WO2010086189A2 - Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof - Google Patents

Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof Download PDF

Info

Publication number
WO2010086189A2
WO2010086189A2 PCT/EP2010/000616 EP2010000616W WO2010086189A2 WO 2010086189 A2 WO2010086189 A2 WO 2010086189A2 EP 2010000616 W EP2010000616 W EP 2010000616W WO 2010086189 A2 WO2010086189 A2 WO 2010086189A2
Authority
WO
WIPO (PCT)
Prior art keywords
adenoviral
protein
polynucleotide
seq
adenovirus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2010/000616
Other languages
English (en)
French (fr)
Other versions
WO2010086189A3 (en
Inventor
Stefano Colloca
Alfredo Nicosia
Riccardo Cortese
Virginia Ammendola
Maria Ambrosio
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Okairos AG
Original Assignee
Okairos AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/EP2009/000672 external-priority patent/WO2010085984A1/en
Priority to JP2011546719A priority Critical patent/JP5882741B2/ja
Priority to KR1020167024396A priority patent/KR101763093B1/ko
Priority to EP10702615.5A priority patent/EP2391638B1/en
Priority to MX2011007980A priority patent/MX2011007980A/es
Priority to LTEP10702615.5T priority patent/LT2391638T/lt
Priority to RU2011136282/10A priority patent/RU2604815C2/ru
Priority to HRP20181377TT priority patent/HRP20181377T1/hr
Priority to ES10702615T priority patent/ES2687294T3/es
Priority to CN201080006197XA priority patent/CN102300872A/zh
Priority to CA2749325A priority patent/CA2749325C/en
Priority to SG2011050275A priority patent/SG172935A1/en
Priority to BRPI1008018A priority patent/BRPI1008018A2/pt
Priority to DK10702615.5T priority patent/DK2391638T3/en
Priority to PL10702615T priority patent/PL2391638T3/pl
Priority to AU2010209938A priority patent/AU2010209938A1/en
Priority to NZ59435510A priority patent/NZ594355A/xx
Priority to EP18173908.7A priority patent/EP3385387B1/en
Application filed by Okairos AG filed Critical Okairos AG
Priority to SI201031745T priority patent/SI2391638T1/sl
Priority to KR1020117017573A priority patent/KR101761425B1/ko
Priority to US13/147,193 priority patent/US9718863B2/en
Publication of WO2010086189A2 publication Critical patent/WO2010086189A2/en
Publication of WO2010086189A3 publication Critical patent/WO2010086189A3/en
Priority to IL214097A priority patent/IL214097B/en
Anticipated expiration legal-status Critical
Priority to IL241494A priority patent/IL241494A0/en
Priority to AU2015238866A priority patent/AU2015238866B2/en
Priority to US15/623,723 priority patent/US10544192B2/en
Priority to AU2017204292A priority patent/AU2017204292B2/en
Priority to CY181100894T priority patent/CY1120652T1/el
Priority to US16/710,131 priority patent/US11214599B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/01DNA viruses
    • C07K14/075Adenoviridae
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/235Adenoviridae
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/861Adenoviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/864Parvoviral vectors, e.g. parvovirus, densovirus
    • C12N15/8645Adeno-associated virus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10111Atadenovirus, e.g. ovine adenovirus D
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10321Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10322New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10334Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/10011Adenoviridae
    • C12N2710/10311Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16634Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16111Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24211Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6009Vectors comprising as targeting moiety peptide derived from defined protein from viruses dsDNA viruses
    • C12N2810/6018Adenoviridae

Definitions

  • the present invention relates to novel adenovirus strains with an improved seroprevalence.
  • the present invention relates to isolated polypeptides of adenoviral capsid proteins such as hexon, penton and fiber protein and fragments thereof and polynucleotides encoding the same.
  • a vector comprising the isolated polynucleotide according to the invention and adenoviruses comprising the isolated polynucleotides or polypeptides according to the invention and a pharmaceutical composition comprising said vector, adenovirus, polypeptide and/or polynucleotide.
  • the invention also relates to the use of the isolated polynucleotides, the isolated polypeptides, the vector, the adenoviruses and/or the pharmaceutical composition for the therapy or prophylaxis of a disease.
  • the adenoviruses comprise a large family of double-stranded DNA viruses found in amphibians, avians, and mammals which have a nonenveloped icosahedral capsid structure (Straus, Adenovirus infections in humans; The Adenoviruses, 451-498, 1984; Hierholzer etal.,J. Infect.Dis.,158 : 804-813,1988; Schnurr and Dondero, Intervirology., 36: 79-83,1993 ; Jong et al., J. Clin. Microbiol., 37 : 3940-3945: 1999).
  • adenoviruses can transduce numerous cell types of several mammalian species, including both dividing and nondividing cells, without integrating into the genome of the host cell.
  • adenoviral DNA is typically very stable and remains episomal (e. g., extrachromosomal), unless transformation or tumorigenesis has occurred.
  • adenoviral vectors can be propagated to high yields in well-defined production systems which are readily amenable to pharmaceutical scale production of clinical grade compositions. These characteristics and their well-characterized molecular genetics make recombinant adenoviral vectors good candidates for use as vaccine carriers.
  • the production of recombinant adenoviral vectors may rely on the use of a packaging cell line which is capable of complementing the functions of adenoviral gene products that have been either deleted or engineered to be nonfunctional.
  • hAd2 and hAd5 are widely used as the sources of the viral backbone for most of the adenoviral vectors that are used for gene therapy.
  • Replication-defective human adenoviral vectors have also been tested as vaccine carriers for the delivery of a variety of immunogens derived from a variety of infectious agents.
  • Studies conducted in experimental animals e. g. rodents, canines and nonhuman primates indicate that recombinant replication-defective human adenoviral vectors carrying transgenes encoding immunogens as well as other antigens elicit both humoral and cell-mediated immune responses against the transgene product.
  • adenoviral vectors as vaccine carriers in nonhuman experimental systems by either using immunization protocols that utilizes high doses of recombinant adenoviral vectors that are predicted to elicit immune responses; or by using immunization protocols which employ the sequential administration of adenoviral vectors that are derived from different serotypes but which carry the same transgene product as boosting immunizations (Mastrangeli, et. al., Human Gene Therapy, 7: 79-87 (1996).
  • Ad5 human adenovirus type 5
  • Ad5-based vectors are extremely efficient in animal models, the presence of a pre-existing immunity in humans against Ad5 wild type virus has been demonstrated in clinical trials to reduce the efficiency of gene transduction.
  • a clear reduction of the immunization efficiency was demonstrated in subjects with titers of neutralizing antibodies over 200 enrolled in vaccine clinical trial based on Ad5 vectors.
  • the most extensive characterization of an Ad5 vectored vaccine was obtained in the HIV vaccine STEP trial conducted by Merck (Moore JP et al. Science. 2008 May 9; 320(5877):753- 5).
  • the vaccine study was based on the co-injection of 3 Ad5 vectors expressing different HIV antigens as proof of concept study in subjects with high risk of HIV infection. Surprisingly, the data revealed an increase of HIV infection rate in vaccinated subjects with anti-Ad5 pre-existing immunity rather then a protective effect. Although the mechanism of this paradoxical observation is not clear yet, the results raised additional questions on the safety and efficiency of vectors based on adenovirus of human origin for vaccine application in healthy subjects. Taken together all results obtained so far in different vaccine and gene therapy clinical trials such as the trials with Ad5 vectors increased the need for an adenovirus characterized in a very low or absent pre-existing immunity in humans.
  • the present invention provides an isolated polynucleotide that encodes an adenoviral fiber protein or a functional derivative thereof and that is selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence according to any of SEQ ID NOs: 14-19, 50 and 53;
  • the present invention relates to an isolated polynucleotide that encodes an adenoviral hexon protein or a functional derivative thereof and that is selected from the group consisting of:
  • a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 95% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 20-25, 51 and 54. Also provided is an isolated polynucleotide that encodes an adenoviral penton protein or a functional derivative thereof and that is selected from the group consisting of:
  • a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 85% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 26-31, 52 and 55.
  • the invention also relates to a polynucleotide comprising at least one of the isolated polynucleotide according to the invention as outlined above.
  • the invention further provides an isolated adenoviral capsid polypeptide encoded by the isolated polynucleotide according to the invention or a functional derivative thereof.
  • the invention provides a vector comprising the isolated polynucleotide according to the invention.
  • a recombinant adenovirus preferably a replication-incompetent adenovirus, comprising an isolated polynucleotide according to the invention and/or at least one isolated adenoviral capsid polypeptide according to the invention.
  • a further aspect of the invention is a composition comprising an adjuvant and at least one of the following (i) through (iv):
  • the invention further relates to a cell comprising at least one of the following: (i) one or more isolated adenoviral capsid polypeptides according to the invention; (ii) an isolated polynucleotide according to the invention; (iii) a vector according to the invention; (iv) a recombinant adenovirus according to the invention.
  • a further aspect of the invention relates to the use of an isolated adenoviral capsid polypeptide according to the invention; an isolated polynucleotide according to the invention; a vector according to the invention; a recombinant adenovirus according to the invention; and/or the composition according to the invention for the therapy or prophylaxis of a disease.
  • the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B. and Klbl, H. eds.
  • the adenoviral genome is well characterized. There is general conservation in the overall organization of the adenoviral genome with respect to specific open reading frames being similarly positioned, e.g. the location of the ElA, ElB, E2A, E2B, E3, E4, LI, L2, L3, L4 and L5 genes of each virus.
  • Each extremity of the adenoviral genome comprises a sequence known as an inverted terminal repeat (ITRs), which is necessary for viral replication.
  • ITRs inverted terminal repeat
  • the virus also comprises a virus-encoded protease, which is necessary for processing some of the structural proteins required to produce infectious virions.
  • the structure of the adenoviral genome is described on the basis of the order in which the viral genes are expressed following host cell transduction.
  • the viral genes are referred to as early (E) or late (L) genes according to whether transcription occurs prior to or after onset of DNA replication.
  • E early
  • L late
  • the ElA, ElB, E2A, E2B, E3 and E4 genes of adenovirus are expressed to prepare the host cell for viral replication.
  • L1-L5 which encode the structural components of the virus particles are activated.
  • isolated refers to a molecule which is substantially free of other molecules with which it is naturally associated with. An isolated molecule is thus free of other molecules that it would encounter or contact in a living animal in nature, i.e. outside an experimental setting.
  • protein As used herein, the term “protein”, “peptide”, “polypeptide”, “peptides” and “polypeptides” are used interchangeably throughout. These terms refers to both naturally occurring peptides, e.g. naturally occurring proteins and synthesized peptides that may include naturally or non-naturally occurring amino acids. Peptides can be also chemically modified by modifying a side chain or a free amino or carboxy-terminus of a natural or non-naturally occurring amino acid. This chemical modification includes the addition of further chemical moieties as well as the modification of functional groups in side chains of the amino acids, such as a glycosylation.
  • a peptide is a polymer preferably having at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least 100 amino acids, most preferably at least 8 or at least 30 amino acids.
  • polypeptides and proteins disclosed herein are derived from adenovirus, it is preferred that the molecular mass of an isolated polypeptide or protein as used herein does not exceed 200 kDa.
  • vector includes any vectors known to the skilled person including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenovirus (Ad) vectors (e.g., non-replicating Ad5, AdI l, Ad26, Ad35, Ad49, ChAd3, ChAd4, ChAd5, ChAd7, ChAd8, ChAd9, ChAdIO, ChAdI l, ChAdl ⁇ , ChAdl7, ChAdl9, ChAd20 , ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd63 and ChAd82 vectors or replication-competent Ad4 and Ad7 vectors known from the prior art, e.g.
  • Ad adenovirus
  • AAV vectors e.g., AAV type 5
  • alphavirus vectors e.g., Venezuelan equine encephalitis virus (VEE), Sindbis virus (SIN), semliki forest virus (SFV), and VEE-SIN chimeras
  • herpes virus vectors measles virus vectors, pox virus vectors (e.g., vaccinia virus, modified vaccinia virus Ankara (MVA), NYVAC (derived from the Copenhagen strain of vaccinia), and avipox vectors: canarypox (ALVAC) and fowlpox (FPV) vectors), and vesicular stomatitis virus vectors, viral like particles, or bacterial spores.
  • a vector also includes expression vectors, cloning vectors and vectors that are useful to generate recombinant adenoviruses in host cells.
  • an expression cassette refers to a nucleic acid molecule which comprises at least one nucleic acid sequence that is to be expressed, along with its transcription and translation control sequences. Changing the expression cassette will cause the vector in which it is incorporated to direct the expression of a different sequence or combination of sequences. Because of the restriction sites being preferably engineered to be present at the 5' and 3' ends, the cassette can be easily inserted, removed, or replaced with another cassette.
  • an expression cassette includes cis-regulating elements for efficient expression of a given gene, such as promoter, initiation-site and/or polyadenylation-site, as further described below.
  • antibody refers to both monoclonal and polyclonal antibodies, i.e., any immunoglobulin protein or portion thereof which is capable of binding an antigen or hapten.
  • Antigen-binding portions may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.
  • antigen-binding portions include Fab, Fab', F(ab') 2 , Fd, Fv, dAb, and complementarity determining region (CDR) variants, single- chain antibodies (scFv), chimeric antibodies, humanized antibodies, diabodies, and polypeptides that contain at least a portion of an antibody that is sufficient to confer specific antigen binding to the polypeptide.
  • an immunogen / antigen for inducing/generating an immune response in a mammal in the context of the present invention is termed "priming", and the administration of an immunogen/ antigen for enhancing an immune response against said immunogen/ antigen, e.g. a particular pathogen (such as a virion or a virus pathogen, an antigen of a pathogenic bacterium or a tumorantigen) in a mammal is termed "boosting".
  • pathogen such as a virion or a virus pathogen, an antigen of a pathogenic bacterium or a tumorantigen
  • Heterologous prime-boost is useful if a subject, e.g. patient has developed antibodies against a first vector and a boosting is required.
  • two different adenoviruses may be used, e.g. for vaccination and/or gene therapy.
  • a first and a second adenovirus are sufficiently different, if the antibody response induced during priming by the first adenovirus does not prevent more than 70% or preferably more than 80% of the second adenovirus particles administered for boosting from entering the nucleus of cells of the animal that has been subjected to priming and boosting.
  • replication-competent recombinant adenovirus refers to an adenovirus which can replicate in a host cell in the absence of any recombinant helper proteins comprised in the cell.
  • a "replication-competent" adenovirus comprises the following intact or functional essential early genes: ElA, ElB, E2A, E2B, E3 and E4. Wild type adenoviruses isolated from a particular animal will be replication competent in that animal.
  • replication-defective recombinant AdV refers to an adenovirus that has been rendered to be incapable of replication because it has been engineered to comprise at least a functional deletion, i.e. a deletion which impairs the function of a gene without removing it entirely, e.g. introduction of artificial stop codons, deletion or mutation of active sites or interaction domains, mutation or deletion of a regulatory sequence of a gene etc, or a complete removal of a gene encoding a gene product that is essential for viral replication, such as one or more of the adenoviral genes selected from El, E2, E3 and E4.
  • the recombinant chimpanzee adenoviral vectors of the invention are preferably replication-defective.
  • identity refers to the number of residues in the two sequences that are identical when aligned for maximum correspondence. Specifically, the percent sequence identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100.
  • Alignment tools that can be used to align two sequences are well known to the person skilled in the art and can, for example, be obtained on the World Wide Web, e.g., ClustalW (www.ebi.ac.uk/clustalw) or Align (http://www.ebi.ac.uk/emboss/align/index.html).
  • the alignments between two sequences may be carried out using standard settings, for Align EMBOSS::needle preferably: Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.
  • Matrix Blosum62
  • Gap Open 10.0 Gap Open 10.0
  • Gap Extend 0.5 Those skilled in the art understand that it may be necessary to introduce gaps in either sequence to produce a satisfactory alignment.
  • the "best sequence alignment" between two polypeptides is defined as the alignment that produces the largest number of aligned identical residues.
  • Ad An adenovirus
  • hAds Human adenoviruses
  • Mastadenovirus genus which includes all known human and many Ads of animal (e. g., bovine, porcine, canine, murine, equine, simian and ovine) origin.
  • Human adenoviruses are generally divided into six subgroups (A-F) based on a number of biological, chemical, immunological and structural criteria which include hemagglutination properties of rat and rhesus monkey erythrocytes, DNA homology, restriction enzyme cleavage patterns, percentage G+C content and oncogenicity (Straus, 1984, in The Adenoviruses, ed. H. Ginsberg, pps.451-498, New York : Plenus Press, and Horwitz, 1990; in Virology, eds. B. N. Fields and D. M. Knipe, pps. 1679-1721).
  • the adenoviral virion has an icosahedral symmetry and, depending on the serotype, a diameter of 60-90 run.
  • the icosahedral capsid comprises three major proteins, hexon (II), penton base (III) and a knobbed fiber (IV) protein (W. C. Russel, J. Gen. Virol., 81 : 2573-2604 (2000)).
  • One aspect of the preexisting immunity that is observed in humans is humoral immunity, which can result in the production and persistence of antibodies that are specific for adenoviral proteins.
  • the humoral response elicited by adenovirus is mainly directed against the three major structural proteins: hexon, penton and fiber.
  • adenoviruses are useful in gene-therapy and as vaccines.
  • Viral vectors based on chimpanzee adenovirus represent an alternative to the use of human derived Ad vectors for the development of genetic vaccines (Farina SF, J Virol. 2001 Dec;75(23):l 1603-13.; Fattori E, Gene Ther. 2006 Jul;13(14):1088-96).
  • Adenoviruses isolated from chimpanzees are closely related to adenoviruses isolated from humans as demonstrated by their efficient propagation in cells of human origin. However, since human and chimp adenoviruses are close relatives, a serologic cross reactivity between the two virus species can be expected.
  • a chimpanzee adenovirus also abbreviated herein as "ChAd” for common chimpanzee adenovirus and "PanAd” for bonobo chimpanzee adenovirus
  • ChoAd common chimpanzee adenovirus
  • PanAd bonobo chimpanzee adenovirus
  • the present invention comprises the unexpected finding that novel chimpanzee adenovirus strains could be isolated, namely ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 isolated from the Common Chimpanzee ⁇ Pan troglodytes) and PanAdl, PanAd2 and PanAd3 isolated from bonobos ⁇ Pan paniscus). All these novel strains show no measurable seroprevalence in humans, i.e.
  • a neutralizing antibody refers to an antibody that binds to an epitope of the adenovirus and prevents it from producing a productive infection in a host cell or prevents the transduction of a target cell with a replication incompentent vector expressing a transgene, e.g. the adenovirus DNA is capable of entering a host cell.
  • the invention provides, in one aspect, novel sequences of adenovirus capsid proteins that represent the most surface exposed adenovirus epitopes, namely hexon, penton and fiber protein.
  • adenovirus capsid proteins that represent the most surface exposed adenovirus epitopes, namely hexon, penton and fiber protein.
  • no neutralizing antibodies specific for the viruses according to the invention are comprised in human blood sera.
  • one advantage of the aforementioned novel chimpanzee hexon, penton and fiber protein sequences is that the sequences of these proteins can be used to enhance prior art adenoviruses, which have been engineered for e.g. medical purposes.
  • the capsid proteins or functional fragments thereof of the present invention can be used to e.g.
  • adenovirus replace/substitute one or more of the major structural capsid proteins or functional fragments thereof, respectively, of a different adenovirus, e.g. a prior art adenovirus, to obtain improved recombinant adenoviruses with a reduced seroprevalence in humans.
  • a different adenovirus e.g. a prior art adenovirus
  • the novel adenoviruses of the invention but also adenoviruses which have been re-engineered as described will not encounter any significant inhibitory immune response in humans when administered, their overall transduction efficiency and infectivity will be enhanced.
  • adenoviruses are expected to be, e.g., more effective vaccines as the entry into host cells and the expression of the antigen cassette will not be hampered by any significant titer of neutralizing antibodies.
  • a potent immune response against HIV gag was elicited even in na ⁇ ve mice vaccinated with a recombinant HIV-gag encoding adenovirus that comprises hexon, penton and fiber proteins of the ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47, PanAdl, PanAd2 or PanAd3 isolate.
  • the immune response elicited by ChAd55-gag, ChAd73-gag, ChAd83-gag, ChAdl46- gag, ChAdl47-gag, PanAdl -gag, PanAd2-gag and PanAd3-gag adenoviruses is comparable with the response observed with the most potent vectors developed so far based on recombinant human Ad5 vector of the prior art expressing HIV gag protein (see data of an ELIspot assay in figure 5A, 5B, 5C).
  • the humoral response elicited by an adenovirus is mainly directed against the three major adenoviral structural proteins: hexon, penton and fiber, all of which comprise polypeptide sequences that are part of the adenoviral capsid and that are exposed to the outside of the virus particle (see also: Madisch I, et al., J. Virol. 2005 Dec;79(24): 15265-76; and also: Madisch I, et al., J Virol. 2007 Aug;81(15):8270-81; and Pichla-Gollon SL, et al., J. Virol. 2007 Feb;81(4): 1680-9).
  • the novel adenovirus isolates of the group of PanAdl, PanAd2, PanAd3, ChAd55, ChAd73, ChAd83, ChAdl46 and ChAdl47 of the present invention share a very similar hexon protein sequence.
  • the hypervariable regions (HVRs) are labeled which occur in loops at the top of the hexon molecule that lie on the exterior of the virion and cover a large amount of its surface (see Jophn J. Rux et. Al, J. of Virology, Sept 2003, vol. 77, no.17).
  • capsid proteins fiber and penton of the novel chimpanzee adenoviruses are provided in figures 2 and 3, respectively. All three structural capsid proteins are expected to contribute to the low seroprevalence and can, thus, be used independently from each other or in combination to suppress the affinity of an adenovirus to preexisting neutralizing antibodies, e.g. to manufacture a recombinant chimeric adenovirus with a reduced seroprevalence.
  • the invention provides an isolated polynucleotide that encodes an adenoviral fiber protein or a functional derivative thereof and that is selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence according to any of SEQ ID NOs: 14-19, 50 and 53; i.e. SEQ ID NO: 14, 15, 16, 17, 18 , 19, 50 or 53; (b) a polynucleotide encoding the functional derivative of a polypeptide according to any of SEQ ID NOs: 14-19, 50 and 53, i.e.
  • adenoviral fiber protein is meant the knobbed fiber (IV) protein comprised in an adenovirus.
  • the isolated polynucleotide comprised in the first aspect of the invention and preferred embodiments thereof described below encodes a fiber protein or a functional derivative thereof that has the same function as a fiber protein or a fragment thereof in an infectious adenovirus virion.
  • a recombinant adenovirus comprising said fiber or functional fiber derivative preferably as a capsid protein is capable of entering a host cell. It can be easily determined if a recombinant adenovirus can enter a host cell.
  • the recombinant host cell can be washed and lysed and it can be determined whether adenoviral RNA and/or DNA is found in the host cell using, e.g. an appropriate hybridization probe specific for adenoviral RNA and/or DNA.
  • the host cell after having been brought into contact with the recombinant adenovirus may be washed, lysed and probed with adenovirus specific antibodies, e.g. using a Western blot.
  • the fiber protein and functional derivative thereof has an affinity to an adenoviral penton protein, such as to SEQ ID NOs: 26-31, 52 and/or 55.
  • an adenoviral penton protein such as to SEQ ID NOs: 26-31, 52 and/or 55.
  • the average skilled person is well aware of how to test protein-protein affinities.
  • a first protein is capable of binding a second protein, such as a penton protein of a chimpanzee derived adenovirus
  • he may use, for example, a genetic yeast two-hybrid assay or a biochemical assay such as a pull-down, an enzyme-linked immunosorbent assay (ELISA), a fluorescence- activated cell sorting (FACS)-based assay or a Plasmon resonance assay.
  • ELISA enzyme-linked immunosorbent assay
  • FACS fluorescence- activated cell sorting
  • adenoviral fiber protein in its glycosylated form is further capable of trimerizing.
  • the fiber protein or a fragment thereof encoded by the polynucleotide according to the first aspect of the invention is capable of being glycosylated and/or of forming a trimer.
  • the phrase "functional derivative" of a protein or polypeptide generally refers to a modified version of the protein or polypeptide, e.g. one or more amino acids of the protein or polypeptide may be deleted, inserted, modified and/or substituted.
  • the derivative is functional, if, as mentioned also above, a chimeric adenovirus comprising the functional derivative in its capsid is capable of infecting a host cell.
  • an insertion refers to the insertion of one or more amino acids into the original polypeptide or protein.
  • a functional derivative does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
  • Amino acids of the protein or polypeptide may also be modified, e.g. chemically modified.
  • the side chain or a free amino or carboxy-terminus of an amino acid of the protein or polypeptide may be modified by e.g. glycosylation, amidation, phosphorylation, ubiquitination, e.t.c.
  • the chemical modification can also take place in vivo, e.g. in a host-cell, as is well known in the art.
  • a suitable chemical modification motif e.g. glycosylation sequence motif present in the amino acid sequence of the protein will cause the protein to be glycosylated.
  • a substitution in a derivative may be a conservative or a non-conservative substitution, preferably a conservative substitution.
  • a substitution also includes the exchange of a naturally occurring amino acid with a not naturally occurring amino acid.
  • a conservative substitution comprises the substitution of an amino acid with another amino acid having a chemical property similar to the amino acid that is substituted.
  • the conservative substitution is a substitution selected from the group consisting of: (i) a substitution of a basic amino acid with another, different basic amino acid; (ii) a substitution of an acidic amino acid with another, different acidic amino acid; (iii) a substitution of an aromatic amino acid with another, different aromatic amino acid;
  • a basic amino acid is preferably selected from the group consisting of arginine, histidine, and lysine.
  • An acidic amino acid is preferably aspartate or glutamate.
  • An aromatic amino acid is preferably selected from the group consisting of phenylalanine, tyrosine and tryptophane.
  • a non- polar, aliphatic amino acid is preferably selected from the group consisting of glycine, alanine, valine, leucine, methionine and isoleucine.
  • a polar, uncharged amino acid is preferably selected from the group consisting of serine, threonine, cysteine, proline, asparagine and glutamine.
  • a non-conservative amino acid substitution is the exchange of one amino acid with any amino acid that does not fall under the above-outlined conservative substitutions (i) through (v).
  • a functional derivative comprises a deletion
  • the derivative one or several amino acids that are present in the reference polypeptide or protein sequence have been removed.
  • the deletion may, however, not be so extensive that the derivative comprises less than 200 amino acids in total.
  • the hyper variable domains of an adenoviral hexon protein are exposed to the outside of the adenovirus.
  • these regions of the adenoviral capsid can be recognized and bound by neutralizing antibodies.
  • an adenovirus with a capsid comprising a hexon protein derived from one of the novel adenovirus isolates of the present invention will exhibit an improved, i.e. smaller seroprevalence in humans.
  • the invention provides an isolated polynucleotide that encodes an adenoviral hexon protein or a functional derivative thereof and that is selected from the group consisting of:
  • a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99.95% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 20-25, 51 and 54, i.e. SEQ ID NO: 20, 21, 22, 23, 24,
  • the isolated polynucleotide comprised in the second aspect of the invention and preferred embodiments thereof described below encodes a hexon protein or a functional derivative thereof that has the same function as a hexon protein or a functional fragment thereof in an infectious adenovirus virion.
  • a recombinant adenovirus comprising said hexon or functional derivative thereof preferably as a capsid protein is capable of entering a host cell.
  • One suitable method for generating functional derivatives of a hexon protein is described in US Patent 5,922,315, which is incorporated by reference. In this method, at least one loop region of the adenovirus hexon is changed with at least one loop region of another adenovirus serotype.
  • a loop region of a hexon protein of the invention can be used to substitute the corresponding hexon loop of an adenovirus of the prior art to generate an improved hybrid adenovirus.
  • Analogously also derivatives of penton and fiber proteins of the invention can be generated.
  • the invention provides an isolated polynucleotide that encodes an adenoviral penton protein or a functional derivative thereof and that is selected from the group consisting of:
  • a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 26-31, 52 and 55, i.e. SEQ ID NO: 26, 27, 28, 29, 30, 31, 52 or 55.
  • the penton protein and functional derivative thereof has an affinity to an adenoviral fiber protein, such as to SEQ ID NOs: 14-19, 50 and/or 53.
  • adenoviral penton protein is meant the penton base (III) protein comprised in an adenovirus.
  • An adenoviral penton protein is characterized in that it localizes to the corners of the icosahedral symmetry of the capsid.
  • the polynucleotide encodes one or more polypeptides, wherein a recombinant adenovirus comprising said one or more polypeptides preferably as a capsid protein(s) is capable to infect, i.e. enter a host cell.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 14 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 14.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 20 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 20.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 26 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99.9% identical over its entire length to the amino acid sequence of SEQ ID NO: 26.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the Ad5 genome as a reference.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ED NO: 15 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99% or at least 99.9% more preferably at least 99% and most preferable at least 99.9% identical over its entire length to the amino acid sequence of SEQ ID NO: 15.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 21 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 21.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 27 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 27.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the Ad5 genome as a reference.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 16 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has the amino acid sequence of SEQ ID NO: 16.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 22 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 22.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 28 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 28.
  • the polynucleotide of the invention consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identical and most preferably at least 99% or 100% identical over its entire length to a sequence that consists of SEQ ID NO: 65 or to a sequence that consists of SEQ ID NO: 65 but lacks any of the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 of SEQ ID NO: 65, most preferably that lacks the genomic regions El, E3 and E4 of SEQ ID NO: 65.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the ChAd83 genome as set out in SEQ ID NO: 65.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 17 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has the amino acid sequence of SEQ ID NO: 17.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 23 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 23.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 29 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 29.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the Ad5 genome as a reference.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 18 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 18.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 24 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 24.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 30 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 30.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the Ad5 genome as a reference.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • Adenovirus PanAdl Adenovirus PanAdl
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 19 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 19.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 25 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferably at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 25.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 31 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 31.
  • the polynucleotide of the invention consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identical and most preferably at least 99% or 100% identical over its entire length to a sequence that consists of SEQ ID NO: 13 or to a sequence that consists of SEQ ID NO: 13 but lacks any of the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 of SEQ ID NO: 13, most preferably that lacks the genomic regions El, E3 and E4 of SEQ ID NO: 13.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the PanAdl genome as set out in SEQ ID NO: 13. It is preferred that the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 50 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 50.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 51 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferably at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 51.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 52 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 52.
  • the polynucleotide of the invention consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identical and most preferably at least 99% or 100% identical over its entire length to a sequence that consists of SEQ ID NO: 62 or to a sequence that consists of SEQ ID NO: 62 but lacks any of the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 of SEQ ID NO: 62, most preferably that lacks the genomic regions El , E3 and E4 of SEQ ID NO: 62.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the PanAdl genome as set out in SEQ ID NO: 62.
  • the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 53 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 53.
  • the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 54 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferably at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 54.
  • the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 55 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 55.
  • the polynucleotide of the invention consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identical and most preferably at least 99% or 100% identical over its entire length to a sequence that consists of SEQ ID NO: 63 or to a sequence that consists of SEQ ID NO: 63 but lacks any of the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 of SEQ ID NO: 63, most preferably that lacks the genomic regions El, E3 and E4 of SEQ ID NO: 63.
  • the invention relates to a polynucleotide comprising the first, the second, the third, the first and second, the first and third, the second and third or the first, second and third aspect and most preferably the first, second and third aspect of the invention.
  • the polynucleotide comprising this or these polynucleotide(s) comprises other adenoviral genes and nucleotide segments, which are adjacent to the hexon, penton and/or fiber gene in the adenovirus genome, e.g. using the PanAdl genome as set out in SEQ ID NO: 63. It is preferred that the polynucleotide also comprises sequences required for packaging of the polynucleotide into an adenoviral particle.
  • a fiber, hexon and penton protein contributes each individually to reduce the interaction of said recombinant adenovirus with human and/or rodent neutralizing antibodies. Accordingly, polynucleotides which encode said fiber, hexon and/or penton protein of the present invention are useful to construct enhanced recombinant adenoviruses.
  • the invention provides a polynucleotide comprising at least one, preferably at least two and most preferably three isolated polynucleotides selected from the group of polynucleotides consisting of a polynucleotide according to the first aspect of the invention, the second aspect of the invention and the third aspect of the invention.
  • the fourth aspect is an isolated polynucleotide comprising the first, second and third aspect of the invention.
  • the polynucleotide according to the fourth aspect of the invention is a polynucleotide selected from the group consisting of:
  • polynucleotide comprising a polynucleotide according to the first aspect of the invention and a polynucleotide according to the second aspect of the invention;
  • a polynucleotide comprising a polynucleotide according to the first aspect of the invention and a polynucleotide according to the third aspect of the invention;
  • a polynucleotide comprising a polynucleotide according to the second aspect of the invention and a polynucleotide according to the third aspect of the invention; and
  • a polynucleotide comprising a polynucleotide according to the first, second and third aspect of the invention wherein it is preferred that said polynucleotides comprised in the polynucleotide according to (i) through (v) are selected from the same adenovirus isolate, e.g.
  • each "functional derivative" does not comprise more than 10, more than 5 or more than 3 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
  • Table 2 below lists a number of particularly preferred embodiments of the polynucleotide of the fourth aspect of invention outlined above.
  • Preferred is a polynucleotide selected from polynucleotides Al through AFl shown in Table 2, wherein the polynucleotide comprises three polynucleotides according to alternative (c) of the first, second and third aspect of the invention, each of which respectively encodes an adenoviral fiber, hexon and penton protein or a functional derivative thereof.
  • Table 2 below shows the minimal sequence identity (i.e. at least the indicated sequence identity) which each of said three encoded proteins has to have over its entire length to the amino acid sequence according to the SEQ ID NO which is also shown in Table 2:
  • preferred polynucleotide Al as shown in Table 1 above comprises:
  • said "functional derivative" of a polynucleotide listen in table 2 does not comprise more than 10 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
  • polynucleotide of the fourth aspect of the invention Preferred is a polynucleotide selected from polynucleotides A2 through J2 selected from Table 3, wherein the polynucleotide comprises three polynucleotides designated, "Polynucleotide 1", “Polynucleotide 2" and “Polynucleotide 3", wherein each respective polynucleotide has at least the indicated sequence identity over its entire length to the corresponding polynucleotide according to the SEQ ID NO shown in Table 3:
  • preferred embodiment A2 (“A2 - ChAd55") of Table 3 above is a polynucleotide comprising:
  • polynucleotide of the fourth aspect of invention a polynucleotide selected from polynucleotides A3 through H3 shown in Table 4, wherein the polynucleotide encodes an adenoviral fiber, hexon and penton protein according to the indicated SEQ ID NO or a functional derivative thereof, wherein all three proteins and/or encoded functional derivatives in total comprises equal or less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 20 deleted, inserted, modified and/or substituted amino acids:
  • the polynucleotide encodes an adenoviral fiber and hexon protein of the same strain according to the respective SEQ ID NO as shown in Table 4 or functional derivatives thereof.
  • the polynucleotide encodes an adenoviral fiber and penton protein of the same strain according to the respective SEQ ID NO as shown in Table 4 or functional derivatives thereof.
  • the polynucleotide of the fourth aspect of invention encodes an adenoviral hexon and penton protein of the same strain according to the respective SEQ ID NO as shown in Table 4 or functional derivatives thereof.
  • said functional derivative comprises in each instance less than 1, 2, 3, 4, 5, 6, 7, 8, 9 or less than 10, most preferably less than 3 deleted, inserted, modified and/or substituted amino acids.
  • the polynucleotide consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or 100%, preferably 98% identical over its entire length to a sequence that (i) consists of any one of SEQ ID NO: 13, 62, 63 or 65 or to (ii) a sequence that consists of any one of SEQ ID NO: 13, 62 63 or 65 that lacks one or more of the genomic regions ElA, ElB, E2A, E2B, E3 ORFl, E3 ORF2, E3 ORF3, E3 ORF4, E3 ORF5, E3 ORF6, E3 ORF7, E3 ORF8, E3 ORF9, E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4, E4 ORF3, E4 ORF2 and/or E4 ORFl.
  • the polynucleotide comprises or consists of SEQ ID NO: 13, 62, 63 or 65, wherein one or more of the genomic regions ElA, ElB, E2A, E2B, E3 ORFl, E3 ORF2, E3 ORF3, E3 ORF4, E3 ORF5, E3 ORF6, E3 ORF7, E3 ORF8, E3 ORF9, E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4, E4 ORF3, E4 ORF2 and E4 ORFl are deleted from SEQ ID NO: 13, 62, 63 or 65, respectively, or substituted with a transgene or an expression cassette encoding a heterologous protein as described herein.
  • adenoviral regions El, E3 and/or E4 are deleted as also exemplified in example 2.
  • the aforementioned preferred polynucleotides, which lack one or more of the indicated genomic regions may further comprise a polynucleotide sequence encoding for a heterologous protein or an expression cassette comprising such a polynucleotide sequence encoding for a heterologous protein.
  • Said polynucleotide sequence encoding for a heterologous protein and said expression cassette comprising such a polynucleotide sequence encoding for a heterologous protein may be inserted into e.g.
  • heterologous protein may be a molecule for delivery into a target cell such as described herein, e.g. a polynucleotide encoding an antigenic protein or a fragment thereof, preferably an antigenic protein or a fragment of a pathogen such as HIV gag protein, a tumour antigen or a protein of the herpes simplex virus as described in the examples.
  • the isolated polynucleotide according to the invention further comprises a polynucleotide encoding an antigen selected from the group consisting of a virus antigen, an antigen of a pathogenic bacterium and a tumorantigen.
  • said heterologous protein can thus be an antigen selected from the group consisting of an RNA virus antigen, an antigen of a pathogenic bacterium and a tumorantigen.
  • An antigen refers to any protein or peptide capable of eliciting an immune response in a mammal.
  • An antigen comprises preferably at least 8 amino acids and most preferably comprises between 8 and 12 amino acids.
  • the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 are preferably not considered in the alignment, i.e. the alignment is done using a sequence that consists of the entire sequence SEQ ID NO: 13, 62 63 or 65 but excluding the genomic regions ElA, ElB, E2A, E2B, E3, E4 and/or any polynucleotide encoding a heterologous polypeptide or expression cassette comprising such polynucleotide.
  • the polynucleotide according to the fourth aspect of the invention and all its preferred embodiments encodes functional hexon, penton and/or fiber capsid proteins or functional derivatives thereof, e.g. the encoded proteins have the same function as the respective capsid proteins or fragments thereof in an infectious adenovirus virion.
  • a recombinant adenovirus comprising in its capsid said encoded recombinant penton, hexon and/or fiber proteins or functional derivatives thereof is capable of entering a host cell.
  • the capsid proteins or functional derivatives thereof according to the invention or encoded by polynucleotides of the invention have no seroprevalence in human.
  • the invention further provides an isolated protein encoded by the isolated polynucleotide according to the invention, i.e. an isolated adenoviral capsid polypeptide encoded by the isolated polynucleotide according to the first, second and/or third aspect of the invention or a functional derivative thereof.
  • the "functional derivative" in one embodiment does not comprise more than 5, 10 or not more than 25 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
  • the invention further relates to a vector comprising an isolated polynucleotide according to the invention.
  • the vector does not comprise a gene in a genomic region selected from the group of genomic regions consisting of ElA, ElB, E2A, E2B, E3 and E4, and/or comprises at least one gene of a genomic region selected from the group of ElA, ElB, E2A, E2B, E3 and E4, wherein said at least one gene comprises a deletion and/or mutation which renders the at least one gene non-functional.
  • One possibility to render one of these gene products non-functional is to introduce one or more artificial stop-codons (e.g. TAA) into the open reading frame of these genes.
  • the polynucleotide of the invention comprises a polynucleotide encoding a hexon protein; penton protein; fiber protein; hexon protein and penton protein; hexon protein and fibre protein; penton protein and fibre protein; or hexon protein, penton protein and fibre protein of the invention and further comprises additional adenoviral polynucleotides.
  • the isolated polynucleotide according to the invention comprises at least one of the following:
  • an adenoviral EIa region or a fragment thereof selected from among the 13 S, 12S and 9S regions;
  • an adenoviral Ll region or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of the 28.1 kD protein, polymerase, agnoprotein, 52/55 kDa protein, and Ilia protein;
  • an adenoviral L2 region or a L2 region comprising a polynucleotide encoding the penton protein of the invention, or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of a penton protein or the penton protein of the invention, VII, V, and Mu protein;
  • an adenoviral L3 region or a L3 region comprising a polynucleotide encoding the hexon protein of the invention, or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of the VI protein, hexon protein or the hexon protein of the invention and endoprotease;
  • an adenoviral E2a region comprising a polynucleotide encoding the hexon protein of the invention, or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of the VI protein, hexon protein or the hexon protein of the invention and endoprotease;
  • an adenoviral L4 region or a fragment thereof said fragment encoding an adenoviral protein selected from the group consisting of the 100 kD protein, the 33 kD homolog, and protein VIII;
  • E3 ORFl an adenoviral E3 region, or a fragment thereof selected from the group consisting of E3 ORFl, E3 ORF2, E3 ORF3, E3 ORF4, E3 ORF5, E3 ORF6, E3 ORF7, E3 ORF8, and E3
  • ORF9 an adenoviral L5 region or a L5 region comprising a polynucleotide encoding the fibre protein of the invention, or a fragment thereof said fragment encoding the fiber protein or the fiber protein of the invention; (1) an adenoviral E4 region, or a fragment thereof selected from the group consisting of E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4, E4 ORF3, E4 ORF2, and E4 ORFl; in particular ORF6 of said E4 region; and /or (m) an adenoviral 3'-ITR.
  • the polynucleotide does not comprise an ORF of a genomic region as outlined above (such as e.g. region E3 and/or E4 as defined in example 2) and/or comprises an adenoviral gene which comprises a deletion and/or mutation which renders the at least one gene non-functional.
  • the suitable adenoviral regions will be modified to not include the aforementioned gene(s) or to render the selected gene(s) non-functional. Any adenoviral gene deletions will make space to insert transgenes such as a minigene cassette as described herein.
  • the final recombinant adenovirus comprising a polynucleotide as outlined above which comprises one or more of the specified gene / region deletions or loss-of-function mutations can provide a safer recombinant adenovirus for e.g. gene therapy or vaccination.
  • the polynucleotide of the invention comprises at least one of the following: (a) the 5'-inverted terminal repeat (ITR) region of any one of SEQ ID NO: 13, 62, 63 or 65;
  • adenovirus L4 region of any one of SEQ ID NO: 13, 62, 63 or 65, or a fragment thereof said fragment encoding an adenoviral protein selected from the group consisting of the 100 kD protein, the 33 kD homolog, and protein VIII;
  • E4 ORF7 the adenovirus E4 region of any one of SEQ ID NO: 13, 62, 63 or 65, or a fragment thereof selected from the group consisting of E4 ORF7, E4 ORF6, E4 ORF5, E4 ORF4,
  • E4 ORF3, E4 ORF2, and E4 ORFl or ORF6 of Ad5 E4 region (SEQ ID NO: 64);
  • the isolated polynucleotide of the invention further encodes one or more, preferably all of the following adenoviral proteins: protein VI, protein VIII, protein IX, protein Ilia and protein IVa2.
  • these proteins are encoded by from the respective open reading frames of the PanAdl, PanAd2 or PanAd3 genomic sequence disclosed herein.
  • An average person skilled in the art of recombinant adenoviruses is well aware of how to determine the open reading frames that encode for the above specified adenoviral proteins.
  • a polynucleotide preferably a cDNA, encoding one or more adenoviral proteins of the invention
  • a strong promoter to direct transcription, a transcription/translation terminator, and a ribosome-binding site for translational initiation.
  • Suitable bacterial promoters are well known in the art, e.g., E. coli, Bacillus sp., and Salmonella, and kits for such expression systems are commercially available.
  • eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
  • the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the adenoviral protein-encoding nucleic acid in host cells.
  • a typical expression cassette thus contains a promoter operatively linked to the nucleic acid sequence encoding the adenoviral protein/polypeptide and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include, for example enhancers.
  • An expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
  • the particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as GST and LacZ, but there are many more known in the art to the skilled person that can be usefully employed.
  • Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g. SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
  • eukaryotic expression vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, pcDNA3.1, pIRES and any other vector allowing expression of proteins under the direction of e.g.
  • HCMV immediate-early promoter SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
  • markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
  • high yield expression systems not involving gene amplification are also suitable.
  • the elements that may also be included in expression vectors include a replicon that functions in E. coli, a gene encoding drug resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of eukaryotic sequences.
  • the particular drug resistance gene chosen is not critical - any of the many drug resistance genes known in the art are suitable.
  • the prokaryotic sequences are optionally chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.
  • Standard transfection methods can be used to produce bacterial, mammalian, yeast or insect cell lines. Any of the well-known procedures for introducing foreign polynucleotide sequences into host cells may be used.
  • liposome-based transfection kits such as LipofectamineTM (Invitrogen)
  • lipid-based transfection kits such as Fugene (Roche Diagnostics)
  • polyethylene glycol-based transfection calcium phosphate precipitation
  • gene gun biolistic
  • electroporation or viral infection
  • any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell may be used. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the receptor.
  • an expressed adenoviral protein can be optionally purified using standard techniques.
  • the cells may be lysed either mechanically or by osmotic shock before being subject to precipitation and chromatography steps, the nature and sequence of which will depend on the particular recombinant material to be recovered.
  • the recombinant protein may be secreted and recovered from the culture medium in which the recombinant cells had been cultured as is known in the art of protein expression.
  • the vector of the invention is a plasmid vector, e.g. an expression vector.
  • a plasmid vector according to the invention can also be used to generate a recombinant adenovirus.
  • a further aspect of the present invention is a recombinant adenovirus, preferably a replication-incompetent adenovirus, comprising an isolated polynucleotide according to the invention and/or at least one isolated adenoviral capsid polypeptide according to the invention.
  • the recombinant adenovirus of the invention comprises a hexon a fiber and a penton protein of the present invention, e.g. a combination as outlined in Table 2 above.
  • the recombinant adenovirus is characterized in that it is capable of infecting a human cell - preferably capable of infecting a human cell after said adenovirus was incubated for one hour in a human blood serum derived from a human that has not previously been exposed to a chimpanzee adenovirus.
  • said recombinant adenovirus is obtainable e.g. by constructing a recombinant adenovirus which is composed of the usual adenoviral proteins but which has a capsid that comprises at least one isolated adenoviral capsid polypeptide according to the invention or a functional derivative thereof.
  • the recombinant adenovirus comprises an L2 region which comprises a polynucleotide sequence encoding the penton protein of the invention, an L3 region which comprises a polynucleotide sequence encoding the hexon protein of the invention and/or an L5 region which comprises a polynucleotide sequence encoding the fiber protein of the invention.
  • said recombinant adenovirus comprises an L2 region, an L3 region and an L5 region encoding, respectively, at least for the penton, hexon and fiber protein of the invention.
  • one or several of the ElA, ElB, E2A, E2B, E3 and E4 gene products may be expressed in a complementing cell line that can be used for the propagation and rescue of recombinant adenoviruses that are replication-incompetent, because they lack e.g. one of the aforementioned gene products.
  • a complementing cell line that can be used for the propagation and rescue of recombinant adenoviruses that are replication-incompetent, because they lack e.g. one of the aforementioned gene products.
  • the use of such cell-lines is also described in the references outlined above.
  • the polynucleotides of the invention are used to produce recombinant adenoviral particles.
  • the recombinant adenoviruses are preferably functionally deleted as mentioned above in one or more adenoviral regions such as e.g. the EIa or EIb regions, and optionally bearing other mutations, e. g., temperature-sensitive mutations or deletions in other adenoviral genes.
  • Such an intact El region may be located in its native location in the adenoviral genome or placed in the site of a deletion in the native adenoviral genome (e.g., in the E3 region).
  • a range of adenovirus nucleic acid sequences can be employed in the vectors of the invention.
  • all or a portion of the adenovirus delayed early gene E3 may be eliminated from the adenovirus sequence which forms a part of the recombinant virus.
  • the function of simian E3 is believed to be irrelevant to the function and production of the recombinant virus particle.
  • adenovirus vectors may also be constructed having a deletion of at least the ORF6 region of the E4 gene, and more desirably because of the redundancy in the function of this region, the entire E4 region.
  • Still another vector of this invention contains a deletion in the delayed early gene E2a. Deletions may also be made in any of the late genes Ll through L 5 of the simian adenovirus genome. Similarly, deletions in the intermediate genes IX and IV a2 may be useful for some purposes. Other deletions may be made in the other structural or non-structural adenovirus genes. The above discussed deletions may be used individually, i.
  • an adenovirus sequence for use in the present invention may contain deletions in only a single region.
  • deletions of entire genes or portions thereof effective to destroy their biological activity may be used in any combination.
  • the adenovirus sequence may have deletions of the El and the E4 region, or of the El, E2a and E3 region, or of the El and E3 regions, or of El, E2a and E4 regions, with or without deletion of E3, and so on.
  • deletions may be used in combination with other adenoviral gene mutations, such as temperature-sensitive mutations, to achieve a desired result.
  • An adenoviral vector lacking any essential adenoviral sequences may be cultured in the presence of the missing adenoviral gene products which are required for viral infectivity and propagation of an adenoviral particle.
  • helper functions may be provided by culturing the adenoviral vector in the presence of one or more helper constructs (e. g. , a plasmid or virus) or a packaging host cell (complementing cell line as also described above). See, for example, the examples included herein and the techniques described for preparation of a "minimal" human adenovirus vector in International Patent Application WO96/13597 published May 9, 1996, and incorporated herein by reference.
  • Useful helper viruses contain selected adenovirus gene sequences that complement the respective genes that are deleted in preferred embodiments of the adenovirus vector of the invention and/or that are not expressed by the packaging cell line in which the vector is transfected.
  • the helper virus is replication-defective and contains a variety of adenovirus genes in addition to the sequences described above.
  • Helper viruses may also be formed into poly-cation conjugates as described in Wu et al, J. Biol. Chem., 264: 16985-16987 (1989); K. J. Fisher and J. M. Wilson, Biochem. J., 299: 49 (April 1, 1994).
  • a helper virus may optionally contain a second reporter minigene.
  • reporter genes are known to the art. The presence of a reporter gene on the helper virus which is different from the transgene on the adenovirus vector allows both the Ad vector and the helper virus to be independently monitored. This second reporter may be used to facilitate separation between the resulting recombinant virus and the helper virus upon purification.
  • the function of the deleted gene region if essential to the replication and infectivity of the virus, is preferably supplied to the recombinant virus by a helper virus or cell line, i. e. , a complementation or packaging cell line.
  • a helper virus or cell line i. e. , a complementation or packaging cell line.
  • a cell line expressing the human El can be used to transcomplement the vector used to generate recombinant adenoviruses.
  • a packaging cell or cell line that expresses, at a minimum, the adenovirus El gene from a ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47, PanAdl, PanAd2 or PanAd3 adenovirus under the transcriptional control of a promoter for expression in a selected parent cell line, such as e.g. a HeLa cell.
  • a promoter for expression in a selected parent cell line such as e.g. a HeLa cell.
  • Inducible or constitutive promoters may be employed for this purpose. Examples of promoters are provided e.g. in the examples described herein.
  • Such El -expressing cell lines are useful in the generation of recombinant adenovirus El deleted vectors.
  • the invention provides cell lines that express one or more adenoviral gene products, e. g., EIa, EIb, E2a, and/or E4 ORF6, preferably Ad5 E4 ORF6 (see also the examples below), which can be constructed using essentially the same procedures for use in the generation of recombinant adenoviral vectors.
  • adenoviral gene products e. g., EIa, EIb, E2a, and/or E4 ORF6, preferably Ad5 E4 ORF6 (see also the examples below
  • Such cell lines can be utilized to transcomplement adenovirus vectors deleted in essential genes that encode those products, or to provide helper functions necessary for packaging of a helper- dependent virus (e. g., adeno-associated virus).
  • the vector when delivering a vector of the invention comprising e.g. a minigene by transfection, the vector is delivered in an amount from about 0.1 ⁇ g to about 100 ⁇ g DNA, and preferably about 10 to about 50 ⁇ g DNA to about 1 x 10 4 cells to about 1 x 10 3 cells, and preferably about 10 5 cells.
  • the relative amounts of vector DNA to host cells may be adjusted, taking into consideration such factors as the selected vector, the delivery method and the host cells selected.
  • Introduction of the vector into a host cell may be achieved by any means known in the art or as disclosed herein, including transfection, and infection, e. g. using CaPO 4 transfection or electroporation.
  • the vector can in one example be transfected in-vitro in the presence of a helper virus into the packaging cell line, allowing homologous recombination to occur between the helper and the vector sequences, which permits the adenovirus-transgene sequences in the vector to be replicated and packaged into virion capsids, resulting in the recombinant viral vector particles as is well known in the art.
  • a recombinant adenoviruses of the invention is useful e.g. in transferring a selected transgene into a selected host cell.
  • the adenovirus has a seroprevalence of less than 5% in human subjects and preferably no seroprevalence in human subjects, most preferably no seroprevalence in human subjects that have not previously been in contact with a chimpanzee adenovirus.
  • the human subjects belong to an ethnic group selected from Europeans, indigenous people of Africa, Asians, indigenous people of America and indigenous people of Oceania. Methods for the identification of the ethnic origin of a human subject are comprised in the art (see e.g. WO2003/102236).
  • the adenovirus DNA is capable of entering a mammalian target cell, i.e. it is infectious.
  • An infectious recombinant adenoviruses of the invention can be used as a vaccine and for gene therapy as also described below.
  • the recombinant adenovirus comprises a molecule for delivery into a target cell.
  • the target cell is a mammalian cell, e.g. a chimpanzee cell, a rodent cell or a human cell.
  • the molecule for delivery into a target cell can be an expression cassette as defined herein.
  • a recombinant adenovirus of the present invention that comprises an expression cassette, encoding e.g. a minigene or an antigene, can be generated by replacing a genomic region of the adenovirus selected from ElA, ElB, E2A, E2B, E3 and E4 with said expression cassette.
  • the genomic regions ElA, ElB, E2A, E2B, E3 and E4 of the adenoviruses of the invention can easily be identified by an alignment with known and annotated adenoviral genomes such as from human Ad5 (see: Birgitt Tauber and Thomas Dobner, Oncogene (2001) 20, p. 7847 - 7854; and also: Andrew J. Davison, et al., "Genetic content and evolution of adenoviruses", Journal of General Virology (2003), 84, p. 2895-2908).
  • Non-limiting examples of how to generate modified adenoviruses comprising a molecule for delivery into a target cell are also provided in examples 1 and 2 and figure 4 below.
  • the molecule for delivery into a target cell is preferably a polynucleotide but may also be a polypeptide or a small chemical compound, preferably having a therapeutic or diagnostic activity.
  • the molecule for delivery into a target cell is a polynucleotide that comprises an adenovirus 5' inverted terminal repeat sequence (ITR), a gene, e.g. SEQ ID NO: 1 and a 3' ITR.
  • ITR adenovirus 5' inverted terminal repeat sequence
  • the molecular size of the molecule has to be chosen such that the capsid can form around and package the molecule, when the recombinant adenovirus is produced, e.g. in a packaging cell line.
  • the gene is a minigene which can have e.g. up to 7000 and maximally up to 8000 base pairs.
  • the molecule for delivery into a target cell comprised in the recombinant adenovirus according to the invention is a polynucleotide encoding an antigenic protein or a fragment thereof.
  • An antigenic protein or fragment thereof is capable of eliciting an immune response in a mammal and may be in a particularly preferred embodiment the gag protein of HIV as shown in the examples and being encoded by a polynucleotide according to SEQ ID NO: 1.
  • the recombinant adenovirus of the invention is an adenovirus that has been deposited at ECACC (European Collection of Cell Culture, Porton Down, Salisbury, SP4 OJG, UK) and has a deposit number selected from the group consisting of 08110601 (ChAd83), 08110602 (ChAd73), 08110603 (ChAd55), 081 10604 (ChAdl47) and 08110605 (ChAdl46).
  • the deposits of the aforementioned adenoviral strains (Latin name: Mastadenovirus, Adenoviridae) have been made on November 6, 2008 by Okairos AG, Elisabethenstr. 3, 4051 Basel, Switzerland. These deposits will be maintained under the terms of the Budapest Treaty on the
  • the adenovirus derived of one of the aforementioned deposited adenoviruses has been altered by introducing a functional deletion, deletion or modification in its genome, e.g. to obtain a replication incompetent adenovirus and/or an adenovirus that is capable of expressing a transgene in a host cell.
  • one or more genes selected from the group consisting of ElA, ElB, E2A, E2B, E3 and E4 gene can be deleted, rendered non-functional, and/or can be replaced by an expression cassette as outlined above.
  • one or more genes of another adenovirus may be introduced, preferably for a deleted gene.
  • a skilled person is well aware of how to introduce these genomic alterations in the deposited strains. In this respect, methods of generating modified adenoviruses comprising a molecule for delivery into a target cell, which is a preferred modification of the deposited strains, have been described above.
  • composition that comprises an immunological adjuvant and at least one of the following (i) through (iv):
  • composition according to the invention that comprises an adjuvant can be used as a vaccine, e.g. for human subjects.
  • the immunological adjuvant also referred to herein in short as "adjuvant" accelerates, prolongs and/or enhances the quality and/or strength of an immune response to an antigen/immunogen, in comparison to the administration of the antigen alone, thus, reducing the quantity of antigen/immunogen necessary in any given vaccine, and/or the frequency of injection necessary in order to generate an adequate immune response to the antigen/immunogen of interest.
  • adjuvants examples include gel-like precipitates of aluminum hydroxide (alum); AlPO 4 ; alhydrogel; bacterial products from the outer membrane of Gram-negative bacteria, in particular monophosphoryl lipid A (MPLA), lipopolysaccharides (LPS), muramyl dipeptides and derivatives thereof; Freund's incomplete adjuvant; liposomes, in particular neutral liposomes, liposomes containing the composition and optionally cytokines; non-ionic block copolymers; ISCOMATRIX adjuvant (Drane et al., 2007); unmethylated DNA comprising CpG dinucleotides (CpG motif), in particular CpG ODN with a phosphorothioate (PTO) backbone (CpG PTO ODN) or phosphodiester (PO) backbone (CpG PO ODN); synthetic lipopeptide derivatives, in particular Pam 3 Cys; lipoarabinomannan
  • Non-ionic block polymers containing polyoxyethylene (POE) and polyoxypropylene (POP), such as POE-POP-POE block copolymers may be used as an adjuvant (Newman et al., 1998). This type of adjuvant is particularly useful for compositions comprising nucleic acids as active ingredient.
  • various pharmaceutically acceptable excipients may be used. Preferred pharmaceutically acceptable excipients are mentioned below when discussing the uses according to the invention.
  • Activation of specific receptors can stimulate an immune response.
  • Such receptors are known to the skilled artisan and comprise, for example, cytokine receptors, in particular type I cytokine receptors, type II cytokine receptors, TNF receptors; and vitamin D receptor acting as transcription factor; and the Toll-like receptors 1 (TLRl), TLR-2, TLR 3, TLR4, TLR5, TLR-6, TLR7, and TLR9.
  • TLRl Toll-like receptors 1
  • TLR-2, TLR 3, TLR4, TLR5, TLR-6, TLR7, and TLR9 Agonists to such receptors have adjuvant activity, i.e., are immunostimulatory.
  • the adjuvant of the composition of the present invention may be one or more Toll-like receptor agonists.
  • the adjuvant is a Toll-like receptor 4 agonist.
  • the adjuvant is a Toll-like receptor 9 agonist, preferably being encoded by the nucleotide tccatgacgttcctgacgtt (SEQ ID NO: 2).
  • the invention provides a cell, preferably a non-simian cell, comprising at least one of the following:
  • the cell may be selected of a bacterial cell such as an E. coli cell, a yeast cell such as
  • Saccharomyces cerevisiae or Pichia pastoris a plant cell, an insect cell such as SF9 or Hi5 cells, or a mammalian cell.
  • mammalian cells are Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK 293) cells, HELA cells, human hepatoma cells (e.g. Huh7.5), Hep G2 human hepatoma cells, Hep 3B human hepatoma cells and the like.
  • this polynucleotide may be present in the cell either (i) freely dispersed as such, or (ii) integrated into the host cell genome or mitochondrial DNA.
  • the cell is a host cell, preferably a 293 cell or a PER.C6TM cell, that expresses at least one adenoviral gene selected from the group consisting of EIa, EIb, E2a, E2b, E4, Ll, L2, L3, L4 and L5.
  • the isolated polynucleotide according to the invention is also provided.
  • the isolated protein according to the invention has demonstrated great potential as vaccine vectors.
  • Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system.
  • the therapy or prophylaxis is a vaccination, e.g. for human subjects.
  • Detailed instructions of how adenoviruses are used and prepared for vaccination are provided as ample literature comprised in the art and known to the skilled person.
  • a recombinant adenovirus of the invention can be administered in an immunologically and/or prophylactically effective dose which is preferably 1 x 10 to 1 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 or 5 x 10 10 particles).
  • an immunologically and/or prophylactically effective dose which is preferably 1 x 10 to 1 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 or 5 x 10 10 particles).
  • a "heterologous prime-boost" methodology as defined above.
  • the vaccine comprises an adjuvant.
  • Preferred immunological adjutants have been mentioned herein and can be used in such vaccine.
  • a recombinant adenovirus prepared using a polynucleotide or recombinant adenoviral protein or fragment thereof according to the invention can be used to transduce a host cell with a polynucleotide, e.g. DNA.
  • a polynucleotide e.g. DNA.
  • adenovirus can be prepared to express any custom protein or polypeptide in a host cell.
  • the therapy recited in the use according to the invention is gene therapy.
  • an isolated polynucleotide, an isolated protein, a vector, a recombinant adenovirus and/or a pharmaceutical composition according to the invention is used for gene therapy and is administered to a subject to be treated, it is preferred that it is administered in a sufficiently large dose such that the treatment results in one or more cells of the patient being transfected, i.e. transduced.
  • a recombinant adenovirus and/or a pharmaceutical composition according to the invention is administered by any of the preferred means of administrations disclosed herein, it is preferred that an effective dose which is preferably 1 x 10 to 5 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 , 5 x 10 10 , 1 x 10 11 or, most preferably, 5 x 10 11 particles) is administered.
  • an effective dose which is preferably 1 x 10 to 5 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 , 5 x 10 10 , 1 x 10 11 or, most preferably, 5 x 10 11 particles) is administered.
  • the preferably heterologous polynucleotide that is comprised in the recombinant adenovirus of the invention is capable of expressing a protein or polypeptide in a host cell of the subject, wherein the protein or polypeptide comprises a signal peptide which effects secretion of the protein or polypeptide from said host cell.
  • a patient in need of a certain protein can be treated using an adenovirus of the present invention which comprises a cDNA that encodes a secretable form of that protein.
  • the isolated polynucleotide, isolated protein, vector, adenovirus and/or pharmaceutical composition according to the invention is formulated to further comprise one or more pharmaceutically acceptable diluents; carriers; excipients, including fillers, binders, lubricants, glidants, disintegrants, and adsorbents; and/or preservatives.
  • the pharmaceutical according to the invention can be administered by various well known routes, including oral, rectal, intragastrical and parenteral administration, e.g. intravenous, intramuscular, intranasal, intradermal, subcutaneous and similar administration routes. Parenteral-, intramuscular- and intravenous administration is preferred.
  • the pharmaceutical according to the invention is formulated as syrup, an infusion or injection solution, a tablet, a capsule, a capslet, lozenge, a liposome, a suppository, a plaster, a band-aid, a retard capsule, a powder, or a slow release formulation.
  • the diluent is water, a buffer, a buffered salt solution or a salt solution and the carrier preferably is selected from the group consisting of cocoa butter and vitebesole.
  • Particular preferred pharmaceutical forms for the administration of the pharmaceutical according to the invention during the use of the present invention are forms suitable for injectable use and include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • a solution or dispersion will include a solvent or dispersion medium, containing, for example, water-buffered aqueous solutions, e.g. biocompatible buffers, ethanol, polyol, such as glycerol, propylene glycol, polyethylene glycol, suitable mixtures thereof, surfactants or vegetable oils.
  • Infusion or injection solutions can be accomplished by any number of art recognized techniques including but not limited to addition of preservatives like anti -bacterial or anti-fungal agents, e.g. parabene, chlorobutanol, phenol, sorbic acid or thimersal. Further, isotonic agents, such as sugars or salts, in particular sodium chloride may be incorporated in infusion or injection solutions.
  • preservatives like anti -bacterial or anti-fungal agents, e.g. parabene, chlorobutanol, phenol, sorbic acid or thimersal.
  • isotonic agents such as sugars or salts, in particular sodium chloride may be incorporated in infusion or injection solutions.
  • Preferred diluents of the present invention are water, physiological acceptable buffers, physiological acceptable buffer salt solutions or salt solutions.
  • Preferred carriers are cocoa butter and vitebesole.
  • Excipients which can be used with the various pharmaceutical forms of the pharmaceutical according to the invention can be chosen from the following non-limiting list: a) binders such as lactose, mannitol, crystalline sorbitol, dibasic phosphates, calcium phosphates, sugars, microcrystalline cellulose, carboxymethyl cellulose, hydroxyethyl cellulose, polyvinyl pyrrolidone and the like; b) lubricants such as magnesium stearate, talc, calcium stearate, zinc stearate, stearic acid, hydrogenated vegetable oil, leucine, glycerids and sodium stearyl fumarates, c) disintegrants such as starches, croscaramellose, sodium methyl cellulose, agar, bentonite, algin
  • Certain amounts of the pharmaceutical according to the invention are preferred for the therapy or prophylaxis of a disease. It is, however, understood that depending on the severity of the disease, the type of the disease, as well as on the respective patient to be treated, e.g. the general health status of the patient, etc., different doses of the pharmaceutical according to the invention are required to elicit a therapeutic or prophylactic effect. The determination of the appropriate dose lies within the discretion of the attending physician.
  • the pharmaceutical according to the invention may be formulated as a vaccine.
  • the pharmaceutical according to the invention is preferably administered in above outlined preferred and particular preferred doses.
  • the administration of the vaccine is repeated at least two, three, four, five, six, seven, eight nine or at least 10 times over the course of a defined period of time, until the vaccinated subject has generated sufficient antibodies against the pharmaceutical according to the invention so that the risk of developing the respective disease has lessened.
  • the period of time in this case is usually variable depending on the antigenicity of the vaccine.
  • the period of time is not more than four weeks, three months, six months or three years.
  • an adenovirus according to the invention if used for vaccination purposes, at least one of the hyper variable domains of the hexon protein can be replaced by an immunogenic epitope of the respective disease agent that the vaccination is directed against.
  • Vaccines typically contain one or more adjuvants as outlined above.
  • a detailed summary of the use of adenoviruses for vaccination and methods pertaining thereto is provided in: Bangari DS and Mittal SK (2006) Vaccine, 24(7), p. 849-862; see also: Zhou D, et al., Expert Opin Biol Ther. 2006 Jan;6(l):63-72; and: Folgori A, et al., Nat Med.
  • FIG. 1 Multiple sequence alignment between hexon proteins of various adenovirus isolates of the invention, using Clustal-W with default settings. Hexon proteins of said novel chimpanzee adenovirus isolates are shown (designated as PanAdl, PanAd2, PanAd3, ChAd55, ChAd73, ChAd83, ChAdl46 and ChAdl47). The hypervariable domains 1 through 7 are designated as "HVR 1-6" and "HVR 7", respectively.
  • Fig. 2 Multiple sequence alignment between fiber proteins of adenovirus ChAd55 and of further novel chimpanzee adenovirus isolates (designated as PanAdl, PanAd2, PanAd3,
  • Fig. 4 Diagram of construction of a replication-defective adenovirus vector by homologous recombination with wild type viral genome and the corresponding shuttle plasmid. See also example 2 .
  • Fig. 5 Cell-mediated immune response in mice vaccinated with recombinant adenoviruses comprising an expression cassette for the expression of HIV gag protein (SEQ ED NO:1).
  • Fig. 5C The immune response was measured by Interferon- ⁇ ELIspot assay by incubating the cells with a CD8 HIV gag epitope mapped in Balb/C mice. The results are reported as spot forming cells per 10 6 splenocytes.
  • Fig. 6 The seroprevalence of novel adenovirus vectors was evaluated on a panel of human sera of European origin.
  • PanAd2, PanAd3 and CV-68 were evaluated in parallel on the same panel. The data are expressed as % of subjects showing an immunoprevalence. Neutralizing antibodies were only detected against Ad5 and CV-68 adenoviruses but not for any of the novel adenoviruses of the present invention.
  • Fig. 7 PanAd HSV immunization of BALB/c mice is shown in Fig. 7A and PanAd cancer Ag immunization of BALB/c mice is shown in Fig. 7B.
  • Fig. 8 PanAd HIV gag immunization of Macaca fascicularis is shown in a priming/boosting vaccination experiment.
  • Example 1 Adenovirus isolation and characterization
  • ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 are a group of chimpanzee adenoviruses obtained from healthy animals housed in different European and US facilities. ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 have the property of no detectable reactivity with human sera.
  • PanAdl, PanAd2 and PanAd3 are new adenovirus isolated from healthy bonobos ⁇ Pan Paniscus) housed in different European and US facilities. PanAdl, PanAd2 and PanAd3 have the property of no detectable reactivity with human sera.
  • the common chimpanzee and bonobo adenovirus stocks were cloned by infecting 293 cells seeded in 96-well plates, after the first passage of amplification.
  • the virus cloning was performed by limiting dilution of the cell lysate obtained at the first passage of the virus amplification. 5 isolated clones were picked up and serially propagated. After 3-4 serial passages of amplification, a large-scale preparation of adenovirus was performed on cells planted on 5 two-layer cell-factories (NUNC) (200 millions of cells/cell factory). Purified viral particles were obtained from cell lysate by two ultra-centrifugation steps on cesium chloride density gradients.
  • NUNC two-layer cell-factories
  • Genomic DNA was isolated from 3 X 10 1 pp of purified virus preparation by digestion with Proteinase K (0.5 mg/ml) in 1% SDS-TEN (2 hrs at 55°C). After a Phenol-Chloroform extraction and Ethanol precipitation, the genomic DNA was resuspended in water and submitted for genomic sequencing. An initial classification of the new isolates was obtained by sequence analysis of the hypervariable region 7 (HVR7) of the hexon gene. To this end two primers were designed on the highly conserved regions flanking HVR7: TGTCCTACC ARCTCTTGCTTGA (SEQ ID NO. 3) and GTGGAARGGCACGTAGCG (SEQ ID NO. 4).
  • HVR7 hypervariable region 7
  • the HVR7 was amplified by PCR using purified viral DNA or crude 293 lysate as template and then sequenced. More detailed information about the isolate was obtained by sequencing the hypervariable regions 1 to 6.
  • the DNA region containing HVRl -6 was amplified by PCR using oligonucleotides HVRl-6fd, CAYGATGTGACCACCGACCG (SEQ ID NO. 5) and HVRl -6rev, GTGTTYCTGTCYTGCAAGTC (SEQ ID NO. 6).
  • subgroup E ChAd55, ChAd73, ChAd83, ChAdI 46, ChAdI 47
  • subgroup C PanAdl, PanAd2 and PanAd3 of human Ad virus classification (Horowitz, MS (1990), Adenoviridae and their replication. In Virology B.N. Fields and D.M. Knipe, eds (raven Press, New York) pp.1679- 1740).
  • a phylogenetic tree was obtained by alignment of human and chimp adenovirus hexon amino acid sequences. The results are consistent with the initial classification based on nucleotide sequence alignment limited to hexon HVRl -6 and 7 by using Align X program (Informax, Inc) demonstrating a close phylogenetic relationship of ChAd55, ChAd73, ChAd83, ChAd 146, ChAd 147 isolates with human Ad4 (subgroup E) while bonobo adenovirus isolate PanAdl, PanAd2 and PanAd3 are related to human AdI, 2, 5, 6 (subgroup C).
  • Example 2 Vector construction
  • the PanAdl, PanAd2 and PanAd3 and ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 virus genomes were cloned in a plasmid vector following the strategy detailed below. All manipulations of the vector genome were performed in E.coli following standard techniques. Vector systems were developed by deleting El and E3 regions from ChAd and PanAd backbones. The El region was substituted with expression cassettes based on human CMV IE promoter and BGHpA signal containing HCV non structural region (HCV NS) and HIV gag (SEQ ID NO: 1) genes for the evaluation of the immunological potency in animal models.
  • HCV NS HCV non structural region
  • SEQ ID NO: 1 HIV gag
  • ChAd and PanAd vectors expressing the secreted alkaline phosphatase gene were constructed for the neutralization assay.
  • the vectors were propagated in 293 cells and purified by CsCl gradients following standard protocols.
  • PanAdl, PanAd2 and PanAd3 ⁇ E1 vectors proceeded through the steps provided below.
  • PanAdl genome was used to construct a shuttle vector for cloning by homologous recombination the entire genome of PanAdl, PanAd2 and PanAd3.
  • the shuttle vector used to clone bonobo adenovirus 1 referred to herein as pBAdlRLD_EGFP was constructed as follows: PanAdl left end (nt 1-450) was amplified by PCR with oligonucleotides
  • PanAdl right end (nt 37362-37772) was then amplified by PCR with oligonucleotides 5'- TCCAGCGGCGCGCCAGACCCGAGTCTTACCAGGA-3' (SEQ ID NO: 9) and 5'- ATTCAGGATCCGAATTCGTTTAAACCATCATCAATAATATACCTTATTTTG-S ' (SEQ ID NO: 10), and cloned in pBAdl-L thus generating plasmid pBAdl-RL.
  • a PanAdl DNA fragment (nt 3498-4039) containing pIX coding region was subsequently amplified by PCR with the oligonucleotides 5'- TATTCTGCGATCGCTGAGGTGGGTGAGTGGGCG -3' (SEQ ID NO: 11) and 5'- TTACTGGCGCGCCTGCCTCGAGTAAACGGCATTTGCAGGAGAAG-S' (SEQ ID NO: 12) then cloned into pBAdl-RL obtaining the plasmid pBAdlRLD EGFP shuttle.
  • Shuttle plasmids containing the expression cassettes for secreted alkaline phosphatase (SEAP), HIV gag, HCV non structural region (NS) genes were also constructed by substituting the EGFP gene in pBAdlRLD EGFP shuttle.
  • HIV gag HCV NS region SEAP and EGFP expression cassette based on human cytomegalovirus (HCMV) promoter and bovine growth hormone polyadenylation signal (Bgh polyA) were constructed as described in Emini et al., International Publication Number WO
  • the viral DNA cassette was designed to contain restriction enzyme sites (Pmel) that are present only at the end of both ITRs to allow the release of viral DNA from plasmid DNA.
  • Pmel restriction enzyme sites
  • PanAdl, PanAd2 and PanAd3 vectors were constructed by homologous recombination in
  • E. coli strain BJ5183 E. coli strain BJ5183.
  • BJ5183 cells were co-transformed with PanAdl, 2 and 3 purified viral DNAs and pBAd IRLD-EGFP or pBAdlRLD-Gag. Homologous recombination between pIX genes, right ITR DNA sequences present at the ends of linearized pBAd IRLD-EGFP or pBAdlRLD-Gag and viral genomic DNAs allowed its insertion in the plasmid vector, by deleting at the same time the El region that was substituted by the expression cassette.
  • PanAdl E3 deletion spans from nucleotide 28636 to nucleotide 32596 of genomic PanAdl sequence (SEQ ID NO.: 13); PanAd2 E3 deletion spans from nucleotide 28653 to nucleotide 32599 of genomic PanAd2 sequence (SEQ ID NO.: 62); PanAd3 E3 deletion spans from nucleotide 28684 to nucleotide 32640 of genomic PanAd3 sequence (SEQ ID NO.: 63).
  • the native E4 region of PanAdl, PanAd2 and PanAd3 was deleted and replaced with Ad5 E4 ORF6 coding sequence (SEQ ID NO.: 64).
  • Ad5 E4 ORF6 coding sequence SEQ ID NO.: 64.
  • the coordinates of the E4 deletion introduced in the PanAd 1 , 2 and 3 backbones are the following:
  • the deleted region contains all PanAd E4 orfs while the E4 native promoter and polyadenylation signal were not deleted
  • the HIV gag and HCV NS region expression cassette based on human cytomegalovirus (HCMV) promoter and bovine growth hormone polyadenylation signal (Bgh polyA) was constructed as described in Emini et al., International Publication Number WO 03/031588 and inserted into PanAd 1, 2 and 3 ⁇ E1 EGFP vector by homologous recombination in E. coli strain BJ5183 exploiting the homologies between HCMV and Bgh polyA DNA sequences.
  • HCMV human cytomegalovirus
  • Bgh polyA bovine growth hormone polyadenylation signal
  • ChAd55 shuttle was constructed by following the same strategy described above for PanAd vectors then used for the cloning of the ChAd55 viral genomes.
  • the shuttle vector pARS ChAd55 containing the right end as well as the left end of viral genome was linearized with Ascl restriction enzyme and co-transformed into E. coli strain BJ5183 with ChAd55 purified viral DNA.
  • Expression cassettes based on human cytomegalovirus (HCMV) promoter and bovine growth hormone poly-adenylation signal (Bgh polyA) were constructed to express secreted alkaline phosphatase (SEAP), EGFP, HIV gag , HCV NS genes. All expression cassettes were inserted into the single SnaBI site of pARS ChAd55 vector to be transferred by homologous recombination into the ⁇ E1 adenovirus pre-plasmids.
  • HCMV human cytomegalovirus
  • Bgh polyA bovine growth hormone poly-adenylation signal
  • the vector potency of ChAd55 gag was compared with human Ad5 gag in immunization experiments performed in parallel.
  • Groups of 10 animals were injected in the quadriceps with a dose of the vector of 10 8 vp/mouse for Ad5gag or ChAd55gag (Fig. 5A).
  • a group of 5 animals were injected with a dose of the vector of 10 8 vp/mouse for Ad5gag or PanAdlgag, PanAd2gag and PanAd3gag (Fig. 5B).
  • the potency of ChAd73 gag, ChAd83 gag, ChAd 146 gag and Chadl47gag was also determined by immunizing groups of 5 mice with a dose of vector of 10 8 vp/mouse in parallel with ChAd55 gag (Fig. 5C).
  • the immune response elicited against HIV gag was measured by Interferon- ⁇ Elispot assay on splenocytes.
  • Example 4 Neutralization Studies Neutralization assays were carried out in order to evaluate the prevalence in human sera of neutralizing antibodies against the common chimpanzee adenovirus 55, 73, 83, 146, 147 and the Bonobo adenovirus type 1, 2 and 3. The assay evaluated the effects of serum preincubation on the ability of ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47, PanAdl, PanAd2 and PanAd3 carrying the gene for secreted alkaline phosphatase (SEAP) to transduce human 293 cells.
  • SEAP secreted alkaline phosphatase
  • the neutralization titer is defined as the dilution of serum giving a 50% reduction of the SEAP activity observed in the positive control with the virus in absence of serum.
  • Each serum sample was tested at various dilutions (five 4-fold increments starting from 1/18 dilution through 1 :4608). Samples were pre-incubated for one hour at 37°C and then added to 293 cells seeded into 96-well plates (3x10 4 cells/well). A panel of human sera was tested for neutralization activity. In parallel the same panel was tested on Ad5 and on chimp and bonobo Ad SEAP vectors. The results are provided in Figure 6. The results indicate that the seroprevalence on chimpanzee adenoviruses is lower than human adenovirus Ad5.
  • the novel adenovirus isolates ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 and PanAdl, PanAd2 and PanAd3 represent the ideal solution to the problem of the pre-existing anti-human Ad immunity that limits the administration of viral vectors based on common human Ad serotypes such as Ad5.
  • PanAdl and PanAd3 vectors as potential recombinant vaccines was evaluated in BALB/c mice with vectors expressing herpes simplex virus (HSV) antigen and with vectors expressing a cancer antigen.
  • HSV herpes simplex virus
  • the vector potency of PanAdl and 3 expressing HSV Ag and the cancer Ag was compared with the corresponding vectors based on human Ad5.
  • 9 groups of BALB/c mice were injected in the quadriceps with increasing doses of the vectors starting from 10 7 vp/mouse up to 10 9 vp/mouse in parallel with PanAdl -HSV, PanAd3-HSV and Ad5-HSV (see Fig. 7A).
  • the immune response elicited against the HSV antigen was measured by Interferon- ⁇ Elispot assay on mouse splenocytes incubated with a peptide pool covering the entire amino acid sequence of the antigen.
  • the results of immunization experiments with PanAdl, PanAd2 and PanAd3 in comparison with human Ad5 vector reported in Figure 7 showed that the novel adenoviruses of the invention are more effective in eliciting a specific immune response than the prior art recombinant adenovirus Ad5 at each concentration tested. This is clearly demonstrated by the higher frequency of antigen- specific T-cell observed in mice immunized with PanAdl and PanAd3 vectors.
  • the efficiency in eliciting anti-tumoral T-cell response by PanAd vectors was evaluated by immunizing groups of BALB/c mice by injecting in the quadriceps increasing doses of the vectors starting from 10 7 vp/mouse up to 10 9 vp/mouse.
  • Two groups of BALB/C mice were injected with Ad5 vector expressing the tumor antigen at 10 7 vp/mouse and 10 9 vp/mouse.
  • 3 groups of BALB/c mice were immunized with 10 , 10 ,10 vp of PanAdl or PanAd3 vectors carrying the same tumor antigen.
  • the T cell response was measured by Interferon- ⁇ Elispot assay on splenocytes using a single peptide representing a mapped CD8 epitope.
  • the results shown in Figure 7B demonstrated a higher frequency of responding animals at the lowest dose of the vaccine as well as a higher frequency of antigen-specific T-cell in the groups of animals immunized with the PanAd vectors in comparison with those immunized with Ad5 vector.
  • IFN- ⁇ ELISPOT assay This assays measure HIV antigen-specific CD8+ and CD4+ T lymphocyte responses. Peptides based on the amino acid sequence of HIV Gag protein were prepared for use in these assays to measure immune responses in adenovirus vector vaccinated monkeys. The individual peptides are overlapping 20- mers, offset by 10 amino acids.
  • the IFN ⁇ -ELISPOT assay provides a quantitative determination of antigen-specific T lymphocyte responses. PBMC are serially diluted and placed in microplate wells coated with anti-rhesus IFN- ⁇ antibody (MD-I U-Cytech).
  • the number of spots per well is directly related to the precursor frequency of antigen-specific T cells.
  • Gamma interferon was selected as the cytokine visualized in this assay (using specific anti- gamma interferon monoclonal antibodies) because it is the most common, and one of the most abundant cytokines synthesized and secreted by activated T lymphocytes.
  • SFC spot forming cells
  • the invention provides the use of two recombinant adenoviruses of the invention for a heterologous prime-boost immunization wherein the two recombinant adenoviruses of the invention are of distinct adenoviral serotypes, most preferably of PanAdl and PanAd3 as described herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/EP2010/000616 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof Ceased WO2010086189A2 (en)

Priority Applications (27)

Application Number Priority Date Filing Date Title
KR1020117017573A KR101761425B1 (ko) 2009-02-02 2010-02-02 시미안 아데노바이러스 핵산- 및 아미노산-서열, 이를 포함하는 벡터 및 이의 용도
AU2010209938A AU2010209938A1 (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
EP10702615.5A EP2391638B1 (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
MX2011007980A MX2011007980A (es) 2009-02-02 2010-02-02 Secuencias de acido nucleico y aminoacido de adenovirus de simio, vectores que contienen los mismos y usos de las mismas.
LTEP10702615.5T LT2391638T (lt) 2009-02-02 2010-02-02 Beždžionių adenoviruso nukleorūgšties ir aminorūgščių sekos, vektoriai, turintys sekas ir jų panaudojimas
RU2011136282/10A RU2604815C2 (ru) 2009-02-02 2010-02-02 Нуклеинокислотные и аминокислотные последовательности аденовируса обезьян, векторы, содержащие указанные последовательности, и их применение
HRP20181377TT HRP20181377T1 (hr) 2009-02-02 2010-02-02 Nukleinskokiselinski i aminokiselinski sljedovi majmunskog adenovirusa, vektori koji ih sadrže, te njihova upotreba
ES10702615T ES2687294T3 (es) 2009-02-02 2010-02-02 Secuencias de aminoácidos y de ácidos nucleicos de adenovirus de simio, vectores que las contienen, y sus usos
EP18173908.7A EP3385387B1 (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
CA2749325A CA2749325C (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
SG2011050275A SG172935A1 (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
BRPI1008018A BRPI1008018A2 (pt) 2009-02-02 2010-02-02 ácidos nucleicos de adenovírus símio e sequências de aminoácidos, vetores contendo os mesmos e uso dos mesmos
DK10702615.5T DK2391638T3 (en) 2009-02-02 2010-02-02 Abeadenovirus nucleic acid and amino acid sequences, vectors containing them, and uses thereof.
PL10702615T PL2391638T3 (pl) 2009-02-02 2010-02-02 Sekwencje nukleotydowe i aminokwasowe małpiego adenowirusa, zawierające je wektory i ich zastosowania
NZ59435510A NZ594355A (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
JP2011546719A JP5882741B2 (ja) 2009-02-02 2010-02-02 サルアデノウイルスの核酸配列及びアミノ酸配列、それを含有するベクター、並びにその使用
CN201080006197XA CN102300872A (zh) 2009-02-02 2010-02-02 猿腺病毒核酸和氨基酸序列,包含其的载体及其用途
KR1020167024396A KR101763093B1 (ko) 2009-02-02 2010-02-02 시미안 아데노바이러스 핵산- 및 아미노산-서열, 이를 포함하는 벡터 및 이의 용도
SI201031745T SI2391638T1 (sl) 2009-02-02 2010-02-02 Nukleinskokislinske in aminokislinske sekvence opičjega adenovirusa, vektorji, ki le-te vsebujejo, in njihova uporaba
US13/147,193 US9718863B2 (en) 2009-02-02 2010-02-06 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
IL214097A IL214097B (en) 2009-02-02 2011-07-14 Simian adenovirus nucleic acid-and amino acid-sequences, vectors containing same and uses thereof
IL241494A IL241494A0 (en) 2009-02-02 2015-09-10 Simian adenovirus nucleic acid-and amino acid-sequences, vectors containing same, and uses thereof
AU2015238866A AU2015238866B2 (en) 2009-02-02 2015-10-08 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
US15/623,723 US10544192B2 (en) 2009-02-02 2017-06-15 Chimpanzee clade E adenovirus nucleic acid-and amino acid-sequences, vectors containing same, and uses thereof
AU2017204292A AU2017204292B2 (en) 2009-02-02 2017-06-23 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
CY181100894T CY1120652T1 (el) 2009-02-02 2018-08-28 Αλληλουχιες νουκλεϊνικου οξεος και αμινοξεος αδενοϊου πιθηκοειδους, φορεις που περιεχουν αυτες και χρησεις αυτων
US16/710,131 US11214599B2 (en) 2009-02-02 2019-12-11 Recombinant simian adenoviral vectors encoding a heterologous fiber protein and uses thereof

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
PCT/EP2009/000672 WO2010085984A1 (en) 2009-02-02 2009-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
EPPCT/EP2009/000672 2009-02-02
US17262409P 2009-04-24 2009-04-24
US61/172,624 2009-04-24
US17485209P 2009-05-01 2009-05-01
US61/174,852 2009-05-01
US26634209P 2009-12-03 2009-12-03
US61/266,342 2009-12-03

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/147,193 A-371-Of-International US9718863B2 (en) 2009-02-02 2010-02-06 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
US15/623,723 Division US10544192B2 (en) 2009-02-02 2017-06-15 Chimpanzee clade E adenovirus nucleic acid-and amino acid-sequences, vectors containing same, and uses thereof

Publications (2)

Publication Number Publication Date
WO2010086189A2 true WO2010086189A2 (en) 2010-08-05
WO2010086189A3 WO2010086189A3 (en) 2010-09-23

Family

ID=45561183

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/000616 Ceased WO2010086189A2 (en) 2009-02-02 2010-02-02 Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof

Country Status (23)

Country Link
US (3) US9718863B2 (https=)
EP (2) EP3385387B1 (https=)
JP (3) JP5882741B2 (https=)
KR (2) KR101763093B1 (https=)
CN (2) CN105112428B (https=)
AU (3) AU2010209938A1 (https=)
BR (1) BRPI1008018A2 (https=)
CA (2) CA2749325C (https=)
CY (1) CY1120652T1 (https=)
DK (1) DK2391638T3 (https=)
ES (2) ES2687294T3 (https=)
HR (1) HRP20181377T1 (https=)
HU (1) HUE039908T2 (https=)
IL (2) IL214097B (https=)
LT (1) LT2391638T (https=)
MX (1) MX2011007980A (https=)
NZ (2) NZ603348A (https=)
PL (1) PL2391638T3 (https=)
PT (1) PT2391638T (https=)
RU (1) RU2604815C2 (https=)
SG (3) SG2014007959A (https=)
SI (1) SI2391638T1 (https=)
WO (1) WO2010086189A2 (https=)

Cited By (119)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011130627A2 (en) 2010-04-16 2011-10-20 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Chimpanzee adenoviral vector-based filovirus vaccines
WO2012089231A1 (en) 2010-12-30 2012-07-05 Okairòs Ag Paramyxovirus vaccines
WO2013007772A1 (en) 2011-07-12 2013-01-17 Transgene Sa Hbv polymerase mutants
WO2013045668A2 (en) 2011-09-29 2013-04-04 Transgene Sa Immunotherapy composition and regimen for treating hepatitis c virus infection
WO2013045658A1 (en) 2011-09-29 2013-04-04 Transgene Sa Immunotherapy composition and regimen for treating hepatitis c virus infection
WO2013074501A1 (en) 2011-11-14 2013-05-23 Crucell Holland B.V. Heterologous prime-boost immunization using measles virus-based vaccines
WO2013135615A1 (en) 2012-03-12 2013-09-19 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
WO2013164754A2 (en) 2012-05-04 2013-11-07 Pfizer Inc. Prostate-associated antigens and vaccine-based immunotherapy regimens
WO2014005643A1 (en) 2012-07-05 2014-01-09 Okairos Ag Novel prime-boosting regimens involving immunogenic polypeptides encoded by polynucleotides
WO2014139587A1 (en) 2013-03-15 2014-09-18 Okairòs Ag Improved poxviral vaccines
US8932607B2 (en) 2012-03-12 2015-01-13 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
WO2015092710A1 (en) 2013-12-19 2015-06-25 Glaxosmithkline Biologicals, S.A. Contralateral co-administration of vaccines
JP2015519058A (ja) * 2012-05-18 2015-07-09 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 亜科eサルアデノウイルスa1302、a1320、a1331及びa1337ならびにそれらの使用
US9133248B2 (en) 2009-11-09 2015-09-15 Genvec, Inc. Methods of propagating monkey adenoviral vectors
WO2016049287A1 (en) 2014-09-26 2016-03-31 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for inducing protective immunity against human immunodeficiency virus infection
WO2016131945A1 (en) 2015-02-20 2016-08-25 Transgene Sa Combination product with autophagy modulator
EP3075860A1 (en) * 2010-11-23 2016-10-05 The Trustees of the University of Pennsylvania Subfamily e simian adenovirus a1295 and uses thereof
WO2016166088A1 (en) 2015-04-14 2016-10-20 Janssen Vaccines & Prevention B.V. Recombinant adenovirus expressing two transgenes with a bidirectional promoter
WO2016184822A1 (en) 2015-05-15 2016-11-24 Curevac Ag Prime-boost regimens involving administration of at least one mrna construct
WO2016198599A1 (en) * 2015-06-12 2016-12-15 Glaxosmithkline Biologicals S.A. Adenovirus polynucleotides and polypeptides
WO2017017049A1 (en) * 2015-07-27 2017-02-02 Glaxosmithkline Biologicals S.A. Novel adenovirus
WO2017025782A1 (en) 2014-09-17 2017-02-16 Glaxosmithkline Biologicals Sa Improved poxviral vaccines
WO2017125844A1 (en) 2016-01-19 2017-07-27 Pfizer Inc. Cancer vaccines
WO2017191147A1 (en) 2016-05-04 2017-11-09 Transgene Sa Combination therapy with cpg tlr9 ligand
WO2017220499A1 (en) 2016-06-20 2017-12-28 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
WO2018011768A1 (en) 2016-07-15 2018-01-18 Janssen Vaccines And Prevention B.V. Methods and compositions for inducing protective immunity against a marburg virus infection
WO2018011198A1 (en) 2016-07-15 2018-01-18 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against a marburg virus infection
WO2018037045A1 (en) 2016-08-23 2018-03-01 Glaxosmithkline Biologicals Sa Fusion peptides with antigens linked to short fragments of invariant chain (cd74)
WO2018060288A1 (en) 2016-09-29 2018-04-05 Glaxosmithkline Biologicals S.A. Compositions and methods of treatment of persistent hpv infection
WO2018065931A1 (en) 2016-10-05 2018-04-12 Glaxosmithkline Biologicals Sa Vaccine
WO2018069316A2 (en) 2016-10-10 2018-04-19 Transgene Sa Immunotherapeutic product and mdsc modulator combination therapy
WO2018104919A1 (en) 2016-12-09 2018-06-14 Glaxosmithkline Biologicals Sa Chimpanzee adenovirus constructs with lyssavirus antigens
WO2018104911A1 (en) 2016-12-09 2018-06-14 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
BE1024824B1 (fr) * 2015-06-12 2018-07-13 Glaxosmithkline Biologicals Sa Polynucleotides et polypeptides d'adenovirus
WO2018138667A1 (en) 2017-01-25 2018-08-02 Glaxosmithkline Biologicals Sa Novel formulation
WO2018146205A1 (en) 2017-02-09 2018-08-16 Janssen Vaccines & Prevention B.V. Potent and short promoter for expression of heterologous genes
US10059962B2 (en) 2011-10-05 2018-08-28 Genvec, Inc. Simian (gorilla) adenovirus or adenoviral vectors and methods of use
WO2018185732A1 (en) 2017-04-06 2018-10-11 Janssen Vaccines & Prevention B.V. Mva-bn and ad26.zebov or ad26.filo prime-boost regimen
US10125174B2 (en) 2012-05-29 2018-11-13 Genvec, Inc. Herpes simplex virus vaccine
WO2018210871A1 (en) 2017-05-17 2018-11-22 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against rsv infection
WO2018229711A1 (en) 2017-06-15 2018-12-20 Janssen Vaccines & Prevention B.V. Poxvirus vectors encoding hiv antigens, and methods of use thereof
WO2019012091A1 (en) 2017-07-12 2019-01-17 Nouscom Ag NEOANTIGEN-BASED VACCINE COMPOSITION FOR THE TREATMENT OF CANCER
WO2019012371A1 (en) 2017-07-11 2019-01-17 Pfizer Inc. IMMUNOGENIC COMPOSITIONS COMPRISING CEA MUC1 AND TERT
WO2019016756A1 (en) 2017-07-21 2019-01-24 Glaxosmithkline Biologicals Sa ANTIGEN CONSTRUCTS OF CHIKUNGUNYA VIRUSES
WO2019023566A1 (en) 2017-07-28 2019-01-31 Janssen Vaccines & Prevention B.V. METHODS AND COMPOSITIONS FOR PROVIDING IMMUNIZATION AGAINST Heterologous ARNREP
US10260074B2 (en) 2011-10-05 2019-04-16 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
WO2019076880A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa SIMIENS ADENOVIRAL VECTORS COMPRISING TWO EXPRESSION CASSETTES
WO2019076877A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ADENOVIRAL VECTORS FOR REPLICATION
WO2019076892A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ENHANCED PROMOTER
WO2019076882A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ADENOVIRAL VECTORS COMPRISING TWO EXPRESSION CASSETTES ENCODING RSV ANTIGENIC PROTEINS OR FRAGMENTS THEREOF
US10272162B2 (en) 2011-10-05 2019-04-30 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
WO2019086615A1 (en) 2017-11-03 2019-05-09 Nouscom Ag Vaccine t cell enhancer
WO2019086450A1 (en) * 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2019099970A1 (en) 2017-11-20 2019-05-23 Janssen Pharmaceuticals Inc. Method of providing safe administration of adenoviral vectors encoding a zika virus antigen
WO2019115817A2 (en) 2017-12-15 2019-06-20 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
WO2019115816A1 (en) 2017-12-15 2019-06-20 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
WO2019123169A1 (en) 2017-12-20 2019-06-27 Glaxosmithkline Biologicals Sa Epstein-barr virus antigen constructs
WO2019123250A1 (en) 2017-12-19 2019-06-27 Janssen Sciences Ireland Unlimited Company Methods and compositions for inducing an immune response against hepatitis b virus (hbv)
EP3581201A1 (en) 2018-06-15 2019-12-18 GlaxoSmithKline Biologicals S.A. Escherichia coli o157:h7 proteins and uses thereof
WO2019239311A1 (en) 2018-06-12 2019-12-19 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
EP3584252A1 (en) 2015-12-15 2019-12-25 Janssen Vaccines & Prevention B.V. Human immunodeficiency virus antigens, vectors, compositions, and methods of use thereof
EP3587581A1 (en) 2018-06-26 2020-01-01 GlaxoSmithKline Biologicals S.A. Formulations for simian adenoviral vectors having enhanced storage stability
WO2020016394A1 (en) 2018-07-20 2020-01-23 Janssen Vaccines & Prevention B.V. Recombinant adenoviral vector expressing zika antigen with improved productivity
US10561721B2 (en) 2014-09-03 2020-02-18 Bavarian Nordic A/S Methods and compositions for inducing protective immunity against filovirus infection
US10561722B2 (en) 2014-09-03 2020-02-18 Bavarian Nordic A/S Methods and compositions for enhancing immune responses
WO2020079234A1 (en) 2018-10-19 2020-04-23 Nouscom Ag Teleost invariant chain cancer vaccine
WO2020099614A1 (en) 2018-11-15 2020-05-22 Nouscom Ag Selection of cancer mutations for generation of a personalized cancer vaccine
WO2020144615A1 (en) 2019-01-10 2020-07-16 Janssen Biotech, Inc. Prostate neoantigens and their uses
US10729757B2 (en) 2016-04-05 2020-08-04 Janssen Vaccines & Prevention B.V. Vaccine against RSV
WO2020178359A1 (en) 2019-03-05 2020-09-10 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
US10899800B2 (en) 2013-04-25 2021-01-26 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F polypeptides
US10953087B2 (en) 2016-05-30 2021-03-23 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion RSV F proteins
WO2021099906A1 (en) 2019-11-18 2021-05-27 Janssen Biotech, Inc. Vaccines based on mutant calr and jak2 and their uses
US11034731B2 (en) 2015-07-07 2021-06-15 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F polypeptides
EP3842068A1 (en) 2012-07-05 2021-06-30 GlaxoSmithKline Biologicals S.A. Novel prime-boosting regimens involving immunogenic polypeptides encoded by polynucleotides
WO2021161245A1 (en) 2020-02-14 2021-08-19 Janssen Biotech, Inc. Neoantigens expressed in multiple myeloma and their uses
WO2021161244A1 (en) 2020-02-14 2021-08-19 Janssen Biotech, Inc. Neoantigens expressed in ovarian cancer and their uses
EP3888676A1 (en) 2014-06-13 2021-10-06 GlaxoSmithKline Biologicals S.A. Immunogenic combinations
US11142551B2 (en) 2017-10-31 2021-10-12 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2021209897A1 (en) 2020-04-13 2021-10-21 Janssen Biotech, Inc. Psma and steap1 vaccines and their uses
US11155583B2 (en) 2016-04-05 2021-10-26 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F proteins
WO2021228842A1 (en) 2020-05-11 2021-11-18 Janssen Pharmaceuticals, Inc. Stabilized coronavirus spike protein fusion proteins
EA039001B1 (ru) * 2015-08-19 2021-11-19 Глаксосмитклайн Байолоджикалс С.А. Аденовирусные полинуклеотиды и полипептиды
WO2022002894A1 (en) 2020-06-29 2022-01-06 Janssen Vaccines & Prevention B.V. Vaccine combination against respiratory syncytial virus infection
WO2022009052A2 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022009049A1 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022008438A1 (en) 2020-07-06 2022-01-13 Janssen Pharmaceuticals, Inc. Stabilized corona virus spike protein fusion proteins
WO2022008613A1 (en) 2020-07-08 2022-01-13 Janssen Sciences Ireland Unlimited Company Rna replicon vaccines against hbv
WO2022009051A1 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. A method for determining responsiveness to prostate cancer treatment
WO2022013221A1 (en) 2020-07-13 2022-01-20 Transgene Treatment of immune depression
US11229695B2 (en) 2017-09-15 2022-01-25 Janssen Vaccines & Prevention B.V. Method for the safe induction of immunity against RSV
US11229692B2 (en) 2017-05-17 2022-01-25 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against RSV infection
US11229694B2 (en) 2015-07-07 2022-01-25 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US11236361B2 (en) 2017-10-31 2022-02-01 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
US11384122B2 (en) 2020-01-31 2022-07-12 Janssen Pharmaceuticals, Inc. Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines
WO2022175477A1 (en) 2021-02-19 2022-08-25 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion rsv fb antigens
WO2022175479A1 (en) 2021-02-19 2022-08-25 Janssen Vaccines & Prevention B.V. Vaccine combinations against respiratory syncytial virus strain a and b infections
US11459583B2 (en) 2017-10-31 2022-10-04 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
WO2022207839A2 (en) 2021-04-01 2022-10-06 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion piv3 f proteins
US11473105B2 (en) 2016-05-12 2022-10-18 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
WO2022218997A1 (en) 2021-04-12 2022-10-20 Centre National De La Recherche Scientifique (Cnrs) Novel universal vaccine presenting system
WO2022268722A1 (en) 2021-06-21 2022-12-29 Nouscom Ag Vaccine composition comprising encoded adjuvant
WO2023020939A1 (en) 2021-08-17 2023-02-23 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023026182A1 (en) 2021-08-24 2023-03-02 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023047348A1 (en) 2021-09-24 2023-03-30 Janssen Pharmaceuticals, Inc. Stabilized corona virus spike protein fusion proteins
WO2023047349A1 (en) 2021-09-24 2023-03-30 Janssen Pharmaceuticals, Inc. Stabilized coronavirus spike protein fusion proteins
EP4190906A1 (en) 2016-03-31 2023-06-07 The European Molecular Biology Laboratory Engineered polypeptides derived from adenoviral fibre protein and vlps containing the polypeptides
WO2023111725A1 (en) 2021-12-14 2023-06-22 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023110618A1 (en) 2021-12-16 2023-06-22 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion hmpv fusion proteins
WO2023198815A1 (en) 2022-04-14 2023-10-19 Janssen Vaccines & Prevention B.V. Sequential administration of adenoviruses
WO2023213764A1 (en) 2022-05-02 2023-11-09 Transgene Fusion polypeptide comprising an anti-pd-l1 sdab and a member of the tnfsf
WO2024061757A1 (en) 2022-09-23 2024-03-28 Janssen Vaccines & Prevention B.V. Pre-fusion human piv1 f proteins
WO2024061759A1 (en) 2022-09-23 2024-03-28 Janssen Vaccines & Prevention B.V. Stabilized coronavirus s proteins
WO2024074584A1 (en) 2022-10-06 2024-04-11 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion piv3 f proteins
US12098383B2 (en) 2019-05-30 2024-09-24 Gritstone Bio, Inc. Modified adenoviruses
EP4523756A2 (en) 2015-02-13 2025-03-19 Transgene Immunotherapeutic vaccine and antibody combination therapy
US12275766B2 (en) 2020-12-23 2025-04-15 Janssen Biotech, Inc. Neoantigen peptide mimics
US12331077B2 (en) 2018-11-13 2025-06-17 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion RSV F proteins
WO2025158316A1 (en) 2024-01-26 2025-07-31 Janssen Biotech, Inc. Ovarian neoantigens and use thereof

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2391638T3 (pl) * 2009-02-02 2018-11-30 Glaxosmithkline Biologicals Sa Sekwencje nukleotydowe i aminokwasowe małpiego adenowirusa, zawierające je wektory i ich zastosowania
US10106781B2 (en) 2012-11-16 2018-10-23 Beth Israel Deaconess Medical Center, Inc. Recombinant adenoviruses and use thereof
SG11201507393TA (en) 2013-03-14 2015-10-29 Salk Inst For Biological Studi Oncolytic adenovirus compositions
KR102608590B1 (ko) 2014-09-24 2023-12-01 솔크 인스티튜트 포 바이올로지칼 스터디즈 종양 살상 바이러스 및 이의 사용방법
WO2017147269A1 (en) 2016-02-23 2017-08-31 Salk Institute For Biological Studies Exogenous gene expression in therapeutic adenovirus for minimal impact on viral kinetics
WO2017147265A1 (en) 2016-02-23 2017-08-31 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
GB2549809C (en) 2016-06-23 2022-11-30 Univ Oxford Innovation Ltd Vector
EP3532082A4 (en) 2016-12-12 2020-08-26 Salk Institute for Biological Studies SYNTHETIC ADENOVIRUS TUMOR TARGETING AND THEIR USES
EP3634449A4 (en) 2017-05-08 2021-03-17 Gritstone Oncology, Inc. ALPHAVIRUS NEOANTIGEN VECTORS
WO2018209113A1 (en) * 2017-05-10 2018-11-15 University Of Utah Research Foundation Compositions and methods of use of arc capsids
ES2906441T3 (es) * 2017-07-05 2022-04-18 Nouscom Ag Secuencias de ácidos nucleicos y de aminoácidos del adenovirus de los grandes simios no humanos, vectores que las contienen y usos de las mismas
US11773142B2 (en) 2017-12-11 2023-10-03 Beth Israel Deaconess Medical Center, Inc. Recombinant adenoviruses and uses thereof
CN112292449A (zh) 2018-04-09 2021-01-29 萨克生物研究学院 具有增强的复制特性的溶瘤腺病毒组合物
GB201812647D0 (en) * 2018-08-03 2018-09-19 Chancellor Masters And Scholars Of The Univ Of Oxford Viral vectors and methods for the prevention or treatment of cancer
CN113573741B (zh) * 2019-03-20 2024-07-26 国立大学法人北海道大学 修饰腺病毒和含有其的医药
US20220372515A1 (en) * 2019-10-03 2022-11-24 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
WO2021092095A1 (en) * 2019-11-04 2021-05-14 Gritstone Oncology, Inc. Neoantigen vaccine therapy
CN113088530A (zh) * 2020-01-08 2021-07-09 怡道生物科技(苏州)有限公司 一种基于黑猩猩ChAd63型腺病毒的表达载体及其构建方法
CN113897388B (zh) * 2020-07-06 2024-05-31 嘉兴安宇生物科技有限公司 一种新型黑猩猩腺病毒载体及其构建方法和应用
CN116438308A (zh) * 2020-08-06 2023-07-14 磨石生物公司 多表位疫苗盒

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996013597A2 (en) 1994-10-28 1996-05-09 The Trustees Of The University Of Pennsylvania Improved adenovirus and methods of use thereof
US5922315A (en) 1997-01-24 1999-07-13 Genetic Therapy, Inc. Adenoviruses having altered hexon proteins
WO2003031588A2 (en) 2001-10-11 2003-04-17 Merck & Co., Inc. Hepatitis c virus vaccine
WO2003102236A1 (en) 2002-05-31 2003-12-11 Queen Mary & Westfield College Method for determing ethnic origin by means of str profile
WO2005071093A2 (en) 2004-01-23 2005-08-04 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Chimpanzee adenovirus vaccine carriers
WO2006086284A2 (en) 2005-02-11 2006-08-17 Merck & Co., Inc. Adenovirus serotype 26 vectors, nucleic acid and viruses produced thereby

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2264145T3 (es) * 1995-11-30 2006-12-16 The Board Of Regents, The University Of Texas System Metodos y composiciones para el tratamiento de cancer.
US7138103B2 (en) * 1998-06-22 2006-11-21 Immunomedics, Inc. Use of bi-specific antibodies for pre-targeting diagnosis and therapy
KR20040043129A (ko) * 2001-06-22 2004-05-22 더 위스타 인스티튜트 오브 아나토미 앤드 바이올로지 세포독성 면역 반응을 유도하는 방법과 그에 유용한재조합체 원숭이 아데노바이러스 조성물
EP1409748B1 (en) * 2001-06-22 2011-10-26 The Trustees of The University of Pennsylvania Recombinant Adenoviruses comprising simian adenovirus proteins and uses thereof.
AU2002365366B2 (en) * 2001-11-21 2007-05-10 The Trustees Of The University Of Pennsylvania Simian adenovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use
US7291498B2 (en) * 2003-06-20 2007-11-06 The Trustees Of The University Of Pennsylvania Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses
RU2267496C2 (ru) 2004-01-15 2006-01-10 Сергей Иванович Черныш Противоопухолевые и антивирусные пептиды
DE602005025512D1 (de) * 2004-10-13 2011-02-03 Crucell Holland Bv Verbesserte adenovirusvektoren und deren verwendung
AU2006236910B2 (en) * 2005-04-11 2012-06-07 Purdue Research Foundation Vaccine against pandemic strains of influenza viruses
JP2008541730A (ja) * 2005-05-23 2008-11-27 ヴァクシン インコーポレイテッド 高力価かつ複製コンピテントアデノウイルス不含である組換えアデノウイルスベクターの迅速な作成法
WO2006133911A2 (en) * 2005-06-17 2006-12-21 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Hepatitis c virus nucleic acid vaccine
CN101883858B (zh) * 2007-11-28 2015-07-22 宾夕法尼亚大学托管会 猿猴亚家族E腺病毒SAdV-39、-25.2、-26、-30、-37和-38及其应用
CN102131920B (zh) * 2007-11-28 2013-11-06 宾夕法尼亚大学托管会 猿猴亚家族C腺病毒SAdV-40、-31和-34及其应用
JP5661476B2 (ja) * 2008-03-04 2015-01-28 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア サルアデノウイルスSAdV−36、−42.1、−42.2および−44ならびにそれらの用途
WO2009146902A1 (en) * 2008-06-03 2009-12-10 Okairòs Ag A vaccine for the prevention and therapy of hcv infections
PL2391638T3 (pl) * 2009-02-02 2018-11-30 Glaxosmithkline Biologicals Sa Sekwencje nukleotydowe i aminokwasowe małpiego adenowirusa, zawierające je wektory i ich zastosowania

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996013597A2 (en) 1994-10-28 1996-05-09 The Trustees Of The University Of Pennsylvania Improved adenovirus and methods of use thereof
US5922315A (en) 1997-01-24 1999-07-13 Genetic Therapy, Inc. Adenoviruses having altered hexon proteins
WO2003031588A2 (en) 2001-10-11 2003-04-17 Merck & Co., Inc. Hepatitis c virus vaccine
WO2003102236A1 (en) 2002-05-31 2003-12-11 Queen Mary & Westfield College Method for determing ethnic origin by means of str profile
WO2005071093A2 (en) 2004-01-23 2005-08-04 Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa Chimpanzee adenovirus vaccine carriers
WO2006086284A2 (en) 2005-02-11 2006-08-17 Merck & Co., Inc. Adenovirus serotype 26 vectors, nucleic acid and viruses produced thereby

Non-Patent Citations (34)

* Cited by examiner, † Cited by third party
Title
"A multilingual glossary of biotechnological terms", 1999, HELVETICA CHIMICA ACTA
"Merck Index: An Encyclopedia of Chemicals, Drugs, and Biologicals", 1996, CRC PRESS
"United States Pharmacopeia-25National Formulary-20", 2001, UNITED STATES PHARMCOPEIAL CONVENTION, INC.
"Virology", RAVEN PRESS, pages: 1679 - 1740
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ANDREW J. DAVISON ET AL.: "Genetic content and evolution of adenoviruses", JOURNAL OF GENERAL VIROLOGY, vol. 84, 2003, pages 2895 - 2908, XP055142403, DOI: doi:10.1099/vir.0.19497-0
AXEL KLEEMANN; JURGEN ENGEL: "Pharmaceutical Substances: Syntheses, Patents, Applications", 1999, THIEME MEDICAL PUBLISHING
BANGARI DS; MITTAL SK, VACCINE, vol. 24, no. 7, 2006, pages 849 - 862
BIRGITT TAUBER; THOMAS DOBNER, ONCOGENE, vol. 20, 2001, pages 7847 - 7854
BRODY ET AL., ANN NY ACAD SCI., vol. 716, 1994, pages 90 - 101
DAMBROSIO, E., J. HYG. (LONDON), vol. 89, 1982, pages 209 - 219
DRAPER SJ ET AL., NAT MED., vol. 14, no. 8, 2008, pages 819 - 21
FARINA SF, J VIROL., vol. 75, no. 23, 2001, pages 11603 - 13
FATTORI E, GENE THER., vol. 13, no. 14, 2006, pages 1088 - 96
FOLGORI A ET AL., NAT MED., vol. 12, no. 2, 2006, pages 190 - 7
GRAHAM; PREVEC: "Methods in Molecular Biology: Gene Transfer and Expression Protocols", 1991, pages: 109
HIERHOLZER ET AL., J. INFECT.DIS., vol. 158, 1984, pages 804 - 813
HITT ET AL.: "Human Adenovirus Vectors for Gene Transfer into Mammalian Cells", ADVANCES IN PHARMACOLOGY, vol. 40, 1997, pages 137 - 206
HORWITZ: "Virology", 1990, pages: 1679 - 1721
JONG ET AL., J CLIN. MICROBIOL., vol. 37, 1999, pages 3940 - 3945
JOPHN J. RUX, J. OF VIROLOGY, vol. 77, no. 17, 2003
K. J. FISHER; J. M. WILSON, BIOCHEM. J., vol. 299, 1994, pages 49
KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877
MADISCH I ET AL., J VIROL., vol. 81, no. 15, 2007, pages 8270 - 81
MADISCH I ET AL., J. VIROL., vol. 79, no. 24, 2005, pages 15265 - 76
MASTRANGELI, HUMAN GENE THERAPY, vol. 7, 1996, pages 79 - 87
MERCK; MOORE JP ET AL., SCIENCE, vol. 320, no. 5877, 2008, pages 753 - 5
PICHLA-GOLLON SL ET AL., J. VIROL., vol. 81, no. 4, 2007, pages 1680 - 9
SCHNURR; DONDERO, INTERVIROLOGY., vol. 36, 1993, pages 79 - 83
STRAUS: "Adenovirus infections in humans", THE ADENOVIRUSES, 1984, pages 451 - 498
STRAUS: "The Adenoviruses", 1984, NEW YORK : PLENUS PRESS, pages: 451 - 498
W. C. RUSSEL, J. GEN.VIROL., vol. 81, 2000, pages 2573 - 2604
WU ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 16985 - 16987
ZHOU D ET AL., EXPERT OPIN BIOL THER., vol. 6, no. L, 2006, pages 63 - 72

Cited By (187)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9586998B2 (en) 2009-11-09 2017-03-07 Genvec, Inc. Methods of propagating monkey adenoviral vectors
US9133248B2 (en) 2009-11-09 2015-09-15 Genvec, Inc. Methods of propagating monkey adenoviral vectors
EP2560680A4 (en) * 2010-04-16 2015-03-04 Us Government FILOVIRUS VACCINES ON CHIMPANZEE ADENOVINE VECTOR BASE
US10584355B2 (en) 2010-04-16 2020-03-10 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Chimpanzee adenoviral vector-based filovirus vaccines
WO2011130627A2 (en) 2010-04-16 2011-10-20 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Chimpanzee adenoviral vector-based filovirus vaccines
EP3466440A1 (en) 2010-04-16 2019-04-10 The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Chimpanzee adenoviral vector-based filovirus vaccines
US9526777B2 (en) 2010-04-16 2016-12-27 The United States Of America As Represented By The Department Of Health And Human Services Methods for the induction of ebola virus-specific immune responses comprising administering a replication-defective chimpanzee adenovirus vector expressing the ebola virus glycoprotein
EP3075860A1 (en) * 2010-11-23 2016-10-05 The Trustees of the University of Pennsylvania Subfamily e simian adenovirus a1295 and uses thereof
EP3868397A1 (en) 2010-12-30 2021-08-25 GlaxoSmithKline Biologicals S.A. Expression system
WO2012089833A2 (en) 2010-12-30 2012-07-05 Okairos Ag Expression Systems
WO2012089231A1 (en) 2010-12-30 2012-07-05 Okairòs Ag Paramyxovirus vaccines
WO2013007772A1 (en) 2011-07-12 2013-01-17 Transgene Sa Hbv polymerase mutants
WO2013045658A1 (en) 2011-09-29 2013-04-04 Transgene Sa Immunotherapy composition and regimen for treating hepatitis c virus infection
WO2013045668A2 (en) 2011-09-29 2013-04-04 Transgene Sa Immunotherapy composition and regimen for treating hepatitis c virus infection
US10059962B2 (en) 2011-10-05 2018-08-28 Genvec, Inc. Simian (gorilla) adenovirus or adenoviral vectors and methods of use
US11034975B2 (en) 2011-10-05 2021-06-15 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
US11359214B2 (en) 2011-10-05 2022-06-14 Genvec, Inc. Simian (gorilla) adenovirus or adenoviral vectors and methods of use
US10272162B2 (en) 2011-10-05 2019-04-30 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
US10792376B2 (en) 2011-10-05 2020-10-06 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
US10260074B2 (en) 2011-10-05 2019-04-16 Genvec, Inc. Affenadenovirus (gorilla) or adenoviral vectors and methods of use
EP2764012B1 (en) * 2011-10-05 2022-02-23 GenVec, Inc. Adenoviral vectors and methods of use
US10787682B2 (en) 2011-10-05 2020-09-29 Genvec, Inc. Simian (gorilla) adenovirus or adenoviral vectors and methods of use
WO2013074501A1 (en) 2011-11-14 2013-05-23 Crucell Holland B.V. Heterologous prime-boost immunization using measles virus-based vaccines
US8932607B2 (en) 2012-03-12 2015-01-13 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
WO2013135615A1 (en) 2012-03-12 2013-09-19 Crucell Holland B.V. Batches of recombinant adenovirus with altered terminal ends
WO2013164754A2 (en) 2012-05-04 2013-11-07 Pfizer Inc. Prostate-associated antigens and vaccine-based immunotherapy regimens
EP3563865A2 (en) 2012-05-04 2019-11-06 Pfizer Inc Prostate-associated antigens and vaccine-based immunotherapy regimens
JP2015519058A (ja) * 2012-05-18 2015-07-09 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア 亜科eサルアデノウイルスa1302、a1320、a1331及びa1337ならびにそれらの使用
US10125174B2 (en) 2012-05-29 2018-11-13 Genvec, Inc. Herpes simplex virus vaccine
WO2014005643A1 (en) 2012-07-05 2014-01-09 Okairos Ag Novel prime-boosting regimens involving immunogenic polypeptides encoded by polynucleotides
EP3842068A1 (en) 2012-07-05 2021-06-30 GlaxoSmithKline Biologicals S.A. Novel prime-boosting regimens involving immunogenic polypeptides encoded by polynucleotides
WO2014139587A1 (en) 2013-03-15 2014-09-18 Okairòs Ag Improved poxviral vaccines
WO2014141176A1 (en) 2013-03-15 2014-09-18 Okairos Ag Improved poxviral vaccines
US10899800B2 (en) 2013-04-25 2021-01-26 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F polypeptides
WO2015092710A1 (en) 2013-12-19 2015-06-25 Glaxosmithkline Biologicals, S.A. Contralateral co-administration of vaccines
US11571472B2 (en) 2014-06-13 2023-02-07 Glaxosmithkline Biologicals Sa Immunogenic combinations
EP3888676A1 (en) 2014-06-13 2021-10-06 GlaxoSmithKline Biologicals S.A. Immunogenic combinations
US11173201B2 (en) 2014-09-03 2021-11-16 Bavarian Nordic A/S Methods and compositions for inducing protective immunity against filovirus infection
US11918639B2 (en) 2014-09-03 2024-03-05 Bavarian Nordic A/S Methods and compositions for inducing protective immunity against filovirus infection
US10561721B2 (en) 2014-09-03 2020-02-18 Bavarian Nordic A/S Methods and compositions for inducing protective immunity against filovirus infection
US10561722B2 (en) 2014-09-03 2020-02-18 Bavarian Nordic A/S Methods and compositions for enhancing immune responses
EP3656395A1 (en) 2014-09-03 2020-05-27 Bavarian Nordic A/S Methods and compositions for inducing protective immunity against filovirus infection
WO2017025782A1 (en) 2014-09-17 2017-02-16 Glaxosmithkline Biologicals Sa Improved poxviral vaccines
EP3868398A1 (en) 2014-09-26 2021-08-25 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for inducing protective immunity against human immunodeficiency virus infection
WO2016049287A1 (en) 2014-09-26 2016-03-31 Beth Israel Deaconess Medical Center, Inc. Methods and compositions for inducing protective immunity against human immunodeficiency virus infection
EP4523756A2 (en) 2015-02-13 2025-03-19 Transgene Immunotherapeutic vaccine and antibody combination therapy
WO2016131945A1 (en) 2015-02-20 2016-08-25 Transgene Sa Combination product with autophagy modulator
US10570417B2 (en) 2015-04-14 2020-02-25 Janssen Vaccines & Prevention B.V. Recombinant adenovirus expressing two transgenes with a bidirectional promoter
WO2016166088A1 (en) 2015-04-14 2016-10-20 Janssen Vaccines & Prevention B.V. Recombinant adenovirus expressing two transgenes with a bidirectional promoter
WO2016184822A1 (en) 2015-05-15 2016-11-24 Curevac Ag Prime-boost regimens involving administration of at least one mrna construct
WO2016198599A1 (en) * 2015-06-12 2016-12-15 Glaxosmithkline Biologicals S.A. Adenovirus polynucleotides and polypeptides
BE1024420B1 (fr) * 2015-06-12 2018-02-19 Glaxosmithkline Biologicals Sa Polynucleotides et polypeptides d'adenovirus
WO2016198621A1 (en) * 2015-06-12 2016-12-15 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
IL256121B (en) * 2015-06-12 2022-10-01 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
EA038402B1 (ru) * 2015-06-12 2021-08-23 Глаксосмитклайн Байолоджикалс Са Аденовирусные полинуклеотиды и полипептиды
CN107921118A (zh) * 2015-06-12 2018-04-17 葛兰素史密丝克莱恩生物有限公司 腺病毒多核苷酸和多肽
CN107921118B (zh) * 2015-06-12 2022-11-08 葛兰素史密丝克莱恩生物有限公司 腺病毒多核苷酸和多肽
US11254711B2 (en) 2015-06-12 2022-02-22 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
US11254710B2 (en) 2015-06-12 2022-02-22 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
EA038402B9 (ru) * 2015-06-12 2021-09-22 Глаксосмитклайн Байолоджикалс Са Аденовирусные полинуклеотиды и полипептиды
BE1024824B1 (fr) * 2015-06-12 2018-07-13 Glaxosmithkline Biologicals Sa Polynucleotides et polypeptides d'adenovirus
IL256121B2 (en) * 2015-06-12 2023-02-01 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
US11229694B2 (en) 2015-07-07 2022-01-25 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US11998597B2 (en) 2015-07-07 2024-06-04 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US11034731B2 (en) 2015-07-07 2021-06-15 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F polypeptides
WO2017017049A1 (en) * 2015-07-27 2017-02-02 Glaxosmithkline Biologicals S.A. Novel adenovirus
US11110159B2 (en) 2015-07-27 2021-09-07 Glaxosmithkline Biologicals Sa Methods for inducing an immune response
BE1023916B1 (fr) * 2015-07-27 2018-01-22 Glaxosmithkline Biologicals Sa Nouvel adenovirus
EA039001B1 (ru) * 2015-08-19 2021-11-19 Глаксосмитклайн Байолоджикалс С.А. Аденовирусные полинуклеотиды и полипептиды
EP3584252A1 (en) 2015-12-15 2019-12-25 Janssen Vaccines & Prevention B.V. Human immunodeficiency virus antigens, vectors, compositions, and methods of use thereof
EP3964569A1 (en) 2015-12-15 2022-03-09 Janssen Vaccines & Prevention B.V. Human immunodeficiency virus antigens, vectors, compositions, and methods of use thereof
EP3733201A1 (en) 2016-01-19 2020-11-04 Pfizer Inc Cancer vaccines
WO2017125844A1 (en) 2016-01-19 2017-07-27 Pfizer Inc. Cancer vaccines
US10251944B2 (en) 2016-01-19 2019-04-09 Pfizer Inc. Cancer vaccines
US11058753B2 (en) 2016-01-19 2021-07-13 Pfizer Inc. Cancer vaccines
EP4190906A1 (en) 2016-03-31 2023-06-07 The European Molecular Biology Laboratory Engineered polypeptides derived from adenoviral fibre protein and vlps containing the polypeptides
US12234264B2 (en) 2016-04-05 2025-02-25 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F proteins
US11338031B2 (en) 2016-04-05 2022-05-24 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US11801297B2 (en) 2016-04-05 2023-10-31 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US10729757B2 (en) 2016-04-05 2020-08-04 Janssen Vaccines & Prevention B.V. Vaccine against RSV
US11155583B2 (en) 2016-04-05 2021-10-26 Janssen Vaccines & Prevention B.V. Stabilized soluble pre-fusion RSV F proteins
WO2017191147A1 (en) 2016-05-04 2017-11-09 Transgene Sa Combination therapy with cpg tlr9 ligand
US11473105B2 (en) 2016-05-12 2022-10-18 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
US10953087B2 (en) 2016-05-30 2021-03-23 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion RSV F proteins
US11759514B2 (en) 2016-05-30 2023-09-19 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion RSV F proteins
US11001858B2 (en) 2016-06-20 2021-05-11 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
WO2017220499A1 (en) 2016-06-20 2017-12-28 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
US11781155B2 (en) 2016-06-20 2023-10-10 Janssen Vaccines & Prevention B.V. Potent and balanced bidirectional promoter
US10925955B2 (en) 2016-07-15 2021-02-23 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against a Marburg virus infection
WO2018011768A1 (en) 2016-07-15 2018-01-18 Janssen Vaccines And Prevention B.V. Methods and compositions for inducing protective immunity against a marburg virus infection
WO2018011198A1 (en) 2016-07-15 2018-01-18 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against a marburg virus infection
US10925956B2 (en) 2016-07-15 2021-02-23 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against a marburg virus infection
WO2018037045A1 (en) 2016-08-23 2018-03-01 Glaxosmithkline Biologicals Sa Fusion peptides with antigens linked to short fragments of invariant chain (cd74)
WO2018060288A1 (en) 2016-09-29 2018-04-05 Glaxosmithkline Biologicals S.A. Compositions and methods of treatment of persistent hpv infection
WO2018065931A1 (en) 2016-10-05 2018-04-12 Glaxosmithkline Biologicals Sa Vaccine
WO2018069316A2 (en) 2016-10-10 2018-04-19 Transgene Sa Immunotherapeutic product and mdsc modulator combination therapy
WO2018104911A1 (en) 2016-12-09 2018-06-14 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
WO2018104919A1 (en) 2016-12-09 2018-06-14 Glaxosmithkline Biologicals Sa Chimpanzee adenovirus constructs with lyssavirus antigens
CN110430867A (zh) * 2017-01-25 2019-11-08 葛兰素史密丝克莱恩生物有限公司 新型制剂
CN110430867B (zh) * 2017-01-25 2023-04-07 葛兰素史密丝克莱恩生物有限公司 从水性混合物冷冻干燥的组合物及其制备方法
US11590243B2 (en) 2017-01-25 2023-02-28 Glaxosmithkline Biologicals Sa Formulation
WO2018138667A1 (en) 2017-01-25 2018-08-02 Glaxosmithkline Biologicals Sa Novel formulation
US12054737B2 (en) 2017-02-09 2024-08-06 Janssen Vaccines & Prevention B.V. Potent and short promoter for expression of heterologous genes
US11034978B2 (en) 2017-02-09 2021-06-15 Janssen Vaccines & Prevention B.V. Potent and short promoter for expression of heterologous genes
WO2018146205A1 (en) 2017-02-09 2018-08-16 Janssen Vaccines & Prevention B.V. Potent and short promoter for expression of heterologous genes
WO2018185732A1 (en) 2017-04-06 2018-10-11 Janssen Vaccines & Prevention B.V. Mva-bn and ad26.zebov or ad26.filo prime-boost regimen
US11173204B2 (en) 2017-04-06 2021-11-16 Janssen Vaccines & Prevention B.V. MVA-BN and Ad26.ZEBOV or Ad26.filo prime-boost regimen
US11229692B2 (en) 2017-05-17 2022-01-25 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against RSV infection
WO2018210871A1 (en) 2017-05-17 2018-11-22 Janssen Vaccines & Prevention B.V. Methods and compositions for inducing protective immunity against rsv infection
WO2018229711A1 (en) 2017-06-15 2018-12-20 Janssen Vaccines & Prevention B.V. Poxvirus vectors encoding hiv antigens, and methods of use thereof
WO2019012371A1 (en) 2017-07-11 2019-01-17 Pfizer Inc. IMMUNOGENIC COMPOSITIONS COMPRISING CEA MUC1 AND TERT
WO2019012091A1 (en) 2017-07-12 2019-01-17 Nouscom Ag NEOANTIGEN-BASED VACCINE COMPOSITION FOR THE TREATMENT OF CANCER
WO2019016756A1 (en) 2017-07-21 2019-01-24 Glaxosmithkline Biologicals Sa ANTIGEN CONSTRUCTS OF CHIKUNGUNYA VIRUSES
US11235051B2 (en) 2017-07-28 2022-02-01 Janssen Vaccines & Prevention B.V. Methods and compositions for heterologous repRNA immunizations
WO2019023566A1 (en) 2017-07-28 2019-01-31 Janssen Vaccines & Prevention B.V. METHODS AND COMPOSITIONS FOR PROVIDING IMMUNIZATION AGAINST Heterologous ARNREP
US11964007B2 (en) 2017-07-28 2024-04-23 Janssen Vaccines & Prevention B.V. Methods and compositions for heterologous repRNA immunizations
US11229695B2 (en) 2017-09-15 2022-01-25 Janssen Vaccines & Prevention B.V. Method for the safe induction of immunity against RSV
WO2019076882A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ADENOVIRAL VECTORS COMPRISING TWO EXPRESSION CASSETTES ENCODING RSV ANTIGENIC PROTEINS OR FRAGMENTS THEREOF
WO2019076880A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa SIMIENS ADENOVIRAL VECTORS COMPRISING TWO EXPRESSION CASSETTES
WO2019076877A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ADENOVIRAL VECTORS FOR REPLICATION
US12180512B2 (en) 2017-10-16 2024-12-31 Glaxosmithkline Biologicals Sa Simian adenoviral vectors with two expression cassettes
WO2019076892A1 (en) 2017-10-16 2019-04-25 Glaxosmithkline Biologicals Sa ENHANCED PROMOTER
US11859199B2 (en) 2017-10-16 2024-01-02 Glaxosmithkline Biologicals Sa Adenoviral vectors with two expression cassettes encoding RSV antigenic proteins or fragments thereof
WO2019086450A1 (en) * 2017-10-31 2019-05-09 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
US11459583B2 (en) 2017-10-31 2022-10-04 Janssen Vaccines & Prevention B.V. Adenovirus vectors and uses thereof
US11872281B2 (en) 2017-10-31 2024-01-16 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
US11142551B2 (en) 2017-10-31 2021-10-12 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
US11236361B2 (en) 2017-10-31 2022-02-01 Janssen Vaccines & Prevention B.V. Adenovirus and uses thereof
WO2019086615A1 (en) 2017-11-03 2019-05-09 Nouscom Ag Vaccine t cell enhancer
US10864263B2 (en) 2017-11-20 2020-12-15 Janssen Pharmaceuticals, Inc. Method of providing safe administration of adenoviral vectors encoding a zika virus antigen
WO2019099970A1 (en) 2017-11-20 2019-05-23 Janssen Pharmaceuticals Inc. Method of providing safe administration of adenoviral vectors encoding a zika virus antigen
WO2019115816A1 (en) 2017-12-15 2019-06-20 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
WO2019115817A2 (en) 2017-12-15 2019-06-20 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
WO2019123250A1 (en) 2017-12-19 2019-06-27 Janssen Sciences Ireland Unlimited Company Methods and compositions for inducing an immune response against hepatitis b virus (hbv)
WO2019123169A1 (en) 2017-12-20 2019-06-27 Glaxosmithkline Biologicals Sa Epstein-barr virus antigen constructs
WO2019239311A1 (en) 2018-06-12 2019-12-19 Glaxosmithkline Biologicals Sa Adenovirus polynucleotides and polypeptides
US11702674B2 (en) 2018-06-12 2023-07-18 Glaxosmithkline Biologicals Sa Simian adenovirus vectors comprising the ChAd-157 fiber protein
WO2019238757A1 (en) 2018-06-15 2019-12-19 Glaxosmithkline Biologicals Sa Escherichia coli o157:h7 proteins and uses thereof
EP3581201A1 (en) 2018-06-15 2019-12-18 GlaxoSmithKline Biologicals S.A. Escherichia coli o157:h7 proteins and uses thereof
WO2020003126A1 (en) 2018-06-26 2020-01-02 Glaxosmithkline Biologicals Sa Formulations for simian adenoviral vectors having enhanced stability
EP3587581A1 (en) 2018-06-26 2020-01-01 GlaxoSmithKline Biologicals S.A. Formulations for simian adenoviral vectors having enhanced storage stability
WO2020016394A1 (en) 2018-07-20 2020-01-23 Janssen Vaccines & Prevention B.V. Recombinant adenoviral vector expressing zika antigen with improved productivity
US11713469B2 (en) 2018-07-20 2023-08-01 Janssen Vaccines & Prevention B.V. Recombinant adenoviral vector expressing Zika antigen with improved productivity
WO2020079234A1 (en) 2018-10-19 2020-04-23 Nouscom Ag Teleost invariant chain cancer vaccine
US12331077B2 (en) 2018-11-13 2025-06-17 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion RSV F proteins
WO2020099614A1 (en) 2018-11-15 2020-05-22 Nouscom Ag Selection of cancer mutations for generation of a personalized cancer vaccine
US11793843B2 (en) 2019-01-10 2023-10-24 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2020144615A1 (en) 2019-01-10 2020-07-16 Janssen Biotech, Inc. Prostate neoantigens and their uses
US12582683B2 (en) 2019-01-10 2026-03-24 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2020178359A1 (en) 2019-03-05 2020-09-10 Glaxosmithkline Biologicals Sa Hepatitis b immunisation regimen and compositions
US12098383B2 (en) 2019-05-30 2024-09-24 Gritstone Bio, Inc. Modified adenoviruses
WO2021099906A1 (en) 2019-11-18 2021-05-27 Janssen Biotech, Inc. Vaccines based on mutant calr and jak2 and their uses
US12018289B2 (en) 2019-11-18 2024-06-25 Janssen Biotech, Inc. Vaccines based on mutant CALR and JAK2 and their uses
US11498944B2 (en) 2020-01-31 2022-11-15 Janssen Pharmaceuticals, Inc. Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines
US11384122B2 (en) 2020-01-31 2022-07-12 Janssen Pharmaceuticals, Inc. Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines
WO2021161244A1 (en) 2020-02-14 2021-08-19 Janssen Biotech, Inc. Neoantigens expressed in ovarian cancer and their uses
WO2021161245A1 (en) 2020-02-14 2021-08-19 Janssen Biotech, Inc. Neoantigens expressed in multiple myeloma and their uses
US11945881B2 (en) 2020-02-14 2024-04-02 Janssen Biotech, Inc. Neoantigens expressed in ovarian cancer and their uses
WO2021209897A1 (en) 2020-04-13 2021-10-21 Janssen Biotech, Inc. Psma and steap1 vaccines and their uses
WO2021228842A1 (en) 2020-05-11 2021-11-18 Janssen Pharmaceuticals, Inc. Stabilized coronavirus spike protein fusion proteins
WO2022002894A1 (en) 2020-06-29 2022-01-06 Janssen Vaccines & Prevention B.V. Vaccine combination against respiratory syncytial virus infection
WO2022009049A1 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022009052A2 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022008438A1 (en) 2020-07-06 2022-01-13 Janssen Pharmaceuticals, Inc. Stabilized corona virus spike protein fusion proteins
US12295997B2 (en) 2020-07-06 2025-05-13 Janssen Biotech, Inc. Prostate neoantigens and their uses
WO2022009051A1 (en) 2020-07-06 2022-01-13 Janssen Biotech, Inc. A method for determining responsiveness to prostate cancer treatment
WO2022008613A1 (en) 2020-07-08 2022-01-13 Janssen Sciences Ireland Unlimited Company Rna replicon vaccines against hbv
KR20230038496A (ko) 2020-07-13 2023-03-20 트랜스진 면역 억제의 치료
WO2022013221A1 (en) 2020-07-13 2022-01-20 Transgene Treatment of immune depression
US12275766B2 (en) 2020-12-23 2025-04-15 Janssen Biotech, Inc. Neoantigen peptide mimics
WO2022175477A1 (en) 2021-02-19 2022-08-25 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion rsv fb antigens
WO2022175479A1 (en) 2021-02-19 2022-08-25 Janssen Vaccines & Prevention B.V. Vaccine combinations against respiratory syncytial virus strain a and b infections
WO2022207839A2 (en) 2021-04-01 2022-10-06 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion piv3 f proteins
WO2022218997A1 (en) 2021-04-12 2022-10-20 Centre National De La Recherche Scientifique (Cnrs) Novel universal vaccine presenting system
WO2022268722A1 (en) 2021-06-21 2022-12-29 Nouscom Ag Vaccine composition comprising encoded adjuvant
WO2023020939A1 (en) 2021-08-17 2023-02-23 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023026182A1 (en) 2021-08-24 2023-03-02 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023047348A1 (en) 2021-09-24 2023-03-30 Janssen Pharmaceuticals, Inc. Stabilized corona virus spike protein fusion proteins
WO2023047349A1 (en) 2021-09-24 2023-03-30 Janssen Pharmaceuticals, Inc. Stabilized coronavirus spike protein fusion proteins
WO2023111725A1 (en) 2021-12-14 2023-06-22 Janssen Pharmaceuticals, Inc. Sars-cov-2 vaccines
WO2023110618A1 (en) 2021-12-16 2023-06-22 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion hmpv fusion proteins
WO2023198815A1 (en) 2022-04-14 2023-10-19 Janssen Vaccines & Prevention B.V. Sequential administration of adenoviruses
WO2023213764A1 (en) 2022-05-02 2023-11-09 Transgene Fusion polypeptide comprising an anti-pd-l1 sdab and a member of the tnfsf
WO2024061759A1 (en) 2022-09-23 2024-03-28 Janssen Vaccines & Prevention B.V. Stabilized coronavirus s proteins
WO2024061757A1 (en) 2022-09-23 2024-03-28 Janssen Vaccines & Prevention B.V. Pre-fusion human piv1 f proteins
WO2024074584A1 (en) 2022-10-06 2024-04-11 Janssen Vaccines & Prevention B.V. Stabilized pre-fusion piv3 f proteins
WO2025158316A1 (en) 2024-01-26 2025-07-31 Janssen Biotech, Inc. Ovarian neoantigens and use thereof

Also Published As

Publication number Publication date
KR101763093B1 (ko) 2017-07-28
CY1120652T1 (el) 2019-12-11
AU2015238866A1 (en) 2015-10-29
SG10201900819SA (en) 2019-03-28
IL241494A0 (en) 2015-11-30
RU2604815C2 (ru) 2016-12-10
HUE039908T2 (hu) 2019-02-28
US20180057540A1 (en) 2018-03-01
ES2898235T3 (es) 2022-03-04
KR20110116144A (ko) 2011-10-25
PL2391638T3 (pl) 2018-11-30
KR101761425B1 (ko) 2017-07-26
JP2018078894A (ja) 2018-05-24
JP6262779B2 (ja) 2018-01-17
US9718863B2 (en) 2017-08-01
WO2010086189A3 (en) 2010-09-23
LT2391638T (lt) 2018-10-10
AU2017204292A1 (en) 2017-07-13
JP2012516679A (ja) 2012-07-26
ES2687294T3 (es) 2018-10-24
EP2391638B1 (en) 2018-06-27
CA2749325C (en) 2021-03-30
PT2391638T (pt) 2018-10-19
AU2010209938A1 (en) 2011-08-25
HRP20181377T1 (hr) 2018-10-19
JP2016152801A (ja) 2016-08-25
CN102300872A (zh) 2011-12-28
CA3108979A1 (en) 2010-08-05
US20200102352A1 (en) 2020-04-02
SG2014007959A (en) 2014-03-28
EP3385387B1 (en) 2021-08-25
US11214599B2 (en) 2022-01-04
IL214097B (en) 2018-08-30
KR20160110525A (ko) 2016-09-21
SG172935A1 (en) 2011-08-29
RU2011136282A (ru) 2013-03-10
IL214097A0 (en) 2011-08-31
EP3385387A1 (en) 2018-10-10
JP5882741B2 (ja) 2016-03-09
MX2011007980A (es) 2011-08-17
DK2391638T3 (en) 2018-08-27
EP2391638A2 (en) 2011-12-07
US20120027788A1 (en) 2012-02-02
CA2749325A1 (en) 2010-08-05
NZ594355A (en) 2012-11-30
AU2017204292B2 (en) 2019-02-07
CN105112428B (zh) 2021-04-20
US10544192B2 (en) 2020-01-28
CN105112428A (zh) 2015-12-02
BRPI1008018A2 (pt) 2016-03-15
NZ603348A (en) 2014-05-30
SI2391638T1 (sl) 2018-10-30
AU2015238866B2 (en) 2017-05-25

Similar Documents

Publication Publication Date Title
US11214599B2 (en) Recombinant simian adenoviral vectors encoding a heterologous fiber protein and uses thereof
WO2010085984A1 (en) Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
US11098324B2 (en) Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
US20240002879A1 (en) Gorilla adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
HK40031047B (en) Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
HK40031047A (en) Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
NZ759892B2 (en) Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080006197.X

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10702615

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2749325

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 5603/DELNP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20117017573

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/007980

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2011546719

Country of ref document: JP

Ref document number: 594355

Country of ref document: NZ

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2010209938

Country of ref document: AU

Date of ref document: 20100202

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010702615

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011136282

Country of ref document: RU

WWE Wipo information: entry into national phase

Ref document number: 13147193

Country of ref document: US

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: PI1008018

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 241494

Country of ref document: IL

ENP Entry into the national phase

Ref document number: PI1008018

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110802