative is lacking both the PCP sequence and the sequence KCLTSRLLKLLRQ.
• the mutated derivative of the CD domain of the BLV TM protein may comprise or consist of the sequence SEQ ID No. 8, which corresponds to the sequence SEQ ID No. 6 in which the 13 N-terminal residues have been deleted.
• sequence of the mutated derivative of the BLV TM protein may differ from the sequence of the CD domain the BLV TM protein by the substitution of at least one residue, preferably one, two, three, four , five or more residues, consecutive or not, and / or deletion and / or insertion of at least one residue, preferably one, two, three, four, five or more five residue (s), consecutive or not in the sequence of said domain corresponding to the sequence SEQ ID NO.8.
• sequence of the mutated derivative of the CD domain of the BLV TM protein may have at least 60 or 70%, in particular at least 80%, and 90% or 95%, of similarity or identity with the sequence SEQ ID NO.8.
• sequence of said mutated derivative retains in particular the YINL, YSHL (or, where appropriate, DYINL) motif and the PSAP motif of the sequence SEQ ID NO.8.
• sequence of the mutated derivative of the CD domain of sequence SEQ ID No. 6 is preferably devoid of PC (proline-cysteine) and CP (cysteine-proline) motif and, more preferably, lacks a PCP (proline-cysteine-proline) motif. ).
• PC proline-cysteine
• CP cysteine-proline
• PCP proline-cysteine-proline
• the CD domain or its mutated derivative in particular the mutated derivative of the CD domain of sequence SEQ ID No. 6, comprises or consists of a sequence chosen from the following sequences:
• x and x n are respectively any residue and any residue (s), and wherein at least one of the PxxP motifs is the PSAP or PTAP pattern.
• the CD domain or its derivative mutated, in particular the mutated derivative of the CD domain of sequence SEQ ID No. 6, comprises or consists of a sequence chosen from the following sequences:
• x and x n respectively represent any residue and one or more residues any, at least one of the PxxP motifs being the PSAP or PTAP pattern.
• n is greater than or equal to 1 and less than 50. n may in particular have any value between 1 and 20.
• the pattern PxxP which, in a particular embodiment, is in the N-terminal position in the sequences indicated above, may be the PSAP or PTAP pattern.
• the YxxL motif which, in a particular embodiment, is in the C-terminal position in the sequences indicated above, can be for example the YINL or YSHL motif.
• the consecutive amino acid residues added upstream or downstream of this sequence do not form a motif.
• said mutated derivative of the CD domain of sequence SEQ ID No. 6 comprises 6 to 100 residues, in particular 20 to 80, 30 to 70 or 40 to 60, for example 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 residues.
• sequence of the mutated derivative of the CD domain may comprise or consist of the sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 or present at least 60 or 70%, in particular at least 80%, 90% or 95%, similarity or identity with the sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 with reference to the sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 complete.
• peptide or polypeptide of interest is meant, in the present application, a sequence of several (at least two) successive residues, forming the structure of a peptide or a polypeptide.
• a peptide denotes a chain of 2 to 20 successive residues (in particular 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19 or 20 residues), in particular a chain of 5 to 10, 10 to 15 or 15 to 20 successive residues.
• a polypeptide which also refers to a protein or a fragment of a protein, is a sequence of more than 20 (at least 21) successive residues, in particular a chain of 21 to 1000 successive residues, preferably 21 to 500, 21 at 250 or 21 to 150 successive residues, for example 21 to 50, 50 to 100, 100 to 150 successive residues.
• Said peptide or polypeptide of interest may in particular comprise or consist of one or more domains of a soluble, membrane, transmembrane and / or multimeric protein.
• the "peptide or polypeptide of interest" in particular the peptide or polypeptide of interest present in the chimeric polypeptide of the invention, comprises or consists of one or more domains of a protein. cytosolic or nuclear protein, or fragment (s) of this domain (s).
• fragment of a domain is meant, in the present application, a portion composed of at least 6 contiguous residues of said domain, and in particular a portion having at least 50%, preferably at least 60%, 70%, 80%, or at least 90%, even 100% identity with the complete sequence of said domain. In any case, a fragment is smaller than the size of the protein from which it is derived.
• said peptide or polypeptide of interest is antigenic, i.e., it is capable of eliciting an immune response directed against said peptide or polypeptide of interest.
• Said peptide or polypeptide of interest may in particular comprise or consist of one or more epitopes of a protein.
• said peptide or polypeptide of interest comes from a pathogenic organism, for example a virus, a bacterium or a parasite, or from a pathogenic agent, for example a tumor cell, a toxin, etc.
• a pathogenic organism for example a virus, a bacterium or a parasite
• a pathogenic agent for example a tumor cell, a toxin, etc.
• Any cytoplasmic or nuclear peptide component of such an organism or pathogen can be used, whether or not it is a structural protein. This may be in particular a pathogen antigen, and in particular a viral, bacterial or antigen from a parasite.
• the said peptide or polypeptide of interest may also come from a cytoplasmic antigen, and in particular from a cytoplasmic tumor antigen, or from the cytosolic part of a transmembrane protein. It may be alternatively an enzyme or part of an enzyme or a mutated derivative of an enzyme, or a protein toxin, or a portion of protein toxin, or a compound chosen for its ability to act specifically on a cell (said compound may have a deleterious or otherwise beneficial effect on a target cell). It can also be a protein (for example a G protein) or a protein fragment capable of specifically binding a nucleic acid, for example the MS2 phage capsid protein. It may also be a peptide or polypeptide capable of binding a particular nucleic acid.
• the invention may be used in vivo, in particular for a medical application, especially in immunization, particularly in vaccination.
• the polypeptide of interest is a mutated derivative of the hAGT protein.
• This mutated derivative is the SNAP protein, which is commercially available (Covalys, NEB).
• a chimeric polypeptide as defined in the present application further comprises at least one linker molecule (or linker).
• linker refers to any element that links two successive domains. This one may be of length and of variable nature.
• at least two successive domains of the polypeptide of the invention are covalently linked, for example via peptide bonds.
• said linker is a polypeptide or a peptide.
• This polypeptide linker can consist of a sequence of 2 to 50 residues, preferably of 2 to 30 residues, for example 2 to 5, 5 to 10, 10 to 20 or 20 to 30 successive residues.
• the nucleotide sequence coding for said linker comprises or consists of a restriction site.
• restriction site is meant a particular nucleotide sequence recognized by a type II restriction enzyme as a cleavage site in the DNA molecule.
• this linker may be, for example, the SR sequence linker, or AS, or PAGSGAP (SEQ ID NO.:106), encoded respectively by the nucleotide sequences TCTAGA, or GCTAGC, or CCTGCAGGAAGCGGCGCGCCC (SEQ ID NO.:107 ) which respectively comprise the sites of the restriction enzymes XbaI, NheI, and SbfI-AscI.
• the peptide or polypeptide of interest is in its native conformation in the chimeric polypeptides described in the present application and in particular in the chimeric polypeptide of the invention.
• a chimeric polypeptide as defined in the application is multimeric and in particular is in the form of a dimer or a trimer. This may be the case, in particular, when the peptide or the polypeptide of interest originates from a protein which, in its native form, dimerizes or trimerizes.
• a chimeric polypeptide as defined in the application further comprises a tag sequence which makes it possible to purify it.
• said tag sequence may comprise or consist of a plurality of consecutively linked histidine residues, in particular a sequence of 6 consecutive histidine residues.
• a chimeric polypeptide as defined in the application comprises a tag or reporter protein, which may be for example an enzyme, and which is intended to label the polypeptide, for example by associating a fluorophore, or any other marker or substrate to fix markers (eg biotin).
• a protein may be for example the SNAP protein or a mutated derivative of the SNAP protein, which retains the labeling properties normally attached to the SNAP protein.
• a chimeric polypeptide as defined in the application comprises the hAGT protein, whose accession number in the GenBank database is M29971.1, or a derived or mutated derivative of the hAGT protein (Keppler et al., 2002) contained in the plasmid pSNAPm (NEB, USA).
• the chimeric polypeptide further comprises a marker for detecting the chimeric polypeptide by ELISA or in Western Blot.
• said marker is an epitope recognized by a specific monoclonal antibody, for example a myc epitope.
• the peptide or polypeptide of interest advantageously has its native conformation (in particular is in the form of multimer, for example in the form of dimer or trimer) when associated with exosomes.
• the subject of the present invention is also the use of a chimeric polypeptide of the invention as defined in the present application, for addressing (in vivo or in vitro) a peptide or polypeptide of interest that it comprises, towards the membrane vesicles, in particular to the vesicles forming exosomes, and / or to the cell compartment (s) involved in the formation of membrane vesicles, and in particular vesicles forming the exosomes, and for thus to allow the secretion, by appropriate eukaryotic cells, of said peptide or polypeptide of interest in association with said membrane vesicles.
• the chimeric polypeptide of the invention may be used in combination with a chimeric polypeptide, hereinafter referred to as "additional chimeric polypeptide".
• the additional chimeric polypeptide comprises or consists of the following domains: a peptide or a polypeptide of interest;
• CD cytoplasmic domain
• mutated derivative of this CD domain said CD domain and its mutated derivative being as defined in the present application
• these domains being positioned successively in the following order, from the N-terminal end to the C-terminal end: peptide or polypeptide of interest - transmembrane domain - CD domain or its mutated derivative; or CD domain or its mutated derivative - transmembrane domain - peptide or polypeptide of interest.
• the additional chimeric polypeptide necessarily comprises at least one membrane domain (the transmembrane domain) but may include several; the peptide or polypeptide of interest may comprise zero, one or more membrane domain (s), in particular transmembrane (s) (see below), the additional chimeric polypeptide comprises one or more membrane domains (in particular transmembrane domains) (s)).
• the chimeric polypeptide comprises only one membrane domain (the transmembrane domain), it may or may not be derived from the same entity, in particular the same protein as the peptide or polypeptide of interest of said polypeptide.
• the CD domain or the mutated derivative of the additional chimeric polypeptide may be identical to or different from the CD domain or the mutated CD domain derivative of the chimeric polypeptide of the invention.
• a “membrane domain” denotes, in the present application, any domain capable of interacting with a lipid bilayer and in particular capable of anchoring - and thus anchoring a polypeptide comprising it - in a lipid bilayer and in particular in a membrane. vesicular or cellular and in the membrane of an exosome. According to a particular embodiment, this membrane domain is capable of binding on the one hand to a first domain (for example a peptide or a polypeptide of interest) and on the other hand to a second domain (for example a cytoplasmic domain). ). It may for example have 10 to 50 residues, preferably 15 to 40 residues and more preferably 20 to 30 residues.
• said membrane domain is a transmembrane domain, that is to say a membrane domain entirely crossing the lipid bilayer of a vesicular or cellular membrane.
• a transmembrane domain is generally hydrophobic-helical, the multi-pass transmembrane proteins may contain several, in particular 2, 3, 4, 5, 6, 7, 8, 9 or 10, or even 20 or more hydrophobic helices. It can also be arranged in a ⁇ sheet.
• One or more transmembrane domains may also adopt a transmembrane ⁇ -barrel structure, generally composed of 8 to 22 ⁇ -strands.
• membrane protein any polypeptide chain having one or more membrane domain (s) as defined above.
• the additional chimeric polypeptide is capable of being secreted in association with membrane vesicles, particularly with exosomes, when expressed in appropriate eukaryotic cells.
• the additional chimeric polypeptide or a degradation product of said polypeptide can be anchored in the membrane of the membrane.
• a membrane vesicle in particular an exosome
• a degradation product of said chimeric polypeptide may also be anchored in the membrane of a membrane vesicle via the membrane (especially transmembrane) domain of a MHC (class I or II) molecule to which said degradation product said chimeric polypeptide is associated.
• the peptide or polypeptide of interest may be exposed (wholly or in part) to the outside of said vesicle membrane and / or included (in whole or in part) in the membrane of said membrane vesicle (this is the case when said polypeptide or peptide of interest comprises one or more membrane domains) and / or included (in whole or in part ) in the cytosolic fraction of said membrane vesicle.
• the domain CD and a transmembrane domain of said additional chimeric polypeptide are derived from the same protein, then at least the CD domain, its mutated derivative or the transmembrane domain derived from the same protein as the CD domain is a mutated derivative by substitution and / or deletion one or more residue (s) in the sequence of the original domain.
• the transmembrane domain can be derived from one or more transmembrane protein (s), which passes (s) once or more than once, in particular 2, 3, 4, 5, 6, 7, 8, 9 or 10 times. or 20 times, or more, a vesicular or cell membrane.
• Said membrane or transmembrane proteins may be chosen in particular from: human proteins, proteins of a non-human animal, proteins of a pathogenic organism or of a pathogenic agent, in particular viral proteins, bacterial proteins, or expressed proteins by a parasite or a tumor cell.
• the or at least one of the transmembrane domain (s) of the additional chimeric polypeptide may be in particular that of a single transmembrane protein or may be a mutated derivative of the transmembrane domain of a membrane protein. Said mutated derivative can for example be obtained by replacing part of the sequence of the reference domain with a sequence derived from the transmembrane domain of another transmembrane protein.
• CD of the additional chimeric polypeptide or its mutated derivative comprises or consists of the CD domain the BLV TM protein, of sequence SEQ ID No. 6, the membrane domain (s) of said additional chimeric polypeptide is (are) lacking the transmembrane domain of the BLV TM protein, which has the sequence SEQ ID NO.4.
• a transmembrane domain of the additional chimeric polypeptide may, on the other hand, correspond to a mutated derivative of the domain of sequence SEQ ID No. 4, said mutated derivative not comprising the sequence SEQ ID No. 4.
• Such a mutated derivative can be obtained by deletion and optionally substitution of one or more residue (s) in the sequence SEQ ID No. 4, as illustrated in the examples.
• the transmembrane domain (s) and the CD domain derive from the same protein, especially when they are derived from the BLV TM protein, one uses, as a domain (iii) ) a mutated derivative of the CD domain that lacks the PCP sequence (the residue C of the PCP sequence is for example replaced by a residue A) and / or lacks the KCLTSRLLKLLRQ sequence.
• the CD domain or its mutated derivative lacks the CD domain. of the BLV TM protein, of sequence SEQ ID No. 6.
• the CD domain or its mutated derivative may, on the other hand, correspond to or comprise a mutated derivative of the domain of sequence SEQ ID No. 6. As illustrated in the examples, such a mutated derivative can be obtained, for example, by deleting residues located in the N-terminal part of the sequence SEQ ID No.
• the peptide or polypeptide of interest present in this additional chimeric polypeptide may be as defined in the application for the chimeric polypeptide of the invention.
• said peptide or polypeptide of interest of the additional chimeric polypeptide may also comprise or consist of one or more domains of an extracellular protein or a surface protein or fragment (s) thereof. one or more of this domain (s).
• the peptide or polypeptide of interest present in this additional chimeric polypeptide comprises or consists of one or more domain (s) of an extracellular or surface protein or fragment (s) thereof. one or more of this area (s) and, where appropriate:
• membrane domain (s) of a membrane protein in particular of a transmembrane protein or one or more fragment (s) of this domain (s), and / or one or more cytoplasmic domain (s) of a membrane protein, in particular of a transmembrane protein, or one or more fragment (s) of this domain (s).
• the peptide or polypeptide of interest of the additional chimeric polypeptide is a receptor, for example a receptor with multiple membrane domains and in particular a CXCR4 or GPR receptor, or any other peptide or polypeptide which allows to target a target cell or a particular type of target cells (for example tumor cells or cells presenting a metabolic or functional disorder).
• a receptor for example a receptor with multiple membrane domains and in particular a CXCR4 or GPR receptor, or any other peptide or polypeptide which allows to target a target cell or a particular type of target cells (for example tumor cells or cells presenting a metabolic or functional disorder).
• the peptide or polypeptide of interest of this additional chimeric polypeptide comprises or consists of one or more ectodomain (s) and / or one or more membrane domain (s) and / or or one or more cytoplasmic domains of a membrane protein, particularly a transmembrane protein, or one or more fragment (s) of one or more of this domain (s).
• said peptide or polypeptide of interest of this additional chimeric polypeptide comes from a pathogenic organism, for example a virus, a bacterium or a parasite, or a pathogenic agent, for example a tumor cell, a toxin ..., or a tumor antigen, a cytoplasmic antigen, a ligand receptor, in particular a receptor with multiple membrane domains, for example a receptor with seven transmembrane domains, a cytokine receptor or a receptor ligand, especially a cytokine or fragment thereof.
• Any peptide component of an organism or pathogen can be used, whether or not it is a structural protein. This may be in particular a pathogen antigen, and in particular a viral, bacterial or antigen from a parasite.
• Said peptide or polypeptide of interest of this additional chimeric polypeptide may also come from a tumor antigen, a cytoplasmic antigen, a transmembrane protein, in particular an integrin or a co-receptor or a protein intervening in interactions (in particular ICAM, CD4, CD8 proteins), of a ligand receptor, in particular a receptor with a single membrane domain, for example a cytokine receptor (in particular receptors of the EGF family responding to EGF, for example the EGF-R1 receptor), especially a receptor with multiple membrane domains, for example a receptor with seven transmembrane domains (in particular the HIV CXCR4 receptor or a gamma amino butyric acid (GABA) receptor), or a receptor ligand, in particular a cytokine or a fragment thereof. them.
• a ligand receptor in particular a receptor with a single membrane domain, for example a cytokine receptor (in particular receptors of the EGF family responding to E
• the invention may be used in vitro, for example to screen for molecules interacting with said peptide or polypeptide of interest.
• said peptide or polypeptide of interest comes from a protein present on the surface of a virus, for example a protein responsible for fixing a viral particle to a receptor located on a target cell and or responsible for the fusion of the viral envelope or the plasma membrane of a cell infected with the plasma membrane of a target cell, or a fragment of such a protein.
• domain (i) a protein of the envelope of an enveloped virus or a fragment of this protein.
• This enveloped virus may be chosen in particular from the following families:
• Poxviridae in particular those of the genus Orthopoxvirus, which includes, in particular, the smallpox virus and the vaccinia virus;
• Herpesviridae in particular those of the genus Herpesvirus, which notably comprise Herpesvirus types 1 and 2, Varicella virus, Epstein Barr virus, Cytomegalovirus, and Herpesvirus types 6, 7, 8;
• Hepadnaviridae which include the hepatitis B virus
• Orthomyxoviridae especially those of the genus Influenza virus A, B or C, which includes the bird flu virus H5N1;
• Paramyxoviridae in particular those of the genus Paramyxovirus, which comprises in particular the parainfluenzae and mumps viruses, those of the genus Morbillivirus, which notably comprises the measles viruses, and those of the Pneumovirus genus, which notably comprises the respiratory syncytial virus. ;
• - Rhabdoviridae in particular those of the genus Lyssavirus, which includes including the rabies virus;
• Filoviridae which include, in particular, Marburg virus and Ebola virus;
• Flavivirus which includes in particular the yellow fever virus and the hepatitis C virus (HCV), those of the genus Alphavirus and those of the genus Rubivirus, which includes in particular the rubella virus ;
• Coronaviridae especially those of the genus Coronavirus, which includes viruses responsible for respiratory and digestive infections such as Severe Acute Respiratory Syndrome (SARS);
• SARS Severe Acute Respiratory Syndrome
• Arenaviridae in particular those of the genus Arenavirus, which comprises in particular the Lassa virus;
• Bunyaviridae in particular those of the genus Bunyavirus, Hantavirus, Phlebovirus;
• Retroviridae in particular those of the genus Lentivirus and especially human immunodeficiency viruses (HIV).
• the peptide or polypeptide of interest may be derived from a protein of the envelope of an influenza virus, in particular of the haemagglutinin (HA) of an influenza virus. and more particularly the HA protein of the H5N1 avian influenza virus. It may be the ectodomain of this protein or a fragment of this ectodomain or a fragment comprising or consisting of one or more epitopes of this ectodomain.
• HA haemagglutinin
• antigenic polypeptides of these viruses can naturally be used, such as the protein or fragment of the HIV GAG polyprotein, the protein or a capsid fragment of the poliovirus or papillomavirus.
• the peptide or polypeptide of interest may be derived from a protein of the outer envelope of one of these viruses. It can be derived from a coronavirus envelope protein, in particular from the protein Spike (S) of a coronavirus, and more particularly the Spike protein of a coronavirus of the severe acute respiratory syndrome (SARS coronavirus or SARS-CoV in English).
• This peptide or polypeptide of interest may in particular comprise or consist of the ectodomain of this protein or a fragment comprising or consisting of one or more epitopes of this ectodomain.
• the peptide or polypeptide of interest of the additional chimeric polypeptide has the ability to recognize a protein present on the surface of target cells, for example dendritic cells, lymphocytes, tumor cells, etc.
• the additional chimeric polypeptide may notably require that said additional chimeric polypeptide comprises an import signal peptide. in the endoplasmic reticulum, so that said additional chimeric polypeptide can be inserted into a vesicular or cellular membrane (the anchoring function in the membrane being provided by the transmembrane domain).
• the additional chimeric polypeptide may comprise one or more import signal peptide (s) in the endoplasmic reticulum.
• import signal peptide in the endoplasmic reticulum is meant a small continuous polypeptide sequence of about 5 to about 60 residues, particularly 15 to 60 residues and more particularly 15 to 30 residues, which allows the passage of a protein carrying it through the membrane of the endoplasmic reticulum, the passage of the protein being complete or partial, stopping the passage of the protein depending on the presence of another additional signal (or other signals) (s).
• the signal peptides for the same destination being interchangeable from one protein to another, any signal peptide allowing the addressing of a protein to the endoplasmic reticulum can be used in the context of the present invention.
• peptide import signal in the endoplasmic reticulum a peptide of 27 residues of sequence SEQ ID NO.:2.
• signal peptide of a membrane protein such as CD4, CD8 and hemagglutinin (HA) proteins
• the signal peptide of a cytokine receptor such as IL1 R1, EGFR1 (HER1) , HER2, HER3 or HER4, or the signal peptide of a secreted protein, for example that of a cytokine.
• a signal peptide chosen from: that of the human CD4 protein (peptide of sequence SEQ ID NO.:49) or mouse CD4 (peptide of sequence SEQ ID NO.:50), that of the CD8 protein mouse alpha (peptide of sequence SEQ ID NO.:51), bovine alpha CD8 (peptide of sequence SEQ ID NO.:52), human CD8 alpha (peptide of sequence SEQ ID NO.:53), or rat CD8 alpha (peptide of sequence SEQ ID NO.:54), that of human IL1 R1 receptors (peptide of sequence SEQ ID NO.:55), human EGFR1 (HER1) (peptide of sequence SEQ ID NO.:56), human HER2 ( peptide of sequence SEQ ID NO.:57), human HER3 (peptide of sequence SEQ ID NO.:58) or human HER4 (peptide of sequence SEQ ID NO.:59), or that of mouse cytokines IL-2 (peptide of sequence SEQ ID NO .: 60), mouse
• said import signal peptide in the endoplasmic reticulum may be part of the peptide or polypeptide of interest of the additional chimeric polypeptide. This is for example the case when said peptide or polypeptide of interest is a membrane protein or a cytokine.
• said import signal peptide in the endoplasmic reticulum may be part of one of the membrane domains (particularly a transmembrane domain) of the additional chimeric polypeptide. This can be for example the case when the transmembrane domain or one of the domains membrane of said polypeptide is derived from a receptor with seven transmembrane domains.
• said import signal peptide does not belong to any of the three main domains (namely the domains: peptide or polypeptide of interest, transmembrane domain, CD domain or its mutated derivative), and is, therefore, added in addition to these three domains in additional chimeric polypeptide. It can then be placed at different locations in the linear sequence of said polypeptide, but is generally at an end of said polypeptide and is preferably in an N-terminal position in said polypeptide.
• a second import signal peptide in the endoplasmic reticulum is added to the additional chimeric polypeptide, it can optionally increase the membrane targeting.
• the additional chimeric polypeptide In a mature form, particularly when it is anchored in the membrane of a membrane vesicle, for example an exosome, the additional chimeric polypeptide generally does not comprise or more than a signal peptide N- or C-terminal import in the endoplasmic reticulum; after it has fulfilled its function, the N- or C-terminal signal peptide can be separated from the polypeptide by proteolytic cleavage, for example in the endoplasmic reticulum or in Golgi.
• the present invention also relates to a membrane vesicle, and more specifically to an exosome, which comprises a chimeric polypeptide of the invention of the invention, and / or one or more degradation product (s) of said chimeric polypeptide of the invention.
• this degradation product (s) possibly being associated with a major histocompatibility complex (MHC) type I and / or type II molecule.
• MHC major histocompatibility complex
• a degradation product comprises or consists of a fragment of the peptide or polypeptide of interest, in particular a fragment comprising or consisting of one or more epitopes of said peptide or polypeptide of interest.
• the membrane vesicle of the invention comprises, besides the chimeric polypeptide of the invention, and / or its possible degradation product (s), a or more additional chimeric polypeptide (s) described in the application, and / or one or more degradation product (s) of this additional chimeric polyeptide (s), the (s) product (s) of degradation of the additional chimeric polypeptide (s) being optionally associated with a molecule of the major histocompatibility complex (MHC) of type I and / or or type II.
• MHC major histocompatibility complex
• the vesicle of the invention which comprises a chimeric polypeptide of the invention may be used in combination with a membrane vesicle (in particular an exosome), hereinafter referred to as "additional membrane vesicle” (and in particular “additional exosome”).
• a membrane vesicle in particular an exosome
• additional membrane vesicle and in particular “additional exosome”
• this (s) degradation product (s) being optionally associated with a molecule of the major histocompatibility complex (MHC) type I and / or type II.
• MHC major histocompatibility complex
• the membrane vesicle of the invention may comprise:
• a chimeric polypeptide of the invention in which the peptide or polypeptide of interest is a cytosolic protein, for example an antigen, a G protein, a enzyme (for example a cytosolic enzyme which is defective in target cells), a toxin or any other cytosolic peptide or polypeptide that may have a deleterious or otherwise beneficial effect on a target cell, or a peptide or polypeptide capable of fixing a particular nucleic acid, said chimeric polypeptide of the invention being optionally labeled, for example by a first fluorophore;
• an additional chimeric polypeptide in which the peptide or polypeptide of interest is for example a receptor (for example a receptor with multiple membrane domains and in particular a CXCR4 or GPR receiver) or any other peptide or polypeptide which makes it possible to target a target cell or a particular type of target cells (for example tumor cells or cells presenting a metabolic or functional disorder), said additional chimeric polypeptide being preferably labeled, for example by a second fluorophore ( distinct from the first fluorophore).
• a receptor for example a receptor with multiple membrane domains and in particular a CXCR4 or GPR receiver
• any other peptide or polypeptide which makes it possible to target a target cell or a particular type of target cells (for example tumor cells or cells presenting a metabolic or functional disorder)
• said additional chimeric polypeptide being preferably labeled, for example by a second fluorophore ( distinct from the first fluorophore).
• Such a vesicle of the invention can have many applications and can be used in particular to modify the content of target cells.
• this vesicle When administered to a cell, a population of cells or a human or non-human host, this vesicle may be internalized by certain cells (e.g., dendritic cells or tumor cells) targeted via the peptide or polypeptide of interest present in the additional chimeric polypeptide (or via its possible degradation product (s)) of this vesicle.
• the target cells internalize the peptide or polypeptide of interest of the chimeric polypeptide of the invention present in this vesicle, which, depending on the nature of said peptide or polypeptide of interest, may have various applications, and in particular to permit, to allow (to:
• the membrane vesicle of the invention may be used in particular to produce, in vivo or in vitro, monoclonal or polyclonal antibodies, vaccinating or non-vaccinating, directed against said peptide or polypeptide. interest or their fragment.
• Such antibodies can be used in particular in diagnosis or for studying protein interactions, in particular for performing high-throughput screens of molecules such as drugs or cytokines capable of interacting with the peptide or polypeptide of interest or fragment thereof.
• the membrane vesicle of the invention may be used in vivo, in immunization, to elicit or promote, in a host (human or non-human), a humoral response. and / or cell against a tumor, or against the virus, bacterium or parasite whose peptide or polypeptide of interest derives.
• the immune response elicitée or favored for the membrane vesicle of the invention, in particular by an exosome of the invention may be, depending on the nature of the polypeptides associated with exosomes, a tolerogenic or defense response.
• a tolerogenic response may allow, for example, the host to fight against asthma or to support a transplant.
• a vesicle of the invention also comprising an additional chimeric polypeptide may be used in particular to produce or select or target in vivo or in vitro prokaryotic or eukaryotic cells or viruses (eg phages) or ribosomes interacting directly or indirectly with said peptide or polypeptide of interest or fragment thereof.
• said peptide or polypeptide of interest of the additional chimeric polypeptide, or the fragment of said peptide or polypeptide of interest is exposed (partially or wholly) in its native conformation to the surface of the membrane vesicle .
• the peptide or the polypeptide of interest of the additional chimeric polypeptide or the fragment of said peptide or polypeptide of interest is included in part or in whole in the membrane of the membrane vesicle of the invention, and or included partially or wholly in the cytosolic fraction of said membrane vesicle.
• composition in particular a therapeutic (for example pharmaceutical) composition or an immunogenic composition, the active principle of which comprises one or more chimeric polypeptide (s) of the invention or one or several meniscan vesicle (s) of the invention, in particular one or more exosome (s) of the invention is also part of the invention.
• a therapeutic (for example pharmaceutical) composition or an immunogenic composition the active principle of which comprises one or more chimeric polypeptide (s) of the invention or one or several meniscan vesicle (s) of the invention, in particular one or more exosome (s) of the invention is also part of the invention.
• said composition further comprises:
• additional membrane vesicle (in particular one or more additional exosome (s)).
• composition may be used (in particular administered to a human or non-human host) in conjunction with another composition, in particular another therapeutic or immunogenic composition, which comprises one or more additional chimeric polypeptide (s) ( s) and one or more additional membrane vesicle (s).
• another composition in particular another therapeutic or immunogenic composition, which comprises one or more additional chimeric polypeptide (s) ( s) and one or more additional membrane vesicle (s).
• said composition (s) further comprises (include) one or more vehicle (s), diluent (s), and / or adjuvant (s) or a combination thereof.
• vehicle s
• diluent s
• adjuvant s
• a formulation in an aqueous, non-aqueous or isotonic solution.
• carrier means, in the present application, any support (that is to say anything that can carry at least one active principle) that does not affect the effectiveness of the biological activity of the active substances of the present invention. the invention.
• Many vehicles are known in the state of the art.
• the vehicles used may be, for example, water, saline, serum albumin, Ringer's solution, polyethylene glycol, water-miscible solvents, sugars, linkers, excipients, pigments, vegetable or mineral oils, water-soluble polymers, surfactants, thickening or gelling agents, cosmetic agents, solubilising agents, stabilizing agents, preserving agents, basifying or acidifying agents or one of their combinations.
• diluent in this application means a diluent, and includes soluble diluents and insoluble diluents.
• An insoluble diluent is generally used when the active ingredient is soluble and a soluble diluent when the active ingredient is insoluble.
• An "insoluble" active ingredient may be totally insoluble in an aqueous medium or have a limited solubility (ie a solubility of less than 10 mg / ml in 250 ml of water at a pH of 1.0 to 7.5) in an aqueous medium.
• insoluble diluents examples include microcrystalline cellulose, silicified microcrystalline cellulose, hydroxymethylcellulose, dicalcium phosphate, calcium carbonate, calcium sulfate, magnesium carbonate, tricalcium phosphate, and the like.
• soluble diluents include mannitol, glucose, sorbitol, maltose, dextrates, dextrins, dextrose, etc.
• adjuvant means, in the present application, a product which, added to the contents of an immunogenic composition, in particular to a vaccine, increases the intensity of the immune reaction induced in the host (human or non-human) to which said composition is administered.
• An adjuvant can in particular increase the amount of specific antibodies that said mammal is capable of producing after the administration of said composition and thus increases the effectiveness of the immunization.
• Adjuvants are particularly useful when the antigen used alone causes only a weak immune response to provide good protection, to reduce the amount of antigen to be administered to a host, or to facilitate certain modes of administration of said composition, for example in the case of mucosal administration.
• the adjuvants that may be used in the context of the invention are, in particular, saponins, aluminum phosphate (alum), peptidoglycans, carbohydrates, peptides, for example muramyl dipeptide (N-acetylmuramyl-L- alanyl-D-isoglutamine, MDP), oil / water emulsions, polysaccharides, cytokines, hormones, keyhole limpet hemocyanin, adjuvants of the unmethylated CpG dinucleotide family, adjuvants of the poly IC family, adjuvants of the monophosphoryl lipid A family and nucleic acids, in particular bacterial DNAs or DNAs coding for a protein having an adjuvant effect, for example a growth factor or a cytokine, more particularly GM-CSF or NL4.
• alum aluminum phosphate
• peptidoglycans carbohydrates
• peptides for example muramyl dipeptide (N-ace
• said vehicle (s), diluent (s), and / or adjuvant (s) or combination thereof are substances or a combination of pharmaceutically acceptable substances, that is to say appropriate (s) for administration to a host (e.g. a human, a non-human mammal or a bird) for therapeutic or prophylactic purposes.
• a host e.g. a human, a non-human mammal or a bird
• Such a substance or combination of substance is therefore preferably nontoxic to the host to which it is administered.
• the present invention also relates to a polynucleotide characterized in that it encodes a chimeric polypeptide, according to the universal genetic code, and taking into account the degeneracy of this code.
• polynucleotide covers any molecule of DNA or RNA (mono- or double-stranded).
• This polynucleotide may be naked or, alternatively, it may be inserted into a cloning or expression vector, preferably a vector suitable for expression in eukaryotic cells.
• This vector is preferably a plasmid.
• Said polynucleotide may in particular be assembled by PCR. It preferably comprises from 2000 to 50000 nucleotides.
• code does not necessarily mean that said polynucleotide comprises only the coding portion.
• Said polynucleotide may in fact further comprise expression regulation sequences and in particular comprise a promoter, for example a eukaryotic promoter
• said polynucleotide comprises, as a sequence coding for the CD domain of the chimeric polypeptide of the invention or for the mutated derivative of this CD domain, a sequence comprising or consisting of a sequence chosen from the SEQ ID sequences. NO.5, SEQ ID NO.7, SEQ ID NO. 9, SEQ ID NO. 1 SEQ ID NO. 47 and SEQ ID NO. 94.
• the polynucleotide of the invention further codes for an additional chimeric polypeptide as defined in the present application.
• the polynucleotide of the invention may be used in conjunction with a distinct polynucleotide, hereinafter referred to as "additional polynucleotide", which encodes an additional chimeric polypeptide as defined herein.
• a polynucleotide encoding an additional chimeric polypeptide comprises a sequence coding for an import signal in the endoplasmic reticulum.
• this sequence may be the sequence SEQ ID NO.:1 or a sequence coding for a peptide of sequence SEQ ID NO.:49 to SEQ ID NO.:78.
• the signal peptide coded by this sequence when it is in the N- or C-terminal position in the polypeptide encoded by said polypeptide, can be cleaved at a step of processing the chimeric polypeptide, which usually takes place in the endoplasmic reticulum or in the Golgi.
• polynucleotide of the invention may be placed under the control of regulatory, cloning or expression elements.
• said (said) polynucleotide (s) is (are) inserted into a cloning or expression vector, preferably an expression vector and more preferably a vector suitable for expression in eukaryotic cells.
• Said vector is preferably a plasmid.
• the chimeric polynucleotide of the invention and the additional chimeric polynucleotide may be inserted into the same vector or into two distinct vectors.
• Said polynucleotides are generally placed under the control of a eukaryotic promoter, preferably a strong eukaryotic promoter such as a viral promoter, for example the promoter of a virus chosen from: the SV40 virus, the Rous sarcoma virus, murine leukemia virus (MuLV), human adult T cell leukemia virus (HTLV-I), bovine leukemia virus (BLV), cytomegalovirus, a hybrid promoter derived from these viral promoters or a viral promoter containing modified sequences.
• a viral promoter for example the promoter of a virus chosen from: the SV40 virus, the Rous sarcoma virus, murine leukemia virus (MuLV), human adult T cell leukemia virus (HTLV-I), bovine leukemia virus (BLV), cytomegalovirus, a hybrid promoter derived from these viral promoters or a viral promoter containing modified sequences.
• Said polynucleotides may further comprise a kozak sequence, in particular the ACCATGG nucleotide sequence or an ACCATG derived sequence, in which the ATG sequence corresponds to the initiation codon of the coding sequence.
• said polynucleotides may further comprise an intron.
• said polynucleotides comprise at least one nucleotide linker encoding a polypeptide linker as defined above.
• This nucleotide linker can in particular comprise or consist of a restriction site.
• restriction site is meant a particular nucleotide sequence recognized by a type II restriction enzyme as a cleavage site in the polynucleotide.
• these nucleotide linkers may consist of the nucleotide sequences TCTAGA, or GCTAGC, or CCTGCAGGAAGCGGCGCGCCC which include the restriction enzyme Xbal, Nhe I, and Sbf I-Asc I sites, respectively.
• sequence of said polynucleotide of the invention and / or the sequence of the additional polynucleotide are optimized for use in a host (for example a eukaryotic host), in particular a human being, a non-human mammal and / or a bird.
• a host for example a eukaryotic host
• a human being for example a human being, a non-human mammal and / or a bird.
• the subject of the present invention is also a cloning or expression vector, which is preferably a plasmid, characterized in that it comprises a polynucleotide insert consisting of a polynucleotide of the invention, under the control of regulation, cloning or expression.
• This cloning or expression vector may further comprise a polynucleotide insert constituted by additional polynucleotide, under the control of regulatory elements, cloning or expression.
• this cloning or expression vector may be used in conjunction with another cloning vector, hereinafter referred to as an additional cloning or expression vector, which comprises a polynucleotide insert consisting of an additional polynucleotide, under the control of elements regulation, cloning or expression.
• the invention also relates to a cell culture selected from the group comprising cell cultures of bacteria, primary cell cultures of animal eukaryotic cells and cell lines, said cell culture containing a polynucleotide of the invention, a cloning vector or expression of the invention, or a chimeric polypeptide of the invention. Where appropriate, said cell culture may further comprise an additional polynucleotide, an additional cloning or expression vector, or an additional chimeric polypeptide.
• the present invention also relates to a composition, in particular a therapeutic or immunogenic composition, comprising a nucleic acid characterized in that it comprises or consists of a polynucleotide of the invention, and a carrier, a diluent or a pharmaceutically acceptable vehicle.
• composition of the invention may further comprise a nucleic acid comprising or consisting of an additional chimeric polynucleotide.
• said composition of the invention may be used (in particular administered to a human or non-human host) in association with a (so-called additional) composition comprising a nucleic acid which comprises or consists of an additional polynucleotide, and a pharmaceutically acceptable carrier, diluent or carrier.
• composition (s) further comprises (include) an adjuvant as defined in the present application.
• said nucleic acid (s) is (are) a DNA.
• DNA-based immunogenic compositions target in vivo cells of the host to be immunized, particularly dendritic cells (especially Langerhans cells), which are excellent producers of vaccinating exosomes.
• this immunogenic composition can make it possible to induce the production, by the own cells of a host immunized with said immunogenic composition, of exosomes carrying the peptide or the polypeptide of interest or a fragment thereof.
• said immunogenic composition (s) is (are) a vaccine, in particular a DNA vaccine.
• the subject of the present invention is also a recombinant cell producing exosomes, in particular a cell of the immune system and more particularly a cell of the immune system chosen from mast cells, lymphocytes, in particular B and T lymphocytes, and dendritic cells.
• a recombinant cell producing exosomes in particular a cell of the immune system and more particularly a cell of the immune system chosen from mast cells, lymphocytes, in particular B and T lymphocytes, and dendritic cells.
• Langerhans cells characterized in that it is recombined with one or more polynucleotide (s) of the invention or a cloning or expression vector of the invention and, where appropriate, one or more additional polynucleotide (s), or an additional cloning or expression vector, or that it has absorbed a membrane vesicle of the invention, and / or an additional membrane vesicle.
• the present invention also relates to an element chosen from a chimeric polypeptide of the invention, one or more membrane vesicle (s) of the invention (in particular one or more exosome (s) of the invention) , a polynucleotide of the invention and a composition of the invention for use as a medicament.
• Said elements may be used in particular for the prophylaxis and / or treatment of a bacterial, viral, parasitic, or tumor infection, or of a functional or metabolic deficiency, in particular a deficit enzyme. They are especially intended for use in immunization, in particular for eliciting or promoting (that is to say, amplifying) in vivo, in a host (human or non-human) a humoral and / or cellular response against the tumor, the virus, bacterium or parasite from which the peptide or polypeptide of interest is derived.
• They may especially be used in vivo to elicit or amplify a specific CD4 and / or T CD8 T response directed against the peptide or the polypeptide of interest and / or to produce polyclonal and / or monoclonal antibodies directed against the peptide or the polypeptide of interest, particularly antibodies directed against a peptide or polypeptide comprising or consisting of one or more conformational epitopes.
• these elements are used to target specific cells in vivo.
• Said elements may be used in particular for treating target cells in a human or non-human host (by the provision of an enzyme for example), and / or for destroying target cells in a human or non-human host and / or to induce an immune response directed for example against a cytosolic antigen present in the chimeric polypeptide of the invention in a human or non-human host (for example tumor cells) and / or to make a diagnosis (for example by detecting a nucleic acid bound to the peptide or polypeptide of interest of the chimeric polypeptide of the invention).
• said elements can be used in vitro, to screen proteins and / or analyze possible interactions between proteins (for example by detecting possible energy transfers between two fluorophores used).
• the subject of the present invention is also the use of one of these elements for the manufacture of a medicament intended for the prophylaxis and / or treatment of a functional or metabolic deficiency, in particular an enzymatic or tumor deficiency. or an infection by a pathogenic organism or a pathogen, in particular a bacterial, viral or parasitic infection, and / or to elicit or amplify an immune response for example as described above.
• compositions of the invention Following the administration of a composition of the invention, the active principle of which is a polynucleotide of the invention (and, where appropriate, an additional polynucleotide) or one or more vesicles the mennbran (s) of the invention (and, if appropriate, one or more additional meninglab (s)), to a host (human or non-human), the exosome-producing cells thereof.
• host particularly dendritic cells, will produce exosomes, comprising a chimeric polypeptide and / or a degradation product thereof, this degradation product can naturally associate with a molecule of the major histocompatibility complex.
• These membrane vesicles are used to elicit or promote an immune response against the peptide or polypeptide of interest.
• a “host” as used herein refers to a human or a non-human animal.
• non-human animal as used in this application includes any non-human mammal, including a rodent (particularly a mouse, rat, hamster or rabbit), a monkey, a camelid, a cat, a dog, a horse, a mullet, a cow, a sheep, a pig, and also includes a bird, especially a chicken.
• infection means that said host (human or non-human) has been exposed to a particular pathogen or pathogen to an enveloped virus as defined herein.
• infectious is capable of evolving towards clinical signs of pathologies induced or accompanying said infection.
• the term “infection” therefore also includes any clinical sign, symptom or disease occurring in a host (human or non-human) following exposure to a pathogen or pathogen.
• a "viral infection” or “bacterial infection” as used herein includes both the earliest phases of viral, bacterial or parasitic contamination, the intermediate phases, and the later phases of the infection. contamination, as well as the various pathologies that are the consequence of the contamination of a host by a virus, by bacteria or by a parasite, it also includes the presence of all or part of genome of a pathogenic organism.
• prophylaxis refers to any degree of delay in the onset of clinical signs or symptoms of infection or the appearance of a tumor or any other condition, in particular a functional or metabolic deficiency (eg an enzyme deficiency), as well as any degree of inhibition of the severity of clinical signs or symptoms of infection or tumor, including, but not limited to, total prevention of infection or cancer.
• a functional or metabolic deficiency eg an enzyme deficiency
• the chimeric polypeptides described in the application in particular the chimeric polypeptide of the invention
• the membrane vesicles described in the application in particular membrane vesicles of the invention
• the compositions described in the application in particular the compositions of the invention of the invention
• is administered to the host may be exposed to a pathogenic organism or a pathogen and / or likely to develop a tumor or any other pathologies, in particular a functional deficit or metabolic, before the appearance of any clinical sign or symptom of the disease.
• Prophylactic administration may take place before said host is exposed to the organism or pathogen responsible for the infection, or at the time of exposure. Such prophylactic administration serves to prevent, and / or reduce the severity of any subsequent infection.
• Prophylaxis within the meaning of the present application also covers the total prevention of an infection or cancer or any other pathologies.
• treatment is meant the therapeutic effect produced on a host by the chimeric polypeptides described in the application (in particular the chimeric polypeptide of the invention), the polynucleotides described in the application (in particular the polynucleotide of the invention ), the membrane vesicles described in the application (in particular the membrane vesicles of the invention), or one of the compositions described in the application (in particular the compositions of the invention), when they are administered to said host at the time of exposure to an organism or pathogen after exposure or after the appearance of clinical signs or symptoms of the infection or after the appearance of a tumor.
• the active substances of the invention are administered to a host after contamination by a virus, they can be administered during the primary infection phase, during the asymptomatic phase or after the appearance of clinical signs or symptoms of the virus. sickness.
• treatment includes any curative effect obtained by virtue of an active substance of the invention, as well as the improvement of the clinical signs or symptoms observed in the host (human or non-human), as well as improvement of the condition of the host.
• treatment covers in particular the slowing down, the decrease, the interruption, as well as the stopping of a viral, bacterial or parasitic infection or the growth of tumors or any other pathologies and / or the harmful consequences. infection or appearance of the tumor or any other pathology; a treatment does not necessarily require the complete elimination of all clinical signs of infection or tumor and / or all symptoms of the disease, or even the complete elimination of the virus, bacteria, parasites or tumor cells, or functionally deficient cells.
• the active substances of the invention can therefore be administered to a host that presents risks of being exposed to an organism or a pathogen and to develop an infection or a tumor (prophylaxis) or after exposure of the host to an organism or pathogen, in particular after the onset of the first clinical signs or symptoms of the disease, for example after virus, bacteria, parasites or tumor-specific proteins or antibodies have been detected in the blood of the host (treatment).
• the invention also relates to a method for preventing and / or treating a viral, bacterial or parasitic infection or a tumor or any other pathology, said method comprising at least one step of administration in vivo, to a host requiring it, of the chimeric polypeptide, one or more membrane vesicle (s) of the invention (in particular one or more exosome (s) of the invention), a polynucleotide of the invention or a composition immunogen of the invention.
• Said method of treatment is, in particular, suitable for and intended to elicit or promote, in vivo, in said host, a humoral and / or cellular response against the tumor, the virus, the bacterium or the parasite whose peptide or polypeptide interest drifts.
• administration and “administer” as used in this application include any administration, regardless of the route of administration chosen.
• the routes of administration and the dosages vary according to a variety of parameters, for example depending on the state of the host, the type infection and the severity of the infection to be treated or the importance of the tumor.
• the chimeric polypeptide, as well as one or more vesicle (s) membrane (s) of the invention (in particular one or more exosome (s) of the invention), the polynucleotide of the invention or a composition of the invention are capable of being administered to a human or non-human host in dry, solid form (in particular cachet, powder, capsule, pill, granule, suppository, polymeric capsule or tablet, and more specifically accelerated release tablet, gastroresistant tablet) or sustained-release tablet), in gelatinous form or in the form of a solution or a liquid suspension (in particular syrup, solution for injection, infusible or drinkable, nebulisates, microvesicles, liposomes) or in the form of a patch.
• a human or non-human host in dry, solid form (in particular cachet, powder, capsule, pill, granule, suppository, polymeric capsule or tablet, and more specifically accelerated release tablet, gastroresistant tablet) or sustained-release tablet), in gelatin
• These compounds may also be in the form of dry form doses (powder, lyophilizate, etc.) to be reconstituted at the time of use using a suitable diluent. Moreover, they can be packaged for administration in the form of a single dose (single dose) or multiple dose (multidose).
• the active substances of the invention may be formulated for enteral, parenteral (intravenous, intramuscular or subcutaneous), transdermal (or transdermal or percutaneous), cutaneous, oral, mucosal, in particular transmucosal, nasal, ophthalmic, otological (in the ear), vaginal, rectal, intragastric, intracardiac, intraperitoneal, intrapulmonary or intratracheal.
• compositions of the invention in particular immunogenic compositions of the invention
• a second therapeutic agent in particular an antiviral, antibacterial, antiparasitic or antitumor agent.
• an immunogenic composition based on a polynucleotide of the invention in particular with a DNA vaccine of the invention.
• an immunogenic composition based on said vesicles or an immunogenic composition whose active ingredient is a chimeric polypeptide of the invention or one or more fragment (s) thereof can be obtained in particular by purification or by chemical synthesis.
• a host initially with the membrane vesicles of the invention or an immunogenic composition based on said vesicles, then, in a second step, with an immunogenic composition based on a polynucleotide of the invention, in particular with a DNA vaccine of the invention.
• the immunogenic compositions based on a polynucleotide of the invention and in particular the DNA vaccines of the invention are preferably administered to a host intramuscularly or subcutaneously, using either a needle and a syringe, or a needle-free injector, in particular a compressed air gun capable of propelling, inside the cells of a host, DNA-loaded gold, tungsten or platinum microbeads ("biolistic" pistol or pistol gene), for example the "Helios® Gene Gun System” pistol from BioRad.
• the amount of active ingredient administered to a human or non-human host is a therapeutically effective amount, i.e., an active, sufficient amount, at dosages and for periods of time required, to achieve a significant effect and particularly provide a significant benefit to the host as part of an administration for prophylaxis or treatment as defined in this application.
• a therapeutically effective amount is also an amount for which the beneficial effects outweigh any toxic or deleterious effect of the active ingredient (s).
• Such amount may be an amount sufficient to inhibit viral replication, bacterial proliferation, or tumor growth significantly or to remove, reduce, or ameliorate any existing infection caused by the pathogen or agent.
• the therapeutically effective amount varies depending on factors such as infection status, age, sex, or weight of the host.
• the subject of the present invention is also a process for obtaining in vivo membrane vesicles, in particular exosomes, characterized in that it comprises a step of administering a chimeric polypeptide of the invention (and optionally an additional chimeric polypeptide), of one or more membrane vesicle (s) (s) of the invention, in particular one or more exosome (s) of the invention (and optionally one or more additional vesicle (s) membrane (s)), a polynucleotide of the invention (and optionally an additional polynucleotide), or a composition of the invention (and optionally an additional composition), to a host (human or non-human).
• This method can be implemented in particular in the context of a method for the prophylaxis and / or treatment of a tumor or infection by a pathogenic organism or a pathogenic agent, in particular a bacterial, viral or parasitic infection. .
• the present invention furthermore relates to a process for the in vitro production of membrane vesicles and in particular to exosomes comprising a peptide or a polypeptide of interest and / or a degradation product of this peptide or a polypeptide of interest, this product of degradation which may be associated with a molecule of the major histocompatibility complex.
• the method comprises the following steps:
• the exosome-producing cell is a cell of the HEK293 line, or a derived line, or a cell of the immune system.
• the cell of the immune system may be selected from mast cells, lymphocytes, in particular T and B lymphocytes, and dendritic cells.
• the immune system cell is preferably a dendritic cell, for example a Langerhans cell.
• step a) consists in bringing into contact one or more membrane vesicle (s) of the invention, in particular one or more exosomes (s) of the invention, with a dendritic cell.
• said method further comprises an intermediate step between steps a) and b), during which the cell is selected and / or stimulated to induce and / or increase the secretion of exosomes or to obtain exosomes having defined qualities, in particular for inducing a specificity in the composition of exosomes in certain cellular proteins, for example the ICAM protein.
• the introduction of one or more polynucleotide (s) of the invention into an exosome-producing cell in step a) is carried out by transfection or by transduction.
• step c) is carried out by purifying the membrane vesicles and in particular the exosomes from the culture supernatant of the exosome-producing cell by differential centrifugation, by ultrafiltration, by adsorption on a support, or by any other method.
• membrane vesicles and in particular the exosomes obtained by this method also form part of the invention.
• the present invention also relates to the use of one or more vesicle (s) membrane (s) of the invention (and, where appropriate, one or more vesicle (s) membrane (s) additional (s) )), or a membrane vesicle-based composition (s) of the invention (and, if appropriate, an additional composition), to produce antibodies against the peptide or polypeptide of the present invention. interest, these antibodies being intended for use in diagnosis or research.
• the present invention also relates to a method for preparing a polyclonal serum directed against one or more peptide (s) or antigenic polypeptide (s) of interest expressed on the surface of membrane vesicles, in particular exosomes, said method comprising the following steps:
• step a) is followed by a sacrifice step of the non-human animal.
• the present invention also relates to two processes for the preparation of monoclonal antibodies directed against one or more peptide (s) or antigenic polypeptide (s) expressed on the surface of or in membrane vesicles, in particular those exosomes.
• the first method comprises the following steps:
• the second method for preparing monoclonal antibodies comprises the following steps:
• a host human or non-human
• the invention makes it possible in particular to produce cytosolic antibodies.
• the immortalization of the antibody-producing cells in step a) can be carried out in particular by infection of these cells with a immortalizing virus.
• This immortalizing virus can be a herpes virus, for example Epstein-Barr virus.
• This immortalization can also be effected by modifying the genome of the antibody-producing cells with an immortalizing component.
• This immortalizing component may be a viral component, for example of a herpesvirus, or a cellular gene, for example the telomerase gene.
• the non-human animal to which membrane vesicles, an immunogenic composition or a polynucleotide of the invention has been administered in the context of the process for the preparation of a polyclonal serum or methods for the preparation of monoclonal antibodies may in particular be a rodent (in particular a mouse, for example a Balb / c mouse, a rat, a hamster or a rabbit), a bird, in particular a chicken, or a mullet.
• a rodent in particular a mouse, for example a Balb / c mouse, a rat, a hamster or a rabbit
• a bird in particular a chicken, or a mullet.
• the spleen cells or the antibody-producing cells of step a) have previously been obtained in a non-human host after a sacrifice step said non-human animal.
• the monoclonal or polyclonal antibodies produced by the antibody preparation methods of the invention may be "humanized”, i.e., genetically engineered so as to replace as much as possible the Fc constant fragments of the invention. species of origin by human fragments.
• the present invention also relates to the use of a chimeric polypeptide of the invention (and, if appropriate, an additional chimeric polypeptide), of one or more vesicle (s) membrane (s) of the invention (and, if appropriate, one or more additional membrane vesicle (s)), or a composition of the invention (and optionally an additional composition), for the detecting (in particular in vitro) specific partners capable of interacting with said peptide or a polypeptide of interest or with a fragment of said peptide or a polypeptide of interest.
• the present application also relates to a method for in vitro screening of molecules or a method for selecting cells producing molecules interacting with a peptide or a polypeptide of interest or with a fragment of said peptide or a polypeptide of interest, said method comprising: a) contacting membrane vesicles of the invention with one or more molecules capable of interacting with said peptide or polypeptide of interest present in the additional chimeric polypeptide;
• the interactions between said peptide or polypeptide of interest and a possible partner can be demonstrated in vitro by any technique making it possible to demonstrate protein interactions and in particular between a protein and its ligand, for example, by coimmunoprecipitation experiments, by for example by ELISA, for example by flow cytofluorometry, for example by SDS-PAGE or Western blot analysis, as well as by any high throughput screening technique for demonstrating protein interactions and in particular between a protein and its ligand, for example techniques measuring changes in inositol phosphates, or cAMP, or calcium, or energy transfers (eg FRET or BRET technique) between molecules or between two domains of molecules.
• any technique making it possible to demonstrate protein interactions and in particular between a protein and its ligand for example, by coimmunoprecipitation experiments, by for example by ELISA, for example by flow cytofluorometry, for example by SDS-PAGE or Western blot analysis, as well as by any high throughput screening technique
• the membrane vesicles used in step a) of the screening method of the invention are such that at least one peptide or polypeptide of interest or at least one of their fragments is exposed, in part or in total, outside of said membrane vesicle.
• Said peptide or polypeptide of interest may be in particular a multiple transmembrane domain receptor, for example the CXCR4 receptor or a receptor comprising a single transmembrane domain, for example the CD4 or EGF-R1 receptor.
• the subject of the present invention is also a kit comprising a polynucleotide of the invention and a leaflet for use, and, if appropriate, an additional polynucleotide.
• FIG. 1 Representation of the different types of CD8-CD TM constructions studied.
• Construction X2 sequence SEQ ID NO. 79 and SEQ ID NO. 80: the ectodomain (ED) of CD8 is fused with the transmembrane (tmD) and cytoplasmic (CD) domains of the BLV TM protein.
• This construction retains the two palmitoylation sites Cys 1 and Cys 2 as well as the non-palmitoylable regulatory cysteine residue (Cys 3) of the BLV TM protein.
• Construction X3 (SEQ ID NO.81 and SEQ ID NO.82): ED and a portion of CD8 tmD are fused with a tmD portion of BLV and all CD TM BLV. BLV's TmD is then amputated from its first 15 residues. This construct retains the two palmitoylation sites (the cysteine residues at positions 153 and 158) as well as the non-palmitoylable regulatory cysteine residue (the cysteine residue at the C-terminal position, Cys 3) of the BLV TM protein.
• Construction X4 (sequence SEQ ID NO.83 to SEQ ID NO.86): The bulk of CD TM BLV is retained.
• the transmembrane domain of mouse CD8 alpha is linked by a "RSR" sequence linker to the CD domain of the BLV TM protein.
• This construct contains only the non-palmitoylable regulatory cysteine residue (Cys 3) of the BLV TM protein.
• Figure 2 Summary of the sequences of the chimeric proteins obtained from the mouse CD8 alpha protein and the BLV TM protein. The underlined residues correspond to the transmembrane helical residues of the CD8 alpha and TM proteins. The three cysteine residues of mutated BLV TM protein (substitution with an alanine residue) are indicated by C1, C2 and C3.
• the chimeric proteins created correspond to the constructs X2 (sequence SEQ ID NO.79 and SEQ ID NO.80), X3 (sequence SEQ ID NO.81 and SEQ ID NO.82) and X4 (sequence SEQ ID NO.83 to SEQ ID No.86).
• Figure 3 DNA preparations by the STET method.
• the numbers 1 to 7 correspond to the sample numbers of the STET products.
• "M” represents the size marker.
• the bands corresponding to the super-coiled plasmid DNA are framed.
• Figure 4 Control of the presence of DNA in column purification products. The bands corresponding to the super-coiled plasmid DNA are framed.
• A DNA obtained by the STET method and deposited on a column.
• E and E ' Fractions retained on the column then eluted.
• FT Fraction not retained.
• M Size marker.
• Figure 5 Spectrometric assays of the aliquots and adjustment of the concentrations of the DNA after enzymatic digestion. The double arrow indicates that the concentrations have been readjusted.
• Figure 6 DNA identity control after enzymatic digestion. Discriminations of CD8-CD TM mutants. A: discrimination of mutants pX2 AAC and pX2 CCA. B: X2 mutant discrimination between them.
• FIG. 7 Western Blot analysis of the expression of the different CD8-CD TM chimeras.
• the CD8-CD TM chimera is indicated by an arrow.
• Figure 8 Western Blot analysis of the expression of the different CD8-CD TM chimeras after immunoprecipitation.
• the CD8-CD TM chimera is indicated by an arrow.
• Figure 9 Western Blot analysis of CD8-CD TM expression in isolated exosomes by ultracentrifugation. The signal at 55 kDa corresponds to the presence of CD8-CD TM.
• Figure 10 Western blot analysis of CD8-CD TM content of isolated vesicles after sucrose density gradient sedimentation, for mutants pX4 -C and pX4 -A.
• FIG. 11 Western Blot analysis of the expression of CD8-CD TM after cell lysis, according to the presence or absence of vesicular transport inhibitors.
• the CD8-CD TM chimera is indicated by an arrow.
• Figure 12 Western Blot analysis of the expression of CD8-CD TM within the exosomes, according to the presence or absence of vesicular transport inhibitors.
• the CD8-CD TM chimera is indicated by an arrow.
• Figure 13 Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype A - HEK293 cells transfected with pX2 CAC. This phenotype is found in the pX2 mutants conserving the Cys 3: pX2 CCC, pX2 ACC, pX2 CAC and pX2 AAC. (See results section, "Immunofluorescence localization)
• Figure 14 Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype B - Cells transfected with pX2 CAA. This phenotype is found in pX2 mutants which do not retain Cys 3: pX2 CCA, pX2 ACA, pX2 CAA and pX2 AAA. (See results section, "Immunofluorescence localization)
• Figure 15 Confocal immunofluorescence imaging assay for general phenotypes - Phenotype C - Cells transfected with pX3 CCC. This phenotype is found in the two pX3 mutants studied: pX3 CCC and pX3 ACC. (See results section, "immunofluorescence localization")
• Figure 16 Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype D - Cells transfected with pX4 ⁇ C. This phenotype is found in the two pX4 mutants studied: pX4 ⁇ C and pX4 -A. (See results section, "Immunofluorescence localization)
• FIG 17 Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype E - Cells transfected with pX4 stp. This phenotype is found only in pX4 stp. (See results section, "Immunofluorescence localization)
• Figure 18 Confocal immunofluorescence imaging analysis of perinuclear areas with a strong FITC signal. Cells transfected with pX3 CCC.
• Figure 19 Representation of the CD TM mutant panel.
• FIG 20 Scheme of the Topo® plasmid (pCR-Blunt ll-TOPO) used to clone the different PCR products.
• the Topo vector provided in the Topo-blunt cloning kit (Invitrogen) is linearized and has, at each of its 3'-phosphate ends, the Topoisomerase I of vaccinia virus, which makes it possible to ligate the PCR products with the linearized Topo vector.
• Figure 21 Expression vector pBluescript II KS (+).
• Figure 22 Schematic of the plasmid pKSII-CD8 ⁇ .
• Figure 23 Schematic of the retroviral plasmid pLPCX used for the expression of chimeric genes. These genes are introduced at the multiple cloning site.
• Figure 24 Schematic of the final chimeric constructs cloned into the pLPCX retroviral expression vector.
• Figure 25 Visualization of expression and exosomal targeting of chimeric proteins.
• the anti-CD TM rabbit sera and anti-CD8 ⁇ are diluted to 1/200 th.
• the rabbit anti-IgG secondary antibody coupled to peroxidase is diluted 1/5000 th .
• Figure 26 Comparative results of CD8 ⁇ detection experiments associated with exosomes by flow cytofluorimetry and Western Blot. Table giving the results of the expression and the targeting towards the exosomes of the various chimeric proteins analyzed. The mutants reported by a star are significant for exosomal targeting. The presence of CD8 ⁇ on the exosomes is detected by flow cytofluorimetry using a fluorescent mouse monoclonal antibody specific for a conformational epitope of the CD8 ⁇ protein (antibody 53-6.7 from Pharmingen).
• Figure 27 Expression of CD8 on the surface of exosomes. Histogram representing the average of the measurements of the exposure of each chimeric protein to the surface of the exosomes. These measurements were performed by flow cytofluorimetry.
• the chimeric proteins analyzed are: 1: negative control (pLPCX expression vector containing CD8 ⁇ alone); 2: KS5; 3: KS6; 4: KS8; 5: KS9; 6: KS10; 7: KS12; 8: KS14; 9: wild sequence; 10: no construction; 11: KM4; 12: KM5; 13: S; 14: KTMY; 15: KM8; 16: E; 17: KM9; 18: KM1 1/1; 19: KM1 1/3; 20: D and 21: KM13.
• the observed results confirm the results presented in Figures 25 and 26.
• FIG. 28 Representation of various pLPCX expression plasmids obtained after cloning of chimeric genes encoding proteins with single or multiple transmembrane domains.
• Figure 29 A. Anti-CD TM -BLV Western Blot analysis performed on cellular protein extracts of non-transfected (N-T) HEK293T cells or transfected with the pLPCX expression vectors containing the three constructs coding for the three chimeric proteins.
• the rabbit anti-CD TM -BLV primary antibody is used diluted 1: 200.
• the rabbit anti-IgG secondary antibody coupled to peroxidase is used at 1: 2000.
• B. The sizes of the bands observed correspond to the expected sizes and are noted on the right.
• Figure 30 A. Anti-CD TM -BLV Western Blot analysis performed on exosomal protein extracts produced by non-transfected (N-T) HEK293T cells or transfected with the pLPCX expression vectors containing the three constructs coding for the three chimeric proteins.
• the rabbit anti-CD TM -BLV primary antibody is used diluted 1: 200.
• the rabbit anti-IgG secondary antibody coupled to peroxidase is used at 1: 2000.
• B. The sizes of the bands observed correspond to the expected sizes and are noted on the right.
• Figure 31 Coomassie Blue Revelation of protein fingerprints of different (A) and exosomal (B) cell extracts.
• FIG. 34 Demonstration of targeting in exosomes of SSC and DSC proteins.
• HEK 293 cells (5 ⁇ 10 5 cells) are transfected in the presence of 2 ⁇ l of JetPrime (PolyPIus transfection) with 1 ⁇ g of eukaryotic expression vector DNA (pCDNA 3.1) containing the Src-SNAP-CDTM chimeric genes (lanes 3 and 6), or D-SNAP-CDTM (lanes 2 and 5) or lacking these genes (lane 1 and 4).
• Exosome proteins (A) secreted into the medium and cells are separated by gel electrophoresis (SDS-PAGE) and transferred to Immobilon membrane (Millipore).
• the Western blots are revealed using a rabbit anti-CDTM serum and a secondary anti-IgG rabbit antibody labeled with peroxidase: A) analysis of 2 ⁇ g of exosomes, B) analysis of 20 ⁇ g of cell extract.
• DH5c ⁇ competent bacteria 200 ⁇ are transformed by thermal shock with 12.5 ng of each of the 13 studied DNAs encoding the wild-type CD TM or mutants of the BLV virus, as well as by an insert-free plasmid (pLPCX) acting as negative control.
• the bacteria are then plated on LB / Agar medium containing 50 ⁇ g / ml of ampicillin, at 37 ° C. for 16 hours. They are then stored at 4 ° C.
• a colony of each type of bacteria is then precultured in 3 ml of LB medium containing 100 ⁇ g / ml of ampicillin, at 37 ° C. with shaking, for approximately 8 hours.
• Each pre-culture will serve to inoculate, at 1/200, two vials each containing 250 ml of LB / Amp (100 ⁇ g / ml). Incubation is at 37 ° C, with stirring, for 12 to 16 hours.
• the cultures obtained are centrifuged (GR 412, Jouan) for 20 minutes at a speed of 3600 rpm and at a temperature of 4 ° C.
• the pellets are taken up in 25 ml of STET buffer (8% sucrose, 5% Triton X100, 50 mM Tris-HCl pH 8, 50 mM EDTA) to which 500 ⁇ l of lysozyme (10 mg / ml, Sigma) and 250 ⁇ l of RNase are added. (2 mg / ml, Sigma).
• the tubes are then incubated for 10 min at 100 ° C. and then centrifuged at 16,000 rpm for 30 min.
• the supernatants obtained are incubated for 45 min at 65 ° C.
• STET maxiEstparations allow obtaining large amounts of plasmids, but the degree of purity can be improved.
• each of the 14 plasmids by performing a double pass on AX100 columns (Kit Nucleobond PC 100, Macherey Nagel). After precipitation with isopropanol, the purified plasmids obtained are taken up in 500 ⁇ l of TE1 X and stored at 4 ° C.
• Each type of DNA is aliquoted in 50 or 100 ⁇ g tubes, and precipitation is then carried out with ethanol (EtOH) and NaCl in a laminar flow hood to sterilize the plasmids.
• the pellets obtained are taken up at the rate of 200 ⁇ l of TE1 X per 100 ⁇ g of plasmids, ie a concentration of 500 ng / ⁇ .
• the presence of DNA in the aliquots is verified by electrophoresis on 0.8% agarose gel.
• the aliquots are assayed spectrophotometrically at a wavelength of 260 nm.
• the samples are diluted 1/50 and are assayed in a final volume of 500 ⁇ .
• each plasmid is controlled by digesting 20 ng of each with restriction enzymes (New England Biolabs): Hindlll / Not I, Xba I, Aat II, Pac I, Sfo I. Plasmids are discriminated according to the number of bands obtained and their molecular weight, after electrophoresis on agarose gel (0.8%) of each product of digestion.
• restriction enzymes New England Biolabs: Hindlll / Not I, Xba I, Aat II, Pac I, Sfo I. Plasmids are discriminated according to the number of bands obtained and their molecular weight, after electrophoresis on agarose gel (0.8%) of each product of digestion.
• HEK293 Human Embryonic Kidney cells (HEK293) are cultured in Dulbecco's Modified Eagle's medium (DMEM), supplemented with 10% fetal calf serum (FCS) and 20 ⁇ g / ml gentamicin, at 37 ° C. ° C at 5% CO2.
• DMEM Dulbecco's Modified Eagle's medium
• FCS fetal calf serum
• 20 ⁇ g / ml gentamicin 20 ⁇ g / ml gentamicin
• the cells are then transfected with a polyplexium formed by the complexation, in a NaCl buffer (0.15 M), of 6 ⁇ l of Jet PEI (Qbiogen) and 3 ⁇ g of each nucleic acid to be tested;
• a LacZ-expressing plasmid serves as a positive control for transfection.
• the medium is removed and replaced by complete DMEM with 20 ⁇ g / ml of gentamicin.
• Optimal expression of the plasmids is obtained 48 h after the beginning of the transfection.
• vesicular transport inhibitors bafilomycin and Ly 294002. 32 h after transfection, each inhibitor is added to culture medium at a concentration of 0.5 ⁇ for bafilomycin and 10 ⁇ for Ly 294002.
• the cells are lysed with a 0.5% TNE-NP40 buffer to which 0.1 mM PMSF is added. After clarification by centrifugation (14000 rpm, 15 min, 4 ° C., Eppendorf 5417R), the lysates are determined spectrophotometrically (at 595 nm) according to the Bradford technique.
• the culture media are recovered and precentrifuged at 10,000 rpm for 20 min at a temperature of 4 ° C (Aventi 30, Beckman).
• the supernatants obtained are then ultracentrifuged (Optima LE-80K, Ti 50 rotor, Beckman) at 100000 g for 2 h at a temperature of 4 ° C.
• the pellets obtained are taken up in 100 ⁇ l of CB 1 X.
• the vesicles are then deposited on a sucrose gradient prepared with 8 layers (of 1, 2 ml) of different densities (in molarity): 0.5 / 0.75 / 1/1, 25/1, 5/1, 75 / 2 / 2.5.
• the tubes are then centrifuged (Optima LE-80K, rotor SW 41, Beckman) at 39,000 rpm for 16 hours at a temperature of 4 ° C.
• the gradient is taken by fraction of 700 ⁇ .
• the proteins are then precipitated by addition of the same volume of TCA 30%.
• the tubes are stored for 2 hours at 4 ° C. and then centrifuged (Eppendorf, 5417R) at temperature of 4 ° C for 20 min at 13000 rpm. The pellets are taken up in 500 ⁇ l of acetone and then centrifuged again as before.
• the protein samples obtained are analyzed by western blotting: after migration and separation on acrylamide gel (12.5%), the proteins are transferred to hydrophobic membrane PVDF (Immobillon-P, Millipore).
• transferrin receptors The presence of transferrin receptors is revealed by immunostaining using the following antibodies:
• Mouse anti-human TFR mouse IgG (Dilution 1/200; Zymed)
• Rat Anti-CD8 Rat IgG (53/672) (JIR)
• coverslips coverslips are sterilized with absolute EtOH under a laminar flow hood, then placed in wells of 1, 9 / cm 2 (24-well plates) before being "coated” with poly-L-Lysine ( 25 ⁇ g / ml, Sigma) for 1 hour at 37 ° C. After washing with PBS, the coverslips are stored at 4 ° C. in 1 ml of PBS.
• the HEK293 cells are cultured and transfected according to the method described in the "Analysis of chimeric expression" section. 24 h after transfection, the cells are taken up in 35 ml of complete DMEM, then distributed in wells of 1.9 cm 2 (24-well plates), containing the slides previously sterilized and "coated", at the rate of 1 ml of dilution per well. The cells thus cultured are incubated for 24 hours at 37 ° C. under 5% CO 2.
• the cells are then fixed for 30 min with a solution of formaldehyde (4%) and then permeabilized with Triton X-100 (0.2% final). After 3 rinses of 10 min in PBS, the slides are stored with 1 ml of PBS at 4 ° C.
• BLV bovine leukemia virus
• CD TM protein TM
• the mouse CD8 ectodomain is, in a human cell, a neutral element that does not interfere with cellular receptors.
• the chimeras used thus assure us of the absence of interactions between the ectodomain of the proteins and the cellular structures.
• pX4 stp (pX4 stp is composed only of ED, tmD and a small part of the CD8 CD TM).
• cytoplasmic protein TM (CD TM).
• the DNAs obtained by the STET method are purified on columns, the retained fractions then eluted as well as the non-retained fractions are then analyzed by gel electrophoresis in order to verify the integrity of the purified DNAs obtained.
• the gel shown in FIG. 4 indicates that the super-coiled DNA is present in the pure fractions eluted from the columns (E and E ') but undetectable in the non-retained fractions (FT).
• the purified DNAs are then assayed with the spectrophotometer.
• the concentrations then obtained vary, depending on the aliquots, between 149 ⁇ g / ml and 584 ⁇ g / ml.
• the DNAs of the aliquots are taken up in TE1 X and adjusted to the same concentration.
• CD8-CD TM constructs Digestion of the constructs studied makes it possible to ascertain the identity of each plasmid. Discrimination of the major types of CD8-CD TM constructs is done by analyzing the number and size of the bands obtained after digestion with the enzymes Hind III / Not I and Xba I. The discrimination between the different mutants of the cysteine residues is after digestion with the enzymes Aat II, Pac I and Sfo I. The number of bands then obtained is greater than with digests by Hind III / Not I and Xba I, and the discrimination is carried out based mainly on the presence or absence of specific bands (in bold).
• 7206 bp corresponds to the presence of X2 or X4 constructs in each of the two samples.
• Digestion by Xbal obtaining two bands at about 6822 (or 6812) and 367 bp correspond to the presence of X2 or X3 constructs in each of the two samples.
• Sample 4 the obtaining of a specific band around 3423 bp (red) corresponds to the presence of one of the following X2 plasmids: pX2 CAC, pX2 AAC, pX2 CAA or pX2 AAA.
• Sample 5 the obtaining of a specific band around 4285 bp (blue) corresponds to the presence of one of the following X2 plasmids: pX2 CCC, pX2 ACC, pX2 CCA or pX2 ACA.
• Sample 4 the obtaining of a specific band around 2538 bp (red) corresponds to the presence of one of the following X2 plasmids: pX2 CCC, pX2 ACC, pX2 CAC, pX2 AAC.
• Samples 4 and 5 correspond respectively to pX2 AAC and pX2 CCA mutants.
• the same amount of each of the plasmids was transfected into HEK293 cells.
• the proteins thus expressed are analyzed by gel migration followed by transfer to a PVDF membrane.
• the membranes are then revealed using an Anti-CD TM rabbit serum and a peroxidase labeled anti-rabbit secondary antibody.
• CD8-CD TM In order to lower the threshold of detection of CD8-CD TM within cell lysates, we used a large amount of extract and concentrated the chimeras by immunoprecipitation with monoclonal antibodies specific for a conformational epitope of the CD8 ectodomain .
• the cells After 48 hours of transfection, the cells are lysed and the extracts obtained are assayed according to the Bradford technique. After normalizing the protein concentrations, the extract is immunoprecipitated in the presence of Anti-CD8 and protein A sepharose. The products obtained are analyzed by gel migration and Western Blot revealed with an anti-CD TM antibody (see FIG. 8). Different signals are then observable according to the samples:
• the pX2 AAC sample has a detectable signal at 50KDa in contrast to the analysis performed without immunoprecipitation.
• no signal is detectable for the pX2 CCC, pX2 ACC, pX2 CAC, pX4 stp and pLPCX samples.
• CD8-CD TM chimeras two factors may affect the presence of CD8-CD TM chimeras. These factors are: the presence or absence of tmD BLV, and the presence or absence of the third cysteine residue (Cys 213).
• the culture media are recovered and centrifuged in order to isolate the exosomes.
• the pellets obtained are then analyzed by gel migration and Western Blot revealed with an anti-CD TM antibody (see FIG. 9).
• a 55 kDa signal corresponding to the presence of CD8-CD TM can be visualized according to the samples. This signal is undetectable for pX2 CCC, pX2 ACC, pX2 CAC, pX2 AAC, pX4 stp and pLPCX samples.
• the proteins are precipitated using TCA and analyzed by gel migration and Western Blots revealed with an anti-CD TM antibody and an anti-transferrin receptor (RTf) antibody to detect the presence of cell vesicles (endosomes or exosomes).
• RTf anti-transferrin receptor
• CD8-CD TM with exosomes was detected for all CD TM containing mutants except for pX2's with Cys 213.
• the pX4 ⁇ C and pX4-A mutants appear to be very efficiently targeted in exosomes.
• the mutants pX3 and pX2 not possessing Cys 213 are also found in the exosomes but in lesser proportions than for the pX4 ⁇ C and pX4 ⁇ A mutants.
• vesicular transport inhibitors such as bafilomycin and Ly294002. These inhibitors block the lysosomal degradation pathway, thereby promoting secretion of proteins by exosomes.
• Inhibitors are added to culture media 32 hours after transfection; 16 hours later, the cells are lysed and the culture media are recovered and centrifuged to isolate the exosomes. The samples obtained are then analyzed by gel migration and Western Blot revealed with an anti-CD TM antibody. We thus analyzed the expression of the pX2 CCC, pX2 CCA, pX3 CCC, pX4-C, pX4-A and pX4 stp chimeras (see Figures 11 and 12).
• each type of labeling (see Materials and Methods) is tested, with varying antibody dilutions, on fixed cells expressing pX4 - C or pLPCX.
• a conventional immunofluorescence microscope (ZEISS Axiovert 200 M)
• we tested the different antibodies available see part "Materials and Methods” and determined their effectiveness and their optimal dilutions.
• Several anti-intracellular anti-compartment antibodies appeared to have a nil or aspecific signal.
• Rat IgG 53 / 6.7
• FITC mouse anti-CD8 Pieris, 1/50 dilution
• Cells expressing pLPCX do not display a FITC signal. This control therefore allows us to ensure that the FITC fluorescence visualized for the other mutants is due to the presence of CD8-CD TM.
• HEK293 cells are transfected for 48 hours and then fixed. The observation is carried out using a ZEISS LSM 510 confocal microscope (immersion objective X63).
• CD8 FITC labeling (green) revealing the presence of chimeras containing CD8.
• Lamp3 Cy3 labeling (red) revealing the presence of the Lamp3 protein characteristic of late endosomes.
• CD8-CD TM / Lamp3 Overlay of FITC and Cy3 images. The yellow shade obtained highlights the colocalization of CD8-CD TM with Lamp3.
• CD8-CD TM / Lamp3 [a]: Colocalization of CD8-CD TM (green) with Lamp3 (red).
• CD8-CD TM FITC signal from CD8-CD TM. The intensity parameters have been lowered substantially in order to eliminate any saturation phenomenon of the signal. The FITC signal appears diffuse, homogeneous and not punctuated.
• the labeling from Lamp3 actually appears to be located within this perinuclear zone but is in any case never collocated with FITC labeling (see Figure 18).
• CD8-CD TM labeling of these perinuclear zones appears diffuse, homogeneous and not punctuated, and seems to highlight the presence of CD8-CD TM within a cellular structure.
• the location and appearance of this staining, as well as the absence of actual collocation with Lamp3 suggest the presence of CD8-CD TM in the Golgi apparatus.
• This phenotype is found, more or less intensively, in all mutants, except pX4 stp. In the pX4 ⁇ C and pX4 -A mutants, this phenotype is visible only in a minority of cells, in contrast to the pX2 and pX3 mutants in which it is consistently present.
• the pX4 stp chimera composed solely of ectodomain and CD8 tmD, accumulates in HEK293 cells by being efficiently targeted to the plasma membrane.
• the pX4 -C and pX4-A chimeras accumulate and are found in the plasma membrane but in greater proportions than pX4 stp. These chimeras are very efficiently secreted within exosomes.
• the pX3 chimeras are very present in the Golgi apparatus, unlike the pX4 chimeras. Their targeting within the plasma membrane and in the exosomes seems less effective than in the pX4 chimeras but remains important.
• the pX2 chimeras appear unstable and are found within the TGN but not in the plasma membrane.
• PX2 constructs with Cys 3 are very unstable in cells and are not detected in exosomes.
• the substitution of the terminal Cys in this type of construct seems to contribute to a gain in stability of the chimeric proteins. Indeed, pX2 constructs without Cys3 are detectable in cells and in exosomes.
• BLV TM deletion of the 13 N-terminal residues and substitution of the 2 proline residues of the first PxxP motif (SEQ ID NO.:13 and SEQ ID NO: 14, KM4 mutation);
• deletion of the 13 N-terminal residues and substitution of the 2 proline residues of the second PxxP motif (SEQ ID NO.:15 and SEQ ID NO.:16, KM5 mutation);
• deletion of the 13 N-terminal residues and substitution of the tyrosine residue of the first YxxL motif SEQ ID NO: 23 and SEQ ID NO: 24, KTMY mutation
• deletion of the 13 N-terminal residues and substitution of the tyrosine residue of the second YxxL motif SEQ ID NO: 25 and SEQ ID NO: 26, KM9 mutation
• deletion of the 13 N-terminal residues and substitution of the glutamic acid residue located before the second YxxL motif (SEQ ID NO.:31 and SEQ ID NO: 32, mutation E);
• substitution and deletion mutants were obtained by site-directed mutagenesis; the substituted residues have been replaced by an alanine residue.
• the translational stop of the deletion mutants was obtained by addition of a stop codon (TGA, TAG or TAA codon).
• the DNA sequences coding for the 18 mutants, as well as the wild-type CD TM DNA sequence in which only the 13 N-terminal residues were deleted were -cloned downstream of a sequence coding for the ectodomain of murine CD8 ⁇ .
• the 19 chimeric genes obtained were then cloned into a viral expression vector.
• the recombinant vectors thus obtained were transfected into eukaryotic cells (HEK cells) to analyze the targeting to the exosomes of the resulting chimeric proteins. 48 hours later, the protein expression in the cells was examined by Western Blot. In parallel, the exosomes were purified by ultracentrifugation thus making it possible to evaluate the sorting of the chimeric protein in exosomes by FACS and western blot.
• A (25 ⁇ L): 10 ng of DNA to be amplified, 1 ⁇ M of 10 mM dNTP (200 ⁇ M final each), 1.5 ⁇ L of each of the two sense and antisense primers at 10 ⁇ M (300 nM final), sterile water (qs 25 ⁇ L); and
• the resulting PCR product was kept at 4 ° C.
• DNA sequences coding for the 18 mutants, as well as the wild-type DNA sequence were modified by PCR (site-directed mutagenesis) so that they were flanked by particular restriction sites; the protocol indicated above was implemented, using two primers possessing the restriction sites XbaI and NotI.
• Each of the 19 DNAs was ligated into a TOPO cloning vector (see Figure 20) of the Topo-blunt cloning kit (Invitrogen) for introduction into chemokompetent bacteria.
• the transformed clones were selected and all the DNA sequences checked by sequencing.
• Each of the different PCR products was integrated into an already open-ended TOPO-Bluntll plasmid bearing the kanamycin resistance gene.
• the Top10 chemokompetent bacteria were transformed with these plasmids and cultured on an LB / agar plate (100 g / ml of kanamycin).
• the TOPO-BluntII plasmid without insert served as a negative control and another control (1 ng of plasmid PUC19) was used as a positive transformation control. After culture, only the bacteria transformed with a plasmid containing the insert or PUC19 (positive control) developed in the presence of the selection agent (antibiotic).
• the plasmid DNAs were digested with the restriction enzyme EcoRI which frames the sequences of interest.
• EcoRI The visualization of these digestion products was made on 2% agarose gel where the presence of a fragment (of about 300 bp) constitutes the proof of a recombinant DNA.
• the vector pKSII-CD8 ⁇ (see FIG. 22) was digested successively with the restriction enzymes XbaI and NotI in order to accommodate the inserts. The digestions carried out, the plasmid was dephosphorylated, precipitated with ethanol and purified on 0.8% agarose gel.
• the digested inserts were purified on 2.5% agarose gel. Their reinsertion into the vector pKSII-CD8 ⁇ was carried out by the technique of ligation in the gel.
• a fragment of virgin gel served as a negative control of ligation.
• Plasmid and inserts should be able to establish links between them. It is an enzyme, ligase, that catalyzes the formation of a phosphodiester bond between a 3'-OH end and a 5'-phosphate end of two nucleic acids.
• DH5 ⁇ bacteria are transformed with these plasmids carrying the ampicillin resistance gene.
• colonies are only found in the cells transformed by the ligation products in the presence of CD TM insert. This suggests that the colonies obtained have indeed been transformed by a vector containing an insert between the XbaI and NotI sites.
• pKSI1 expression vector while easy to manipulate by size and restriction sites, does not allow protein expression in eukaryotic cells.
• pLPCX (Clontech Laboratories Inc., see Figure 23), which makes it possible to introduce a gene by both transfection and transduction using a retroviral vector.
• Each chimeric gene was excised from plasmid pKSI1 between XhoI-NotI sites for purification by 2% agarose gel extraction using the Nucleospin Extract II kit (Macherey-Nagel).
• the expression vector pLPCX has also been previously digested by the pair of enzymes XhoI-NotI, dephosphorylated and then precipitated with isopropanol (this step makes it possible to eliminate the short DNA fragment (less than 100 bp) located between Xhol and NotI released during digestion).
• the ligation of the chimeric genes with pLPCX was carried out using T4 DNA ligase (Biolabs) (insert / vector ratio of approximately 3/1 molecule to molecule).
• Stbl2 chemo-competent bacteria MAX Efficiency Stbl2 TM Competent Cells, Invitrogen
• a positive control (1 ng of plasmid pUC19) and a negative control (pLPCX "ligated" without insert) were prepared in parallel. After bacterial culture at 30 ° C. on an agar medium containing 50 ⁇ g / ml of ampicillin, only the bacteria transformed by the positive control or by the ligation products with inserts have developed.
• the cells are transfected with the plasmid containing the LacZ gene and incubated in an X-Gal solution.
• the cell and exosomal lysates resulting from the transfections were analyzed by migration on 10% SDS-PAGE gel, followed by transfer on a PVDF membrane (polyvinylidene difluoride, Immobilon-P, Millipore). These membranes were then revealed using a rabbit anti-CD TM primary serum followed by a peroxidase-coupled rabbit anti-IgG secondary antibody. After revelation, these antibodies are removed and the transfer membranes revealed in the same way but using anti-CD8 ⁇ rabbit serum.
• the major difference between cellular and exosomal proteins is the presence of 2-3 bands for cells and only one for exosomes. This is because the cell contains non-glycosylated and more or less glycosylated forms. Only the correctly glycosylated form is found in the exosomes.
• a 31 kDa migrating band is present in the exosomal lysate of the wild-type CD8 ⁇ -CD TM control whereas it is absent in the lysate of the cells transfected by the negative control. This band is characteristic of the expected chimeric protein.
• the CD8 ⁇ negative control alone has a band around 27kDa which corresponds to the expression and the exosomal targeting of CD8 ⁇ without CD TM.
• a 31 kDa migrating band is present in the exsomal lysate of the wild-type CD8 ⁇ -CD TM control.
• the difference in intensity between the 31 kDa and 27 kDa bands indicates that CD8 ⁇ is much more targeted to exosomes when it is fused to CD TM.
• the chimeric proteins present on the surface of the exosomes were labeled with a mouse monoclonal antibody anti-CD8 ⁇ coupled to fluorescein (antibody 53-6.7 from Pharmingen) and analyzed by cytofluorimeter (FACScan).
• the different chimeric genes have been integrated into a vector retroviral expression method for transfecting HEK 293T eukaryotic cells to obtain the expression of these chimeric proteins.
• the bands observed in western blot suggest that, like the native CD8 ⁇ protein, these proteins are differently glycosylated during their passage in the Golgi apparatus. Only the correctly glycosylated proteins would end up in the exosomes.
• These proteins have undergone the appropriate post-translational modifications, a prerequisite for the expression of conformational epitopes essential for the future elaboration of a vaccine immunity or the screening of therapeutic molecules.
• these glycosylations which are more or less present, lead to multiple diffuse bands which hampered us in the comparative quantification of proteins. To overcome this problem, it will be necessary to treat the lysates with an endoglycosylase to observe a single band on gel.
• Membrane receptors are major targets for the development of therapeutic molecules.
• the high throughput screening of drugs is carried out in particular with receptors with multiple membrane domains expressed on cells in culture.
• this technique entails difficulties of robotization.
• exosomes carrying receptors in particular Multiple domain receptors would be easy to use and well suited for screening because of their stability and ease of handling.
• the present study aimed to produce exosomes carrying single or multi-domain transmembrane receptors, in particular the CxCR4 receptor (chemokine receptor SDS-1 (CXCL-12) and HIV) and the CD4 receptor (HIV receptor). .
• CxCR4 receptor chemokine receptor SDS-1 (CXCL-12) and HIV
• CD4 receptor HIV receptor
• chimeric genes comprise, at the 3 'end, the CD TM -BLV peptide of sequence SEQ ID. NO. : 8, and at the 5 'end, a DNA coding for the human CxCR4 receptor, for a version of the C-terminally truncated CxCR4 receptor with 307 amino acids (CxCR4 (307)) or for a version of the truncated CD4 receptor partly C-terminal with 403 amino acids (CD4 (403)).
• the CD4 and CxCR4 receptors comprise one and seven transmembrane domains, respectively.
• the three chimeric genes were cloned into a pLPCX retroviral expression vector. These different plasmids were transfected into HEK293T human eukaryotic cells in order to observe the expression of the different chimeric proteins in these cells as well as their sorting towards the exosomes.
• the DNAs coding for the CxCR4, CxCR4 (307) and CD4 (403) receptors as well as the coding for the CD TM pilot peptide are amplified by PCR using primers comprising the restriction site sequences that it is desired to integrate into each end of the amplified fragments (the fragments CxCR4, CxCR4 (307) and CD4 (403) will be flanked in 5 'by the EcoRI site and in 3' by the Xbal site and CD TM / BLV will be flanked in 5 'by the Xbal site and 3 'by the Notl site).
• the inserts thus produced are cloned into Topo amplification vectors (see FIG. 20).
• the plasmids obtained are then digested with restriction enzymes and analyzed on agarose gel 1.5%, and sequenced to verify the integrity of their sequence.
• the CD TM / BLV insert is then excised from the Topo vector by enzymatic digestion using the XbaI / NotI pair and then subcloned into the vector.
• amplification pKS2 see Figure 21.
• the recombinant pKS2 vector as well as the recombinant Topo vectors containing the CxCR4, CxCR4 (307) and CD4 (403) inserts are then digested with the restriction enzymes EcoRI and XbaI in order to be able to subclone the CxCR4 and CxCR4 fragments (307). and CD4 (403) in the pKS2 amplification vector, said fragments being placed 5 'to the CD TM peptide coding sequence.
• the different constructs thus obtained are excised from the recombinant pKS2 plasmids by digestion with the EcoRI / NotI enzyme pair and then subcloned into the retroviral expression vector pLPCX (see FIG. 22).
• the vectors obtained are verified by enzymatic digestion using the enzyme pair EcoR1 / Xba1.
• the different plasmids pLPCX are transfected into human eukaryotic cells HEK293T in order to express the chimeric proteins CxCR4 / CD TM, CxCR4 (307) / CD TM and CD4 (403) / CD TM.
• the bands 30, 42, 60 and 83 kDa reveal the presence of the CxCR4 chimera (307) / CD TM.
• the size variation of the bands representing the different isoforms of this chimera is explained by the fact that the CxCR4 receptor is truncated.
• the CD4 (403) / CD TM chimera is characterized by a clearly visible band of 53 kDa.
• these chimeras are all sorted to the exosomes as shown by the presence of bands 36, 42, 62 and 87 kDa (for CxCR4 / CD TM); 30, 38, 48, and 83 kDa (for CxCR4 (307) / CD TM) and the 53 kDa band (for CD4 (403) / CD TM) (see Figure 30).
• CD4 (403) / CD TM -BLV chimera is observed in the HEK293T cells transfected with the plasmid pLPCX CD4 (403) / CD TM -BLV. It seems that the CD TM -BLV pilot peptide promotes a very important sorting of the CD4 (403) / CD TM -BLV chimera towards the exosomes.
• Exosomes in the membrane of which are integrated recombinant proteins and in particular proteins comprising multiple transmembrane domains could be used in vaccinology and as a screening tool.
• SNAP protein is a trade name of NEB (New England Biochemical, Ipswich, MA, USA) for a mutant of the enzyme 06-alkylguanine-DNA alkyltransferase (hAGT). It is involved in the nucleotide synthesis pathway (in DNA repair).
• NEB company's plasmid pSNAPm DNA as DNA template PCR amplifications of the fused DNA fragment between the src fragments. and CDTM.
• SNAP protein can bind several substrates (Keppler et al., 2002, Keppler et al., 2004).
• the interaction properties of cell membranes are the result of numerous cellular proteins, in particular proteins involved in signaling. These proteins interact with the membrane via fatty acids that they acquire post-translationally and also by the presence of basic amino acids that interact with the polar heads of certain fatty acids of the membrane (for example choline). . These fatty acids are generally myristic acids, palmitic acids or geranyl-geranyl.
• the prototype of these proteins is the c-Src oncogene which has a myristoylable glycine at the 2-position and many N-terminal lysines and arginines. It is known that, when fused to a cytoplasmic protein, this N-terminal fragment confers on it the property of binding to the inner face of cell membranes. Many other protein fragments (particularly cellular or viral proteins) binding under the membranes could play the same role as the N-terminal fragment of c-Src if these fragments were fused with a cytoplasmic protein. The location of the fused fragment must retain the membrane binding properties.
• the sub-membrane targeting peptide be located at the N-terminus of the fusion protein.
• myristylation of c-src is only on glycine at position 2.
• acylations for example palmitoylation, the position of the substituted amino acids is generated more internally to the protein sequence.
• the exosomal targeting CD TM sequence used in the chimeric polypeptide of the invention may vary (see for example the many mutants of the CD TM sequence in the previous examples), but it must contain at least the PSAP sequence (or PTAP) and YxxL to be fully effective.
• the Localization of this CD domain in the chimeric polypeptide of the invention does not appear to be crucial for the targeting property to exosomes.
• the optimal location of this CD domain in the chimeric polypeptide of the invention is the C-terminal position.
• the peptide or polypeptide of interest to which these two peptides are added (the CD domain or its mutated derivative and the sub-membrane targeting domain) so that it acquires an exosomal targeting may be of different natures:
• this may be the SNAP protein, as in the CNS and DSC polypeptides described hereinafter.
• this SNAP protein as described, for example, by Keppler et al., 2002 and Keppler et al., 2004), to introduce a fluorophore or a biotin or any other molecules into a protein. particular site in the exosome, for example, at the level of a protein called G protein.
• the peptide or polypeptide of interest of the chimeric polypeptide of the invention may also be a particular enzyme.
• the exosome can thus be used as a vehicle that can deliver this enzyme (in particular cytosolic enzyme) to a cell (in particular a cell of a human or non-human host) or to an organ devoid of this enzymatic activity. This can notably make it possible to treat patients suffering from a disease due to a metabolic or functional deficit.
• the peptide or polypeptide of interest of the chimeric polypeptide of the invention may be an antigen (pathogen, tumor or other).
• the exosome containing it can thus elicit an immune reaction against this antigen, which would be particularly effective because the exosomes are known to be captured by the cells of the immune responses (by the dendritic cells in particular).
• the peptide or polypeptide of interest of the chimeric polypeptide of the invention may be a protein specifically binding a nucleic sequence (eg DNA).
• the exosome of the invention can then fix a nucleic acid easily detectable by PCR, for example, which makes it possible to make the diagnosis.
• An example of a technique for specific binding of a protein to an RNA is given in the article by Bertrand et al. (1998). The technique described by Bertrand et al. is based on the use of the single-stranded RNA phage protein MS2 (Fouts et al., 1997) and an RNA containing multiple copies of a sequence of 19 nucleotides recognized by this protein.
• the synthesis of the chimeric gene encoding the SSC protein is carried out in several steps. First, obtaining a 75 nt synthetic DNA encoding the N-terminus of the c-Src protein. Then separately amplification of 3 DNA fragments: a) synthetic DNA bounded by enzymatic sites EcoR1 upstream and Nhe I downstream; b) the DNA coding for the SNAP protein (NEB) bordered by the Nhe I sites upstream and Sbfl and Ascl downstream; c) the DNA coding for a CDTM fragment with the Sbfl and Ascl sites upstream and Not1 downstream. Finally, amplification is performed using simultaneously as template DNAs the three preceding DNA fragments whose sequences are overlapping; this latter amplification makes it possible to obtain a DNA that links together the three fragments in the order Src-SNAP-CDTM.
• S2 (5'-CCCAGCCAGCGCCGCCGCAAGTCTAGAGGCCCGGGAGGC 3 ') (SEQ ID NO ::109), AS1 (5'GCCTCCCGGGCCTCTAGACTTG 3 ') (SEQ ID NO: 1),
• the synthetic DNA is then amplified by PCR in a mix containing 10 ng of template DNA, primers S1 and AS1, 4 dNTPs, buffer X 1 and 2.5U. of Pfu Turbo DNA-polymerase (Stratagene) under the conditions of the supplier of the enzyme. After 2 min of denaturation at 95 ° C, 25 amplification cycles (95 ° C dry, 67 ° C dry, 72 ° C dry) are performed.
• the nucleotide sequence of the Src fragment (coding for the sub-membrane targeting domain or domain (ii)) is SEQ ID NO.:120.
• the nucleotide sequence of the CD TM fragment (coding for the CD domain or (Ni) domain) is SEQ ID NO.:120.
• the 3 amplifications are carried out under the conditions and according to the recommendations of the company Finnzyme, supplier of the Phusion DNA polymerase used.
• Src GATTCGCCACCATGGGCAGCAGCAAGAGCAAG
• SrcNhel CATGCTAGCGCTGCCTCCCGGGCCTCTAGACTTTC
• NheSNAP (GGAGGCAGCGCTAGCATGGACAAAGACTGCGAAATGA) (SEQ ID NO: 1 15)
• SNAPSbfAsc (GCGCGCCGCTTCCTGCAGGACCCAGCCCAGGCTTG) (SEQ ID NO.:1 16).
• SbfAscDCTM15 (CCTGCAGGAAGCGGCGCGCCCCACTTCCCTGAAATC) (SEQ ID NO: 1 17) and
• DCTM15Not (GCGGCCGCTTCGAACTCGGTGCTGGCAGCAAGA) (SEQ ID NO: 1 18).
• the 3 preceding DNA fragments are purified on gel.
• An amplification of the mixture of these 3 DNAs as template is carried out in the presence of the primers R1 Src and DCTM15Not (see above) under the conditions and according to the recommendations of the company Finnzyme, supplier of the Phusion DNA polymerase used.
• the resulting DNA fuses in phase with the previous 3 DNAs.
• the ligation is carried out using a linearized plasmid vector having topoisomerase I enzymes at its ends (see FIG. 6) thus making it possible to integrate the insert without the intervention of a ligase.
• this vector has a clean cut on both sides of its ends, the insert must also be at full length to be able to join.
• the plasmid possesses an antibiotic resistance gene: kanamycin.
• the chemo-competent TOP 10 bacteria (10 ⁇ l) are transformed by the totality of the TOPO / insert ligation mixture.
• the mixture undergoes thermal shock for 30 seconds at 42 ° C.
• the tubes are then immediately put back on the ice.
• 250 ⁇ L of SOC medium Bacto-yeast extract 0.5%, NaCl 0.05% and glucose 0.2%) are then gently added and homogenized, which are incubated for 1 hour at 37 ° C. in the bath.
• the bacterial culture is centrifuged for 15min at 3500rpm and at 4 ° C.
• the pellet is taken up in 250 ⁇ l of re-suspension buffer A1 (plasmid DNA Purification Nucleospin kit (Macherey-Nagel)).
• the bacteria are lysed for 5 min at room temperature with 250 ⁇ l of lysis buffer A2.
• 300 ⁇ l of neutralization buffer A3 are then added and it is important to mix well by inversion so as not to obtain a diffuse pellet.
• the tubes are centrifuged for 10 min at 1000 rpm at 4 ° C.
• the supernatant is passed over a column placed on a collection tube, all centrifuged for 1 min at 1000 rpm.
• the column After washing with 500 ⁇ l of wash buffer A4, the column is dried for 2 minutes at 1000 rpm. 50 ⁇ l of elution buffer are passed and the eluate is collected in an Eppendorf tube. The DNA obtained is determined spectrophotometrically at 260 nm.
• the plasmids are digested with a specific restriction enzyme (Biolabs®) EcoRI which frames the insertion site. Approximately 200ng of each plasmid is digested with 4 units of enzyme. To this, it is added 1 ⁇ _ of 10X NEB1 buffer and sterile water to obtain 10 ⁇ _ in the end. Digestion is at 37 ° C for 1 h. After identification of the good clones on agarose gel 2%, 1, 5 ⁇ g of plasmid DNA is sent to be sequenced at Eurofins MWG Operon. This makes it possible to check the integrity of each sequence by checking whether the restriction sites added are present as well as the mutation.
• a specific restriction enzyme Biolabs®
• the first Src-SNAP-CDTM represents the expected chimeric gene
• the second D-SNAP-CDTM corresponds to a sequence having a deletion of part of the Src fragment that had to occur during the last PCR.
• the protein encoded by DNA D-SNAP-CDTM also contains a glycine in a myristoylable position but has lost some of its basic amino acids that enhance sub-membrane anchoring properties.
• the vector pCDNA3.1 is digested with restriction enzymes EcoR1 and NotI, then dephosphorylated and phenol / chloroform extracted.
• Isopropanol precipitation removes the short DNA fragment ( ⁇ 100pb located between EcoR1 and NotI) released during digestion and which could religate with the plasmid.
• the insert fragments are extracted on 2% low melting agarose gel and purified on a column using the Nucleospin kit (Nucleospin Extract II® Kit, MACHEREYAGEL). The final volume is 50 ⁇ _.
• 35ng of dephosporylated vector is mixed with the insert with an insert / vector ratio of about 3/1 (molecule to molecule). It is added: 1 ⁇ of 10X ligase buffer, sterile water (qs 10 ⁇ ) and 1 U of T4 DNA ligase (Biolabs®). A negative control is performed by replacing the insert volume with the same volume of TE1 X. The mixtures are incubated overnight at room temperature.
• This transformation is based on a thermal shock.
• HEK 293T Human Embryonic Kidney eukaryotic cells are cultured in DMEM (Dulbecco's modified eagle's medium) flasks, containing 10% fetal calf serum (FCS) and gentamicin at 20 ⁇ g / mL, at 37 ° C. under 5% CO 2 .
• DMEM Dulbecco's modified eagle's medium
• FCS fetal calf serum
• HEK 293T / well cells are seeded into 4 mL of DMEM 10% FCS without antibiotics. After 24 h of culture at 37 ° C. under 5% of CO2, the cells are at 90% confluency and are transfected with a complex formed between 1 ⁇ g of plasmid of interest and 2 ⁇ l of JetPEl (PolyPIus®) in 500 ⁇ l of medium. DNA is internalized by endocytosis.
• the medium is replaced by 10% DMEM in SVF free exosomes contained in the serum (removed by ultracentrifugation at 42000rpm for 18h (Rotor Ti 45, Beckman) .A 48 hours post-transfection, the supernatant is taken up in order to recover the exosomes produced and the cells are lysed to obtain cellular proteins.
• the cell medium is recovered, it is centrifuged for 10 min at 1400 rpm to remove the cells from the culture medium. The supernatant is centrifuged for 10 min at 1000 rpm at 4 ° C to remove cell debris. The supernatant is recovered and a 20% sucrose TNE cushion is poured into the bottom of the tube to be ultracentrifuged at 42000rpm in a Ti50 rotor (Beckman) for 2h at 4 ° C. The pellet of pure exosomes is then taken up in 100 ⁇ l of PBS.
• the cells are washed with PBS at 4 ° C. and then lysed with RIPA buffer (1 X TNE, 0.5% NP40, 20 Mg / ml Aprotinin, 20 ⁇ l Leupeptine, sterile H 2 O, 0.2 mM PMSF). The lysate is centrifuged for 20 min at 14,000 rpm at 4 ° C and the supernatant is recovered.
• Proteins from cell extracts and exosomes are assayed by the Bradford method using a NanoDrop spectrophotometer and a standard range of BSA (0-200 ⁇ g / mL).
• the samples (20 ⁇ g for the cellular protein extracts and 2 ⁇ g for the exosomal lysates) are separated on a 10% polyacrylamide gel for 1 h 30 at 60 mA and then transferred onto a PVDF membrane (polyvinylidene difluoride, Immobilon-P, Millipore), previously activated in a bath of methanol, rinsed with water and then with TBST (20 mM Tris Base pH 7.4, 0.15M NaCl, 0.5% Tween), overnight at 50mA in a cold room. The membrane is then saturated with 5% milk powder in TBST for 1 hour. Then, it is incubated overnight at 4 ° C with the primary antibody: anti-CD TM rabbit serum prepared in the laboratory.
• PVDF membrane polyvinylidene difluoride, Immobilon-P, Millipore
• the membrane is washed 3 times 5min with TBST and then incubated for 1 hour with the secondary anti-rabbit IgG antibody coupled to peroxidase (Jackson ImmunoResearch). It is again washed in TBST and then deposited on Whatmam paper soaked in an ECL solution (Enhanced chemiluminescence, Amersham)). The revelation is made using a Lumi-imager F1 (Roche®) camera.
• the DSC (lanes 2 and 5) and SSC CDTM proteins (lanes 3 and 6) make about 30 kDa expressed in the cells (see Fig. 34B). Both DSC and SSC proteins are found targeted in exosomes (see Figure 34A). Examination of ratios of secreted proteins in the exosomes / proteins produced in the cells shows that the targeting of the SSC protein in the exosomes is more efficient than that of the DSC protein.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• General Chemical & Material Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Public Health (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Immunology (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Plant Pathology (AREA)
• Obesity (AREA)
• Diabetes (AREA)
• Tropical Medicine & Parasitology (AREA)
• Hematology (AREA)
• Virology (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=42107419

Family Applications (1)

Country Status (6)

Cited By (2)

Families Citing this family (21)

Citations (1)

Family Cites Families (3)

• 2009
  • 2009-09-24 FR FR0904576A patent/FR2950350B1/fr active Active
• 2010
  • 2010-09-23 WO PCT/FR2010/052006 patent/WO2011036416A1/fr not_active Ceased
  • 2010-09-23 CA CA2775151A patent/CA2775151C/fr active Active
  • 2010-09-23 US US13/497,779 patent/US9611481B2/en active Active
  • 2010-09-23 JP JP2012530319A patent/JP5932647B2/ja active Active
  • 2010-09-23 EP EP10769025.7A patent/EP2480672B8/fr active Active

Patent Citations (1)

Non-Patent Citations (28)

Also Published As

Similar Documents

Legal Events