WO2008047023A2 - Methode d'immunisation contre les 4 serotypes de la dengue - Google Patents
Methode d'immunisation contre les 4 serotypes de la dengue Download PDFInfo
- Publication number
- WO2008047023A2 WO2008047023A2 PCT/FR2007/052054 FR2007052054W WO2008047023A2 WO 2008047023 A2 WO2008047023 A2 WO 2008047023A2 FR 2007052054 W FR2007052054 W FR 2007052054W WO 2008047023 A2 WO2008047023 A2 WO 2008047023A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- den
- chimerivax
- dengue
- vaccine
- serotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/70—Multivalent vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
- C12N2770/24134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the subject of the invention is a method for inducing protection against the four serotypes of dengue in a patient, comprising
- Dengue diseases are caused by four closely related, but antigenically distinct, flavivirus-like viruses of the serotype type (G ⁇ bler et al., 1988 In: Epidemiology of arthropod-terminal viral disease.) Monath TPM, editor, Boca Raton (FL) ): CRC Press: 223-60, Kautner et al., 1997, J. of Pediatrics, 131: 516-524, Rigau-Pérez et al., 1998, Lancet, 352: 971-977, Vaughn et al., 1997 J Infect Dis; 176: 322-30). Infection with a dengue serotype can produce a spectrum of clinical illness ranging from nonspecific viral syndrome to fatal severe haemorrhagic disease.
- the incubation period of dengue fever after mosquito bite is about 4 days (ranging from 3 to 14 days).
- Dengue fever is characterized by biphasic fever, headache, pain in various parts of the body, prostration, rash, lymphadenopathy and leukopenia (Kautner et al., 1997, J. of Pediatrics, 131: 516 Rigau-Pérez et al., 1998, Lancet, 352: 971-977).
- the viremic period is the same as the febrile period (Vaughn et al., 1997, J. Infect Dis 176: 322-30).
- the cure of dengue fever is acquired after 7 to 10 days, but prolonged asthenia is usual. Decreases in leukocyte and platelet count are common.
- Dengue haemorrhagic fever is a severe febrile illness characterized by abnormalities of homeostasis and an increase in vascular permeability that can lead to hypovolemia and hypotension (dengue with shock syndrome) often complicated by severe internal bleeding.
- the mortality rate of dengue haemorrhagic fever can reach up to 10% without therapy, but is 1% in most centers with therapeutic experience (WHO technical guide, 1986. Dengue haemorrhagic fever: diagnosis, treatment and control, p1 -2 World Health Organization, Geneva, Switzerland).
- Routine laboratory diagnosis of dengue fever is based on virus isolation and / or detection of dengue virus specific antibodies.
- Dengue fever is the second most important tropical infectious disease after malaria, with more than half of the world's population living in areas at risk of epidemic transmission. Each year, dengue cases are estimated at 50-100 million, cases of patients hospitalized for dengue haemorrhagic at 500 000, and the number of deaths at 25 000. Dengue is endemic in Asia, the Pacific, Africa , in Latin America and the Caribbean. More than 100 tropical countries are endemic for dengue virus and dengue haemorrhagic infections have been documented in 60 of these countries (Gubler, 2002, TRENDS in Microbiology, 10: 100-103, Monath, 1994, Proc Natl Acad Sci 91: 2395-2400).
- Dengue fever has been a leading cause of febrile illness in US troops during deployments in tropical areas endemic for dengue fever (DeFraites et al., 1994, MMWR 1994; 43: 845-848).
- the viruses are maintained in a cycle that involves humans and Aedes aegypti, a domestic mosquito bites the day, which prefers to feed on humans.
- Infection in humans is initiated by injecting the virus during the blood meal of an infected Aedes aegypti mosquito.
- the salivary virus is deposited mainly in extravascular tissues.
- the first class of infected cells after inoculation are the dendritic cells, which then migrate to the lymph nodes (Wu et al., 2000, Nature Med., 7: 816-820). After initial replication in the skin and in the lymph nodes, the virus appears in the blood during the acute febrile phase, usually for 3-5 days.
- Monocytes and macrophages are, along with dendritic cells, among the first targets of the dengue virus. Protection against homotypic reinfection is complete and probably lasts a lifetime, but cross-protection between different types of dengue lasts less than a few weeks to a few months (Sabin, 1952, Am. J. Trop., Med Hyg .; : 30-50). As a result, a subject may be infected with a different serotype. A second dengue infection is theoretically a risk factor for developing severe dengue fever. However, dengue haemorrhagic fever is multifactorial: these factors include the strain of the virus involved, as well as the age, immune status, and genetic predisposition of the patient.
- dengue haemorrhagic fever Two factors play a major role in the occurrence of dengue haemorrhagic fever: rapid viral replication with high viremia (the severity of the disease being associated with the level of viremia, Vaughn et al., 2000, J. Dis. 181: 2-9) and a significant inflammatory response with the release of elevated levels of inflammatory mediators (Rothman and Ennis, 1999, Virology, 257: 1-6).
- the treatment of dengue fever is symptomatic with bed rest, fever and pain control with antipyretics and analgesics, and adequate drinking.
- Treatment of dengue haemorrhagic fever requires the balancing of fluid loss, replacement of clotting factors and heparin infusion.
- the inventors have demonstrated that it is possible to generate a homologous immune response comprising antibodies neutralizing the four serotypes when they are administered simultaneously two by two at distinct anatomical sites in a first series. administrations then a second series of administrations implemented 30 days to 12 months after the first administration of the 4 serotypes.
- the inventors have in particular shown that a bivalent immunization DEN-1, 2 concomitant with a bivalent immunization DEN-3,4 carried out at two distinct anatomical sites and followed by a booster of the same vaccine doses under the same conditions induces responses against all four serotypes in all immunized monkeys, with the exception of one serotype in one animal. Conversely, tetravalent immunization conducted in a single site only led to a satisfactory response against two out of four serotypes.
- the immune response generated by the method according to the present invention is therefore more important quantitatively and qualitatively (covers all serotypes).
- the present invention thus relates to a method for inducing homologous protection against the four serotypes of dengue in a patient, comprising
- the dengue vaccine viruses (i) are administered in the form of a single bivalent vaccine dose.
- the vaccine viruses of dengue (ii) are administered in the form of a single bivalent vaccine dose.
- said serotype 1 dengue vaccine virus is selected from the group consisting of the VDV1 strain and a ChimeriVax TM DEN-1.
- said serotype 2 dengue vaccine virus is selected from the group consisting of the VDV2 strain and a ChimeriVax TM DEN-2.
- said vaccinal dengue serotype 1 virus is the VDV1 strain and said serotype 2 dengue vaccine virus is the VDV2 strain.
- said serotype 1 dengue vaccine virus is a ChimeriVax TM DEN-1 and said serotype 2 dengue vaccine virus is a ChimeriVax TM DEN-2.
- said vaccine virus dengue serotype 3 is a ChimeriVax TM DEN-3.
- said serotype 4 dengue vaccine virus is a ChimeriVax TM DEN-4.
- the first and second serotypes are respectively CYD DEN-1 and CYD DEN-2 and the third and fourth serotypes are respectively CYD DEN-3 and CYD DEN-4.
- the first and second serotypes are respectively CYD DEN-1 and CYD DEN-3 and the third and fourth serotypes are respectively CYD DEN-2 and CYD DEN-4.
- the amount of dengue vaccine viruses of serotypes 1, 2, 3 and 4 is in a range of from 10 3 to 10 6 DICC 5 O-
- the vaccine viruses used in the second series of administrations are identical to those used in the first series of administration.
- the second series of administrations is implemented 30 to 60 days after the first series of administrations.
- the subject of the present invention is also a dengue virus immunization kit comprising a casing containing at least the dengue vaccine viruses of serotypes 1, 2, 3 and 4.
- the kit according to the invention comprises at least:
- the kiit according to the kit according to the invention comprises at least:
- the present invention also relates to a dengue virus immunization kit comprising a housing containing at least the dengue vaccine viruses of a first and a second serotype,
- the kit comprises at least: (a) a container containing a divalent vaccine comprising a ChimeriVax TM DEN-1 and a ChimeriVax TM DEN-3, or (b) a container containing a divalent vaccine comprising a ChimeriVax TM DEN-2 and a ChimeriVax TM DEN-4, or
- a container containing a divalent vaccine comprising a ChimeriVax TM DEN-1 and a ChimeriVax TM DEN-2, or
- the present invention also provides a divalent composition or vaccine comprising an immunoperative amount of the first and second serovar dengue vaccine viruses and a pharmaceutically acceptable excipient.
- the divalent composition or vaccine comprises vaccine viruses selected from the group consisting of: ChimeriVax TM DEN-1 and ChimeriVax TM DEN-3; or ChimeriVax TM DEN-2 and ChimeriVax TM DEN-4; or ChimeriVax TM DEN-1 and ChimeriVax TM DEN-2; or ChimeriVax TM DEN-3 and ChimeriVax TM DEN-4.
- two anatomical sites are "distinct", if they are drained by different lymph nodes.
- the right arm and the left arm are considered separate sites.
- Other non-limiting examples include the following distinct sites: right arm / right thigh; the left arm / the left thigh, the left arm / the right thigh.
- spontaneous administrations means administrations implemented on the same day (i.e. at most 24H). Simultaneous administrations are advantageously carried out at most 1 hour apart from each other, typically 1 -5 minutes apart.
- the doses (i) are administered at a first anatomical site, either in the form of two monovalent doses or as a single bivalent dose.
- the doses (ii) they are administered simultaneously at a second anatomical site, either in the form of two monovalent doses or in the form of a single bivalent dose, the first and second sites being distinct sites as defined above .
- the "dengue virus” or "DEN” are single-stranded, positive-strand RNA viruses belonging to the genus Flavivirus of the flaviviridae family.
- the genomic RNA contains a type I cap at the 5 'end but lacks a poly-A tail at the 3' end.
- the genomic organization consists of the following: 5 'non-coding region (NCR), structural proteins (capsid (C), pre-membrane / membrane (prM / M), envelope (E)) and non-structural proteins (NS1 - NS2A-NS2B-NS3-NS4A-NS4B-NS5) and NCR 3 '.
- the genomic viral RNA is associated with the capsid proteins to form a nucleocapsid.
- the DEN viral genome encodes an uninterrupted coding region that is translated into a single polyprotein.
- the term "dengue vaccine virus” is intended to mean any viral form of the dengue virus capable of inducing a specific homologous immune response, preferably any viral form of the dengue virus that can be used in the context of the present invention. of a human immunization program against dengue virus infection.
- the term “dengue vaccine virus” is thus understood to mean inactivated viruses, attenuated viruses, or recombinant proteins such as the dengue virus envelope protein.
- a vaccine virus is considered “inactivated” if it does not replicate on permissive cells.
- a vaccine virus is considered to be "attenuated” if, after growth at 37 ° C or 39 ° C on a Huh-7, VERO and / or C6 / 36 hepatic cell, said vaccine virus has a maximum titre that is at least 10 maximum titre obtained with the wild parental strain under the same culture conditions and as measured using the same titration method.
- a vaccine virus that shows diminished growth on at least one of the three cell types identified above is therefore considered “attenuated” in the context of the present invention.
- a vaccine virus that can be used in humans has a positive benefit / risk ratio, which generally meets the regulatory requirements for obtaining a marketing authorization.
- a dengue vaccine virus used in the context of the present invention is preferably a virus attenuated so that it does not induce the disease in humans.
- said vaccine virus only leads to side effects of more moderate intensity (ie average to low or zero) in the majority of vaccinated subjects while maintaining its ability to induce a neutralizing antibody response.
- Non-limiting examples of dengue vaccine viruses that can be used in the context of the present invention are inactivated vaccine viruses, attenuated vaccine viruses such as the attenuated VDV-1, VDV-2 and described for example in the applications: WO02 / 66621, WO0057904, WO0057908, WO0057909; WO0057910, WO02 / 0950075 and WO02 / 102828, or the chimeras.
- the chimeric viruses have the particularity of presenting the characteristics of the attenuated viruses as defined above. Any chimeric virus expressing the envelope protein of a dengue virus and inducing an immune response comprising antibodies neutralizing the serotype from which the envelope protein is derived can therefore be used within the scope of the present invention.
- Nonlimiting examples include: ChimeriVax TM dengue as described for example in patent application WO 98/3791 1, dengue / dengue chimeras as described for example in patent applications WO9640933 and WO0160847.
- the vaccinal dengue serotype 1 virus may be, for example, the vaccine strain VDV1 or a ChimeriVax TM DEN-1, in particular a YF17D / DEN-1 virus, or a DEN-1 16007 / PDK13 strain.
- the vaccinal dengue serotype 2 virus may be, for example, the vaccine strain VDV2 or a ChimeriVax TM DEN-2, in particular a YF17D / DEN-2 virus, or a DEN-2 16681 / PDK53 strain.
- the vaccine virus of serotype 3 dengue fever may be a ChimeriVax TM DEN-3, particularly a YF17D / DEN-3 virus.
- the vaccinal dengue serotype 4 virus may be a ChimeriVax TM DEN-4, in particular a YF17D / DEN-4 virus.
- This strain has been described in patent application EP1 159968 in the name of Mahidol University and has been deposited with the National Collection of Cultures of Microorganisms (CNCM) under the number 1-2483.
- VDV or "Vero Dengue Vaccine” means a live attenuated viral dengue strain adapted to Vero cells and capable of inducing a specific humoral response, including the induction of neutralizing antibodies, in primates and in particular in humans .
- VDV-1 is a strain obtained from a DEN-1 16007 wild-type strain which has undergone 11 passages on PDK cells (DEN-1 16007 / PDK1 1) which was then amplified on Vero cells at 32 ° C., and whose RNA has been purified and transfected into Vero cells.
- the strain VDV-1 has 14 additional mutations compared to the vaccine strain DEN-1 16007 / PDK13 (13 passages on PDK-Primary Dog Kidney cells).
- the strain DEN-1 16007 / PDK13 also called “LAV1”
- LAV1 has been described in the patent application EP1 159968 in the name of Mahidol University and has been deposited with the National Collection of Cultures of Microorganisms (CNCM) under the number I -2480.
- the complete sequence of the VDV-1 strain is given to the sequence SEQ ID NO: 1. Said strain can be easily reproduced from said sequence.
- a method of preparation and the characterization of the strain VDV-1 have been described in the international patent application filed in the names of Sanofi-Pasteur and the Center for Disease Control and Prevention under the number PCT / IB 2006/001313.
- VDV-2 is a strain obtained from a wild-type strain DEN-2 16681 which has undergone 50 passages on PDK cells (DEN-2 16681 / PDK50), purified by plate and whose RNA has been extracted and purified before to be transfected into Vero cells. The VDV-2 strain was then obtained by plaque purification and amplification on Vero cells. The strain VDV-2 has 10 additional mutations compared to the DEN-2 16681 / PDK53 vaccine strain (53 passages on PDK cells), including 4 silent mutations.
- the strain DEN-2 16681 / PDK53 also called “LAV2”
- LAV2 has been described in patent application EP1 159968 in the name of Mahidol University and has been filed with the National Collection of Cultures of Microorganisms (CNCM) under the number 1 -2481.
- the complete sequence of the VDV-2 strain is shown in the sequence SEQ ID NO: 2.
- the VDV-2 strain can be easily reproduced from said sequence.
- a method of preparation and characterization of the VDV-2 strain has been described in the international patent application filed in the names of Sanofi-Pasteur and the Center for Disease Control and Prevention under the number PCT / IB 2006/001513.
- Strains VDV 1 and 2 are prepared by amplification on Vero cells. Viruses produced are harvested and clarified from cellular debris by filtration. The DNA is digested by enzymatic treatment. The impurities are removed by ultrafiltration. Infectious titres may be increased by a concentration method. After addition of a stabilizer, the strains are stored in freeze-dried or frozen form before use and then reconstituted extemporaneously.
- CYD ChimeriVax TM dengue
- CYD refers to a chimeric yellow fever (YF) virus which comprises the backbone of a YF virus in which the coding sequences for the pre-membrane and envelope proteins have been replaced by those of a DEN virus.
- CYD-1 or CYD DEN1 is a chimeric YF virus containing the prM and E sequences of a dengue serotype 1 (DEN-I) strain.
- CYD-2 or CYD DEN2 refers to a chimeric YF virus containing the prM and E sequences of a DEN-2 strain.
- CYD-3 or CYD DEN3 is a chimeric YF virus containing the prM and E sequences of a DEN-3 strain.
- CYD-4 or CYD DEN4 refers to a chimeric YF virus containing the prM and E sequences of a DEN-4 strain.
- the preparation of these dengue ChimeriVax TM has been described in detail in international patent applications WO 98/3791 1 and WO 03/101397 to which reference can be made for a precise description of their preparation process.
- chimeras described in the examples were generated using the prM and E sequences derived from the DEN 1 PUO359 (TYP1 140), DEN2 PUO218, DEN3 PaH881 / 88 and DEN41288 (TVP980) strains. Any strain of the dengue virus could be used in the context of the present invention for the construction of chimeras.
- the chimeric YF virus comprises the backbone of an attenuated yellow fever strain YF17D (Theiler M, and Smith HH (1937) J Exp. Med 65, p767-786.) (YF17D / DEN-1 virus, YF17D / DEN-2, YF17D / DEN-3, YF17D / DEN-4).
- YF17D / DEN-1 virus YF17D / DEN-2, YF17D / DEN-3, YF17D / DEN-4.
- YF17D strains examples include YF17D204 (YF-Vax®, Sanofi-Pasteur, Swifwater, PA, USA; Stamaril®, Sanofi-Pasteur, Marcy l'Etoile, France; ARILVAX TM, Chiron, Speke, Liverpool, UK; FLAVIMUN®, Berna Biotech, Bern) YF17D-204,234 US (Rice et al., 1985, Science, 229: 726-733), or related strains YF17DD (Genbank Accession No.
- the present invention therefore also relates to a composition or bivalent vaccine comprising an immunoeffective amount of a dengue vaccine virus of a first serotype and a dengue vaccine virus of a second serotype and a pharmaceutically acceptable excipient.
- a composition or bivalent vaccine comprising an immunoeffective amount of a dengue vaccine virus of a first serotype and a dengue vaccine virus of a second serotype and a pharmaceutically acceptable excipient.
- the divalent composition or vaccine according to the invention comprises CYD DEN-1 and CYD DEN-2, or CYD DEN-3 and CYD DEN-4, or CYD DEN-1 and CYD DEN-3 or CYD DEN-2 and CYD DEN-4, advantageously the vaccine viruses are present in the vaccine at a level of 10 5 DICC 5 O
- Each ChimeriVax TM monovalent dengue vaccine virus (serotypes 1, 2, 3 and 4) was prepared by amplification of each serotype on Vero cells. More specifically, the four viruses are produced separately on adherent Vero cells in serum-free medium. The viral harvest, clarified from cell debris by filtration, is then concentrated and purified by ultrafiltration and chromatography to remove DNA from the host cells. After addition of a stabilizer, the vaccine strains are stored frozen or lyophilized before use and then reconstituted extemporaneously. The same process is applied for the four chimeras.
- a dose, composition or vaccine is "monovalent” when it contains in addition to a pharmaceutically acceptable excipient a single serotype of dengue virus.
- a dose, composition or vaccine is "bivalent” when it contains two different serotypes of dengue virus.
- a dose, composition or vaccine is “trivalent” when it contains three different serotypes of dengue virus.
- a dose, composition or vaccine is "tetravalent” when it contains four different serotypes of dengue virus.
- the multivalent compositions are obtained by simple mixing of the monovalent compositions.
- Patient refers to a person (child or adult) who may be infected with dengue fever, particularly a person at risk of infection, such as a person traveling to areas where dengue fever is present or an inhabitant of dengue fever. these regions. This term includes na ⁇ ve people as well as non-naive people for the dengue virus.
- the four serotypes of dengue fever can be administered in any order provided that they are administered two by two (ie doses (i) and (ii) respectively in the form of two monovalent doses or one dose unique bivalent) simultaneously in separate sites.
- the method according to the present invention comprises the administration of the following dengue vaccine viruses: (i) serotypes 1 and 2; (ii) serotypes 3 and 4 or (i) serotypes 1 and 3; (ii) serotypes 2 and 4.
- the doses (i) and (ii) are advantageously in the form of bivalent doses.
- the present invention therefore covers the following diagrams:
- the immunization method according to the invention comprises the administration of the following dengue vaccine viruses (i) CYD DEN-1 and CYD DEN-2; (ii) CYD DEN-3 and CYD DEN-4; or (i) CYD DEN-1 and CYD DEN-3; (ii) CYD DEN-2 and CYD DEN-4.
- the doses (i) and (ii) are advantageously in the form of bivalent doses.
- the immunization method according to the present invention comprises a second series of administrations carried out from 30 days to 12 months, advantageously from 30 days to 3 months, preferably 30 days, 45 days or 60 days after the first series of administrations (i and ii) which advantageously comprises the administration of the same compositions as those used in the first series which are advantageously administered under the same conditions.
- dose of vaccine virus in the context of the present invention a composition comprising an "immunoefficient amount" of the dengue vaccine virus, that is to say a sufficient amount of dengue virus to induce a response neutralizing antibody, which can be demonstrated for example by the serum neutralization test as described below in Example 1.
- a serum is considered positive for the presence of neutralizing antibodies when the neutralizing antibody titer as well as determined is greater than or equal to 1: 10 (unit: 1 / dilution).
- Vaccine strain amounts are commonly expressed in terms of plaque forming unit (PFU) or infective dose 50% of tissue culture or 50% infective dose of cell culture (DICC 50 ).
- PFU plaque forming unit
- DICC 50 infective dose 50% of tissue culture or 50% infective dose of cell culture
- the compositions according to the invention may contain from 10 to 10 6 DICC 50 , in particular from 10 3 to 10 5 DICC 50 dengue vaccine virus of serotype 1, 2, 3 or 4 for a monovalent or bivalent composition.
- the vaccine virus doses of dengue serotype 1, 2, 3 and 4 are preferably each in a range from 10 to 10 6 DICC 50 , such as 10, 10 1 , 2 2 , 3 , 10 4 , 10 5 or 10 6 DICC 50, in particular in a range from 10 3 to 10 5 DICC 50 .
- the vaccine viruses can be used in identical doses or different, which can be adjusted according to the nature of the vaccine virus used and the intensity of the immune response obtained.
- the monovalent or bivalent doses of vaccine viruses respectively comprise 10 5 DICC 50 of CYD DEN-1, of CYD DEN-2, of CYD DEN-3 and of CYD DEN-4.
- the neutralizing antibody response is advantageously durable, i.e., it can be detected in serum at least 6 months after the second series of administrations (i) and (ii).
- the dose of a Dengue vaccine virus of a first serotype and the dose of a Dengue vaccine virus of a second serotype are administered simultaneously as two monovalent compositions. or advantageously in the form of a single bivalent composition or dose.
- the dose of a dengue vaccine virus of a third serotype and the dose of a dengue vaccine virus of a fourth serotype are administered simultaneously under form of two monovalent vaccine compositions, or advantageously in the form of a single bivalent vaccine composition.
- the vaccine viruses are administered in the form of vaccine compositions or doses of vaccine viruses which may be prepared according to any method known to those skilled in the art.
- viruses generally in freeze-dried form, are mixed with a pharmaceutically acceptable excipient, such as water or phosphate buffered saline, wetting or stabilizing agents.
- pharmaceutically acceptable excipient is meant any solvent, dispersion medium, charge etc, which does not produce a side reaction, for example allergic, in humans or animals.
- the excipient is selected according to the chosen dosage form, method and route of administration. Suitable excipients, as well as pharmaceutical formulation requirements, are described in "Remington: The Science & Practice of Pharmacy", which is a reference work in the field.
- the vaccine compositions are prepared in injectable form, and may correspond to liquid solutions, suspensions or emulsions.
- the compositions may in particular comprise an aqueous solution buffered to maintain a pH of between about 6 and 9 (as determined with a pH meter at room temperature).
- compositions may nevertheless comprise such a compound, that is to say a substance that increases, stimulates or strengthens the cellular or humoral immune response induced by the vaccine strain. administered simultaneously.
- an adjuvant that may be appropriate in the context of the present invention.
- the vaccine compositions according to the invention may be administered according to any route usually used for vaccination, for example the parenteral route (especially intradermal, subcutaneous, or intramuscular), advantageously subcutaneously.
- the vaccine compositions are injectable compositions administered subcutaneously in the region of the left deltoid and right deltoid.
- the volume of composition administered depends on the route of administration. For subcutaneous injections, the volume is generally between 0.1 and 1.0 ml, preferably about 0.5 ml.
- the optimal time for administration of all serotypes 1 to 4 is approximately 1 to 3 months before exposure to the dengue virus.
- the vaccines can be administered as a prophylactic treatment for dengue virus infection in adults and children.
- Target populations therefore include people who may be naive (ie, not previously immunized) or non-naive with respect to the dengue virus.
- Recall administrations of dengue vaccine viruses of serotypes 1 to 4 may also be implemented for example between 6 months and 10 years, for example 6 months, 1 year, 3 years, 5 years or 10 years after administration of the second series of administrations according to the invention.
- the recall administrations will be implemented advantageously in using the same vaccine compositions (ie the same vaccine viruses) and preferably under the same conditions of administration (anatomical sites and routes of administration) as those used for the 1 ⁇ r ⁇ and 2 ⁇ m ⁇ series of administrations.
- the interference phenomena can be explained by the dominance of one or more serotypes compared to others and are therefore independent of the technology used to manufacture the candidate vaccine (ex VDV or ChimeriVax).
- the method according to the present invention can therefore generally be applied to any dengue vaccine virus.
- the present invention therefore also relates to the use of vaccinal doses of dengue virus for the preparation of a vaccine to induce protection against the four serotypes of dengue comprising:
- the present invention also relates to an immunization kit against the four serotypes of the dengue virus.
- the kit according to the present invention comprises the doses as defined above in relation to the proposed immunization method.
- the kit according to the invention therefore comprises a box containing the different containers containing the vaccine doses and advantageously an explanatory brochure containing the information useful for the administration of vaccines.
- the kit according to the invention comprises a housing containing at least the dengue vaccine viruses of serotypes 1, 2, 3 and 4
- the kit according to the invention comprises a housing containing at least the dengue vaccine viruses of a first and a second serotype,
- the kit according to the present invention therefore comprises at least:
- the kit according to the invention comprises at least:
- the kit according to the invention comprises at least: (a) a container containing a divalent vaccine comprising a ChimeriVax TM DEN-1 and a ChimeriVax TM DEN-3, or
- a container containing a divalent vaccine comprising a ChimeriVax TM DEN-1 and a ChimeriVax TM DEN-2, or
- kits according to the invention may contain a single or multiple copies of the containers as described above. If the vaccines used are in freeze-dried form, the kit will advantageously comprise at least one additional container containing the diluent for reconstituting an injectable vaccine dose. Any pharmaceutically acceptable diluent can be used for this purpose, conventionally, water or a phosphate buffered aqueous solution.
- Viremia and immunogenicity were tested in a monkey model.
- Viremia in particular, has been identified as one of the factors associated with virulence and severity of illness in men and is therefore an important parameter to consider. Immunogenicity is a key parameter in the assessment of protection conferred.
- Post-vaccination viremia was followed by real-time quantitative RT-PCT (qRT-PCR).
- Two sets of primers and probes located in the NS5 gene of DEN1 and DEN2 strains were used to quantify VDV-1 and VDV-2 RNA respectively.
- a third set of 2 primers and 1 probe located in the NS5 gene of YF virus was used to quantify CYD RNA.
- RNAs Seven plasmids containing, under the control of the T7 promoter, the region targeted by each PCR, were transcribed in vitro to generate a series of synthetic RNAs that were included as internal reference in each RT-PCT assay. These synthetic RNAs were determined by spectrophotometry, the amount of RNA obtained was converted into RNA copy number and expressed in GEQ (genomic equivalents).
- RNA 0.140 ml of monkey serum was extracted using Macherey Nagel's "Nucleospin 96 virus TM" RNA extraction kit, according to the manufacturer's instructions, and the purified RNA was eluted with 0.140 ml (0.090 ml). ml, then 0.05 ml) of RNase free water. To avoid repeated freeze / thaw cycles, a first quantification was performed immediately after the extraction of 5 ⁇ l of said RNA preparation. The remaining volume was frozen at 70 ° C.
- the reaction mixtures contained, in addition to the components of the Qiagen Qauntitect TM probes RT-PCR kit (Qiagen), 10 picomoles of each primer, 4 picomoles of each probe and 5 ⁇ l of RNA, in a total volume of 25. .mu.l.
- Qiagen Qauntitect TM probes RT-PCR kit
- 10 picomoles of each primer 4 picomoles of each probe and 5 ⁇ l of RNA, in a total volume of 25. .mu.l.
- 5 .mu.l of the purified preparation was directly introduced into the reaction mixture, without a prior dilution step.
- the synthetic RNAs were diluted 1/10 in RNAse-free water, and 7 dilutions containing approximately 10 to 10 6 GEQ in 5 ⁇ l were quantified in parallel to generate the standard curve.
- Quantification reactions were performed by the Applied Biosystem ABIPrism 700 TM instrument, using the following program: 50 ° C / 30 min, 95 ° C / 15 min, followed by 40 cycles of 95 ° C / 15 sec. 60 ° C / 60 sec.
- the limit of quantification of the viral RNA in this test is 2.9 to 3.3 log 10 GEQ / ml (800 to 2000 GEQ / ml, 4 to 10 GEQ / reaction), according to the PCR targets (standard deviation: +/- 0.3 log-m)
- the correlation between the infectious titer and the quantification of viral RNA was established in parallel with the assays by analysis of 0.140 ml of negative monkey (OD) sera samples into which a known amount of infectious particles of the viruses served for immunization (CYD or VDV). Said control sera were prepared at two dilutions containing about 1 PFU and about 100 PFU in 5 ⁇ l (2.3 and 4.3 log 10 PFU / ml, respectively).
- Ratio GEQ / PFU of 2.5 logio (ie: 1 PFU 320 GEQ) for the will be positive in VDV1 or VDV2.
- YF-NS5 sense 5 1 OCACGGATGTAACAGACTGAAGA (23 bases)
- V DV1 -NS5 5 1 Farn-TTC ACA CCA CTT CCA CM GEMMFQ (1 6 b)
- a 96-well plate 0.120 ml of each decomplemented serum is added to 0.480 ml of diluent (ISCOVE 4% FCS) per well. Serial dilutions of a factor of 6 are carried out by transfer of 0.150 ml of serum into 0.450 ml of diluent. 450 ⁇ l of viral dilution at 2.7 log-m DICC50 / ml are added to each well to obtain 25 CCID50 / well. The plate is incubated at 37 ° C for 1 hour.
- 0.1 ml of each dilution is then distributed in 6 wells of a 96-well plate in which VERO cells were inoculated 3 days before the start of the experiment at a density of 8000 cells / well, in 0.1 ml of ISCOVE medium. 4% FCS ,. After 6 days of incubation at 37 ° C., in the presence of 5% of CO 2 , the cells are fixed with ethanol / acetone (70/30) at 4 ° C. for 15 minutes, then washed 3 times in PBS and incubated for 1 h at 37 ° C in the presence of 0.05 ml of a 1/2000 dilution of an anti-flavivirus monoclonal antibody (mAb 4G2).
- mAb 4G2 an anti-flavivirus monoclonal antibody
- d represents the dilution leading to 100% neutralization (ie 6 negative replicates that is to say having no sign of infection)
- X total number of wells showing no signs of infection, except dilution d.
- the viral detection limit is 10 SN50 (i.e 1.0 Iog- 0 SN50).
- Viral strains which have been used for the neutralization are the strains DEN1 16007, DEN2 16681, DEN3 16562 or DEN4 1036.
- the correlation between the neutralizing titre measured in the SN50 test and the neutralizing titre conventionally measured in the PRNT50 test is: Iog-
- 0 PRNT50 log 10 SN50 + 0.2.
- the average title is established by calculating the geometric mean of the titles expressed in linear value, the samples whose title is lower than the detection threshold are assigned, by convention, a value equal to half of this threshold.
- Immunization was performed subcutaneously in the 23G1 needle arm at a dose of 5 DICC 5 O for each serotype for CYD DEN 1 to 4 vaccines.
- the administration scheme according to the present invention makes it possible to increase qualitatively and quantitatively the homologous neutralizing antibody response which is obtained with the tetravalent vaccination.
- the responses against serotypes 1 and 4 tend to be higher for simultaneous bivalent immunizations than for tetravalent immunization at a single site.
- Viremia and immunogenicity were tested in the monkey model as in Example 1.
- the bivalent compositions tested contain respectively the most immunogenic vaccine viruses (CYD-1, 4) and the vaccine viruses the less immunogens (CYD-2,3).
- the results of viremia are similar to those obtained in Example 1, showing a serotype 4 induced viremia and no significant differences between the two groups.
- the administration scheme makes it possible to increase qualitatively and quantitatively the homologous neutralizing antibody response that is obtained with the tetravalent vaccination.
- the antibody levels observed after CYD-1, 4 bivalent immunization concomitant with CYD-2,3 immunization are higher for serotypes 1, 2 and 3, and lower for serotype 4, which shows a better balanced response between the 4 serotypes, with less dominance of 4.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Virology (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2009530916A JP5269796B2 (ja) | 2006-10-04 | 2007-10-02 | 4種のデング血清型に対する免疫付与の方法 |
| MX2009003417A MX2009003417A (es) | 2006-10-04 | 2007-10-02 | Metodo de inmunizacion contra los 4 serotipos de dengue. |
| CA002663885A CA2663885A1 (en) | 2006-10-04 | 2007-10-02 | Immunisation method against the 4 dengue serotypes |
| EP07858487.7A EP2077857B1 (fr) | 2006-10-04 | 2007-10-02 | Methode d'immunisation contre les 4 serotypes de la dengue |
| CN2007800444299A CN101553251B (zh) | 2006-10-04 | 2007-10-02 | 针对4种登革热血清型的免疫方法 |
| BRPI0719849-3A2A BRPI0719849A2 (pt) | 2006-10-04 | 2007-10-02 | Método de imunização contra os quatro sorotipos da dengue |
| AU2007311792A AU2007311792B2 (en) | 2006-10-04 | 2007-10-02 | Immunisation method against the 4 dengue serotypes |
| IL197768A IL197768A0 (en) | 2006-10-04 | 2009-03-23 | Immunisation method against the 4 dengue serotypes |
| IL224572A IL224572A (en) | 2006-10-04 | 2013-02-04 | A kit for neutralizing antibodies against the four types of dengue virus |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0608660A FR2906724B1 (fr) | 2006-10-04 | 2006-10-04 | Methode d'immunisation contre les 4 serotypes de la dengue. |
| FR0608660 | 2006-10-04 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008047023A2 true WO2008047023A2 (fr) | 2008-04-24 |
| WO2008047023A3 WO2008047023A3 (fr) | 2008-10-23 |
Family
ID=38222583
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR2007/052054 Ceased WO2008047023A2 (fr) | 2006-10-04 | 2007-10-02 | Methode d'immunisation contre les 4 serotypes de la dengue |
Country Status (15)
| Country | Link |
|---|---|
| US (2) | US7718358B2 (https=) |
| EP (3) | EP2526965A1 (https=) |
| JP (1) | JP5269796B2 (https=) |
| KR (1) | KR20090064593A (https=) |
| CN (2) | CN101553251B (https=) |
| AR (1) | AR063057A1 (https=) |
| AU (1) | AU2007311792B2 (https=) |
| BR (1) | BRPI0719849A2 (https=) |
| CA (1) | CA2663885A1 (https=) |
| FR (1) | FR2906724B1 (https=) |
| IL (2) | IL197768A0 (https=) |
| MX (1) | MX2009003417A (https=) |
| TW (2) | TWI406673B (https=) |
| WO (1) | WO2008047023A2 (https=) |
| ZA (1) | ZA200901816B (https=) |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2099483B1 (fr) * | 2006-12-01 | 2013-12-25 | Sanofi Pasteur | Methode d'immunisation contre les 4 serotypes de la dengue |
| WO2014016362A1 (en) | 2012-07-24 | 2014-01-30 | Sanofi Pasteur | Vaccine compositions for prevention against dengue virus infection |
| WO2014016360A1 (en) | 2012-07-24 | 2014-01-30 | Sanofi Pasteur | Vaccine compositions |
| WO2014083194A1 (en) | 2012-11-30 | 2014-06-05 | Sanofi Pasteur | Methods for inducing antibodies |
| US8999675B2 (en) | 2009-08-31 | 2015-04-07 | Gen-Probe Incorporated | Dengue virus assay |
| WO2016106107A2 (en) | 2014-12-22 | 2016-06-30 | Merck Sharp & Dohme Corp. | Dengue virus vaccine compositions and methods of use thereof |
| US9861692B2 (en) | 2013-06-21 | 2018-01-09 | Merck Sharp & Dohme Corp. | Dengue virus vaccine compositions and methods of use thereof |
| US10010600B2 (en) | 2009-06-01 | 2018-07-03 | Takeda Vaccines, Inc. | Compositions and methods for administration of vaccines against dengue virus |
| WO2019069130A1 (en) | 2017-10-05 | 2019-04-11 | Sanofi Pasteur | COMPOSITIONS FOR RECALL VACCINATION AGAINST DENGUE |
| EP3620174A1 (en) | 2018-09-05 | 2020-03-11 | Takeda Vaccines, Inc. | Dengue vaccine unit dose and administration thereof |
| US10857222B2 (en) | 2015-07-03 | 2020-12-08 | Sanofi Pasteur | Concomitant dengue and yellow fever vaccination |
| WO2021034349A1 (en) | 2019-08-16 | 2021-02-25 | Takeda Vaccines, Inc. | Methods for preventing dengue and hepatitis a |
| US10946087B2 (en) | 2014-09-02 | 2021-03-16 | Sanofi Pasteur | Vaccine compositions against dengue virus diseases |
| WO2021174059A1 (en) | 2020-02-27 | 2021-09-02 | Takeda Vaccines, Inc. | Method for removing host cell dna from virus preparation |
| WO2023147342A2 (en) | 2022-01-25 | 2023-08-03 | Takeda Vaccines, Inc. | Large-scale flaviviral vaccine production and manufacture |
| WO2023158989A1 (en) | 2022-02-15 | 2023-08-24 | Takeda Vaccines, Inc. | Dengue vaccine batch mixing process |
| WO2023215383A1 (en) | 2022-05-04 | 2023-11-09 | Takeda Vaccines, Inc. | Computer-based determination of flavivirus infectivity |
| WO2024108087A1 (en) | 2022-11-18 | 2024-05-23 | Takeda Vaccines, Inc. | A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation |
| WO2024118740A1 (en) | 2022-11-29 | 2024-06-06 | Takeda Vaccines, Inc. | Large-scale flaviviral vaccine production and manufacture |
| WO2025072259A1 (en) | 2023-09-25 | 2025-04-03 | Takeda Vaccines, Inc. | Coadministration of tetravalent dengue vaccine with hpv vaccine |
| WO2025122855A1 (en) | 2023-12-08 | 2025-06-12 | Takeda Vaccines, Inc. | A method for determining the concentration of residual vero cell genomic dna in a sample containing virus obtained from production in vero cells |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080193477A1 (en) * | 2005-08-10 | 2008-08-14 | Acambis Inc. | Vaccination Against Dengue Virus Infection |
| FR2903605A1 (fr) * | 2006-07-12 | 2008-01-18 | Sanofi Pasteur Sa | Methode d'immunisation contre les quatres serotypes de la dengue |
| ES2615390T3 (es) | 2008-03-05 | 2017-06-06 | Sanofi Pasteur | Proceso para estabilizar una composición de vacuna que contiene adyuvante |
| EP2143440A1 (fr) * | 2008-07-09 | 2010-01-13 | Sanofi Pasteur | Agent stabilisant et composition vaccinale comprenant un ou plusieurs flavivirus vivants atténués |
| US8968996B2 (en) * | 2009-06-01 | 2015-03-03 | Takeda Vaccines, Inc. | Compositions and methods for rapid immunization against dengue virus |
| EP2353609A1 (en) * | 2010-02-04 | 2011-08-10 | Sanofi Pasteur | Immunization compositions and methods |
| WO2011119628A2 (en) | 2010-03-23 | 2011-09-29 | The Regents Of The University Of California | Compositions and methods for self-adjuvanting vaccines against microbes and tumors |
| SG195115A1 (en) * | 2011-06-29 | 2013-12-30 | Immunotope Inc | Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of dengue virus infection |
| NZ630831A (en) * | 2012-06-10 | 2019-02-22 | Takeda Vaccines Inc | Compositions and methods for administration of vaccines against dengue virus |
| US8895028B2 (en) * | 2012-07-20 | 2014-11-25 | Arbovax, Inc. | Methods and compositions for dengue virus 3 (DV3) infectious clone |
| JP2016504315A (ja) * | 2012-12-14 | 2016-02-12 | タケダ ワクチン, インコーポレイテッドTakeda Vaccines, Inc. | 三価デングウイルス製剤に関する組成物、投与方法および使用 |
| EP3382012A4 (en) * | 2015-11-27 | 2019-07-03 | KM Biologics Co., Ltd. | LIVING VIRUS WITH A BANK OF ATTENUATED TREES OF DENGUEVIRUS AND DENGUE VACCINE THEREFORE AS ANTIGENE |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996040933A1 (en) | 1995-06-07 | 1996-12-19 | The Government Of The United States Of America, Represented By The Secretary Department Of Health And Human Services | Infectious dengue 2 virus pdk-53 as quadravalent vaccine |
| WO1998037911A1 (en) | 1997-02-28 | 1998-09-03 | Oravax, Inc. | Chimeric flavivirus vaccines |
| WO2000057908A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research, Department Of The Army | Attenuated dengue-1 virus vaccine |
| WO2000057909A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-2 virus vaccine |
| WO2000057904A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-3 virus vaccine |
| WO2000057910A1 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-4 virus vaccine |
| WO2001060847A2 (en) | 2000-02-16 | 2001-08-23 | The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services | Avirulent, immunogenic flavivirus chimeras |
| EP1159968A1 (fr) | 2000-05-30 | 2001-12-05 | Mahidol University | Souches atténuées du virus de la Dengue et leur utilisation dans une composition vaccinale |
| WO2002066621A1 (de) | 2001-02-21 | 2002-08-29 | Heinz Franz X | Attenuierte lebendimpfstoffe |
| WO2002095007A2 (en) | 2001-05-23 | 2002-11-28 | Dendreon San Diego Llc | Conjugates activated by cell surface proteases and therapeutic uses thereof |
| WO2002102828A2 (en) | 2001-06-01 | 2002-12-27 | Acambis, Inc. | Chimeric flavivirus vectors |
| WO2003101397A2 (en) | 2002-05-31 | 2003-12-11 | Acambis, Inc. | Tetravalent dengue vaccines |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU4224499A (en) | 1998-05-29 | 1999-12-13 | Epimmune, Inc. | Identification of broadly reactive dr restricted epitopes |
| JP2002540168A (ja) * | 1999-03-26 | 2002-11-26 | ウォルター リード アーミー インスティテュート オブ リサーチ | 多価デングウイルスワクチン |
| US6632663B1 (en) | 1999-09-22 | 2003-10-14 | Aventis Pasteur Limited | DNA immunization against chlamydia infection |
| EP1159969A1 (fr) | 2000-05-30 | 2001-12-05 | Aventis Pasteur | Vaccine composition |
| DK2290109T3 (da) | 2001-05-22 | 2014-11-10 | Us Gov Health & Human Serv | Udvikling af mutationer, der er anvendelige til svækkelse af dengue-vira samt kimære dengue-vira |
| US20040120964A1 (en) * | 2001-10-29 | 2004-06-24 | Mikszta John A. | Needleless vaccination using chimeric yellow fever vaccine-vectored vaccines against heterologous flaviviruses |
| KR101194818B1 (ko) * | 2002-01-15 | 2012-10-25 | 사노피 파스테르 바이오로직스, 엘엘씨 | 플라비바이러스 백신 |
| DE602004027902D1 (de) | 2003-03-24 | 2010-08-12 | Scripps Research Inst | Dna-vakzine gegen tumorwachstum und anwendungsverfahren dafür |
| CN101238144B (zh) * | 2005-06-17 | 2012-09-05 | 赛诺菲巴斯德有限公司 | 登革血清型1减毒株 |
| US20080193477A1 (en) * | 2005-08-10 | 2008-08-14 | Acambis Inc. | Vaccination Against Dengue Virus Infection |
| FR2903605A1 (fr) | 2006-07-12 | 2008-01-18 | Sanofi Pasteur Sa | Methode d'immunisation contre les quatres serotypes de la dengue |
| FR2909286B1 (fr) | 2006-12-01 | 2012-06-08 | Sanofi Pasteur | Methode d'immunisation contre les 4 serotypes de la dengue |
-
2006
- 2006-10-04 FR FR0608660A patent/FR2906724B1/fr not_active Expired - Fee Related
-
2007
- 2007-09-20 TW TW096135167A patent/TWI406673B/zh not_active IP Right Cessation
- 2007-09-20 TW TW102119488A patent/TW201336508A/zh unknown
- 2007-09-28 AR ARP070104316A patent/AR063057A1/es unknown
- 2007-10-02 CA CA002663885A patent/CA2663885A1/en not_active Abandoned
- 2007-10-02 ZA ZA200901816A patent/ZA200901816B/xx unknown
- 2007-10-02 EP EP11192672A patent/EP2526965A1/fr not_active Withdrawn
- 2007-10-02 EP EP07858487.7A patent/EP2077857B1/fr not_active Not-in-force
- 2007-10-02 JP JP2009530916A patent/JP5269796B2/ja not_active Expired - Fee Related
- 2007-10-02 KR KR1020097008657A patent/KR20090064593A/ko not_active Abandoned
- 2007-10-02 CN CN2007800444299A patent/CN101553251B/zh not_active Expired - Fee Related
- 2007-10-02 BR BRPI0719849-3A2A patent/BRPI0719849A2/pt active Search and Examination
- 2007-10-02 CN CN201310128837XA patent/CN103285386A/zh active Pending
- 2007-10-02 WO PCT/FR2007/052054 patent/WO2008047023A2/fr not_active Ceased
- 2007-10-02 EP EP11192665A patent/EP2526964A1/fr not_active Withdrawn
- 2007-10-02 AU AU2007311792A patent/AU2007311792B2/en not_active Ceased
- 2007-10-02 MX MX2009003417A patent/MX2009003417A/es active IP Right Grant
- 2007-10-02 US US11/866,382 patent/US7718358B2/en not_active Expired - Fee Related
-
2009
- 2009-03-23 IL IL197768A patent/IL197768A0/en not_active IP Right Cessation
-
2010
- 2010-03-05 US US12/718,308 patent/US20100270202A1/en not_active Abandoned
-
2013
- 2013-02-04 IL IL224572A patent/IL224572A/en not_active IP Right Cessation
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996040933A1 (en) | 1995-06-07 | 1996-12-19 | The Government Of The United States Of America, Represented By The Secretary Department Of Health And Human Services | Infectious dengue 2 virus pdk-53 as quadravalent vaccine |
| WO1998037911A1 (en) | 1997-02-28 | 1998-09-03 | Oravax, Inc. | Chimeric flavivirus vaccines |
| WO2000057908A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research, Department Of The Army | Attenuated dengue-1 virus vaccine |
| WO2000057909A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-2 virus vaccine |
| WO2000057904A2 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-3 virus vaccine |
| WO2000057910A1 (en) | 1999-03-26 | 2000-10-05 | Walter Reed Army Institute Of Research | Attenuated dengue-4 virus vaccine |
| WO2001060847A2 (en) | 2000-02-16 | 2001-08-23 | The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services | Avirulent, immunogenic flavivirus chimeras |
| EP1159968A1 (fr) | 2000-05-30 | 2001-12-05 | Mahidol University | Souches atténuées du virus de la Dengue et leur utilisation dans une composition vaccinale |
| WO2002066621A1 (de) | 2001-02-21 | 2002-08-29 | Heinz Franz X | Attenuierte lebendimpfstoffe |
| WO2002095007A2 (en) | 2001-05-23 | 2002-11-28 | Dendreon San Diego Llc | Conjugates activated by cell surface proteases and therapeutic uses thereof |
| WO2002102828A2 (en) | 2001-06-01 | 2002-12-27 | Acambis, Inc. | Chimeric flavivirus vectors |
| WO2003101397A2 (en) | 2002-05-31 | 2003-12-11 | Acambis, Inc. | Tetravalent dengue vaccines |
Non-Patent Citations (9)
| Title |
|---|
| GUBLER D.J., CLIN. MICROBIOL. REV., vol. 11, no. 3, 1998, pages 480 - 96 |
| GÜBLER ET AL.: "Monath TPM", 1988, CRC PRESS, article "Epidemiology of arthropod-bome viral disease", pages: 223 - 60 |
| HALSTEAD ET AL., AM. J. TROP. MED. HYG., vol. 22, 1973, pages 375 - 381 |
| KAUTNER ET AL., J. OF PEDIATRICS, vol. 131, 1997, pages 516 - 524 |
| RIGAU-PÉREZ ET AL., LANCET, vol. 352, 1998, pages 971 - 977 |
| ROTHMAN A.L. ET AL., VACCINE, vol. 19, 2001, pages 4694 - 9 |
| VAUGHN ET AL., J INFECT DIS, vol. 176, 1997, pages 322 - 30 |
| VAUGHN ET AL., J. INFECT. DIS., vol. 176, 1997, pages 322 - 30 |
| ZHOU H; DEEM MW., VACCINE, vol. 24, no. 14, 24 March 2006 (2006-03-24), pages 2451 - 9 |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2099483B1 (fr) * | 2006-12-01 | 2013-12-25 | Sanofi Pasteur | Methode d'immunisation contre les 4 serotypes de la dengue |
| US10010600B2 (en) | 2009-06-01 | 2018-07-03 | Takeda Vaccines, Inc. | Compositions and methods for administration of vaccines against dengue virus |
| US8999675B2 (en) | 2009-08-31 | 2015-04-07 | Gen-Probe Incorporated | Dengue virus assay |
| EP3932422A1 (en) | 2012-07-24 | 2022-01-05 | Sanofi Pasteur | Vaccine compositions for the prevention of dengue virus infection |
| AU2013295014B2 (en) * | 2012-07-24 | 2018-01-18 | Sanofi Pasteur | Vaccine compositions |
| WO2014016360A1 (en) | 2012-07-24 | 2014-01-30 | Sanofi Pasteur | Vaccine compositions |
| WO2014016362A1 (en) | 2012-07-24 | 2014-01-30 | Sanofi Pasteur | Vaccine compositions for prevention against dengue virus infection |
| WO2014083194A1 (en) | 2012-11-30 | 2014-06-05 | Sanofi Pasteur | Methods for inducing antibodies |
| US9861692B2 (en) | 2013-06-21 | 2018-01-09 | Merck Sharp & Dohme Corp. | Dengue virus vaccine compositions and methods of use thereof |
| US10946087B2 (en) | 2014-09-02 | 2021-03-16 | Sanofi Pasteur | Vaccine compositions against dengue virus diseases |
| WO2016106107A2 (en) | 2014-12-22 | 2016-06-30 | Merck Sharp & Dohme Corp. | Dengue virus vaccine compositions and methods of use thereof |
| US10449243B2 (en) | 2014-12-22 | 2019-10-22 | Merck Sharp & Dohme Corp. | Dengue virus vaccine compositions and methods of use thereof |
| US10857222B2 (en) | 2015-07-03 | 2020-12-08 | Sanofi Pasteur | Concomitant dengue and yellow fever vaccination |
| WO2019069130A1 (en) | 2017-10-05 | 2019-04-11 | Sanofi Pasteur | COMPOSITIONS FOR RECALL VACCINATION AGAINST DENGUE |
| US11690903B2 (en) | 2017-10-05 | 2023-07-04 | Sanofi Pasteur | Compositions for booster vaccination against dengue |
| WO2020051334A1 (en) | 2018-09-05 | 2020-03-12 | Takeda Vaccines, Inc. | Dengue vaccine unit dose and administration thereof |
| EP3620174A1 (en) | 2018-09-05 | 2020-03-11 | Takeda Vaccines, Inc. | Dengue vaccine unit dose and administration thereof |
| EP4082568A1 (en) | 2018-09-05 | 2022-11-02 | Takeda Vaccines, Inc. | Dengue vaccine unit dose and administration thereof |
| WO2021034349A1 (en) | 2019-08-16 | 2021-02-25 | Takeda Vaccines, Inc. | Methods for preventing dengue and hepatitis a |
| WO2021174059A1 (en) | 2020-02-27 | 2021-09-02 | Takeda Vaccines, Inc. | Method for removing host cell dna from virus preparation |
| WO2023147342A2 (en) | 2022-01-25 | 2023-08-03 | Takeda Vaccines, Inc. | Large-scale flaviviral vaccine production and manufacture |
| WO2023147337A2 (en) | 2022-01-25 | 2023-08-03 | Takeda Vaccines, Inc. | Large-scale flaviviral vaccine production and manufacture |
| WO2023158989A1 (en) | 2022-02-15 | 2023-08-24 | Takeda Vaccines, Inc. | Dengue vaccine batch mixing process |
| WO2023215383A1 (en) | 2022-05-04 | 2023-11-09 | Takeda Vaccines, Inc. | Computer-based determination of flavivirus infectivity |
| WO2024108087A1 (en) | 2022-11-18 | 2024-05-23 | Takeda Vaccines, Inc. | A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation |
| EP4375381A1 (en) | 2022-11-18 | 2024-05-29 | Takeda Vaccines, Inc. | A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation |
| WO2024118740A1 (en) | 2022-11-29 | 2024-06-06 | Takeda Vaccines, Inc. | Large-scale flaviviral vaccine production and manufacture |
| WO2025072259A1 (en) | 2023-09-25 | 2025-04-03 | Takeda Vaccines, Inc. | Coadministration of tetravalent dengue vaccine with hpv vaccine |
| WO2025122855A1 (en) | 2023-12-08 | 2025-06-12 | Takeda Vaccines, Inc. | A method for determining the concentration of residual vero cell genomic dna in a sample containing virus obtained from production in vero cells |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2007311792A1 (en) | 2008-04-24 |
| FR2906724B1 (fr) | 2009-03-20 |
| AU2007311792B2 (en) | 2013-05-02 |
| JP2010505801A (ja) | 2010-02-25 |
| ZA200901816B (en) | 2010-06-30 |
| US20080085288A1 (en) | 2008-04-10 |
| FR2906724A1 (fr) | 2008-04-11 |
| CN101553251A (zh) | 2009-10-07 |
| IL224572A (en) | 2014-06-30 |
| US7718358B2 (en) | 2010-05-18 |
| TW200826959A (en) | 2008-07-01 |
| CA2663885A1 (en) | 2008-04-24 |
| CN101553251B (zh) | 2013-05-22 |
| EP2526964A1 (fr) | 2012-11-28 |
| WO2008047023A3 (fr) | 2008-10-23 |
| BRPI0719849A2 (pt) | 2014-04-29 |
| TW201336508A (zh) | 2013-09-16 |
| EP2077857B1 (fr) | 2013-11-20 |
| TWI406673B (zh) | 2013-09-01 |
| EP2526965A1 (fr) | 2012-11-28 |
| JP5269796B2 (ja) | 2013-08-21 |
| CN103285386A (zh) | 2013-09-11 |
| IL197768A0 (en) | 2011-08-01 |
| EP2077857A2 (fr) | 2009-07-15 |
| US20100270202A1 (en) | 2010-10-28 |
| AR063057A1 (es) | 2008-12-23 |
| KR20090064593A (ko) | 2009-06-19 |
| MX2009003417A (es) | 2009-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2077857B1 (fr) | Methode d'immunisation contre les 4 serotypes de la dengue | |
| EP2099483B1 (fr) | Methode d'immunisation contre les 4 serotypes de la dengue | |
| WO2008007021A1 (fr) | Methode d'immunisation contre les 4 serotypes de la dengue |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780044429.9 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07858487 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007311792 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2663885 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/003417 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1806/CHENP/2009 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2009530916 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007311792 Country of ref document: AU Date of ref document: 20071002 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007858487 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020097008657 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: PI0719849 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090331 |