WO2008142167A2 - Polynucleotide markers - Google Patents

Polynucleotide markers Download PDF

Info

Publication number
WO2008142167A2
WO2008142167A2 PCT/EP2008/056390 EP2008056390W WO2008142167A2 WO 2008142167 A2 WO2008142167 A2 WO 2008142167A2 EP 2008056390 W EP2008056390 W EP 2008056390W WO 2008142167 A2 WO2008142167 A2 WO 2008142167A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polynucleotide
nucleotide sequence
sequence
fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2008/056390
Other languages
English (en)
French (fr)
Other versions
WO2008142167A3 (en
Inventor
Johannes Jacobus Ludgerus Gielen
Thomas Kraft
Pierre Pin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Syngenta Participations AG
Original Assignee
Syngenta Participations AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN200880100228.0A priority Critical patent/CN101772575B/zh
Priority to UAA200913022A priority patent/UA100855C2/ru
Priority to DK08759990.8T priority patent/DK2152885T3/da
Priority to JP2010508869A priority patent/JP2010527598A/ja
Priority to BRPI0812387-0A2A priority patent/BRPI0812387A2/pt
Priority to US12/601,386 priority patent/US20100209919A1/en
Application filed by Syngenta Participations AG filed Critical Syngenta Participations AG
Priority to CA2687760A priority patent/CA2687760C/en
Priority to EP08759990.8A priority patent/EP2152885B1/en
Priority to PL08759990T priority patent/PL2152885T3/pl
Priority to EA200901525A priority patent/EA022877B1/ru
Publication of WO2008142167A2 publication Critical patent/WO2008142167A2/en
Publication of WO2008142167A3 publication Critical patent/WO2008142167A3/en
Priority to EP09749936.2A priority patent/EP2291525B1/en
Priority to EA201001767A priority patent/EA028355B1/ru
Priority to DK09749936.2T priority patent/DK2291525T3/en
Priority to PCT/EP2009/056262 priority patent/WO2009141446A1/en
Priority to JP2011510002A priority patent/JP2011520461A/ja
Priority to PL09749936T priority patent/PL2291525T3/pl
Priority to CA2724419A priority patent/CA2724419C/en
Priority to UAA201015429A priority patent/UA105489C2/uk
Priority to CN200980121061.0A priority patent/CN102057045B/zh
Priority to US12/994,452 priority patent/US8796506B2/en
Priority to MA32367A priority patent/MA31495B1/fr
Anticipated expiration legal-status Critical
Priority to ZA2010/07986A priority patent/ZA201007986B/en
Priority to MA33397A priority patent/MA32381B1/fr
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

Definitions

  • the present invention is in the area of marker-assisted breeding and quality control of sugar beet seed.
  • the invention relates to polynucleotides that are closely linked to or residing within the bolting gene or S gene within the sugar beet genome and can be used for the development of molecular markers.
  • the invention further relates to molecular markers and kits comprising said markers that can be used for mapping, identification and isolation of the bolting gene or S gene in the sugar beet genome and to discriminate between the annual and biennial genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype.
  • the invention further relates to transgenic approaches, wherein transgenic plants are provided with the B gene either being overexpressed or downreguiated.
  • the cultivated sugar beet (Beta vulgaris ssp. vulgaris L) is a biennial plant which forms a storage root and a leaf rosette in the first year. Shoot elongation (bolting) and flower formation starts after a period of low temperature. In contrast, many wild beets of the genus S. vulgaris ssp. maritima show an annual growing habit due to the presence of the bolting gene B at the S locus, which was mapped to the central region of chromosome II. The dominant allele of locus S. is abundant in wild beets and causes bolting under long days without the cold requirement usually essential for biennial cuittvars (Abe ⁇ t al., 1997 ⁇ carrying the recessive allele. Bolting (stem elongation) is the first step clearly visible in the transition from vegetative to reproductive growth.
  • a marker-based approach could also be advantageously used in sugar beet breeding, e.g., to speed up the breeding process, or to introduce new variation from wild sea beets. In these cases, it is important to have a marker tightly linked to the S gene to be able to select annuals or biennials accurately.
  • the present invention now provides the means to develop such markers.
  • the present invention relates to a polynucleotide, particularly an isolated polynucleotide, identified in the sugar beet genome including variants and derivatives thereof, which polynucleotide is genetically closely linked to, or, preferably, located within the bolting gene or B gene.
  • the invention further relates to the use of said polynucleotide for the development of markers that can be used for mapping, identification and isolation of the bolting gene or B gene in the sugar beet genome.
  • the polynucleotide according to the invention shows perfect co-segregation with the bolting gene (B gene) associated phenotype in sugar beet.
  • the invention in one embodiment, relates to a polynucleotide including informative fragments thereof according to the invention and as described herein before, which polynucleotide is obtainable from a genomic DNA region that maps at a distance of 1 cM upstream of markers IV1P0176 and GJ01 and co-segregates with marker GJ131, shows perfect co-segregation with the bolting gene (B gene) associated phenotype in sugar beet.
  • the invention relates to a polynucleotide including informative fragments thereof, particularly an isolated polynucleotide, according to the invention and as described herein before which is obtainable from a genomic DNA located in the interval delimited by markers GJ 131 and GJ01.
  • a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide which polynucleotide is obtainable from a genomic sugar beet DNA geneticaliy linked to the bolting gene or S gene in the sugar beet genome and comprises one or more of the following elements: a) an intronic region that yields an amplification product of approximately 0.5 kb in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-H as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template, particularly a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 2, 3 or 4, or a sequence that has at least 70%,
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising an intronic region that yields an amplification product of approximateiy 0.5 kb in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-R as given in SEQ iD NO; 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 1 , or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment exhibiting a nucleotide sequence as depicted in SEQ ID NO: 2, 3 or 4, or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85% , but especially at least 90% and up to at least 95%-99% sequence identity therein.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, which, after splicing, encodes a polypeptide which has at least 80%, particularly at least 85%, more particularly at least 90%, even more particularly at least 95%, but especially at least 98% and up to 100% sequence identity with a nucleotide sequence shown in SEQ ID NO: 6 in one embodiment, the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 5 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 86%, but especially at least 90% and up to at feast 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 5.
  • the invention in one embodiment, relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 51 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 51.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment comprising a nucleotide sequence as depicted in SEQ ID NO: 52 or a sequence which has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at feast 85%, but especially at least 90% and up to at least 95%-99% sequence identity with a nucleotide sequence as depicted in SEQ ID NO: 52.
  • the invention relates to a poiynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a poiynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 1 , particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 2, 3 or 4 particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO; 5, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ iD NO: 51 , particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence which encodes a polypeptide having an amino acid sequence as depicted in SEQ SD NO; 6, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • the invention relates to a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, comprising a polynucleotide fragment wherein the complementary strand of said polynucleotide fragment is capable of hybridizing with a nucleotide sequence depicted in SEQ ID NO: 52, particularly under moderate hybridization conditions, more particularly under stringent hybridization conditions.
  • a polynucleotide including an informative fragment thereof, particularly an isolated polynucleotide, which polynucleotide is obtainable from a genomic sugar beet DNA geneticaiiy linked to the bolting gene or S gene in the sugar beet genome a) by screening a BAC library developed from the biennial commercial cultivar H20 using forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, or a primer pair having at least 90%, particularly at least 95%, more particularly at least 98% and up to 99% sequence identity with a sequence as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, in a PCR reaction, particularly under the following conditions:
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 1.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ SD NO: 2. in a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 3. In a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 4. in a specific embodiment, the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 51.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 52.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ iD NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, an A at position 11299, an A at position 11391 , a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 1.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a T at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, an A at position 11238, an T at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, a G at position 12193, a G at position 12337, and a G at position 12837, representing annuai allele 2.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ iD NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a G at position 11043, a T at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391 , a G at position 12053, a G at position 12086, a T at position 12127, a G at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 3.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a T at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391, a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, a G at position 12337, and a G at position 12837, representing annual allele 4.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391 , a G at position 12053, an A at position 12086, a T at position 12127, an A at position 12193, an A at position 12337, and a G at position 12837, representing annual allele 5.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID NO: 5, wherein said sequence has a G at position 3695, a C at position 3827, a T at position 3954, a T at position 5284, a G at position 5714, a G at position 10954, a T at position 11043, a C at position 11143, a C at position 11150, an A at position 11220, a C at position 11238, a T at position 11299, an A at position 11391 , a G at position 12053, a G at position 12086, a T at position 12127, an A at position 12193, an A at position 12337, and a G at position 12837, representing annual allele 6.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence depicted in SEQ ID IMO: 5, wherein said sequence has a G at position 3695, an A at position 3827, an A at position 3954, a C at position 5284, a T at position 5714, an A at position 10954, a G at position 11043, a C at position 11143, a C at position 11150, a C at position 1122O 1 a C at position 11238, a T at position 11299, a G at position 11391 , an A at position 12053, a G at position 12086, a C at position 12127, a G at position 12193, a G at position 12337, and an A at position 12837, representing biennial allele 7.
  • the polynucleotide according to the invention comprises a nucleotide sequence that has the nucleotide sequence which encodes a polypeptide having an amino acid sequence as depicted in SEQ !D NO: 6.
  • the invention relates to an amplification product of approximately 0.5 kb including an informative fragment, which is obtainable in a PCR reaction with forward primer PRR7-F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, when using genomic sugar beet DNA as a template.
  • a set of polynucleotide markers comprising a plurality of individual markers which markers are developed based on a polynucleotide as depicted in SEQ !D NO: 5 including any of its allelic variants 1 to 7 as disclosed herein before and are capable of detecting the various SNPs at the nucleotide positions given in Table 5, wherein said set of markers is capable of identifying the different alleles and thus of differentiating between annual and biennial sugar beet lines.
  • the invention relates to one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially one or a plurality of primer pairs consisting of a forward primer and a reverse primer, which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, but particularly to a region within the S gene, and which comprises a polynucleotide according to the invention and as described herein before including an informative fragment thereof, wherein said fragment comprises a polymorphism, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and bienniaf genotype or between different haplotypes within plant group
  • a polynucleotide marker which can be developed from a polynucleotide molecuie or an informative fragment thereof selected from the group of polynucleotides as depicted in SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 , SEQ ID NO: 51 , SEQ ID NO: 52 and a polynucleotide encoding a polypeptide comprising a amino acid sequence as depicted in SEQ ID NO: 6, wherein said polynucleotide comprises one or more polymorphisms, particuiarfy a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the B allele at the B locus and allows to discriminate between the annual and biennial genotype or between different ha
  • a polynucleotide marker is provided which is developed based on a polynucleotide as depicted in SEQ ID NO: 2, which marker is capable of detecting at least one of the folfow ⁇ ng SNPs in the 3 rd intron of the BvPRR ⁇ gene: a) a cytoslne or a thymine at position 87 b) a cytosi ⁇ e or thymine at position 160 c) an adenine or a guanine at position 406 and thus of differentiating between annual and biennial haplotypes.
  • said polynucleotide marker is represented by one or a plurality of probe mofecuies and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene and exhibits the nucleotide sequences as shown in SEQ ID NO:2 and of amplifying an informative fragment thereof, wherein said fragment comprises one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP as shown, for example, in Table 1 , which polymorphism is diagnostic for the S a ⁇ e ⁇ e at the B locus and allows to discriminate between plants having an annual and a
  • a pair of primers is provided according to the invention and as described herein before, which anneals to a nucleotide sequence within the 3 rd intron as depicted in SEQ ID NO: 2 and amplifies an informative fragment from said region comprising a polymorphism, particularly a polymorphism comprising a CfT SNP at position #87 and/or a C/T SNP at position #160 and/or an A/G SNP at position #406.
  • a pair of primers comprises a forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8 for amplifying a fragment comprising the SNP #160, SNP #87 and SNP #406.
  • the polynucleotide marker according to the invention is represented by one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, particularly to a nucleotide sequence within the B gene, particularly to a nucleotide sequence as shown in SEQ ID NO: 5 and of amplifying an informative fragment thereof, wherein said fragment comprises one or more polymorphisms, particularly a polymorphism that is based on an SNP 1 an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP as shown, for example, in Table 5, which poiymo ⁇ hism is diagnostic for the S allele at the B locus
  • a pair of primers is provided according to the invention and as described herein before, which anneals to a nucleotide sequence within the coding region of the BvPRR7 gene as depicted in SEQ ID NO: 5 and amplifies an informative fragment from said coding sequence comprising a polymorphism, particularly a polymorphism comprising an A/C SNP at position #3827 and/or an A/T SNP at position #3954 and/or a TYG SNP at position #5714 and/or a C/A SNP at position #11220, and/or a G/A SNP at position #11391, and/or an A/G SNP at position #12053, and/or a C/T SNP at position #12127.
  • a polymorphism particularly a polymorphism comprising an A/C SNP at position #3827 and/or an A/T SNP at position #3954 and/or a TYG SNP at position #5714 and/or a C/A SNP
  • a first pair of primers comprises a forward primer F3806 as depicted in SEQ ID NO 27 and a reverse primer R3807 as depicted in SEQ ID NO 28 for amplifying a fragment comprising the SNP #3827 and SNP #3954.
  • a second pair of primers comprises a forward primer F3768 as depicted in SEQ ID NO 21 and a reverse primer R3769 as depicted in SEQ ID NO 22 for amplifying a fragment comprising the SNP #5714.
  • a third pair of primers comprises a forward primer F3857 as depicted in SEQ ID NO 37 and a reverse primer R3858 as depicted in SEQ ID NO 38 for amplifying a fragment comprising the SNP #11220.
  • a fourth pair of primers comprises a forward primer F3859 as depicted in SEQ ID NO 39 and a reverse primer R3860 as depicted in SEQ ID NO 40 for amplifying a fragment comprising the SNP #11391.
  • a fifth pair of primers comprises a forward primer F3861 as depicted in SEQ ID NO 41 and a reverse primer R3862 as depicted in SEQ ID NO 42 for amplifying a fragment comprising the SNP #12053 and SNP #12127.
  • the polynucleotide marker according to the invention is represented by one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the B gene, particularly to a nucleotide sequence within the ⁇ gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene as shown in SEQ ID NO; 5 and SEQ ID NO: 51 , respectively, and of amplifying an informative fragment thereof, which is diagnostic for the S allele at the S locus and allows to discriminate between plants having an annual and a biennial genotype or between different hapiotypes within a plant grouping of sugar beet
  • a polynucleotide marker is provided which is represented by a primer pair selected from the group of primer pair F3808 (SEQ ID NO 29 ⁇ and R3809 (SEQ ID NO 30) yielding an amplification product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Tabie 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as tempiate, but does not provide amplification for the annuai lines.
  • Said informative fragment may further comprise one or more polymorphisms, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP 1 which is diagnostic for the B allele at the B locus and allows to discriminate between plants having an annual and a bienniai genotype or between different hapiotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.
  • the invention further relates to one or a plurality of probe molecules and/or to one or a plurality of primers, particularly one or a plurality of primer pairs, but especially a pair of primers consisting of a forward primer and a reverse primer which primers are capable of annealing to a nucleotide sequence within a genomic region of the sugar beet genome that is genetically closely linked to the S gene, particularly to a nucleotide sequence within the B gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene, particularly to a nucleotide sequence within the promoter region of the PRR7 gene as shown in SEQ ID NO: 5 and SEQ ID NO: 51 , respectively, and of amplifying an informative fragment thereof, which is diagnostic for the B allele at the S locus and allows to discriminate between plants having an annual and a biennial genotype or between different haplotypes within a plant grouping of sugar beet plants exhibiting a biennial or annual genotype.
  • a primer pair is provided selected from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification product of 0,8 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as template, but does not provide amplification for the annual lines.
  • the above probe molecules and/or primers can be used in a method of identifying annual contaminations in commerciai sugar beet seed.
  • the invention relates to a set of probe polynucleotides comprising at least two separate probe moiecules that are complementary to a sub- region within an informative polynucleotide fragment according to the invention and as described herein before comprising a polymorphic site and amplify partially overlapping fragments which differ only by one or two base mismatches in the area of overlap, wherein a first probe, particuiariy a probe labelled with a first fluorescent dye, more particularly with a first fluorescent dye and a quencher represents one alleie and a second probe, particuiariy a probe labelled with a second fluorescent dye, which is not identical with the first dye, more particularly with a second fluorescent dye and a quencher represents the other allele.
  • said informative polynucleotide fragment comprises a polymorphism, wherein said polymorphism is based on SNP #3827, within the Pseudo-receiver domain of the PRR7 gene depicted in SEQ ID NO; 5 and the first probe molecuie labelled with a first fluorescent dye, has a nucleotide sequence as shown in SEQ ID NO: 47 and the second probe molecule labelled with a second fluorescent dye, has a nucleotide sequence as shown in SEQ ID NO: 48.
  • the invention relates to the use of a polynucleotide according to the invention and as described herein before, or any informative fragment thereof, for developing a marker that may be used in an allelic discrimination assay for detecting a polymorphism in the sugar beet genome, which polymorphism is diagnostic for the S allele at the S locus and allows to discriminate between the annual and biennia! genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype or for mapping the S gene to the sugar beet genome.
  • the invention relates to the use of one or a plurality of primers, particularly one or a plurality of primer pairs, according to the invention and as described herein before in an allelic discrimination assay for detecting a polymorphism in the sugar beef genome, particularly a polymorphism that is based on an SNP, an SSR, a deletion or an insertion of at least one nucleotide, but especially a polymorphism based on an SNP, which polymorphism is diagnostic for the S allele at the B locus and allows to discriminate between the annual and biennia! genotype or between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype.
  • a set of probe molecules according to the invention and as described herein before may in addition be employed in said allelic discrimination assay.
  • the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) anafyz ⁇ ng the nucleotide sequence of the genomic region of the sugar beet genome that is genetically closely linked to the S gene and complementary to or comprises the sequence of a polynucleotide according to the invention and as described herein before, and c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively,
  • the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) amplifying a fragment from said sample DNA using a primer, particularly a primer pair, that is complementary and binds to a nucleotide sequence present in the promoter region of the BvPRR7 gene, particularly the BvPRR? as disclosed in SEQ ID NO: 51 , and c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype but not with the annual phenotype.
  • the invention relates to a method of identifying the absence or presence of an allele associated with annuality in a sugar beet plant, comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) probing said sample DNA with a probe molecule comprising an aliele-specific sequence, particularly an allele-specific sequence form the promoter region of the BvPRRI gene, particularly the BvPRR7 as disclosed in SEQ ID NO: 51 , known to be present in the biennial allele but not in the annual allele.
  • a primer pair is used in said method selected from the group of primer pair F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) yielding an amplification product of 0.6 Kb; primer pair F3855 (SEQ ID NO 35) and R3809 (SEQ ID NO 30) yielding an amplification product of 1.0 Kb; and primer pair F3855 (SEQ ID NO 35) and R3856 (SEQ ID NO 36) (Table 4) yielding an amplifications product of 0.8, provided that a genomic DNA from biennial lines is used as template, but does not provide amplification for the annual lines.
  • the invention relates to a method of identifying a specific haplotype within a plant grouping of sugar beet plants exhibiting a biennial genotype comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) analyzing the nucleotide sequence of the genomic region of the sugar beet genome that is genetically closely linked to the S gene and complementary to or comprises the sequence of a polynucleotide according to the invention and as described herein before, and c) comparing said sequence with an allelic sequence known to be associated with a specific haplotype.
  • sequence analysis is carried out using a molecular marker based on a polynucleotide or an informative fragment thereof or on one or a plurality of primers, particularly on one or a plurality of primer pairs, but especially on one or a plurality of primer pairs consisting of a forward primer and a reverse primer according to the invention and as described herein before.
  • a method of identifying the absence or presence of an alieSe associated with annuality in a sugar beet plant comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) analyzing the nucleotide sequence of an intronic region obtainable from the sugar beet genome by PCR amplification based on forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8, and c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively.
  • the intronic region has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with the nucleotide sequence depicted in SEQ ID NO: 2.
  • the intronic region has a nucleotide sequence as shown in SEQ ID NO: 2,
  • a method of identifying the absence or presence of an allele associated with annuaiity in a sugar beet plant comprising a) obtaining a genomic sample from a sugar beet plant to be analyzed, b) analyzing the nucleotide sequence of a genomic region comprising a nucleotide sequence as given in SEQ ID NO: 5, and c) comparing said sequence with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively; and d) determining whether said genomic sample is from a genome representing an annual or a biennial phenotype.
  • a method wherein within a genomic sample from a sugar beet plant the intronic region of a polynucleotide according to the invention and as described herein before is analyzed using a forward and a reverse primer flanking a sub-region within said intronic region known to comprise a polymorphic site, amplifying said sub-region and comparing the amplified fragment with an allelic sequence known to be associated with the biennial phenotype and the annual phenotype, respectively.
  • a method is provided as described herein before, wherein a set of probe polynucleotides is designed based on said SNP comprising two separate probe moiecules which differ by at least one mismatch, particularly by two or more mismatches located at adjacent sites, but especially by one single mismatch, wherein a first probe molecule, particularly a labelled probe molecule, more particularly a probe molecule labelled with a first fluorescent dye and a quencher, represents one allele and a second probe molecule, particularly a labelled probe molecule, more particularly a probe molecule labelled with a second fluorescent dye and a quencher, which is not identical with the first dye, represents the other allele, and wherein said set of probe polynucleotides is used for discriminating between the two allelic variants.
  • the markers according to the present invention can be used in an allelic discrimination assay, particularly in an assay for discriminating between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype.
  • Said assay is based on a set of probe polynucleotides comprising two separate probe molecules that are complementary, for example, to a subregion of the BvPRR7 gene obtainable by PCR amplification based on forward primer PRR7- F and reverse primer PRR7-R as given in SEQ ID NO: 7 and SEQ ID NQ: 8, respectively, which probe molecules differ only by one base mismatch, particularly a base mismatch at position #631.
  • a first probe molecule particularly a probe molecule which has a sequence as depicted in SEQ ID NO: 9 and is labelled with a first fluorescent dye such as, for exampte, FAM, more particularly with a first fluorescent dye and a quencher, represents one allele
  • a second probe molecule particularly a probe molecule which has a sequence as depicted in SEQ ID NO: 10 and is labelled with a second fluorescent dye, which is not identical with the first dye, such as, for example VIC, more particularly with a second fluorescent dye and a quencher, represents the other allele.
  • an allelic discrimination assay for detecting a polymorphism in a genomic region of the sugar beet genome co-segregating with the annuality phenotype, particuiariy a polymorphism that is based on an SNP, an SSR 1 a deletion or an insertion of at least one nucleotide, but especiaily a polymorphism based on an SNP, which polymorphism is diagnostic for the S allele at the S locus and allows to discriminate between the annuai and bienniaf genotype, comprising a molecular marker developed based on a polynucleotide according to the invention and as described herein before or any informative fragment thereof.
  • said molecular marker comprises a pair of primers according to the invention and as described herein before.
  • an allelic discrimination assay for detecting a single-base polymorphism in an intronic region obtainable from the sugar beet genome by PCR amplification based on forward primer PRR7-F as depicted in SEQ ID NO: 7 and a reverse primer PRR7-R as depicted in SEQ ID NO: 8, comprising a set of primers and/or probe polynucleotides according to the invention and as described herein before.
  • the intronic region has at least 70%, particularly at least 75%, more particuiariy at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity with the nucleotide sequence depicted in SEQ ID NO: 2.
  • the intronic region has a nucleotide sequence as shown in SEQ ID NO: 2.
  • the invention relates to the use of a polynucleotide according to the invention and as described herein before for the development of a molecular marker to be used for identifying the absence or presence of an allele associated with annuality in a sugar beet genome, comprising a) identifying in said polynucleotide polymorphic sites b) associating said polymorphisms with the absence or presence of an allele associated with annuaiity in sugar beet by c) designing a probe molecule or a plurality of probe molecules, particularly a primer or a plurality of primers, particularly a pair of primers or a plurality of primer pairs, but especially a forward and reverse primer recognizing a nucleotide sequence flanking this polymorphic site for amplification of a polynucleotide comprising said polymorphic site that can be used in an allelic discrimination assay.
  • the invention relates to a method of identifying annual contaminations in commercial seed using a polynucleotide according to the invention and as described herein before or an informative fragment thereof as a marker for determining the presence or absence of the annuality allele in a plant sample.
  • the invention relates to a method of identifying annual contaminations in commercial seed using a polynucleotide according to the invention and as described herein before or an informative fragment thereof as a marker for identifying annual contaminations in commercial seed.
  • the invention relates to a method of identifying annual contaminations in commercial seed using a marker-based allelic discrimination assay according to the invention and as described herein before.
  • the Invention further relates to the use of the 8 gene, particularly the BvPRR7 gene, in a transgenic approach for producing plants exhibiting an annual or an non-bolting phenotype.
  • the invention relates to chimeric constructs comprising an expression cassette comprising the coding sequence of the S gene, particularly the BvPRR? coding sequence as depicted in SEQ ID NO:1 , but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95% ⁇ 99% sequence identity therein under the control of regulatory eiements, particularly under the control of regulatory elements functional in plants.
  • the invention provides chimeric constructs comprising an expression cassette comprising the coding sequence of the B gene, particularly the BvPRR? coding sequence as depicted in SEQ ID NO:1, but particularly in SEQ SD N Q : 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein under the control of annual promoter and terminator sequences such as those provided in the PRR7 gene, particularly the PRR7 gene of Beta vulgaris.
  • the chimeric construct as described hereinbefore may further contain a selection marker gene which allows discriminating between transformed and non-transformed plant material in a selection procedure.
  • the chimeric construct of the invention comprises a negative selection marker, particularly a selection marker encoding a resistance to plant toxic compounds such as antibiotics or herbicides.
  • the chimeric construct of the invention comprises a positive selection marker, particularly a selection marker encoding an enzyme that provides the transformed plant with a selective advantage over the non-transformed plants, particularly a nutritional advantage such as, for example, a phosphomannose isomerase gene, a xylose isomerase gene.
  • a transformation vector and/or an expression vector is provided, particularly a plant transformation vector and/or an expression vector, comprising the chimeric construct of the invention as described herein before.
  • a plant cell is provided, particularly a plant cell of a sugar beet plant, comprising a chimeric polynucleotide construct or a vector molecule according to the invention and as described herein before.
  • a plant is provided, particularly a sugar beet plant comprising a plant cell of the invention and expressing the S gene protein, particularly the BvPRR7 protein such that the plant exhibits an annual phenofype.
  • a polynucleotide construct for transgenic suppression of BvPRR7 gene expression, particularly through an antisense or an RNAi approach.
  • a polynucleotide construct is provided comprising a nucleotide sequence encoding a dsRNA which is capable of targetting mRNAs produced by transcription of the DNA sequence encoding the B gene protein, particularly the BvPRR? protein, for degradation.
  • a polynucleotide construct comprising a nucleotide sequence encoding a dsRNA which is substantially identical with at least a region of the coding sequence of the B gene, particularly the coding region of the BvPRR7 gene as depicted in SEQ ID NO:1 , but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at least 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%- 99% sequence identity therein.
  • a polynucleotide construct comprising a fragment of the coding region of the S gene, particularly a fragment of the coding region of the BvPRR? gene as depicted in SEQ ID NO:1 , but particularly in SEQ ID NO: 52 or a sequence that has at least 70%, particularly at least 75%, more particularly at ieast 80%, even more particularly at least 85%, but especially at least 90% and up to at least 95%-99% sequence identity therein, assembled into an RNAi cassette under the control of the constitutive promoter such as, for example, the Ubi3 promoter from Arabidopsis.
  • a transformation vector and/or an RNAi expression vector is provided, particularly a plant transformation vector and/or an expression vector, comprising the polynucleotide construct of the invention as described herein before.
  • a plant cell comprising a polynucleotide construct or a vector molecule according to the invention and as described herein before.
  • a plant is provided, particularly a sugar beet plant, comprising a plant cell of the invention and expressing the dsRNA such that bolting is suppressed and the plant exhibits a non-bolting phenotype.
  • Figure 1 shows an amino acid sequence comparison of the REC domains between different species and the putative REC domain of sugar beet EST CV301305.
  • identical amino acids are in black; conserved in grey; weakly similar in light grey and non-similar in white.
  • Bb Bordeteila bronchiseptica
  • Bs Baci ⁇ fus subtilis
  • Bv Beta vulgaris
  • Ec Escherichia cofi
  • Kp Klebsiella pneumoniae
  • Pa Pseudomonas aeruginosa
  • Rc Rhodobacter capsulatus: Sc 1 Streptomyces coelicolor
  • Sf Shigella fiexneri
  • St Safmoneila typhimurium.
  • Figure 2 Amino acid sequence comparison of the Arabidopsis PRR7 protein and the predicted partial protein from sugar beet EST CV301305. Identical amino acids are in black; similar in grey and non-similar in white.
  • Figure 3 Sequence alignment between the genomic and mRNA sequences of the Arabidopsis PRR7 gene and sugar beet EST CV301305. conserveed nucleotides between Arabidopsi ⁇ and Beta vulgaris L are in grey. I ⁇ trons are represented by strings of dashes.
  • Figure 4 Genetic map of sugar beet chromosome II. Marker names are given at the right of the chromosome, at the left the cumulative genetic distance is indicated.
  • Figure 5 Schematic representation of the gene structure of the BvPRRY gene showing putative exons and introns. The region covered by EST CV301305 is shown by the biock arrow.
  • Figure 6 Amino acid sequence comparison of the Arabidopsis PRR gene family members and the BvPRR7 protein. Identical amino acids are in black; conserved in grey; weakly similar in fight grey and non-simiiar in white. The REC and CCT motifs are boxed.
  • Figure 7 Phylogenefic relationship between BvPRR7 and related proteins from other flowering plants.
  • the predicted amino acid sequence of BvPRR? was aligned to the proteins listed below using ClustalW and an unrooted phylogenetic tree was constructed.
  • the evolutionary history was inferred using the Neighbor- Joining method (Saitou and Nei, 1987).
  • the bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches.
  • the tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.
  • the evolutionary distances were computed using the Poisson correction method (Zuckerkandl and Pauling, 1965) and are in the units of the number of amino acid substitutions per site. AJl positions containing gaps and missing data were eliminated from the datas ⁇ t (Complete deletion option). There were a total of 352 positions in the final dataset.
  • Phylogenetic analyses were conducted in MEGA4 software (Tamura ⁇ t a/., 2007).
  • Figure 8 Gene expression profile of BvPRR? in biennial sugar beet pfant grown in long days (16 h light, 8 h dark) and at constant temperature 18°C. Values are expressed as relative expression levels normalized against the BvBTU and BvICDH reference genes by geometric averaging analysis (Vandesompele et al., 2002).
  • Figure 9 Plasmid map of the binary vector for the transformation of the BvPRR? cDNA under the control of the annual BvPRR? promoter fragment.
  • the selectable marker consists of the PMI gene under the control of the HSP80 promoter (Brunke and Wilson, 1993).
  • FIG. 10 Plasmid map of the binary vector for the transgenic suppression of BvPRR ⁇ by means of RNAi.
  • the inverted repeat for BvPRR7 consists of a 0.6 Kb cDNA fragment that was cloned between the Ubi3 promoter (Norn ' s et a/, 1993) and Nos terminator in both the antisense and sense orientation, separated by the second intron of the StLSI gene from potato (Eckes et a!, 1986; Vancanneyt ⁇ t a/, 1990).
  • the selectable marker consists of the PMi gene under the control of the HSP80 promoter (Brunke and Wilson, 1993).
  • SEQ ID NO: 1 depicts the nucleotide sequence of EST CV301305
  • SEQ ID NQ: 2 depicts the nucleotide sequence of lntron 3 of BvPRR? and its allelic variability for mapping
  • SEQ ID NO: 3 depicts the nucleotide sequence of lntron 3 of allelic variant 1 of
  • SEQ ID NO: 5 depicts the genomic nucleotide sequence of BvPRR?
  • SEQ ID NQ: 6 depicts the putative amino acid sequence of BvPRR?
  • D NO: 7 depicts the nucleotide sequence of primer PRR? ⁇ F
  • SEQ ID NO: 8 depicts the nucleotide sequence of primer PRR7-R
  • SEQ ID NO: 9 depicts the nucleotide sequence of probe PR/?7(T1 )-FAM
  • SEQ ID NO: 10 depicts the nucleotide sequence of probe PRR7 ⁇ Ti ) ⁇ /IC
  • SEQ ID NO: 11 depicts the nucleotide sequence of forward primer BvPRR7
  • SEQ ID NO: 12 depicts the nucleotide sequence of reverse primer BvPRR?
  • SEQ ID NO: 13 depicts the nucleotide sequence of forward primer BvBTU SEQ ID NO: 14 depicts the nucleotide sequence of reverse primer BvBTU SEQ ID NO: 15 depicts the nucleotide sequence of forward primer BvICDH SEQ ID NO: 16 depicts the nucleotide sequence of reverse primer BvICDH SEQ ID NO: 17 depicts the nucleotide sequence of primer F3766 SEQ ID NO: 18 depicts the nucleotide sequence of primer R3767 SEQ ID NO: 19 depicts the nucleotide sequence of primer F3354 SEQ iD NO: 20 depicts the nucleotide sequence of primer R3355 SEQ ID NO: 21 depicts the nucleotide sequence of primer F3768 SEQ iD NO: 22 depicts the nucleotide sequence of primer R3769 SEQ !D NQ: 23 depicts the nucleotide sequence of primer F3782 SEQ ID NO: 24 depicts the nucleotide sequence of primer R37
  • SEQ ID NO: 26 depicts the nucleotide sequence of primer R3785
  • SEQ ID NO: 27 depicts the nucleotide sequence of primer F3806
  • SEQ ID NO: 28 depicts the nucleotide sequence of primer R3807
  • SEQ ID NO: 29 depicts the nucleotide sequence of primer F3808
  • SEQ !D NO: 30 depicts the nucleotide sequence of primer R3809
  • SEQ ID NO: 31 depicts the nucleotide sequence of primer F3810
  • SEQ ID NO: 32 depicts the nucleotide sequence of primer R3811
  • SEQ ID NO: 33 depicts the nucleotide sequence of primer F3853
  • SEQ ID NO: 34 depicts the nucleotide sequence of primer F3854
  • SEQ ID NO: 35 depicts the nucleotide sequence of primer F3855
  • SEQ ID NO: 36 depicts the nucleotide sequence of primer R3856
  • SEQ ID NO: 37 depicts the nucleotide sequence of primer F3857
  • SEQ ID NO: 38 depicts the nucleotide sequence of primer R3858
  • SEQ ID NO: 39 depicts the nucleotide sequence of primer F3859
  • SEQ ID NO: 40 depicts the nucleotide sequence of primer R3860
  • SEQ ID NO: 41 depicts the nucleotide sequence of primer F3861
  • SEQ ID NO: 42 depicts the nucleotide sequence of primer R3862
  • SEQ ID NO: 43 depicts the nucleotide sequence of primer F3863
  • SEQ ID NO: 44 depicts the nucleotide sequence of primer R3864
  • SEQ ID NO: 45 depicts the nucleotide sequence of primer F3865
  • SEQ ID NO: 46 depicts the nucleotide sequence of primer R3866
  • SEQ ID NO: 47 depicts the nucleotide sequence of probe PRR7(#3827) ⁇ FAM
  • SEQ ID NO: 48 depicts the nucleotide sequence of probe PRR7(#3827)-VIC
  • SEQ ID NO: 49 depicts the nucleotide sequence of forward primer BvPRRT used for gene expression analysis
  • SEQ ID NO: 50 depicts the nucleotide sequence of reverse primer BvPRRJ used for gene expression analysis
  • SEQ iD NO: 51 depicts the nucleotide sequence of genomic nucleotide sequence of BvPRR7 including about 13 kb of the promoter region.
  • SEQ ID NO: 52 depicts the nucleotide sequence of the coding region of BvPRRJ. DEFtNlTIONS
  • Sugar beet refers to all species and subspecies within the genus Beta as well as all kinds of cultivated beets of Beta vulgaris. Cultivated beets have been separated into four groups: leaf beet, garden beet, fodder beet and sugar beet "Sugar beet” refers also to all cultivated beets including those grown for other purposes than the production of sugar, such as ethanof, plastics or industrial products. In particular, “Sugar beet” refers to fodder beet and sugar beet, but especially to sugar beet.
  • An "annual sugar beet line” refers to a sugar beet plant containing the dominant allele b at the ⁇ locus in a heterozygous or homozygous state.
  • a "biennial sugar beet line” refers to a sugar beet plant containing the recessive allele b at the S locus in a homozygous state
  • “Bolting” refers to the transition from the vegetative rosette stage to the inflorescence or reproductive growth stage.
  • B gene refers to a gene that is responsible for early bolting in sugarbeet. Plants carrying the dominant allele make shoot elongation followed by flowering without prior exposure to cold temperatures,
  • “Vernalization” refers to the process by which floral induction in some plants is promoted by exposing the plants to chilling for certain duration.
  • an "allele” is understood within the scope of the invention to refer to alternative forms of various genetic units associated with different forms of a gene or of any kind of identifiable genetic element, which are alternative in inheritance because they are situated at the same locus in homologous chromosomes.
  • the two alleles of a given gene ⁇ or marker typically occupy corresponding loci on a pair of homologous chromosomes.
  • breeding refers to any process that generates a progeny individual. Breedings can be sexuai or asexual, or any combination thereof. Exemplary non-iimiting types of breedings include crossings, seifings, doubled haploid derivative generation, and combinations thereof.
  • Locus is understood within the scope of the invention to refer to a region on a chromosome, which comprises a gene or any other genetic element or factor contributing to a trait.
  • the phrase "genetic marker” refers to a feature of an individual's genome (e.g., a nucleotide or a polynucleotide sequence that is present in an individual's genome) that is associated with one or more loci of interest. Sn some embodiments, a genetic marker is polymorphic in a population of interest, or the focus occupied by the polymorphism, depending on context.
  • Genetic markers include, for example, single nucleotide polymorphisms (SNPs), indels ⁇ i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples. Genetic markers can, for example, be used to locate genetic loci containing alleles that contribute to variability in expression of phenotypic traits on a chromosome.
  • the phrase "genetic marker” can also refer to a polynucleotide sequence complementary to a genomic sequence, such as a sequence of a nucleic acid used as probes.
  • a genetic marker can be physically located in a position on a chromosome that is within or outside of to the genetic locus with which it is associated ⁇ i.e., is intragenic or extragenic, respectively).
  • genetic markers are typically employed when the location on a chromosome of the gene that corresponds to the locus of interest has not been identified and there is a nonzero rate of recombination between the genetic marker and the locus of interest
  • the presently disclosed subject matter can also employ genetic markers that are physically within the boundaries of a genetic locus ⁇ e.g., inside a genomic sequence that corresponds to a gene such as, but not limited to a polymorphism within an intron or an exon of a gene).
  • the one or more genetic markers comprise between one and ten markers, and in some embodiments the one or more genetic markers comprise more than ten genetic markers.
  • the phrase "informative fragment" refers to a polynucleotide fragment with an information content that is a retrievable and can assist in the determination and/or characterization of a genetic locus of interest.
  • This information content may be represented by a polymorphism which is associated with said iocus of interest such as, for example, a single nucleotide polymorphisms (SNPs), indels (i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples and may be used for the development of a genetic marker.
  • SNPs single nucleotide polymorphisms
  • indels i.e., insertions/deletions
  • phenotypic trait refers to the appearance or other detectable characteristic of an individuaf, resulting from the interaction of its genome with the environment.
  • Marker-based selection is understood within the scope of the invention to refer to the use of genetic markers to detect one or more nucleic acids from the plant, where the nucleic acid is associated with a desired trait to identify plants that carry genes for desirable (or undesirable) traits, so that those plants can be used (or avoided) in a selective breeding program.
  • tellite or SSRs Simple sequence repeats
  • Marker is understood within the scope of the invention to refer to a type of genetic marker that consists of numerous repeats of short sequences of DNA bases, which are found at Joci throughout the plant's DNA and have a likelihood of being highly polymorphic.
  • PCR Polymerase chain reaction
  • PCR primer is understood within the scope of the invention to refer to rrelatively short fragments of single-stranded DNA used in the PCR amplification of specific regions of DNA.
  • Phenotype is understood within the scope of the invention to refer to a distinguishable characteristic(s) of a genetically conf roiled trait.
  • Polymorphism is understood within the scope of the invention to refer to the presence in a population of two or more different forms of a gene, genetic marker, or inherited trait.
  • Selective breeding is understood within the scope of the invention to refer to a program of breeding that uses plants that possess or display desirable traits as parents.
  • polynucleotide is understood herein to refer to poiymeric molecule of high molecular weight which can be single-stranded or double-stranded, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine.
  • a "polynucleotide fragment” is a fraction of a given polynucleotide molecule, Jn higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins.
  • a “genome” is the entire body of genetic material contained in each cell of an organism.
  • polynucleotide thus refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-naturai or altered nucleotide bases capable of incorporation into DNA or RNA polymers. Unless otherwise indicated, a particular nucleic acid sequence of this invention also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et a/., 1991 ; Ohtsuka et a/., 1985; Rossoli ⁇ i et a/., 1994),
  • the term polynucleotide is used interchangeably with nucleic acid, nucleotide sequence and may include genes, cDNAs, and mRNAs encoded by a gene, etc.
  • the polynucleotide of the invention is understood to be provided in isolated form.
  • isolated means that the polynucleotide disclosed and claimed herein is not a polynucleotide as it occurs in its natural context, if it indeed has a naturally occurring counterpart. Accordingly, the other compounds of the invention described further below are understood to be isolated. If claimed in the context of a plant genome, the polynucleotide of the Invention is distinguished over naturally occurring counterparts by the insertion side in the genome and the flanking sequences at the insertion side.
  • nucleic acid refers to any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g., a typical DNA or RNA polymer), modified oligonucleotides (e.g., oligonucleotides comprising bases that are not typical to biological RNA or DNA, such as 2'-O-methyiated oligonucleotides), and the like.
  • a nucleic acid can be single-stranded, doubie-stranded, multi- stranded, or combinations thereof.
  • a particular nucleic acid sequence of the presently disclosed subject matter optionally comprises or encodes complementary sequences, in addition to any sequence explicitly indicated.
  • genes include coding sequences and/or the regulatory sequences required for their expression.
  • gene refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
  • Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins.
  • Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
  • a "marker gene” encodes a selectable or screenable trait.
  • chimeric gene refers to any gene that contains 1 ) DNA sequences, including regulatory and coding sequences that are not found together in nature or 2 ⁇ sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not ⁇ aturaiiy adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
  • transgene refers to a gene that has been introduced into the genome by transformation and is stably maintained.
  • Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.
  • protein protein
  • Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences, it may constitute an "uninterrupted coding sequence", i.e., lacking an i ⁇ tron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions.
  • An "intron” is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-iigation of the RNA within the ceil to create the mature mRNA that can be translated into a protein.
  • Promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
  • Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for contra! of expression.
  • Promoter also refers to a nucleotide sequence that inciudes a minima! promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • an "enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (norma! or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • the "initiation site” is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences ⁇ I.e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.
  • promoter elements particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters.”
  • the minima! promoter functions to permit transcription.
  • a “minima! or core promoter” thus consists only of all basal elements needed for transcription initiation, e.g.,, a TATA box and/or an initiator.
  • Constant expression refers to expression using a constitutive or regulated promoter.
  • Consditional and regulated expression refer to expression controlled by a regulated promoter.
  • Constant promoter refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant. Each of the transcription-activating elements do not exhibit an absolute tissue-specificity, but mediate transcriptional activation in most plant parts at a level of >1 % of the level reached in the part of the plant in which transcription is most active.
  • REguiated promoter refers to promoters that direct gene expression not constitutively, but in a temporally- and/or spatialiy-regulated manner, and includes both tissue-specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and naturai sequences.
  • Different promoters may direct the expression of a gene in different tissues or eel! types, or at different stages of development, or in response to different environmental conditions.
  • New promoters of various types useful in plant cells are constantly being discovered, numerous examples may be found in the compiiation by Okamuro et a/. (1989).
  • Typical regulated promoters useful in plants include but are not limited to safener-inducibfe promoters, promoters derived from the tetracycline-inducible system, promoters derived from salicylate-inducible systems, promoters derived from alcohol-inducibie systems, promoters derived from glucocorticoid-inducible system, promoters derived from pathogen-inducibfe systems, and promoters derived from ecdysome-inducible systems.
  • tissue-specific promoter refers to regulated promoters that are not expressed in all plant ceils bui only in one or more cell types in specific organs (such as leaves or seeds), specific tissues (such as embryo or cotyledon), or specific celi types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated, such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
  • inducible promoter refers to those regulated promoters that can be turned on in one or more eel! types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
  • “Operably-ijnked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other.
  • a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
  • “Expression” refers to the transcription and/or translation of an endogenous gene, ORF or portion thereof, or a transgene in plants.
  • expression may refer to the transcription of the antisense DNA only.
  • expression refers to the transcription and stable accumulation of sense (r ⁇ RNA) or functional RNA.
  • Expression may afso refer to the production of protein
  • “Overexpression” refers to the levef of expression in transgenic cells or organisms that exceeds levels of expression in normal or untransformed (nontra ⁇ sgenic) cells or organisms.
  • Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene.
  • Gene silencing refers to homology-dependent suppression of viral genes, transgenes, or endogenous nuclear genes. Gene silencing may be transcriptional, when the suppression is due to decreased transcription of the affected genes, or post-franscriptionaf, when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes (English et a!., 1996). Gene siiencing includes virus-induced gene silencing (Ruiz e( a/., 1998).
  • hybridize refers to conventional hybridization conditions, preferably to hybridization conditions at which ⁇ xSSPE, 1 % SDS, ixDenhardts solution is used as a solution and/or hybridization temperatures are between 35°C and 7O 0 C, preferably 65 0 C.
  • washing is preferably carried out first with 2xSSC, 1% SDS and subsequently with 0.2xSSC at temperatures between 35°C and 75 0 C, particularly between 45°C and 65 ⁇ C, but especially at 59°C (regarding the definition of SSPE, SSC and Denhardts solution see Sambrook et a/, loc. cit).
  • High stringency hybridization conditions as for instance described in Sambrook et a/, supra, are particularly preferred. Particularly preferred stringent hybridization conditions are for instance present if hybridization and washing occur at 65 0 C as indicated above. Non-stringent hybridization conditions for instance with hybridization and washing carried out at 45 0 C are less preferred and at 35 0 C even less. "Sequence Homology or Sequence Identity" is used herein interchangeably.
  • sequence identity in the context of two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. If two sequences which are to be compared with each other differ in length, sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence which are identica! with the nucleotide residues of the longer sequence.
  • Sequence identity can be determined conventionally with the use of computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, Wf 53711), Bestfit utilizes the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981 ), 482-489, in order to find the segment having the highest sequence identity between two sequences.
  • Bestfit Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, Wf 53711
  • Bestfit utilizes the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981 ), 482-489, in order to find the segment having the highest sequence identity between two sequences.
  • Bestfit or another sequence alignment program to determine whether a particular sequence has for instance 95% identify with a reference sequence of the present invention, the parameters are preferably so adjusted that the percentage of identity is calculated over the entire length of the reference sequence and that homology gaps of up to 5%
  • the so- called optional parameters are preferably left at their preset ("default") values.
  • the deviations appearing in the comparison between a given sequence and the above- described sequences of the invention may be caused for instance by addition, deletion, substitution, insertion or recombination.
  • Such a sequence comparison can preferably also be carried out with the program Ji fasta2Qu66" (version 2.0u66, September 1998 by Wiifiam R. Pearson and the University of Virginia; see also Pearson, 1990, appended examples and http://workbench.sdsc.edu/).
  • Ji fasta2Qu66 version 2.0u66, September 1998 by Wiifiam R. Pearson and the University of Virginia; see also Pearson, 1990, appended examples and http://workbench.sdsc.edu/.
  • the "default" parameter settings may be used.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule o ⁇ iy to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total celiuiar) DNA or RNA.
  • Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
  • Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen P., 1993 Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5. degree. C. lower than the thermal melting point (T.sub.m) for the specific sequence at a defined ionic strength and pH. Typically, under “stringent conditions” a probe will hybridize to its target subsequence, but to no other sequences.
  • T.sub.m thermal melting point
  • the T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
  • Very stringent conditions are selected to be equal to the T.sub.m for a particular probe.
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42.degree C, with the hybridization being carried out overnight.
  • An example of highly stringent wash conditions is 0.1 5M NaCI at 72. degree C for about 15 minutes.
  • An example of stringent wash conditions is a 0.2.times.SSC wash at 65.
  • degree C for 15 minutes see, Sambrook, infra, for a description of SSC buffer.
  • a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1 time.
  • An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6.times.SSC at 40. degree C for 15 minutes.
  • stringent conditions typicaiiy involve salt concentrations of less than about 1.OJVl Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typicaiiy at least about 30. degree C.
  • Stringent conditions can aiso be achieved with the addition of destabilizing agents such as fomnarnide.
  • a signal to noise ratio of 2.iimes. (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • a "plant” is any plant at any stage of development, particularly a seed plant.
  • a "plant ceil” is a structural and physiological unit of a piant, comprising a protoplast and a ceil wall.
  • the plant cell may be in form of an isolated single ceil or a cuitured cell, or as a part of higher organized unit such as, for example, plant tissue, a plant organ, or a whofe piant.
  • Proant cell culture means cultures of plant units such as, for example, protoplasts, celi culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of deveiopment.
  • Plant material refers to leaves, stems, roots, fiowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, celi or tissue cuitures, or any other part or product of a plant.
  • a "plant organ” is a distinct and visibly structured and differentiated part of a piant such as a root, stem, leaf, flower bud, or embryo.
  • Plant tissue as used herein means a group of plant cells organized into a structural and functionai unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whoie plants, plant organs, piant seeds, tissue culture and any groups of plant ceils organized into structural and/or functional units. The use of this term in conjunction with, or in the absence of, any specific type of piant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.
  • the present invention discloses polynucleotides identified in the sugar beet genome including variants and derivatives thereof, which polynucleotides were demonstrated to show perfect co-segregation with the bolting gene (S gene) associated phenotype in sugar beet, and the use of said polynucleotides for the development of markers that can be used for mapping and identification of the bolting gene or S gene.
  • the polynucleotide markers according to the invention may also be used for quality control of commercial seed lots by screening of commercial biennial sugar beet seed for annua! contaminants and for identifying annuals/biennials in breeding programs, which use the annual trait to speed up the breeding process, or when the annual trait is introduced together with new sources of genetic variation.
  • the polynucleotides according to the invention and described herein before, can further be used in a transgenic approach for producing transgenic sugar beet plants comprising said polynucleotides stably integrated into the sugar beet genome.
  • the expression product upon expression from the genome, can be used to modulate the vernalization response of the sugar beet plant.
  • the vernalization response will be delayed by suppressing or down-regulating expression of the S gene.
  • the present invention provides a polynucleotide which maps at or in close vicinity to the S locus, particularly at a distance of 1 clVI upstream of markers MP0176 and GJ01 and co-segregates with marker GJ131 (Mohring S. et ai, 2004; Gaafar R. M. ef ai, 2005 ⁇ ( Figure 5).
  • the invention relates to a polynucleotide including an informative fragment thereof according to the invention and as described herein before, which is obtainable from a genomic DNA region that maps at a distance of less than 1 cM, particularly of less than 0.75 cM, more particularly of less than 0.5 cM, even more particularly of less than 0.3 cM, but especially of less than 0.25 cM relative to the B gene.
  • the polynucleotide according to the invention can further be used to fully characterize the region around the S locus including the B gene and to identify further putative flowering time control candidate genes.
  • a BAC library has been established with DNA from the biennial commercial sugar beet cultivar H20. Partially (Hindlll) digested HMW DNA of fragments in the size of 100-400 kb were size selected two times. The DNA fragments were ligated into the vector pBeloBAC-Kan. The library contains 57,600 clones with an average insert size of approximately 120 kb, corresponding to an 8x coverage of the beet genome. The redundancy has been tested by screening with single-copy probes and the frequency of clones from mitochondrial or plastid DNA was estimated to be lower than 1 %.
  • This BAG library was used to recover the full-length genomic sequence of the sugar beet PRR7 gene.
  • primers PRR7-F and PRR7-R were used to screen the sugar beet BAC library using standard PCR techniques well known to those skilled in the art.
  • the PCR conditions for the screening of the DNA pools were as follows: primary denaturation was accomplished at a temperature of between 9O 0 C and 98 0 C, particularly at about 95 0 C for 2 to 10 min, particularly for about 5 min followed by between 30 and 40 amplification cycles of between 25 and 35 seconds, particularly about 35 amplification cycles of about 30 seconds at a temperature of between 9O 0 C and 98°C, particularly at about 95 0 C, between 25 and 35 seconds, particularly 30 seconds at a temperature of between 55 0 C and 65 0 C, particularly at about 6O 0 C and between 25 and 35 seconds, particularly 30 seconds at a temperature of between 68 0 C and 75 0 C, particularly at about 72 0 C and followed by between 2 and 8 min, particularly about 5 min, at a temperature of between 68 0 C and 75 0 C, particularly at about 72 0 C.
  • PCR experiments are carried out using an appropriate reaction mix including a suitable polymerase, particularly a Taq polymerase.
  • a suitable polymerase particularly a Taq polymerase.
  • Subsequent screenings of the DNA pools for fragment BvPRR ⁇ resulted in the positive identification of a BAC clone carrying the respective fragment.
  • the previously identified BAC clone is sequenced using standard sequencing technology such as, for example, the pyrosequencing technology developed by 454 Life Sciences.
  • Two non-overiapping contigs that both share sequence homology with EST CV301305 can then be combined into one single sequence (SEQ ID NO 5), Based on the alignment of the BAC sequence contigs to EST CV301305 and on sequence homology to the PRR7 gene from Arabidopsis, the putative gene structure of the beet BvPRR? gene comprising introns and exons can be predicted as shown in Figure 5. Based on this prediction the genomic sequence can be shown to span the entire BvPRR? gene with 3.6 Kb of sequence upstream of the ATG stop codon and 2.2 Kb downstream of the coding region. The corresponding amino acid sequence of BvPRR? is shown under SEQ ID NO 6.
  • the B gene may be used in a transgenic approach for producing transgenic sugar beet plants comprising said polynucleotides stably integrated into the sugar beet genome.
  • the expression product upon expression from the genome, can be used to modulate the vernalization response of the sugar beet plant.
  • the vernalization response may be delayed by suppressing or down-regulating expression of the ⁇ gene.
  • early bolting without cold treatment may be induced upon overexpression of the B gene.
  • moiecular marker techniques have been developed which can be used for genetic mapping, gene cloning, marker assisted plant breeding and for genome fingerprinting and investigating genetic relationships.
  • Genetic markers are based on DNA polymorphisms in the nucleotide sequences of genomic regions and can either be detected by restriction enzymes, or by means of two priming sites.
  • RFLP restriction fragment length polymorphism
  • RAPD random amplification of polymorphic DNA
  • AFLP amplified restriction fragment length polymorphism
  • SSR single sequence repeats
  • the information content of the different types of markers may be different depending on the method that was used to obtain the marker data and the population in which the markers were scored. For example, it is not always possible to distinguish genome fragments that are present in homozygous condition from heterozygous fragments.
  • co-dominant markers like restriction fragment length polymorphisms (RFLPs 1 Botstein et ai, 1980) and co- dominantly scored amplified fragment length polymorphisms (AFLPs, Vos et ai, 1995) yield more information than dominant markers like random amplified polymorphic DNAs (RAPDs 1 Welsh and fvlcCleland, 1990) and dominantly scored AFLPs.
  • RFLPs are co-dominant and are able to identify a unique locus
  • RFLP involves the use of restriction enzymes to cut chromosomal DNA at specific short restriction sites
  • polymorphisms result from duplications or deletions between the sites or mutations at the restriction sites.
  • AFLP requires digestion of cellular DNA with a restriction enzyme before using PCR and selective nucleotides in the primers to amplify specific fragments. With this method up to 100 polymorphic loci can be measured and only relatively small DNA sample are required for each test.
  • PCR polymerase chain reaction
  • RAPD PCR based technique
  • PCR polymerase chain reaction
  • Microsateilites or simple sequence repeats (SSRs), simple sequence length polymorphisms (SSLPs) 1 short tandem repeats (STRs), simple sequence motifs (SSMs), and sequence target microsatellites (STMs) represent a class of repetitive sequences which are widely dispersed throughout the genome of eukaryotes. The variation in number and length of the repeats is a source of polymorphism even between closely related individuals. SSR analysis is based on these (short-repeat) sequences which are selectively amplified to detect variations in simple sequence repeats.
  • microsatellite sequences can be easily amplified by PCR using a pair of flanking locus-specific oligonucleotides as primers and defect DNA length polymorphisms (Litt and Luty, 1989; Weber and May, 1989).
  • SNPs single nucleotide polymorphisms or SNPs, which occur approximately every 1.3 kb in human (Cooper et al., 1985; Kwok et at., 1996). Most polymorphisms of this type have only two alleles and are also called bialielic loci. Positional cloning based on SNPs may accelerate the identification of disease traits and a range of biologically informative mutations (Wang et a!., 1998).
  • PCR extension assays that efficiently pick up point mutations may be used to detect SNPs. The procedure requires little DNA per sample.
  • Three widely used types of SNP detection assays using PCR method are cleaved amplified poiymorphic sequences (CAPS) (Konieczny and Ausubei, 1993; Thiel et a/,, 2004), derived CAPS (dCAPS) (Michaels and Amas ⁇ no, 1998; Neff et a!,, 1998), and single strand conformation polymorphism (SSCP) (Orita et ai., 1989),
  • CAPS poiymorphisms are differences in restriction fragment lengths caused by SNPs or INDELs that create or abolish restriction endonuclease recognition sites in PCR ampiicons produced by locus-specific oligonucleotide primers.
  • CAPS assays are performed by digesting locus-specific PCR amplicons with one or more restriction enzymes and then separating the digested DNA on agarose or poiyacrylamide gels.
  • dCAPS is a modification of the CAPS technique that allows detection of most singie- nucleotide changes by utilizing mismatched PCR primers.
  • a restriction enzyme recognition site that includes the SNP is introduced into the PCR product by a primer containing one or more mismatches to template DNA.
  • the PCR product modified in this manner is then subjected to restriction enzyme digestion, and the presence or absence of the SNP is determined by the resulting restriction pattern.
  • the SSCP technique separates denatured double stranded DNA on a non- denaturing gel, and thus allows the secondary structure, as well as the molecular weight, of single stranded DNA to determine gel mobility.
  • the ARMS (amplification refractory mutation system)-PCR procedure involves the use of a single PCR for SNP genotyping (Fan et a/., 2003; Chiapparino et a/., 2004), A tetra-primer, employing two primer pairs, is used to amplify two different alleles of a SNP in a single PCR reaction.
  • Aiternative methods may be employed to amplify such fragments, such as the "Ligase Chain Reaction” ("LCR”) (Barany, F,, 1991)), which uses two pairs of oligonucleotide probes to exponentially amplify a specific target.
  • LCR Low-Ligase Chain Reaction
  • the sequences of each pair of oligonucleotides are selected to permit the pair to hybridize to abutting sequences of the same strand of the target.
  • Such hybridization forms a substrate for a template-dependent ligase.
  • the resulting products thus serve as a template in subsequent cycles and an exponential amplification of the desired sequence is obtained.
  • LCR can be performed with oligonucleotides having the proximal and distal sequences of the same strand of a polymorphic site.
  • either oligonucleotide will be designed to include the actual polymorphic site of the polymorphism, in such an embodiment, the reaction conditions are selected such that the oligonucleotides can be ligated together only if the target molecule either contains or lacks the specific nucleotide that is complementary to the polymorphic site present on the oligonucleotide.
  • the oligonucleotides may be selected such that they do not include the polymorphic site (see, Segev, PCT Appiication WO 90/01069).
  • OLA Oligonucleotide Ligation Assay
  • Molecular markers preferentially End point TaqMa ⁇ ®, can be developed based on SNPs characterized from sequenced PCR products that are amplified from annual and biennial plants. Here, several PCR amplifications will be performed in order to cover the whole sequence of the gene.
  • New molecular markers will then be tested within different annual and biennial genetic backgrounds to evaluate the robustness of the molecular test.
  • a molecular marker is a DNA fragment amplified by PCR, e.g., a SSR marker or a RAPD marker.
  • the presence or absence of an amplified DNA fragment is indicative of the presence or absence of the trait itself or of a particular allele of the trait.
  • a difference in the length of an amplified DNA fragment is indicative of the presence of a particular allele of a trait, and thus enables to distinguish between different alleles of a trait.
  • simple sequence repeat (SSR) markers are used to identify invention-reievant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.
  • a marker based on a single nucleotide polymorphism is used to identify invention-relevant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.
  • a marker based on a deletion or an insertion (“INDEL") of at least one nucleotide is used to identify invention-relevant alleles in the parent plants and/or the ancestors thereof, as well as in the progeny plants resulting from a cross of said parent plants.
  • markers can be developed based on the sequence of the polynucleotides according to the invention and as described herein before. in one aspect of the invention, markers may be developed and used which are not explicitly disclosed herein or markers even yet to be identified. Based on the information provided in this application it will be possible, for a skilled person, to identify or develop markers not explicitly disclosed herein but genetically closely linked to, or, preferably, located within the bolting gene or S gene or linked to the markers disclosed herein. The skilled person knows that other markers may provide at ieast equal utility in screening assays and marker assisted selection.
  • primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein may be used as (hybridization) probes in isolating nucleic acid sequences/genes flanking the markers and/or linked and/or associated and/or specific for the ⁇ gene region from a genomic nucleic acid sample and/or RNA or cDNA sample or pool of samples (for example screening of genomic resources like BAG libraries or gDNA or cDNA library screening).
  • primer sequences as disclosed herein and/or marker/(candidate)gene sequences (or part thereof) that can be determined using the primer sequences as disclosed may be used as (PCR) amplification primers to amplify a nucleic acid sequence/gene flanking and/or linked to and/or associated with and/or specific for the QTL region from a genomic nucleic acid sample and/or RNA or cDNA sample or pool of samples either or not isolated from a specific piant tissue and/or after specific treatment of the piant and from sugar beet or in principal any other organism with sufficient homology.
  • nucleotide sequences/genes of one or more markers can be determined after internal primers for said marker sequences may be designed and used to further determine additional flanking sequence/genes within the B gene region and/or genetically linked and/or associated with the trait.
  • markers of any type, may be identified by genetic mapping approaches, eventually (if already needed) by positioning of the disclosed markers (by genetic mapping or extrapolation based on common markers across maps) on a (high density) genetic map(s), and/or integrated genetic or consensus map(s). Markers already known and/or new markers genetically linked and/or positioned in the vicinity of the disclosed markers and/or S gene region may be identified and/or obtained and eventually used in S gene (fine-) mapping and/or S gene cloning and/or MAS breeding applications.
  • primer sequences as discfosed herein and/or marker/(candidate)gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein or based on linked markers may be used in 'in-silico' methods to search sequence or protein databases (e.g., BLAST) for (additional) flanking and/or homolog sequences/genes and/or allelic diversity (both genomic and/or cDWA sequences or even proteins and both originating from capsicum and/or any other organism) genetically linked and/or associated with the traits as described herein and/or located in the S gene region.
  • primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein or using other markers genetically linked to the markers disclosed herein and/or located in the B gene region may be positioned on a physical map and/or (whole) genome sequence in principal of any organism with sufficient homology to identify (candidate) sequences/markers/- genes applicable in S gene(fine-mapping) and/or S gene cloning and/or MAS breeding applications.
  • primer sequences as disclosed herein and/or marker/gene sequences (or part thereof) that can be determined using the primer sequences as disclosed herein may be used in comparative genome or syntheny mapping approaches to identify homolog region and homolog and/or ortholog sequences/ ⁇ candidate)- genes geneticaliy linked and/or positioned in the S gene region and applicable in S gene(fine-mapping) and/or B gene cloning and/or MAS breeding applications.
  • primer sequences and/or markers as disclosed herein may be used to select individuals with different/contrasting B gene alleles.
  • Genetic association approaches and/or bulk segregant analysis can be used to identify markers/genes in the specific region (B gene region) of interest and/or associated or genetically linked to the described traits.
  • the disclosed information may be used to identify positiona! and/or functional candidate genes which may be associated with the described traits and/or genetically linked.
  • the markers according to the present invention can be used in an allelic discrimination assay, particularly in an assay for discriminating between different haplotypes within plant groupings of sugar beet plants exhibiting a biennial genotype. Said assay is based on a set of probe polynucleotides comprising two separate probe molecules that are complementary, for example, to a subregion of the BvPRR?
  • an assay is provided involving markers that can discriminate specifically between annual piants and biennial plants and can thus be used, for example, for quality control of seed lots.
  • the invention refates to an assay, which is based on a set of probe polynucleotides comprising two separate probe moiecules that are complementary, for example, to a to a subregion of the BvPRRJ gene obtainable by PCR amplification based on forward primer PRR7-F and reverse primer PRR7-H as given in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, which probe molecuSes differ only by one base mismatch, particularly a base mismatch at position #631.
  • the annual plant habit conferred by the B gene behaves as a single dominant trait; the requirement for vernalization in biennial plants accordingly is recessive.
  • the transformation of an annual allele of BvPRR7 into a biennial genotype thus is predicted to bestow the annual flowering behavior onto the biennial acceptor genotype.
  • the coding sequence of an annual allele of BvPRR? under the control of an annual promoter and terminator fragment is transformed into biennial genotype such as, for example G018. Transformation can be accomplished by methods known in art such as that disclosed by Chang et a/, 2002 using sugar beet meristems as expiant material and the phosphomannose isomerase (PMI) gene as selectable marker...
  • PMI phosphomannose isomerase
  • Transgenic shoots are checked for expression of the selection marker such as, for example, PMI activity (J ⁇ ersbo et a/, 1998) and subsequently rooted, potted in soil and transferred to the greenhouse.
  • Negative controls consist of non-transgenic shoots that are subjected to the same in vitro regeneration procedure, but without Agrobacte ⁇ um infection and selection. Plants are grown in growth chambers at a constant temperature of 18 0 C and a photoperiod of 17 hours light and 7 hours dark. Under these conditions none of the non-transgenic controls are supposed to show any signs of bolting during the observation period, whereas annual control plants are supposed to bolt normally within 8 weeks.
  • transgenic plants that bolted and flowered are cross-pollinated with a biennial maintainer line to produce offspring. Progeny plants are tested for selection marker activity and subsequently monitored for bolting and flowering without vernalization. Most progenies should show a one to one segregation ratio and a perfect correlation between PMi activity and the annual habit.
  • BvPRR7 plays a key role in the vernalization response in sugar beet and can thus be used for engineering bolting resistance into sugar beet plants by suppressing the vernalization response.
  • a BvPRR? cDNA fragment such as, for example the 0.6 Kb fragment depicted in SEQ ID NO. 1 , is assembled into an RNAi cassette under the control of a constitutive promoter.
  • Suitable constitutive promoters are, for example, the Ubi3 promoter from Arabidopsis (Morris ef ai, 1993), the CaMV 35S promoter, or any other promoter known to promote constitutive expression in sugar beet.
  • the expression cassette further contains a selectable marker gene under the control of a suitable promoter.
  • the marker gene encodes a positive selection marker such as phosphomannose isomerase or a xylose isomerase.
  • the inverted repeat of the BvPRR7 fragment may be separated by the second intron from the potato StLSI gene (Eckes ef a/, 1986; Vancanneyt et a/, 1990) to stabilize the RNAi cassette, but also to improve the efficiency of the RNAi phenomenon (Wang and Waterhouse, 2001 ; Smith et ai, 2000).
  • RNAi cassette can then be transformed into a biennial sugar beet genotype such as, for example, G018 as described herein previously.
  • Transgenic shoots are checked for expression of the selection marker such as, for example, PMI activity (Joersbo ef a/, 1998).
  • Positive shoots and non-transgenic controis are rooted and transferred to the greenhouse for an acclimatization period of two weeks minimum at 18 D C prior to the vernalization treatment
  • the transgenic plants are exposed to the vernalization treatment consisting of a period of 14 weeks at a constant temperature of 6 0 C and 12 hours low artificial light.
  • vernalized plants Prior to applying bolting-inductive conditions, vernalized plants are slowiy acciimatized for two weeks in ciimate chambers by stepwise increasing the temperature from 10 to 18 0 C. Plants are subsequently repotted into to larger pots (2 liter), and monitored for bolting while exposed to a constant temperature of 18 0 C and a long-day photoperiod of 17 hours light / 7 hours dark, Non-transgenic control plants routinely start bolting between four to six weeks post vernalization. Transgenic plants suppressed for BvPRR? frequently show a delay in bolting ranging from only two weeks to more than two months. A few events never bolted under the conditions applied in the greenhouse. Apart from the delay in bolting and flowering, transgenic plants develop normally and show no phenotypic aberrations. In general, plants delayed in bolting show a higher leaf number at the time of bolting as a result of the prolonged vegetative stage.
  • heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed.
  • a plant promoter fragment may be employed which will direct expression of the gene in ail tissue; of a regenerated piant.
  • Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation.
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the V- or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill.
  • Such genes include for example, the AP2 gene, ACT11 from Arabidopsis (Huang et a/. Plant MoI. Biol.
  • the plant promoter may direct expression of the nucleic acid molecules of the invention in a specific tissue or may be otherwise under more precise environmentai or developmental control.
  • environmental conditions that may effect transcription by inducible promoters include anaerobic conditions, elevated temperature, or the presence of light.
  • inducible or tissue-specific promoters.
  • tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue.
  • a tissue-specific promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other tissues as well.
  • promoters under developmental control include promoters that initiate transcription only (or primarily only) in certain tissues, such as fruit, seeds, or flowers. Promoters that direct expression of nucleic acids in ovules, flowers or seeds are particularly useful in the present invention.
  • a seed-specific or preferential promoter is one which directs expression specifically or preferentially in seed tissues, such promoters may be, for example, ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed coat-specific, or some combination thereof. Examples include a promoter from the ovule-specific BEL1 gene described in Reiser et al. Cell 83:735-742 (1995) (GenBank No. U39944).
  • Suitable seed specific promoters are derived from the following genes: MAC1 from maize (Sheridan et al. Genetics 142:1009-1020 (1996), Cat3 from maize (GenBank No. L05934, Abler et al. Plant MoI. Biol. 22:10131-1038 (1993), the gene encoding oleosin 18 kD from maize (GenBank No, J05212, Lee et al. Plant MoL Biol. 26:1981- 1987 (1994)), vivpar ⁇ us ⁇ 1 from Arabidopsis (Genbank No. U93215), the gene encoding oleosin from Arabidopsis (Genbank No.
  • Atmycl from Arabidopsis (Urao et al. Plant MoI. Biol. 32:571-576 (1996), the 2s seed storage protein gene family from Arabidopsis (Conceicao et al. Plant 5:493-505 (1994)) the gene encoding oleosin 20 kD from Brassica napus (GenBank No. M63985), napA from Brassica napus (GenBank No. J02798, Josefsson et at. JBL 26:12196-1301 (1987), the napin gene family from Brassica napus (Sjodahl et al.
  • sequences which provide the promoter with desirable expression characteristics, or the promoter with expression enhancement activity couid be identified and these or similar sequences introduced into the sequences via mutation. It is further contemplated that one couid mutagenize these sequences in order to enhance their expression of transgenes in a particular species.
  • promoters combining elements from more than one promoter may be useful.
  • U.S. Patent No. 5,491 ,288 discloses combining a Cauliflower Mosaic Virus promoter with a histone promoter.
  • the elements from the promoters disclosed herein may be combined with elements from other promoters.
  • the 3' nontranslated regulatory DNA sequence preferably includes from about 50 to about 1 ,000, more preferably about 100 to about 1 ,000, nucleotide base pairs and contains plant transcriptional and translationa! termination sequences.
  • Appropriate transcriptional terminators and those which are known to function in plants include the CaMV 35S terminator, the tml terminator, the nopa ⁇ ne synthase terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefa ⁇ ens, and the 3" end of the protease inhibitor I or I! genes from potato or tomato, although other 3' elements known to those of skill in the art can also be employed.
  • Preferred 3' elements include those from the nopaline synthase gene of Agrobacterium tumefaci ⁇ ns (Bevan ef a/., 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacteri ⁇ m tumefaciens, and the 3' end of the protease inhibitor ! or il genes from potato or tomato.
  • leader sequences are contemplated to include those which include sequences predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation.
  • sequences wi ⁇ ! be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will be most preferred.
  • sequences that have been found to enhance gene expression in transgenic plants include intron sequences (e.g., from Adh1, bronzel, actini, actin 2 (WO 00/760067), or the sucrose synthase intron) and viral leader sequences (e.g., from TMV, MCMV and AMV).
  • intron sequences e.g., from Adh1, bronzel, actini, actin 2 (WO 00/760067), or the sucrose synthase intron
  • viral leader sequences e.g., from TMV, MCMV and AMV.
  • a number of non-translated leader sequences derived from viruses are known to enhance expression.
  • leader sequences from Tobacco Mosaic Virus TMV
  • MCMV Maize Chlorotic Mottle Virus
  • AMV Alfalfa Mosaic Virus
  • Picornavirus leaders for example, EMCV leader (Encephalomyocarditis 5 noncoding region) (Elroy-Stein et a!., 1989); Potyvirus leaders, for example, TEV leader (Tobacco Etch Virus); MDMV leader (Maize Dwarf Mosaic Virus); Human immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak ef a/., 1991 ); Untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), (Jobling et a/., 1987; Tobacco mosaic virus leader (TMV) 1 (Galiie ef a/., 1989; and Maize Chlorotic Mottle Virus leader (MCMV) (Lomrnei et ai, 1991. See also, Delia-Cioppa er a/., 1987.
  • TEV leader Tobacco Etch Virus
  • MDMV leader Mainze Dwarf Mosaic
  • Adh intron 1 (Califs et a!., 1987), sucrose synthase intron (Vasii et a/., 1989) or TMV omega element (Galiie, ef a/., 1989), may further be included where desired.
  • enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis el al., 1987), the rice actin !
  • the maize alcohol dehydrogenase gene (Caliis et al., 1987), the maize shrunken I gene (Vasii et aL, 1989), TMV Omega element (Gallie et a!., 1989) and promoters from non-plant eukaryotes (e.g., yeast; Ma et al., 1988).
  • Overexpression can be achieved by insertion of one or more than one extra copy of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as wei! as overexpression.
  • underexpression there are two principle methods which are commonly referred to in the art as “antisense downregulatio ⁇ ” and “sense down regulation” (sense downregulation is also referred to as “cosuppression”).
  • gene silencing Both of these methods lead to an inhibition of expression of the target gene.
  • the alteration in expression of the nucleic acid molecule of the present invention may be achieved in one of the following ways:
  • a nucleotide sequence of the present invention preferably reduction of its expression, is obtained by "sense" suppression (referenced in e.g., Jorgensen et al. (1996) Plant MoI. Biol. 31, 957-973).
  • the entirety or a portion of a nucleotide sequence of the present invention is comprised in a DNA molecule,
  • the DNA molecule is preferably operatively linked to a promoter functional in a ceil comprising the target gene, preferably a plant cell, and introduced into the cell, in which the nucleotide sequence is expressible.
  • the nucleotide sequence is inserted in the DNA molecule in the "sense orientation", meaning that the coding strand of the nucleotide sequence can be transcribed.
  • the nucleotide sequence is fully translatable and all the genetic information comprised in the nucleotide sequence, or portion thereof, is translated into a polypeptide.
  • the nucleotide sequence is partially translatable and a short peptide is translated. In a preferred embodiment this is achieved by inserting at ieast one premature stop codon in the nucleotide sequence, which brings transiation to a halt.
  • the nucleotide sequence is transcribed but no translation product is being made.
  • the DNA molecule comprising the nucleotide sequence, or a portion thereof is stably integrated in the genome of the plant ceil, in another preferred embodiment, the DNA molecule comprising the nucleotide sequence, or a portion thereof, is comprised in an extrachromosomally replicating molecule.
  • the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced.
  • the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferably it is at least 80% identical, yet more preferably at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.
  • the alteration of the expression of a nucleotide sequence of the present invention preferably the reduction of its expression is obtained by "anti-sense" suppression.
  • the entirety or a portion of a nucleotide sequence of the present invention is comprised in a DNA molecule.
  • the DNA molecule is preferably operatively linked to a promoter functional in a plant cell, and introduced in a plant ceil, in which the nucleotide sequence is expressible.
  • the nucleotide sequence is inserted in the DNA molecule in the "anti-sense orientation", meaning that the reverse complement (also called sometimes non-coding strand) of the nucleotide sequence can be transcribed.
  • the DNA molecule comprising the nucleotide sequence, or a portion thereof is stabiy integrated in the genome of the plant ceil.
  • the DNA molecule comprising the nucleotide sequence, or a portion thereof is comprised in an extrachromosomally replicating molecule.
  • the expression of the nucleotide sequence corresponding to the nucleotide sequence comprised in the DNA molecule is preferably reduced.
  • the nucleotide sequence in the DNA molecule is at least 70% identical to the nucleotide sequence the expression of which is reduced, more preferabiy it is at least 80% identical, yet more preferabiy at least 90% identical, yet more preferably at least 95% identical, yet more preferably at least 99% identical.
  • At least one genomic copy corresponding to a nucleotide sequence of the present invention is modified in the genome of the plant by homologous recombination as further illustrated in Paszkowski et a/., EMBO Journal 7:4021-26 (1988).
  • This technique uses the property of homologous sequences to recognize each other and to exchange nucleotide sequences between each by a process known in the art as homologous recombination.
  • homologous recombination can occur between the chromosomal copy of a nucleotide sequence in a cell and an incoming copy of the nucleotide sequence introduced in the celi by transformation. Specific modifications are thus accurately introduced in the chromosomal copy of the nucleotide sequence.
  • the regulatory elements of the nucleotide sequence of the present invention are modified. Such regulatory elements are easily obtainable by screening a genomic library using the nucleotide sequence of the present invention, or a portion thereof, as a probe. The existing regulatory elements are replaced by different regulatory elements, thus altering expression of the nucleotide sequence, or they are mutated or deleted, thus abolishing the expression of the nucleotide sequence. !n another embodiment, the nucleotide sequence is modified by deletion of a part of the nucleotide sequence or the entire nucleotide sequence, or by mutation. Expression of a mutated polypeptide in a plant cell is also contemplated in the present invention.
  • a mutation in the chromosomal copy of a nucleotide sequence is introduced by transforming a cell with a chimeric oligonucleotide composed of a contiguous stretch of RNA and DNA residues in a duplex conformation with double hairpin caps on the ends.
  • An additional feature of the oligonucleotide is for example the presence of 2'-O-methy!ation at the RNA residues.
  • the RNA/DNA sequence is designed to align with the sequence of a chromosomal copy of a nucleotide sequence of the present invention and to contain the desired nucleotide change.
  • this technique is further illustrated in US patent 5,501 ,967 and Zhu et al. (1999) Proc. Natl. Acad. Sci. USA 96: 8768- 8773.
  • the RNA coding for a polypeptide of the present invention is cleaved by a catalytic RNA, or ribozyme, specific for such RNA.
  • the ribozyme is expressed in transgenic plants and results in reduced amounts of RNA coding for the polypeptide of the present invention in plant cells, thus leading to reduced amounts of polypeptide accumulated in the ceils. This method is further illustrated in US patent 4,987,071.
  • the activity of the polypeptide encoded by the nucleotide sequences of this invention is changed. This is achieved by expression of dominant negative mutants of the proteins in transgenic plants, leading to the loss of activity of the endogenous protein.
  • the activity of polypeptide of the present invention is inhibited by expressing in transgenic plants nucleic acid ligands, so-called aptamers, which specifically bind to the protein, Aptamers are preferentially obtained by the SELEX ⁇ Systematic Evolution of Ligands by Exponential Enrichment) method.
  • SELEX Systematic Evolution of Ligands by Exponential Enrichment
  • a candidate mixture of single stranded nucieic acids having regions of randomized sequence is contacted with the protein and those nucleic acids having an increased affinity to the target are partitioned from the remainder of the candidate mixture.
  • the partitioned nucieic acids are ampiified to yield a iigand enriched mixture.
  • a nucleic acid with optima! affinity to the polypeptide is obtained and is used for expression in transgenic plants. This method is further illustrated in US patent 5,270,163.
  • a zinc finger protein that binds a nucleotide sequence of the present invention or to its reguiatory region is also used to alter expression of the nucleotide sequence. Preferably, transcription of the nucleotide sequence is reduced or increased.
  • Zinc finger proteins are for example described in Beer ⁇ et a/. (1998) PNAS 95:14628- 14633., or in WO 95/19431 , WO 98/54311 , or WO 96/06166, all incorporated herein by reference in their entirety.
  • Alteration of the expression of a nucleotide sequence of the present invention is aiso obtained by dsRNA interference as described for example in WO 99/32619, WO 99/53050 or WO 99/61631 , all incorporated herein by reference in their entirety.
  • a DNA molecuie is inserted into a chromosomal copy of a nucleotide sequence of the present invention, or into a regulatory region thereof.
  • such DNA molecule comprises a transposabie element capable of transposition in a plant cell, such as e.g., Ac/Ds, Em/Spm, mutator.
  • the DNA moiecule comprises a T-DNA border of an Agrobacterium T-DNA.
  • the DNA molecule may also comprise a recombinase or integrase recognition site which can be used to remove part of the DNA moiecule from the chromosome of the pfa ⁇ t cell.
  • Example 2 Methods of insertional mutagenesis using T-DNA, transposons, oligonucleotides or other methods known to those skilled in the art are also encompassed. Methods of using T-DNA and transposon for insertio ⁇ a! mutagenesis are described in Winkler et al, (1989) Methods MoI. BioL 82:129-136 and Martienssen (1998) PNAS 95:2021-2028, incorporated herein by reference in their entireties.
  • a mutation of a nucleic acid molecule of the present invention is created in the genomic copy of the sequence in the cell or plant by deletion of a portion of the nucleotide sequence or regufator sequence.
  • Methods of deletion mutagenesis are known to those skilled in the art. See, for example, Miao et a/, (1995) Plant J. 7:359.
  • this deletion is created at random in a large population of plants by chemica! mutagenesis or irradiation and a plant with a deletion in a gene of the present invention is isolated by forward or reverse genetics. Irradiation with fast neutrons or gamma rays is known to cause deletion mutations in plants (Silverstone et al, (1998) Plant Cell, 10:155-189; Bruggema ⁇ n et al., (1996) Plant J., 10:755-760; Redei and Koncz in Methods in Arabidopsis Research, World Scientific Press (1992), pp. 16-82).
  • Deietion mutations in a gene of the present invention can be recovered in a reverse genetics strategy using PCR with pooled sets of genomic DNAs as has been shown in C, elegans (Liu et al., (1999), Genome Research, 9:859-867.).
  • a forward genetics strategy would involve mutagenesis of a line displaying PTGS followed by screening the M2 progeny for the absence of PTGS. Among these mutants would be expected to be some that disrupt a gene of the present invention. This could be assessed by Southern biot or PCR for a gene of the present invention with genomic DNA from these mutants.
  • a nucleotide sequence of the present invention encoding the B gene, particularly the BvPRR7 gene, in a plant eel! is overexpressed.
  • Examples of nucleic acid molecules and expression cassettes for overexpression of a nucleic acid molecule of the present invention are described above. Methods known to those skilled in the art of over-expression of nucleic acid molecules are also encompassed by the present invention.
  • the expression of the nucleotide sequence of the present invention is altered in every ceil of a plant. This is for example obtained though homologous recombination or by insertion in the chromosome. This is aiso for example obtained by expressing a sense or antisense RNA, zinc finger protein or ribozyme under the control of a promoter capable of expressing the sense or antisense RNA 1 zinc finger protein or ribozyme in every cell of a plant.
  • Constitutive expression, inducible, tissue-specific or developmentally-regulated expression are aiso within the scope of the present invention and result in a constitute inducible, tissue-specific or developmentaily-reguiated alteration of the expression of a nucleotide sequence of the present invention in the plant cell.
  • Constructs for expression of the sense or antisense RNA, zinc finger protein or ribozyme, or for overexpression of a nucleotide sequence of the present invention are prepared and transformed into a plant cell according to the teachings of the present invention, e.g., as described infra.
  • the invention hence also provides sense and anti-sense nucleic acid molecules corresponding to the open reading frames identified in the SEQ ID NO; 1 of the Sequence Listing as well as their orthologs. .
  • genes and open reading frames according to the present invention which are substantially simitar to a nucleotide sequence encoding a polypeptide as given in SEQ ID NO: 6 including any corresponding anti-sense constructs can be operably linked to any promoter that is functional within the plant host including the promoter sequences according to the invention or mutants thereof.
  • the polynucleotide construct of the invention comprising an expression cassette or an RNAi cassette may be mobilized into a suitable vector for plant transformation, such as, for example, a binary vector, which may then be mobilized to sugar beet using one of the well known transformation techniques such as, for example, Agrobacte ⁇ um-me ⁇ iaied transformation.
  • Transgenic plants (or plant cells, or plant explants, or plant tissues) incorporating and expressing the polynucleotide or dsRNA of the invention can be produced by a variety of well established techniques. Following construction of the polynucleotide construct of the invention comprising an expression cassette or an RNAi cassette incorporating a polynucleotide sequence according to the invention and as described herein before, standard techniques Gan be used to introduce the polynucleotide into a plant, a plant cell, a plant expfant or a plant tissue of interest. Optionally, the plant ceil, explant or tissue can be regenerated to produce a transgenic plant.
  • the plant can be any higher plant, including gymnosperms, monocotyledonous and dicotyledonous plants. Suitable protocols are available for Leguminosae (alfalfa, soybean, clover, etc), Urnbeliiferae (carrot, vaery, parsnip), Cructferae (cabbage, radish, rapeseed, broccoli, etc.), Curcurbitaceae (melons and cucumber), Gramineae (wheat, com, rice, barley, millet, etc.), Solanaceae (potato, tomato, tobacco, peppers, etc.), and various other crops.
  • Leguminosae alfalfa, soybean, clover, etc
  • Urnbeliiferae carrot,titiery, parsnip
  • Cructferae cabbage, radish, rapeseed, broccoli, etc.
  • Curcurbitaceae melons and cucumber
  • Gramineae wheat, com, rice, barley
  • Suitable methods can include, but are not limited to: electroporafion of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant ceils; micro- projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium tumefaciens mediated transformation.
  • Transformation of plants can be undertaken with a single DNA molecule or multiple DNA moiecules ⁇ i.e., co-transformation), and both these techniques are suitable for use with the polynucleotide constructs of the present invention.
  • Numerous transformation vectors are available for plant transformation, and the expression cassettes of this invention can be used in conjunction with any such vectors. The selection of vector will depend upon the preferred transformation technique and the target species for transformation.
  • a variety of techniques are available and known to those skilled in the art for introduction of constructs into a plant cell host. These techniques generally include transformation with DNA employing A. tumefaciens or A. rhizogen ⁇ s as the transforming agent, liposomes, PEG precipitation, electro po ration, DNA injection, direct DNA uptake, microprojectiie bombardment, particle acceleration, and the ⁇ ke (See, for example, EP 295959 and EP 138341 ) (see below). However, cells other than plant cells may be transformed with the polynucleotide construct of the invention.
  • the general descriptions of plant expression vectors and reporter genes, and Agrobacterium and Agrobacterium-mediated gene transfer, can be found in Gruber ef a/. (1993).
  • Expression vectors containing a polynucleotide sequence according to the invention can be introduced into protoplasts or into intact tissues or isolated ceils.
  • expression vectors are introduced into intact tissue.
  • General methods of culturing plant tissues are provided for example by Maki et al., (1993); and by Phillips et al. (1988).
  • expression vectors are introduced into maize or other plant tissues using a direct gene transfer method such as microproject ⁇ e-medialed delivery, DNA injection, elecfroporation and the like. More preferably expression vectors are introduced into plant tissues using the microprojectiie media delivery with the biolistic device. See, for example, Tomes et al. (1995).
  • the vectors of the invention can not only be used for expression of structural genes but may also be used in exon-trap cloning, or promoter trap procedures to detect differential gene expression in varieties of tissues, (Lindsey et al., 1993; Auch & Reth et al.). it is particularly preferred to use the binary type vectors of Ti and Ri plasmids of Agrobacterium spp. Ti-derived vectors transform a wide variety of higher plants, including rnonocotyledonous and dicotyledonous plants, such as soybean, cotton, rape, tobacco, and rice (Pacciotti et a/., 1985: Byrne et a/., 1987; Sukhapinda ef al.
  • T-DNA T-DNA to transform piant cells has received extensive study and is amply described (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An ef al., 1985).
  • the chimeric genes of the invention can be inserted into binary vectors as described in the examples.
  • Suitable methods of transforming plant cells include, but are not limited to, microinjection (Crossway et aL, 1986), electroporation (Riggs et a!., 1986), Agrobacterium-medlate ⁇ transformation ⁇ Hinchee et aL, 1988), direct gene transfer (Paszkowski et a/., 1984), and ballistic particle acceleration using devices available from Agracetus, inc., Madison, WIs.
  • the main focus of the present invention is on transformation of sugar beet.
  • the experimental procedures for the transformation of sugar beet are well known to those skilied in the art such as that disclosed by Chang et a/, 2002 using sugar beet meristems as explant material.
  • expression levels or activity of the polypeptide or polynucleotide of interest can be determined by analyzing mRNA expression using Northern biots, RT-PCR or rnicroarrays, or protein expression using ⁇ mrnunobiots or Western blots or gel shift assays.
  • the invention thus relates to plant cells and tissues, to plants derived from such cells and tissues, respectively, to plant material, to the progeny and to seeds derived from such plants, and to agricultural products including processed plant products with improved properties obtainable by, for example, any one of the transformation methods described below.
  • Preferred plants of the invention include gymnosperms, monocots, and dicots, especially agronomically important crop plants, such as rice, wheat, barley, rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.
  • agronomically important crop plants such as rice, wheat, barley, rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant
  • the genetic properties engineered into the transgenic plants described above are passed on by sexua! reproduction or vegetative growth and can thus be maintained and propagated in progeny plants.
  • said maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting.
  • Specialized processes such as hydroponics or greenhouse technoSogies can also be applied.
  • Use of the advantageous genetic properties of the transgenic plants according to the invention can further be made in plant breeding that aims at the development of plants with improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value, increased yield, or improved structure causing less loss from lodging or shattering.
  • the various breeding steps are characterized by well-defined human intervention such as selecting the Sines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending on the desired properties different breeding measures are taken.
  • the relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
  • Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile piant will uniformly obtain properties of both parental lines.
  • transgenic plants according to the invention can be used for the breeding of improved plant lines that for example increase the effectiveness of conventional methods such as herbicide or pesticide treatment or allow to dispense with said methods due to their modified genetic properties.
  • new crops with improved stress tolerance can be obtained that, due to their optimized genetic "equipment", yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions.
  • a polynucleotide sequence is provided as given in SEQ ID NO: 5, SEQ ID NO: 51 and SEQ ID NO: 52, which encodes a protein which is functionaliy equivalent to the B gene.
  • the EST sequence with accession number CV301305 was identified as the putative beet homologue of PRR7 by means of homology searches using BLAST.
  • SEQ ID 1 shows the nucleotide sequence of EST CV301305.
  • the corresponding amino acid sequence shows the partial presence of a Pseudo Response Regulator receiver (PRR, pfarn00072) or Signal Receiver (REC 1 cd00156) domain ( Figure 1), a hallmark of the PRR gene family that appear to be crucial for certain circadian-associated events (Nakamichi et a/, 2005).
  • FIG 2 shows the alignment of the amino acid sequence of CV301305 with PRR7, its closest Arabidopsis homoiogue, which has been described as a component of the temperature-sensitive circadian system (Nakamichi et a/, 2007; Salome and McClung 2005).
  • the circadian clock is known to control several developmental processes in plants including flowering time (i.e; bolting) control (Imaizumi and Kay, 2006; Zhou et ai, 2007).
  • the putative gene structure of the partial beet PRR7 fragment was deduced using the alignment between the genomic sequence and the mRNA of the Arabidopsis PRR7 gene (AT5G02810 and NiVL 120359 respectively) to the BvPRR7 sugar beet EST (CV3013G5), which revealed the presence of several putative intronic regions (Figure 3).
  • Primers PRR7-F and -R (SEQ ID NO 2 and 3) encompassing the third putative intronic region delivered an amplification product of approximately 0.5 Kb when using genomic beet DNA as template.
  • PCR conditions for the amplification reaction were as follows: primary denaturation at 95 0 C for 5 min followed by 35 amplification cycles of 30 seconds at 95 0 C, 30 seconds at 6O 0 C and 30 seconds at 72 0 C and followed by 5 min at 72 0 C.
  • PCR experiments were run at a GeneAMP PCR System 9600 instrument from Applied Biosystems inc. using Platinum Taq DNA polymerase and the corresponding reaction mix from invitrogen Corporation as recommended by the supplier. Sequence analysis of the PCR product enabled the reconstruction of the genomic sequence around intron 3 of the BvPRR7 gene fragment and confirmed the presence of an intron of 296 base pairs in length (SEQ ID NO 4).
  • the genomic fragment of the BvPRR7 gene was amplified and sequenced across a panel of sugar beet parental lines consisting of 15 biennial and one annual line. All biennial Sines revealed monomorphic for BvPRR7 as only two different haplotypes were observed: one biennial allele and one annual allele (Tablei ). in order to map BvPRR7 in a population segregating for the annual habit, an assay was developed targeting the SNP at position #160 (SEQ ID NO 4) using the EndPoint TaqMan® technology.
  • Table 2 summarizes the nucleotide sequences of the primers and probes designed for the PRRr(TI ) TaqMan® assay targeting SNP at position #160; the reactions further consisted of the TaqMan® Universal PCR Master Mix, No AmpErase® UNG (2X) from Applied Biosystems Inc. according to the manufacturer's recommendations.
  • the PCR amplification was performed as follows: 95 0 C for 10 min foiiowed by 40 cycles of 95 0 C for 15 sec and 6O 0 C for 1 min, using an ABi PRISM 7700 Sequence Detector instrument. EndPoint measurement was performed using the Sequence Detection System 2.0 software.
  • the BvPRR7 gene was mapped in a F2 population of 198 individuals derived from a cross between the annual line and a biennial line polymorphic for the SNP at position #160.
  • BvPRR ⁇ maps at chromosome Il at an approximate distance of 1 cM downstream of the GJ131 marker ( Figure 4), a region known to contain the B gene for vernalization- independent flowering ⁇ M ⁇ hring et al, 2004; Gaafar et a/, 2005).
  • the results of the PRR7(T1 ) assay show a perfect match between the predicted genotype of the S gene and the genotype of the BvPRR? gene.
  • the genotype of the B gene was predicted based on phenotypic evaluation of the F3 populations derived from the individual F2 plants for vernalization-independent flowering.
  • Table 3 summarizes the graphical representation of the fine-map of the S gene region for 9 individual progeny plants comprising the cfosest recombination events.
  • the combination of its map position and its biological function relating to the temperature-sensitive circadian rhythm (Salome and McClung, 2005) obviously make BvPRR7 a strong candidate for the S gene.
  • a sugar beet BAC library was screened by means of PCR, The library was developed from the biennial commercial cultivar H20 and calculated to represent 6 genome equivalents with an average insert size of 120 Kb (McGrath et al, 2004). DNA pools for this library are distributed by Amp ⁇ con Express, Pullman WA. The PCR conditions for the screening of the DNA pools were as follows: primary denaturation at 95 0 C for 5 min followed by 35 amplification cycles of 30 seconds at 95 0 C, 30 seconds at 6O 0 C and 30 seconds at 72 0 C and followed by 5 min at 72 0 C. PCR experiments were run at a GeneAMP PCR System 9700 instrument from Applied Biosystems Inc.
  • BAC SBA079-L24 was sent to MWG Biotech AG, Germany for sequence analysis by means of the 454 sequencing technology. Where necessary, gaps between the obtained contigs were filled by regular Sanger sequencing to yield one single genomic sequence for the BvPRR ⁇ gene (SEQ iD NO 5). Based on the alignment of the genomic sequence to EST CV301305 and on sequence homology to the PRR7 gene from Arabidopsis, the putative gene structure of the beet BvPRR? gene comprising introns and exons was predicted as shown in Figure 5.
  • the genomic sequence spans the entire BvPRR7 gene with 3.6 Kb of sequence upstream of the ATG start codon and 2.2 Kb downstream of the coding region.
  • the corresponding amino acid sequence of BvPRRJ is shown under SEQ ID NO 8. Alignment of the amino acid sequence of BvPRR7 to all members of the PRR gene family from Arabidopsis including TOC1 (PRR1), PRR3, PRR5, PRR7 and PRR9 illustrates the strong conservation of the Pseudo Response Regulator receiver domain (PRR) motif (pfam00072) near the NH2-terminus and the CCT motif (pfam06203) at the COOH-terminus ( Figure 6).
  • PRR Pseudo Response Regulator receiver domain
  • PRR7 homologue in cereals in addition to the PRR gene family from Arahidopsis, BvPRR? also shares strong homology to the PRR7 homologue in cereals as illustrated by the phylogenetic tree shown in Figure 7.
  • the PRR7 homologue in cereals better known as Ppd, is known to represent a major determinant of the photoperiod response (Turner et ai, 2005; Beaies et a/, 2007) rather than the vernalization response as suggested here for sugar beet.
  • RNA isolation steps were added to the RNA isolation steps to remove contaminants such as polysaccharides and polyphenols and the RNA samples were treated with DNase I (Ambion) for removal of DNA residues.
  • RNA samples were converted to cDNA using the RETROscripi® Kit (Ambion) starting from 1 ⁇ g of total RNA as template.
  • the expression of the BvPRRJ gene was measured by means of quantitative PCR (qPCR) using the Power SYBR® Green PCR Master Mix (Applied Biosystems Inc.) on an ABI PRISM 7700 Sequence Detector instrument.
  • the PCR conditions were as follows: primary denaturation at 95 0 C for 10 min followed by 40 amplification cycles of 15 seconds at 95 0 C and 1 min at 6O 0 C.
  • BvBTU beta tubulin
  • BvICDH isocitrate dehydrogenase
  • the primer sequences designed for these two reference genes consisted of 5' ⁇ TTGTTGAAAATGCAGACGAGTGT-S' (SEQ [D NO: 13) and 5'- AAGATCGCCAAAGCTTGGTG ⁇ 3' for BvBTU (AW063029) (SEQ ID NO: 14) and 5'- CACACCAGATGAAGGCCGT-3' (SEQ ID NO: 15) and 5' ⁇ CCCTGAAGACCGTGCCAT-3' (SEQ ⁇ D NO: 16) for BvICDH (AF173666). AH time points were run on bioiogical triplicates and each qPCR experiment was repeated twice.
  • the bienniai allele is unique for the biennial lines and is never found in the annual entries, which suggest a strong correlation between the allelic variation observed for BvPRR ⁇ and the annual or biennial plant habit. This observation further strengthens the causa! relationship between BvPRR? and the B iocus for vernalization independent flowering in sugar beet. Amongst the 19 SNPs characterized in the coding regions, 7 of them lead to amino acid changes in the predicted protein sequence between the annual and the biennial alleles.
  • any of the SNPs at positions #3827, #3954, #5284, #5714, #10954, #11220, #11391 , #12053, #12127, and #12837 can be used to distinguish all annual alleles from the biennial allele by means of molecular markers targeting one or more of these SNPs.
  • the promoter region also revealed polymorphic between annual and biennial Sines.
  • primers F3808 (SEQ ID NO 29) and R3809 (SEQ ID NO 30) an amplification product of 0.6 Kb is obtained when using genomic DNA from biennial lines as template, but no amplification for the annual lines.
  • PCR conditions for the amplification reaction were as follows: primary denaturation at 95°C for 5 min followed by 35 amplification cycles of 30 seconds at 95 0 C, 30 seconds at 6O 0 C and 30 seconds at 72 0 C and followed by 5 min at 72 0 C.
  • PCR experiments were run at a GeneAMP PCR System 9600 instrument from Applied Biosystems Inc. using Platinum Taq DNA polymerase and the corresponding reaction mix from Invitrogen Corporation as recommended by the supplier. This primer pair thus specifically amplifies the bienniai alleles, but not the annual alleles.
  • Table 1 Polymorphisms observed between 1 annual and 15 biennial sugar beet lines for the BvPRR? gene fragment spanning intron 3.
  • the header row indicates the nucleotide position at the genomic sequence of the BvPRR? gene fragment (SEQ !D NO 5).
  • the remaining rows represent the 2 hapiotypes observed across the panel of 16 lines.
  • Table 3 Genotypes for a number of markers including PRRJ(T 1 ] ⁇ mapping around the B gene across nine F2 plants showing recombination events at either side of the B gene.
  • PRR7(7' ⁇ ) as we ⁇ as 9_27(T2) marker, show a perfect match to the predicted genotype of the B gene.
  • the genotype of the B gene is based on phenotypic evaluation of the F3 populations derived from the individual F2 plants. c b nseom i na ti o r
  • E16M16 20 4 H H B A H B A H B Table 4: Nucleotide sequences of the PCR primers used to amplify and sequence a!! exons of BvPRR7 and part of the introns and promoter or terminator regions. Table 5: Haplotypes and polymorphisms observed in the coding region of BvPRR? amongst 16 biennial and 14 annuai lines
  • the Table shows the 19 polymorphisms identified in the coding regions when comparing the annual and biennial alleles. Poiymorphisms in the Pseudo-receiver and CCT domains are indicated by bolded lines. Amino acid substitutions are indicated by small stars. Amino acid changes specific for the biennial allele are indicated by big stars. The SNP position indicated in the header row are numbered according to SEQ ID NO 5.
  • EXAMPLE 2 Transgenic validation of BvPRRT by means of a complementation study
  • the annual plant habit conferred by the S gene behaves as a single dominant trait; the requirement for vernalization in biennia! plants accordingly is recessive.
  • the transformation of an annual allele of BvPRRT into a biennia! genotype thus is predicted to bestow the annual flowering behavior onto the biennial acceptor genotype.
  • the coding sequence of an annual allele of BvPRR7 under the control of an annual promoter and terminator fragment is transformed into biennial genotype G018.
  • the experimental procedure for the transformation of sugar beet is essentially as disclosed by Chang et a/, 2002 using sugar beet meristems as explant material and the phosphomannose isomerase (PIvII) gene as selectable marker.
  • the plasmid map of the binary vector carrying the gene cassettes for both the PMi selectable marker gene and the annual BvPRR? allele is shown in Figure 9.
  • Transgenic shoots are checked for PMI activity (Joersbo et at, 1998) and subsequently rooted, potted in soil and transferred to the greenhouse.
  • Negative controls consist of non ⁇ transgenic shoots that underwent the same in vitro regeneration procedure, but without Agrobacterium infection and mannose selection. Plants are grown in growth chambers at a constant temperature of 18 0 C and a photoperiod of 17 hours light and 7 hours dark. Under these conditions none of the non ⁇ transgenic controls are supposed to show any signs of bolting during the observation period, whereas annual control plants are supposed to bolt normally within 8 weeks.
  • BvPRR? plays a key role in the vernalization response in sugar beet
  • BvPRR? represents an obvious candidate for engineering bolting resistance by suppressing the vernalization response.
  • a BvPRR? cDNA fragment of 0.6 Kb (SEQ ID NO, 1) is assembled into an RNAi cassette under the control of the constitutive Ubi3 promoter from Arabidopsis (Norris et al, 1993).
  • RNAi cassette is separated by the second intron from the potato StLSI gene (Eckes et a/, 1986; Vancanneyt et al, 1990) to stabilize the RNAi cassette, but also to improve the efficiency of the RNAi phenomenon (Wang and Waterhouse, 2001 ; Smith et a/, 2000).
  • the piasmid map of the binary vector carrying the RNAi gene cassette for BvPRR7 and the PM! selectable marker gene is shown in Figure 10.
  • the RNAi cassette is transformed into the biennial genotype G018 as described in the previous example.
  • PMi-positive shoots and non-transgenic controls are rooted and transferred to the greenhouse for an acclimatization period of two weeks minimum at 18 0 C prior to the vernalization treatment
  • the transgenic plants are exposed to the vernalization treatment consisting of a period of 14 weeks at a constant temperature of 6 0 C and 12 hours low artificial light.
  • vernalized plants Prior to applying bolting-inductive conditions, vernalized plants are siowly acclimatized for two weeks in climate chambers by stepwise increasing the temperature from 10 to 18 °C. Plants are subsequently repotted into to larger pots (2 liter), and monitored for bolting while exposed to a constant temperature of 18 0 C and a long-day photoperiod of 17 hours light / 7 hours dark.
  • Non-transgenic control plants routinely start bolting between four to six weeks post vernalization.
  • Transgenic plants suppressed for BvPRR? frequently show a deiay in bolting ranging from only two weeks to more than two months. A few events may never bolt under the conditions applied in the greenhouse.
  • transgenic plants develop normally and show no phenotypic aberrations, in general, plants delayed in bolting show a higher leaf number at the time of bolting as a result of the prolonged vegetative stage.
  • a Pseudo- Response Regulator is m ⁇ sexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L). Theor. Appl. Genet. 115: 721-733.
  • PSEUDO-RESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian dock. Plant Cell 17: 791-803.
  • MEGA4 Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599.
  • SNP2CAPS a SNP and INDEL analysis tool for CAPS marker development. Nucleic Acids Res 32(1): e5.
  • Pseudo- Response Regulator Ppd ⁇ H1 provides adaptation to photoperiod in bariey. Science 310: 1031-1034,

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Saccharide Compounds (AREA)
PCT/EP2008/056390 2007-05-23 2008-05-23 Polynucleotide markers Ceased WO2008142167A2 (en)

Priority Applications (23)

Application Number Priority Date Filing Date Title
UAA200913022A UA100855C2 (en) 2007-05-23 2008-05-23 Polynucleotide markers
DK08759990.8T DK2152885T3 (da) 2007-05-23 2008-05-23 Polynukleotidmarkører
JP2010508869A JP2010527598A (ja) 2007-05-23 2008-05-23 ポリヌクレオチドマーカー
BRPI0812387-0A2A BRPI0812387A2 (pt) 2007-05-23 2008-05-23 Macadores de polinucleotídeo
US12/601,386 US20100209919A1 (en) 2007-05-23 2008-05-23 Polynucleotide markers
CN200880100228.0A CN101772575B (zh) 2007-05-23 2008-05-23 多核苷酸标志物
CA2687760A CA2687760C (en) 2007-05-23 2008-05-23 Sugar beet polynucleotide markers
EP08759990.8A EP2152885B1 (en) 2007-05-23 2008-05-23 Polynucleotide markers
PL08759990T PL2152885T3 (pl) 2007-05-23 2008-05-23 Markery polinukleotydowe
EA200901525A EA022877B1 (ru) 2007-05-23 2008-05-23 Полинуклеотид гена стрелкования b сахарной свеклы и его применение
CN200980121061.0A CN102057045B (zh) 2007-05-23 2009-05-25 转基因糖用甜菜植物
US12/994,452 US8796506B2 (en) 2007-05-23 2009-05-25 Transgenic sugar beet plants
UAA201015429A UA105489C2 (uk) 2007-05-23 2009-05-25 Трансгенна рослина цукрового буряка
EP09749936.2A EP2291525B1 (en) 2008-05-23 2009-05-25 Transgenic sugar beet plants
DK09749936.2T DK2291525T3 (en) 2008-05-23 2009-05-25 TRANSGENE sugarbeet
PCT/EP2009/056262 WO2009141446A1 (en) 2008-05-23 2009-05-25 Transgenic sugar beet plants
JP2011510002A JP2011520461A (ja) 2007-05-23 2009-05-25 トランスジェニック甜菜植物
PL09749936T PL2291525T3 (pl) 2008-05-23 2009-05-25 Transgeniczne rośliny buraka cukrowego
CA2724419A CA2724419C (en) 2007-05-23 2009-05-25 Transgenic sugar beet plants
EA201001767A EA028355B1 (ru) 2008-05-23 2009-05-25 Трансгенные растения сахарной свеклы
MA32367A MA31495B1 (fr) 2007-05-23 2009-11-20 Marqueurs de polynucleotides
ZA2010/07986A ZA201007986B (en) 2008-05-23 2010-11-08 Transgenic sugar beet plants
MA33397A MA32381B1 (fr) 2008-05-23 2010-12-03 PLANTES TRANSGÉNIQUES DE BETTERAVE SUCRIèRE

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP07108777.9 2007-05-23
EP07108777 2007-05-23

Publications (2)

Publication Number Publication Date
WO2008142167A2 true WO2008142167A2 (en) 2008-11-27
WO2008142167A3 WO2008142167A3 (en) 2009-03-12

Family

ID=39529427

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/056390 Ceased WO2008142167A2 (en) 2007-05-23 2008-05-23 Polynucleotide markers

Country Status (13)

Country Link
US (2) US20100209919A1 (enExample)
EP (3) EP2152885B1 (enExample)
JP (2) JP2010527598A (enExample)
CN (2) CN101772575B (enExample)
BR (1) BRPI0812387A2 (enExample)
CA (2) CA2687760C (enExample)
DK (1) DK2152885T3 (enExample)
EA (1) EA022877B1 (enExample)
MA (1) MA31495B1 (enExample)
PL (1) PL2152885T3 (enExample)
UA (2) UA100855C2 (enExample)
WO (1) WO2008142167A2 (enExample)
ZA (1) ZA200907678B (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009141446A1 (en) * 2008-05-23 2009-11-26 Syngenta Participations Ag Transgenic sugar beet plants
EA028355B1 (ru) * 2008-05-23 2017-11-30 Зингента Партисипейшнс Аг Трансгенные растения сахарной свеклы

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2687760C (en) * 2007-05-23 2017-10-31 Syngenta Participations Ag Sugar beet polynucleotide markers
JP2014516514A (ja) * 2011-04-14 2014-07-17 コンプリート・ジェノミックス・インコーポレイテッド 複合核酸配列データの処理および解析
WO2013103367A1 (en) * 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Somatic ovule specific promoter and methods of use
AU2013224684B2 (en) * 2012-09-13 2017-07-06 Plant Bioscience Limited GENETIC MARKERS FOR Myb28
KR101962669B1 (ko) * 2016-06-08 2019-03-27 동아대학교 산학협력단 푸자리움 푸지쿠로이 종복합체 구분을 위한 프라이머 선별방법 및 프라이머 세트
KR101962636B1 (ko) * 2016-06-08 2019-03-27 동아대학교 산학협력단 실린드로카폰 데스트럭탄스균을 선별하기 위한 프라이머 선별방법 및 프라이머 세트
CN107267660B (zh) * 2017-08-21 2020-10-09 黑龙江大学 检测甜菜雄蕊育性的ssr分子标记及其应用
US11180796B2 (en) 2018-06-13 2021-11-23 International Business Machines Corporation Detection of mutations regarding one or more deoxyribonucleic acid sequences using deterministic lateral displacement arrays
US11149298B2 (en) 2018-06-13 2021-10-19 International Business Machines Corporation Detection of nucleic acid sequences using deterministic lateral displacement arrays
CN109825604B (zh) * 2019-04-03 2022-12-13 中国农业科学院郑州果树研究所 与桃抗蚜性状紧密连锁的分子标记,用于检测桃抗蚜性状的引物、试剂盒、方法及其应用
CN110305981A (zh) * 2019-08-05 2019-10-08 辽宁省果树科学研究所 一种杏果实硬度关键基因的分子标记pg1524及其检测方法和应用
CN110527740B (zh) * 2019-09-11 2022-03-22 东北农业大学 一种与印度南瓜强雌基因紧密连锁的分子标记、引物及应用
CN111518916B (zh) * 2020-02-28 2022-07-15 南京农业大学 猪13号染色体与二花脸猪产活仔数显著相关的snp标记及其检测方法与应用
CN116121437B (zh) * 2022-11-07 2023-10-13 中国热带农业科学院南亚热带作物研究所 一种杧果品种的snp标记组合及杧果育种中的应用
CN117625635A (zh) * 2023-10-31 2024-03-01 长江大学 甘蓝型油菜BnPPD基因、突变体及其应用

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL8300698A (nl) 1983-02-24 1984-09-17 Univ Leiden Werkwijze voor het inbouwen van vreemd dna in het genoom van tweezaadlobbige planten; agrobacterium tumefaciens bacterien en werkwijze voor het produceren daarvan; planten en plantecellen met gewijzigde genetische eigenschappen; werkwijze voor het bereiden van chemische en/of farmaceutische produkten.
GB2148322B (en) 1983-09-03 1987-10-07 Bass Plc Beer and other beverages and their manufacture
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5350689A (en) 1987-05-20 1994-09-27 Ciba-Geigy Corporation Zea mays plants and transgenic Zea mays plants regenerated from protoplasts or protoplast-derived cells
ES2074999T3 (es) 1987-05-20 1995-10-01 Ciba Geigy Ag Plantas de zea mays y plantas de zea mays transgenicas regeneradas de protoplastos o celulas derivadas de protoplastos.
NZ225044A (en) 1987-06-19 1990-01-29 Plant Cell Res Inst Bertholletia excelsa dna molecule; sulphur rich storage protein
EP0332581B1 (de) 1988-03-08 1996-12-11 Ciba-Geigy Ag Regeneration von fertilen Gramineen-Pflanzen aus der Unterfamilie Pooideae ausgehend von Protoplasten
JP2955759B2 (ja) 1988-07-20 1999-10-04 セゲブ・ダイアグノスティックス・インコーポレイテッド 核酸配列を増幅及び検出する方法
US5501967A (en) 1989-07-26 1996-03-26 Mogen International, N.V./Rijksuniversiteit Te Leiden Process for the site-directed integration of DNA into the genome of plants
US5270163A (en) 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
FR2673642B1 (fr) 1991-03-05 1994-08-12 Rhone Poulenc Agrochimie Gene chimere comprenant un promoteur capable de conferer a une plante une tolerance accrue au glyphosate.
HU218034B (hu) 1992-01-09 2000-05-28 Novartis Ag. Új növényi promoter
US6140466A (en) 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
AU704601B2 (en) 1994-01-18 1999-04-29 Scripps Research Institute, The Zinc finger protein derivatives and methods therefor
EP0781331B1 (en) 1994-08-20 2008-09-03 Gendaq Limited Improvements in or relating to binding proteins for recognition of dna
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
EP1068311B2 (en) 1998-04-08 2020-12-09 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
AR020078A1 (es) 1998-05-26 2002-04-10 Syngenta Participations Ag Metodo para alterar la expresion de un gen objetivo en una celula de planta
US20040031072A1 (en) * 1999-05-06 2004-02-12 La Rosa Thomas J. Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement
US20100293669A2 (en) * 1999-05-06 2010-11-18 Jingdong Liu Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
US20070234438A1 (en) * 2000-05-08 2007-10-04 Abad Mark S Nucleic acid molecules and other molecules associated with plants
US20040181830A1 (en) * 2001-05-07 2004-09-16 Kovalic David K. Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement
BR0113156A (pt) 2000-08-11 2003-07-08 Syngenta Participations Ag Método para produzir um planta dicotiledÈnea transformada, célula de planta transformada, cultura de múltiplos brotos, planta transformada, semente produzida pela planta transformada, método para produzir uma planta compreendendo um genoma de plastìdeo transformado, genoma de plastìdeo transformado, e, plastìdeo
MXPA05013190A (es) * 2003-06-06 2007-05-23 Arborgen Llc Factores de transcripcion.
US20060150283A1 (en) * 2004-02-13 2006-07-06 Nickolai Alexandrov Sequence-determined DNA fragments and corresponding polypeptides encoded thereby
AU2006266251A1 (en) * 2005-06-30 2007-01-11 Syngenta Participations Ag Methods for screening for gene specific hybridization polymorphisms (GSHPs) and their use in genetic mapping and marker development
WO2007122086A1 (en) * 2006-04-21 2007-11-01 Syngenta Participations Ag Transgenic plants and methods for controlling bolting in sugar beet
CA2687760C (en) * 2007-05-23 2017-10-31 Syngenta Participations Ag Sugar beet polynucleotide markers

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
EL-MEZAWY ET AL., THEOR APPL GENET, vol. 105, 2002, pages 100 - 105
HOHMANN ET AL., MOL GEN GENOMICS, vol. 269, 2003, pages 126 - 136
HOHMANN; GAAFAR ET AL., THEOR APPL GENET, vol. 110, 2005, pages 1027 - 1037

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009141446A1 (en) * 2008-05-23 2009-11-26 Syngenta Participations Ag Transgenic sugar beet plants
EA028355B1 (ru) * 2008-05-23 2017-11-30 Зингента Партисипейшнс Аг Трансгенные растения сахарной свеклы

Also Published As

Publication number Publication date
CA2687760A1 (en) 2008-11-27
EP2390335A2 (en) 2011-11-30
WO2008142167A3 (en) 2009-03-12
JP2010527598A (ja) 2010-08-19
CA2687760C (en) 2017-10-31
CN101772575B (zh) 2015-03-11
EP1995320A3 (en) 2009-01-07
CA2724419C (en) 2018-11-13
CA2724419A1 (en) 2009-11-26
JP2011520461A (ja) 2011-07-21
UA105489C2 (uk) 2014-05-26
EP1995320A2 (en) 2008-11-26
ZA200907678B (en) 2010-07-28
DK2152885T3 (da) 2014-08-18
EA022877B1 (ru) 2016-03-31
CN101772575A (zh) 2010-07-07
EP2152885A2 (en) 2010-02-17
US20100209919A1 (en) 2010-08-19
PL2152885T3 (pl) 2014-11-28
EP2152885B1 (en) 2014-06-18
EP2390335A3 (en) 2012-03-21
CN102057045B (zh) 2018-06-05
CN102057045A (zh) 2011-05-11
EA200901525A1 (ru) 2010-10-29
US20110138492A1 (en) 2011-06-09
UA100855C2 (en) 2013-02-11
MA31495B1 (fr) 2010-07-01
BRPI0812387A2 (pt) 2014-11-04
US8796506B2 (en) 2014-08-05

Similar Documents

Publication Publication Date Title
EP2390335A2 (en) Polynucleotide markers
AU779565B2 (en) Methods and means for modification of plant characteristics using the vernalization gene VRN2
AU782427B2 (en) Methods and means for modification of plant flowering characteristics
Boss et al. A cDNA from grapevine (Vitis vinifera L.), which shows homology to AGAMOUS and SHATTERPROOF, is not only expressed in flowers but also throughout berry development
WO1996014414A1 (en) Genetic control of flowering
WO2002077185A2 (en) Methods for modifying flowering phenotypes
AU2020201507B2 (en) Methods and means for modulating flowering time in monocot plants
DK2291525T3 (en) TRANSGENE sugarbeet
CN108148845B (zh) 一种增强植物耐盐性的玉米ZmKNOLLE基因、蛋白及用途
EP2291525B1 (en) Transgenic sugar beet plants
KR101592863B1 (ko) 왜성 표현형을 나타내는 D-h 유전자 및 이의 용도

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880100228.0

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08759990

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2008759990

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2151/MUMNP/2009

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2010508869

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2687760

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 200901525

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: A200913022

Country of ref document: UA

WWE Wipo information: entry into national phase

Ref document number: 12601386

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0812387

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20091123