WO2010125471A2 - Gene vector - Google Patents
Gene vector Download PDFInfo
- Publication number
- WO2010125471A2 WO2010125471A2 PCT/IB2010/001166 IB2010001166W WO2010125471A2 WO 2010125471 A2 WO2010125471 A2 WO 2010125471A2 IB 2010001166 W IB2010001166 W IB 2010001166W WO 2010125471 A2 WO2010125471 A2 WO 2010125471A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- mir
- mirna
- cells
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
Definitions
- the present invention relates to gene vectors for use in gene transfer and therapy applications, and to methods of producing them, and uses thereof.
- HCT Hematopoietic cell transplantation
- LSD lysosomal storage diseases
- HCT Hematopoietic stem cells
- the isolated HSC can be genetically modified and returned to the patient as an autologous transplant.
- Long-term benefit requires the transplantation of a sufficiently high number of gene-modified HSC, which can repopulate the conditioned BM, giving rise to corrected blood cells of all hematopoietic lineages.
- Autologous allogeneic HSC make the transplant procedure available to all patients and avoids immunological compatibility problems leading to GvHD.
- some diseases like primary immunodefficiencies require the correction of a fraction of HSC and their progeny.
- the intensity of the conditioning regimen is reduced which results in better tolerability and fewer side effects for the patient.
- a reduced conditioning regimen is less compatible with a standard allogeneic transplant, because mixed donor chimerism is usually unstable in the allogeneic setting due to immunological antagonism with host-derived immune cells.
- HSC long-term gene modification
- progeny requires a technology which permits stable integration of the corrective DNA into the genome, without affecting HSC function.
- the most efficient delivery systems are viral vectors.
- HSPC hematopoietic progenitor cell
- galactocerebrosidase lacking in Globoid Leukodystrophy — GLD - or Krabbe disease
- GLD Globoid Leukodystrophy
- Krabbe disease hematopoietic progenitor cell
- future expression cassettes used for gene therapy should resemble physiologic expression patterns and avoid ectopic and/or non-physiologic transgene expression, which can result in toxicity, elimination or even malignant transformation of the transduced cells. This is particularly important for stem cells, the key target cell type guaranteeing long-term efficacy of gene therapy, whose biology must not be disturbed by the genetic intervention.
- lineage-specific transcriptional control elements e.g. the endogenous promoter of the locus
- promoters are often spread over a long range of DNA and poorly characterized, and can thus not be easily reconstituted in their entirety in a vector construct.
- expression levels from tissue-specific promoters reconstituted in gene-transfer vectors are often not sufficient to achieve phenotypic correction, most likely because of imperfect reconstirution and/or detrimental influence of the chromatin at the semi-random vector integration site.
- additional strategies to regulate a transgene are direly needed.
- a gene vector for use in gene therapy comprising at least one miRNA sequence target operably linked to a nucleotide sequence having a corresponding miRNA in a hematopoietic progenitor cell (HSPC) which prevents or reduces expression of the nucleotide sequence in a HSPC but not in a differentiated cell.
- HSPC hematopoietic progenitor cell
- a gene vector for use in gene therapy comprising at least one miRNA sequence target operably linked to a nucleotide sequence having a corresponding miRNA in a hematopoietic stem cell (HSC) which prevents or reduces expression of the nucleotide sequence in a HSC but not in a differentiated cell.
- HSC hematopoietic stem cell
- the present invention provides a gene vector suitable for use in hematopoietic gene therapy comprising at least one miRNA sequence target for a miRNA which is present in an effective amount in a hematopoietic progenitor cell or hematopoietic stem cell and optionally a transgene.
- effective amount we mean that the concentration of the endogenous miRNA is sufficient to reduce or prevent expression of a transgene which is operably linked to the corresponding miRNA target sequence.
- the present invention employs the use of miRNA which is strongly expressed in cells, such as HSPC and HSC but not in differentiated progeny of e.g.
- the miRNA is "operably linked" to the transgene.
- operably linked means that the components described are in a relationship permitting them to function in their intended manner.
- a stem cell is able to differentiate into many cell types.
- a cell that is able to differentiate into all cell types is known as totipotent. In mammals, only the zygote and early embryonic cells are totipotent. Stem cells are cells found in most, if not all, multi-cellular organisms. They are characterized by the ability to renew themselves through mitotic cell division and differentiating into a diverse range of specialized cell types.
- the two broad types of mammalian stem cells are: embryonic stem cells that are isolated from the inner cell mass of blastocysts, and adult stem cells that are found in adult tissues, hi a developing embryo, stem cells can differentiate into all of the specialized embryonic tissues.
- HSCs Hematopoietic stem cells
- myeloid monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells
- lymphoid lineages T-cells, B-cells, NK-cells
- Progenitor cells have a capacity to differentiate into a specific type of cell. In contrast to stem cells, however, they are already far more specific: they are pushed to differentiate into their "target" cell. The most important difference between stem cells and progenitor cells is that stem cells can replicate indefinitely, whereas progenitor cells can only divide a limited number of times. HSPC can be rigorously distinguished from HSC only by functional in vivo assay, i.e. transplantation and demonstration that they can give rise to all blood lineages over prolonged time periods.
- cell surface markers such as c-Kit (CD 117), Sca-1 and the absence/ low-expression of a panel of lineage markers, combined with a recently described set of molecules belonging to the SLAM receptor family (CDl 50 and CD48), can enrich for HSC and
- a differentiated cell is a cell which has become more specialized in comparison to the stem cell or progenitor cell. Differentiation occurs during the development of a multicellular organism as the organism changes from a single zygote to a complex system of tissues and cell types. Differentiation is also a common process in adults: adult stem cells divide and create fully-differentiated daughter cells during tissue repair and during normal cell turnover. Differentiation dramatically changes a cell's size, shape, membrane potential, metabolic activity, and responsiveness to signals. These changes are largely due to highly-controlled modifications in gene expression.
- a differentiated cell is a cell which which has specific structures and performs certain functions due to a developmental process which involves the activation and deactivation of specific genes.
- a differentiated cell includes differentiated cells of the hematopoetic lineage such as monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/ platelets, dendritic cells, T-cells, B-cells and NK-cells.
- differentiated cells of the hematopoetic lineage can be distinguished from HSC and HSPC by detection of cell surface molecules which are not or less expressed on undifferentiated cells. Examples of suitable lineage markers such as CDl Ib, GrI, CD19, Terl 19 and CD3.
- a gene vector for use in gene therapy comprising at least one miRNA sequence target corresponding to a miRNA selected from the group comprising mir-130a, mir-126 and mir-223 operably linked to a nucleotide sequence.
- miR-126 target blocks expression most effectively in the more primitive HSPC and (in humans) in the erythroid lineage. miR-126 would be particularly suitable for gene therapy applications relying on robust transgene expression in the myeloid and lymphoid lineage.
- miR-130a target blocks expression most effectively in the more primitive HSPC (similar to miR-126), miR-130a would be most particularly suitable for gene therapy applications relying on robust transgene expression in the myeloid, lymphoid and erythroid lineage. miR-126 may be stronger than miR-130a in human CD34 cells, but may have also non-specific activity in the differentiated progeny.
- a combination target comprising miR-130aT sequences ( preferably 2-4 copies) and "half miR-126T ( preferably 2 copies) maximizes the operating window determined by the ratio of repression in HSPC and expression in the myeloid progeny.
- miR-223 target blocks expression most effectively in myeloid committed progenitors and at least partially in the more primitive HSPC.
- miR-223 target fully and strongly blocks expression in differentiated myeloid cells including granulocytes, monocytes, macrophages, myeloid dentritic cells.
- miR-223 target would be particularly suitable for gene therapy applications relying on robust transgene expression in the lymphoid or erythroid lineage. miR-223 target may block expression also very effectively in human HSC.
- the miRNA sequence targets correspond to mir-130a and mir-126.
- the gene vector comprises the nucleotide sequence which controls the expression of the vector.
- the endogenous microRNA prevents expression or proliferation of the virus in certain cell types (HSC and HSPC) but allows the expression or proliferation in other cell types.
- mir-126, mir- 130 and mir-223 prevent expression of a gene vector or oncloytic virus in a hematopoietic stem cell or progenitor cell.
- the gene vector comprises the nucleotide sequence which is a transgene.
- the gene transfer vector is in the form of a non-viral gene transfer vector.
- the gene transfer vector may comprise, or be in the form of, an expression vector or plasmid which comprises the miRNA target sequence operationally linked to a nucleotide sequence.
- Expression vectors as described herein comprise regions of nucleic acid containing sequences capable of being transcribed. Thus, sequences encoding mRNA, tRNA and rRNA are included within this definition.
- the gene vector or gene transfer vector of the present invention may be used to deliver a transgene to a site or cell of interest.
- the vector of the present invention may be delivered to a target site by a viral or non- viral vector.
- a vector is a tool that allows or facilitates the transfer of an entity from one environment to another.
- some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a target cell.
- the vector may then serve to maintain the heterologous DNA within the cell or may act as a unit of DNA replication.
- examples of vectors used in recombinant DNA techniques include plasmids, chromosomes, artificial chromosomes or viruses.
- Non-viral delivery systems include but are not limited to DNA transfection methods.
- transfection includes a process using a non- viral vector to deliver a gene to a target mammalian cell.
- Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, cationic facial amphiphiles (CFAs) (Nature Biotechnology 1996 14; 556), and combinations thereof.
- CFAs cationic facial amphiphiles
- the gene vector is a viral vector.
- Viral delivery systems include but are not limited to adenovirus vector, an adeno- associated viral (AAV) vector, a herpes viral vector, retroviral vector, lentiviral vector, baculoviral vector.
- Other examples of vectors include ex vivo delivery systems, which include but are not limited to DNA transfection methods such as electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA- mediated transfection.
- vector particle refers to the packaged retroviral vector, that is preferably capable of binding to and entering target cells.
- the components of the particle as already discussed for the vector, may be modified with respect to the wild type retrovirus.
- the Env proteins in the proteinaceous coat of the particle may be genetically modified in order to alter their targeting specificity or achieve some other desired function.
- the viral vector preferentially transduces a certain cell type or cell types.
- the viral vector is a targeted vector, that is it has a tissue tropism which is altered compared to the native virus, so that the vector is targeted to particular cells.
- the gene vector is derivable from a lentivirus.
- the gene vector comprises a tissue specific promoter.
- the tissue specific promoter is selected from the group comprising CDl Ib and c-Fes, and promoters derived from the cytochrome b-245 heavy chain (CYBB, gp91 phox) locus and TEK (Tie2).
- CYBB, gp91 phox cytochrome b-245 heavy chain locus
- TEK (Tie2) promoter could be combined with the miR-126 target sequence, this combination would allow specific transgene expression in a subset of tumor-infiltrating myeloid cells.
- the gene vector comprises a transgene which codes for an en2yme.
- the enayme is selected from the group lysosomal enzyme galactocerebrosidase and gp91 phox.
- the present invention can be used to deliver immunomodulatory molecules, such as interferon-alpha.
- these vectors deliver the immunomodulatory molecules into tumor cells upon bone marrow transplantation.
- these vectors contain the Tie2 promoter plus a miR-126T sequence.
- the Tie2 promoter possesses activity in hematopoietic stem cells, and immunomodulatory molecules such as interferon-alpha are known to be toxic to HSC.
- immunomodulatory molecules such as interferon-alpha are known to be toxic to HSC.
- HSC-specific miRTs- as described in this patent application- becomes obligatory rather than an option in order to specifically deliver bioactive molecules by Tie2 expressing, tumor infiltrating macrophages without interfering with HSC function.
- the Tie2 promoter is weaker in HSC than the PGK promoter which has been used throuhout our studies, we expect that 126T/130aT sequences fully prevent toxicity of transgenes expressed from the Tie2 promoter in HSC.
- a set of DNA constructs for producing a viral vector particle comprising a DNA construct encoding a packagable viral vector genome comprising at least one miRNA sequence target according to the present invention, and optionally a transgene.
- packagable vector genome we mean that the vector genome is in an environment where it can be packaged into a viral vector particle. This generally requires the present of Gag-Pol and Env.
- a process for preparing a viral vector particle comprising introducing the set of DNA constructs of the present invention into a host cell, and obtaining the viral vector particle.
- the host cell comprises the corresponding miRNA.
- a viral vector particle produced by the process of the present invention.
- composition comprising the gene vector or particle according to the present invention together with a pharmaceutically acceptable diluent, excipient or carrier.
- a cell infected or transduced with the gene vector or particle according to the present invention may be transduced or infected in an in vivo or in vitro scenario.
- the cell may be derived from or form part of an animal, preferably a mammal, such as a human or mouse.
- the present invention is useful in providing transgenic animals e.g., for use as disease models.
- the mammal is a non-human mammal.
- the cell is a hematopoietic stem cell or a hematopoietic progenitor cell.
- the miRNA sequence targets are for simultaneous, separate or sequential use.
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for preventing or reducing expression of a transgene in a hematopoietic stem cell or a hematopoietic progenitor cell.
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for treating a disease selected from Globoid Cell Leukodystrophy, Chronic Granulomatous Disease and Severe Combined Immunodeficiency (SCID).
- SCID Severe Combined Immunodeficiency
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for increasing the chances of survival of a hematopoietic stem cell or a hematopoietic progenitor cell in relation to gene therapy.
- the chances of survival of an HSC or HSPC can be increased by specifically detargeting expression of genes from these cells.
- the detargeting of expression of transgenes which are toxic for HSC or HSPC could be beneficial for the survival of these cells.
- detargeting of expression of transgenes which could cause an unwanted immune reaction in the host could result in an increased chance of survival of the cell.
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for increasing the safety and/or efficacy of gene therapy.
- An increase in safety of gene therapy includes the prevention or reduction of unwanted expression of transgenes or expression of the vector in certain cell types such as HSC and HSPC.
- Detargeting of expression of a transgene or vector from specific cell types can reduce unwanted reaction or side effects which may accompany gene therapy.
- An increase in efficacy of gene therapy includes that transgenes are more effectively expressed in the desired cell types such as differentiated hematopoietic cells, because these cells are more effectively generated from gene-modified undifferentiated cells which are protected from transgene toxicity and unwanted immune reactions by the microRNA target sequence.
- gene therapy involving the transplantation of HSC or HSPC can be safer and more efficient if expression of the transgene can be avoided until the cells have differentiated.
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for preventing apoptosis of a hematopoietic stem cell or a hematopoietic progenitor cell, whereby the apoptosis is caused by expression of the transgene.
- a gene vector according to the present invention a particle according to the present invention, a pharmaceutical composition according to the present invention, a cell according to claims the present invention or a combination according to the present invention for monitoring a stage of differentiation of a hematopoietic stem cell or a hematopoietic progenitor cell.
- mir-126, mir-223 and mir-130a are indicative of an HSC or HSPC. More specifically mir-126 is indicative of primitive HSPC and, in humans, also of cells of the erythroid lineage. Mir- 13 Oa is indicative of the more primitive HSPC. Mir-223 is indicative of myeloid committed progenitor cells and the more primitive HSPC. Mir-223 is also indicative of differentiated myeloid cells including granulocytes, monocytes, marcophages and myeloid dentritic cells.
- the gene vector is for use in hematopoietic cell therapy.
- Hematopoietic cell therapy includes hematopoetic stem cell transplantation.
- a miRNA sequence target corresponding to a miRNA selected from the group of mir-130a, mir-126 and mir-223 for use in gene therapy is provided.
- a method of determining the differentiation stage of a hematopoietic stem cell or a hematopoietic progenitor cell comprising determining the level of expression of a miRNA in the cell, wherein the miRNA corresponds to a miRNA target sequence operably linked to a nucleotides sequences, wherein the miRNA prevents or reduces expression of the nucleotide sequence in a hematopoietic progenitor cell (HSPC) or a hematopoietic stem cell (HSC) but not in a differentiated cell.
- HSPC hematopoietic progenitor cell
- HSC hematopoietic stem cell
- expression of mir-130a and mir-126 indicates that the cell is a HSPC or HSC, while expression of miR-223 indicates affiliation to the myeloid lineage, i.e. granulocytes and monocytes, including their precursors and derivatives.
- a method of determining the differentiation stage of a hematopoietic stem cell or a hematopoietic progenitor cell comprising determining the level of expression of at least two different miRNAs in the cell, wherein the miRNAs correspond to miRNA target sequences operably linked to nucleotide sequences, wherein the miRNAs prevent or reduce expression of the nucleotide sequences in a hematopoietic progenitor cell (HSPC) or a hematopoietic stem cell (HSC) but not in a differentiated cell and comparing the expression level of the different miRNAs.
- HSPC hematopoietic progenitor cell
- HSC hematopoietic stem cell
- the expression of two microRNAs can be assayed contemporaneously and independently from each other using a bidirectional vector which expresses two marker genes, each one containing a different microRNA target sequence.
- the different micro RNAs could be linked to different marker such as fluorescent markers.
- Different colours would indicate different mixtures of expression of the microRNAs which represent different differentiations stages (e.g. green marker+miR-126T, red marker+miR-223T. If cells are red or black: ⁇ > HSPC; if cells are yellow: --> lymphocytes; if cells are green: differentiated myeloid lineage cells.)
- a method of determining the differentiation stage of a hematopoietic stem cell or a hematopoietic progenitor cell comprising determining the expression level of a transgene in said hematopoietic stem cell or said hematopoietic progenitor cell, wherein the transgene is operably linked to a miRNA sequence target, whereby the corresponding miRNA prevents or reduces expression of the transgene in a hematopoietic progenitor cell (HSPC) or a hematopoietic stem cell (HSC) but not in a differentiated cell.
- HSPC hematopoietic progenitor cell
- HSC hematopoietic stem cell
- reporter vectors for miRNAs selected from the group containing miR- 126, miR-130a and miR-223 might be applied to identify hematopoietic stem cells and/or their immediate precursors in culture systems aimed at obtaining hematopoietic lineage cells from induced pluripotent cells (iPS) or embryonic stem cells (ES)
- iPS induced pluripotent cells
- ES embryonic stem cells
- the miRNAs used in the methods of the present invention comprise the miRNA selected from the group comprising mir-130a, mir- 126 and mir-223.
- the invention teaches how gene vectors suitable for gene therapy can be designed to be regulated by miRNAs endogenous for HSC and HSPC for controlling transgene expression to achieve specific expression profiles of the vector.
- the invention provides broad application of these vectors as they will help to prevent transgene toxicity in HSC and HSPC and thus faciliate the development of gene therapy strategies for the treatment of various diseases.
- the vectors are particularly suitable for gene therapies which involve the expression of a transgene which is toxic for HSC or HSPC.
- the inventors provide a novel method to profile the activity of selected miRNAs across multiple hematopoietic cell subsets including rare HSPC populations, thus adding a new dimension to conventional miRNA expression profiling approaches, which are broad but limited to a previously purified bulk population.
- This method is based on the transduction of HSPC with lentiviral miRNA reporter vectors, which serve as a live genetic indicator for the activity of a miRNA, easily quantifiable at the single cell level and in multiple cell populations in parallel by flow cytometry.
- the inventors identified two miRNAs that are highly functional in mouse and human HSPC, including subsets enriched for the most primitive stem cells.
- one miRNA Upon differentiation, one miRNA is rapidly down-regulated at the early progenitor cell level, while the other one is further induced during granulo- and monopoiesis, but sharply down-regulated in lymphocytes and during megakaryocyte/erythrocyte differentiation.
- the inventors applied one of the two miRNAs highly expressed in HSPC to overcome a major issue preventing efficacious treatment of globoid leukodystrophy
- the miRNA-responsive sequences used for the reporter vectors allowed regulating the expression profile of the therapeutically relevant GALC transgene, de-targeting transgene expression from cells where the cognate miRNA is expressed (HSPC), while permitting full therapeutic expression in the differentiated progeny that is not affected by the GALC-expression toxicity.
- the HSPC transduced with the miRNA-regulated GALC lentiviral vectors were protected from enzyme toxicity and retained their function both in vitro and in vivo. Preliminary results indicate therapeutic efficacy of this approach in correcting disease manifestations in the mouse model.
- the following miRNA target sequences are employed to achieve regulated transgene expression in the human hematopoietic system: gene therapy applications which require expression in the myeloid lineage (e.g. chronic granulomatous disease, lysosomal storage disorders such as Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, etc): 126T/130aT (2+2 target sequences) - optimized for maximal repression in HSPC; 126T (2 target sequences) - optimized for minimal background activity in the myeloid progeny.
- gene therapy applications which require expression in the myeloid lineage (e.g. chronic granulomatous disease, lysosomal storage disorders such as Krabbe disease, metachromatic leukodystrophy, adrenoleukodystrophy, etc): 126T/130aT (2+2 target sequences) - optimized for maximal repression in HSPC; 126T (2 target sequences) - optimized for minimal
- Gene therapy applications which require expression in the erythroid lineage (e.g. thalassemia, glucose-6-phosphate dehydrogenase deficiency, sickle cell disease,..): 13OaT (4 target sequences), or 223T (2 or 4 target sequences).
- the latter target might exhibit some activity ( ⁇ 5x) in more primitive BFU-E and CFU-E.
- Gene therapy applications which require expression in the lymphoid lineage (e.g. RAG1/RAG2 deficiency, BTK deficiency, X-SCID, ADA-SCID): 223T (2 or 4 target sequences), possibly in combination with 126T/130aT (2+2 target sequences) or 126T (2 target sequences).
- Vectors such as viral including lentiviral vectors, for transgene expression for gene transfer and therapy can be engineered with miRNAs target sequence in order to be recognized by endogenous miRNAs cell endogenous to HSC and HSPC, thus regulating transgene expression in a subset of cells.
- miRNA target sequences can be used to obtain vectors with highly specific cell expression patterns.
- the practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T.
- FIG. 1 Schematic representation of bidirectional miRNA-regulated lentiviral reporter vectors. Shown here are representative structures of miRNA regulated bidirectional vectors (Bd.LVs), containing the green fluorescent protein (GFP) as the miRNA reporter and a truncated form of the human loe affinity nerve growth factor receptor (NGFR) as a constitutively expressed normalizer. While Bd.LV-ctr does not contain any miRNA target sequence (miRT), Bd.LV-223T and Bd.LV-126T were constructed by the addition of 4 tandem repeats containing 21 bp perfectly complementary to miR-223 or miR-126, respectively.
- Bd.LVs miRNA regulated bidirectional vectors
- GFP green fluorescent protein
- NGFR human loe affinity nerve growth factor receptor
- FIG. 1 Evaluation of miRNA reporter Bd.LVs in cell lines, a) Quantitative analysis of miR-223 and miR-126 expression levels (copies/pg) in HEK293T, U937 and HEK293T cells that ectopically express miR-126 by transduction with an LV containing the pri-mir-126 under control of a ubiquitous promoter (HEK293T.LV.miR-126). b) Representative FACS analysis of HEK-293T, U937, HUVEC and HEK293T.LV.miR-126 cells, transduced with the indicated miRNA regulated Bd.LVs.
- Cells are analyzed for GFP "miRNA reporter” and NGFR "normalizer” expression, c) Formula for calculation of miRNA-mediated fold repression of the reporter gene expression at the protein level and at the RNA level. Histograms show miR-223 and miR-126 activity in cell lines calculated as GFP FR values at the protein level. Diamonds represent GFP FR at the RNA level.
- FIG. 3 Evaluation of miRNA reporter BdLVs in vivo.
- Lineage "710 * bone marrow (BM) hematopoietic stem and progenitor cells (HSPC) were transduced with bidirectional miRNA reporter lentiviral vectors (BdLVs) for miR-223 and miR-126, and transplanted into recipient mice.
- Peripheral blood cells of mice stably engrafted with cells carrying the miRNA reporter was analyzed by FACS.
- FIG. 4 (a) Lineage " ow bone marrow (BM) hematopoietic stem and progenitor cells (HSPC) were transduced with bidirectional miRNA reporter lentiviral vectors (BdLVs) and transplanted into lethally irradiated mice. BdLVs co-express a destabilized GFP (d4GFP) reporter made responsive to a specific miRNA by 4 tandem repeats of a perfectly complementary miRNA target (miRT) sequence, and a truncated NGFR marker gene ( ⁇ NGFR).
- d4GFP destabilized GFP
- miRT perfectly complementary miRNA target
- ⁇ NGFR truncated NGFR marker gene
- mice were euthanized 8-12 weeks after transplant, and multiple BM HSPC subpopulations were prospectively identified by immunophenotyping as shown (HSC: hematopoietic stem cells; MPP: multipotent progenitors; GMLP: granulocyte-monocyte-lymphocyte progenitors; GMP: granulocyte-monocyte progenitors; eMEP: early megakaryocyte-erythrocyte progenitors; EP: erythrocyte precursors), (b) Representative FACS plots show expression of the Control-BdLV (no miRT or 133aT, a muscle-specific miRT) and reporter BdLVs for miR-126 (126T), miR-130a (13OaT), miR-196b (196bT), miR-lOa (1OaT), miR-223 (223T), miR-19a (19aT), miR-93 (93T), miR-17-5p (17T) and let-7a (Let7aT) in
- Figure 5 (a) Hematopoietic activity of 8 miRNAs as measured by the mean fold repression (FR) of indicated reporter BdLVs in multiple cell populations isolated from transplanted mice.
- FIG. 6 Regulating the expression of a suicide gene by miRNA target sequences, (a) miRT sequences perfectly complementary to miR-142, miR-223, miR-126, or miR- 130a were added to a destabilized thymidine kinase (dTK) transcript. Monodirectional lentiviral suicide vectors (right half of each vector drawing) were used for (b), while bidirectional suicide vectors coupling a GFP marker to the miRNA-regulated TK, or an NGFR marker to the Control-TK were used in (c).
- dTK destabilized thymidine kinase
- Box and whiskers plots show the colony number in the cultures containing GCV divided by the colony count in respective control cultures without GCV (10th-90th percentile).
- Statistical comparisons were made against the GCV-treated, LV-GFP group; ns, not significantly different; **, O.OOKpO.Ol: ***, pO.OOl.
- Representative FACS plots show GFP/NGFR chimerism within CD45.1+ donor cells.
- Graphs show the fraction of GFP-expressing cells within the transduced, donor-derived cells in the blood for the GCV treated (red) and untreated (black) mice, for each blood cell type over a 7-8 month time period. Note that significantly more cells are GFP+ in the GCV group (***: p ⁇ 0.001, 2-way Anova), indicating protection from suicide and selective advantage of HSC transduced by GFP/TK.126T or GFP/TK.142T.
- the miR- 126T sequence added to a transgene overcomes HSPC toxicity arising from highly toxic transgenes even when expressed from ubiquitous promoters, carrying significant potential to improve the safety and efficacy of HSPC-based gene therapy. Furthermore, these results formally prove that miR-126 is active in long-term engrafting hematopoietic stem cells as demonstrated by a functional repopulation assay.
- FIG. 7 (a) To address the safety of exploiting miR-126 regulation for gene therapy, a transgenic mouse line containing a miR-126 reporter (Tg.126T) was created by microinjection of the illustrated LV into the perivitelline space of zygotes. FACS analysis of the bone marrow of young, adult transgenic mice demonstrated that GFP expression was lowest in Kit + Sca + Lineage marker " (KSL) cells (blue graph in histogram plot), while GFP expression switched on in Kit + ScaXin " progenitors (black and red graph in histogram plot).
- KSL Kit + Sca + Lineage marker
- mice carrying two knockout alleles for miR-126 manifest significant embryonic lethality due to angiogenic defects, breeding our Tg.l26T colony resulted in normal litter size and an expected vector copy number (VCN) distribution in the offspring reflecting the one of the parental generation, suggesting that moderate expression of miR-126T sequences from a PGK promoter did not interfere with the regulation of natural miR-126 targets during development,
- mice were bled in regular intervals, and CD45.1/CD45.2 chimerism was determined in the various peripheral blood cell lineages (Granu: CDl lb + side scatter '; Mono: CDl lb + side scatter low ; B cells: CD19 + ; T cells: CD3*). These data indicate that there is a comfortable therapeutic window for safely exploiting miR-126 regulation.
- (B) Cord blood CD34 + cells were transduced with control- or miRNA regulated bidirectional suicide vectors containing miRNA target sequences for miR- 223 (TK-223T) or miR-126 (TK-126T, see also Figure 2), and plated in CFC assays in quadruplicate, either in the presence or the absence of the pro-drug GCV.
- the regulation index (right graph) is calculated by dividing the fold repression of the respective miRT in the CD34+/CD38- stem/multipotent compartment by the fold repression in metamyelocytes.
- the best "release" of transgene expression in the myeloid progeny is obtained by 126T (2 targets), while suppression in the stem/progenitor compartment is -similar to 13OaT (4 targets)- slightly less compared to 126T (4 targets) and 126T/130aT (2+2 targets).
- 126T/130aT (2+2 targets) is preferable over 126T (4 targets), as it offers the biggest regulation index.
- transgene downregulation is assured by 2 independent miRNAs, and the risk of interfering with endogenous miRNA regulation is further reduced, thus increasing safety and efficacy of the miRT.
- FIG. 9 Lysosomal enzyme over-expression in HSPC. Enzyme expression level, normalized to wild type, in mHSPC (A) and hHSPC (B) upon LV transduction. GALC expression was significantly lower as compared to ARSA and IDUA.
- Figure 10 Impaired function of murine HSPC upon LV-mediated GALC expression.
- A CFC assay on mHSPC transduced with GALC and control LV. The number (#) of colonies/plate (Y left axis, columns) was counted and the number of integrated LV copies/cell (VCN)(Y right axis, dots) was measured.
- FIG. 11 Impaired function of human HSPC upon LV-mediated GALC expression.
- A CFC assay on hHSPC transduced with GALC and control LV. The number (#) of colonies/plate (Y left axis, columns) was counted and the number of integrated LV copies/cell (VCN)(Y right axis, dots) was measured.
- FIG. 12 Survival of twi mice upon HSCT.
- A Schematic representation of GFP.LV and GALCLV.
- C Representative plot showing the percentage of GFP + engrafted cells in the peripheral blood of a twi mouse transplanted with GFP.LV transduced + 1 + mHSPC and Seal- progenitors.
- FIG. 14 Apoptosis of GALC expressing murine and human HSPC (A-B)TUNEL assay on -/- mHSPC (left) and hHSPC (right)(from n.d. CB and GLD BM) at 2 and 5 days after gene transfer. % of TUNEL+ nuclei over the total number of nucleated cells is reported. 8 fields and 100 cells were counted condition. Similar results were obtained using +/+ mHSPC (A) The large majority of GALCLV transduced m- and hHSPC were TUNEL positive both at 2 and at 5 days after transduction.
- the fraction of apoptotic cells is higher among GALCLV transduced mHSPC and hHSPC as compared to GFP- transduced controls.
- CMT Camptotecin treated positive control. Acquisition was performed with FACS Calibur 2, Beckton Dickinson. At least 10,000 events were scored and data were processed by FlowJo 8.5.3 software. Data from -/- mHSPC and n.d. CB (and GLD BM for TUNEL) are shown, but similar findings were obtained following GALC transduction of +/+ mHSPC as compared to -/- cells and in n.d. BM (TTJNEL and Annexin V) and GLD BM (Annexin V) hHSPC as compared to CB cells.
- IGFl treatment prevents apoptosis of GALC expressing HSPC.
- A CFC assay on GALCLV and ARSA.LV transduced mHSPC treated or not with IGF 1.
- the number (#) of colonies/plate (Y left axis, bars) was counted and the number of integrated lentiviral vector copies/cell (VCN)(Y right axis, dots) was measured.
- FIG. 16 Analysis of Cathepsin D activation in transduced cells.
- Activated form corresponds to 3OkDa membrane bound isoform, as indicated by arrow.
- No significant accumulation of the active form of Cathepsin D was observed in GALCLV transduced cells after gene transfer, compared to GFP.LV transduced cells.
- the precursor (48kDa, arrow) accumulated in GFP-transduced cells after 7 days of culture (GFP 7d), while its accumulation was less pronounced in the presence of GALC (GALC 5d), culminating with disappearance of both the precursor and mature forms after 7 days.
- An anti -actin was used as control for protein loading.
- FIG. 1 Sensitivity to GALC de novo expression in myeloid cells.
- Results from TUNEL assay (% TUNEL+ cells over the total nucleated cells, on Y left axis, bars), GALC activity determination (on Y right axis, dots) and, when possible, dedicated stainings, performed on (A) human monocytes, (B) the monocytic human cell line U(C) murine macrophages and D) murine microglia, 5 days after transduction.
- TUNEL staining demonstrated the occurrence of minor/no apoptosis (> 6 fields and > 250 cells were counted per condition), despite efficient transduction (evaluated by anti-HA staining on macrophages in (C)) and sustained GALC expression above basal levels in all the other samples (ARSA. LV- or GFP. LV- transduced cells), were obtained. Mean values ⁇ SD are shown.
- C and D Representative images of TUNEL assay on GALC/GALC-HA.LV or GFP.LV transduced macrophages (C) and microglia (D). Images were acquired by three-laser confocal microscope (Radiance 2100, BioRad). Fluorescent signals from single optical sections were sequentially acquired and analyzed by Adobe Photoshop CS software. Magnification: 80x in C, 10Ox in D.
- TUNEL staining demonstrated the occurrence of minor/no apoptosis (> 6 fields and > 250 cells were counted per condition), despite efficient transduction (see the sustained GALC expression above basal levels). Mean values ⁇ SD are shown.
- B Representative images of TUNEL assay on GALCLV or GFP.LV transduced oligodendrocytes. The purity of the oligodendrocyte preparation was verified by NG2 and Gal-Cer staining on non-transduced cells (UT), while microglia was stained with F4/80 on GALC.LV-transduced cells; ToPro(TPIII) was used to stain nuclei. Images were acquired by three-laser confocal microscope (Radiance 2100, BioRad). Fluorescent signals from single optical sections were sequentially acquired and analyzed by Adobe Photoshop CS software. Magnification: 4Ox.
- FIG. 21 Regulation of GALC expression by miRNA 126.
- A Schematic representation of GALC.miRNA126Tag.LV.
- B-C GALC activity assay and CFC assay performed on -I- mHSPC transduced with GALC.miRNA126Tag.LV (GALC.126miT) or with GALCLV or GFP.miRNA126Tag.LV.
- B Activity was normalized respect to +1+ levels (first colunm). Cells transduced with GALC.miRNA126Tag.LV over-express GALC at supraphysiological levels.
- FIG. 22 miRNA126 regulation of GALC expression prevents apoptosis of mHSPC.
- A TUNEL assay on GALC.miRNA126Tag.LV or GALCLV and GFP.miRNA126Tag.LV -transduced mHSPC. > 8 fields and > 100 cells were counted per condition. The large majority of GALC.miRNA126Tag.LV transduced cells was negative for TUNIEL.
- the indicated LVs were used to transduce murine and human HSPC obtained from GaIc-I- (-/-) and wild type (+/+) mice, as well as cord blood (CB) and bone marrow (BM) from normal donors, respectively.
- GALC activity B
- VCN vector copy number
- FIG. 24 Improved survival of GLD mice after HSC gene therapy.
- Gale-/- or +/+ murine HSPC were transduced with the indicated vectors and intravenously transplanted into Trs mice according to the experimental scheme in (A).
- Average survival ⁇ SD and average engraftment of the transduced cells, measured as % Of GFP + cells or VCN detected in the BM of transplanted mice ( ⁇ SD) at 120 days or at death; are shown (n 4-26 per group).
- ⁇ Similar results were obtained using +/+ mHSPC.
- F-I GALC activity (light blue) was qualitatively evaluated on brain sections from GALC- 126T transplanted and control mice.
- a marked infiltration of activated hematopoietic cells is present in untreated and GALC- 126T transplanted Trs mice, the latter showing GALC activity both within the transduced HSPC hematopoietic progeny (arrowheads in G and I showing co-staining of GALC [in blue] and Ibal [G] and CD45 [I] in brown) and in Ibal " , CD45 " non-hematopoietic cells.
- MicroRNAs fmiRNAs It has long been a central dogma of biology that genetic information flows from DNA to mRNA to protein. In other words, it has been assumed that genes code for proteins, and that proteins fulfil all cellular functions, including the regulation of gene expression programs. However, only a minority of RNA transcripts (2-3%) code for proteins in higher eukaryotes, calling into question the central dogma that proteins are the only effectors of cell function (Mercer et al., 2009). In fact, there is now emerging evidence that a class of non-coding small RNAs, called "microRNAs", fulfil a fundamental role in the regulation of gene expression.
- MicroRNAs are (Biffi et al, 2004; Sadelain M., 2006; Sadelain et al, 2005; Gaziev et al., 2005; Yesilipek MA., 2006; Abonour et al., 2000) nucleotide long, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level by triggering a process called RNA interference (RNAi, see below) (Bartel DP., 2004). MicroRNAs were first discovered in Caenorhabditis elegans in the form of lin-4 and let-7, and they were shown to regulate the timing of larval development. (Lee et al., 1993; Reinhart et ⁇ /.,2000).
- MicroRNA genes are scattered across all human chromosomes, except for the Y chromosome. They can be either located in non-coding regions of the genome or within introns of protein-coding genes. Around 50% of miRNAs appear in clusters which are transcribed as polycistronic primary transcripts (Lagos-Quintana et al., 2003). Similar to protein-coding genes, miRNAs are usually transcribed from polymerase-II promoters, generating a so-called primary miRNA transcript (pri- miRNA). This pri-miRNA is then processed through a series of endonucleolytic cleavage steps, performed by two enzymes belonging to the RNAse Type III family, Drosha and Dicer.
- a stem loop of about 60 nucleotides in length is excised by a specific nuclear complex, composed of Drosha and DiGeorge syndrome critical region gene (DGCR8), which crops both strands near the base of the primary stem loop and leaves a 5' phosphate and a 2 bp long, 3' overhang.
- DGCR8 DiGeorge syndrome critical region gene
- the pre-mirna is then actively transported from the nucleus to the cytoplasm by RAN-GTP and Exportin-(Yi et ai, 2003; Lund et ah, 2004).
- Dicer performs a double strand cut at the end of the stem loop not defined by the Drosha cut, generating a 19-24 bp duplex, which is composed of the mature miRNA and the opposite strand of the duplex, called miRNA* (Bartel DP., 2004).
- miRNA* the opposite strand of the duplex
- RISC RNA-induced silencing complex
- MicroRNAs trigger RNAi, very much like small interfering RNAs (siRNA) which are extensively being used for experimental gene knockdown.
- siRNA small interfering RNAs
- the main difference between miRNA and siRNA is their biogenesis.
- the guide strand of the small RNA molecule interacts with mRNA target sequences preferentially found in the 3' untranslated region (3'UTR) of protein-coding genes. It has been shown that nucleotides 2-8 counted from the 5 'end of the miRNA, the so- called seed sequence, are essential for triggering RNAi (Brennecke et al., 2005).
- the mRNA is endonucleolytically cleaved by involvement of the Argonaute (Ago) protein, also called “slicer". of the small RNA duplex into the RNA-induced silencing complex (RISC).
- DGRC DiGeorge syndrome critical region gene 8
- TRBP TAR (HIV) RNA binding protein 2
- miRNAs can induce the repression of translation initiation, mark target mRNAs for degradation by deadenylation, or sequester targets into the cytoplasm ic P-body.
- RNAi acts through multiple mechanisms leading to translational repression (Bartel DP., 2004; Pillai RS., 2005; Bartel DP., 2009).
- Eukaryotic mRNA degradation mainly occurs through the shortening of the polyA tail at the 3' end of the mRNA, and de-capping at the 5 'end, followed by 5 '-3' exonuclease digestion and accumulation of the miRNA in discrete cytoplasmic areas, the so called P-bodies, enriched in components of the mRNA decay pathway (Lui et al., 2005).
- MiRNAs which are useful in the present invention are miRNAs which are expressed in hematopoietic stem and/or progenitor cells but which are not expressed extensively in differentiated cells.
- Preferred examples include mir-130a, mir-126 and mir-223.
- Other sutiatble microRNAs include microRNAs expressed in embryonic stem cells and the so-called iPS cells.
- miR-302a, miR-373 and miR-292 are specifically expressed in pluripotent cells (ES, iPS) but not in adult-type stem cells or differentiated cells
- let-7 family microRNAs are expressed in all cells except from pluripotent ones (ES, iPS).
- miR-124a is specifically expressed in neurons.
- the miRNA may be used with a suitable gene vector, i.e. a vector suitable for delivering a gene (transgene) of interest, such as a viral vector.
- a suitable gene vector i.e. a vector suitable for delivering a gene (transgene) of interest, such as a viral vector.
- viral vectors suitable for gene therapy are well known in the art. Examples of viral vectors useful for the present invention are discribed in WO2007/000668.
- Viruses from several different families have been modified to generate viral vectors for gene delivery.
- Viruses which can be used in the present invention include retroviruses, lentivirus, adenoviruses, adeno-associated viruses, herpes simplex viruses, picornaviruses, and alphaviruses.
- the present invention preferably employs retroviruses, including lentiviruses.
- the present invention can be used to control expression of a transgene included in the vector.
- the invention can also be used to control expression of the vector.
- a vector which can be controlled by the mir-RNAs of the present invention is an oncolytic virus.
- Hematopoietic stem cell transplantation is the transplantation of blood stem cells derived from the bone marrow (in this case known as bone marrow transplantation) or blood.
- Stem cell transplantation is a medical procedure in the fields of hematology and oncology, most often performed for people with diseases of the blood, bone marrow, or certain types of cancer.
- stem cell growth factors GM-CSF and G-CSF are now performed using stem cells collected from the peripheral blood, rather than from the bone marrow. Collecting peripheral blood stem cells provides a bigger graft, does not require that the donor be subjected to general anesthesia to collect the graft, results in a shorter time to engraftment, and may provide for a lower long-term relapse rate.
- Hematopoietic stem cell transplantation remains a risky procedure with many possible complications; it has traditionally been reserved for patients with life-threatening diseases. While occasionally used experimentally in nonmalignant and nonhematologic indications such as severe disabling auto-immune disease and cardiovascular disease, the risk of fatal complications appears too high to gain wider acceptance.
- HSCTs Many recipients of HSCTs are multiple myeloma or leukemia patients who would not benefit from prolonged treatment with, or are already resistant to, chemotherapy.
- Candidates for HSCTs include pediatric cases where the patient has an inborn defect such as severe combined immunodeficiency or congenital neutropenia with defective stem cells, and also children or adults with aplastic anemia who have lost their stem cells after birth.
- Other conditions treated with stem cell transplants include sickle-cell disease, myelodysplastic syndrome, neuroblastoma, lymphoma, Ewing's Sarcoma, Desmoplastic small round cell tumor and Hodgkin's disease.
- More recently non- myeloablative, or so-called "mini transplant” procedures have been developed that require smaller doses of preparative chemo and radiation. This has allowed HSCT to be conducted in the elderly and other patients who would otherwise be considered too weak to withstand a conventional treatment regimen.
- the present invention aims to widen the therapeutic application of such treatments by improving their safety and
- the present invention is particularly useful in gene therapy.
- therapies which involve the expression of a potentially toxic transgene.
- Diseases which can be treated in accordance with the present invention include lysosomal storage disorders (LSD) such as globoid Cell Leukodystrophy (GLD).
- LSD lysosomal storage disorders
- GMD chronic granulomatous disease
- CCD chronic granulomatous disease
- Globoid Cell Leukodystrophy or Krabbe disease is caused by mutations in the GALC gene, which causes a deficiency of an enzyme called galactosylceramidase.
- a gene therapy treatment of GLD involves inducing the GALC gene into the patient.
- the GALC could be intoduced into HSPC or HSC which is then transplanted into the patient.
- the present inventors found toxicity and in vitro and in vivo functional impairment of murine and human HSPC after LV-mediated
- GALC gene transfer and expression This toxicity could be overcome by using the gene vectors of the present invention.
- the delivery of one or more therapeutic genes by a vector system according to the present invention may be used alone or in combination with other treatments or components of the treatment.
- the vector of the present invention may be used to deliver one or more transgene(s) useful in the treatment of the disorders listed in WO-A-98/05635.
- cancer inflammation or inflammatory disease
- dermatological disorders fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, HIV infection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion injury, meningitis, migraine and aspirin-dependent anti- thrombosis
- cerebral ischaemia ischaemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis;
- the vector of the present invention may be used to deliver one or more transgene(s) useful in the treatment of disorders listed in WO-A-
- haematopoiesis e.g. treatment of myeloid or lymphoid diseases; promoting growth of bone, cartilage, tendon, ligament and nerve tissue, e.g. for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration; inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g.
- antiinflammatory activity for treating haemophilia and stroke
- antiinflammatory activity for treating e.g. septic shock or Crohn's disease
- antimicrobials for treating e.g. septic shock or Crohn's disease
- modulators of e.g. metabolism or behaviour for treating analgesics
- treating specific deficiency disorders in treatment of e.g. psoriasis, in human or veterinary medicine.
- the retroviral vector of the present invention may be used to deliver one or more transgenes(s) useful in the treatment of disorders listed in WO-A-98/09985.
- transgenes(s) useful in the treatment of disorders listed in WO-A-98/09985.
- macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity i.e.
- inhibitory effects against a cellular and/or humoral immune response including a response not associated with inflammation; inhibit the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction and inflammation including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urologic diseases, otitis or other oto-rhino-
- retinitis or cystoid macular oedema retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g.
- monocyte or leukocyte proliferative diseases e.g. leukaemia
- monocytes or lymphocytes for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
- the present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the vector of the present invention comprising one or more deliverable therapeutic and/or diagnostic transgenes(s) or a viral particle produced by or obtained from same.
- the pharmaceutical composition may be for human or animal usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual.
- the composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
- a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
- the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
- the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
- the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary; topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
- the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
- compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
- the delivery of one or more therapeutic genes by a vector system according to the invention may be used alone or in combination with other treatments or components of the treatment.
- Diseases which may be treated include, but are not limited to: cancer, neurological diseases, inherited diseases, heart disease, stroke, arthritis, viral infections and diseases of the immune system.
- Suitable therapeutic genes include those coding for tumour suppressor proteins, enzymes, pro-drug activating enzymes, immunomodulatory molecules, antibodies, engineered immunoglobulin-like molecules, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, cytokines, chemokines, anti-viral proteins, antisense RNA and ribozymes.
- Nucleotide sequences in bold: target sequence complementary to the miRNA. In general, we use 4 copies of miRNA targets separated by a 4-6 nucleotide linker. This can, however, be optimized.
- miR-126 UCGUACCGUGAGUAAUAAUGCG miR-126T sequence:
- miR-130a CAGUGCAAUGUUAAAAGGGCAU miR-130aT sequence:
- miR-223 UGUCAGUUUGUC AAAUACCCC A miR-223T sequence:
- transgenes expressed from lentiviral vectors can be down-regulated by endogenous miRNA for which artificial binding sites (miRT, miRNA target sites) are added to the transgene cassette (Brown BD., 2006).
- miRT miRNA target sites
- Bidirectional lentiviral vectors allow the coordinate expression of two reporter genes driven by a constitutive promoter with bidirectional activity, composed of the human phosphoglycerate kinase (PGK) promoter fused to a TATA-box in the form of a minimal cytomegalovirus (CMV) promoter in opposite orientation (Amendola M., 2005) Since this design allows both reporters to be expressed as two independent transcripts, one of them can be made responsive to miRNA activity by adding miRT to the 3'UTR ("miRNA reporter”), while the other one, not equipped with miRT, will not be affected by the miRNA and will serve as an internal control (“normalizer”).
- miRNA reporter 3'UTR
- Bd.LVs containing the green fluorescent protein (GFP) as the miRNA reporter and a truncated version of the human low-affinity nerve growth factor receptor (NGFR) as a constitutively expressed normalizer.
- GFP green fluorescent protein
- NGFR human low-affinity nerve growth factor receptor
- miR-223 was reported to be highly and specifically expressed in differentiated myeloid cells, but absent in lymphocytes (Fazi F., 2005), allowing us to test the performance of our reporter Bd.LVs in well characterized lineages.
- miR-223 was expressed in hematopoietic stem and progenitor cell (HSPC) populations. From a gene therapy perspective, it would be highly relevant to identify miRNAs that are strongly expressed in HSPC but not in differentiated progeny, in order to prevent off-target transgene expression in sensitive stem cell populations while fully maintaining therapeutic correction of the diseased progeny. Large-scale miRNA cloning has suggested that miR-126 might fulfil these criteria, as it was specifically detected in human CD34 + HSPC but not in other hematopoietic cell population (Landgraf et al., 2007).
- BdXVs for miR-223 and miR-126-3p (Bd.LV-223T and Bd.LV-126T, respectively), as well as a control Bd.LV not containing any miRT ( Figure 1). These vectors were then evaluated on a panel of different cell types ( Figure 2). HEK293T embryonic kidney cells, U937 monocytic cells and human umbilical vein endothelial cells (HUVECs) were transduced with matched doses of Bd.LV-ctr, Bd.LV-223T and Bd.LV- 126T, and analyzed for reporter expression by flow cytometry (FACS) several days after transduction.
- FACS flow cytometry
- HEK293T cells express low to undetectable levels of miR-223 or miR-126, while U937 cells strongly express miR-223 but not miR-126 (Fig.2a) and HUVECs express miR-126 but not miR-223 (Kuehbacher et al., 2007).
- Fig.2a U937 cells strongly express miR-223 but not miR-126
- HUVECs express miR-126 but not miR-223 (Kuehbacher et al., 2007).
- HEK293T cells to ectopically express miR-126 (Figure 2a) by transduction with an LV containing the pri-mir-126 under control of a ubiquitous promoter (now referred to as HEK293T.LV.miR-126, as opposed to the wild-type HEK293T cells).
- the GFP mean fluorescence intensity (MFI) of NGFR-expressing, transduced cells was identical for all three Bd.LVs ( Figure 2b, left column), confirming that neither miR-223 nor miR-126-3p were expressed in these cells.
- U937 cells transduced with Bd.LV.223T showed a substantial reduction in GFP MFI compared to Bd.LV.126T or Bd.LV.ctrl, indicating that miR- 223, but not miR-126, was biologically active in U937 cells.
- HUVECs showed a repression of GFP specifically for Bd.LV-126T when compared to the control vector.
- FR Protein Fold Repression value
- MFI mean fluorescence intensities
- the TGR obtained for the miRNA reporter vectors (Bd.LV.223T or Bd.LV.126T, respectively) were then divided by the TGR of the control Bd.LV.
- This quotient which we call “fold repression” from now on, is independent on vector dose and transduction level (at least within the linear portion of the vector dose-response curve) and provides a quantitative readout for miRNA activity in the analyzed cells (Figure 2c).
- Our miRT were designed to be perfectly complementary to the cognate miRNA. We thus expected that transcripts recognized by the miRNA were degraded.
- mice were euthanized, and miRNA activity was determined in multiple bone marrow populations defined by surface immunophenotyping. In this way, we wanted to assess whether these miRNAs were expressed in prospectively identified HSPC. In particular, we wanted to determine whether miR-126 is present in the most primitive HSC compartment.
- PB Peripheral blood
- leukocyte populations were sorted according to physical parameter and surface markers into granulocytes (CDl Ib+ side scatterhi SSChi ), monocytes (CDl lb+SSClo), B cells (CD19+) and T cells (CDl lb-CD19-) ( Figure 3a).
- GFP miRNA reporter and NGFR normalizer expression was quantified within these leukocyte subsets by FACS ( Figure 3b).
- GFP was similarly expressed in all leukocyte subsets derived from Bd.LV- ctr- and Bd.LV-126T-transduced HSPC, we noted a profound down-regulation of GFP specifically in PB myeloid cells but not in lymphocytes within the Bd.LV-223T group. Quantification of miR-223 activity indicated a 30-fold and 17-fold repression in granulocytes and monocytes, respectively, while miR-126 was not active in PB leukocytes ( Figure 3 c).
- mice In order to characterize the miR-223 and miR-126 profile in distinct HSPC subsets, we sacrificed Bd.LV reporter mice and subjected their bone marrow to a multi-color immunophenotyping analysis in order to prospectively identify distinct progenitor- and stem cell subpopulations. This was done for the mice described above, but also in a subsequent experiment on mice transplanted with HSPC expressing a more sensitive miRNA reporter based on a destabilized GFP variant. This reporter contains a proline-glutamate-serine-threonine-rich (PEST) sequence fused to the C-terminus of GFP.
- PEST proline-glutamate-serine-threonine-rich
- the PEST motif mediates fast proteasomal degradation and rapid turnover of the protein, shortening the GFP half-life from about 26 h to 4h (Kitsera et al., 2007). This short dGFP half-life allowed us to more accurately detect changes in miRNA expression, which possibly occur during the transit of HSC towards committed progenitors.
- autofluorescence in each individual subpopulation was subtracted from the GFP MFI by including a group of mice carrying a Bd.LV-NGFR vector which did not contain the GFP gene.
- the FACS plots in the following Fig. 4 were obtained from the BM of mice transplanted with the more sensitive Bd.dGFP vectors.
- the HSPC compartment was defined as bone marrow (BM) cells having a c-Kit hl Lineage markers "71 TM immunophenotype, and further subdivided into fractions with different self-renewal and differentiation potential based on expression of Sea- 1, CD 150, CD48 and CD45.
- BM bone marrow
- KSL immunophenotype c-Kit + Sea- 1 + Lin "
- Kit + Sca " Lineage" cells into subsets enriched for granulocyte/monocyte progenitors (GMPs) vs. megakaryocyte and erythrocyte progenitors (EP), and assessed miRNA expression.
- GMPs granulocyte/monocyte progenitors
- EP erythrocyte progenitors
- miR-126, miR-130a and miR-196b showed the highest activity in fractions enriched for the most primitive HSC, and this activity was lost during early stages of differentiation (Figure 4).
- miR- 126, miR-130a and miR-196b are largely inactive in differentiated cells of the lymphoid and myeloid lineages, with the exception of terminally differentiated granulocytes, which seem to re-establish some degree of miR-126 activity.
- miR-223 was expressed in the majority of KSL cells, and in all myeloid progenitors (GMPs), but was sharply down-regulated in EPs. As expected, miR-223 was progressively upregulated during myeloid differentiation, while B- and T- lymphocytes were devoid of it (Figure 5 a).
- TK herpes simplex virus thymidine kinase
- HSPC were transduced with one of the indicated suicide vectors or a GFP control vector, and were plated in semisolid medium, either in the presence or absence of GCV ( Figure 6b).
- HSPC transduced with the control TK vector did not give rise to colonies in the presence of GCV.
- Adding miR-142T sequences to the dTK transcript completely rescued colony formation, in line with the pan-hematopoietic expression of this miRNA (Brown BD., 2006). Instead, miR-223T at least partially restored the growth of myeloid colonies, while erythroid colony number was significantly reduced (p ⁇ 0.001) and did not differ statistically from control TK-transduced cells.
- a partial rescue of myeloid colonies was also obtained with the miR-126T, although to a lower level than that obtained with miR-223T.
- GCV fully prevented the growth of both myeloid and erythroid colonies in the miR-130aT groups, in line with the sharp down-regulation of mir-130a during early steps of differentiation.
- TK/GCV suicide system requires cell division in order to become toxic. Pilot experiments co-transplanting TK-transduced cells with untransduced BM supporting cells indicated that a 1-week time course of GCV given within the first 2 weeks of engraftment efficiently eliminates TK-transduced long- term repopulating HSC (data not shown).
- HSPC transduced HSPC with either a miRNA-regulated bidirectional suicide vector expressing dTK-126T or dTK-142T and GFP, or a control bidirectional suicide vector expressing dTK and ⁇ NGFR.
- Tg.l26T mice transgenic mouse line which harbors germline integrations of a lentiviral vector expressing a d4GFP.126T transcript from the same promoter used in the BdLV studies described above.
- FACS analysis of Lin " BM cells of young adult Tg.l26T mice showed a similar pattern of miR-126 activity as observed in the transplanted mice ( Figure 7a). This confirms that miR-126 is physiologically expressed in HSC.
- miR-126 is known to be expressed in endothelial cells, and loss-of-function during development resulted in fetal mortality due to defective angiogenesis (Fish JE., 2008). No gross phenotypic abnormalities were present in Tg.l26T mice.
- Myeloid (CD13 + ) and erythroid (CD235 + ) differentiation was assessed using the methylcellulose assay.
- miR-126, miR-130a and miR-223 all suppressed their respective reporter transcripts in the CD34 + HSPC population.
- miR-223 maintained activity in the myeloid lineage, while it decreased during erythroid differentiation.
- miR-126 lost its activity during myeloid differentiation but maintained it in the erythroid progeny.
- FIG. 8A Quantification of miRNA activity in the respective populations indicated that, among the miRNAs tested, miR-126 was the most potent miRNA in the CD34 + CD38 " CB fractions enriched for primitive HSPC.
- Figure 8c/d shows a further optimization of the miRT sequence by combining miR- 126T and miR-130aT sequences.
- mHSPC murine HSPC
- mHSPC Lin- cells from FVB/twi mice.
- mHSPC were transduced at MOI 100 with GALCLV in the presence of an optimized cytokine combination (Biffi et ah, 2004). After transduction, cells were cultured 10-14 days in vitro to assess enzymatic activity and the vector copy number (VCN) by Q-PCR.
- VCN vector copy number
- microRNA 142 Four target sequences for the microRNA 142 incorporated downstream the transgene allow to suppress expression hi mHSPC and in their progeny without impairing GALC expression in non-hematopoietic cells, such as 293T LV-producing cells.
- This technology is based on microRNA post-transcriptional regulation: microRNA 142, expressed only by hematopoietic cells, recognizes its target sequence downstream the transgene and inhibits the translation of the transcript and expression of the transgene.
- transduction of mHSPC with GALCmirl42T.LV was not associated to an increase of GALC activity (Figure 10B).
- mHSPC transduced with GALCmir 142T.LV (n 6) showed unaffected clonogenic potential and similar vector content as compared to controls, thus confirming the previously observed impairment being dependent on GALC expression ( Figure 10A).
- mice were transplanted with GALCLV transduced -/- HSPC and with either +/+ or GALCLV transduced -/- Seal- cells. Twi mice that received GALCLV transduced -/- HSPC and +/+ untransduced cells survived significantly longer than mice transplanted with +/+ total BM or with +/+ HSPC and Seal- progenitors, and showed amelioration of their phenotype and slower disease progression (Figure 12B). This data suggested that GALC over-expressing HSPC transplantation provides a unique therapeutic benefit as compared to conventional HSCT.
- FVB/twi mice instead of the usual twi model of GLD to take advantage from the slightly less severe model: previous experiments showed us that the successful transplantation of Lin- cells without the need of Seal -supporting cells was possible in this model. Moreover, FVB/twi mice have larger litters, thus allowing us to have a larger number of-/- mice to isolate mHSPC.
- Transduced mHSPC were transplanted into lethally irradiated 8 day-old FVB/twi -/- and heterozygous (+/-) recipients ( Figure 13).
- Mice of the control group were transplanted with GFP.LV transduced +/+ cells.
- the transduction efficiency was evaluated by cytofluorimetry 7 days after transduction on the in vitro culture, while the engraftment of transduced cells was evaluated by cytofluorimetry on peripheral blood 6 weeks after HSCT. The transduction efficiency was very high, ranging between 75% and 93% of GFP + cells.
- Macrophages and microglia represent the HSPC effector progeny reconstituting enzyme activity in affected tissues, including the nervous system, in HSPC gene therapy approaches for LSD.
- a prototypical monocytic cell line U937
- primary human monocytes e.g., primary human monocytes
- primary murine macrophages e.g., primary murine macrophages
- microglia could experience GALC expression toxicity upon LV mediated gene transfer.
- T and B lymphocytes e.g., T and B lymphocytes.
- Murine macrophages were obtained as the adherent fraction of peritoneal cell collection. Primary cultures of microglia were isolated from the brain of +/+ and - /- FVB/twi mice by established protocols (Armstrong RC, 1998; Gritti et ah, 1996). Further, we tested both primary monocytes and U937 monocytic cell line. Human monocytes were isolated from PBMC by positive selection for the CD 14 monocytic marker. Transduction conditions were set up using GFP.LV and analyzing the transduction efficiency by cytofluorimetry (when possible) or by confocal microscopy.
- mice transplanted with GALC.miRl 26T.LV transduced mHSPC were rescued from lethality and survived long term (more than 3 months after HSCT), differently from PGK GALCLV-transplanted mice that did not survive after lethal conditioning.
- mice transplanted with GALC. miR126T. LV transduced mHSPC were euthanized at the age of 80 days and Q-PCR analysis was performed on BM, we found an average VCN of 5, thus confirming the presence of transduced cells in the BM long-term after HCT.
- miR-126 regulation rescues HSPC from GALC expression toxicity and enables gene therapy of GLD
- the reconstituted GALC activity was substantially higher (up to 2 fold the wild type level) in the progeny of the cells transduced with GALC- 126T lentivector (in which GALC expression is driven by the PGK promoter) than in CDl Ib-GALC transduced cells, even when cultures transduced to similar vector copy number were compared ( Figure 23B and C).
- the GALC.126T lentiviral vector effectively protected human HSPC from GALC toxicity ( Figure 23 C and D). Given the likely benefit from supra-physiological enzyme activity in mature hematopoietic cells, we selected the miRNA-regulated vector for in vivo studies of GLD therapy.
- HSPC from Trs mice were transduced with the GALC- 126T lentiviral vector and transplanted into newborn Trs mice.
- Figure 24A wild type GFP-transduced HSPC
- the miRNA reporter vectors used in this work offer the opportunity to measure miRNA bioactivity rather than relying only on miRNA expression levels, thus providing a biologically meaningful, quantitative readout of miRNA function.
- Brown et al. have proposed that a threshold level of miRNA expression must be reached for significant suppressive activity against miRNA targets to occur, which might be the result of a limiting RNAi machinery available within a cell (Brown et al., 2007). If small RNAs compete for limited RNAi effector complexes, a sufficiently high level of expression may be necessary to ensure incorporation of the miRNA into an active RISC. Thus, those miRNA species, which are expressed to very low levels, may have little to no activity because they are not part of a functioning RISC.
- miRNA profiling studies often consider only relative differences in miRNA expression and can thus indicate statistically significant differences which may be, however, irrelevant to gene regulation.
- Combining the breadth of genome-wide miRNA expression analysis (e.g. by microarrays or deep sequencing) with the miRNA reporter Bd.LV approach adds another dimension to the study of microRNAs. It allows to stringently validate the biological significance of differential miRNA expression and can be used to longitudinally study the expression of a selected miRNA across multiple cell populations, with single cell resolution and in living cells. We used this approach to study the expression of selected miRNAs in rare and poorly accessible cell populations like HSC.
- miRNA reporter vector studies not only confirmed data on miR-223 and miR-126 expression profiles described in the literature, but added further information on the activity of these miRNA in highly pure HSPC subpopulations and their progeny.
- miR-223 has previously been described to be abundantly expressed in the myeloid lineage of mice and humans (Chen et al., 2004; Fazi et al., 2005; Rosa et al., 2007). Indeed, our reporter vector data found the highest miR-223 activity in granulocytes. Moreover, miR-223 activity was also revealed in monocytes and in a hierarchy of HSPC, in particular progenitors committed to the granulocyte-monocyte lineage.
- miR-126 is active in murine and human HSPC, and in particular within subsets enriched for the most primitive HSC. During early steps of differentiation, miR-126 activity progressively decreases. The association of miR-126 to human HSC is further corroborated by an analysis of BdLV.126T- transduced CB HSPC freshly isolated from NOD/SCED mice performed by our collaborator at UHN, Toronto (Lechman et al., 2008, ASH Abstract). Our data support a stem/early progenitor-specific expression pattern for miR-126, with silencing in most downstream lineages.
- PLK-2a polo-like kinase
- miR-126 activity is maintained upon transplantation of LSC into immunodeficient NOD/SCID mice.
- miR-126 activity visualized by a lentiviral reporter Bd.LV, could serve as a new biomarker and potentially therapeutic target for leukemic AML stem cells (Lechman et al., 2008, ASH Abstract).
- miR-126 has been extensively described as a positive regulator of angiogenic signaling in endothelial cells.
- Angiogenesis describes the formation of new blood vessels through the growth of pre-existing vessels.
- Signals promoting angiogenesis include vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which activate mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) cascades, regulating motility and proliferation of endothelial cells and consequent vessel sprouting.
- VEGF vascular endothelial growth factor
- bFGF basic fibroblast growth factor
- MAPK mitogen-activated protein kinase
- PI3K phosphoinositide 3-kinase
- miR-126 has two validated targets involved in the angiogenic process, Sprouty-related EVHl domain containing protein(Spredl) and a regulatory subunit of PD K, both negative regulators of VEFG/FGF signalling. Endothelial cells lacking miR-126 fail to respond to angiogenetic signals.
- miR-126 is expressed to biologically relevant levels in angiogenic endothelial cells as well as hematopoietic stem cells and their immediate progeny.
- expression of miR-126 is another factor that endothelial cells and HSC have in common.
- endothelial and hematopoietic cells red blood cells
- HSC and endothelial cells in the aorta-gonado- mesonephros region (AGM) underline the common origin of these 2 lineages, arising from a so-called "hemangioblast" cell population.
- miR-126 may contribute to the homeostasis of the hematopoietic niche and regulate proliferation of both its endothelial and HSC components.
- miRNA regulation is the possibility to interfere with the regulation of natural miRNA targets by over-expressing transcripts containing miRNA target sequences.
- dose requirement for saturating an miRNA's activity was quantified. Measuring the loss of regulation of sensitive reporters and a natural miRNA target upon challenging the cells with increasing doses of transcripts containing miRNA target sequences, we found that the threshold for interfering with physiological miRNA regulation is generally high and can only be reached when driving expression from strong, viral promoters.
- miRNA target sequences expressed from a moderate promoter like the phosphoglycerate kinase (PGK) promoter did not saturate miRNA activity, even at high vector copy number (up to 50 integrations). This suggested that miRNA regulation could safely be exploited for HSC gene therapy when expressing the miRNA regulated transcript from a moderate promoter and from a limited number of integrations per cell.
- lentiviral vectors can be engineered for deliberately interfering with miRNA activity and thus be used as a tool to characterize miRNA function.
- RISC complex actually works like an enzyme with high turnover rate, making it inherently difficult to be saturated.
- transcript degradation is impaired 57, redirecting the miRISC/mRNA complex to the "translational repression" pathway which is also primarily used by natural miRNAs in animal cells. Since translational repression likely occurs at a slower rate than degradation, we showed that imperfect targets resulted more efficient in competitively blocking miRNA activity respect to perfectly complementary targets (Gentner et ah, 2009).
- lentiviral vector-based technology allows stable integration of such expression cassettes designed for miRNA knockdown into the genome, thus representing a platform, which allows stable interference with miRNA activity.
- This technology was successfully exploited this technology to obtain a stable knockdown of miR-223 .
- Transplanting mice with BM cells transduced with a miR-223 knockdown vector to high vector copy number resulted in an expansion of myeloid cells, suggesting that miR-223 acts on granulocyte monocyte precursors as a negative regulator of myelopoiesis.
- mice which were reconstituted with BM containing the miR-223 knockdown vector, suggesting additional functions of miR-223 in the regulation of inflammatory myeloid cells (Gentner et ah, 2009). Strikingly, these mice phenocopied a recently described miR- 223 knockout mouse line (Johnnidis et ah, 2008).
- miRNA loss-of-function studies were limited up to now to transient transfection of chemically modified miRNA antisense molecules called "antagomirs" (Krutzfeldt et ah, 2005). While effective, their use is limited to cells, which can easily be transfected, which is not the case for most primary cells. Furthermore, the knockdown is transient and thus not easily applicable to genetic model systems. We envision broad applications for LV mediating stable miRNA knockdown. They will constitute important tools to investigate the physiological role of miRNA.
- microRNA-regulated vectors for hematopoietic stem cell gene therapy
- Adding miR-223 target sequences to a therapeutic transgene delivered to HSC would prevent expression in the myeloid progeny, including granulocyte monocyte progenitors and at least a subtraction of HSC. Importantly, this strategy would result in full therapeutic expression in the lymphoid and red cell lineage.
- miR-126 which is strongly expressed in HSPC but not in differentiated progeny of the myeloid and lymphoid lineage, allows preventing expression of a potentially toxic transgene in sensitive stem cell populations, while maintaining expression and therapeutic efficacy in the diseased progeny.
- Enzyme replacement and gene therapy applications in LSD patients have generally demonstrated the lack of toxicity of lysosomal enzyme administration and expression above normal levels.
- HSPC appear to have a unique sensitivity to GALC- and sphingolipid-mediated control of cell survival, which is apparently lost during differentiation into mature myeloid, T and B cells, and which is restricted to the hematopoietic lineage.
- oligodendrocytic cell death induced by oxidative stress or by amyloid- beta peptide accumulation in Alzheimer's disease (Jana et al., 2007; Lee et al., 2004).
- mature oligodendrocytes were also described as being resistant to some pro-apoptotic stimuli, inducing Cer accumulation.
- a differential response to pro-apoptotic TNF-stimulation was observed in oligodendrocytic precursors, where a high level of apoptosis was observed and in mature oligodendrocytes, which appeared to be resistant to apoptotic stimulation (Scurlock et al., 1999).
- Mature oligodendrocytes are also resistant to apoptosis induced by IL-I administration (Brogi et al., 1997) .
- it has been reported that the increase of intracellular Cer in neural tissue is managed by the high activity of acid ceramidase (Huang et al., 2004). This enzyme catalyzes the degradation of Cer to So, which, in turn, is phosphorylated to SlP.
- micro RNA micro RNA
- HSC-specific miRNA permitted the use of a strong promoter, such as PGK, thereby reaching the same expression level of the transgene in the differentiated HSPC progeny, as that obtained with unregulated PGK GALCLV.
- PGK a strong promoter
- the level of GALC expression required for HSC gene therapy to be effective is not known.
- the use of a stronger promoter may allow the vector copy number(s) to be reduced, but reach the desired enzymatic expression. This issue could be relevant for the safety of clinical translation of HSC gene therapy.
- the lentiviral vector platform represents a versatile and highly useful tool to study microRNA function.
- the bidirectional miRNA reporter vectors developed allow measuring miRNA activity at the single cell level in complex cell mixtures, adding a new dimension to conventional miRNA expression profiling approaches. Using this approach, we dissect the expression of several miRNAs in hematopoietic stem and progenitor cell (HSPC) populations with unprecedented resolution. Changing promoter and miRNA target design can result in lentiviral vectors capable of accomplishing stable miRNA knockdown, useful for generating loss-of-function phenotypes as a basis to elaborate the physiologic role of an miRNA. Proteomic analysis after stable miRNA knockdown will allow the identification of key targets for that miRNA that are modulated in the natural setting.
- miRNA-regulated vectors have significant therapeutic potential.
- miRNA target sequences can reduce ectopic transgene expression and thus alleviate or avoid transgene toxicity.
- HSC hematopoietic stem cell
- the miRNAs characterized here, miR-126, miR-130a and miR-223 restrict unwanted transgene expression in HSPC, while allowing it in the differentiated progeny, and will be further developed into clinical gene therapy protocols.
- Betito S Cuvillier O. Regulation by sphingosine 1 -phosphate of Bax and Bad activities during apoptosis in a MEK-dependent manner. Biochem Biophys Res Commun. 2006;340: 1273-1277.
- Fazi F Rosa A
- Fatica A et al.
- a mmicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis. Cell. 2005;123:81 9-831.
- Amyloid-beta peptide induces oligodendrocyte death by activating the neutral sphingomyelinase-ceramide pathway. J Cell Biol. 2004;164:123-131.
- the C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin- 14.
- Murine mucopolysaccharidosis type VII long term therapeutic effects of enzyme replacement and enzyme replacement followed by bone marrow transplantation. J Clin Invest. 1 997;99: 1596-1 605.
- Yesilipek MA Stem cell transplantation in hemoglobinopathies. Hemoglobin. 2007;31:251-256.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Priority Applications (24)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/266,381 US10287579B2 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| BRPI1010873A BRPI1010873B1 (pt) | 2009-04-30 | 2010-04-30 | usos de um vetor de genes, de uma composição farmacêutica e de uma célula |
| PL10723305T PL2424571T3 (pl) | 2009-04-30 | 2010-04-30 | Wektor genowy |
| SI201032001T SI2424571T1 (sl) | 2009-04-30 | 2010-04-30 | Genski vektor |
| EA201171335A EA023938B1 (ru) | 2009-04-30 | 2010-04-30 | Вектор гена |
| JP2012507847A JP6144911B2 (ja) | 2009-04-30 | 2010-04-30 | 遺伝子ベクター |
| DK10723305.8T DK2424571T3 (da) | 2009-04-30 | 2010-04-30 | Genvektor |
| HRP20200647TT HRP20200647T1 (hr) | 2009-04-30 | 2010-04-30 | Genski vektor |
| SM20200224T SMT202000224T1 (it) | 2009-04-30 | 2010-04-30 | Vettore genico |
| SG2011080009A SG175839A1 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| KR1020117028569A KR101793615B1 (ko) | 2009-04-30 | 2010-04-30 | 유전자 벡터 |
| MX2011011508A MX2011011508A (es) | 2009-04-30 | 2010-04-30 | Vector genico. |
| ES10723305T ES2786039T3 (es) | 2009-04-30 | 2010-04-30 | Vector génico |
| EP20167404.1A EP3733214A1 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| AU2010243276A AU2010243276B2 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| CN201080030337.7A CN102596255B (zh) | 2009-04-30 | 2010-04-30 | 基因载体 |
| EP10723305.8A EP2424571B1 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| CA2759438A CA2759438C (en) | 2009-04-30 | 2010-04-30 | Gene vectors and uses thereof for preventing or reducing expression of a nucleotide sequence in a hematopoietic stem or progenitor cell but not in a differentiated cell |
| LTEP10723305.8T LT2424571T (lt) | 2009-04-30 | 2010-04-30 | Genų vektorius |
| IL215804A IL215804A (en) | 2009-04-30 | 2011-10-23 | Gene vector, a pharmacological drug for use in gene therapy to prevent and reduce the expression of a nucleotide sequence in a hematopoietic or non-sorted but non-sorted stem cell and a method for in vitro |
| US15/693,112 US9951328B2 (en) | 2009-04-30 | 2017-08-31 | Gene vector |
| US16/384,571 US11407996B2 (en) | 2009-04-30 | 2019-04-15 | Gene vector |
| CY20201100405T CY1123218T1 (el) | 2009-04-30 | 2020-05-04 | Διαβιβαστης γονιδιου |
| US17/855,135 US20220333103A1 (en) | 2009-04-30 | 2022-06-30 | Gene vector |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17412409P | 2009-04-30 | 2009-04-30 | |
| US61/174,124 | 2009-04-30 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/266,381 A-371-Of-International US10287579B2 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
| US15/693,112 Division US9951328B2 (en) | 2009-04-30 | 2017-08-31 | Gene vector |
| US16/384,571 Division US11407996B2 (en) | 2009-04-30 | 2019-04-15 | Gene vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010125471A2 true WO2010125471A2 (en) | 2010-11-04 |
| WO2010125471A3 WO2010125471A3 (en) | 2010-12-29 |
Family
ID=42790671
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2010/001166 Ceased WO2010125471A2 (en) | 2009-04-30 | 2010-04-30 | Gene vector |
Country Status (23)
| Country | Link |
|---|---|
| US (4) | US10287579B2 (enExample) |
| EP (2) | EP2424571B1 (enExample) |
| JP (2) | JP6144911B2 (enExample) |
| KR (1) | KR101793615B1 (enExample) |
| CN (1) | CN102596255B (enExample) |
| AU (1) | AU2010243276B2 (enExample) |
| BR (1) | BRPI1010873B1 (enExample) |
| CA (1) | CA2759438C (enExample) |
| CY (1) | CY1123218T1 (enExample) |
| DK (1) | DK2424571T3 (enExample) |
| EA (1) | EA023938B1 (enExample) |
| ES (1) | ES2786039T3 (enExample) |
| HR (1) | HRP20200647T1 (enExample) |
| HU (1) | HUE049845T2 (enExample) |
| IL (1) | IL215804A (enExample) |
| LT (1) | LT2424571T (enExample) |
| MX (1) | MX2011011508A (enExample) |
| PL (1) | PL2424571T3 (enExample) |
| PT (1) | PT2424571T (enExample) |
| SG (2) | SG175839A1 (enExample) |
| SI (1) | SI2424571T1 (enExample) |
| SM (1) | SMT202000224T1 (enExample) |
| WO (1) | WO2010125471A2 (enExample) |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013152230A1 (en) * | 2012-04-04 | 2013-10-10 | The Trustees Of Columbia University In The City Of New York | Smooth muscle specific inhibition for anti-restenotic therapy |
| WO2014011901A3 (en) * | 2012-07-11 | 2014-06-05 | Sangamo Biosciences, Inc. | Methods and compositions for delivery of biologics |
| US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| WO2017136358A1 (en) | 2016-02-01 | 2017-08-10 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| WO2019032898A1 (en) | 2017-08-09 | 2019-02-14 | Bioverativ Therapeutics Inc. | NUCLEIC ACID MOLECULES AND USES THEREOF |
| WO2019152692A1 (en) | 2018-02-01 | 2019-08-08 | Bioverativ Therapeutics, Inc. | Use of lentiviral vectors expressing factor viii |
| WO2020033863A1 (en) | 2018-08-09 | 2020-02-13 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| US10617721B2 (en) | 2013-10-24 | 2020-04-14 | Ospedale San Raffaele S.R.L. | Methods for genetic modification of stem cells |
| US20200165631A1 (en) * | 2017-07-27 | 2020-05-28 | Universita' Del Piemonte Orientale | Endothelial-specific promoter sequences and uses thereof |
| WO2020118069A2 (en) | 2018-12-06 | 2020-06-11 | Bioverativ Therapeutics Inc. | Use of lentiviral vectors expressing factor ix |
| US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| WO2021067389A1 (en) | 2019-09-30 | 2021-04-08 | Bioverativ Therapeutics Inc. | Lentiviral vector formulations |
| US11008561B2 (en) | 2014-06-30 | 2021-05-18 | Bioverativ Therapeutics Inc. | Optimized factor IX gene |
| WO2021262963A1 (en) | 2020-06-24 | 2021-12-30 | Bioverativ Therapeutics Inc. | Methods for the removal of free factor viii from preparations of lentiviral vectors modified to express said protein |
| WO2022046665A1 (en) | 2020-08-23 | 2022-03-03 | Bioverativ Therapeutics Inc. | MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA (ceDNA) |
| US11266732B2 (en) | 2010-05-14 | 2022-03-08 | Oregon Health & Science University | Recombinant HCMV and RHCMV vectors and uses thereof |
| US11305015B2 (en) | 2016-10-18 | 2022-04-19 | Oregon Health & Science University | Cytomegalovirus vectors eliciting T cells restricted by major histocompatibility complex E molecules |
| US11534464B2 (en) * | 2010-07-08 | 2022-12-27 | Duke University | Direct reprogramming of cells to cardiac myocyte fate |
| WO2023028440A2 (en) | 2021-08-23 | 2023-03-02 | Bioverativ Therapeutics Inc. | Baculovirus expression system |
| WO2023028456A1 (en) | 2021-08-23 | 2023-03-02 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| WO2023056331A1 (en) | 2021-09-30 | 2023-04-06 | Bioverativ Therapeutics Inc. | Nucleic acids encoding factor viii polypeptides with reduced immunogenicity |
| US11787851B2 (en) | 2013-02-15 | 2023-10-17 | Bioverativ Therapeutics Inc. | Optimized factor VIII gene |
| EP4058068A4 (en) * | 2019-11-12 | 2024-03-13 | The Regents Of The University Of California | Lentiviral vectors in hematopoietic stem cells to treat x-linked chronic granulomatous disease |
| WO2024026257A3 (en) * | 2022-07-25 | 2024-03-14 | Modernatx, Inc. | Engineered polynucleotides for cell selective expression |
| US12018256B2 (en) | 2016-07-14 | 2024-06-25 | Oxford University Innovation Limited | Method for modifying genes |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2010243276B2 (en) | 2009-04-30 | 2016-09-15 | Fondazione Telethon Ets | Gene vector |
| WO2016171235A1 (ja) * | 2015-04-22 | 2016-10-27 | 国立大学法人京都大学 | 組織細胞の選別方法 |
| US20180327820A1 (en) * | 2015-06-15 | 2018-11-15 | Murdoch Childrens Research Institute | Method of measuring chimerism |
| US10188750B1 (en) * | 2015-10-23 | 2019-01-29 | University Of South Florida | Self-replicating cell selective gene delivery compositions, methods, and uses thereof |
| US10457940B2 (en) | 2016-09-22 | 2019-10-29 | University Of Massachusetts | AAV treatment of Huntington's disease |
| CN106566838B (zh) * | 2016-11-14 | 2019-11-01 | 上海伯豪生物技术有限公司 | 一种基于CRISPR-Cas9技术的miR-126全长基因敲除试剂盒及其应用 |
| FI3612624T3 (fi) * | 2017-04-21 | 2024-12-04 | Ospedale San Raffaele Srl | Geeniterapia |
| CN115725656A (zh) * | 2021-09-01 | 2023-03-03 | 联邦生物科技(珠海横琴)有限公司 | 一种以细胞质rna病毒为载体递送干扰rna的方法 |
| WO2025122739A1 (en) * | 2023-12-05 | 2025-06-12 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Compositions and methods for treating a heart disease |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5723315A (en) | 1996-08-23 | 1998-03-03 | Genetics Institute, Inc. | Secreted proteins and polynucleotides encoding them |
| PL193829B1 (pl) | 1996-08-07 | 2007-03-30 | Darwin Discovery Ltd | Pochodne kwasów hydroksamowych, środek farmaceutyczny i zastosowanie pochodnych kwasów hydroksamowych w medycynie |
| US6126939A (en) | 1996-09-03 | 2000-10-03 | Yeda Research And Development Co. Ltd. | Anti-inflammatory dipeptide and pharmaceutical composition thereof |
| RU2305708C2 (ru) * | 2001-10-02 | 2007-09-10 | Энститю Клейтон Де Ля Решерш | Рекомбинантный лентивирусный вектор, клетка-хозяин, трансдуцированная лентивирусным вектором, способ ее трансдукции и применение |
| EP2290071B1 (en) | 2004-05-28 | 2014-12-31 | Asuragen, Inc. | Methods and compositions involving microRNA |
| US20060134784A1 (en) * | 2004-11-30 | 2006-06-22 | Basch Ross S | Methods and compositions for the growth and maintenance of stem cells |
| PL2002003T3 (pl) * | 2005-05-27 | 2016-06-30 | Ospedale San Raffaele Srl | Wektor genetyczny zawierający mi-RNA |
| JP2008541737A (ja) * | 2005-06-03 | 2008-11-27 | サウザーン アデレード ヘルス サービス−ファインダーズ メディカル センター | マイクロrna発現の変化した細胞を標的とすること |
| US20090180989A1 (en) * | 2005-10-05 | 2009-07-16 | Synageva Biopharma Corp. | Compositions and methods for delivering nucleotide sequences to vertebrates |
| EP2487260B1 (en) | 2006-01-05 | 2015-07-08 | The Ohio State University Research Foundation | Microrna-based methods and compositions for the diagnosis and treatment of solid cancers |
| US20080095750A1 (en) | 2006-05-10 | 2008-04-24 | Pennington Biomedical Research Center, Louisiana State University System | Use of adipose-derived stem cells for treatment of leukodystrophies |
| EP2104736B1 (en) | 2006-12-08 | 2011-11-23 | Asuragen, INC. | Mir-126 regulated genes and pathways as targets for therapeutic intervention |
| PT3252161T (pt) | 2007-06-06 | 2022-02-01 | Genzyme Corp | Terapia genética para doenças do armazenamento lisossomal |
| US9938540B2 (en) | 2008-11-12 | 2018-04-10 | Ospedale San Raffaele S.R.L. | Gene vector for inducing transgene-specific immune tolerance |
| AU2010243276B2 (en) * | 2009-04-30 | 2016-09-15 | Fondazione Telethon Ets | Gene vector |
-
2010
- 2010-04-30 AU AU2010243276A patent/AU2010243276B2/en active Active
- 2010-04-30 SG SG2011080009A patent/SG175839A1/en unknown
- 2010-04-30 BR BRPI1010873A patent/BRPI1010873B1/pt active IP Right Grant
- 2010-04-30 SM SM20200224T patent/SMT202000224T1/it unknown
- 2010-04-30 CA CA2759438A patent/CA2759438C/en active Active
- 2010-04-30 JP JP2012507847A patent/JP6144911B2/ja active Active
- 2010-04-30 PT PT107233058T patent/PT2424571T/pt unknown
- 2010-04-30 SI SI201032001T patent/SI2424571T1/sl unknown
- 2010-04-30 LT LTEP10723305.8T patent/LT2424571T/lt unknown
- 2010-04-30 US US13/266,381 patent/US10287579B2/en active Active
- 2010-04-30 EP EP10723305.8A patent/EP2424571B1/en active Active
- 2010-04-30 EA EA201171335A patent/EA023938B1/ru not_active IP Right Cessation
- 2010-04-30 WO PCT/IB2010/001166 patent/WO2010125471A2/en not_active Ceased
- 2010-04-30 ES ES10723305T patent/ES2786039T3/es active Active
- 2010-04-30 KR KR1020117028569A patent/KR101793615B1/ko active Active
- 2010-04-30 DK DK10723305.8T patent/DK2424571T3/da active
- 2010-04-30 SG SG10201610827RA patent/SG10201610827RA/en unknown
- 2010-04-30 EP EP20167404.1A patent/EP3733214A1/en active Pending
- 2010-04-30 HR HRP20200647TT patent/HRP20200647T1/hr unknown
- 2010-04-30 HU HUE10723305A patent/HUE049845T2/hu unknown
- 2010-04-30 MX MX2011011508A patent/MX2011011508A/es active IP Right Grant
- 2010-04-30 CN CN201080030337.7A patent/CN102596255B/zh active Active
- 2010-04-30 PL PL10723305T patent/PL2424571T3/pl unknown
-
2011
- 2011-10-23 IL IL215804A patent/IL215804A/en active IP Right Grant
-
2015
- 2015-09-07 JP JP2015175986A patent/JP6370278B2/ja active Active
-
2017
- 2017-08-31 US US15/693,112 patent/US9951328B2/en active Active
-
2019
- 2019-04-15 US US16/384,571 patent/US11407996B2/en active Active
-
2020
- 2020-05-04 CY CY20201100405T patent/CY1123218T1/el unknown
-
2022
- 2022-06-30 US US17/855,135 patent/US20220333103A1/en active Pending
Non-Patent Citations (76)
| Title |
|---|
| ABONOUR R; WILLIAMS DA; EINHORN L ET AL.: "Efficient retrovirus-mediated transfer of the multidrug resistance 1 gene into autologous human long-term rep opulating hematopoietic stem cells", NAT MED., vol. 6, 2000, pages 652 - 658 |
| AKASHI K; TRAVER D; MIYAMOTO T; WEISSMAN IL: "A clonogenic common myeloid progenitor that gives rise to all myeloid lineages", NATURE, vol. 404, 2000, pages 1 93 - 197 |
| AMENDOLA, M.; VENNERI, M.A.; BIFFI, A.; VIGNA, E.; NALDINI, L.: "Coordinate dual- gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters", NATURE BIOTECHNOLOGY, vol. 23, 2005, pages 108 - 116, XP002389318, DOI: doi:10.1038/nbt1049 |
| ARMSTRONG RC.: "Isolation and characterization of immature oligodendrocyte lineage cells", METHODS, vol. 16, 1998, pages 282 - 292, XP004466690, DOI: doi:10.1006/meth.1998.0685 |
| BARABE F; KENNEDY JA; HOPE KJ; DICK JE: "Modeling the initiation and progression of human acute leukemia in mice", SCIENCE, vol. 316, 2007, pages 600 - 604, XP009152207, DOI: doi:10.1126/science.1139851 |
| BARTEL DP.: "MicroRNAs: target recognition and regulatory functions", CELL, vol. 136, 2009, pages 21 5 - 233 |
| BARTEL DP: "MicroRNAs: genomics, biogenesis, mechanism, and function", CELL., vol. 116, 2004, pages 281 - 297, XP002359089, DOI: doi:10.1016/S0092-8674(04)00045-5 |
| BETITO S; CUVILLIER O.: "Regulation by sphingosine I-phosphate of Bax and Bad activities during apoptosis in a MEK-dependent manner", BIOCHEM BIOPHYS RES COMMUN., vol. 340, 2006, pages 1273 - 1277, XP024924183, DOI: doi:10.1016/j.bbrc.2005.12.138 |
| BIFFI A; CAPOTONDO A; FASANO S ET AL.: "Gene therapy of metachromatic leukodystrophy reverses neurological damage and deficits in mice", J CLIN INVEST., vol. 1, no. 16, 2006, pages 3070 - 3082 |
| BIFFI A; DE PALMA M; QUATTRINI A ET AL.: "Correction of metachromatic leukodystrophy in the mouse model by transplantation of genetically modified hematopoietic stem cells", J CLIN INVEST., vol. 113, 2004, pages 1118 - 1129 |
| BOGGS JM; GAO W; HIRAHARA Y.: "Myelin glycosphingolipids, galactosylceramide and sulfatide, participate in carbohydrate-carbohydrate interactions between apposed membranes and may form glycosynapses between oligodendrocyte and/or myelin membranes", BIOCHIM BIOPHYS ACTA, vol. 1 78 0, 2008, pages 445 - 455 |
| BRADY RO: "Enzyme replacement .for lysosomal diseases", ANNU REV MED., vol. 57, 2006, pages 283 - 296 |
| BRADY RO; SCHIFFINANN R: "Enzyme-replacement therapy for metabolic storage disorders", LANCET NEUROL., vol. 3, 2004, pages 752 - 756, XP004808813, DOI: doi:10.1016/S1474-4422(04)00938-X |
| BRENNECKE J; STARK A; RUSSELL RB; COHEN SM.: "Principles of microRNA-target recognition", PLOS BIOL., vol. 3, 2005, pages E85, XP002395136, DOI: doi:10.1371/journal.pbio.0030085 |
| BROGI A; STRAZZA M; MELLI M; COSTANTINO-CECCARINI E.: "Induction of intracellular ceramide by interleukin-1 beta in oligodendrocytes", J CELL BIOCHEM., vol. 66, 1997, pages 532 - 541 |
| BROWN BD; CANTORE A; ANNONI A ET AL.: "A microRNA -regulated lentiviral vector mediates stable correction of hemophilia B mice", BLOOD, vol. 110, 2007, pages 4144 - 4152, XP002471753, DOI: doi:10.1182/blood-2007-03-078493 |
| BROWN BD; GENTNER B; CANTORE A ET AL.: "Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state", NAT BIOTECHNOL., vol. 25, 2007, pages 1 457 - 1467 |
| BROWN BD; VENNERI MA; ZINGALE A; SERGI SERGI L; NALDINI L.: "Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer", NAT MED., vol. 12, 2006, pages 585 - 591, XP002652777, DOI: doi:10.1038/nm1398 |
| CAPOTONDO A; CESANI M; PEPE S ET AL.: "Safety of Arylsulfatase A Overexpression for Gene Therapy of Metachromatic Leukodystrophy", HUM GENE THER., 2007 |
| CHEN CZ; LI L; LODISH HF; BARTEL DP: "MicroRNAs modulate hematopoietic lineage differentiation", SCIENCE, vol. 303, 2004, pages 83 - 86, XP002605499 |
| CHUDAKOVA DA; ZEIDAN YH; WHEELER BW ET AL.: "Integrin-associated Lyn kinase promotes cell survival by suppressing acid sphingomyelinase activity", J BIOL CHEM., vol. 283, 2008, pages 28806 - 28816 |
| DIVAKA RAN V; MANN DL.: "The emerging role of microRNAs in cardiac remodeling and heart failure", CIRC RES., vol. 1, no. 03, 2008, pages 1072 - 1083 |
| FAZI F; ROSA A; FATICA A ET AL.: "A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and C/EBPalpha regulates human granulopoiesis", CELL, vol. 123, 2005, pages 81 9 - 831 |
| FISH JE; SANTORO MM; MORTON SU ET AL.: "miR-126 regulates angiogenic signaling and vascular integrity", DEV CELL., vol. 15, 2008, pages 272 - 284, XP055002871, DOI: doi:10.1016/j.devcel.2008.07.008 |
| GAZIEV J; LUCARELLI G.: "Stem cell transplantation and gene therapy for hemoglobinopathies", CURR HEMATOL REP., vol. 4, 2005, pages 1 26 - 131 |
| GENTNER B; SCHIRA G; GIUSTACCHINI A ET AL.: "Stable knockdown of microRNA in vivo by lentiviral vectors", NAT METHODS., 2008 |
| GENTNER B; SCHIRA G; GIUSTACCHINI A ET AL.: "Stable knockdown of microRNA in vivo by lentiviral vectors", NAT METHODS., vol. 6, 2009, pages 63 - 66, XP055111148, DOI: doi:10.1038/nmeth.1277 |
| GRITTI A; PARATI EA; COVA L ET AL.: "Multipotential stem cells from the adult mouse brain proliferate and self-renew in response to basic fibroblast growth factor", J NEUROSCI., vol. 16, 1996, pages 1091 - 1100, XP000881158 |
| HALEY B; ZAMORE PD: "Kinetic analysis of the RNAi enzyme complex", NAT STRUCT MOL BIOL., vol. 11, 2004, pages 599 - 606 |
| HARADA J; FOLEY M; MOSKOWITZ MA; WAEBER C.: "Sphingosine-1 -phosphate induces proliferation and morphological changes of neural progenitor cells", J NEUROCHEM., vol. 88, 2004, pages 1 026 - 1039 |
| HE L; HE X; LOWE SW; HANNON GJ.: "microRNAs join the p53 network--another piece in the tumour-suppression puzzle", NAT REV CANCER., vol. 7, 2007, pages 819 - 822 |
| HOFLING AA; DEVINE S; VOGLER C; SANDS MS: "Human CD34+ hematopoietic progenitor cell-directed lentiviral-mediated gene therapy in a xenotransplantation model of lysosomal storage disease", MOL THER., vol. 9, 2004, pages 856 - 865, XP055103845, DOI: doi:10.1016/j.ymthe.2004.03.013 |
| HUANG Y; TANIMUKAI H; LIU F; IQBAL K; GRUNDKE-IQBAL I; GONG CX: "Elevation of the level and activity of acid ceramidase in Alzheimer's disease brain", EUR J NEUROSCI., vol. 20, 2004, pages 3489 - 3497 |
| JANA A; PAHAN K.: "Oxidative stress kills human primary oligodendrocytes via neutral sphingomyelinase: implications for multiple sclerosis", J NEUROIMMUNE PHARMACOL., vol. 2, 2007, pages 1 84 - 193 |
| JOHNNIDIS JB; HARRIS MH; WHEELER RT ET AL.: "Regulation of progenitor cell proliferation and granulocyte function by microRNA -223", NATURE, vol. 451, 2008, pages 1 125 - 1129 |
| KENNEDY JA; BARABE F; POEPPL AG; WANG JC; DICK JE.: "Comment on "Tumor growth need not be driven by rare cancer stem cells", SCIENCE, vol. 318, 2007, pages 1 722 |
| KIEL MJ; YILMAZ OH; IWASHITA T; TERHORST C; MORRISON SJ.: "SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells", CELL, vol. 1, no. 21, 2005, pages 1109 - 1121 |
| KITSERA N; KHOBTA A; EPE B.: "Destabilized green fluorescent protein detects rapid removal of transcription blocks after genotoxic exposure", BIOTECHNIQUES, vol. 43, 2007, pages 222 - 22 7 |
| KRUTZFELDT J; RAJEWSKY N; BRAICH R ET AL.: "Silencing of microRNAs in vivo with 'antagomirs'", NATURE, vol. 438, 2005, pages 685 - 689, XP008125598 |
| KRUTZFELDT J; STOFFEL M.: "MicroRNAs: a new class of regulatory genes affecting metabolism", CELL METAB., vol. 4, 2006, pages 9 - 12, XP009071518, DOI: doi:10.1016/j.cmet.2006.05.009 |
| KUEHBACHER A; URBICH C; ZEIHER AM; DIMMELER S.: "Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis", CIRC RES., vol. 01, 2007, pages 59 - 68, XP002664447, DOI: doi:10.1161/CIRCRESAHA.107.153916 |
| LAGOS-QUINTANA M; RAUHUT R; MEYER J; BORKHARDT A; TUSCHL T.: "New microRNAs from mouse and human", RNA, vol. 9, 2003, pages 1 75 - 179 |
| LANDGRAF P; RUSU M; SHERIDAN R ET AL.: "A mammalian microRNA expression atlas based on small RNA library sequencing", CELL, vol. 1 29, 2007, pages 1401 - 1414, XP002490508, DOI: doi:10.1016/j.cell.2007.04.040 |
| LEE JT; XU J; LEE JM ET AL.: "Amyloid-beta peptide induces oligodendrocyte death by activating the neutral sphingomyelinase-ceramide pathway", J CELL BIOL., vol. 164, 2004, pages 123 - 131, XP055040322, DOI: doi:10.1083/jcb.200307017 |
| LEE RC; FEINBAUM RL; AMBROS V.: "The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14", CELL, vol. 75, 1993, pages 843 - 854, XP024246130, DOI: doi:10.1016/0092-8674(93)90529-Y |
| LUND E; GUTTINGER S; CALADO A; DAHL BERG JE; KUTAY U.: "Nuclear export of microRNA precursors", SCIENCE, vol. 303, 2004, pages 95 - 98, XP002604102, DOI: doi:10.1126/SCIENCE.1090599 |
| MECHTCHERIAKOVA D; WLACHOS A; SOBANOV J ET AL.: "Sphingosine 1-phosp hate phosphatase 2 is induced during inflammatory responses", CELL SIGNAL., vol. 19, 2007, pages 748 - 760 |
| MERCER TR; DINGER ME; MATTICK JS.: "Long non-coding RNAs: insights into functions", NAT REV GENET., vol. 1, no. 0, 2009, pages 155 - 159 |
| NALDINI L; BLOMER U; GALLAY P ET AL.: "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector", SCIENCE, vol. 272, 1996, pages 263 - 267 |
| NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 556 |
| OTT MG; SCHMIDT M; SCHWARZWAELDER K ET AL.: "Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS 1 -EVI1, PRDM1 6 or SETBP1", NAT MED., vol. 1, no. 2, 2006, pages 401 - 409 |
| OTT MG; SEGER R; STEIN S; SILER U; HOELZER D; GREZ M.: "Advances in the treatment of Chronic Granulomatous Disease by gene therapy", CURR GENE THER., vol. 7, 2007, pages 155 - 161, XP009093422, DOI: doi:10.2174/156652307780859044 |
| PILLAI RS: "MicroRNA function: multiple mechanisms for a tiny RNA?", RNA, vol. 1 1, no. 1, 2005, pages 1753 - 1761 |
| PRONK CJ; ROSSI DJ; MANSSON R ET AL.: "Elucidation of the phenotypic, functional, and molecular topography of a myeloerythroid progenitor cell hierarchy", CELL STEM CELL, vol. 1, 2007, pages 428 - 442 |
| REINHART BJ; SLACK FJ; BASSON M ET AL.: "The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans", NATURE, vol. 403, 2000, pages 901 - 906, XP002229063, DOI: doi:10.1038/35002607 |
| RIVERA J; PROIA RL; OLIVERA A.: "The alliance of sphingosine-1 -phosphate and its receptors in immunity", NAT REV IMMUNOL., vol. 8, 2008, pages 753 - 763, XP055002039, DOI: doi:10.1038/nri2400 |
| ROHRBACH M; CLARKE JT.: "Treatment of lysosomal storage disorders : progress with enzyme replacement therapy", DRUGS, vol. 67, 2007, pages 2697 - 2 71 6 |
| ROHRBACH M; CLARKE JT: "Treatment of lysosomal storage disorders : progress with enzyme replacement therapy", DRUGS, vol. 67, 2007, pages 2697 - 2 71 6 |
| ROSA A; BALLARINO M; SORRENTINO A ET AL.: "The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation", PROC NATL ACAD SCI U S A., vol. 1, no. 04, 2007, pages 19849 - 19854 |
| SADELAIN M.: "Recent advances in globin gene transfer for the treatment of beta- thalassemia and sickle cell anemia", CURR OPIN HEMATOL, vol. 13, 2006, pages 142 - 148 |
| SADELAIN M; LISOWSKI L; SAMAKOGLU S; RIVELLA S; MAY C; RIVIERE I.: "Progress toward the genetic treatment of the beta-thalassemias", ANN N Y ACAD SCI., vol. 1054, 2005, pages 78 - 91 |
| SANDS MS; VOGLER C; TORREY A ET AL.: "Murine mucopolysaccharidosis type VII: long term therapeutic effects of enzyme replacement and enzyme replacement followed by bone marrow transplantation", J CLIN INVEST., vol. 99, 1997, pages 1596 - 1 605 |
| SANO R; TESSITORE A; INGRASSIA A; D'AZZO A: "Chemokine-induced recruitment of genetically modified bone marrow cells into the CNS of GM1-gangliosidosis mice corrects neuronal pathology", BLOOD, vol. 1 06, 2005, pages 2259 - 22 68 |
| SCHWARZ DS; HUTVAGNER G; DU T; XU Z; ARONIN N; ZAMORE PD: "Asymmetry in the assembly of the RNAi enzyme complex", CELL, vol. 115, 2003, pages 199 - 208, XP002521543, DOI: doi:10.1016/S0092-8674(03)00759-1 |
| SCURLOCK B; DAWSON G.: "Differential responses of oligodendrocytes to tumor necrosis factor and other pro-apoptotic agents: role of ceramide in apoptosis", J NEUROSCI RES., vol. 55, 1999, pages 514 - 522 |
| TERSTAPPEN LW; HUANG S; SAFFORD M; LANSDORP PM; LOKEN MR: "Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+ CD38- progenitor cells", BLOOD, vol. 77, 1991, pages 1218 - 122 7 |
| TOMARI Y; ZAMORE PD.: "Perspective: machines for RNAi", GENES DEV., vol. 1, no. 9, 2005, pages 517 - 529 |
| WANG S; AURORA AB; JOHNSON BA ET AL.: "The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis", DEV CELL, vol. 15, 2008, pages 261 - 271 |
| WEIL WM; LINTON GF ET AL.: "Whiting-Theobald N, et al. Genetic correction of p67phox deficient chronic granulomatous disease using peripheral blood progenitor cells as a target for ret rovirus mediated gene transfer", BLOOD, vol. 89, 1997, pages 1 754 - 1761 |
| WOODS NB; BOTTERO V; SCHNIIDT M; VON KALLE C; VERMA IM.: "Gene therapy: therapeutic gene causing lymphoma", NATURE, vol. 440, 2006, pages 1 123 |
| WU YP; ATSUDA J; KUBOTA A; SUZUKI K; SUZUKI K.: "Infiltration of hematogenous lineage cells into the demyelinating central nervous system of twitcher mice", J NEUROPATHOL EXP NEUROL., vol. 59, 2000, pages 628 - 639 |
| XIAO C; RAJEWSKY K.: "MicroRNA control in the immune system: basic principles", CELL, vol. 136, 2009, pages 26 - 36, XP055011387, DOI: doi:10.1016/j.cell.2008.12.027 |
| YEAGER AM; BRENNAN S; TIFFANY C; MOSER HW; SANTOS GW: "Prolonged survival and remyelination after hematopoietic cell transplantation in the twitcher mouse", SCIENCE, vol. 225, 1984, pages 1052 - 1054 |
| YEAGER AM; SHINN C; SHINOHARA M; PARDOLL DM.: "Hematopoietic cell transplantation in the twitcher mouse", THE EFFECTS OF PRETRANSPLANT CONDITIONING WITH GRADED DOSES OF BUSULFAN. TRANSPLANTATION., vol. 56, 1993, pages 185 - 190 |
| YESILIPEK MA: "Stem cell transplantation in hemoglobinopathies", HEMOGLOBIN, vol. 31, 2007, pages 251 - 256 |
| YI R; QIN Y; MACARA IG; CULLEN BR: "Exportin-5 mediates the nuclear export of pre- microRNAs and short hairpin RNAs", GENES DEV., vol. 1, no. 7, 2003, pages 3011 - 3016 |
Cited By (112)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11266732B2 (en) | 2010-05-14 | 2022-03-08 | Oregon Health & Science University | Recombinant HCMV and RHCMV vectors and uses thereof |
| US11534464B2 (en) * | 2010-07-08 | 2022-12-27 | Duke University | Direct reprogramming of cells to cardiac myocyte fate |
| US10435678B2 (en) | 2011-12-30 | 2019-10-08 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US11939604B2 (en) | 2011-12-30 | 2024-03-26 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10954498B2 (en) | 2011-12-30 | 2021-03-23 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US10711257B2 (en) | 2011-12-30 | 2020-07-14 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| US9885026B2 (en) | 2011-12-30 | 2018-02-06 | Caribou Biosciences, Inc. | Modified cascade ribonucleoproteins and uses thereof |
| WO2013152230A1 (en) * | 2012-04-04 | 2013-10-10 | The Trustees Of Columbia University In The City Of New York | Smooth muscle specific inhibition for anti-restenotic therapy |
| US10925976B2 (en) | 2012-04-04 | 2021-02-23 | The Trustees Of Columbia University In The City Of New York | Smooth muscle specific inhibition for anti-restenotic therapy |
| US11479794B2 (en) | 2012-05-25 | 2022-10-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11814645B2 (en) | 2012-05-25 | 2023-11-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10113167B2 (en) | 2012-05-25 | 2018-10-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12215343B2 (en) | 2012-05-25 | 2025-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180503B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10227611B2 (en) | 2012-05-25 | 2019-03-12 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10266850B2 (en) | 2012-05-25 | 2019-04-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10301651B2 (en) | 2012-05-25 | 2019-05-28 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10308961B2 (en) | 2012-05-25 | 2019-06-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10337029B2 (en) | 2012-05-25 | 2019-07-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10351878B2 (en) | 2012-05-25 | 2019-07-16 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358659B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10358658B2 (en) | 2012-05-25 | 2019-07-23 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12180504B2 (en) | 2012-05-25 | 2024-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10385360B2 (en) | 2012-05-25 | 2019-08-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10400253B2 (en) | 2012-05-25 | 2019-09-03 | The Regents Of The University Of California | Methods and compositions or RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10407697B2 (en) | 2012-05-25 | 2019-09-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10415061B2 (en) | 2012-05-25 | 2019-09-17 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10421980B2 (en) | 2012-05-25 | 2019-09-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10428352B2 (en) | 2012-05-25 | 2019-10-01 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US12123015B2 (en) | 2012-05-25 | 2024-10-22 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10443076B2 (en) | 2012-05-25 | 2019-10-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10487341B2 (en) | 2012-05-25 | 2019-11-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10513712B2 (en) | 2012-05-25 | 2019-12-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10519467B2 (en) | 2012-05-25 | 2019-12-31 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10526619B2 (en) | 2012-05-25 | 2020-01-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10533190B2 (en) | 2012-05-25 | 2020-01-14 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10550407B2 (en) | 2012-05-25 | 2020-02-04 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11970711B2 (en) | 2012-05-25 | 2024-04-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10563227B2 (en) | 2012-05-25 | 2020-02-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10570419B2 (en) | 2012-05-25 | 2020-02-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10577631B2 (en) | 2012-05-25 | 2020-03-03 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10597680B2 (en) | 2012-05-25 | 2020-03-24 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10612045B2 (en) | 2012-05-25 | 2020-04-07 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11674159B2 (en) | 2012-05-25 | 2023-06-13 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10626419B2 (en) | 2012-05-25 | 2020-04-21 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10640791B2 (en) | 2012-05-25 | 2020-05-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11634730B2 (en) | 2012-05-25 | 2023-04-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10669560B2 (en) | 2012-05-25 | 2020-06-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10676759B2 (en) | 2012-05-25 | 2020-06-09 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11549127B2 (en) | 2012-05-25 | 2023-01-10 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11473108B2 (en) | 2012-05-25 | 2022-10-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11401532B2 (en) | 2012-05-25 | 2022-08-02 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11332761B2 (en) | 2012-05-25 | 2022-05-17 | The Regenis of Wie University of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10752920B2 (en) | 2012-05-25 | 2020-08-25 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10774344B1 (en) | 2012-05-25 | 2020-09-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10793878B1 (en) | 2012-05-25 | 2020-10-06 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11293034B2 (en) | 2012-05-25 | 2022-04-05 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11274318B2 (en) | 2012-05-25 | 2022-03-15 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10900054B2 (en) | 2012-05-25 | 2021-01-26 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10000772B2 (en) | 2012-05-25 | 2018-06-19 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11242543B2 (en) | 2012-05-25 | 2022-02-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11186849B2 (en) | 2012-05-25 | 2021-11-30 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982230B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10982231B2 (en) | 2012-05-25 | 2021-04-20 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988782B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10988780B2 (en) | 2012-05-25 | 2021-04-27 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11001863B2 (en) | 2012-05-25 | 2021-05-11 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008589B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11028412B2 (en) | 2012-05-25 | 2021-06-08 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US11008590B2 (en) | 2012-05-25 | 2021-05-18 | The Regents Of The University Of California | Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription |
| US10883119B2 (en) | 2012-07-11 | 2021-01-05 | Sangamo Therapeutics, Inc. | Methods and compositions for delivery of biologics |
| WO2014011901A3 (en) * | 2012-07-11 | 2014-06-05 | Sangamo Biosciences, Inc. | Methods and compositions for delivery of biologics |
| US10745716B2 (en) | 2012-12-06 | 2020-08-18 | Sigma-Aldrich Co. Llc | CRISPR-based genome modification and regulation |
| US10731181B2 (en) | 2012-12-06 | 2020-08-04 | Sigma, Aldrich Co. LLC | CRISPR-based genome modification and regulation |
| US11787851B2 (en) | 2013-02-15 | 2023-10-17 | Bioverativ Therapeutics Inc. | Optimized factor VIII gene |
| US9260752B1 (en) | 2013-03-14 | 2016-02-16 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US10125361B2 (en) | 2013-03-14 | 2018-11-13 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9725714B2 (en) | 2013-03-14 | 2017-08-08 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9803194B2 (en) | 2013-03-14 | 2017-10-31 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9909122B2 (en) | 2013-03-14 | 2018-03-06 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US11312953B2 (en) | 2013-03-14 | 2022-04-26 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9809814B1 (en) | 2013-03-14 | 2017-11-07 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US9410198B2 (en) | 2013-03-14 | 2016-08-09 | Caribou Biosciences, Inc. | Compostions and methods of nucleic acid-targeting nucleic acids |
| US10617721B2 (en) | 2013-10-24 | 2020-04-14 | Ospedale San Raffaele S.R.L. | Methods for genetic modification of stem cells |
| US12275970B2 (en) | 2014-06-30 | 2025-04-15 | Bioverativ Therapeutics Inc. | Optimized factor IX gene |
| US11008561B2 (en) | 2014-06-30 | 2021-05-18 | Bioverativ Therapeutics Inc. | Optimized factor IX gene |
| US10849920B2 (en) | 2015-10-05 | 2020-12-01 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US11590157B2 (en) | 2015-10-05 | 2023-02-28 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| US12246030B2 (en) | 2015-10-05 | 2025-03-11 | Modernatx, Inc. | Methods for therapeutic administration of messenger ribonucleic acid drugs |
| WO2017136358A1 (en) | 2016-02-01 | 2017-08-10 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| US11753461B2 (en) | 2016-02-01 | 2023-09-12 | Bioverativ Therapeutics Inc. | Optimized factor VIII genes |
| EP4137570A1 (en) | 2016-02-01 | 2023-02-22 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| US12018256B2 (en) | 2016-07-14 | 2024-06-25 | Oxford University Innovation Limited | Method for modifying genes |
| US11305015B2 (en) | 2016-10-18 | 2022-04-19 | Oregon Health & Science University | Cytomegalovirus vectors eliciting T cells restricted by major histocompatibility complex E molecules |
| US12460225B2 (en) * | 2017-07-27 | 2025-11-04 | Universita' Del Piemonte Orientale | Vector with an endothelial-specific promoter for treating factor V, VII, VIII, or IX deficiency |
| US20200165631A1 (en) * | 2017-07-27 | 2020-05-28 | Universita' Del Piemonte Orientale | Endothelial-specific promoter sequences and uses thereof |
| WO2019032898A1 (en) | 2017-08-09 | 2019-02-14 | Bioverativ Therapeutics Inc. | NUCLEIC ACID MOLECULES AND USES THEREOF |
| US12168776B2 (en) | 2017-08-09 | 2024-12-17 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof |
| WO2019152692A1 (en) | 2018-02-01 | 2019-08-08 | Bioverativ Therapeutics, Inc. | Use of lentiviral vectors expressing factor viii |
| WO2020033863A1 (en) | 2018-08-09 | 2020-02-13 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| US12364774B2 (en) | 2018-08-09 | 2025-07-22 | Bioverativ Therapeutics Inc. | Nucleic acid molecules and uses thereof for non-viral gene therapy |
| WO2020118069A2 (en) | 2018-12-06 | 2020-06-11 | Bioverativ Therapeutics Inc. | Use of lentiviral vectors expressing factor ix |
| US12403164B2 (en) | 2019-09-30 | 2025-09-02 | Bioverativ Therapeutics Inc. | Lentiviral vector formulations |
| WO2021067389A1 (en) | 2019-09-30 | 2021-04-08 | Bioverativ Therapeutics Inc. | Lentiviral vector formulations |
| EP4058068A4 (en) * | 2019-11-12 | 2024-03-13 | The Regents Of The University Of California | Lentiviral vectors in hematopoietic stem cells to treat x-linked chronic granulomatous disease |
| WO2021262963A1 (en) | 2020-06-24 | 2021-12-30 | Bioverativ Therapeutics Inc. | Methods for the removal of free factor viii from preparations of lentiviral vectors modified to express said protein |
| US12173307B2 (en) | 2020-06-24 | 2024-12-24 | Bioverativ Therapeutics Inc. | Methods for the purification of viral vectors |
| WO2022046665A1 (en) | 2020-08-23 | 2022-03-03 | Bioverativ Therapeutics Inc. | MODIFIED BACULOVIRUS SYSTEM FOR IMPROVED PRODUCTION OF CLOSED-ENDED DNA (ceDNA) |
| WO2023028456A1 (en) | 2021-08-23 | 2023-03-02 | Bioverativ Therapeutics Inc. | Optimized factor viii genes |
| WO2023028440A2 (en) | 2021-08-23 | 2023-03-02 | Bioverativ Therapeutics Inc. | Baculovirus expression system |
| WO2023056331A1 (en) | 2021-09-30 | 2023-04-06 | Bioverativ Therapeutics Inc. | Nucleic acids encoding factor viii polypeptides with reduced immunogenicity |
| WO2024026257A3 (en) * | 2022-07-25 | 2024-03-14 | Modernatx, Inc. | Engineered polynucleotides for cell selective expression |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220333103A1 (en) | Gene vector | |
| Wang et al. | Brain endothelial cells maintain lactate homeostasis and control adult hippocampal neurogenesis | |
| JP6713073B2 (ja) | 異常ヘモグロビン症を治療するための組成物および方法 | |
| US20160348103A1 (en) | Oligonucleotides and Methods for Treatment of Cardiomyopathy Using RNA Interference | |
| Yang et al. | Mir-184 contributes to brain injury through targeting PPAP2B following ischemic stroke in male rats | |
| US20090202493A1 (en) | Mir-150 for the treatment of blood disorders | |
| HK40021359A (en) | Compositions and methods to treating hemoglobinopathies | |
| HK1233490B (en) | Compositions and methods to treating hemoglobinopathies | |
| HK1233490A1 (en) | Compositions and methods to treating hemoglobinopathies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080030337.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10723305 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2759438 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 215804 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012507847 Country of ref document: JP Ref document number: 7894/CHENP/2011 Country of ref document: IN Ref document number: MX/A/2011/011508 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2010243276 Country of ref document: AU Date of ref document: 20100430 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010723305 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20117028569 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201171335 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13266381 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI1010873 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI1010873 Country of ref document: BR Kind code of ref document: A2 Effective date: 20111031 |