WO2008008537A2 - Combi) compositions for the treatment of mucormycosis. comprising iron chelator and antifungal agent - Google Patents
Combi) compositions for the treatment of mucormycosis. comprising iron chelator and antifungal agent Download PDFInfo
- Publication number
- WO2008008537A2 WO2008008537A2 PCT/US2007/016065 US2007016065W WO2008008537A2 WO 2008008537 A2 WO2008008537 A2 WO 2008008537A2 US 2007016065 W US2007016065 W US 2007016065W WO 2008008537 A2 WO2008008537 A2 WO 2008008537A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mucormycosis
- iron
- antifungal agent
- deferasirox
- iron chelating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/4196—1,2,4-Triazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- This invention relates generally to the treatment of infectious diseases and, more specifically to effective treatments of opportunistic fungal diseases.
- Mucormycosis is a life-threatening infection caused by fungi of the class Zygomycetes, order Mucorales. Fungi belonging to the order Mucorales are distributed into six families, all of which can cause mucormycosis (Ibrahim et al. Zygomycosis, p. 241-251, In W. E. Dismukes, P. G. Pappas, and J. D. Sobel (ed.), Clinical Mycology, Oxford University Press, New York (2003); Kwon-Chung, K. J., and J. E. Bennett, Mucormycosis, p. 524-559, Medical Mycology, Lea & Febiger, Philadelphia (1992), and Ribes et al.
- mucormycosis The agents of mucormycosis are opportunistic pathogens that almost uniformly affect immunocompromised hosts (Spellberg et al., Clin. Microbiol. Rev. 18:556-69 (2005)). Patients in diabetic ketoacidosis are uniquely susceptible to mucormycosis, and develop these infections more commonly than infections caused by other fungi. In contrast, in the face of other immunocompromising conditions predisposing patients to developing mucormycosis, including neutropenia and corticosteroid therapy, mucormuycosis is less common than other opportunistic fungal infections, such as those caused by Candida and Aspergillus spp.
- Available therapies for invasive mucormycosis include attempts to reverse the underlying predisposing factors, emergent, wide-spread surgical debridement of the infected area, and adjunctive antifungal therapy (Edwards, J., Jr., Zygomycosis, p. 1192-1199. In P. Hoeprich and M. Jordan (ed.), Infectious Disease, 4th ed. J.B. Lippincott Co., Philadelphia (1989); Wheat et al., (2003), supra; Kwon-Chung and Bennett, supra; Sugar, A. M., Agent of Mucormycosis and Related Species, p. 2311-2321. In G. Mandell, J. Bennett, and R.
- Amphotericin B remains the only antifungal agent approved for the treatment of invasive mucormycosis (Id.). Because the fungus is relatively resistant to AmB, high doses are required, which frequently cause nephrotoxicity and other adverse effects (Sugar, supra). Also, in the absence of surgical removal of the infected focus (such as excision of the eye in patients with rhinocerebral mucormycosis), antifungal therapy alone is rarely curative (Edwards, J. (1989), supra; Ibrahim et al., (2003), supra).
- Rhizopus obtains iron from the iron-deferoxamine complex by intracellular transport of the reduced iron without deferoxamine internalization (de Locht et al., Biochemical Pharmacology 47:1843-50 (1994)). This transport is likely mediated by high-affinity iron permeases. Therefore, increased available serum iron is a risk factor for mucormycosis pathogenesis.
- iron chelating compounds can function as sideophores for the pathogen and, thus, may not be generally applicable for therapeutic treatments.
- the invention provides a composition including at least one iron chelating compound and at least one antifungal agent.
- the composition can include the iron chelating compounds deferiprone or deferasirox.
- An antifungal agent included in the composition can include a polyene antifungal agent, an azole antifungal agent or an echinocandin antifungal agent.
- the invention also provides a method of treating or preventing a fungal condition.
- the method includes administering to an individual having, or susceptible to having, a fungal condition a therapeutically effective amount of at least one iron chelating compound for a sufficient time to reduce the severity of a fungal condition, wherein the iron chelating compound comprises a non-siderophore or non-xenosiderophore relative to the fungal condition.
- a method of treating or preventing a fungal condition provided by the invention also can include administering to an individual having, or susceptible of having, a fungal condition a therapeutically effective amount of at least one iron chelating compound and at least one antifungal agent.
- a method including prophylactic administration of the at least one iron chelating compound or at least one iron chelating compound and at least one antifungal agent prior to onset of the fungal condition.
- Figure 1 shows the relationship between Def and iron and survival of DBCA mice infected with R. oryzae.
- Mice (n>20 in each treatment) were treated with deferiprone (Def) or Def + FeCb (60 mg/kg) to reverse the effect of iron chelation.
- An LAmB-treated arm was included as a control. Treatment was initiated 24 h post infection. *, p ⁇ 0.003 compared to infected untreated or uninfected untreated +FeCb.
- Figure 2 shows that Exjade Tm (deferasirox) improves survival of diabetic ketoacidotic mice infected with R. oryzae.
- Figure 3 shows the survival of DKA mice infected with R. oryzae and treated with different treatment regimens of Def.
- Figure 4 shows the treatment of experimental mucormycosis with a combination of Def and LAmB.
- Figure 7 shows a frozen section of necrotic nasal mucosa stained with silver methanamine, showing fungi with wide, ribbon-like aseptate hyphae consistent with Mucorales. 840x magnification.
- Figure 8 shows that deferasirox induces rFTRl gene expression in Rhizopus oryzae.
- Figure 8(a) shows the RT PCR-detected expression of rFTRl gene from R. oryzae mycelia incubated in iron-replete, iron chelation (deferasirox), or reversal of iron chelation (deferasirox saturated with ferric chloride) conditions. The expression of 18s rDNA was included to verify the quality of RNA extraction.
- Figure 8(b) shows a diagram demonstrating the strategy for constructing R. oryzae GFP expression vector. Promoter denotes either rFtrlp or Actlp.
- Figure 8(c) shows the GFP expression in R.
- Figure 9(a) shows the survival of diabetic ketoacidotic mice (n> 7 per group) infected with R. oryzae 99-892 (2.2 x 10 4 ) and treated with different doses of deferasirox. Mice were treated with placebo (hydroxypropylcellulose carrier), deferasirox, or deferasirox plus iron (FeCb, 10 mg/kg) to reverse the effect of iron chelation. *P ⁇ 0.05 for survival.
- Figure 10(b) shows hematoxylin and eosin stained kidney sections of diabetic ketoacidotic mice infected with R.
- oryzae 99-892 and treated with deferasirox, deferasirox plus ferric chloride, or placebo as mentioned in 10(a). Arrows indicate R. oryzae hyphae in the tissue. Magnification, X 400. *P ⁇ 0.002 for tissue fungal burden compared to placebo or deferasirox plus ferric chloride.
- Figure 11 shows that Iron chelation increases splenic ThI and Th2 lymphocyte frequencies and increases the levels of pro-inflammatory cytokines compared to iron overloaded mice.
- Figure 12 shows the efficacy against mucormycosis for deferasirox alone, LAmB alone and the combination of deferasirox and LAmB together.
- the figure specifically shows the survival of diabetic ketoacidotic mice (n > 16 from two separate experiments with similar results) infected with R. oryzae 99-880 (average inoculum 1.5 x 10 3 spores) and treated with deferasirox alone, LAmB alone and the combination of deferasirox (10 mg/kg bid for 7 days) and LAmB (15 mg/kg for 4 days).
- Figure 13 shows the efficacy in reducing target organ infection for deferasirox alone, LAmB alone and the combination of deferasirox and LAmB together. More specifically, the figure shows tissue R. oryzae burden in brains and kidneys of mice (n > 7) infected with R. oryzae 99-880. In these mice, treatment began 24 h post infection and consisted of placebo, deferasirox (10 mg/kg, bid), LAmB (15 mg/kg/d), or a combination of both drugs. Organs were harvested on day 3 after receiving two daily treatments. Data are displayed as median ⁇ interquartile ranges. The y-axis reflects the lower limit of detection of the assay. * P O.003 compared to placebo. * * P ⁇ 0.003 compared to placebo, deferasirox , or LAmB. ⁇ P ⁇ 0.01 compared to placebo, or deferasirox.
- Figure 14 shows the efficacy of deferasirox in treating R. oryzae infections in neutropenic mice.
- * P 0.037 compared to placebo.
- This invention is directed to the use of iron chelating compounds for the treatment or reduction in severity of fungal conditions.
- the iron chelating compounds are selected to have low siderophore or xenosiderophore activity relative to the targeted fungal condition.
- the iron chelating compounds are selected to be substantially free of siderophore or xenosiderophore activity relative to the targeted fungal condition.
- iron chelators that act as siderophores or xenosiderophores, which supply previously unavailable iron to a fungus non-siderophoric and non-xenosiderophoric iron chelating compounds lack such facilitating or transport activity. Therefore, the iron chelators of the inventions can be used for removal of iron from the surrounding environment.
- One benefit of iron chelation for antifungal therapy is that it reduces the availability of a important mineral which is required by many microbial pathogens for growth and/or virulence.
- the invention is directed to a therapeutic composition containing a iron chelating compound and an antifungal agent.
- the iron chelating compound can be deferiprone (1,2 dimethyl-3-hydroxypyrid-4-l), or deferasirox (4-[3,5-Bis (2- hydroxyphenyl)-lH-l,2,4-triazol-l-yl]-benzoic acid). Both deferiprone and deferasirox have been used in therapeutic settings for the treatment of iron overload conditions and are therefore, safe and effective for iron chelation therapy for the treatment or prevention of fungal conditions.
- Antifungal agents known in the art can be selected for combination with an iron chelator of the invention. The combination is beneficial for use in the treatment or prevention of fungal conditions.
- the invention is directed to a method of treating or preventing a fungal condition.
- the method includes administering to an individual one or more iron chelating compounds which exhibits non-siderophoric or non-xenosiderophoric iron chelation activity toward the targeted fungal species.
- the method also can include co-administration of an antifungal agent to achieve enhanced efficacy compared to an iron chelator alone.
- the iron chelating compound can be deferiprone, deferasirox or selected from other iron chelating compounds know in the art.
- the methods of the invention are particularly beneficial for therapeutic and prophylactic treatments because iron chelation targets the removal of an important mineral for fungal pathogenesis.
- the invention provides a composition including at least one iron chelating compound and at least one antifungal agent.
- compositions of the invention target this important mineral for removal from the host environment to neutralize fungal pathogens.
- the compositions of the invention include an iron chelating compound to deplete available iron and inhibit growth, viability and/or virulence to a fungal pathogen.
- the compositions of the invention include a combination of at least one iron chelating compound together with at least one antifungal agent. The inclusion of both an iron chelating compound and an antifungal agent combines antifungal activities that target two different pathways used by fungi for growth, viability or virulence. Targeting two or more different fungal pathways provides for effective therapeutic treatment of fungal conditions since the likelihood of pathogenic evasion of both targeted pathways is low.
- iron chelating compound or "iron chelator” is intended to mean a compound that binds iron between two or more separate binding sites so as to form a chelate ring or rings.
- An iron chelating compound bound or complexed with iron is referred to herein as an iron chelate.
- An iron chelating compound can be bidentate (or didentate), which binds iron using two separate binding sites.
- Iron chelating compounds of the invention also can be tridentate, tetradentate or higher order multidentate iron chelation compounds binding iron with three, four or more separate binding sites, respectively.
- Iron chelating compounds of the invention include chelation compounds that can bind to all oxidation states of iron including, for example, iron (-II) state, iron (-1) state, iron (0) state, iron (I) state, iron (II) state (ferrous), iron (III) state (ferric), iron (IV) state (ferryl) and/or iron (V).
- Iron chelation therapy refers to the use of an iron chelator to bind with iron in vivo to form an iron chelate so that the iron loses its toxic effect or adverse physiological activity. Alternatively, chelated iron becomes unavailable to the infectious organism.
- An iron chelating compound useful in a composition of the invention can include any chelator or other molecule that can bind and prevent iron utilization by the targeted fungus or fungi.
- Specific examples of iron chelating compounds included in the compositions of the invention include, for example, deferiprone and deferasirox. These exemplary iron chelating compounds are particularly useful because they have been approved in various countries for therapeutic indications unrelated to fungal conditions and are therefore, well characterized, safe and non-toxic in humans.
- deferiprone as it is used herein is intended to mean an iron chelating compound having the structure 1,2 dimethyl-3-hydroxypyrid-4-l.
- Deferiprone (Def) also is known in the art as Ll, CP20, Ferriprox, or Kelfer.
- Deferiprone is a member of the ⁇ - ketohydroxypyridine class of iron chelators and is commercially available from, for example, Apotex, Inc. (Weston, Ontario, Canada).
- deferasirox as it is used herein is intended to mean an iron chelating compound having the structure 4-[3,5-Bis (2-hydroxyphenyl)-lH-l,2,4-triazol-l-yl]-benzoic acid and having a molecular weight of 373.4 daltons.
- Deferasirox also is known in the art as Exjade® or ICL 670, is a member of the class of tridentate iron chelators referred to as N-substituted bis-hydroxyphenyl-triazoles. Deferasirox is commercially available from, for example,
- iron chelating compounds also can be included in the compositions of the invention.
- Such other iron chelating compounds are well known in the art and include, for example, naturally occurring siderophores and xenosiderophores such as those described below as well and non-natural Iy occurring compounds such as deferiprone and deferasirox.
- Non-naturally occurring iron chelating compounds are exemplified by members of the hydroxypyridin-4-one (HPO) class of chelators such as deferiprone, members of the N- substituted bis-hydroxyphenyl-triazole class of chelators such as deferasirox, diethylenetriaminepentaacetic acid (DTPA) and deferoxamine.
- HPO hydroxypyridin-4-one
- DTPA diethylenetriaminepentaacetic acid
- Deferiprone, deferasirox and any of the above exemplary iron chelating compounds as well as others well known in the art can be included in the iron chelating compound containing compositions of the invention
- Siderophores and xenosiderophores include, for example, hydroxamates and polycarboxylates.
- the hydroxamates contain an N- ⁇ -hydroxyornithine moiety and are generally categorized into four exemplary families.
- One category includes rhodotoruHc acid, which is the diketopiperazine of N- ⁇ -acetyl-L-N ⁇ -hydroxyornithine. Included within this category are derivatives such as dihydroxamate named dimerum acid.
- a second category includes the coprogens, which contain an N- ⁇ -acyl-N- ⁇ -hydroxy-L-ornithine moiety.
- Coprogens also can be considered trihydroxamate derivatives of rhodotorulic acid with a linear structure.
- a third category includes the ferrichromes, which consist of cyclic peptides containing a tripeptide of N- ⁇ -acyl-N- ⁇ -hydroxyornithine and combinations of glycine, serine or alanine.
- the fourth exemplary category includes the fusarinines, also called fusigens, which can be either linear or cyclic hydroxamates. Fusarinine is a compound characterized by N acylation of N-hydroxyornithine by anhydromevalonic acid.
- the polycarboxylates consist of a citric acid-containing polycarboxylate called rhizoferrin.
- the molecule contains two citric acid units linked to diaminobutane.
- Rhizoferrin is widely distributed among the members of the phylum Zygomycota, having been observed in the order Mucorales and in the order Entomophthoraies.
- Other categories of siderophores useful as iron chelating compounds in the compositions of the invention include, for example, the phenolate-catecholate class of siderophores, hemin, and ⁇ -ketoaldehyde phytotoxins.
- the amount of iron chelating compound included in a composition of the invention can vary but will generally be a therapeutically effective amount or an amount that can be reconstituted or diluted to a therapeutically effective amount.
- effective amounts of iron chelating compounds of the invention are described further below with reference to the methods of the invention.
- An amount of one, some or all iron chelating compounds can be formulated in a composition of the invention to correspond to these exemplary effective amounts.
- An iron chelating compound also can be formulated in a composition of the invention in amounts greater than a therapeutically effective amount for either short or long-term storage and the end user can dilute the formulation prior to use to a desired therapeutically effective amount.
- an iron chelating compound included in a composition of the invention can be lyophilized or produced in powder or other solid form and the end user can reconstitute the dry formulation prior to use to a desired therapeutically effective amount.
- the dry or concentrated formulations or the formulations containing an effective amount of constituents can contain the iron chelating compound and the antifungal agent alone or together with any desired excipients, surfactants, tonicifiers, salts or buffers. Dilution or reconstitution can be performed in a pharmaceutically acceptable medium that adjusts the formulation to the desired therapeutically effective amount of the at least one iron chelating compound and the at least one antifungal agent and includes any includes any additional excipients, surfactants, tonicifiers, salts or buffers.
- Pharmaceutical formulations are well known and practiced in the pharmaceutical. Any such well known formulations and pharmaceutical formulation components are applicable for use with a composition of the invention.
- compositions of the invention also include at least one antifungal agent.
- antifungal agent or "antifungal,” as it is used herein is intended to mean an agent that destroys fungi, or inhibits or prevents fungal growth, viability and/or virulence.
- exemplary categories of antifungal agents include polyene antifungal agents, azole antifungal agents and echinocandin antifungal agents.
- polyene antifungal agents include amphotericin B deoxycholate, liposomal amphotericin B, amphotericin B lipid complex and amphotec.
- Specific examples of azole antifungal agents include posaconazole, voricoazole, fluconazole and itraconazole.
- echinocandin antifungal agents include caspofungin acetate and micafungin. Numerous other antifungal agents are well known in the art and are included within the meaning of the term as it is used herein.
- the combination of the at least one iron chelating compound and the at least one antifungal agent will be selected depending on the fungal condition to be targeted.
- amphotericin B lipid complex can be a good antifungal agent against, for example, zygomycosis, (mucormycosis), aspergillosis and/or candidiasis and can be combined with an iron chelating compound such as deferiprone or deferasirox.
- one of the antifungal agents exemplified above or another one known in the art can be effective or therapeutically desirable against another targeted condition and one of such other antifungal agents can be combined with an iron chelating compound to produce a composition of the invention.
- compositions of the invention are flexible in both their constituent iron chelating compounds and constituent antifungal agents and allow for any an all combinations and permutations of the at least one iron chelating compound and the at least one antifungal agent of be combined, for example, into a single formulation.
- the invention provides for a composition containing at least one iron chelating compound and at least one antifungal agent.
- the iron chelating compound can be selected from, for example, the non-naturally occurring iron chelating compounds described previously exemplified by members of the hydroxypyridin-4-one (HPO) class of chelators such as deferiprone, members of the N-substituted bis-hydroxyphenyl-triazole class of chelators such as deferasirox, diethylenetriaminepentaacetic acid (DTPA) and deferoxamine.
- HPO hydroxypyridin-4-one
- DTPA diethylenetriaminepentaacetic acid
- the iron chelating compound also can be selected from, for example, the siderophores and/or xenosiderophores exemplified by, for example, the hydroxamates, the polycarboxylates, the phenolate-catecholate class of siderophores, hemin or the ⁇ - ketoaldehyde phytotoxins described previously.
- the antifungal agent can be selected from, for example, a polyene antifungal agent such as amphotericin B deoxycholate, liposomal amphotericin B, amphotericin B lipid complex or amphotec.
- the antifungal agent also can be selected from, for example, an azole antifungal agent such as posaconazole, voricoazole, fluconazole or itraconazole.
- the antifungal agent can additionally be selected from, for example, an echinocandin antifungal agent such as caspofungin acetate or micafungin.
- An exemplary composition of the invention having one iron chelating compound for the at least one iron chelating compound and having one antifungal agent for the at least one antifungal agent can be deferasirox and amphotericion B lipid complex.
- the amount of antifungal agent included in a also can vary, but will generally be a therapeutically effective amount or an amount that can be reconstituted or diluted to a therapeutically effective amount.
- effective amounts of antifungal agents of the invention are described further below and exemplified with reference to polyene antifungal agents.
- An amount of one, some or all antifungal agents can be formulated in a composition of the invention to correspond to these exemplary effective amounts for polyene antifungal agents or corresponding to well known effective amounts for other antifungal agents such as the azole antifungal agents or the echinocandin antifungal agent.
- an antifungal agent also can be formulated in a composition of the invention in concentrated form for either short or long-term storage and the end user can dilute the formulation prior to use to a desired therapeutically effective amount.
- an antifungal agent included in a composition of the invention can be produced in lyophilized, powder or other solid form and the end user can reconstitute the dry formulation prior to use to a desired therapeutically effective amount.
- the dry or concentrated formulations or the formulations containing an effective amount of constituents can contain the iron chelating compound and the antifungal agent alone or together with any desired excipients, surfactants, tonicif ⁇ ers, salts or buffers. Dilution or reconstitution can be performed as described previously and exemplified in, for example, Remington: The Science and Practice of Pharmacy, supra; Williams et al., Foye's Principles of Medicinal Chemistry, 5th Ed., Lippincott Williams & Wilkins (2002); Allen et al., Ansels Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th Ed., Lippincott Williams & Wilkins (2004); Holmberg et al., Surfactants and Polymers in Aqueous Solution, supra; Surfactants: A Practical Handbook, K. Robert Lange, ed., supra, and Vogel, A.I., Vogel's Textbook of Practical Organic Chemistry, supra.
- compositions of the invention can additionally contain two or more iron chelating compounds.
- Inclusion of two or more iron chelating compounds allows targeting of multiple fungal conditions and/or provides for the inclusion of a range of iron affinities in the iron chelating component of the composition.
- Inclusion of iron chelating compounds having different affinities for iron can be therapeutically beneficial to further prevent evasion of fungal pathogens.
- compositions of the invention will generally contain between about 1-8, particularly between about 2-7, more particularly between about 3-6 or even more particularly between about 4-5 iron chelating compounds.
- Iron chelating compounds greater than or in between these ranges also can be used in a composition of the invention.
- a composition of the invention can be produced that contains essentially any desired number of different iron chelating compounds including, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 or more.
- compositions of the invention can additionally contain two or more antifungal agents.
- the inclusion of two or more antifungal agents also allows targeting of multiple fungal conditions and/or provides for the targeting of different fungal mechanisms used for growth, viability or virulence. Inclusion of multiple antifungal agents can similarly be therapeutically beneficial to further prevent evasion of fungal pathogens.
- compositions of the invention will generally contain between about 1-8, particularly between about 2-7, more particularly between about 3-6 or even more particularly between about 4-5 antifungal agents.
- Antifungal agents greater than or in between these ranges also can be used in a composition of the invention. Therefore, a composition of the invention can be produced that contains essentially any desired number of different antifungal agents including, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 or more.
- compositions include deferasirox and one or more of any of amphotericin B deoxycholate, liposomal amphotericin B 5 amphotericin B lipid complex, amphotec, posaconazole, voricoazole, fluconazole, itraconazole, caspofungin acetate or micafungin.
- compositions include, for example, deferasirox and/or deferiprone and one, two or three or more antifungal agents selected from each category corresponding to the polyene antifungal agents, the azole antifungal agents and the echinocandin antifungal agents.
- the invention provides any combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 or more iron chelating compounds together with any combination of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 or more antifungal agents.
- Such compositions containing multiple iron chelating compounds and/or multiple antifungal agents can be formulated as described previously.
- compositions of the invention also can include a pharmaceutically acceptable medium.
- pharmaceutically acceptable medium is intended to mean that the medium admixed with an iron chelating compound of the invention is of sufficient purity and quality for use in humans.
- a pharmaceutically acceptable medium includes a formulation that is substantially free from contaminating particles and organisms. Therefore, the term is intended to include a medium that is compatible with a iron chelating compound of the invention and is safe and non-toxic when administered to humans.
- Such pharmaceutically acceptable media are well known in the art.
- the invention also provides a method of treating or preventing a fungal condition.
- the method includes administering to an individual having, or susceptible to having, a fungal condition a therapeutically effective amount of at least one iron chelating compound for a sufficient time to reduce the severity of a fungal condition, wherein the iron chelating compound comprises a non-siderophore or non-xenosiderophore relative to the fungal condition.
- the invention additionally provides a method treating or preventing a fungal condition that includes administering to an individual having, or susceptible of having, a fungal condition a therapeutically effective amount of at least one iron chelating compound and at least one antifungal agent for sufficient time to reduce the severity of the fungal condition, wherein the iron chelating compound comprises a non-siderophore or non-xenosiderophore relative to the fungal condition.
- the methods of the invention include iron chelation therapy alone or iron chelation therapy used together with antifungal therapy.
- a formulation including at least one iron chelating compound is administered.
- a formulation including at least one iron chelating compound and at least one antifungal agent is administered.
- Such formulations are selected and prepared as described previously with respect to the compositions of the invention. Therefore, a composition of the invention can be prepared devoid of an at least one antifungal agent for use in iron chelation therapy alone or it can be prepared with at least one antifungal agent for use in combined iron chelation and antifungal therapy.
- a first composition of the invention also can be prepared devoid of at least one antifungal agent and a second composition of the invention can be prepared devoid of an iron chelating compound.
- the first and second preparations can then be used simultaneously, sequentially or alternatively for combination iron chelation and antifungal therapy. Therefore, the teachings and guidance described previously with respect to a composition of the invention can be similarly employed for selection and preparation of a formulation containing at least one iron chelating compound alone, a formulation containing at least one antifungal agent or for a formulation containing both.
- the iron chelating compound in a formulation containing at least one iron chelating compound, a first or second preparation containing at least one iron chelating compound and/or a composition of the invention will be selected so as to include a non-siderophore or non-xenosiderophore relative to the fungal condition or fungal agent causing the condition.
- siderophore as it is used herein is intended to mean an iron chelator that facilitates iron gathering by an organism. For example, under conditions of iron starvation, many fungi synthesize siderophores that function in iron gathering through iron binding and uptake. Siderophores are generally low molecular weight compounds (e.g., less than about 2,000 MW) and can exhibit either or both cellular uptake and/or iron storage functions. Siderophores are synthesized by the utilizing organism.
- siderophore refers to an iron chelator in context with, or relative to, the siderophore-producing and utilizing organism or species. Accordingly, although iron chelating siderophores bind and decrease iron levels from the extracellular environment, because they facilitate iron uptake and use by a pathogen they have diminished therapeutic value when used for iron chelation therapy targeting a condition caused by the siderophore- producing organism. Siderophores synthesis and use can be found described in, for example, Howard, D.H., Clinical Microbiology Reviews 12:394-404 (1999).
- xenosiderophore as it is used herein is intended to mean a siderophore not produced by the utilizing fungus or organism.
- xenosiderophore refers to an iron chelator in context with, or relative to, the xenosiderophore utilizing organism or species. Similar to siderophores, xenosiderophores exhibit therapeutic value when used for iron chelation therapy that targets a condition caused by a non-utilizing organism. Siderophore and xenosiderophore synthesis and use can be found described in, for example, Howard, D.H., FEMS Immunology and Medical Microbiology 40:95-100 (2004).
- an iron chelating compound corresponding to a non-siderophore or a non- xenosiderophore relative to a targeted fungal condition refers to a siderophore not produced or utilized by the fungal agent causing the fungal condition or to a xenosiderophore not utilized by the fungal agent causing the fungal condition.
- the iron chelation formulations, compositions, including first and second constituent preparations, and methods of the invention are applicable for treating, reducing the severity, preventing and curing a fungal condition.
- a particularly useful application of the iron chelation formulations, compositions and methods of the invention include prophylactic administration prior to onset of the fungal condition.
- treating or "treatment,” as it is used herein is intended to mean an amelioration of a clinical symptom indicative of a fungal condition.
- Amelioration of a clinical symptom includes, for example, a decrease or reduction in at least one symptom of a fungal condition in a treated individual compared to pretreatment levels or compared to an individual with a fungal condition.
- the term “treating” also is intended to include the reduction in severity of a pathological condition, a chronic complication or an opportunistic fungal infection which is associated with a fungal condition. Such pathological conditions, chronic complications or opportunistic infections are exemplified below with reference to mucormycosis.
- Mucormycosis and other such pathological conditions, chronic complications and opportunistic infections also can be found described in, for example, Merck Manual, Sixteenth Edition, 1992, and Spellberg et al., CHn. Microbio. Rev. 18:556-69 (2005).
- Symptoms of a fungal condition that can be ameliorated by a method of the invention include, for example, fever, chills, night sweats, anorexia, weight loss, malaise, depression and lung, skin or other lesions.
- Other symptoms or characteristic manifestations include, for example, dissemination from a primary focus, acute or subacute presentations, progressive pneumonia, fungemia, manifestations of extrapulmonary dissemination, chronic meningitis, progressive disseminated histoplasmosis as a generalized involvement of the reticuloendothelial system (liver, spleen, bone marrow) and blastomycosis as single or multiple skin lesions.
- Effective treatment of an individual with a fungal condition for example, will result in a reduction one or more of such symptoms in the treated individual.
- Numerous other clinical symptoms of fungal conditions are well known in the art and also can be used as a measure of amelioration or reduction in the severity of a fungal condition using the methods of the invention described herein.
- Diagnosis of a fungal condition can be confirmed by isolating causative fungi from, for example, sputum, urine, blood, bone marrow, or specimens from infected tissues.
- causative fungi can be diagnosed histopathologically with a high degree of reliability based on distinctive morphologic characteristics of invading fungi and/or by immunohistochemistry and the like selective for identifying antigens.
- Assessment of the activity of the infection also can be based on cultures taken from many different sites, fever, leukocyte counts, clinical and laboratory parameters related to specific involved organs (eg, liver function tests), and immunoserologic tests.
- the clinical significance of positive sputum cultures also can be corroborated by confirmation of tissue invasion. Such corroboration can be particularly beneficial with commensal organisms such as Candida albicans or for those organisms that are prevalent in the environment such as Aspergillus sp.
- preventing or "prevention,” as it is used herein is intended to mean a forestalling of a clinical symptom indicative of a fungal condition.
- forestalling includes, for example, the maintenance of normal physiological indicators in an individual at risk of infection by a fungus or fungi prior to the development of overt symptoms of the condition or prior to diagnosis of the condition. Therefore, the term “preventing” includes the prophylactic treatment of individuals to guard them from the occurrence of a fungal condition. Preventing a fungal condition in an individual also is intended to include inhibiting or arresting the development of the fungal condition.
- Inhibiting or arresting the development of the condition includes, for example, inhibiting or arresting the occurrence of abnormal physiological indicators or clinical symptoms such as those described above and/or well known in the art. Therefore, effective prevention of a fungal condition would include maintenance of normal body temperature, weight, psychological state as well as lack of lesions or other pathological manifestations as described above in an individual predisposed to a fungal condition.
- Individuals predisposed to a fungal condition include, for example, an individual with AIDS, azotemia, diabetes mellitus, bronchiectasis, emphysema, TB, lymphoma, leukemia, or burns, or an individual with a history of susceptibility to a fungal condition.
- Inhibiting or arresting the development of the condition also includes, for example, inhibiting or arresting the progression of one or more pathological conditions, chronic complications or susceptibility to an opportunistic infection associated with a fungal condition.
- the methods of the invention are useful for the treatment and/or prevention of a wide variety of fungal conditions.
- the term "fungal condition,” as it is used herein is intended to mean an aberrant condition causes by a fungus infection.
- Fungal infection, or mycoses, of humans and animals include, for example, superficial fungal infections that affect the outer layers of skin; fungal infections of the mucous membranes including the mouth (thrush), vaginal and anal regions, such as those caused by Candida albicans, and fungal infections that affect the deeper layers of skin and internal organs are capable of causing serious, often fatal illness.
- Fungal infections are well known in the art and include, for example, zygomycosis, aspergillosis, cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis, paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis, penicilliosis or sporotrichosis.
- zygomycosis aspergillosis, cryptococcosis, candidiasis, histoplasmosis, coccidiomycosis, paracoccidiomycosis, fusariosis (hyalohyphomycoses), blastomycosis, penicilliosis or sporotrichosis.
- zygomycosis aspergillosis
- cryptococcosis candidiasis
- histoplasmosis histoplasmosis
- coccidiomycosis paracoccidio
- zygomycosis is intended to mean a fungal condition caused by fungi of the class Zygomycetes, comprised of the orders Mucorales and Entomophthorales.
- the Entomophthorales are causes of subcutaneous and mucocutaneous infections known as entomophthoromycosis, which largely afflict immunocompetent hosts in developing countries.
- Mucormycosis is intended to mean a fungal condition caused by fungi of the order Mucorales.
- Mucormycosis is a life-threatening fungal infection almost uniformly affecting immunocompromised hosts in either developing or industrialized countries.
- Fungi belonging to the order Mucorales are distributed into six families, all of which can cause cutaneous and deep infections.
- Species belonging to the family Mucoraceae are isolated more frequently from patients with mucormycosis than any other family.
- Rhizopus oryzae ⁇ Rhizopus arrhizus is a common cause of infection.
- Mucoraceae family that cause a similar spectrum of infections include, for example, Rhizopus microsporias var. rhizopodiformis, Absidia corymbifera, Apophysomyces elegans, Mucor species, Rhizomucor pusillus and Cunninghamella spp (Cunninghamellaceae family).
- Mucormycosis is well known in the art and includes, for example, rinocerebral mucormycosis, pulmonary mucormycosis, gastrointestinal mucormycosis, disseminated mucormycosis, bone mucormycosis, mediastinum mucormycosis, trachea mucormycosis, kidney mucormycosis, peritoneum mucormycosis, superior vena cava mucormycosis or external otitis mucormycosis.
- Candida fungi of the genus Candida.
- Candidiasis can occur in the skin and mucous membranes of the mouth, respiratory tract and/or vagina as well as invade the bloodstream, especially in immunocompromised individuals.
- Candidiasis also is known in the art as candidosis or moniliasis.
- Exemplary species of the genus Candida include, for example, Candida albicans, Candida krusei, Candida tropicalis, Candida glabrata and Candida par apsilosis.
- the term "aspergillosis” is intended to mean the group of diseases caused by the genus Aspergillus.
- the symptoms include, for example, fever, cough, chest pain and/or breathlessness.
- Patients with a weakened immune systems or who suffer from a lung condition are particularly susceptible to aspergillosis.
- Exemplary forms of this fungal condition includeallergic aspergillosis, which affects asthma, cystic fibrosis and sinusitis patients); acute invasive aspergillosis, which shows increased incidence in patients with weakened immunity such as in cancer patients, patients undergoing chemotherapy and AIDS patients; disseminated invasive aspergillosis, which is widespread throughout the body, and opportunistic Aspergillus infection, which is characterized by inflammation and lesions of the ear and other organs.
- Aspergillus is a genus of around 200 fungi.
- Aspergillus species causing • invasive disease include, for example, Aspergillus fumigatus and Aspergillus flavus.
- Aspergillus species causing allergic disease include, for example, Aspergillus fumigatus and Aspergillus clavatus.
- Other exemplary Aspergillus infectious species include, for example, Aspergillus terreus and Aspergillus nidulans.
- cryptococcosis is intended to mean a fungal condition caused by the genus Cryptococcus, Cryptococcosis, also known as Busse-Buschke disease, generally manifests as a systemic infection that can affect any organ of the body including, for example, the lungs, skin, or other body organs, but most often occurs in the central nervous system such as the brain and meninges.
- Cryptococcosis is an opportunistic infection for AIDS, although patients with Hodgkin's or other lymphomas or sarcoidosis or those receiving long-term corticosteroid therapy are also at increased risk. Symptoms include, for example, chest pain, dry cough, swelling of abdomen, headache, blurred vision and confusion.
- Exemplary forms of this fungal condition include cutaneous cryptococcosis such as those occurring in wounds, pulmonary cryptococcosis and Cryptococcal meningitis.
- Cryptococcal meningitis can result from dissemination of Cryptococcus neoformans from either an observed or unappreciated pulmonary infection generally in immunocompromised patients.
- C. gattii generally causes infections in immunocompetent people. Detection of cryptococcal antigen (capsular material) by culture of CSF, sputum and urine provides one useful method of diagnosis. Blood cultures also can be positive in heavy infections.
- histoplasmosis is intended to mean a fungal condition caused by the genus Histoplasma, including the infectious disease caused by the inhalation of spores of Histoplasma capsulatum. Histoplasmosis also is known in the art as Darling's disease. The condition can be asymptomatic, but also can progress to acute pneumonia or an influenza like illness, primarily affects the lungs. Histoplasmosis also can spread to other organs and systems in the body. As with other disseminated forms of fungal conditions, this disseminated histoplasmosis can be fatal. Symptoms can occur within 3 to 17 days after exposure.
- the acute respiratory disease can be characterized by respiratory symptoms, a general ill feeling, fever, chest pains, and a dry or nonproductive cough. Distinct patterns also can be seen on a chest x-ray. Chronic lung disease resembles tuberculosis and can worsen over months or years.
- Coccidiomycosis is intended to mean a fungal condition caused by the genus Coccidioides. Included in the meaning of the term is the infectious respiratory disease caused by Coccidioides immitis or C. posadasii, particularly through inhalation of spores, and which is characterized by fever and various respiratory symptoms. Coccidiomycosis also is known in the art as coccidioidomycosis and valley fever. Systemic coccidiomycosis can spread from the respiratory tract to, for example, the skin, bones, and central nervous system. Manifestations of the condition range from complete absence of symptoms to systemic infection and death.
- symptomatic infection can present as an influenza-like illness with fever, cough, headaches, rash, and myalgia (muscle pain).
- Some patients can fail to recover and develop chronic pulmonary infection or widespread disseminated infection (affecting meninges, soft tissues, joints, and bone). Severe pulmonary disease can develop in, for example, HIV-infected and other immunocompromised persons.
- paracoccidiomycosis is intended to mean a fungal condition caused by the genus Paracoccidioides including, for example, a chronic mycosis caused by Paracoccidioides brasiliensis.
- Paracoccidiomycosis is characterized by primary lesions of the lungs with dissemination to many internal organs, by conspicuous ulcerative granulomas of the mucous membranes of the cheeks and nose with extensions to the skin, and by generalized lymphangitis.
- Paracoccidiomycosis also is known in art as paracoccidioidomycosis, Almeida's disease, Lutz-Splendore-Almeida disease, paracoccidioidal granuloma and South American blastomycosis.
- fusarium or ""hyalohyphomycoses” is intended to mean a fungal condition caused by the genus fusarium. Fusarium species causing the condition include, for example, F. solani, F. oxysporum and F. moniliforme. Infections include keratitis, onychomycosis and occasionally peritonitis and cellulitis. Risk factors for disseminated fusariosis include severe immunosuppression (neutropenia, lymphopenia, graft-versus-host disease, corticosteroids), colonisation and tissue damage.
- tissue breakdown (as caused by trauma, severe burns or foreign body) is the risk factor for fusariosis.
- Clinical presentation includes refractory fever, skin lesions and sino- pulmonary infections. Skin lesions can lead to diagnosis in many patients and precede fungemia by approximately 5 days. Disseminated fusariosis can be diagnosed by, for example, blood cultures and other well known methods described above and below.
- blastomycosis is intended to mean a fungal condition caused by the genus blastomycete, generally originating as a respiratory infection, and usually spreading to the lungs, bones, and skin.
- Blastomycosis is characterized by multiple inflammatory lesions of the skin, mucous membranes, or internal organs.
- Blastomyces dermatitidis is one species prevalent causative species.
- Symptoms of blastomycosis include, for example, a flulike illness with fever, chills, myalgia, headache, and a nonproductive cough; an acute illness resembling bacterial pneumonia, with symptoms of high fever, chills, a productive cough, and pleuritic chest pain; a chronic illness that mimics tuberculosis or lung cancer, with symptoms of low-grade fever, a productive cough, night sweats, and weight loss; a fast, progressive, and severe disease that manifests as ARDS, with fever, shortness of breath, tachypnea, hypoxemia, and diffuse pulmonary infiltrates; skin lesions; bone lytic lesions; prostatitis, and/or laryngeal involvement causing hoarseness.
- penicilliosis is intended to mean a fungal condition caused by the genus penicillium.
- An exemplary species is penicillium marneffei, which is a prevalent cause of opportunistic fungal infections in immunocompromised individuals.
- Diagnosis is can be made by identification of the fungi from clinical specimens. Biopsies of skin lesions, lymph nodes, and bone marrow can demonstrate the presence of organisms on histopathology. Symptoms include, for example, fever, skin lesions, anemia, generalized lymphadenopathy, and hepatomegaly.
- sporotrichosis is intended to mean a fungal condition caused by the genus Sporothrix, including the species S. schenckii. The condition manifests as a chronic infectious characterized by nodules or ulcers in the lymph nodes and skin.
- Sporotrichosis infection can spread through the blood to other areas including, for example, infection of the joints, lungs, eye, and the genitourinary and central nervous system.
- disseminated sporotrichosis occurs in immunocompromised individuals such as patients with AIDS, cancer, patients undergoing chemotherapy, and transplant recipients on immunosuppressive therapy.
- an effective amount or “therapeutically effective amount” are intended to mean an amount of an iron chelating compound, an antifungal agent or both an iron chelating compound and an antifungal agent of the invention required to effect a decrease in the extent, amount or rate of spread of a fungal condition when administered to an individual. Therefore, an effective amount when used in reference to an iron chelating compound is intended to mean an amount of the iron chelating compound sufficient to ameliorate at least one symptom associated with a targeted fungal condition.
- an iron chelating compound, an antifungal agent or both an iron chelating compound and an antifungal agent of the invention required to be therapeutically effective will depend, for example, on the fungal condition to be treated, the affinity of the iron chelating compound for iron, the level of abundance and concentration of iron as well as the weight and condition of the individual, and previous or concurrent therapies.
- the appropriate amount considered to be an effective dose for a particular application of the method can be determined by those skilled in the art, using the guidance provided herein. For example, the amount can be extrapolated from in vitro or in vivo assays as described below.
- iron chelating compounds include, for example, a concentration range from about 0.3-3.0 ⁇ g/ml, but also can include concentrations as low as 0.01 ⁇ g/ml or lower and as high as 10 ⁇ g/ml or higher.
- concentration range from about 0.3-3.0 ⁇ g/ml, but also can include concentrations as low as 0.01 ⁇ g/ml or lower and as high as 10 ⁇ g/ml or higher.
- concentration of an antifungal agent to be administered are well known in the art and are included herein within the meaning of the term "effective amount.”
- an iron chelating compound will be included in an iron chelation therapy formulation, a first or second constituent formulation and/or a composition of the invention at a concentration from between about 0.01-10 ⁇ g/ml, about 0.1-8 ⁇ g/ml, , about 0.2-6 ⁇ g/ml, particularly between about 0.3-3.0 ⁇ g/ml, more particularly between about 0.6-2.0 ⁇ g/ml, , even more particularly between about 0.8-1.0 ⁇ g/ml or about 0.9 ⁇ g/ml.
- Iron chelating compound concentrations and/or amounts less than, greater than or in between these ranges also can be used in an iron chelation therapy formulation, a first or second constituent formulation and/or a composition of the invention.
- one or more iron chelating compounds can be included in a formulation or composition which constitute less than about 0.1 ⁇ g/ml .
- a formulation or composition can contain a concentration of one or more iron chelating compounds greater than about 10 ⁇ g/ml, particularly when formulated for storage.
- a formulation or composition useful in the methods of the invention can be produced that contains essentially any desired concentration or amount of one or more iron chelating compounds including, for example, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ⁇ g/ml or more.
- Exemplary effective amounts of antifungal agents include, for example, those exemplified below with respect to polyene antifungal agents.
- amphotericin B deoxycholate is in general administered at, for example, a dose of less than about 10 mg/kg of body weight and can include rates of about 0.25-1.0 mg/kg/day for intravenous administration.
- Liposomal amphotericin B (L-AMB) is in general administered at, for example, doses of 1-5 mg/kg.
- Liposomal amphotericin B can also be administered as high as 15 mg/kg/day especially in cerebral disease.
- Amphotericin B lipid complex is in general administered at a dose of 5 mg/kg, but can range from about 0.5-15 mg/kg.
- Amphotec is in general administered at single doses of about 50-100 mg. Similarly, for combination therapy using an iron chelating compound and an antifungal agent, the above amounts can be administered together or either or both the compound and/or the agent amount can be modulated up or down. Effective amounts for azole antifungal agents and echinocandin antifungal agents similarly are well known to those skilled in the art, and generally include dosages within the ranges above.
- the effective amounts exemplified above can be modulated with respect to, for example, the type and amount of the other active ingredient.
- dosages of the at least one iron chelating compound are in the high range exemplified above, if desired, one can decrease the amount of one or more of the at least antifungal agent while still obtaining an effective amount.
- dosages of the at least one antifungal agent are in the high range or higher than those exemplified above, if desired, one can decrease the amount of one or more of the at least one or more of the at least iron chelating compounds.
- Dosages of two or more iron chelating compounds and/or dosages of two or more of the at least one antifungal agents also can be modulated with respect to each other. All other modulations of such combined effective amounts can be utilized in the method of the invention.
- Rhizopus pathogenicity Abse et al., Mycopathologia 110:87-91 (1990); Boelaert et al., (1993), supra; Boelaert et al., (1994), supra; Van Cutsem and Boelaert, Kidney International 36:1061-68 (1989)). Additionally, in vitro studies of radiolabeled iron uptake from deferoxamine in serum showed that Rhizopus accumulated 8-fold and 40-fold greater amounts of iron than did Aspergillus fiimigatus and C.
- Rhizopus This increased iron uptake by Rhizopus was linearly correlated with its growth in serum (Boelaert et al., (1993), supra).
- the increased growth in serum may explain the special affinity of Zygomycetes to directly penetrate and grow through blood vessels, which results in the propensity for thrombosis and tissue necrosis during the disease (Edwards, (1989), supra; Web et al., (2003), supra; Ventura et al., supra).
- LAmB Liposomal amphotericin B
- Def deferiprone
- This Example shows a comparison of the efficacy of deferiprone to liposomal amphotericin B (LAmB) in treating mucormycosis in diabetic ketoacidotic (DKA) mice or prophylaxing against mucormycosis in neutropenic mice.
- LAmB liposomal amphotericin B
- R. oryzae is a common cause of mucormycosis (Ibrahim et al., (2003), supra). Patients with elevated available serum iron, such as diabetics in ketoacidosis, are at high risk of developing mucormycosis infections (Artis et al., supra). Additionally, deferoxamine iron-chelation therapy predisposes patients to these infections. Deferoxamine acts as a xeno-siderophore to supply previously unavailable iron to the fungus (Boelaert et al., (1993) supra). Therefore, the use of an iron-chelator that cannot be utilized by the fungus to scavenge iron from the host was assessed for efficacy against mucormycosis. Def is an iron chelator which cannot be utilized by Rhizopus to scavenge iron (Boelaert et al,, (1994) supra).
- R. oryzae 99-880 was isolated from a brain abscess of a diabetic patient. The organism was grown on potato dextrose agar (PDA) for 3 days at 37 0 C. In some experiments, R. oryzae was starved for iron by growth on PDA in the presence of 1 mM of ascorbic acid and ferrozine. The sporangiospores were collected in endotoxin free PBS containing 0.01% Tween 80, washed with PBS then counted with hemacytometer to prepare the final inocula.
- PDA potato dextrose agar
- MIC minimum inhibitory concentration
- MFC minimum fungicidal concentration
- Table 2 MIC90 and MFC of DEF and deferoxamine against R. oryzae. Values are expressed in mg/ml.
- mice were rendered diabetic with a single i.p. injection of 210 mg/kg streptozotocin in 0.2 ml citrate buffer 10 days prior to fungal challenge. Glycosuria and ketonuria were confirmed in all mice 7 days after streptozotocin treatment. Mice were infected through the tail vein with the appropriate inocula of R. oryzae.
- brain fungal burden (the primary target organ) was determined by homogenization by rolling a pipette on organs placed in Whirl-Pak bags (Nasco, Fort Atkinson, WI) containing 2 ml saline. The homogenate was serially diluted in 0.85% saline and then quantitatively cultured on PDA. Values were expressed as loglO cfu g "1 tissue.
- mice All procedures involving mice were approved by the institutional animal use and care committee, following the National Institutes of Health guidelines for animal housing and care.
- LAmB diluted in 5% dextrose water was obtained from Gi lead Sciences and was administered at 15 mg/kg qd (once a day) intravenously through the tail vein.
- Deferiprone (Apotex Research Inc.) was dissolved in iron-free water and administered intraperitoneally at 50, 100, or 200 mg/kg qd or qod (every other day). Treatment was begun 24 h post infection and continued for a total of 4 doses. Control groups were treated with the diluent, 5% dextrose water.
- a saturating dose of free iron was administered with deferiprone, in an attempt to reverse the efficacy of iron-chelation.
- Deferiprone is known to form molecular complexes with ferric iron ( 3+ Fe) in a 1:3 ratio of iron to deferiprone.
- FeCb ferric chloride
- deferiprone molecular weight 139 g/mol
- mice Statistical analysis was performed using the nonparametric log rank test was used to determine differences in survival times of the mice. Differences in tissue fungal burdens in the infected organs were compared by the nonparametric Steel test for multiple comparisons. P values of ⁇ 0.05 were considered significant.
- the results are shown in Figure 4 and indicate enhanced efficacy using a combination of both treatments. (*, p ⁇ .005 compared to infected untreated mice).
- Def has considerable efficacy in treating mucormycosis in the DKA model and this efficacy is comparable to high dose therapy of LAmB.
- the efficacy of Def is likely due to its ability to chelate iron since administration of free iron reversed its protection. Def prophylaxis did not appear to antagonize the protective effect of LAmB in the neutropenic mouse model of mucormycosis.
- This Example shows the use of Deferasirox, an iron-chelating agent, as a salvage therapy for rhinocerebral mucormycosis.
- Deferasirox (Exjade®) is a novel, first-in-class, orally available iron chelator, recently approved by the United States (US) Food and Drug Administration (FDA) for the treatment of iron overload in transfusion-dependent anemias. This study describes the use of deferasirox as salvage therapy for a patient with rhinocerebral mucormycosis failing maximum conventional antifungal therapy.
- Computed tomography (CT) scan of the head showed only left sphenoid and ethmoid sinusitis.
- the patient progressed to complete left ophthalmoplegia in the first 24 hours.
- ABLC amphotericin B lipid complex
- On hospital day 2 he underwent endoscopic sphenooethmoid exploration. No necrotic tissue or eschar was found, and multiple biopsies showed nonspecific inflammation.
- Fungal culture was negative and special stains revealed no organisms. Bacterial
- deferasirox was administered at a dose of 1000 mg po (by mouth) daily for seven days.
- LAmB was continued.
- the patient developed an erythematous, slightly pruritic, confluent maculopapular eruption over the trunk and extremities consistent with a probable drug rash.
- the pruritis was managed with diphenhydramine. No other adverse events were noted.
- Repeat MRI of the brain one week after deferas ⁇ rox treatment demonstrated resolution of the edema in the left cerebellar peduncle.
- follow up imaging five weeks later showed no new lesions.
- Ten months after his initial diagnosis the patient remained asymptomatic and neurologically intact.
- This Example shows the effects of deferasirox on expression of the high affinity iron permease gene (rFTRl) in Rhizopus oryzae.
- This example also shows the deferasirox susceptibilities of multiple clinical isolates of Mucorales. The following describes materials and methods used in the procedures described in this or the subsequent examples.
- R. oryzae 99-880 is a clinical isolate from a brain abscess of a diabetic patient.
- R. oryzae 99- 892 is a clinical, pulmonary isolate.
- R. oryzae Ml 6 is apyrF null mutant (pyrF encodes orotidine 5'-phosphate decarboxylase, an enzyme required for uracil synthesis) generated from R. oryzae 99-880 by chemical mutagenesis. This mutant exhibited a stable phenotype for uracil auxotrophy even when plating more than 1x10 9 spores.
- Organisms were grown on potato dextrose agar (PDA) [formulation/liter; potato starch 4g, dextrose 2Og, agar 15g] for 4 days at 37 0 C.
- PDA potato dextrose agar
- Ml 6 PDA was supplemented with 100 ⁇ g/ml uracil.
- oryzae was starved for iron by growth on yeast nitrogen base (YNB) (Difco/Becton Dickinson, Sparks, MD) supplemented with complete supplemental media without uracil (CSM-URA), (YNB+CSM-URA) [formulation/lOOml, 1.7g YNB without amino acids, 2Og glucose, 0.77g CSM-URA] in the presence of 1 mM of ascorbic acid and ferrozine.
- YNB yeast nitrogen base
- CSM-URA supplemental media without uracil
- YNB+CSM-URA [formulation/lOOml, 1.7g YNB without amino acids, 2Og glucose, 0.77g CSM-URA] in the presence of 1 mM of ascorbic acid and ferrozine.
- the sporangiospores were collected in endotoxin free PBS containing 0.01%
- Tween 80 washed with PBS, and counted with a hemacytometer to prepare the final inocula.
- R. oryzae 99-880 plugs taken from a confluent PDA plate were grown in potato dextrose broth overnight at 37oC with shaking. Mycelia were collected aseptically and transferred to fresh PDB flasks containing 350 ⁇ M ferric chloride (to suppress the expression of rFTRl),
- PCR primers are as follows: sense primer 5'- TCAGAGAAGGACTTGAAGC -3' and anti-sense primer 5'- TAAGTAGCCGTATTGTTCC -3' for rFTRl to amplify of R oryzae; and sense primer 5'- CATGGTTGAGATTGTAAGATAG -3' and anti-sense primer 5'- AGTCAATGGACGTGGAGTC -3' for 18s rDNA gene.
- the PCR products were separated on a 2% agarose gel containing 0.1 ⁇ g/ml ethidium bromide. Both primer sets were designed to amplify a 400 bp bands.
- a 1.5 kb fragment upstream of the rFTRl ORF was PCR amplified using the following primer pair: sense primer 5'-GCTCTAGATCAGTCTCAACACCATCAATT-3 • ; and anti- sense primer 5 I -TGCGGCCGTGCTTTTTAGTTCTCCTTGGA-3 I .
- a 2.1 kb fragment containing the constitutively expressed actin promoter was also PCR amplified to use as a control using the following ' primer pair: sense 5'GCTCTAGATGGTATTATCGATTTAGA- 3'; and anti-sense:5' TACGGCCGC ATACCGGAACCGTTATCG-3.
- Transformants were selected on YNB+CSM-URA plates grown at 37 0 C for 5-7 days following bombardment. Isolates were then tested for uracil auxotrophy by passaging transformants on plates containing minimal medium without uracil and incubating the plates at 37 0 C. Purified transformants selected on uracil negative plates were analyzed by Southern blotting.
- rFTRlp and ACTIp were studied in transformants grown in iron-replete medium (i.e. YNB+CSM-URA) or iron-depleted conditions (i.e. YNB+CSM-URA supplemented with 2mM deferasirox). Additionally, to reverse the effect of deferasirox transformants were grown in YNB+CSM-URA supplemented with 2mM deferasirox and supersaturating 6 mM ferric chloride. Finally, Ml 6 transformed with empty plasmid (pyr225b-pyrF without GFP) was used as a negative control.
- Spores (Ix 10 4 /ml) were inoculated in the above mentioned media and incubated overnight at 37 0 C. A drop of the culture was mounted on a slide and GFP expression was visualized in R. oryzae with a Leica DMRXE confocal microscope using an excitation wavelength of 488 nm. Additionally, a 1 ml sample from each culture was also used to quantify the fluorescence emission using a FACSCaliberTM (Becton Dickinson®) instrument equipped with an argon laser emitting at 488 nm. Spores were gated by forward and side scatter and fluorescence measured in FLl.
- FACSCaliberTM Becton Dickinson®
- MIC Minimum inhibitory concentration
- MFC minimum fungicidal concentration
- Deferasirox Novartis Pharmaceuticals, Basel, Switzerland
- Deferasirox Novartis Pharmaceuticals, Basel, Switzerland
- Deferasirox was suspended in 0.5% hydroxypropylcellulose (Klucel) and administered by oral gavage at 1 , 3, or 10 mg/kg twice (qd) or every other day (qod).
- Treatment was begun 24 h post infection and continued for a total of 5 or 7 doses.
- Control groups were treated with the diluent, 5% dextrose water and 0.5% Klucel.
- a saturating dose of free iron was administered with deferasirox.
- Deferasirox is known to form molecular complexes with ferric iron ( 3+ Fe) in a 1:2 ratio of iron to deferasirox.
- LAmB diluted in 5% dextrose water was obtained from Gilead Sciences® (Foster city, CA) and was administered at a dose of 15 mg/kg daily (qd) via the tail vein for 4 days.
- rFTRl oryzae expression of rFTRl.
- R. oryzae 99-880 spores were incubated overnight in PDB. The next day mycelia were transferred into PDB supplemented with 350 ⁇ M ferric chloride (iron replete), 350 ⁇ M ferric chloride plus 2 mM deferasirox (iron depleted), or 2 mM deferasirox plus supersaturating 6 mM ferric chloride.
- RNA was extracted from spores grown in each condition for 1 h at 37 0 C, and RT-PCR was performed to evaluate gene expression.
- the rFTRl gene was expressed in the presence of deferasirox, but not in media supplemented with ferric chloride or in the presence of deferasirox plus supersaturating ferric chloride (Figure 8a).
- ACTlp::GFP constitutive positive control
- ACTlp::GFP were incubated overnight with deferasirox, deferasirox plus supersaturating ferric chloride, or iron-rich media (iron replete).
- Figure 8c shows that in contrast to GFP under the control of the ACTl promoter, which was constitutively expressed regardless of growth conditions, GFP under the control of the rFTRl promoter was expressed or was active only in the presence of iron chelation conditions (deferasirox).
- M16 transformed with the constitutive ACTlp::GFP construct was fluorescent regardless of growth conditions.
- This Example shows the in vivo efficacy of deferasirox in treating mice infected with Mucorales.
- mice For in vivo infection, BALB/c male mice (>20g) were rendered diabetic with a single i.p. injection of 210 mg/kg streptozotocin in 0.2 ml citrate buffer 10 days prior to fungal challenge. Glycosuria and ketonuria were confirmed in all mice 7 days after streptozotocin treatment.
- mice For neutropenic mouse model, mice were injected with a single i.p. dose of 200 mg/kg cycolphosphamide (Bristol Myer Squibb) 2 days prior to infection with R. oryzae. This treatment regimen resulted in pancytopenia from days -2 to day 5 relative to infection, with recovery of cell counts began on day 6 post infection.
- mice were infected through the tail vein with the appropriate inocula of R oryzae. To confirm the inocula, dilutions were streaked on PDA plates containing 0.1% triton and colonies were counted following a 24 h incubation period at 37 0 C. The primary efficacy endpoint was time to death. As a secondary endpoint, brain fungal burden (the primary target organ) was determined by homogenization by rolling a pipette on organs placed in Whirl-PakTM bags (Nasco®, Fort Atkinson, WI) containing 1 ml saline. The homogenate was serially diluted in 0.85% saline and then quantitatively cultured on PDA.
- the primary target organ was determined by homogenization by rolling a pipette on organs placed in Whirl-PakTM bags (Nasco®, Fort Atkinson, WI) containing 1 ml saline. The homogenate was serially diluted in 0.85% saline and then
- mice were collected from mice and fixed in 10% zinc formalin. Fixed tissues were embedded in paraffin, and 5 mm sections were stained with haematoxylin and eosin for light microscopy examination. All procedures involving mice were approved by the institutional animal use and care committee, following the National Institutes of Health guidelines for animal housing and care.
- Diabetic ketoacidotic mice were infected via the tail-vein with 2.2 x 10 spores of R. oryzae 99-892.
- the mice were treated by oral gavage with 1, 3, or 10 mg/kg deferasirox in 0.5% hydroxypropylcellulose (Klucel) twice daily (bid) for seven days starting the day after infection.
- Negative control mice were treated with hydroxypropylcellulose carrier (placebo) or deferasirox plus saturating ferric chloride (administered subcutaneously).
- An additional negative control consisted of uninfected mice treated with ferric chloride.
- Deferasirox at 1, 3, or 10 mg/kg bid significantly improved survival compared to controls ( Figure 9a).
- mice were infected via the tail-vein with 4.2 x 10 4 spores of R. oryzae 99-892. Mice were treated with deferasirox (10 mg/kg bid), deferasirox plus saturating ferric chloride, or placebo. Treatment was begun 16 h after infection and administered daily for 3 days. Kidneys and brains were removed on day four, homogenized, and quantitatively cultured. Deferasirox resulted in a greater than 10-fold decrease in both brain and kidney (primary target organs) fungal burden compared to mice treated with placebo or deferasirox plus saturating ferric chloride (Figure 10a).
- kidneys of deferasirox-treated mice had no visible hyphae (as pointed to by arrows in Figure 10b), whereas kidneys of mice treated with placebo or deferasirox plus saturating ferric chloride had extensively filamented fungi. Furthermore, mice treated with saturating iron had a striking absence of neutrophil influx to the sites of infection, while neutrophil influx was prominent in the kidneys of mice treated with deferasirox ( Figure 10b).
- this example demonstrates that the protective effect of deferasirox can be reversed by administration of free iron, which confirms that the drug's mechanism of protection is via iron chelation.
- This Example shows a comparison between the effects of deferasirox and deferasirox plus ferric chloride on host immune response.
- Splenic lymphocyte frequencies were determined as we have previously described (Spellberg et al., Infect. Imtnun. 71:5756-5764 (2003)). In brief, splenic homogenates were passed through 70 ⁇ m filters followed by RBC lysis with 0.15 M ammonium chloride.
- the cells were fixed with CytofixTM buffer (BD Pharmingen®), permeabilized with CytopermTM buffer (BD Pharmingen), and stained with 10 ⁇ g/ml of FITC- conjugated anti-mouse CD4 (clone RM4-5), PE-conjugated anti-mouse IFN- ⁇ (clone XMGl.2) or isotype control (clone R-34), allophycocyanin (APC)-conjugated anti-mouse IL-4 (clone 1 IBl 1) or isotype control (clone R3-34), or APC-conjugated anti-mouse IL-IO (clone JES5-16E3) or isotype control (clone A95-1) (all from BD Pharmingen).
- the frequency of CD4+CD25+foxp3+ T-regulatory cells were determined using the Mouse Regulatory T cell StainingTM Kit (eBioscience®) per the manufacturer's recommendation.
- the frequency of apoptosis was determined using the Annexin FITC ApoptosisTM kit (BD Pharmingen®).
- CD4+ lymphocytes were gated by concatenation of forward and side scatter, and FITC-anti- CD4 antibody fluorescence properties. Data for each sample were acquired until 10,000 CD4+ lymphocytes were analyzed.
- Spleens and kidneys were homogenized in 1 ml of PBS.
- the homogenates were pelleted at maximum speed on a tabletop centrifuge at 4°C.
- the supernatants were assayed for cytokines using the Cytometric Bead Array Murine Inflammatory CytokineTM kit (BD Pharmingen) per the manufacturer's instructions.
- Diabetic ketoacidotic mice were infected with 3.1 x 10 4 spores of R oryzae 99-892 as above and treated with deferasirox, deferasirox plus ferric chloride, or placebo. On day four of infection, spleens and kidneys were processed for intracellular and whole organ cytokine determination.
- mice had significantly higher splenic levels of the canonical proinflammatory cytokines, TNF and IFN- ⁇ , than mice treated with saturating iron or placebo ( Figure 11 b). Mice treated with deferasirox also had significantly higher kidney levels of IFN- ⁇ ( Figure 1 Ib).
- This Example shows the effects of combination therapy using the iron chelator, Deferasirox (Exjade ® ), and Liposomal Amphotericin B (LAmB) for the treatment of mucormycosis.
- Figure 12 shows the efficacy for the monotherapies Deferasirox alone and LAmB alone as well as for the combination therapy Deferasirox and LAmB together in treating mucormycosis.
- the results indicate that both monotherapies improved survival compared to placebo (25% and 28% survival for Deferasirox and LAmB, respectively, and 0% for placebo, P ⁇ 0.003).
- Combination therapy markedly improved both time to survival and overall survival of infected DKA mice (n > 16 per group) compared to all other groups (70% survival for combination therapy, PO.008 by Log Rank test for all comparisons).
- This Example shows the efficacy of deferasirox in treating neutropenic mice infected with R. oryzae.
- mice were myeloablated with cyclophosphamide. Two days later, mice were infected via the tail-vein with 2.7 x 10 3 spores of R. oryzae 99-892.
- Initial dose response studies suggested that, in contrast to the diabetic ketoacidotic model, optimal outcomes were achieved with dosing of deferasirox every other day rather than every day (data not shown), as we have previously described with the iron chelator, deferiprone.
- Treatment with deferasirox (10 mg/kg twice qod for five doses starting 24 h post infection) significantly improved time to death compared to placebo ( Figure 14). In contrast, deferasirox dosed twice daily did not significantly improve time to death versus placebo.
- This Example shows the results of toxicity evaluation in neutropenic mice treated with daily dose of deferasirox.
- Toxicity of deferasirox in neutropenic mice was evaluated. Mice were rendered neutropenic as above and treated with deferasirox at 10 mg/kg twice every day or every other day for 7 days. Mice from three different groups (i.e. placebo, deferasirox daily treatment, and deferasirox every other day treatment) were sacrificed on day 3 or 8 and blood was collected and sent for Charles River Laboratories for evaluation. Additionally, bone marrow smears were prepared from femurs, and tissues were collected, preserved in zinc-buffered formalin, embedded in paraffin, sectioned at 5 ⁇ m, and stained with hematoxylin and eosin. The resulting slides were examined by a board-certified veterinary pathologist at Charles River Laboratories.
- mice were made neutropenic with cyclophosphamide as above, but were not infected. The mice were treated with deferasirox 10 mg/kg twice daily for seven days, 10 mg/kg twice every other day for 4 doses, or placebo. Terminal bleeds were performed on day 3 or day 8 to measure complete blood count, serum chemistries, and liver function tests.
- Histopathology was performed on an extensive list of organs, including brain, heart, lungs, liver, gallbladder, spleen, kidneys, gastrointestinal tract (including stomach, small intestine, and large intestine), and bone marrow (both smears and core). No differences in white cell counts, absolute neutrophil counts, platelet counts, hemoglobin levels, serum chemistries (including creatinine, blood urea nitrogen, or electrolytes), or liver function tests (including AST, ALT, or bilirubin) were identified between the three groups at either time point.
- histopathology no organ-specific toxicity attributable to deferasirox was identified, including no evidence of alterations in hematopoeisis. Specifically, there was no evidence of exacerbation of or delayed recovery from bone marrow ablation by chemotherapy, nor was there any evidence of renal or hepatic dysfunction by laboratory testing, nor any specific organ toxicity by histopathological evaluation.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2009519562A JP2009543788A (ja) | 2006-07-13 | 2007-07-13 | ムコール症および他の真菌性疾患を処置するための組成物および方法 |
| MX2009000506A MX2009000506A (es) | 2006-07-13 | 2007-07-13 | Composiciones y metodos para el tratamiento de la mucormicosis y otras enfermedades micoticas. |
| US12/373,511 US20100129434A1 (en) | 2006-07-13 | 2007-07-13 | Compositions and methods for the treatment of mucormycosis and other fungal diseases |
| BRPI0714221-8A BRPI0714221A2 (pt) | 2006-07-13 | 2007-07-13 | composições e métodos para o tratamento de mucormicose e outras doenças fúngicas |
| EP07796874A EP2043636A2 (en) | 2006-07-13 | 2007-07-13 | (combi) compositions for the treatment of mucormycosis comprising iron chelator and antifungal agent |
| NZ574862A NZ574862A (en) | 2006-07-13 | 2007-07-13 | Compositions and methods for the treatment of mucormycosis comprising iron chelator and antifungal agent |
| CA002657634A CA2657634A1 (en) | 2006-07-13 | 2007-07-13 | Compositions and methods for the treatment of mucormycosis and other fungal diseases |
| AU2007272781A AU2007272781B2 (en) | 2006-07-13 | 2007-07-13 | Combi) compositions for the treatment of mucormycosis. comprising iron chelator and antifungal agent |
| IL196389A IL196389A0 (en) | 2006-07-13 | 2009-01-08 | Compositions containing an antifungal compound and an iron chelating compound and uses thereof |
| TN2009000004A TN2009000004A1 (en) | 2006-07-13 | 2009-01-12 | Compositions and methods for the treatment of mucormycosis and other fungal diseases |
| NO20090565A NO20090565L (no) | 2006-07-13 | 2009-02-05 | Sammensetninger og fremgangsmater for behandling av mucormycose og andre soppsykdommer |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US83109906P | 2006-07-13 | 2006-07-13 | |
| US60/831,099 | 2006-07-13 | ||
| US89762007P | 2007-01-26 | 2007-01-26 | |
| US60/897,620 | 2007-01-26 | ||
| US90407507P | 2007-02-27 | 2007-02-27 | |
| US60/904,075 | 2007-02-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008008537A2 true WO2008008537A2 (en) | 2008-01-17 |
| WO2008008537A3 WO2008008537A3 (en) | 2008-04-24 |
Family
ID=38610625
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/016065 Ceased WO2008008537A2 (en) | 2006-07-13 | 2007-07-13 | Combi) compositions for the treatment of mucormycosis. comprising iron chelator and antifungal agent |
Country Status (18)
| Country | Link |
|---|---|
| US (1) | US20100129434A1 (https=) |
| EP (2) | EP2412371A1 (https=) |
| JP (2) | JP2009543788A (https=) |
| KR (1) | KR20090036587A (https=) |
| AU (1) | AU2007272781B2 (https=) |
| BR (1) | BRPI0714221A2 (https=) |
| CA (1) | CA2657634A1 (https=) |
| CL (1) | CL2007002026A1 (https=) |
| IL (1) | IL196389A0 (https=) |
| MA (1) | MA30625B1 (https=) |
| MX (1) | MX2009000506A (https=) |
| NO (1) | NO20090565L (https=) |
| NZ (1) | NZ574862A (https=) |
| RU (1) | RU2464024C2 (https=) |
| SG (1) | SG177122A1 (https=) |
| TN (1) | TN2009000004A1 (https=) |
| TW (1) | TWI448285B (https=) |
| WO (1) | WO2008008537A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012520878A (ja) * | 2009-03-19 | 2012-09-10 | ロサンゼルス ビオメドイカル リサーチ インストイトウテ アト ハルボル‐ユーシーエルエー メドイカル センテル | ムコール菌症、及びその他の真菌疾患の治療のためのワクチン組成物、及び方法 |
| US8980876B2 (en) | 2010-10-28 | 2015-03-17 | The Procter & Gamble Company | Inhibition of microbial growth by aconitase inhibition |
| US11229685B2 (en) | 2013-01-29 | 2022-01-25 | Case Western Reserve University | Fungal iron acquisition inhibitors and uses thereof |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2015003729A (es) * | 2012-11-12 | 2015-06-15 | Cipla Ltd | Composiciones farmaceuticas de dosis fija que comprende deferasirox y deferiprona. |
| WO2015026852A1 (en) * | 2013-08-19 | 2015-02-26 | Rutgers, The State University Of New Jersey | Method of inducing an anti-retroviral immune response by counter-acting retro-virus induced anti-apoptosis |
| US20170239182A1 (en) * | 2014-08-13 | 2017-08-24 | Mark E. Hayes | Pharmaceutical formulations of and methods to prepare chelating agents for efficient metal removal treatment systems |
| WO2016025611A2 (en) * | 2014-08-13 | 2016-02-18 | Zoneone Pharma, Inc. | Pharmaceutical formulations of chelating agents as a metal removal treatment system |
| EP3344246A4 (en) * | 2015-08-31 | 2019-04-10 | The University of Adelaide | METHOD AND PRODUCTS FOR THE PREVENTION AND / OR TREATMENT OF MICROORGANISM INFECTIONS WITH IRON-CHELATORS AND IRON-FREE PORPHYRINE |
| US10960002B2 (en) | 2016-05-13 | 2021-03-30 | The Brigham And Women's Hospital, Inc. | Volatile metabolite profiles for the diagnosis and treatment of Mucorales fungi |
| FR3095755A1 (fr) * | 2019-05-10 | 2020-11-13 | Balmes Transplantation | Nouveaux médicaments cytoprotecteurs |
| CN113905715B (zh) | 2019-06-28 | 2025-04-15 | 宝洁公司 | 光增强处理方法 |
| JP2023057423A (ja) * | 2021-10-11 | 2023-04-21 | 国立大学法人 熊本大学 | ムコール症治療薬 |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8329043D0 (en) * | 1983-10-31 | 1983-11-30 | Hider R C | Pharmaceutical compositions |
| US4698431A (en) * | 1985-11-12 | 1987-10-06 | The United States Of America As Represented By The United States Department Of Energy | Hydroxypyridonate chelating agents |
| PH31594A (en) * | 1993-09-30 | 1998-11-03 | Janssen Pharmaceutica Nv | Oral formulations on an antifungal. |
| MY129541A (en) | 1996-06-25 | 2007-04-30 | Novartis Ag | Substituded 3,5-diphenyl-1,2,4-triazoles and their use as pharmaceutical metal chelators |
| WO1999009997A1 (en) * | 1997-08-26 | 1999-03-04 | Board Of Regents, The University Of Texas System | Edta and other chelators with or without antifungal antimicrobial agents for the prevention and treatment of fungal infections |
| EP1223308B1 (de) * | 2000-12-16 | 2007-01-24 | ALSTOM Technology Ltd | Komponente einer Strömungsmaschine |
| GB0223978D0 (en) | 2002-10-15 | 2002-11-20 | Novartis Ag | Organic compound |
| ITMI20022447A1 (it) * | 2002-11-19 | 2004-05-20 | Carlo Ghisalberti | Uso di piridinoni nel trattamento della purpura capillare ed affezioni cutanee correlate. |
| JP2006513235A (ja) * | 2002-12-31 | 2006-04-20 | ネクター セラピューティクス | 真菌感染症療法のためのエアゾール化可能な医薬製剤 |
| WO2004108114A2 (en) * | 2003-03-31 | 2004-12-16 | Dinesh Shantilal Patel | Anti-fungal composition and a process for its manufacture |
| DE10356409B4 (de) * | 2003-11-28 | 2006-12-28 | Biofrontera Discovery Gmbh | Neues Arzneimittel Oxachelin und Derivate |
-
2007
- 2007-07-12 TW TW096125466A patent/TWI448285B/zh not_active IP Right Cessation
- 2007-07-12 CL CL200702026A patent/CL2007002026A1/es unknown
- 2007-07-13 NZ NZ574862A patent/NZ574862A/en not_active IP Right Cessation
- 2007-07-13 WO PCT/US2007/016065 patent/WO2008008537A2/en not_active Ceased
- 2007-07-13 RU RU2009104961/15A patent/RU2464024C2/ru not_active IP Right Cessation
- 2007-07-13 SG SG2011075421A patent/SG177122A1/en unknown
- 2007-07-13 EP EP11003922A patent/EP2412371A1/en not_active Withdrawn
- 2007-07-13 JP JP2009519562A patent/JP2009543788A/ja active Pending
- 2007-07-13 US US12/373,511 patent/US20100129434A1/en not_active Abandoned
- 2007-07-13 BR BRPI0714221-8A patent/BRPI0714221A2/pt not_active IP Right Cessation
- 2007-07-13 EP EP07796874A patent/EP2043636A2/en not_active Withdrawn
- 2007-07-13 CA CA002657634A patent/CA2657634A1/en not_active Abandoned
- 2007-07-13 MX MX2009000506A patent/MX2009000506A/es not_active Application Discontinuation
- 2007-07-13 KR KR1020097002793A patent/KR20090036587A/ko not_active Ceased
- 2007-07-13 AU AU2007272781A patent/AU2007272781B2/en not_active Ceased
-
2009
- 2009-01-08 IL IL196389A patent/IL196389A0/en unknown
- 2009-01-12 TN TN2009000004A patent/TN2009000004A1/fr unknown
- 2009-02-04 MA MA31613A patent/MA30625B1/fr unknown
- 2009-02-05 NO NO20090565A patent/NO20090565L/no not_active Application Discontinuation
-
2012
- 2012-11-27 JP JP2012258262A patent/JP2013040212A/ja active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012520878A (ja) * | 2009-03-19 | 2012-09-10 | ロサンゼルス ビオメドイカル リサーチ インストイトウテ アト ハルボル‐ユーシーエルエー メドイカル センテル | ムコール菌症、及びその他の真菌疾患の治療のためのワクチン組成物、及び方法 |
| EP2408804A4 (en) * | 2009-03-19 | 2012-10-03 | Los Angeles Biomed Res Inst | VACCINE COMPOSITIONS AND METHODS FOR THE TREATMENT OF MUCORMYCOSIS AND OTHER FUNGAL DISEASES |
| US8980876B2 (en) | 2010-10-28 | 2015-03-17 | The Procter & Gamble Company | Inhibition of microbial growth by aconitase inhibition |
| US11229685B2 (en) | 2013-01-29 | 2022-01-25 | Case Western Reserve University | Fungal iron acquisition inhibitors and uses thereof |
| US11779634B2 (en) | 2013-01-29 | 2023-10-10 | Case Western Reserve University | Fungal iron acquisition inhibitors and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20100129434A1 (en) | 2010-05-27 |
| NZ574862A (en) | 2012-02-24 |
| MX2009000506A (es) | 2009-05-20 |
| JP2009543788A (ja) | 2009-12-10 |
| TW200816994A (en) | 2008-04-16 |
| AU2007272781A1 (en) | 2008-01-17 |
| WO2008008537A3 (en) | 2008-04-24 |
| JP2013040212A (ja) | 2013-02-28 |
| RU2464024C2 (ru) | 2012-10-20 |
| EP2412371A1 (en) | 2012-02-01 |
| BRPI0714221A2 (pt) | 2013-01-01 |
| IL196389A0 (en) | 2009-09-22 |
| TN2009000004A1 (en) | 2010-08-19 |
| TWI448285B (zh) | 2014-08-11 |
| EP2043636A2 (en) | 2009-04-08 |
| MA30625B1 (fr) | 2009-08-03 |
| CL2007002026A1 (es) | 2008-06-06 |
| AU2007272781B2 (en) | 2012-10-18 |
| RU2009104961A (ru) | 2010-08-20 |
| KR20090036587A (ko) | 2009-04-14 |
| NO20090565L (no) | 2009-03-30 |
| CA2657634A1 (en) | 2008-01-17 |
| SG177122A1 (en) | 2012-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007272781B2 (en) | Combi) compositions for the treatment of mucormycosis. comprising iron chelator and antifungal agent | |
| Hoenigl et al. | The antifungal pipeline: fosmanogepix, ibrexafungerp, olorofim, opelconazole, and rezafungin | |
| Moen et al. | Liposomal amphotericin B: a review of its use as empirical therapy in febrile neutropenia and in the treatment of invasive fungal infections | |
| Deresinski et al. | Caspofungin | |
| Lai et al. | Synergy and antagonism between iron chelators and antifungal drugs in Cryptococcus | |
| Canuto et al. | Antifungal drug resistance to azoles and polyenes | |
| Leenders et al. | Liposomal amphotericin B (AmBisome) reduces dissemination of infection ad compared with amphotericin B deoxycholate (Fungizone) in a rat model of pulmonary aspergillosis | |
| Almajid et al. | Fosmanogepix: the novel anti-fungal agent’s comprehensive review of in vitro, in vivo, and current insights from advancing clinical trials | |
| Sanati et al. | Combination therapy with amphotericin B and fluconazole against invasive candidiasis in neutropenic-mouse and infective-endocarditis rabbit models | |
| CN110290797A (zh) | 用于预防和治疗真菌感染的单剂量方法 | |
| De Pauw et al. | Progress in fighting systemic fungal infections in haematological neoplasia | |
| Estes et al. | Pharmacology and antifungal properties of anidulafungin, a new echinocandin | |
| US9901615B2 (en) | Method for treatment of gastric ulcers | |
| CN101301289A (zh) | 小檗碱及其结构类似物在逆转多药耐药泵中的应用 | |
| Carrillo-Muñoz et al. | Current developments in anti-fungal agents | |
| Saoulidis et al. | Antifungal activity of posaconazole and granulocyte colony‐stimulating factor in the treatment of disseminated zygomycosis (mucormycosis) in a neutropaenic murine model | |
| CN101511360A (zh) | 用于毛霉病和其它真菌疾病治疗的组合物及方法 | |
| US20220160631A1 (en) | Antifungal nanoparticles for targeted treatment of fungal infections | |
| TWI712410B (zh) | 艾曲波帕用於製備抗隱球菌藥物之用途 | |
| Flattery et al. | New model of oropharyngeal and gastrointestinal colonization by Candida albicans in CD4+ T-cell-deficient mice for evaluation of antifungal agents | |
| Sahu et al. | mucormycosis in indian covid-19 patients: insight into its patho-genesis, clinical manifestation, and management strategies. Antibiotics 2021; 10 | |
| US20090131366A1 (en) | Use of Amine-Borane Compounds as Anti-Microbial Agents | |
| Samajdar et al. | Fungal Infections of Lungs | |
| EP2680857B1 (en) | Oleyl phosphocholine for the treatment of mycosis | |
| Khan et al. | Efficacy of liposomal amphotericin B in treating fungal meningitis in AIDS Patients: A review article |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780032861.6 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07796874 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009519562 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009010043 Country of ref document: EG |
|
| ENP | Entry into the national phase |
Ref document number: 2657634 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/000506 Country of ref document: MX Ref document number: 12009500116 Country of ref document: PH |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007272781 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 574862 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020097002793 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007796874 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2009104961 Country of ref document: RU Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2007272781 Country of ref document: AU Date of ref document: 20070713 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12373511 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0714221 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090113 |