WO2008054726A2 - Targeting nbs1-atm interaction to sensitize cancer cells to radiotherapy and chemotherapy - Google Patents
Targeting nbs1-atm interaction to sensitize cancer cells to radiotherapy and chemotherapy Download PDFInfo
- Publication number
- WO2008054726A2 WO2008054726A2 PCT/US2007/022886 US2007022886W WO2008054726A2 WO 2008054726 A2 WO2008054726 A2 WO 2008054726A2 US 2007022886 W US2007022886 W US 2007022886W WO 2008054726 A2 WO2008054726 A2 WO 2008054726A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- polypeptide
- nbsl
- atm
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 C*C(C(C)*)N Chemical compound C*C(C(C)*)N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
- C07K14/43—Sweetening agents, e.g. thaumatin, monellin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
Definitions
- Radiotherapy is considered one of the most important and powerful treatments for many cancers, especially for localized cancers that have no metastases.
- tumors to be treated by radiotherapy only a few are highly responsive, including the lymphomas and seminomas.
- many other solid tumors such as melanoma, glioblastoma, and prostate cancer etc., are typically very resistant to radiation, and they tend to progress even after high dose radiation.
- Treatment regimens often become more complicated when radiation oncologists consider normal tissue damage, a response that limits the dose and number of fractions in a treatment protocol.
- this invention relates to novel radiosensitizers and methods of making and use thereof. Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.
- Figure 1 shows development of the NBSl inhibitory peptides.
- Figure IA shows schematic illustration of functional domains of ATM and NBSl and their interaction. The C-terminal of NBSl is required for ATM activation and recruitment to sites of DNA damage. It consists of at least two sets of amino acid residues, 736-737 (EE) and 741-743 (DDL), that are evolutionarily conserved and necessary for ATM binding. NBSl binds to two sets of the Heat Repeats (Heat Repeat 2 (a.a. 248-522), and Heat Repeat 7 (a.a.1436- 1770), in ATM.
- Figure IB shows the amino acid sequences for the Rg, wtNIP, and scNIP peptides developed.
- Figure 2 shows peptide internalization and cytotoxicity.
- Figure 2A shows HeLa cells were treated with lO ⁇ M Rg, wtNIP, or scNIP for one hour and analyzed by immunofluorescence microscopy after staining with Fluorescein-co ⁇ jugated streptavidin.
- Figure 2B shows HeLa cells were treated with Taxol and the NIP peptides at indicated doses. 24 hours after treatment, cell survival was quantified by a standard MTT assay.
- Figure 3 shows wtNIP inhibits NBSl-ATM binding.
- HeLa cells treated with the NIP peptides were irradiated (0 or 6Gy). Immunoprecipitation was performed with a rabbit NBSl antibody, and Western blotting was performed with monoclonal antibodies against ATM, NBSlor MREl l.
- Figure 4 shows wtNIP can inhibit ⁇ -H2AX focus formation.
- Figure 4A shows HeLa cells were treated with lO ⁇ M Rg, wtNIP, or scNIP for one hour, irradiated with 0 or 6Gy, and harvested 30 minutes later before immunofluorescence microscopy was employed to detect radiation induced- ⁇ -H2AX foci.
- Figure 4B shows the mean ⁇ -H2AX nuclear foci per nucleus determined for each image using Image Pro 5.1 software, expressed in arbitrary units. Error bars represent +/-1 SD, graphed are the mean of three independent experiments.
- Figure 5 shows exposure to the wtNIP peptide abrogates IR-induced NBSl phosphorylation.
- Figure 5 A shows HeLa cells were treated with lO ⁇ M R 9 , wtNIP, or scNIP for one hour, irradiated with 0 or 6Gy, and harvested 120 minutes later before immunofluorescence microscopy was employed to detect radiation induced-NBSl focus formation using an anti-Ser343 NBSl antibody.
- Figure 4B shows the mean number of NBS 1 foci per nucleus determined from a population of at least 25 cells in three independent experiments. Error bars represent +/-1 SD, graphed are the mean of three independent experiments.
- Figure 6 shows wtNIP increases cellular radiosensitivity.
- Figure 6A shows cells seeded at limiting dilutions and treated with lO ⁇ M Rg, wtNEP, or scNIP for one hour prior to irradiation, continuously exposed to the peptides for 24 hours, harvested 10-12 days later, and stained with crystal violet. Shown in A (HeLa), C (MO59J) and D (GM9607) are the susvival curves after indicated doses of radiation. Error bars represent +/- 1 SEM, graphed are the mean of three independent experiments.
- Figure 6B shows representative plates of the clonogenic assay for NIP mediated radiosensitivity in HeLa cells.
- Figure 7 shows degradation of the Rg, wtNIP or scNIP peptides.
- HeLa cells were treated with 10 ⁇ M R 9 , wtNIP, or scNIP for one hour and harvested at indicated time points before they were analyzed by immunofluorescence microscopy staining with an anti-streptavidin antibody.
- Figure 8 shows wtNIP inhibits ⁇ -H2AX focus formation in the prostate cancer cell line DU-145.
- Figure 8A shows DU-145 cells were treated with lO ⁇ M R 9 , wtNIP, or scNIP for one hour, irradiated with 0 or 6Gy, and harvested 30 minutes later before immunofluorescence microscopy was employed to detect radiation induced- ⁇ -H2AX foci.
- Figure 8B shows the mean ⁇ -H2AX nuclear foci per nucleus determined for each image using Image Pro 5.1 software and is expressed in arbitrary units. Error bars represent +/-1 SD, graphed are the mean of three independent experiments.
- Figure 9 shows exposure to the wtNIP peptide abrogates IR-induced NBSl phosphorylation in the prostate cancer cell line DU- 145.
- Figure 9 A shows DU- 145 cells were treated with lO ⁇ M R 9 , wtNIP, or scNIP for one hour, irradiated with 0 or 6Gy, and harvested 120 minutes later before immunofluorescence microscopy was employed to detect radiation induced-NBSl foci formation using an anti-Ser343 NBSl antibody.
- Figure 9B shows the mean number of NBSl foci per nucleus was determined from a population of at least 25 cells in three independent experiments. Error bars represent +/-1 SD, graphed are the mean of three independent experiments.
- Figure 10 shows fluorescence polarization with bound and free Texas red labeled NBSl peptides.
- Radiotherapy in order to increase the sensitivity of a cell, such as a cancer cell, to radiotherapy and chemotherapy.
- Radiotherapy also has applications in non-malignant conditions, such as the treatment of trigeminal neuralgia, severe thyroid eye disease, pterygium, prevention of keloid scar growth, and prevention of heterotopic ossification.
- biological targeting requires in-depth understanding of the mechanism of cellular responses pertaining to cell proliferation, DNA repair and cell death. It is well known that cellular responses to irradiation (IR)- induced DNA damage are controlled by a concisely organized signal transduction network. This network is composed of a number of gene products, which include sensors, transducers and effectors.
- DNA double strand breaks are detected by sensor molecules that trigger the activation of transducing kinases. These transducers then phosphorylate effector molecules to regulate signaling cascades that control cell cycle checkpoints, influence DNA repair machinery, or trigger apoptotic pathways.
- One central element in the network is the ATM protein, mutation of which contributes to the human autosomal recessive disorder named ataxia-telangiectasia (A-T) (Shiloh, 2003).
- A-T is characterized by progressive neuro-degeneration, a variable immunodeficiency, an extremely high predisposition to the development of lymphoid malignancies and hypersensitivity to IR.
- ATM Ataxia Telangiectasia Mutated
- the ATM gene encodes a 370-KD protein kinase, which consists of several functional domains, including an FAT domain that is conserved among the above mentioned PI3 kinases and may function as a protein-protein interaction domain.
- the kinase domain can phosphorylate serine/ threonine followed by glutamine (the S/T-Q consensus sequence), and the FAT carboxy-terminal domain (FATC) may regulate protein activity and stability.
- FAT carboxy-terminal domain FATC
- the other model for ATM activation is based on the fact that ATM activation is impaired in the absence of NBSl and Mrel 1, both of which form a complex with Rad50 (the so-called MRN complex).
- MRN complex is highly conserved, influencing each aspect of chromosome break metabolism and is considered a DNA damage sensor to detect strand breaks (Difilippantonio et al., 2005; Dupre et al., 2006).
- a conserved C- terminus motif of NBSl binds to several HEAT repeats of ATM, an interaction that is essential to activate the kinase (Falck et al., 2005).
- ATM is central to the cellular response to irradiation, blocking its activation or activity can make virtually any type of tumor much more sensitive to radiation. Since cloning the gene in 1995, a number of investigators have employed several methods to target ATM. These methods include antisense RNA, small interfering RNA (siRNA), and screening of small molecule inhibitors of ATM. Zhang et al., successfully sublconed the full length cDNA of ATM in the opposite orientation into CB3 AR cells, where it was shown to significantly increase radiosensitivity. The anti- sense construct imparted an approximate 3-fold increase in radiation sensitivity, similar to that observed in A-T cells.
- siRNA small interfering RNA
- siRNA that could inhibit ATM function in prostate cancer cells.
- Collis et al. designed, and delivered, an exogenous plasmid encoding siRNA' s targeting ATM in human cancer cells.
- Both DU- 145 and PC-3 cells when transfected with these plasmids, exhibited an increase in radiosensitivity at clinically relevant radiation doses (Collis et al., 2003).
- stable transfection of HeIa cells with an ATM specific siRNA led to a 10-fold increase in sensitivity to ionizing radiation.
- Hickson et al. reported a compound (KU55933) to selectively inhibit the ATM kinase. Their studies have shown a significant increase in radiosensitivity in HeIa cells, and as much as 35.5 fold increases in sensitivity to etoposide (Hickson et al., 2004). However the in vivo radiosensitization effect and the toxicity of the compounds have not been reported.
- NBSl-ATM interaction is important for IR-induced activation of ATM and limiting radiosensitivity
- an approach for developing radiosensitizers that selectively disrupt the signaling pathway is the use of small non-functional peptides to block NBSl-ATM interaction.
- a small peptide containing the wild-type C-terminal NBSl sequence can inhibit NBSl-ATM interaction and ATM activation.
- a small peptide comprising the heat repeat sequences of ATM can inhibit NBSl-ATM interaction and ATM activation.
- the terms "peptide” and "polypeptide” are used herein synonymously to refer to a polymer of two or more amino acids and are not meant to denote a particular length or method of making.
- an isolated polypeptide comprising a carboxy-terminal amino acid sequence of NBSl, or a conservative variant thereof (also referred to herein as NIP).
- the provided peptide can comprise amino acids 734 to 754 of SEQ ED NO:1.
- the provided peptide can comprise a conservative amino acid substitution within the C-terminal-most 4 to 30 amino acids, including amino acids 734 to 754, of NBSl (SEQ ID NO:1).
- the peptide can comprise 1, 2 or 3 conservative amino acid substitutions, hi some aspects, the peptide comprises the amino acid sequence xEExxxDDLx, where x is any amino acid (SEQ ID NO:55).
- the peptide can comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ED NO:3, SEQ BD NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO: 10.
- polypeptide comprising the NBSl -binding sequences of ATM, or a conservative variant thereof.
- the polypeptide can comprise the heat repeat sequences of ATM, or a fragment thereof, that binds NBSl .
- the provided polypeptide can comprise SEQ ID NO:56.
- the provided polypeptide can comprise SEQ BD NO:57.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ID NO:56, or a fragment thereof, that binds NBSl.
- polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ID NO:57, or a fragment thereof, that binds NBSl.
- the provided polypeptides can inhibit the binding of ATM to the carboxy-terminus of NBSl. Also as disclosed herein, the provided polypeptides can increase the sensitivity of cells, such as cancer cells, to radiotherapy and chemotherapy.
- the herein provided isolated polypeptides are in a pharmaceutical composition suitable for administration to a subject.
- the herein provided polypeptide can be any polypeptide comprising the carboxy-terminal most amino acids of NBSl, provided that the peptide is not the full- length NBSl.
- the provided polypeptide can comprise the C-terminal-most 4 to 30 amino acids of NBSl, including the C-terminal most 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino acids of NBSl, or a fragment thereof.
- the provided polypeptide can comprise amino acids 734 to 754 of NBSl (SEQ BD NO:1).
- the provided polypeptide can comprise a conservative amino acid substitution within the C-terminal-most 4 to 30 amino acids, including amino acids 734 to 754, of NBSl (SEQ ID NO:1).
- the peptide can comprise 1, 2 or 3 conservative amino acid substitutions.
- the polypeptide can comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ED NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ DD NO:6, SEQ ID NO:7, SEQ ED NO:8, SEQ ED NO:9, or SEQ ID NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 96% sequence identity to SEQ ID NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ED NO:8, SEQ ED NO:9, or SEQ ID NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 97% sequence identity to SEQ ID NO:3, SEQ ID NO:4, SEQ ED NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ED NO:9, and SEQ ED NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 98% sequence identity to SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ED NO:8, SEQ ED NO:9, and SEQ ED NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 99% sequence identity to SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ ED NO:6, SEQ ED NO:7, SEQ ED NO: 8, SEQ ED NO:9, and SEQ ED NO: 10.
- the polypeptide does not comprise the C-terminal most 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, for example.
- the peptide can comprise amino acids 734-753, 734-752, 734-751, 734-750, 734-749, 734-748, 734-747, 734-746, 734- 745, 734-744 of NBSl.
- the peptide can in some aspects not comprise amino acids 754, 753, 752, 751, 750, 749, 748, 747, 746, 745 of NBSl.
- NBSl The C-terminal of NBSl is required for ATM activation and recruitment to sites of DNA damage. It comprises at least two sets of amino acid residues, 736-737 (EE) and 741-743 (DDL), that are evolutionarily conserved and necessary for ATM binding.
- EE 736-737
- DDL 741-743
- the NBSl can comprises the amino acid sequence xEExxxDDLx, where x is any amino acid sequence (SEQ ED NO:55).
- the herein provided polypeptide can be any polypeptide comprising the NBSl -binding domain of ATM, provided that the peptide is not the full- length ATM.
- the herein provided polypeptide can be any polypeptide comprising heat repeats 2 and/or 7 of ATM.
- the herein provided polypeptide can be any polypeptide comprising amino acids 248-522 of the ATM sequence disclosed in SEQ ED NO:51.
- the herein provided polypeptide can be any polypeptide comprising amino acids SEQ ED NO:56.
- the herein provided polypeptide can be any polypeptide comprising amino acids 1436-1770 of ATM (SEQ ED NO:51).
- the herein provided polypeptide can be any polypeptide comprising amino acids SEQ ED NO:57.
- the provided polypeptide can comprise a conservative amino acid substitution within the heat repeats 2 and/or 7 of ATM.
- the peptide can comprise 1, 2 or 3 conservative amino acid substitutions.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ED NO:56 or SEQ ED NO:57.
- the polypeptide can comprise an amino acid sequence with at least 96% sequence identity to SEQ ED NO:56 or SEQ ED NO:57.
- the polypeptide can comprise an amino acid sequence with at least 97% sequence identity to SEQ ID NO:56 or SEQ ID NO:57.
- the polypeptide can comprise an amino acid sequence with at least 98% sequence identity to SEQ ID NO:56 or SEQ ID NO:57.
- the polypeptide can comprise an amino acid sequence with at least 99% sequence identity to SEQ ID NO:56 or SEQ ID NO:57.
- the provided polypeptide can further constitute a fusion protein or otherwise have additional N-terminal, C-terminal, or intermediate amino acid sequences, e.g., linkers or tags.
- Linker is an amino acid sequences or insertion that can be used to connect or separate two distinct polypeptides or polypeptide fragments, wherein the linker does not otherwise contribute to the essential function of the composition.
- a polypeptide provided herein can have an amino acid linker comprising, for example, the amino acids GLS, ALS, or LLA.
- a "tag”, as used herein, refers to a distinct amino acid sequence that can be used to detect or purify the provided polypeptide, wherein the tag does not otherwise contribute to the essential function of the composition.
- the provided polypeptide can further have deleted N-terminal, C-terminal or intermediate amino acids that do not contribute to the essential activity of the polypeptide.
- the herein disclosed polypeptide can be a fusion protein.
- Fusion proteins also know as chimeric proteins, are proteins created through the joining of two or more genes which originally coded for separate proteins. Translation of this fusion gene results in a single polypeptide with function properties derived from each of the original proteins.
- Recombinant fusion proteins can be created artificially by recombinant DNA technology for use in biological research or therapeutics. Chimeric mutant proteins occur naturally when a large-scale mutation, typically a chromosomal translocation, creates a novel coding sequence containing parts of the coding sequences from two different genes.
- the functionality of fusion proteins is made possible by the fact that many protein functional domains are modular. In other words, the linear portion of a polypeptide which corresponds to a given domain, such as a tyrosine kinase domain, may be removed from the rest of the protein without destroying its intrinsic enzymatic capability. Thus, any of the herein disclosed functional domains can be used to design a fusion protein.
- a recombinant fusion protein is a protein created through genetic engineering of a fusion gene. This typically involves removing the stop codon from a cDNA sequence coding for the first protein, then appending the cDNA sequence of the second protein in frame through ligation or overlap extension PCR. That DNA sequence will then be expressed by a cell as a single protein.
- the protein can be engineered to include the full sequence of both original proteins, or only a portion of either.
- linker or "spacer" peptides are also added which make it more likely that the proteins fold independently and behave as expected.
- linkers in protein or peptide fusions are sometimes engineered with cleavage sites for proteases or chemical agents which enable the liberation of the two separate proteins.
- This technique is often used for identification and purification of proteins, by fusing a GST protein, FLAG peptide, or a hexa-his peptide (aka: a 6xhis-tag) which can be isolated using nickel or cobalt resins (affinity chromatography).
- Chimeric proteins can also be manufactured with toxins or anti-bodies attached to them in order to study disease development.
- IRES elements can be used to create multigene, or polycistronic, messages.
- IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988).
- IRES elements from two members of the picornavirus family polio and encephalomyocarditis have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991).
- IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages.
- IRES element By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (U.S. Pat. Nos. 5,925, 565 and 5,935,819; PCT/US99/05781). IRES sequences are known in the art and include those from encephalomycarditis virus (EMCV) (Ghattas, I. R. et al., MoI. Cell.
- EMCV encephalomycarditis virus
- the NBSl peptide can be linked to an internalization sequence or a protein transduction domain to effectively enter the cell.
- Peptide mediated cytotoxicity has also been shown to be less with polyarginine- based internalization sequences.
- R 9 mediated membrane transport is facilitated through heparan sulfate proteoglycan binding and endocytic packaging. Once internalized, heparan is degraded by heparanases, releasing R 9 which leaks into the cytoplasm (Deshayes et al., 2005).
- derivatives of polyarginine can deliver a full length p53 protein to oral cancer cells, suppressing their growth and metastasis, defining polyarginine as a potent cell penetrating peptide (Takenobu et al., 2002).
- the provided polypeptide can comprise a cellular internalization transporter or sequence.
- the cellular internalization sequence can be any internalization sequence known or newly discovered in the art, or conservative variants thereof.
- Non-limiting examples of cellular internalization transporters and sequences include Polyarginine (e.g., R 9 ), Antennapedia sequences, TAT, HFV-Tat, Penetratin, Antp-3A (Antp mutant), Buforin II, Transportan, MAP (model amphipathic peptide), K-FGF, Ku70, Prion, pVEC, Pep-1, SynBl, Pep-7, HN-I, BGSC (Bis-Guanidinium-Spermidine-Cholesterol, and BGTC (Bis- Guanidinium-Tren-Cholesterol) (see Table 1).
- Table 1 Cell Internalization Transporters
- Antp-3A RQIA ⁇ WFQNRRMKWAA SEQ ID NO:22
- the provided polypeptide can further comprise the amino acid sequence SEQ DD NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 , SEQ ID NO:32, SEQ ID NO:33, or SEQ ID NO:34. See Bucci, M. et al. 2000. Nat. Med. 6, 1362-1367; Derossi, D., et al. 1994. Biol.Chem.
- the provided polypeptide can further comprise BGSC (Bis-Guanidinium-Spermidine-Cholesterol) or BGTC (Bis-Guanidinium-Tren-Cholesterol) (Vigneron, J.P. et al. 1998. Proc. Natl. Acad. Sci. USA. 93, 9682-9686).
- BGSC Bis-Guanidinium-Spermidine-Cholesterol
- BGTC Bis-Guanidinium-Tren-Cholesterol
- the polypeptide can comprise the carboxy-terminal most amino acids of NBSl and a polyarginine internalization sequence.
- the polypeptide can comprise the amino acid sequence SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, or SEQ ID NO:42. 5.
- a preferred radiosensitizer only sensitizes tumor cells, and spares normal cells.
- polypeptides e.g., modified or fusion proteins
- tumor vasculature differs from the vasculature of surrounding normal tissues, both in morphology and biochemistry, this difference has received increased attention in recent years as an important determinant of tumor progression and as a potential target for novel anti-cancer therapies.
- angiogenesis-related molecules such as certain integrins, endothelial cell growth factor receptors, proteases, cell surface proteoglycans and extracellular matrix components (Ruoslahti, 2000).
- NGR-containing peptides have proven useful for delivering cytotoxic drugs, pro-apoptotic peptides, and the tumor necrosis factor or to tumor vasculature (Ellerby et al., 1999; Arap et al., 1998; Arap et al., 2002; Curnis et al., 2002).
- GSL GSL
- the tumor homing of the phage carrying the RGD, NGR and GSL motif peptides is independent of the tumor type (Arap et al., 1998; Pasqualini et al., 2000; Pasqualini et al., 1997), rather, the homing depends on the angiogenic characteristics of the tumor vasculature.
- the receptor for the NGR tumor homing peptides is not an integrin. Instead, aminopeptidase N (APN or CD 13) has been identified as the receptor for the NGR motif peptides in tumor vasculature (Pasqualini et al., 2000).
- the NGR-containing peptides have proven useful for delivering cytotoxic drugs, pro-apoptotic peptides, and the tumor necrosis factor a to tumor vasculature (Ellerby et al., 1999; Arap et al., 1998; Arap et al., 2002; Curnis et al., 2002). More interestingly, it has been shown that NGR peptides can bind to prostatic primary and metastatic tumors, but not to normal prostate tissues (Pasqualini et al., 2000). The NGR peptide also displays the ability for cytosolic internalization (Arap et al., 1998).
- the targeting molecule of the present polypeptide can be used as the targeting molecule of the present polypeptide (e.g., in a fusion protein comprising an NIP).
- the targeting molecule can be a molecule (e.g., an antibody or aptamer) that interacts with human epithelial cell mucin (Muc-1; a 20 amino acid core repeat for Muc-1 glycoprotein, present on breast cancer cells and pancreatic cancer cells), the Ha-ras oncogene product, p53, carcino-embryonic antigen (CEA), the raf oncogene product, gpl00/pmell7, GD2, GD3, GM2, TF, sTn, MAGE-I, MAGE-3, BAGE, GAGE, tyrosinase, gp75, Melan-
- human epithelial cell mucin Moc-1; a 20 amino acid core repeat for Muc-1 glycoprotein, present on breast cancer cells and pancreatic cancer cells
- PSA prostate-specific antigen
- HPV-16 MUM
- CO17-1A GA733, gp72, p53
- the ras oncogene product HPV E7
- Wilm's tumor antigen-1 telomerase
- melanoma gangliosides or a simple transmembrane sequence.
- Immunoliposome-mediated targeting using monoclonal antibodies to folate receptor (E. Mastrobattista, G. A. Koning, and G. Storm, "Immonoliposomes for the Targeted Delivery of Antitumor Drugs,” Adv Drug Delivery Reviews 1999, 40: 103-27; J. Sudimack and R. J. Lee, "Targeted Drug Delivery Via Folate Receptor,” Adv Drug
- the herein provided polypeptide can further comprise a tumor specific targeting sequence.
- the tumor specific targeting sequence can comprise an RGD, NGR, or GSL motif.
- the tumor specific targeting sequence targets tumor blood vessel endothelial cells.
- the polypeptide can comprise the amino acid sequence set forth in SEQ K) NO:11 or SEQ ID NO: 12.
- compositions can further comprise an effector molecule.
- effector molecule is meant a substance that acts upon the target cell(s) or tissue to bring about a desired effect.
- the effect can, for example, be the labeling, activating, repressing, or killing of the target cell(s) or tissue.
- the effector molecule can, for example, be a small molecule, pharmaceutical drug, toxin, fatty acid, detectable marker, conjugating tag, nanoparticle, or enzyme.
- small molecules and pharmaceutical drugs that can be conjugated to a targeting peptide are known in the art.
- the effector can be a cytotoxic small molecule or drug that kills the target cell.
- the small molecule or drug can be designed to act on any critical cellular function or pathway.
- the small molecule or drug can inhibit the cell cycle, activate protein degredation, induce apoptosis, modulate kinase activity, or modify cytoskeletal proteins. Any known or newly discovered cytotoxic small molecule or drugs is contemplated for use with the targeting peptides.
- the effector can be a toxin that kills the targeted cell.
- Non-limiting examples of toxins include abrin, modeccin, ricin and diphtheria toxin. Other known or newly discovered toxins are contemplated for use with the provided compositions.
- Fatty acids i.e., lipids
- the fatty acid is a polar lipid.
- the fatty acid can be a phospholipid.
- the provided compositions can comprise either natural or synthetic phospholipid.
- the phospholipids can be selected from phospholipids containing saturated or unsaturated mono or disubstituted fatty acids and combinations thereof.
- These phospholipids can be dioleoylphosphatidylcholine, dioleoylphosphatidylserine, dioleoylphosphatidylethanolamine, dioleoylphosphatidylglycerol, dioleoylphosphatidic acid, palmitoyloleoylphosphatidylcholine, palmitoyloleoylphosphatidylserine, palmitoyloleoylphosphatidylethanolamine, palmitoyloleoylphophatidylglycerol, palmitoyloleoylphosphatidic acid, palmitelaidoyloleoylphosphatidylcholine, palmitelaidoyloleoylphosphatidylserine, palmitelaidoyloleoylphosphatidylethanolamine, palmitelaidoyloleoylphosphatidylglycerol, palmi
- These phospholipids may also be the monoacylated derivatives of phosphatidylcholine (lysophophatidylidylcholine), phosphatidylserine (lysophosphatidylserine), phosphatidylethanolamine (lysophosphatidylethanolamine), phophatidylglycerol (lysophosphatidylglycerol) and phosphatidic acid (lysophosphatidic acid).
- the monoacyl chain in these lysophosphatidyl derivatives may be palimtoyl, oleoyl, palmitoleoyl, linoleoyl myristoyl or myristoleoyl.
- the phospholipids can also be synthetic. Synthetic phospholipids are readily available commercially from various sources, such as AVANTI Polar Lipids (Albaster, Ala.); Sigma Chemical Company (St. Louis, Mo.). These synthetic compounds may be varied and may have variations in their fatty acid side chains not found in naturally occurring phospholipids.
- the fatty acid can have unsaturated fatty acid side chains with C14, C16, C18 or C20 chains length in either or both the PS or PC.
- Synthetic phospholipids can have dioleoyl (18:1)-PS; palmitoyl (16:0)-oleoyl (18:1)-PS, dimyristoyl (14:0)-PS; dipalmitoleoyl (16:1)-PC, dipalmitoyl (16:0)-PC, dioleoyl (18:1)- PC, palmitoyl (16:0)-oleoyl (18: 1)-PC, and myristoyl (14:0)-oleoyl (18: 1)-PC as constituents.
- the provided compositions can comprise palmitoyl 16:0.
- Detectable markers include any substance that can be used to label or stain a target tissue or cell(s).
- detectable markers include radioactive isotopes, enzymes, fluorochromes, and quantum dots (Qdot®).
- Qdot® quantum dots
- the effector molecule can be a nanoparticle, such as a heat generating nanoshell.
- 'nanoshell' is a nanoparticle having a discrete dielectric or semi- conducting core section surrounded by one or more conducting shell layers.
- U.S. Patent No. 6,530,944 is hereby incorporated by reference herein in its entirety for its teaching of the methods of making and using metal nanoshells.
- Nanoshells can be formed with a core of a dielectric or inert material such as silicon, coated with a material such as a highly conductive metal which can be excited using radiation such as near infrared light (approximately 800 to 1300 run). Upon excitation, the nanoshells emit heat.
- the resulting hyperthermia can kill the surrounding cell(s) or tissue.
- the combined diameter of the shell and core of the nanoshells ranges from the tens to the hundreds of nanometers.
- Near infrared light is advantageous for its ability to penetrate tissue.
- Other types of radiation can also be used, depending on the selection of the nanoparticle coating and targeted cells. Examples include x-rays, magnetic fields, electric fields, and ultrasound.
- the problems with the existing methods for hyperthermia, especially for use in cancer therapy, such as the use of heated probes, microwaves, ultrasound, lasers, perfusion, radiofrequency energy, and radiant heating is avoided since the levels of radiation used as described herein is insufficient to induce hyperthermia except at the surface of the nanoparticles, where the energy is more effectively concentrated by the metal surface on the dielectric.
- the particles can also be used to enhance imaging, especially using infrared diffuse photon imaging methods.
- Targeting molecules can be antibodies or fragments thereof, ligands for specific receptors, or other proteins specifically binding to the surface of the cells to be targeted.
- the effector molecule can be a radioactive isotope.
- the effector molecule can be a material, such as a "seed" or wire comprising any radioactive isotope suiteable for implantation.
- a number of devices have been employed to implant radioactive seeds into tissues. See, e.g., U.S. Pat. Nos. 2,269,963 to Wappler; U.S. Pat. No. 4,402,308 to Scott; U.S. Pat. No. 5,860,909 to Mick; and U.S. Pat. No. 6,007,474 to Rydell.
- an implantation device having a specialized needle is inserted through the skin between the rectum and scrotum into the prostate to deliver radioactive seeds to the prostate.
- the needle can be repositioned or a new needle used for other sites in the prostate where seeds are to be implanted.
- 20-40 needles are used to deliver between about 50-150 seeds per prostate.
- An ultrasound probe can be used to track the position of the needles.
- radioactive seeds take the form of a capsule encapsulating a radioisotope. See, e.g., Symmetra.RTM. 1-125 (Bebig GmbH, Germany); IoGold.TM. I- 125 and IoGold.TM. Pd-103 (North American Scientific, Inc., Chatsworth, Calif.);
- Best.RTM. 1-125 and Best Pd-103 Best Industries, Springfield, Va.
- Brachyseed.RTM. I- 125 Density, Inc., Canada
- Intersource.RTM. Pd-103 International Brachytherapy, Belgium
- Oncoseed.RTM. 1-125 Nemplant Medical, Carol Stream, 111.
- Pharmaseed.RTM. 1-125 Syner, Woodland Hills, Calif.
- Prostaseed.TM. 1-125 Urocor, Oklahoma City, OkIa.
- I-plant.RTM. I- 125 Implant Sciences Wakefield, Mass.
- the capsule of these seeds can be made of a biocompatible substance such as titanium or stainless steel, and be tightly sealed to prevent leaching of the radioisotope.
- the capsule can be sized to fit down the bore of one of the needles used in the implantation device. Since most such needles are about 18 gauge, the capsule typically has a diameter of about 0.8 mm and a length of about 4.5-mm.
- the two radioisotopes most commonly used in brachytherapy seeds are iodine (I- 125 ) and palladium (Pd- 103 ). Both emit low energy irradiation and have half-life characteristics ideal for treating tumors.
- I- 125 seeds decay at a rate of 50% every 60 days, so that using typical starting doses their radioactivity is almost exhausted after ten months.
- Pd- 103 seeds decay even more quickly, losing half their energy every 17 days so that they are nearly inert after only 3 months.
- Radioactive brachytherapy seeds can also contain other components.
- such seeds may contain a radiopaque marker.
- Markers are typically made of high atomic number (i.e., "high Z") elements or alloys or mixtures containing such elements. Examples of these include platinum, iridium, rhenium, gold, tantalum, lead, bismuth alloys, indium alloys, solder or other alloys with low melting points, tungsten, and silver.
- Many radiopaque markers are currently being marketed including: platinum/iridium markers
- radiopaque markers include polymers impregnated with various substances (see, e.g., U.S. Pat. No. 6,077,880).
- U.S. Pat. No. 3,351,049 discloses the use of a low-energy X-ray-emitting interstitial implant as a brachytherapy source.
- U.S. Pat. No. 4,323,055; U.S. Pat. No. 4,702,228; U.S. Pat. No. 4,891,165; U.S. Pat. No. 5,405,309; U.S. Pat. No. 5,713,828; U.S. Pat. No. 5,997,463; U.S. Pat. No. 6,066,083; and 6,074,337 disclose technologies relating to brachytherapy devices.
- the effector molecule can be covalently linked to the disclosed peptide.
- the effector molecule can be linked to the amino terminal end of the disclosed peptide.
- the effector molecule can be linked to the carboxy terminal end of the disclosed peptide.
- the effector molecule can be linked to an amino acid within the disclosed peptide.
- the herein provided compositions can further comprise a linker connecting the effector molecule and disclosed peptide.
- the disclosed peptide can also be conjugated to a coating molecule such as bovine serum albumin (BSA) (see Tkachenko et al., (2003) J Am Chem Soc, 125, 4700- 4701) that can be used to coat the Nanoshells with the peptide.
- BSA bovine serum albumin
- Protein crosslinkers that can be used to crosslink the effector molecule to the disclosed peptide are known in the art and are defined based on utility and structure and include DSS (Disuccinimidylsuberate), DSP (Dithiobis(succinimidylpropionate)), DTSSP (3,3'-Dithiobis (sulfosuccinimidylpropionate)), SULFO BSOCOES (Bis[2- (sulfosuccinimdooxycarbonyloxy) ethyl] sulfone), BSOCOES (Bis[2- (succinimdooxycarbonyloxy)ethyl]sulfone), SULFO DST (Disulfosuccinimdyltartrate), DST (Disuccinimdyltartrate), SULFO EGS (Ethylene glycolbis(succinimidylsuccinate)), EGS (Ethylene glycolbis(sulf
- compositions that comprises the NIP and any known or newly discovered substance that can be administered to a cancer.
- the provided composition can further comprise one or more of classes of antibiotics (e.g. Aminoglycosides, Cephalosporins, Chloramphenicol, Clindamycin, Erythromycins, Fluoroquinolones, Macrolides, Azolides, Metronidazole, Penicillin's, Tetracycline's, Trimethoprim-sulfamethoxazole, Vancomycin), steroids (e.g. Andranes (e.g. Testosterone), Cholestanes (e.g. Cholesterol), Cholic acids (e.g.
- antibiotics e.g. Aminoglycosides, Cephalosporins, Chloramphenicol, Clindamycin, Erythromycins, Fluoroquinolones, Macrolides, Azolides, Metronidazole, Penicillin's, Tetracycline's
- Corticosteroids e.g. Dexamethasone
- Estraenes e.g. Estradiol
- Pregnanes e.g. Progesterone
- narcotic and non-narcotic analgesics e.g. Morphine, Codeine, Heroin, Hydromorphone, Levorphanol, Meperidine, Methadone, Oxydone, Propoxyphene, Fentanyl, Methadone, Naloxone, Buprenorphine, Butorphanol, Nalbuphine, Pentazocine
- anti-inflammatory agents e.g.
- Alclofenac Alclometasone Dipropionate; Algestone Acetonide; alpha Amylase; Amcinafal; Amcinafide; Amfenac Sodium; Amiprilose Hydrochloride; Anakinra; Anirolac; Anitrazafen; Apazone; Balsalazide Disodium; Bendazac; Benoxaprofen; Benzydamine Hydrochloride; Bromelains; Broperamole; Budesonide; Carprofen; Cicloprofen; Cintazone; Cliprofen; Clobetasol Propionate; Clobetasone Butyrate; Clopirac; Cloticasone Propionate; Cormethasone Acetate; Cortodoxone; Decanoate; Deflazacort; Delatestryl; Depo-Testosterone; Desonide; Desoximetasone; Dexamethasone Dipropionate; Diclofenac Potassium; Diclofenac Sodium; D
- Isoflupredone Acetate Isoxepac; Isoxicam; Ketoprofen; Lofemizole Hydrochloride;
- Meclorisone Dibutyrate Mefenamic Acid
- Mesalamine Mesalamine
- Meseclazone Mefenamic Acid
- Mesterolone Methandrostenolone
- Methenolone Methenolone Acetate
- Oxaprozin Oxyphenbutazone; Oxymetholone ; Paranyline Hydrochloride; Pentosan
- Salnacedin Salsalate; Sanguinarium Chloride; Seclazone; Sermetacin; Stanozolol;
- Triclonide Triflumidate; Zidometacin; Zomepirac Sodium), or anti-histaminic agents
- Ethanolamines like diphenhydrmine carbinoxamine
- Ethylenediamine like tripelennamine pyrilamine
- Alkylamine like chlo ⁇ heniramine, dexchlorpheniramine, brompheniramine, triprolidine
- other anti-histamines like astemizole, loratadine, fexofenadine, Bropheniramine, Clemastine, Acetaminophen, Pseudoephedrine,
- anti-cancer drugs are available for combination with the present method and compositions.
- Antineoplastic Acivicin; Aclarubicin; Acodazole Hydrochloride; AcrQnine;
- Adozelesin Aldesleukin; Altretamine; Ambomycin; Ametantrone Acetate;
- Aminoglutethimide Amsacrine; Anastrozole; Anthramycin; Asparaginase; Asperlin;
- Azacitidine Azetepa; Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene Hydrochloride; Bisnafide Dimesylate; Bizelesin; Bleomycin Sulfate; Brequinar Sodium;
- Carmustine Carubicin Hydrochloride; Carzelesin; Cedefingol; Chlorambucil;
- Cirolemycin Cisplatin; Cladribine; Crisnatol Mesylate; Cyclophosphamide; Cytarabine; dacarbazine; Dactinomycin; Daunorubicin Hydrochloride; Decitabine; Dexormaplatin;
- Fazarabine Fenretinide; Floxuridine; Fludarabine Phosphate; Fluorouracil; Flurocitabine;
- Fosquidone Fostriecin Sodium; Gemcitabine; Gemcitabine Hydrochloride; Gold Au 198; Hydroxyurea; Idarubicin Hydrochloride; Ifosfamide; Ilmofosine; Interferon Alfa-2a;
- Interferon Alfa-2b Interferon Alfa-nl; hiterferon Alfa-n3; Interferon Beta- 1 a; Interferon
- Leuprolide Acetate Liarozole Hydrochloride; Lometrexol Sodium; Lomustine;
- Losoxantrone Hydrochloride Losoxantrone Hydrochloride; Masoprocol; Maytansine; Mechlorethamine Hydrochloride; Megestrol Acetate; Melengestrol Acetate; Melphalan; Menogaril; Mercaptopurine;
- Methotrexate Methotrexate Sodium; Metoprine; Meturedepa; Mitindomide; Mitocarcin;
- Mitocromin Mitogillin; Mitomalcin; Mitomycin; Mitosper; Mitotane; Mitoxantrone
- Spirogermanium Hydrochloride Spiromustine; Spiroplatin; Streptonigrin; Streptozocin; Strontium Chloride Sr 89; Sulofenur; Talisomycin; Taxane; Taxoid; Tecogalan Sodium;
- Trimetrexate Trimetrexate Glucuronate; Triptorelin; Tubulozole Hydrochloride; Uracil Mustard; Uredepa; Vapreotide; Verteporfin; Vinblastine Sulfate; Vincristine Sulfate;
- Vindesine Vindesine; Vindesine Sulfate; Vinepidine Sulfate; Vinglycinate Sulfate; Vinleurosine
- Zeniplatin Zinostatin; Zorubicin Hydrochloride.
- Other anti-neoplastic compounds include: 20-epi-l,25 dihydroxyvitamin D3; 5- ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin;
- ALL-TK antagonists altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; atrsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein- 1 ; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balan
- UBC inhibitors UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; zinostatin stimalamer.
- composition can further comprise one or more additional radiosensitizers.
- additional radiosensitizers include gemcitabine, 5-fluorouracil, pentoxifylline, and vinorelbine.
- variants, derivatives, and fragments are contemplated.
- Protein variants and derivatives are well understood to those of skill in the art and in can involve amino acid sequence modifications.
- amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants.
- Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence.
- variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
- Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known and include, for example, M 13 primer mutagenesis and PCR mutagenesis.
- Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues.
- Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct.
- the mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure unless such a change in secondary structure of the mRNA is desired.
- Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 2 and are referred to as conservative substitutions.
- substitutions include combinations shown in Table 2. Conservatively substituted variations of each explicitly disclosed sequence are included within the polypeptides provided herein.
- conservative substitutions have little to no impact on the biological activity of a resulting polypeptide.
- a conservative substitution is an amino acid substitution in a peptide that does not substantially affect the biological function of the peptide.
- a peptide can include one or more amino acid substitutions, for example 2-10 conservative substitutions, 2-5 conservative substitutions, 4-9 conservative substitutions, such as 2, 5 or 10 conservative substitutions.
- a polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR.
- a polypeptide can be produced to contain one or more conservative substitutions by using standard peptide synthesis methods.
- An alanine scan can be used to identify which amino acid residues in a protein can tolerate an amino acid substitution.
- the biological activity of the protein is not decreased by more than 25%, for example not more than 20%, for example not more than 10%, when an alanine, or other conservative amino acid (such as those listed below), is substituted for one or more native amino acids.
- Substitutional or deletional mutagenesis can be employed to insert sites for N- glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr).
- Deletions of cysteine or other labile residues also may be desirable.
- Deletions or substitutions of potential proteolysis sites, e.g. Arg is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
- Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide.
- Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions.
- Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o- amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C- terminal carboxyl .
- Molecules can be produced that resemble polypeptides, but which are not connected via a natural peptide linkage.
- peptide analogs can have more than one atom between the bond atoms, such as b-alanine, g-aminobutyric acid, and the like.
- Amino acid analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, greater ability to cross biological barriers (e.g., gut, blood vessels, blood-brain-barrier), and others.
- enhanced or desirable properties such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, greater ability to cross biological barriers (e.g., gut, blood vessels, blood-brain-barrier), and others.
- D-amino acids can be used to generate more stable peptides, because D amino acids are not recognized by peptidases and such.
- Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type e.g., D-lysine in place of L-lysine
- Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particular conformations.
- variants of the nucleic acids and polypeptides herein disclosed which have at least 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent sequence identity to the stated or known sequence.
- sequence identity can be calculated after aligning the two sequences so that the sequence identity is at its highest level.
- sequence identity Another way of calculating sequence identity can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local sequence identity algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the sequence identity alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection. These references are incorporated herein by reference in their entirety for the methods of calculating sequence identity.
- sequence identity can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281- 306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
- the provided polypeptide can comprise an amino acid sequence with at least 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent sequence identity to the c-terminus of NBSl.
- the provided polypeptide comprises an amino acid sequence with at least 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent sequence identity to SEQ ID NO:3, SEQ ID NO:4, SEQ BD NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. 9. Nucleic Acids
- isolated nucleic acids encoding the polypeptides provided herein.
- an isolated nucleic acid encoding a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- an isolated nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, or SEQ ID NO:50.
- nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, the expressed mRNA will typically be made up of A, C, G, and U.
- 'isolated nucleic acid' or 'purified nucleic acid' is meant DNA that is free of the genes that, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, such as an autonomously replicating plasmid or virus; or incorporated into the genomic DNA of a prokaryote or eukaryote (e.g., a transgene); or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR, restriction endonuclease digestion, or chemical or in vitro synthesis). It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
- RNA e.g., an mRNA molecule that is encoded by an isolated DNA molecule, or that is chemically synthesized, or that is separated or substantially free from at least some cellular components, e.g., other types of RNA molecules or polypeptide molecules.
- nucleic acid encoding a polypeptide comprising the amino acid sequence SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- the provided nucleic acid can comprise the nucleic acid sequence SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, or SEQ ID NO:50.
- the herein provided nucleic acid can be operably linked to an expression control sequence.
- nucleic acid is operably linked to an expression control sequence.
- compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems.
- the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
- direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
- Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA are described by, for example, Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352,
- a vector comprising a nucleic acid encoding the carboxy- terminal amino acid sequence of NBSl, or a conservative variant thereof, wherein the polypeptide does not comprise the full length NBSl.
- a vector comprising a nucleic acid encoding the NBSl -binding sequences of ATM, or a conservative variant thereof.
- the polypeptide can comprise the heat repeat sequences of ATM, or a fragment thereof, that binds NBSl.
- a preferred vector targets hypoxia tumor tissues.
- the vector can be a hypoxia-target adenoviral vector.
- Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
- plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ BD NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, or SEQ ID NO:50, into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered.
- the promoters are derived from either a virus or a retrovirus.
- Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also disclosed are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non- proliferating cells.
- Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells.
- Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature.
- a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens.
- Vectors of this type can carry coding regions for Interleukin 8 or 10.
- Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells.
- viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
- viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs ofthis type can carry up to about 8 kb of foreign genetic material.
- the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
- a retrovirus is an animal virus belonging to the virus family of Retroviridae, including any types, subfamilies, genus, or tropisms.
- Retroviral vectors in general, are described by Verma, LM. , Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4, 868, 116 and 4, 980, 286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference.
- a retrovirus is essentially a package which has packed into it nucleic acid cargo.
- the nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat.
- a packaging signal In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus.
- a retroviral genome contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that is to be transferred to the target cell.
- Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome.
- a packaging signal for incorporation into the package coat a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the
- gag, pol, and env genes allow for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript.
- a packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal.
- the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
- viruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest.
- Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J.
- a viral vector can be one based on an adenovirus which has had the El gene removed, and these virons are generated in a cell line such as the human 293 cell line.
- both the El and E3 genes are removed from the adenovirus genome.
- AAV adeno-associated virus
- This defective parvovirus can infect many cell types and is nonpathogenic to humans.
- AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19.
- this vector can be the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
- the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter, which directs cell-specific expression, operably linked to a heterologous gene.
- ITRs inverted terminal repeats
- Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus.
- AAV and Bl 9 coding regions have been deleted, resulting in a safe, noncytotoxic vector.
- the AAV ITRs, or modifications thereof, confer infectivity and site- specific integration, but not cytotoxicity, and the promoter directs cell-specific expression.
- Patent No. 6, 261, 834 is herein incorporated by reference for material related to the AAV vector.
- the disclosed vectors thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
- the inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
- herpes simplex virus (HSV) and Epstein-Barr virus (EBV) have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable.
- EBV nuclear protein EBNAl
- EBNAl EBV nuclear protein
- these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro.
- Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes.
- Other useful systems include, for example, replicating and host-restricted non- replicating vaccinia virus vectors.
- compositions can be delivered to the target cells in a variety of ways.
- the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation.
- the delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example Un vivo or in vitro.
- compositions can comprise, in addition to the disclosed polypeptides, nucleic acids or vectors, for example, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
- liposomes can further comprise proteins to facilitate targeting a particular cell, if desired.
- Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract.
- liposomes see, e.g., Brigham et al. Am. J. Resp. Cell. MoI. Biol.
- the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage.
- delivery of the compositions to cells can be via a variety of mechanisms.
- delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art.
- LIPOFECTIN LIPOFECTAMINE
- SUPERFECT Qiagen, Inc. Hilden, Germany
- TRANSFECTAM Promega Biotec, Inc., Madison, WI
- the disclosed nucleic acid or vector can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (ImaRx Pharmaceutical Corp., Arlington, AZ).
- Nucleic acids that are delivered to cells which are to be integrated into the host cell genome typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral integration systems can also be incorporated into nucleic acids which are to be delivered using a non-nucleic acid based system of deliver, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
- Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome.
- compositions can be delivered to the subject's cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
- cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
- the compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
- the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
- the nucleic acids that are delivered to cells typically contain expression controlling systems.
- the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
- Promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus, cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter.
- the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)).
- the immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360
- promoters from the host cell or related species also are useful herein.
- Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3 1 (Lusky, M.L., et al., Mol. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)).
- Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression.
- Examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- the promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function.
- Systems can be regulated by reagents such as tetracycline and dexamethasone.
- the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed.
- the promoter and/or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time.
- a promoter of this type is the CMV promoter (650 bases).
- Other such promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTR.
- GFAP glial fibrillary acetic protein
- Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3 1 untranslated regions also include transcription termination sites.
- the transcription unit can also contain a polyadenylation region.
- polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. Transcribed units an contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct.
- the viral vectors can include nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
- Example marker genes are the E.
- CoIi lacZ gene which encodes ⁇ -galactosidase, and green fluorescent protein.
- the marker may be a selectable marker.
- suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media.
- CHO Chinese hamster ovary
- mouse LTK- cells Two examples are: Chinese hamster ovary (CHO) DHFR- cells and mouse LTK- cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
- An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
- the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., J. Molec.
- Tumor virotherapy represents a new platform for the treatment of cancer.
- Appealing features include tumor-selective targeting, and no cross-resistance to current treatments.
- Human adenoviruses (Ad) in subgroup C e.g. Ad5
- Ad5 Human adenoviruses
- Ad5 adenoviruses
- Ad5 adenoviruses
- Ad5 adenoviruses
- Ad5 adenoviruses
- Ad5 adenoviruses
- Ad5 adenovirus vectors for tumor gene therapy have attracted considerable interest.
- Two types of Ad vectors replication-defective and replication- competent have been developed for anticancer therapy (Adam and Nasz, 2001 ; Glasgow et al., 2006).
- a large number of non-replicating antitumor adenoviral vectors are designed to have a wide variety of tumor-targeting mechanisms, such as immunomodulatory gene therapy, tumor suppressor gene therapy, and chemogene therapy.
- Replication-competent vectors are designed to replicate in tumor cells selectively, thus causing tumor lyses.
- a hypoxia-driven adenoviral vector which expresses wtNIP in hypoxic tumor tissues.
- This gene-therapeutic vector has the following two features: 1) tumor-selective and hypoxia-specific targeting, and 2) tumor radiosensitizing. 12.
- Cells Also provided is a cell comprising one or more of the herein provided vectors. As used herein, 'cell', 'cell line', and 'cell culture' may be used interchangeably and all such designations include progeny.
- the disclosed cell can be any cell used to clone or propagate the vectors provided herein. Thus, the cell can be from any primary cell culture or established cell line.
- the method may be applied to any cell, including prokaryotic or eukaryotic, such as bacterial, plant, animal, and the like.
- the cell type can be selected by one skilled in the art based on the choice of vector and desired use.
- the cell can be isolated or in an organism.
- animals produced by the process of transfecting a cell within the animal with any of the nucleic acid molecules or vectors disclosed herein Disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules or vectors disclosed herein, wherein the animal is a mammal. Also disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules or vectors disclosed herein, wherein the mammal is mouse, rat, rabbit, cow, sheep, pig, or primate.
- compositions can be combined, conjugated or coupled with or to carriers and other compositions to aid administration, delivery or other aspects of the inhibitors and their use.
- Carriers can, for example, be a small molecule, pharmaceutical drug, fatty acid, detectable marker, conjugating tag, nanoparticle, or enzyme.
- compositions can be used therapeutically in combination with a pharmaceutically acceptable carrier.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject, along with the composition, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
- composition comprising one or more of the herein provided polypeptides, nucleic acids, or vectors in a pharmaceutically acceptable carrier.
- composition comprising a combination of two or more of any of the herein provided NBSl polypeptides in a pharmaceutically acceptable carrier.
- composition comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ED NO:7, SEQ ID NO:8, SEQ ED NO:9, SEQ ED NO: 10, SEQ ED NO:43, SEQ ED NO:44, SEQ ED NO:45, SEQ ED NO:46, SEQ ED NO:47, SEQ ED NO:48, SEQ ED NO:49, or SEQ ED NO:50 in a pharmaceutically acceptable carrier.
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
- compositions can be administered intramuscularly or subcutaneously.
- Other compounds can be administered according to standard procedures used by those skilled in the art.
- compositions can include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
- Pharmaceutical compositions can also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
- Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- Formulations for topical administration can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable..
- compositions can potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid, glyco
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These can be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol.
- Vehicles such as 'stealth' and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
- the carrier molecule can be covalently linked to the disclosed inhibitors.
- the carrier molecule can be linked to the amino terminal end of the disclosed peptides.
- the carrier molecule can be linked to the carboxy terminal end of the disclosed peptides.
- the carrier molecule can be linked to an amino acid within the disclosed peptides.
- the herein provided compositions can further comprise a linker connecting the carrier molecule and disclosed inhibitors.
- the disclosed inhibitors can also be conjugated to a coating molecule such as bovine serum albumin (BSA) (see Tkachenko et al., (2003) J Am Chem Soc, 125, 4700-4701) that can be used to coat microparticles, nanoparticles of nanoshells with the inhibitors.
- BSA bovine serum albumin
- Protein crosslinkers that can be used to crosslink the carrier molecule to the inhibitors, such as the disclosed peptides, are known in the art and are defined based on utility and structure and include DSS (Disuccinimidylsuberate), DSP (Dithiobis(succinimidylpropionate)), DTSSP (3,3'-Dithiobis (sulfosuccinimidylpropionate)), SULFO BSOCOES (Bis[2- (sulfosuccinimdooxycarbonyloxy) ethyl] sulfone), BSOCOES (Bis[2- (succinimdooxycarbonyloxy)ethyl]sulfone), SULFO DST (Disulfosuccinimdyltartrate), DST (Disuccinimdyltartrate), SULFO EGS (Ethylene glycolbis(succinimidylsuccinate)), EGS (Ethylene
- Nanoparticles refers to a nanoscale particle with a size that is measured in nanometers, for example, a nanoscopic particle that has at least one dimension of less than about 100 run.
- nanoparticles include paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanof ⁇ bers, nanohoms, nano-onions, nanorods, nanoropes and quantum dots.
- a nanoparticle can produce a detectable signal, for example, through absorption and/or emission of photons (including radio frequency and visible photons) and plasmon resonance.
- Microspheres can also be used with the methods disclosed herein.
- Microspheres containing chromophores have been utilized in an extensive variety of applications, including photonic crystals, biological labeling, and flow visualization in microfluidic channels. See, for example, Y. Lin, et al., Appl. Phys Lett. 2002, 81, 3134; D. Wang, et al., Chem. Mater. 2003, 15, 2724; X. Gao, et al., J. Biomed. Opt. 2002, 7, 532; M. Han, et al., Nature Biotechnology. 2001, 19, 631; V. M. Pai, et al., Mag. & Magnetic Mater.
- Nanoparticles such as, for example, silica nanoparticles, metal nanoparticles, metal oxide nanoparticles, or semiconductor nanocrystals can be incorporated into microspheres.
- the optical, magnetic, and electronic properties of the nanoparticles can allow them to be observed while associated with the microspheres and can allow the microspheres to be identified and spatially monitored.
- the high photostability, good fluorescence efficiency and wide emission tunability of colloidally synthesized semiconductor nanocrystals can make them an excellent choice of chromophore.
- nanocrystals that emit different colors can be excited simultaneously with a single light source.
- Colloidally synthesized semiconductor nanocrystals such as, for example, core-shell CdSe/ZnS and CdS/ZnS nanocrystals
- the microspheres can be monodisperse silica microspheres.
- the nanoparticle can be a metal nanoparticle, a metal oxide nanoparticle, or a semiconductor nanocrystal.
- the metal of the metal nanoparticle or the metal oxide nanoparticle can include titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, manganese, technetium, rhenium, iron, ruthenium, osmium, cobalt, rhodium, indium, nickel, palladium, platinum, copper, silver, gold, zinc, cadmium, scandium, yttrium, lanthanum, a lanthanide series or actinide series element (e.g., cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, lute
- the metal can be iron, ruthenium, cobalt, rhodium, nickel, palladium, platinum, silver, gold, cerium or samarium.
- the metal oxide can be an oxide of any of these materials or combination of materials.
- the metal can be gold, or the metal oxide can be an iron oxide, a cobalt oxide, a zinc oxide, a cerium oxide, or a titanium oxide. Preparation of metal and metal oxide nanoparticles is described, for example, in U.S. Pat. Nos. 5,897,945 and 6,759,199, each of which is incorporated by reference in its entirety.
- compositions can be immobilized on silica nanoparticles (SNPs).
- SNPs silica nanoparticles
- SNPs have been widely used for biosensing and catalytic applications owing to their favorable surface area-to-volume ratio, straightforward manufacture and the possibility of attaching fluorescent labels, magnetic nanoparticles (Yang, H.H. et al. 2005) and semiconducting nanocrystals (Lin, Y.W., et al. 2006).
- the nanoparticle can also be, for example, a heat generating nanoshell.
- 'nanoshell' is a nanoparticle having a discrete dielectric or semi-conducting core section surrounded by one or more conducting shell layers.
- U.S. Patent No. 6,530,944 is hereby incorporated by reference herein in its entirety for its teaching of the methods of making and using metal nanoshells.
- Targeting molecules can be attached to the disclosed compositions and/or carriers.
- the targeting molecules can be antibodies or fragments thereof, ligands for specific receptors, or other proteins specifically binding to the surface of the cells to be targeted. ii. Liposomes
- 'Liposome' refers to a structure comprising an outer lipid bi- or multi-layer membrane surrounding an internal aqueous space. Liposomes can be used to package any biologically active agent for delivery to cells.
- liposomes Materials and procedures for forming liposomes are well-known to those skilled in the art. Upon dispersion in an appropriate medium, a wide variety of phospholipids swell, hydrate and form multilamellar concentric bilayer vesicles with layers of aqueous media separating the lipid bilayers. These systems are referred to as multilamellar liposomes or multilamellar lipid vesicles ('MLVs') and have diameters within the range of 10 nm to 100 ⁇ m. These MLVs were first described by Bangham, et al., J MoI. Biol. 13:238-252 (1965). In general, lipids or lipophilic substances are dissolved in an organic solvent.
- the lipid residue forms a film on the wall of the container.
- An aqueous solution that typically contains electrolytes or hydrophilic biologically active materials is then added to the film.
- Large MLVs are produced upon agitation.
- the larger vesicles are subjected to sonication, sequential filtration through filters with decreasing pore size or reduced by other forms of mechanical shearing.
- pressurized extrusion Barenholz, et al., FEBS Lett. 99:210-214 (1979)
- Liposomes can also take the form of unilamnellar vesicles, which are prepared by more extensive sonication of MLVs, and consist of a single spherical lipid bilayer surrounding an aqueous solution.
- Unilamellar vesicles ('ULVs') can be small, having diameters within the range of 20 to 200 nm, while larger ULVs can have diameters within the range of 200 nm to 2 ⁇ m.
- ULVs' Unilamellar vesicles
- Small ULVs can also be prepared by the ethanol injection technique described by Batzri, et al., Biochim et Biophys Acta 298:1015-1019 (1973) and the ether injection technique of Deamer, et al., Biochim et Biophys Acta 443:629-634 (1976). These methods involve the rapid injection of an organic solution of lipids into a buffer solution, which results in the rapid formation of unilamellar liposomes.
- Another technique for making ULVs is taught by Weder, et al. in 'Liposome Technology', ed. G. Gregoriadis, CRC Press Inc., Boca Raton, FIa., Vol. I, Chapter 7, pg.
- ULVs by a reverse phase evaporation technique that involves the formation of a water-in- oil emulsion of lipids in an organic solvent and the drug to be encapsulated in an aqueous buffer solution.
- the organic solvent is removed under pressure to yield a mixture which, upon agitation or dispersion in an aqueous media, is converted to large ULVs.
- Suzuki et al. U.S. Pat. No. 4,016,100, describes another method of encapsulating agents in unilamellar vesicles by freezing/thawing an aqueous phospholipid dispersion of the agent and lipids.
- liposomes can also be multivesicular. Described in Kim, et al., Biochim et Biophys Acta 728:339-348 (1983), these multivesicular liposomes are spherical and contain internal granular structures. The outer membrane is a lipid bilayer and the internal region contains small compartments separated by bilayer septum. Still yet another type of liposomes are oligolamellar vesicles ('OLVs'), which have a large center compartment surrounded by several peripheral lipid layers. These vesicles, having a diameter of 2-15 ⁇ m, are described in Callo, et al., Cryobiology 22(3):251-267 (1985).
- Fatty acids i.e., lipids
- the fatty acid is a polar lipid.
- the fatty acid can be a phospholipid
- the provided compositions can comprise either natural or synthetic phospholipid.
- the phospholipids can be selected from phospholipids containing saturated or unsaturated mono or disubstituted fatty acids and combinations thereof.
- These phospholipids can be dioleoylphosphatidylcholine, dioleoylphosphatidylserine, dioleoylphosphatidylethanolamine, dioleoylphosphatidylglycerol, dioleoylphosphatidic acid, palmitoyloleoylphosphatidylcholine, palmitoyloleoylphosphatidylserine, palmitoyloleoylphosphatidylethanolamine, palmitoyloleoylphophatidylglycerol, palmitoyloleoylphosphatidic acid, palmitelaidoyloleoylphosphatidylcholine, palmitelaidoyloleoylphosphatidylserine, palmitelaidoyloleoylphosphatidylethanolamine, palmitelaidoyloleoylphosphatidylglycerol, palmi
- These phospholipids may also be the monoacylated derivatives of phosphatidylcholine (lysophophatidylidylcholine), phosphatidylserine (lysophosphatidylserine), phosphatidylethanolamine (lysophosphatidylethanolamine), phophatidylglycerol (lysophosphatidylglycerol) and phosphatidic acid (lysophosphatidic acid).
- the monoacyl chain in these lysophosphatidyl derivatives may be palimtoyl, oleoyl, palmitoleoyl, linoleoyl myristoyl or myristoleoyl.
- the phospholipids can also be synthetic. Synthetic phospholipids are readily available commercially from various sources, such as AVANTI Polar Lipids (Albaster, Ala.); Sigma Chemical Company (St. Louis, Mo.). These synthetic compounds may be varied and may have variations in their fatty acid side chains not found in naturally occurring phospholipids.
- the fatty acid can have unsaturated fatty acid side chains with C 14, C 16, Cl 8 or C20 chains length in either or both the PS or PC.
- Synthetic phospholipids can have dioleoyl (18:1)-PS; palmitoyl (16:0)-oleoyl (18:1)-PS, dimyristoyl (14:0)-PS; dipalmitoleoyl (16:1)-PC, dipalmitoyl (16:0)-PC, dioleoyl (18:1)- PC, palmitoyl (16:0)-oleoyl (18:1)-PC, and myristoyl (14:0)-oleoyl (18:1)-PC as constituents.
- the provided compositions can comprise palmitoyl 16:0. iii.
- compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject's cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
- cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
- the compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
- the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject.
- tissue can be any tissue for which radiotherapy is desired, including cancer or a benign growth.
- a method of treating cancer in a subject comprising administering to the cancer a composition that inhibits the interaction of NBSl with ATM, and irradiating the cancer.
- the chemotherapeutic of the disclosed method can be, for example, any of the herein disclosed neoplastic drugs.
- the cancer of the disclosed methods can be any cell in a subject undergoing unregulated growth, invasion, or metastasis.
- the cancer can be any neoplasm or tumor for which radiotherapy is currently used.
- the cancer can be a neoplasm or tumor that is not sufficiently sensitive to radiotherapy using standard methods.
- the cancer can be a sarcoma, lymphoma, leukemia, carcinoma, blastoma, or germ cell tumor.
- a representative but non-limiting list of cancers that the disclosed compositions can be used to treat include lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin's Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma/glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, colon cancer, cervical cancer, cervical carcinoma, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon and rectal cancers, prostatic cancer, and pancreatic cancer.
- radiation can be used as primary therapy or as postoperative treatment. Sometimes radiation is given in combination with chemotherapy.
- One of the most beneficial results of radiotherapy is laryngeal preservation in persons with cancer of the vocal cord. Because of their location, nasopharyngeal cancers are treated primarily with radiation therapy. Many patients can be re-treated successfully should the tumor recur. Postoperatively, patients with large, extensively invasive tumors or tumors that have positive or close margins, and patients with positive lymph nodes are at high risk for local or regional recurrence. Radiation therapy increases the chance of local control of these tumors and often improves survival in patients with tumors of the head and neck. b. Skin Cancer
- compositions and methods can be used to treat skin cancer.
- Skin cancer can be treated primarily or postoperatively with radiation.
- primary treatment is reserved for use in areas where the cosmetic result with surgery may not be suitable. Most commonly, these include areas around the nose, ear, upper lip and commissure, eyelid and canthi. Similarly, postoperative irradiation increases local control in high-risk patients.6 c. Central Nervous System Tumors
- the provided compositions and methods can be used to treat cancer of the central nervous system.
- primary radiotherapy can be indicated because the tumor location precludes surgery. But most commonly, postoperative radiation is employed. Radiation therapy improves survival in many patients with high-grade gliomas and in some patients with low-grade gliomas.
- New methods of conformal and stereotactic therapy which more precisely focus the treatment beam using a three-dimensional technique, allow higher doses of radiation to be administered safely and accurately. These techniques can be particularly promising for the treatment of brain tumors.
- Genitourinary Cancers The provided compositions and methods can be used to treat genitourinary cancers.
- Prostate cancer can be treated primarily or postoperatively with radiation. It appears that, stage for stage, radical prostatectomy and primary radiotherapy offer the same chance of disease- free survival for prostate cancer patients. Recently, androgen blockade has been found to enhance local control and improve survival rates. Radiation therapy is associated with lower morbidity in patients with prostate cancer, particularly when conformal therapy or radioactive seed implants are used. With radiation, it is often possible to avoid the occurrence of impotence and incontinence, which are more common with other therapies.
- compositions and methods can be used to treat gynecologic tumors.
- Stage I cervical cancer can be treated with radiotherapy as effectively as with surgery.
- Stage II and III tumors are best treated with irradiation.
- Many cervical and endometrial cancers with unfavorable histologic characteristics are better controlled with postoperative radiation.
- Certain patients with ovarian cancer may benefit from intraperitoneal radioactive phosphorus given postoperatively.
- Vaginal and vulvar cancers are frequently treated with radiotherapy because the required surgery is often too extensive, and patients are often elderly. f.
- compositions and methods can be used to treat breast cancer. Radiation has dramatically altered the management of primary breast cancer. Breast conservation, using lumpectomy and radiation therapy, is the treatment of choice in early- stage breast cancer. Cosmetic results are good in most patients, and survival is not compromised. Attempts are being made to identify patients at low risk who can be managed with lumpectomy alone, but so far, all groups of patients have better local control with added radiation. Many patients with locally advanced breast cancer show improvement in local control with radiotherapy, and there is increased survival following radiation. g. Gastrointestinal Tumors
- compositions and methods can be used to treat gastrointestinal tumors.
- Esophageal cancer is usually advanced by the time the patient seeks treatment. Radiotherapy, along with chemotherapy, appears to be as effective as surgery in most patients with esophageal cancer. In selected patients, preoperative chemoradiotherapy can offer the best results. Patients with stomach cancer also often present with advanced disease. Some studies suggest the best treatment in these patients is postoperative chemoradiotherapy if the tumor is resectable or chemoradiotherapy alone if it is unresectable. Similarly, postoperative chemoradiotherapy or chemoradiotherapy alone is the preferred treatment for resectable and unresectable pancreatic cancer.
- Certain high-risk patients with locally advanced colon cancer may have better local control and survival with adjuvant radiation therapy.
- Preoperative radiotherapy often administered with chemotherapy, can downstage advanced or low-lying rectal cancers and allow resection and preservation of the sphincter.
- radiation therapy can be helpful postoperatively as well.
- Anal and perianal cancers are usually treated with combined radiation and chemotherapy because excellent results and sphincter preservation can be obtained.
- compositions and methods can be used to treat lung cancer.
- Lung cancer should be treated surgically whenever possible. Postoperative radiation improves local control and can improve survival in certain high-risk surgical patients. Unresectable lung cancer can occasionally be made resectable with preoperative radiation. If resection is not possible, an approach combining radiation and chemotherapy is preferred. Administration of chemotherapy may precede or coincide with radiotherapy. i. Sarcomas
- the provided compositions and methods can be used to treat a sarcoma. Wide local excision with preservation of function is indicated for soft tissue sarcomas. High-risk patients who receive preoperative or postoperative irradiation show improvement in local control and survival. By shrinking the tumor, preoperative radiation may allow more limited surgery and improvement in local control, which can also be limb sparing. j. Lymphomas
- the provided compositions and methods can be used to treat a lymphoma. Some patients with either non-Hodgkin's or Hodgkin's lymphoma may be best treated with radiotherapy. Many patients with low-grade non-Hodgkin's lymphoma can be treated with radiation alone, with excellent local control.
- Hodgkin's lymphoma in selected patients with early-stage disease should be treated with radiation alone or combined with chemotherapy. Radiation therapy may also help control more advanced Hodgkin's lymphomas. k. Pediatric Cancers
- compositions and methods can be used to treat a pediatric cancer.
- Pediatric cancer patients may benefit from radiation of central nervous system tumors
- compositions and methods can be used to for palliative care.
- radiation In patients with metastatic cancer, radiation often improves quality of life and even survival. Radiation is excellent for relief of painful bone metastases and may prevent pathologic fracture in weight-bearing bones. Generally, the pain relief afforded by radiation allows a reduction in pain medications and drug side effects.
- Spinal cord compression as a result of cancer is an emergency that can often be treated effectively with radiotherapy alone. Patients with back pain, weakness of the extremities, or problems with bowel or bladder control should be evaluated immediately to rule out cord compression. Superior vena cava syndrome, another potential emergency, usually responds well to radiotherapy. Patients usually present with dyspnea, orthopnea and venous congestion in the neck and upper extremities.
- radiotherapy can be used to treat Ameloblastoma, Aneurysmal bone cyst, Angiofibroma, Arteriovenous malformation, Chemodectoma, Chordoma, Craniopharyngioma, Desmoid tumor, Graves' ophthalmopathy, Gynecomastia associated with hormonal management of prostate cancer, Hemangioma, Heterotopic bone formation, Hypersplenism, Keloid, Keratoacanthoma, Meningioma, Peyronie's disease, Pituitary adenoma, Pterygium, Total lymphoid irradiation for autoimmune disease or organ transplantation, trigeminal neuralgia, thyroid eye disease, and Vascular restenosis prevention.
- Trigeminal Neuralgia a method of treating trigeminal neuralgia in a subject, comprising administering to the trigeminal nerve a composition that inhibits the interaction of NBSl with ATM, and irradiating the trigeminal nerve.
- Trigeminal neuralgia is a neuropathic disorder of the trigeminal nerve that causes episodes of intense pain in the eyes, lips, nose, scalp, forehead, and jaw. Trigeminal neuralgia is considered by many to be among the most painful of conditions and once was labeled the suicide disease because of the significant numbers of people taking their own lives before effective treatments were discovered. An estimated one in 15,000 people suffers from trigeminal neuralgia, although numbers may be significantly higher due to frequent misdiagnosis.
- the trigeminal nerve is the fifth cranial nerve, a mixed cranial nerve responsible for sensory data such as tactition (pressure), thermoception (temperature), and nociception (pain) originating from the face above the jawline; it is also responsible for the motor function of the muscles of mastication, the muscles involved in chewing but not facial expression.
- tactition pressure
- thermoception temperature
- nociception nociception
- This type of injury also may be caused by an aneurysm (an outpouching of a blood vessel); by a tumor; by an arachnoid cyst in the cerebellopontine angle, or by a traumatic event such as a car accident or even a tongue piercing.
- An aneurysm an outpouching of a blood vessel
- a tumor by an arachnoid cyst in the cerebellopontine angle, or by a traumatic event such as a car accident or even a tongue piercing.
- Two to four percent of patients with TN usually younger, have evidence of multiple sclerosis, which may damage either the trigeminal nerve or other related parts of the brain. When there is no structural cause, the syndrome is called idiopathic.
- Postherpetic Neuralgia which occurs after shingles, may cause similar symptoms if
- the nerve can be damaged to prevent pain signal transmission using a gamma knife or similar radiosurgical device such as Novalis shaped beam. No incisions are involved in this procedure. It uses radiation to bombard the nerve root, this time targeting the selective damage at the same point where vessel compressions are often found. This option is used especially for those people who are medically unfit for a long general anaesthetic, or who are taking medications for prevention of blood clotting (e.g., warfarin).
- a gamma knife or similar radiosurgical device such as Novalis shaped beam. No incisions are involved in this procedure. It uses radiation to bombard the nerve root, this time targeting the selective damage at the same point where vessel compressions are often found. This option is used especially for those people who are medically unfit for a long general anaesthetic, or who are taking medications for prevention of blood clotting (e.g., warfarin).
- compositions can be used to radiosensitise the nerve prior to the radiosurgical proceedure.
- Pterygium Local strontium application can help prevent the local recurrence of a surgically resected eye pterygium.
- Superficial low-dose radiation treatment can help prevent local recurrence of surgically resected keloids.
- Radiation therapy is often used to treat pituitary adenomas successfully with minimal morbidity. Low-dose irradiation can sometimes improve Graves' ophthalmopathy in selected patients in whom other types of therapy have failed.
- keratoacanthomas that fail to respond to other treatment usually respond well to irradiation.
- Hemangiomas also respond well to low-dose radiation.
- Radiotherapy can help control high-risk desmoids and Peyronie's disease.
- low-dose radiation can prevent heterotopic bone formation.
- arteriovenous malformations of the central nervous system may be eliminated with stereotactic radiotherapy, if the malformations are not surgically accessible.
- Also provided herein is a method of treating pterygium in a subject, comprising administering to the conjunctiva a composition that inhibits the interaction of NBSl with ATM, and irradiating the conjunctiva.
- Pterygium can refer to a benign growth of the conjunctiva. Alternately, it refers to any winglike triangular membrane occurring in the neck, eyelids, knees, elbows, ankles or digits (J Pediatr Orthop B 2004, 13:197-201). An example is popliteal pterygium syndrome, which affects the legs. When associated with the conjunctiva, a pterygium commonly grows from the nasal side of the sclera. It is associated with, and thought to be caused by ultraviolet-light exposure (e.g. sunlight), low humidity, and dust.
- ultraviolet-light exposure e.g. sunlight
- the predominance of pterygia on the nasal side is possibly a result of the sun's rays passing laterally through the cornea where it undergoes refraction and becomes focused on the limbic area.
- Sunlight passes unobstructed from the lateral side of the eye, focusing on the medial limbus after passing through the cornea.
- the shadow of the nose medially reduces the intensity of sunlight focused on the lateral/temporal limbus.
- Pterygium in the conjunctiva is characterized by elastotic degeneration of collagen and fibro vascular proliferation. It has an advancing portion called the head of the pterygium, which is connected to the main body of the pterygium by the neck. Sometimes a line of iron deposition can be seen adjacent to the head of the pterygium called Stocker's line. The location of the line can give an indication of the pattern of growth. As it is a benign growth, it requires no treatment unless it grows to such an extent that it covers the pupil, obstructing vision. Some patients may also choose surgery if the growth becomes too unsightly. The exact cause is unknown, but it is associated with excessive exposure to wind, sun, or sand.
- Also provided herein is a method of treating severe thyroid eye disease in a subject, comprising administering to the eye a composition that inhibits the interaction of NBS 1 with ATM, and irradiating the eye.
- Thyroid eye disease often occurs in people who develop an overactive thyroid gland. Swelling of the muscles and other tissues in the orbits causes the eyes to become pushed forward and more prominent. The eyes often take on a more staring appearance. In more severe cases the swelling may cause stiffness of the muscles which move the eyes. This can cause a "squint" to develop and may result in double vision. Occasionally the swelling behind the eyeball may press on the nerve from the eye to the brain and distrupt vision. Thyroid eye disease is also called thyroid opthalmopathy, Graves' eye disease or dysthyroid eye disease.
- Overactivity of the thyroid gland is usually caused by an "autoimmune condition" This means that cells which normally protect the body from infection develop a “fault” and begin to recognise the thyroid gland as foreign material and attack it. This stimulates the thyroid gland to produce extra thyroid hormones. The attacking process may spill over to the cells behind the eye causing them to swell.
- Radiotherapy can be given to the tissues behind the eyeball. It involves usually 10 dosages given over 2 weeks. Two thirds of patients find significant benefit but regrettably one third do not and require other therapy such as orbital decompression. Often this therapy is combined with steroids and immunosuppression. d. Keloid
- keloid scar is a type of scar which results in an overgrowth of tissue at the site of a healed skin injury.
- Keloids are firm, rubbery lesions or shiny, fibrous nodules and can vary from pink to flesh-colored or red to dark brown in color.
- a keloid scar is benign, noncontagious and usually accompanied by severe itchiness, sharp pains and changes in texture. In severe cases, it can affect movement of skin. Keloids should not be confused with hypertrophic scars, which are raised scars that do not grow beyond the boundaries of the original wound and may reduce over time.
- Keloids expand in claw like growths over normal skin. They have the capability to hurt with a needle-like pain or to itch without warning, although the degree of sensation varies from patient to patient. If the keloid becomes infected, it may ulcerate. The only treatment is to remove the scar completely.
- Keloids form within scar tissue. Collagen, used in wound repair, tends to overgrow in this area, sometimes producing a lump many times larger than that of the original scar. Although they usually occur at the site of an injury, keloids can also arise spontaneously. They can occur at the site of a piercing and even from something as simple as a pimple or scratch. They can occur as a result of severe acne or chickenpox scarring, infection at a wound site, repeated trauma to an area, excessive skin tension during wound closure or a foreign body in a wound.
- Electron beam radiation can be used at levels which do not penetrate the body deeply enough to affect internal organs. Orthovoltage radiation is more penetrating and slightly more effective. Radiation treatments reduce scar formation if they are used soon after a surgery while the surgical wound is healing. e. Heterotopic Ossification
- Also provided herein is a preventing heterotopic ossification in a subject, comprising administering to the tissue a composition that inhibits the interaction of NBSl with ATM, and irradiating the tissue.
- Heterotopic ossification is the abnormal formation of true bone within extraskeletal soft tissues.
- many diseases sharing this common feature were lumped under the category of myositis ossificans, a term that has fallen into disfavor because primary muscle inflammation is not a necessary precursor and ossification does not always occur in muscle tissue since it frequently shows a predilection for fascia, tendons, and other mesenchymal soft tissues.
- myositis ossificans traumatica is applied to HO occurring after recalled trauma such as blunt injury, surgery, or burns.
- myositis ossificans atraumatica if no inciting trauma can be identified.
- Lesions have been labeled as panniculitis ossificans when confined to the subcutaneous fat, as rider's bones when found in the adductor muscles, and as shooter's bones when located in the deltoid.
- Fibrodysplasia ossificans progressiva (FOP), or Munchmeyer disease, is an autosomal dominant, severely disabling disease resulting in progressive ossification of fascial planes, muscles, tendons, and ligaments. Congenital malformation of the great toes is associated with FOP.
- HO is a feature of several other diseases, including Albright hereditary osteodystrophy, progressive osseous heteroplasia, and primary osteoma cutis. HO originates from osteoprogenitor stem cells lying dormant within the affected soft tissues. With the proper stimulus, the stem cells differentiate into osteoblasts and begin the process of osteoid formation, eventually leading to mature heterotopic bone.
- Radiotherapy is a local treatment modality that works by damaging the DNA of malignant cells. Normal cells have a greater ability to repair this damage than tumor cells. Radiation therapy takes advantage of this difference. It is important to note that since damaged cells do not die immediately after treatment, tumors often persist after successful radiation therapy is completed.
- Treatment prescriptions are based on the goals of treatment and the potential for side effects.
- a course of treatment may be as short as one day or as long as 10 weeks, but a typical duration is between two and seven weeks and usually consists of five daily treatments a week.
- Patients most commonly receive radiation through a linear accelerator, which accelerates electrons to be used as a treatment beam or to generate x-rays to be used as a treatment beam. Treatment is not painful and often lasts less than five minutes.
- the goal of treatment may be curative or palliative. If radiotherapy is potentially curative, the length of treatment is often longer and usually consists of smaller daily doses over a longer period of time. This approach minimizes late side effects. If treatment is intended to be strictly palliative, shorter treatment schedules consisting of larger daily treatment doses over a shorter time period are used. In such cases, late side effects are not likely to occur within the patient's lifetime. Furthermore, a shorter treatment program will negatively affect less of the patient's remaining life.
- Radiation therapy has many potential specific indications. It can be given as primary tumor treatment, as pre- or postoperative therapy, or as a component of combination or consolidative therapy. Radiation therapy is suitable for almost two-thirds of cancer patients and is used for curative and palliative purposes. Many tumors, such as prostate cancer, breast cancer, head and neck cancer, lung cancer, brain tumor, gastro-intestinal tumors, liver cancer, soft tissue sarcomas, cervical cancer, lymphomas etc, will receive radiotherapy as a part of treatment regimen. Radiation therapy includes external beam radiation (such as X-ray, ⁇ - ray, proton and neutron), brachytherapy and radioactive material implementation.
- external beam radiation such as X-ray, ⁇ - ray, proton and neutron
- Radiation therapy can be administrated by 2-D, 3-D, conformal, intensity-modulated (IMRT) and image-guided (IGRT) approaches.
- Standard radiotherapy for most of solid tumors is given 2Gy/day with a total dose of around 60Gys (50-70Gys).
- the present method constitutes an improvement on existing radiation therapy methods by increasing the sensitivity of the cancer cells to the radiation.
- the provided method can result in the cancer cell being at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or higher sensitivity to the radiation.
- the term 'sensitivity' and 'radiosensistivity' refer to the number of cells that survive based on a dosage of radiation.
- increased radiosensitivy can result in a decrease in the number of cells that survive a dose of radiation, a decrease in the dose of radiation that is required for lethality, or a combination thereof.
- Brachytherapy also known as sealed source radiotherapy or endocurietherapy, is a form of radiotherapy where a radioactive source is placed inside or next to the area requiring treatment.
- external beam radiotherapy, or teletherapy is the application of radiation that has been externally produced by a linear accelerator. Brachytherapy is commonly used to treat localized prostate cancer and cancers of the head and neck.
- Brachytherapy includes Mold brachytherapy, Strontium plaque therapy, Interstitial brachytherapy, Intracavitary brachytherapy, and Intravascular brachytherapy.
- mold brachytherapy superficial tumours can be treated using sealed sources placed close to the skin. Dosimetry is often performed with reference to the Manchester system; a rule-based approach designed to ensure that the dose to all parts of the target volume is within 10% of the prescription dose.
- Surface Applicator is usually called strontium plaque therapy and is used for very superficial lesions less than 1 mm thick.
- the plaque is a hollow, thin silver casing that encloses a radioactive Strontium-90 powdered salt.
- the beta (electron) particles produced from Strontium's radioactive decay have a very shallow penetration.
- the Sr90 plaque is placed on the bed of a resected pterygium.
- a stat dose of around 10-12 Gy is delivered by timing the contact.
- Strontium belongs to the same chemical class as Calcium, i.e., an alkaline earth metal, and so will co-locate in the bone if any strontium salt makes contact with the eye and is absorbed. Operators can prevent exposure to the beta rays by holding the applicator to face away from their bodies.
- interstitial brachytherapy the sources are inserted into tissue.
- the first treatments of this kind used needles containing Radium-226, arranged according to the Manchester system, but modern methods tend to use Indium- 192 wire.
- Iridium wire can be arranged either using the Manchester or the Paris system; the latter was designed specifically to take advantage of the new nuclide.
- Prostate cancer treatment with Iodine- 125 seeds is also classified as interstitial brachytherapy.
- gamma emitters please see commonly used gamma emitting isotopes.
- Intracavitary brachytherapy places the sources inside a pre-existing body cavity.
- Intravascular brachytherapy places a catheter with the sources inside the vasculature.
- the most common application of this method is the treatment of coronary in-stent restenosis, although the therapy has also been investigated for use in the treatment of peripheral vasculature stenoses.
- High Dose Rate (HDR) brachytherapy is a common brachytherapy method.
- Applicators in the form of catheters are arranged, usually according to the Manchester or Paris system on, or in the patient.
- a high dose rate source (often iridium 192, Ir- 192) is then driven along the catheters on the end of a wire by a machine while the patient is isolated in a room.
- the source dwells in a preplanned position for a preset time before stepping forward along the catheter and repeating, to build up the required dose distribution.
- the advantage of this treatment over implanting radioactive sources directly is that there is lower staff exposure and the source can be more active due to low staff exposure, thus making treatment times quicker.
- LDR Low dose rate
- HDR High dose rate
- LDR brachytherapy with a machine works in a similar way.
- the sources being in the form of active and inactive balls which are again, driven into the patient using a machine.
- the disclosed method can further comprise administering to the healthy tissue of the subject a radioprotectant.
- radioprotectants will comprise compositions that scavenge free-radicals and prevent oxidative damage. iv.
- Chemotherapy The majority of chemotherapeutic drugs can be divided in to: alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, monoclonal antibodies, and other antitumour agents. All of these drugs affect cell division or DNA synthesis. Some newer agents don't directly interfere with DNA. These include the new tyrosine kinase inhibitor imatinib mesylate (Gleevec® or Glivec®), which directly targets a molecular abnormality in certain types of cancer (chronic myelogenous leukemia, gastrointestinal stromal tumors). In addition, some drugs can be used which modulate tumor cell behaviour without directly attacking those cells. Hormone treatments fall into this category of adjuvant therapies.
- the chemotherapeutic of the disclosed method can be an alkylating agent.
- Alkylating agents are so named because of their ability to add alkyl groups to many electronegative groups under conditions present in cells.
- Cisplatin and carboplatin, as well as oxaliplatin are alkylating agents.
- Other agents are mechloethamine, cyclophosphamide, chlorambucil. They work by chemically modifying a cell's DNA.
- the chemotherapeutic of the disclosed method can be an anti-metabolite. Anti- metabolites masquerade as purine ((azathioprine, mercaptopurine)) or pyrimidine - which become the building blocks of DNA. They prevent these substances becoming incorporated in to DNA during the 'S' phase (of the cell cycle), stopping normal development and division. They also affect RNA synthesis. Due to their efficiency, these drugs are the most widely used cytostatics.
- the chemotherapeutic of the disclosed method can be a plant alkaloids or terpenoids. These alkaloids are derived from plants and block cell division by preventing microtubule function. Microtubules are vital for cell division and without them it can not occur. The main examples are vinca alkaloids and taxanes.
- the chemotherapeutic of the disclosed method can be a vinca alkaloid.
- Vinca alkaloids bind to specific sites on tubulin, inhibiting the assembly of tubulin into microtubules (M phase of the cell cycle). They are derived from the Madagascar periwinkle, Catharanthus roseus (formerly known as Vinca rosea).
- the vinca alkaloids include: Vincristine, Vinblastine, Vinorelbine, Vindesine, and Podophyllotoxin.
- Podophyllotoxin is a plant-derived compound used to produce two other cytostatic drugs, etoposide and teniposide. They prevent the cell from entering the Gl phase (the start of DNA replication) and the replication of DNA (the S phase).
- the exact mechanism of its action still has to be elucidated.
- the substance has been primarily obtained from the American Mayapple (Podophyllum peltatum). Recently it has been discovered that a rare Himalayan Mayapple (Podophyllum hexandrum) contains it in a much greater quantity, but as the plant is endangered, its supply is limited. Studies have been conducted to isolate the genes involved in the substance's production, so that it could be obtained recombinantively.
- the chemotherapeutic of the disclosed method can be a taxane.
- the prototype taxane is the natural product paclitaxel, originally known as Taxol and first derived from the bark of the Pacific Yew tree.
- Docetaxel is a semi-synthetic analogue of paclitaxel. Taxanes enhance stability of microtubules, preventing the separation of chromosomes during anaphase.
- the chemotherapeutic of the disclosed method can be a topoisomerase inhibitor.
- Topoisomerases are essential enzymes that maintain the topology of DNA. Inhibition of type I or type II topoisomerases interferes with both transcription and replication of DNA by upsetting proper DNA supercoiling.
- Some type I topoisomerase inhibitors include the camptothecins irinotecan and topotecan. Examples of type II inhibitors include amsacrine, etoposide, etoposide phosphate, and teniposide. These are semisynthetic derivatives of epipodophyllotoxins, alkaloids naturally occurring in the root of American Mayapple (Podophyllum peltatum).
- the chemotherapeutic of the disclosed method can be an antitumour antibiotic (Antineoplastics).
- Antineoplastics The most important immunosuppressant from this group is dactinomycin, which is used in kidney transplantations.
- the chemotherapeutic of the disclosed method can be an (monoclonal) antibody.
- Monoclonal antibodies work by targeting tumour specific antigens, thus enhancing the host's immune response to tumour cells to which the agent attaches itself. Examples are trastuzumab (Herceptin), cetuximab, and rituximab (Rituxan or Mabthera).
- trastuzumab Herceptin
- cetuximab cetuximab
- rituximab Rituxan or Mabthera
- Bevacizumab is a monoclonal antibody that does not directly attack tumor cells but instead blocks the formation of new tumor vessels.
- the chemotherapeutic of the disclosed method can be a hormonal therapy.
- Several malignancies respond to hormonal therapy. Strictly speaking, this is not chemotherapy.
- Cancer arising from certain tissues, including the mammary and prostate glands may be inhibited or stimulated by appropriate changes in hormone balance.
- Steroids can inhibit tumour growth or the associated edema (tissue swelling), and may cause regression of lymph node malignancies.
- Prostate cancer is often sensitive to finasteride, an agent that blocks the peripheral conversion of testosterone to dihydrotestosterone.
- Breast cancer cells often highly express the estrogen and/or progesterone receptor.
- Inhibiting the production (with aromatase inhibitors) or action (with tamoxifen) of these hormones can often be used as an adjunct to therapy.
- Gonadotropin- releasing hormone agonists such as goserelin possess a paradoxic negative feedback effect followed by inhibition of the release of FSH (follicle-stimulating hormone) and LH (luteinizing hormone), when given continuously.
- FSH follicle-stimulating hormone
- LH luteinizing hormone
- composition of the disclosed methods can comprise a peptide that inhibits the interaction of NBSl with ATM, e.g., an isolated polypeptide or a nucleic acid encoding a polypeptide comprising a carboxy-terminal amino acid sequence of NBSl, or a conservative variant thereof (e.g., NTP) as described herein.
- the composition of the method can comprise an isolated polypeptide or a nucleic acid encoding a polypeptide comprising the NBSl -binding sequences of ATM, or a conservative variant thereof.
- the polypeptide can comprise the heat repeat sequences of ATM, or a fragment thereof, that binds NBS 1.
- the polypeptide can be any polypeptide comprising the carboxy- terminal most amino acids of NBSl.
- the provided polypeptide can comprise the C- terminal-most 4 to 30 amino acids of NBSl, including the C-terminal most 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino acids of NBSl, or a fragment thereof.
- the provided polypeptide can comprise amino acids 734 to 754 of NBSl (SEQ ID NO:1).
- the provided polypeptide can comprise a conservative amino acid substitution within the C-terminal-most 4 to 30 amino acids, including amino acids 734 to 754, of NBSl (SEQ ID NO:1).
- the peptide can comprise 1, 2 or 3 conservative amino acid substitutions.
- the polypeptide can comprises an amino acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
- the polypeptide does not comprise the C-terminal most 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids, for example.
- the polypeptide can be any polypeptide comprising the NBS 1 - binding domain of ATM.
- the herein provided polypeptide can be any polypeptide comprising heat repeats 2 and/or 7 of ATM.
- the herein provided polypeptide can be any polypeptide comprising amino acids 248-522 of ATM (SEQ ID NO:51).
- the herein provided polypeptide can be any polypeptide comprising SEQ ID NO:56.
- the herein provided polypeptide can be any polypeptide comprising amino acids 1436-1770 of ATM (SEQ K) NO:51).
- the herein provided polypeptide can be any polypeptide comprising SEQ K) NO:57.
- the provided polypeptide can comprise a conservative amino acid substitution within the heat repeats 2 and/or 7 of ATM.
- the peptide can comprise 1, 2 or 3 conservative amino acid substitutions.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to amino acids 248- 522 of ATM (SEQ ED NO:51) or amino acids 1436-1770 of ATM (SEQ ID NO:51).
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ K) NO:56.
- the polypeptide can comprise an amino acid sequence with at least 95% sequence identity to SEQ K) NO: 57.
- a method of identifying a radiosensitizing agent comprising contacting a sample comprising NBSl and ATM polypeptides with a candidate agent, and detecting the interaction between the NBSl and ATM polypeptides, a decrease in the interaction between the NBSl and ATM polypeptides as compared to controls indicating the candidate agent is radiosensitizing.
- the method is in one aspect a screening assay, such as a high-throughput screening assay.
- the contacting step can be in a cell-based or cell- free assay.
- the interaction between the NBSl and ATM polypeptides can be detected using fluorescence polarization.
- the NBSl and/or ATM polypeptide can comprise a fluorophore.
- the herein disclosed NBSl polypeptide can be used as a positive control.
- candidate agents can be identified from large libraries of natural products or synthetic (or semi-synthetic) extracts or chemical libraries according to methods known in the art.
- test extracts or compounds are not critical to the screening procedure(s) of the invention.
- chemical extracts or compounds can be screened using the exemplary methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.
- Synthetic compound libraries are commercially available, e.g., from Brandon Associates (Merrimack, NH) and Aldrich Chemical (Milwaukee, WI).
- libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft.
- the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract having an activity that stimulates or inhibits NBSl-ATM interaction.
- the same assays described herein for the detection of activities in mixtures of compounds can be used to purify the active component and to test derivatives thereof. Methods of fractionation and purification of such heterogenous extracts are known in the art. If desired, compounds shown to be useful agents for treatment are chemically modified according to methods known in the art. Compounds identified as being of therapeutic value may be subsequently analyzed using animal models for diseases or conditions. 3. Methods of Administration
- compositions may be administered topically, orally, or parenterally.
- the compositions can be administered extracorporeally, intracranially, intravaginally, intraanally, subcutaneously, intradermally, intracardiac, intragastric, intravenously, intramuscularly, by intraperitoneal injection, transdermally, intranasally, or by inhalant.
- 'intracranial administration means the direct delivery of substances to the brain including, for example, intrathecal, intracisternal, intraventricular or trans-sphenoidal delivery via catheter or needle.
- Parenteral administration of the composition is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3, 610, 795, which is incorporated by reference herein.
- 'topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
- the materials may be in solution or suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol.
- Vehicles such as 'stealth' and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution can be from about 5 to about 8, from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
- Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. The compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
- compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
- Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
- the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
- Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- Formulations for topical administration may include ointments, lotions, creams, gels (e.g., poloxamer gel), drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions can be administered, for example, in a microfiber, polymer (e.g., collagen), nanosphere, aerosol, lotion, cream, fabric, plastic, tissue engineered scaffold, matrix material, tablet, implanted container, powder, oil, resin, wound dressing, bead, microbead, slow release bead, capsule, injectables, intravenous drips, pump device, silicone implants, or any bio-engineered materials.
- the provided pharmaceutically acceptable carrier is a poloxamer.
- Poloxamers referred to by the trade name Pluronics ® , are nonionic surfactants that form clear thermoreversible gels in water.
- Poloxamers are polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) tri-block copolymers.
- the two polyethylene oxide chains are hydrophilic but the polypropylene chain is hydrophobic. These hydrophobic and hydrophilic characteristics take charge when placed in aqueous solutions.
- the PEO-PPO-PEO chains take the form of small strands where the hydrophobic centers would come together to form micelles.
- the micelle sequentially, tend to have gelling characteristics because they come together in groups to form solids (gels) where water is just slightly present near the hydrophilic ends. When it is chilled, it becomes liquid, but it hardens when warmed.
- compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable..
- compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid, glyco
- Effective dosages and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art.
- the dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected.
- the dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like.
- the dosage will vary with the age, condition, sex and extent of the disease in the patient, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art.
- the dosage can be adjusted by the individual doctor in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. The range of dosage largely depends on the application of the compositions herein, severity of condition, and its route of administration.
- the NBSl peptide compositions can be used in doses as low as 0.01% w/v.
- the dosage can be as low as 0.02% w/v and possibly as high as 2% w/v in topical treatments.
- Significantly higher concentrations of the compositions by themselves or in combination with other compounds may be used in applications like cancer/tumor therapy or as an early concentrated bolus immediately following an acute tissue injury.
- upper limits of the provided polypeptides may be up to 2-5 % w/v or v/v if given as an initial bolus delivered for example directly into a tumor mass.
- parenteral routes of administration for example intramuscular, intracerebral, intracardicardiac and intraspinal could be up to 1 % w/v or v/v depending on the severity of the injury.
- This upper dosage limit may vary by formulation, depending for example on how the polypeptide(s) is combined with other agents promoting its action or acting in concert with the polypeptide(s).
- upper limits of O.Olg /Kg body weight over time courses determined by the doctor based on improvement in the condition can be used.
- upper limits of concentration of the provided nucleic acids delivered topically would be 5-10 ⁇ g/cm 2 depending for example on how the nucleic acid is combined with other agents promoting its action or acting in concert with the nucleic acids. This would be repeated at a frequency determined by the Doctor based on improvement.
- upper limits of concentration of the provided nucleic acids delivered internally for example, intramuscular, intracerebral, intracardicardiac and intraspinal would be 50- 100 ⁇ g/ml of solution. Again, the frequency would be determined by the Doctor based on improvement.
- the concentration of the polypeptides can be 10-200 ⁇ M mixed in with 10-30 % pluronic gel or any such carrier that enables penetration of the peptide(s) within the site of interest for a period of at least 3-6 hours prior to surgery.
- This pre-procedural conditioning can improve the subsequent healing response to surgery, including reduced inflammatory response.
- Viral vectors remain highly experimental tools that nonetheless show considerable potential in clinical applications. As such, caution is warranted in calculation of expected dosage regimes for viral vectors and will depend considerably on the type of vector used.
- retroviral vectors infect dividing cells such as cancer cells efficiently, intercalating into the host cell genome and continuing expression of encoded proteins indefinitely. Typical dosages of retroviruses in an animal model setting are in the range of 10 7 to 10 9 infectious units per ml.
- adenoviruses most efficiently target postmitotic cells, but cells are quickly eliminated by the host immune system or virus is eventually lost if infected cells resume proliferation and subsequently dilute the viral episomal DNA.
- this transient time course of infection may be useful for short-term delivery of the composition described herein in certain clinical situations, for example in amelioration of a small injury.
- concentrations of 10 8 -10 H infectious units per ml of adenovirus are typical for uses in research. Dose ranges of vectors based on data derived from animal models would be envisaged to be used eventually in clinical setting(s), pending the development of pharmaceutically acceptable formulation(s).
- a composition such as a polypeptide, for promoting radiosensitization
- the efficacy of the therapeutic composition can be assessed in various ways well known to the skilled practitioner.
- a composition, such as a polypeptide, disclosed herein is efficacious in promoting radiosensitization in a subject by observing that the composition can reduce scar tissue formation, reduce fibrotic tissue formation, improve tissue regeneration, or reduce inflammation in the subject following tissue injury. Methods for measuring these criteria are known in the art and discussed herein. 4. Methods of Making the Compositions
- compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
- the provided nucleic acids can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation (see for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.
- Protein nucleic acid molecules can be made using known methods such as those described by Nielsen et al., Bioconjug. Chem. 5:3-7 (1994).
- One method of producing the disclosed polypeptides is to link two or more peptides or polypeptides together by protein chemistry techniques.
- peptides or polypeptides can be chemically synthesized using currently available laboratory equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert-butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc., Foster City, CA).
- a peptide or polypeptide corresponding to the disclosed proteins can be synthesized by standard chemical reactions.
- a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a peptide or protein can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment.
- peptide condensation reactions these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form a protein, or fragment thereof.
- peptide or polypeptide is independently synthesized in vivo as described herein. Once isolated, these independent peptides or polypeptides may be linked to form a peptide or fragment thereof via similar peptide condensation reactions.
- enzymatic ligation of cloned or synthetic peptide segments allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides or whole protein domains (Abrahmsen L et al., Biochemistry, 30:4151 (1991)).
- native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method consists of a two step chemical reaction (Dawson et al. Synthesis of Proteins by Native Chemical Ligation. Science, 266:776-779 (1994)).
- the first step is the chemoselective reaction of an unprotected synthetic peptide—thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site (Baggiolini M et al. (1992) FEBS Lett.
- unprotected peptide segments are chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer, M et al. Science, 256:221 (1992)).
- This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton RC et al., Techniques in Protein Chemistry IV. Academic Press, New York, pp. 257-267 (1992)).
- nucleic acid molecules produced by the process comprising linking in an operative way a nucleic acid encoding a polypeptide disclosed herein and a sequence controlling the expression of the nucleic acid.
- cells produced by the process of transforming the cell with any of the herein disclosed nucleic acids.
- animals produced by the process of transfecting a cell within the animal with any of the nucleic acid molecules disclosed herein Disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the animal is a mammal. Also disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the mammal is mouse, rat, rabbit, cow, sheep, pig, or primate. Also disclose are animals produced by the process of adding to the animal any of the cells disclosed herein.
- compositions can be used in a variety of ways as research tools.
- the disclosed compositions such an isolated polypeptide comprising SEQ ID NOs:3, 4, 5, 6, 7, 8, 9, and 10 can be used to study the interactions between NBSl and ATM, by for example acting as inhibitors of binding.
- Other uses are disclosed, apparent from the disclosure, and/or will be understood by those in the art.
- Other uses are disclosed, apparent from the disclosure, and/or will be understood by those in the art.
- 'a, ' 'an, ' and 'the' include plural reference unless the context clearly dictates otherwise.
- reference to 'a peptide' includes a plurality of such peptides
- reference to 'the peptide' is a reference to one or more peptides and equivalents thereof known to those skilled in the art, and so forth.
- 'Optional' or 'optionally' means that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present and instances where it does not occur or is not present.
- Ranges can be expressed herein as from 'about' one particular value, and/or to 'about' another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent 'about, ' it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as 'about' that particular value in addition to the value itself. For example, if the value '10' is disclosed, then 'about 10' is also disclosed.
- 'inhibit, ' 'inhibiting, ' and 'inhibition' mean to decrease an activity, response, condition, disease, or other biological parameter. This can include, but is not limited to, the complete loss of activity, response, condition, or disease. This can also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. E. Examples
- Example 1 Characterization of an NBSl C-Terminal Peptide That Can Inhibit Ataxia Telangiectasia Mutated (ATM)-Mediated DNA Damage Responses and Enhance Radiosensitivity i.
- Materials and Methods Cell culture Human tumor cell lines HeLa and DU- 145 (ATCC, Manassas, VA), and human SV-40 transformed fibroblast cell line GM9607 (Cornell Cell Repositories, Camden, NJ) were maintained in exponential growth in DMEM-10%FB S, in a 5% CO 2 humidified atmosphere.
- the glioma cell line M059J (Cornell Cell Repositories) were maintained in exponential growth in RPMI- 15%FBS, in a 5% CO 2 humidified atmosphere.
- Peptides synthesis All peptides were synthesized by Abgent (San Diego, CA) and labeled with a biotin tag at their N-terminus for detection in vitro. Three peptides were produced, one containing the polyarginine (R 9 ) internalization sequence alone, and a wild- type NBSl inhibitory peptide (wtNIP) corresponding to amino acids 735-744 of human NBSl, and a random sequence peptide in which a.a. 735-744 of human NBSl were scrambled (scNIP). The peptides were dissolved in DMSO, stored at -2O 0 C, and reconstituted in DMEM- 10% FBS prior to use.
- R 9 polyarginine
- wtNIP wild- type NBSl inhibitory peptide
- scNIP random sequence peptide in which a.a. 735-744 of human NBSl were scrambled
- Immunoprecipitation and Western blotting For co-immunoprecipitation of ATM, NBSl and MREl 1, cells were lysed 1 hour in ice-cold lysis buffer, which consisted of 1OmM Tris-HCl (pH 7.5), 100 mM NaCl, 5 mM EDTA, 0.5% NP-40, 5 HiMNa 3 VO 4 , 1 mM NaF, and 1 mM PMSF. After centrif ⁇ igation, supematants were incubated with indicated antibodies. After extensive washing with the lysis buffer, immunoprecipitates were analyzed by immunoblot using specific antibodies. For western blotting analysis, samples (cell lysates or immunoprecipitates) were separated on 4-12% SDS-poly- acrylamide gels, transferred to nitrocellulose membranes, and probed with various antibodies.
- Immunofluorescence microscopy Exponentially growing cultures of cells were plated on sterile, 22cm 2 coverslips, and incubated for 24 hours at 37 0 C in 5% CO 2 humidified air before they are treated with the NIP peptides at room temperature. Coverslips were washed with PBS and fixed with 4% paraformaldehyde-0.25% Triton X- 100 for 15 minutes at room temperature, blocked for 30 minutes at room temperature, and incubated with FITC-conjugated streptavidin or anti- ⁇ H2AX and phospho-NBSl antibodies (Rockland Immunochemicals, Gilbertsville, PA) for 1 hour at room temperature.
- MTT assay For cytotoxicity studies, exponentially growing cultures of HeLa or DU- 145 cells were harvested, plated in 96-well plates (5000 cells/well) in complete media, and incubated overnight. On the following day cells were treated with the NIP peptides (0, 5, 10, 20, 50 or lOO ⁇ M) or Taxol (0, 10, 50 or 10OuM) as a positive control. At the end of the time course, an MTT cell viability assay (Promega Corp., Madison, WI) was used according to manufacturer's guidelines to determine peptide cytotoxicity.
- Colony formation assays To determine the radiosensitivity, the colony forming assay was incorporated. Cells were harvested with 0.125% trypsin-0.05% EDTA, pelleted and re-suspended in ImI fresh media with a 22g needle to disperse clumps prior to hemocytometer counting in trypan blue. Cells were then plated at limiting dilutions in 6- well plates and allowed to adhere overnight. Cultures were treated with PBS, R % wtNIP, or scNIP for 1 hour, and irradiated (0-6Gy). Fresh peptides were added every four hours until 24 hours after IR, when the medium was replaced with peptide-free medium.
- SER sensitizing enhancement ratio
- NBSl Inhibitory Peptides The C-terminal NBSl domain is critical for its binding to ATM, and an NBSl truncated derivative lacking the C-terminal 20 residues does not associate with ATM in vitro (Cerosaletti and Concannon, 2003, 2004; Falck et al., 2005; Cerosaletti et al., 2006).
- expression of an NBSl transgene lacking the ATM binding domain in NBS cells leads to a dramatic reduction in ATM activation (Difilippantonio et al., 2005).
- NBSl-ATM interaction can be a novel target for developing radiosensitizers.
- One approach to inhibiting NBSl-ATM interaction is to use small peptides containing the conserved C-terminal sequence, which can compete with endogenous NBSl-ATM interactions (Fig. IA). Therefore, peptides were designed containing two functional domains: one an interfering domain that will inhibit the NBSl- ATM association, and the other an internalization domain that will transport the interfering peptides into cells. For the interfering domain, the amino acid sequences containing the conserved C-terminal motif of NBSl was used as shown in Fig. IB.
- This sequence contains the shortest ATM binding motif based on in vitro data.
- a polyarginine (R9) sequence was used for the internalization domain.
- the polyarginine sequence has been shown to have a significant efficiency of transporting small peptides and proteins across the plasma membrane (Fuchs and Raines, 2004; Deshayes et al., 2005).
- Three peptides were generated, including the R 9 -alone, and a wtNIP corresponding to amino acids 73 to 44 of human NBSl .
- the third peptide was designed as a negative control, using a random sequence generator to produce a peptide in which amino acids 735 to 744 of NBSl were scrambled (scNIP). These peptides were labeled with a bio tin tag at their N termini for detection in vitro.
- the immunoprecipitates were then blotted with anti-ATM, NBSl, and MREl 1 antibodies.
- a normal level of ATM-NBSl association was observed in R 9 - treated cells compared with control cells.
- NBSl was no longer able to bring down ATM (Fig. 3).
- the wtNDP affected only the NBSl- ATM interaction and did not interfere with NBSl binding to MREl 1.
- scNBP did not affect the NBSl-ATM interaction.
- wtNEP showed an effect similar to that in unirradiated cells.
- wtNIP can abrogate the NBSl-ATM interaction in the absence or the presence of DNA damage.
- wtNIP Inhibits IR-Induced y-H2AXand NBSl pSer343 Focus Formation:
- One of the earliest responses to IR-induced DNA damage is the formation of ⁇ -H2AX foci, which requires functional ATM (Burma et al., 2001; Furuta et al., 2003).
- wtNIP showed an inhibitory effect on the NBS 1 -ATM interaction, it was investigated whether IR-induced ⁇ -H2AX focus formation was inhibited by the peptide.
- Immunofluorescence microscopy was used to detect the presence of 7-H2AX foci in mock-irradiated or irradiated cells in the presence of R 9 , wtNIP or scNIP. While R 9 showed no significant inhibition of ⁇ -H2AX foci formation, wtNIP can inhibit ⁇ -H2AX foci formation 30 minutes after treatment with 6Gy IR ( Figure 4).
- NBSl foci are a result of ATM-mediated NBSl phosphorylation on serine 343.
- R 9 or scNIP a cell treated with wtNIP compared with those treated with R 9 or scNIP.
- the average number of foci in mock-irradiated HeLa cells was 6, 8, and 6 for R 9 , wtNIP, and scNIP, respectively.
- Cells treated with R 9 or scNIP displayed 25 and 31 foci per nucleus, whereas cells treated with wtNEP showed only 6 foci per nucleus after treatment with 6-Gy IR (Fig. 5B).
- wtNIP Increases Radiation Sensitivity: Whether exposure to the NIP peptides will increase cellular radiosensitivity was then tested using the colony forming assay.
- Figure 6A depicts the survival curves for HeLa cells treated with R 9 , wtNIP, or scNIP over a dose range of 0 to 6 Gy. Neither R 9 nor scNIP affects radiosensitivity, whereas wtNIP can significantly decrease IR-induced survival.
- the survival of cells treated with wtNIP was 31.4% compared to 52% and 49.7% for R 9 and scNIP treated cells.
- survival of cells treated with wtNIP decreases to 4.5% compared to 11.8% and 11.2% for R 9 and scNIP treated cells.
- a dose increase to 6Gy lead to a modest decline in survival of cells treated with wtNIP, 1.7%, compared to 5.3% and 6.9% for cells treated with R 9 or scNIP, respectively.
- the sensitizer enhancement ratio, the relative effectiveness of the enhancer, for wtNIP treated cells was 1.66, 2.61, and 3.12 at 2, 4, and 6Gy respectively.
- D 0 represents the mean lethal dose required for 37% survival and is a measure of the intrinsic radiosensitivity of the cell.
- D 0 values for HeLa treated with wtNIP were 1.9 compared with 3.0 for cells treated with scNIP.
- Student's t test was incorporated. The data were first fit to each experimental group over a dose range of 0 to 6 Gy. Significant differences (p ⁇ 0.05) in clonogenic survival were observed between cells treated with wtNIP and those treated with DMEM, Rg, or scNIP.
- the SER was 1.58.
- wtNIP contains the conserved ATM binding sequence of NBSl, and this sequence is also conserved in the C terminus of ATR-interacting protein and KU80, the interacting proteins of ATR and DNA-PKcs, respectively, it could also inhibit ATR or DNA-PKcs (Abraham, 2001).
- colonyforming assays were performed in cell lines with defective ATM (GM9607) or DNA-PKcs (M059J). Although treatment with wtNIP led to an increase in radiosensitivity in M059J cells (Fig. 6C) with an SER of 1.83, GM9607 (Fig. 6D) displayed no change in radiosensitivity. Because GM9607 cells are ATM-deficient and have functional ATR and DNA-PKcs, these observations strongly indicate that wtNIP can specifically target ATM, but not ATR or DNA-PKcs, to achieve radiosensitization. 2.
- Animal studies strongly indicate that wtNIP can specifically target ATM, but not ATR or DNA-PKcs, to achieve radiosensitization
- the in vivo radiosensitizing effect of these peptides is tested on mouse tumor xenograft models and a zebrafish embryo model. Tumor-targeting NIP peptides that can specifically accumulate in tumor cells are administered. In addition to confirming the radiosensitizing effect of the wtNIP peptide and conservative variants thereof on mouse breast cancer and prostate cancer xenograft models, the the following questions are addressed: 1) how do the NIPs specifically radiosensitize tumor cells; 2) does the peptide also radiosensitize normal tissues; 3) how does the tumor micro-vessel density affect the radiosensitizing enhancement ratio; and 4) what is the radiosensitizing effect of the wtNIP peptide on zebrafish embryos? i.
- NGR a tumor homing motif conjugated fusion peptides to the xenografts.
- the effect of the radiosensitizing peptides on xenografts grown in mice is then determined.
- human breast and prostate tumor xenografts are developed in mice, the mice are injected with the peptides, and the peptides are allowed to target the xenograft cells for the appropriate length of time.
- NGR-- the Tumor Homing Motif The polyarginine sequence can achieve efficient internalization for the fused NIP peptides. However, another approach to achieve this goal is to utilize sequences that have both internalization and tumor specific targeting abilities.
- NGR motif which includes the cyclic tumor-homing peptide, CNGRC (SEQ ID NO: 11).
- the NGR-containing peptides have proven useful for delivering cytotoxic drugs, pro-apoptotic peptides, and the tumor necrosis factor a to tumor vasculature (Ellerby et al., 1999; Arap et al., 1998; Arap et al., 2002; Cumis et al., 2002). More interestingly, it has been shown that NGR peptides can bind to prostatic primary and metastatic tumors, but not to normal prostate tissues (Pasqualini et al., 2000). Therefore the NGR sequence is used for the animal studies. Three NGR-NIP fusion peptides are synthesized, including NGR-only, NGR-wtNEP, and NGR-scNIP. The NGR sequence have been successfully utilized, demonstrating tumor homing and internalization abilities.
- MCF-7 andPC-3 xenografts Establishment of the MCF-7 breast cancer and the PC-3 prostate cancer xenografts is performed. Specific pathogen- free, 4-6 week old male nu/nu (nude) mice are obtained and housed in sterilized filter-topped cages kept in laminar flow isolators. Mice are fed autoclaved food and water ad libitum. Mice are acclimated for one week prior to use in study protocols. All procedures involving the animals are performed under sterile conditions in a laminar flow hood. MCF-7 or PC-3 tumor cells (2 x 10 6 per mouse in PBS) are injected s.c. into the flanks of athymic nude mice. In all experiments, tumors are allowed to establish and grow before any treatment is initiated.
- mice are randomized and treated with the NGR-only, NGR-wtNEP, or NGR-scNIP peptides at doses ranging from 0.5-2 mg/kg by one of two routes: intraperitoneal (ip) or intra-tumoral injection (it). 0, 6, 12, or 24 hours after injection, the mice are euthanized, and the tumor tissue and normal tissues surrounding the tumor tissue is obtained. Whole blood is isolated up to 24 hours after peptide injection. The samples are assessed by a flow-activated cell sorting (FACS) analysis when stained with an FITC-conjugated streptavidin antibody.
- FACS flow-activated cell sorting
- Splenic cells are analyzed by performing a splenectomy up to 24 hours after peptide injection of the mice. These experiments provide information on how fast the peptides can reach the tumor tissue, how long they will remain in the tumors, and whether the peptides will also accumulate in normal tissues. Localization of the peptides within tumor tissues is analyzed by dissection of the tumor tissues after up to 24 hours after peptide injection. The tumor tissue specimen is stained with FITC-conjugated streptavidin, and immunofluorescence microscopy is performed.
- Xenografts are implanted into the flanks of mice through s.c. injections of 0.1 ml of PBS containing 2 x 10 6 human MCF-7 or PC-3 carcinoma cells using a 23G needle. Once the tumors reach 100 mm 3 , the mice are randomized and injected with peptides via ip or it. Dose and time for peptide exposure are determined. For intraperitoneal injection, the volumes of peptides is less than 20ml/Kg. For intratumoral injection, the volume is less than 10ml/kg. Following a short interval to allow peptides to target tumors, mice are transported from the animal center in filter top cages to the radiation room.
- the irradiator unit is a Precision X-RAD 320 Irradiation System.
- the dose rate for the irradiator at the distance of 50cm is 2.8Gy/min, while at the distance of 25 cm is 5.6 Gy/min. Both single dose (10 or 20Gy) and fractionated dose (2Gy * 5 times or 2Gy x lO times) are performed.
- the interval for the fractionated radiation is 24 hours and irradiation duration is less than 4 minutes.
- mice are briefly (less than 5 minutes) restrained in a Plas Labs (Lansing, MI) clear plastic mouse- restraining device (tube) to allow the tumors to be targeted by radiation.
- Tumor growth is reported as an average tumor volume, calculated as ⁇ *(w*l*h)/2, where w is width, 1 is length, and h is height in mm. Tumor volume as a function of time is plotted to compare the sensitizing effect of the peptides after radiotherapy.
- NGR-wtNIP peptide tends to specifically target tumor cells, and a critical endpoint for evaluating this therapeutic agent to be useful in the clinic is how it affects the normal tissue radiation response. Radiation response is investigated on early (skin) and late (lung) responding normal tissues. These tissues were chosen because they fall into radiation fields for many cancer types, especially breast cancer radiotherapy. The second reason that they were chosen is that there are established methods and standards to evaluate skin and lung radiation response. Mice are treated with the NGR-fusion peptides before 10Gy radiation is delivered. To study skin damage, radiation is given locally to the right rear foot on restrained, non anaesthetized mice.
- mice that have survived for 8 months are studied after peptide associated radiation in the left lung. Both lungs are dissected and fixed in 10% formalin for 24 hours and sectioned into 5- ⁇ m-thick sections, mounted on glass slides, and stained. Masson's trichrome stain is used to detect fibrosis (Dileto and Travis, 1996). ii. The Zebrafish embryo model
- Zebrafish (Danio reri ⁇ ) can be used as a unique vertebrate model to screen therapeutic agents rapidly and effectively because of their relatively close genetic relationship to humans, fecundity and accessibility, short embryonic development, and the ease of observation and direct visualization (Stern and Zon, 2003).
- Two zebrafish genes that are related to human genes have been cloned.
- Zebrafish ATM (zATM)(Garg et al., 2004) and zebrafish NBSl (zNBSl, NCBI #AAW50708) share at least 70% of homology with human partners hATM and hNBS 1.
- Embryo harvesting and maintenance Wild-type adult zebrafish are obtained and maintained according to standard operating procedures. Zebrafish are kept at 28.5 0 C on a 14-hour day/10-hour night cycle. Adult fish are kept segregated by sex and mated in embryo collection tanks (Aquatic Habitats, Apopka, FL).
- Embryos from these breedings are collected soon after the onset of the light cycle and transferred to Petri dishes in ImM NaCl in tank water. Methylene blue is routinely added as antiseptic (0.5 mg/L final). Viable embryos are washed and sorted (10 embryos/well of standard 12- well culture plates) in 2ml embryo medium by one- to two-cell stage (approximately 0.5-lh post fertilization [hpfj), and maintained under normoxic conditions with temperature at 25°C to slow normal development. EM is changed after dechorionation at 24-48 and again at 72- 96 hpf.
- Embryo irradiation and NGR-peptide exposure Embryos at 2, 4, 6, 8, or 24 hpf are exposed to different doses (10-50 ⁇ M) of the NGR-peptides for one hour before they are exposed to single fractions of X-ray irradiation (5, 10 or 20 Gy). After irradiation, embryos are incubated at 25°C for 24h, dechorionated, and then maintained at 25°C for up to 144h to evaluate morphology and survival.
- Radiosensitizing enhancement ratios is calculated as a survival ratio with the NIP-peptides pretreated embryos as the numerator and non-NEP- peptide pretreated embryos as the dominator.
- embryos are fixed in 4% paraformaldehyde and embedded in paraffin. Samples are sectioned and the tissue slices (5 ⁇ m) stained with H&E, assessed with a Leica microscope at x40 magnification, and photographed using Q imaging Retiga Exi digital camera and analyzed with Image Pro Plus 5.1 software. At least 20 embryos from each treatment group are assessed, and the experiments repeated at least three times. 3.
- Example 3. High throughput screening (HTS) High throughput screening
- HTS High throughput screening
- the rotational speed of the molecule is dependent on the size of the molecule, such that ligands less than 5000 Da can achieve significant depolarization, leading to rapid molecular rotation and emission of a depolarized fluorescent signal.
- ligands less than 5000 Da can achieve significant depolarization, leading to rapid molecular rotation and emission of a depolarized fluorescent signal.
- the ability of the fluorophore to depolarize light is severely reduced, resulting in an increase of the polarization signal (Figure 10) (Sportsman et al., 2003; Thompson et al., 2002).
- FP HTS inhibitors have been identified to target the BRCT domain of breast cancer related gene BRCAl, Hsp90, and Bcl-xL (Howes et al., 2006; Kim et al., 2004; Qian et al., 2004).
- FP assay is used the to screen a library of compounds developed at Southern Research Institute (2OK compounds) and the CB2 library (100K) and diversity sets from this library (10K and 3K), to identify compounds that can block NBSl-ATM interaction. Since it has been demonstrated that the conserved C-terminal of NBSl binds to a series of the heat repeats (HR 2, a.a. 248-522, and HR 7, a.a.1436-1770) in ATM ( Figure 1), the FP assay is achieved by detecting changes in florescence polarization signals in a cell-free assay with mixtures of GST-ATM peptides (as a receptor) and NBS 1 peptides (as a tracer).
- GST-ATM peptides A purified GST fusion protein containing HR 2 and HR 7 of ATM is generated.
- an expression vector encoding a glutathione S-transferase (GST) containing residues 248- 1770 (GST-ATM) is generated by inserting the corresponding PCR generated BamHl- EcoRl fragment of human ATM cDNA into pGEX-2T (Amersham Bioscience).
- GST-ATM fusion protein is purified by a standard GST-fusion peptide preparation method and protein homogeneity is analyzed by SDS-PAGE.
- the second step is to determine an optimal position for Texas Red (TR) labeling on the NBSl C-terminal peptide (a.a. 734-754).
- TR was chosen in place of fluorescein to eliminate false positives that may occur due to compound auto-fluorescence.
- TR labeling on the N- terminus or the C-terminus can affect NBSl-ATM binding is tested.
- the NBSl conserved C-terminal sequence (QHAKEESLADDLFRYNPYLKRR, SEQ ID NO:3), which includes 3 critical binding sites for ATM (736-737 (EE), 741-742 (DD), and 745-746 (RY)), is used for the binding assay.
- TR- NBSl N-terminus
- NBSl-TR C-terminus of the peptide as shown in Table 3.
- the dissociation constant, K ⁇ is then determined for each labeled-peptide by titrating a constant concentration of TR-labeled peptide ( 1 OO ⁇ M) with increasing concentrations of the GST- ATM proteins.
- the GST tag is left in place since polarization is directly related to the molecular mass of the protein.
- the range of the assay is defined by the difference in polarization between the bound peptide and the free peptide, and the K ⁇ value used to determine the best location for the TR label.
- NBSl-ATM binding affinity, FP assay stability, and FP DMSO tolerance To determine the ability of the labeled NBSl peptide to bind to ATM, a competition based assay is conducted using the unlabeled wtNBSl peptide of equal length to the labeled peptides (Table 1). The unlabeled NBSl peptide is titrated into an optimum concentration (as defined previously) of GST-ATM and labeled NBSl to determine the ability of the labeled NBSl peptide to bind to ATM in the presence of unlabeled NBSl peptide. The stability of the assay is an important parameter that determines the throughput of the FP screen.
- NBSl-ATM binding is incorporated to determine the stability of the signal.
- the binding assay is incubated at room temperature over a 12 hour period with assay plate readings at 4 hour intervals over that time period. This study lends insight into the binding time of the NBSl-ATM complex. Since all of the chemical compounds in the screening libraries are dissolved in DMSO, testing the tolerance of DMSO (i.e., the concentration necessary to keep the compounds in solution without inhibiting the peptide-GST fusion protein interaction) is important in determining the final DMSO concentration in the FP assay for high throughput screening. DMSO with final concentrations ranging from 0-8% is added to each well before addition of the labeled NBSl peptide and GST-ATM.
- Biostatistical analysis of assay performance indicators The Z' factor evaluates the quality and suitability of the assay (0- 1.0, 1.0 being the best assay, but 0.5- 1.0 considered a robust assay) and is based on the mean ( ⁇ ) and standard deviation ( ⁇ ) of both positive (p) controls and negative (n) controls ( ⁇ p, ⁇ n , ⁇ p , ⁇ n ).
- To establish the Z' factor competitive inhibition using the FP assay will be used to establish the enzyme inhibitor constant K ⁇ .
- K ⁇ values increasing concentrations (0-500/xM) of unlabeled NBSl peptide and 2 ⁇ M labeled NBSl peptide are added to an appropriate concentration of GST-ATM.
- the concentration of GST-ATM is established from K & values in the previous experiments which should be at least 1 , and is based on the ratio between the receptor (ATM) and the K ⁇ of the labeled NBSl peptide. From these values, the Z' factor is calculated according to:
- a Z' factor that is >0.5 is considered acceptable for the FP high throughput screen.
- the signal-to-noise ratio is another important performance indication.
- S/N is used to quantify the extent of non-specific binding (NSB) where a signal to noise ratio of 10 or greater is an acceptable level of performance.
- NNB non-specific binding
- FP the S/N cannot be used since the noise cannot be quantified by the extent of non-specific binding.
- unbound tracer is present and contributes to the overall NSB signal making it larger than the NSB signal alone. Therefore, the S/N value is smaller compared to other assays where unbound tracer must be removed or distinguished from bound tracer. ii. HTS and validation of hits.
- the diversity library established at Southern Research Institute (20, 000 compounds) and the Chembridge library (100,000 compounds + 30, 000 and 20,000 diversity sets within this library) are screened at lO ⁇ M with a lO ⁇ M TR-labeled NBSl peptide and an optimal concentration (as defined in previous experiments) of GST-ATM in DMSO solution in 15 minutes incubation at room temperature.
- the assay is carried out in 384 or 1536 -well plates with the unlabeled wtNIP peptide used as a positive inhibitory control.
- the hits identified from this experiment are serially diluted, and the assay repeated and the K 1 values established. The compounds with the 10 lowest K ⁇ value are chosen for further evaluation. iii. In vitro evaluation of the hit compounds.
- hypoxic tumor cells are considered to be hyper-resistant to radiation, leading to a failure of radiotherapy. If the wtNIP radiosensitizing peptide can be expressed specifically in hypoxic tumor tissues, then a dramatic increase of tumor control by radiotherapy is expected.
- a hypoxia-driven adenovirus vector is provided that can express wtNEP in hypoxic tissues. The efficacy of the virus in both tissue culture and animal models is assessed. First, an expression cassette in which the hypoxia-response promoter drives wtNIP expression is generated.
- a complement pair of two synthetic oligonucleotides are generated based on the hypoxia response enhancer element from the murine phosphoglycerate kinase 1 5' flanking sequence (-307 to -290) with Nhel compatible ends: 5'CTAGAGTCGTGCAGGACGTGACATCTAGTGTCGTGCAGGCATCTAGT GTCGTGCAGGACGTGCATC3 ' (SEQ ID NO: 14),
- the two oligos are annealed to form a double strand DNA and cloned directly to the Nhel site of the pGL3-promoter vector (Promega, Madison, WI).
- the pGL3-promoter vector has an SV40 basic promoter, and the structure of the hypoxia response enhancer in combination with the SV40 basic promoter was proven to drive reporter genes and tumor suicide genes to specifically express in hypoxic tumors.
- another pair of oligos are made based on the small peptide sequence with 5' Nco I and 3' Xbal compatible sites. For easy detection of the small peptide expression, a His tag sequence linked to 3' end of the peptide is designed.
- the oligo sequences are:
- the sequence between the slashes is a tandem repeat of 6 histidines. After being annealed to a double strand DNA, the fragment is directly cloned into the Nco I and Xbal sites of the pGL-3 promoter vector to replace the original luciferase reporter gene. The resultant construct is confirmed by sequence.
- the whole expression cassette, released by Kpn I and BamHI, is Ii gated into the adenovirus vector shuttle plasmid (Stratagene, CA). Then, the shuttle vector is recombined by homologous recombination with the El- and E3- deleted pAdEasy-1 adenoviral backbone vector to generate a packagable Ad genome.
- B J5183 competent bacteria is transformed by electroporation, and the correct clone plasmid, pAd5-hypoxia-SIP2, is chosen for adenovirus vector production.
- the 911 adenovirus packaging cell line is used and transfected by calcium phosphate precipitation.
- the produced vector is propagated in 911 cells.
- Cesium chloride gradient centrifugation and Sepharose CL-6B colume desalting is performed to concentrate and purify the vector preparation. After the vector is generated, it is expressed in hypoxic human cancer cell cultures to test whether they express the NIPs. After expression is confirmed, a radiosensitization effect is investigated.
- viruses are injected in the mouse xenograft model and the in vivo radiosensitizing effect evaluated.
- Furuta, T. Takemura, H., Liao, Z. Y., Aune, G.J., Redon, C, Sedelnikova, O.A., Pilch,
- Nicotinamide as a radiosensitizer in tumours and normal tissues the importance of drug dose and timing. Radiother. Oncol. 45, 167-174.
- Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res. 60, 722-727.
- SEQ ID NO:14 ctagagtcgtgcaggacgtgacatctagtgtcgtgcaggcatctagtgtcgtgcaggacgtgcatc 15.
- SEQIDNO:15 ctaggatgtcacgtcctgcacgacactagatgcctgcacgacactagatgtcacgtcctgcacgactagatgtcacgtcctgcacgact
- SEQIDNO:16 catggaaggaggaagcagccaaggagaag/accaccaccaccaccaccaccac
- SEQIDNO:26 klalklalkalkaalkla 27.
- SEQIDNO:27 aavallpavllallap
- SEQIDNO:42 rrrrrrrrreeggdvddl 43.
- SEQIDNO:43 caacatgcaaaagaagagtctcttgctgatgatctttttagatacaatccttatttaaaaggagaagataa
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002674238A CA2674238A1 (en) | 2006-10-30 | 2007-10-30 | Targeting nbs1-atm interaction to sensitize cancer cells to radiotherapy and chemotherapy |
| EP07867306A EP2091964A2 (en) | 2006-10-30 | 2007-10-30 | Targeting nbs1-atm interaction to sensitize cancer cells to radiotherapy and chemotherapy |
| US12/447,717 US20100120679A1 (en) | 2006-10-30 | 2007-10-30 | Targeting NBS1-ATM Interaction To Sensitize Cancer Cells To Radiotherapy And Chemotherapy |
| AU2007314366A AU2007314366A1 (en) | 2006-10-30 | 2007-10-30 | Targeting NBS1-ATM interaction to sensitize cancer cells to radiotherapy and chemotherapy |
| JP2009534698A JP2010508022A (ja) | 2006-10-30 | 2007-10-30 | 放射線療法および化学療法に対して癌細胞を感受性にするためのnbs1−atmのターゲティング |
| MX2009004748A MX2009004748A (es) | 2006-10-30 | 2007-10-30 | Interaccion orientada nbs1-atm para sensibilizar celulas cancerosas a radioterapia y quimioterapia. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US86345706P | 2006-10-30 | 2006-10-30 | |
| US60/863,457 | 2006-10-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008054726A2 true WO2008054726A2 (en) | 2008-05-08 |
| WO2008054726A3 WO2008054726A3 (en) | 2009-02-05 |
Family
ID=39344878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/022886 Ceased WO2008054726A2 (en) | 2006-10-30 | 2007-10-30 | Targeting nbs1-atm interaction to sensitize cancer cells to radiotherapy and chemotherapy |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20100120679A1 (enExample) |
| EP (1) | EP2091964A2 (enExample) |
| JP (1) | JP2010508022A (enExample) |
| KR (1) | KR20090102744A (enExample) |
| CN (1) | CN101631799A (enExample) |
| AU (1) | AU2007314366A1 (enExample) |
| CA (1) | CA2674238A1 (enExample) |
| MX (1) | MX2009004748A (enExample) |
| WO (1) | WO2008054726A2 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013179014A1 (en) * | 2012-05-29 | 2013-12-05 | The University Of Birmingham | Nanoparticles with attached dna repair inhibitors and nuclear localisation signal elements |
| US10385399B2 (en) | 2011-04-29 | 2019-08-20 | Aarhus Universitet | Method for determining clinically relevant hypoxia in cancer |
Families Citing this family (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8118754B1 (en) | 2007-11-15 | 2012-02-21 | Flynn Edward R | Magnetic needle biopsy |
| US9964469B2 (en) | 2005-02-28 | 2018-05-08 | Imagion Biosystems, Inc. | Magnetic needle separation and optical monitoring |
| US8841414B1 (en) * | 2006-01-27 | 2014-09-23 | University Of Mississippi Medical Center | Targeted delivery of therapeutic peptides by thermally responsive biopolymers |
| US8447379B2 (en) | 2006-11-16 | 2013-05-21 | Senior Scientific, LLC | Detection, measurement, and imaging of cells such as cancer and other biologic substances using targeted nanoparticles and magnetic properties thereof |
| US10194825B2 (en) | 2009-11-06 | 2019-02-05 | Imagion Biosystems Inc. | Methods and apparatuses for the localization and treatment of disease such as cancer |
| EP2496175A4 (en) | 2009-11-06 | 2014-08-06 | Scient Nanomedicine Inc | DETECTION, MEASUREMENT, AND IMAGING OF (eg, CANCER) CELLS AND OTHER BIOLOGICAL SUBSTANCES USING TARGETED NANOPARTICLES AND THEIR MAGNETIC PROPERTIES |
| WO2013098339A1 (en) * | 2011-12-27 | 2013-07-04 | Universite Pierre Et Marie Curie (Paris 6) | Anti-tumor adjuvant therapy |
| CN104046644A (zh) * | 2013-03-14 | 2014-09-17 | 中国科学院上海生命科学研究院 | 人源化小鼠模型的构建方法和应用 |
| KR101447901B1 (ko) * | 2013-04-16 | 2014-10-16 | 한양대학교 산학협력단 | 지방세포 표적 비바이러스성 유전자 전달체 |
| WO2015128179A1 (en) * | 2014-02-27 | 2015-09-03 | Koninklijke Philips N.V. | Medical instrument for high dose rate brachytherapy |
| US10213284B2 (en) | 2015-06-30 | 2019-02-26 | Tela Bio, Inc. | Corner-lock stitch patterns |
| EP3324882B1 (en) | 2015-07-21 | 2023-10-25 | Tela Bio, Inc. | Compliance control stitching in substrate materials |
| EP3448308B1 (en) | 2016-04-26 | 2024-08-14 | Tela Bio, Inc. | Hernia repair grafts having anti-adhesion barriers |
| KR101875111B1 (ko) * | 2016-04-29 | 2018-07-09 | 한국수력원자력 주식회사 | 저선량 방사선을 이용한 암화유전자 Ras-유도 악성 암화 억제 |
| MX2019009753A (es) * | 2017-02-16 | 2019-12-18 | Firststring Res Inc | Composicion y metodos para prevenir lesion por radiacion y promover la regeneracion de tejidos. |
| CA3060510A1 (en) | 2017-04-21 | 2018-10-25 | Lunella Biotech, Inc. | Vitamin c and doxycycline: a synthetic lethal combination therapy for eradicating cancer stem cells (cscs) |
| WO2018195446A1 (en) | 2017-04-21 | 2018-10-25 | Lisanti Michael P | Targeting hypoxic cancer stem cells (cscs) with doxycycline: implications for improving anti-angiogenic therapy |
| WO2018213764A1 (en) | 2017-05-19 | 2018-11-22 | Lunella Biotech, Inc. | Companion diagnostics for mitochondrial inhibitors |
| PH12019502594A1 (en) | 2017-05-19 | 2020-10-26 | Lunella Biotech Inc | Antimitoscins: targeted inhibitors of mitochondrial biogenesis for eradicating cancer stem cells |
| RU2020102908A (ru) | 2017-06-26 | 2021-07-27 | Лунелла Байотек, Инк. | Митокетосцины: митохондриальная терапия, нацеленная на кетоновый метаболизм в раковых клетках |
| US11590262B2 (en) | 2018-03-09 | 2023-02-28 | Tela Bio, Inc. | Surgical repair graft |
| WO2020185688A1 (en) | 2019-03-08 | 2020-09-17 | Tela Bio, Inc. | Textured medical textiles |
| WO2023069094A1 (en) * | 2021-10-20 | 2023-04-27 | Castor Trevor P | Method and apparatus for inactivating pathogens in units of whole blood using superparamagnetic nanoparticles coated with chemiluminescence reagents and broad-spectrum anti-viral therapeutics |
| CN115300449B (zh) * | 2022-02-07 | 2023-06-27 | 郑州大学第一附属医院 | 榄香烯在制备抑制肿瘤耐药性的控释制剂中的应用 |
| CN118126155B (zh) * | 2024-02-05 | 2025-04-25 | 中山大学附属第七医院(深圳) | 一种人nbs1蛋白赖氨酸388位点乳酸化抗原、抗体及其制备方法与应用 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6077880A (en) * | 1997-08-08 | 2000-06-20 | Cordis Corporation | Highly radiopaque polyolefins and method for making the same |
| US7074902B1 (en) * | 1998-04-27 | 2006-07-11 | Warf Wisconsin Alumni Research Foundation | Antibody specific for a DNA repair protein |
| US7122343B1 (en) * | 1998-04-27 | 2006-10-17 | Wisconsin Alumni Research Foundation | Methods to alter levels of a DNA repair protein |
| US6530944B2 (en) * | 2000-02-08 | 2003-03-11 | Rice University | Optically-active nanoparticles for use in therapeutic and diagnostic methods |
| US20030104427A1 (en) * | 2001-06-25 | 2003-06-05 | Petrini John H.J. | Methods to modulate telomere structure and function |
-
2007
- 2007-10-30 MX MX2009004748A patent/MX2009004748A/es not_active Application Discontinuation
- 2007-10-30 CA CA002674238A patent/CA2674238A1/en not_active Abandoned
- 2007-10-30 KR KR1020097011353A patent/KR20090102744A/ko not_active Withdrawn
- 2007-10-30 WO PCT/US2007/022886 patent/WO2008054726A2/en not_active Ceased
- 2007-10-30 JP JP2009534698A patent/JP2010508022A/ja not_active Withdrawn
- 2007-10-30 AU AU2007314366A patent/AU2007314366A1/en not_active Abandoned
- 2007-10-30 US US12/447,717 patent/US20100120679A1/en not_active Abandoned
- 2007-10-30 CN CN200780048001A patent/CN101631799A/zh active Pending
- 2007-10-30 EP EP07867306A patent/EP2091964A2/en not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10385399B2 (en) | 2011-04-29 | 2019-08-20 | Aarhus Universitet | Method for determining clinically relevant hypoxia in cancer |
| WO2013179014A1 (en) * | 2012-05-29 | 2013-12-05 | The University Of Birmingham | Nanoparticles with attached dna repair inhibitors and nuclear localisation signal elements |
| CN104540523A (zh) * | 2012-05-29 | 2015-04-22 | 伯明翰大学 | 附有dna修复抑制剂和核定位信号元件的纳米颗粒 |
| US9943598B2 (en) | 2012-05-29 | 2018-04-17 | The University Of Birmingham Edgbaston | Nanoparticles with attached DNA repair inhibitors and nuclear localisation signal elements |
Also Published As
| Publication number | Publication date |
|---|---|
| MX2009004748A (es) | 2009-08-25 |
| CA2674238A1 (en) | 2008-05-08 |
| AU2007314366A1 (en) | 2008-05-08 |
| EP2091964A2 (en) | 2009-08-26 |
| JP2010508022A (ja) | 2010-03-18 |
| US20100120679A1 (en) | 2010-05-13 |
| WO2008054726A3 (en) | 2009-02-05 |
| KR20090102744A (ko) | 2009-09-30 |
| CN101631799A (zh) | 2010-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100120679A1 (en) | Targeting NBS1-ATM Interaction To Sensitize Cancer Cells To Radiotherapy And Chemotherapy | |
| EP2727601B1 (en) | Encapsulated Muc-1 cytoplasmic domain peptides as inhibitors of cancer | |
| US7919466B2 (en) | Lymphatic zip codes in tumors and pre-malignant lesions | |
| US20160166637A1 (en) | Methods of treating a cancer through targeted disruption of alpha connexin 43-zonula occludens-1 (zo-1) interaction | |
| CN103764668B (zh) | 白血病干细胞靶向配体及应用方法 | |
| CA2846629C (en) | Methods and compositions comprising a c-terminal bax peptide | |
| US20100093623A1 (en) | Compositions and methods for modulating nod-like receptor activity and uses thereof | |
| US20090233993A1 (en) | Compositions and methods for inhibiting gsk3 activity and uses thereof | |
| US20110268749A1 (en) | Treatment of cancer via targeting of il-13 receptor-alpha2 | |
| US9279009B2 (en) | FILIP1L nucleic acid fragments | |
| CN109311962A (zh) | Bcl-2 l10/ip3受体相互作用的抑制剂 | |
| Ali | Effect of SHARP1 Knockdown and PLEKHA7 Re-expression on the Growth and Behavior of Acute Myeloid Leukemia Cells induced by Functional Lipid Nanoparticles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780048001.1 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07867306 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2009534698 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/004748 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007314366 Country of ref document: AU Ref document number: 577287 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3523/DELNP/2009 Country of ref document: IN Ref document number: 2007867306 Country of ref document: EP Ref document number: 200970434 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020097011353 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 2007314366 Country of ref document: AU Date of ref document: 20071030 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2674238 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12447717 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: PI0718256 Country of ref document: BR Free format text: APRESENTE DOCUMENTOS QUE COMPROVEM A ALTERACAO DO NOME SOLICITADA NA PETICAO N.O 020090063479 DA DATA DE 29/06/2009. |
|
| ENPW | Started to enter national phase and was withdrawn or failed for other reasons |
Ref document number: PI0718256 Country of ref document: BR Free format text: PEDIDO RETIRADO POR NAO CUMPRIMENTO DE EXIGENCIA PUBLICADA NA RPI 2256 DE 01/04/2014. |