WO2007088371A2 - Expression system - Google Patents
Expression system Download PDFInfo
- Publication number
- WO2007088371A2 WO2007088371A2 PCT/GB2007/000351 GB2007000351W WO2007088371A2 WO 2007088371 A2 WO2007088371 A2 WO 2007088371A2 GB 2007000351 W GB2007000351 W GB 2007000351W WO 2007088371 A2 WO2007088371 A2 WO 2007088371A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plasmid
- promoter
- sequence
- expression
- expression system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
- C12N15/72—Expression systems using regulatory sequences derived from the lac-operon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
- C12N15/73—Expression systems using phage (lambda) regulatory sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/78—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Pseudomonas
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/185—Escherichia
- C12R2001/19—Escherichia coli
Definitions
- the present invention concerns an expression system suitable for the microbial expression of recombinant polypeptides.
- T7-based perfect palindrome operator sequence-based protein expression systems are known from patent US 6,537,779.
- T7 based systems suffer from drawbacks in that operation of the T7 system requires phage polymerase which is commonly provided by inserting a ⁇ DE3 prophage expressing the required phage polymerase into the Escherichia coli host strain to create lysogenic host strains.
- the phage polymerase can also be delivered to the cell by infection with a specialised ⁇ transducing phage that carries the gene for the phage polymerase (e.g. T7 RNA polymerase).
- the ⁇ DE3 prophage lacks the genetic elements required for the excision of the prophage to form lytic phage particles.
- ⁇ DE3 lysogenic host strains have been shown to release phage particles and thus cause undesirable infections in fermentation plants. Indeed, the use of ⁇ DE3 strains is not permitted by certain fermentation plant operators.
- T7-based expression systems generally control expression of heterologous proteins at two levels. First, induction of expression of the T7 RNA polymerase gene to produce T7 RNA polymerase is required to drive expression from the T7 promoter. Secondly, the T7 promoter itself also needs to be induced. This increases the complexity of operating T7-based expression systems.
- a perfect palindrome operator sequence-based protein expression system comprising: a) a promoter; and b) a perfect palindrome operator sequence; characterised in that the promoter is not T7.
- Promoters which can be employed in the expression system of the present invention are commonly host RNA polymerase-based promoter systems, and preferably E. coli RNA polymerase-based promoter systems.
- Examples of promoters which can be employed include T7A1 , T7A2, T7A3, ⁇ pL, ⁇ pR, lac, lacUV5, trp, tac, trc, phoA and rrnB.
- Operator sequences which may be employed in the expression system according to the present invention include lac, gal, deo and gin. One or more perfect palindrome operator sequences may be employed.
- two perfect palindrome operator sequences are employed, most advantageously one operator sequence being located downstream of the promoter, and one operator sequence being located upstream of the promoter.
- the operator sequences are preferably spaced to maximise control of the promoter. In many embodiments, the spacing is from 85 to 150 base pairs apart, preferably from 90 to 126 base pairs apart, and most preferably 91 or 92 base pairs apart. In certain embodiments, an operator sequence overlaps with the transcriptional start point
- Repressor sequences produce repressor protein, for example lacl gene sequence when using the lac operators.
- Other lac repressor sequences may also be used, for example the lacl Q sequence can be used to increase the level of lac repressor protein.
- the repressor sequence may also be provided by the host cell genome or by using an additional compatible plasmid.
- the expression system may be integrated into the host cell genome, but is preferably comprised within an extrachromosomal element such as a plasmid.
- the expression system may be incorporated into phage or viral vectors and these used to deliver the expression system into the host ceil system. Plasmids or expression vectors can be assembled by methods known in the art.
- the plasmid typically also comprises one or more of the following: a selectable marker, for example a sequence conferring antibiotic resistance, a cer stability sequence and an expression cassette.
- the expression system may also incorporate a signal sequence if secretion of the desired protein is required.
- Expression may be induced by the addition of an inducer such as isopropyl- ⁇ -D-1- thiogalactopyranoside (IPTG), analogues of IPTG such as isobutyl-C-galactoside (IBCG), lactose or melibiose.
- inducers may be used and are described more fully elsewhere (e.g. see The Operon, eds Miller and Renznikoff (1978)). Inducers may be used individually or in combination. The construction of appropriate plasmids or expression vectors will be apparent to the scientist of ordinary skill.
- the expression system of the present invention can be employed to express proteins in host cells, and especially in microorganisms.
- proteins refers generally to peptides and proteins having more than about 10 amino acids.
- the host cell may be prokaryotic or eukaryotic.
- prokaryotic cells include bacterial cells, for example gram-negative bacterial cells, including E. coli, Salmonella typhimurium, Serratia marsescens and Pseudomonas aeruginosa, and gram-positive bacterial cells including Bacillus subtilis.
- eukaryotic cells include yeasts, such as Pichia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha, Kluyveromyces lactis, Schizosaccharomyces pombe.
- Mammalian host cells which can be employed include human cell lines, such as human embryonic kidney and PERC.6 cells; murine cell lines, such as NSO cells; and particularly hamster cell lines such as baby hamster kidney cells and especially Chinese hamster ovary cells.
- Other eukaryotic host cells such as those of filamentous fungi, plant, insect, amphibian cells or ovarian species may also be employed.
- Preferred host cells are bacteria, particularly enterobacteriacae, preferably E coli, and especially B or K12 strains thereof.
- the expression system of the present invention is commonly employed in the form of a plasmid, and plasmids comprising a promoter and a perfect palindrome operator sequence, wherein the promoter is not T7, form another aspect of the present invention.
- the plasmids may be autonomously replicating plasmids or integrative plasmids.
- the expression system of the present invention is advantageously employed for the manufacture of proteins, especially recombinant proteins, by culturing recombinant cells.
- the promoter and operator sequence are operably linked to DNA encoding a protein to be expressed.
- the present invention also provides a method for the production of a protein which comprises expressing an expression system comprising a) a promoter; b) a perfect palindrome operator sequence; and c) an expression cassette for a protein; characterised in that the promoter is not 17.
- One or more promoters, operator sequences and expression cassettes which may be the same or different, may be present if desired.
- the expression system is expressed by methods well known in the art for the cells employed. Preferred expression methods include culturing the recombinant cells in growth medium, especially by fermentation, and then recovering the expressed protein.
- growth medium refers to a nutrient medium used for growing the recombinant cells. In many embodiments, a nutrient solution is employed. Suitable growth media for given recombinant cells are well known in the art.
- the starting vector for the generation of pAVE011 was pZT7#2.0, prepared as described in US 6,537,779.
- pZT7#2.0 has a pAT153 vector backbone, cer stability sequence, tet A/R, a single native lac operator sequence upstream of the gene of interest and an upstream T4 transcription terminator.
- a T7A3 promoter and dual perfect palindrome lac operators were cloned into this plasmid using synthetic oligonucleotide linkers by means of the Nco I 1 EcoR I and Xba I restriction enzyme sites.
- Linker 12.1 was prepared by annealing the oligonucleotides 1 and 2.1 : Oligonucleotide 1 (SEQ ID NO 1) 5'CATGTGGGAATTGTGAGCGCTCACAATTCCAAGAACAATCCTGCACG
- Oligonucleotide 2.1 (SEQ ID NO 2) 5 1 AATTCGTGCAGGATTGTTCTTGGAATTGTGAGCGCTCACAATTCCCA
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Nco l/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco I. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE012.
- the T7A3 promoter cassette was then cloned into pAVE012 by annealing oligonucleotides 3 and 4:
- Oligonucleotide 3 (SEQ ID NO 3)
- Oligonucleotide 4 (SEQ ID NO 4) ⁇ 'CTGGTGGGGGGTTGTGGGCGCTCGCGGTTCCGGTGCGTCGTGCCGT
- FIG. 18 A plasmid map for pAVE013 is presented in Figure 18. This shows the arrangement of operators and promoter, and the restriction enzyme sites used in the construction. The operators are both perfect palindrome lac operators. RBS is the ribosomal binding site.
- the vector includes a pAT153 vector backbone, a cer stability sequence, an inducible tetracycline resistance gene ( tet A/R), and an upstream T4 transcription terminator.
- the starting vector for the generation of pAVE038 was pZT7#2.0, prepared as described in US 6,537,779.
- a tac promoter and single native lac operator were cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- Linker 1112 was made by annealing the oligonucleotides 11 and 12
- Oligonucleotide 11 (SEQ ID NO 5)
- Oligonucleotide 12 (SEQ ID NO 6)
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco I. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE038.
- a human TNFq gene was cloned into this plasmid as an Nde I/Xho I fragment to generate plasmid pAVE041.
- the starting vector for the generation of pAVE037 was pZT7#2.0 prepared as described in US 6,537,779.
- a tac promoter and single perfect palindrome lac operator were cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- Linker 1314 was made by annealing the oligonucleotides 13 and 14
- Oligonucleotide 13 (SEQ ID NO 7)
- Oligonucleotide 14 (SEQ ID NO 8) 5 1 CTAGTGGGGAATTGTGAGCGCTCACAATTCCACACAGTATCCGAGCCG ATGATTAATTGTCAACAGCTCATTTCAGAA
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco I. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE037.
- a human TNFq gene was cloned into this plasmid as an Nde I /Xho I fragment to generate pAVE040.
- the starting vector for the generation of pAVE028 was pAVEOI 2.
- a T7A3 promoter cassette was cloned into pAVE012 by annealing oligonucleotides 5 and 6.
- Oligonucleotide 5 (SEQ ID NO 9)
- Oligonucleotide 6 (SEQ ID NO 10) ⁇ 'CTGGTGGGGGGTTGTGGGCGCTCGCGGTTCCGGTGCGTCGTGCCGT GTTTGCTTCGTGTTGTCGGCCGTTTTGTTTCG
- a human TNFq gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE030.
- the starting vector for the generation of pAVE007 was pZT7#2.0 prepared as described in US 6,537,779.
- a T7A3 promoter and single perfect palindrome lac operator was cloned into this plasmid using a synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- the linker containing the T7A3 promoter was made up of oligonucleotides 3 and 4.
- Oligonucleotide 3 (SEQ ID NO 3)
- Oligonucleotides 3 and 4 were annealed, the linker formed was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named PAVE007.
- a human TNF ⁇ gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE031.
- Vectors pAVE029 and pAVE027 The starting vector for the generation of pAVE029 was pZT7#2.0 prepared as described fully in US 6,537,779. A ⁇ pL promoter and single perfect palindrome lac operator was cloned into this plasmid using synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- Linker 78 was made by annealing the oligonucleotides 7 and 8
- Oligonucleotide 8 (SEQ ID NO 12)
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment. Initial screening of transformants was by restriction digestion using Nco I. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE029.
- a human TNF ⁇ gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE027.
- the starting vector for the generation of pAVE043 was pAVE012.
- a tac promoter cassette was cloned into pAVE012 by annealing oligonucleotides 17 and 18: Oligonucleotide 17 (SEQ ID NO 37)
- Oligonucleotide 18 (SEQ ID NO 38)
- a human TNFq gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE044.
- the starting vector for the generation of pAVE034 was pAVE012.
- a ⁇ pL promoter cassette was cloned into pAVE012 by annealing oligonucleotides 9 and 10:
- Oligonucleotide 10 (SEQ ID NO 40)
- a human TNF ⁇ gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE035.
- the starting vector for the generation of pAVE020 was pAVE012.
- a ⁇ pL promoter cassette was cloned into pAVE012 by annealing oligonucleotides 7 and 8.
- Oligonucleotide 7 (SEQ ID NO 11)
- Oligonucleotide 8 (SEQ ID NO 12)
- a human TNFq gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE021.
- the starting vector for the generation of pAVE016 was pAVE012.
- a tac promoter cassette was cloned into pAVE012 by annealing oligonucleotides 15 and 16.
- Oligonucleotide 15 (SEQ ID NO 13)
- Oligonucleotide 16 (SEQ ID NO 14) ⁇ 'CTAGTGGGGAATTGTGAGCGCTCACAATTCCACACATTATACGAGCCG
- a human TNFq gene was cloned into this plasmid as an Nde I/Xho I fragment to generate pAVE017.
- the starting vector for the generation of pAVE049 was pAVEO.17.
- the tac promoter cassette was not altered.
- an EcoR I linker was cloned in. This was made up of oligonucleotides 19 and 20.
- Oligonucleotide 19 (SEQ ID NO 15) 5'AATTCACCGGTGTACAGTCATGTACAACCGGTG
- Oligonucleotide 20 (SEQ ID NO 16) 5'AATTCACCGGTTGTACATGACTGTACACCGGTG
- the starting vector for the generation of secretion vector pAVE046 was pAVE027.
- a D1.3 Fab expression cassette ( Figure 1 , SEQ ID NO 17) was cloned as an Nde I-Bam HI fragment. Initial screening was by restriction digest of plasmid DNA. The sequence was then confirmed by sequencing. The resultant plasmid was named pAVE046.
- E. co// strains W3110 available from the American Type Culture Collection as strain ATCC27325
- BL21 available from EMD Biosciences Inc, San Diego, USA
- the resultant recombinant strains were purified and maintained in glycerol stocks at - 80 q C.
- Table 2 Recombinant strains constructed
- the starting vector for the generation of a plasmid with the T7A3 promoter without any operator was pZT7#2.0.
- a T7A3 promoter was cloned into this plasmid using synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- Linker 2122 was made by annealing the oligonucleotides 21 and 22
- Oligonucleotide 21 (SEQ ID NO 18)
- Oligonucleotide 22 (SEQ ID NO 19)
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment.
- Initial screening was by restriction digest of plasmid DNA.
- the sequence was then confirmed by sequencing. Eighty-two clones were screened by restriction digest and sequencing. No clones were identified with the correct T7A3 promoter sequence (all contained mutations in the sequence). This suggests that construction of plasmids containing this powerful constitutive promoter is problematic.
- the starting vector for the generation of a plasmid with the T7A3 promoter under the control of a single native Lac operator sequence was pZT7#2.0.
- a T7A3 promoter and native Lac operator (LacO) sequence was cloned into this plasmid using synthetic oligonucleotide linker by means of the EcoR I and Xba I restriction enzyme sites.
- Linker 2324 was made by annealing the oligonucleotides 23 and 24
- Oligonucleotide 24 (SEQ ID NO 21)
- the linker was then ligated to plasmid pZT7#2.0 and transformed into cloning host strain XL-1 Blue MR (Stratagene) as an Xba l/EcoR I fragment.
- Initial screening was by restriction digest of plasmid DNA.
- the sequence was then confirmed by sequencing.
- Ninety-four clones were screened by restriction digestion and sequencing. Again no clones were identified with the correct sequence. However, one clone was found to have a near intact sequence. This clone contained an additional 'G' in the sequence approximately at position -37. It is difficult to assign exact position of the mutation since the expected sequence contains -GG- in this region.
- Human TNF ⁇ gene was cloned into the plasmid with the near intact sequence as an Nde I/Xho I fragment. Twenty colonies from the cloning host strain XL-Blue MR (Stratagene) were screened. One was positive clone with no mutations (other than the additional 'G' described above). This plasmid was transformed into a production host (ATCC27325) and the plasmid re- sequenced.
- the plasmid contained gross mutations in both the T7A3 promoter and the human TNF ⁇ sequences indicating that the use of the T7A3 promoter, even under the control of the native lac operator sequence, results in plasmid instability.
- Example 3 A vial of CLD032 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate two 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- Vials of CLD018 was removed from the -80 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). The seed culture was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of the seed culture was then used to inoculate 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- Vials of CLD026 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/l_ yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- Vials of CLD042 and CLD043 were removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of each of the thawed glycerol stock was inoculated separately into each of 2x5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/m! and glucose (1g/L). These were incubated at 37 0 C in an orbital shaker for 16h.
- the accumulation level of hTNF ⁇ was determined using densitometry scanning of Colloidal Blue stained SDS-PAGE gels of whole cell lysates of the sampled bacteria.
- the basal accumulation level of hTNF ⁇ in the un-induced cultures of CLD042 and CLD043 after 20 hours incubation was compared by Western blot analysis (using anti- hTNF ⁇ antibody) following SDS-PAGE of the sampled bacteria. The blots were scanned and the data normalised to enable comparison. The results are summarised below in Table 6.
- a vial of CLD019 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- a vial of CLD030 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- Example 9 Vials of CLD021 and CLD038 were removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of each of the thawed glycerol stock was inoculated separately into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). These were incubated at 37 0 C in an orbital shaker for 16h.
- LB 5g/L yeast extract
- Oxoid 10g/L tryptone
- 5g/L sodium chloride 5g/L sodium chloride
- Vials of CLD028 and CLD035 were removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of each of the thawed glycerol stock was inoculated separately into each of 2x5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). These were incubated at 37 0 C in an orbital shaker for 16h.
- Fermentation inocula were raised by adding 200 ⁇ l of glycerol stock of each of the strains described below to a 2.0L baffled shake flask containing 20OmL of Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with 15 ⁇ g/ml of tetracycline.
- Inocula were grown for 12h at 37 0 C in a shaker-incubator with an agitation of 250rpm.
- 200ml shake flask inoculum was used to inoculate a 15L working volume fermenter containing 10L of batch growth medium. Fermentations were carried out under the operating conditions described below.
- dOT dissolved oxygen tension
- Fermentations were performed in batch mode until depletion of the carbon source (i.e. glycerol) which occurred ca. 10h post inoculation and was characterized by a sharp rise in dOT.
- Fed-batch fermentation was initiated at the point of carbon source exhaustion by the addition of a glycerol / magnesium chloride feed at a feed rate of 11g of glycerol per L of medium per h.
- the fed-batch phase was continued for 12h post induction. Samples were taken to determine biomass level (OD 6 oo) and hTNF ⁇ accumulation (%TCP)/ hTNF ⁇ titre (g/L) at harvest (Colloidal Blue stained SDS-PAGE gels).
- composition of the batch growth medium is provided in Table 10.
- composition of the glycerol / magnesium chloride feed is provided in Table 11.
- a vial of CLD050 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- the dual perfect palindrome operator sequence worked when the spacing was increased.
- the spacing of the dual perfect palindrome can be altered, for example, to achieve effective control of other promoters.
- a vial of CLD048 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract
- the flask was induced with IPTG (isopropyl-. ⁇ .-D-1-thiogalactopyranoside) to a final concentration of 0.1mM and the incubation continued, under the conditions described above for a further 2h.
- IPTG isopropyl-. ⁇ .-D-1-thiogalactopyranoside
- the cells and residual cell free growth medium were then harvested.
- the harvested cells were further subjected to osmotic shock cell fractionation to isolate the cellular fraction containing proteins that had partitioned in the soluble E. coli periplasmic fraction.
- the accumulation of biologically active D1.3 Fab in the soluble periplasmic extract and residual growth medium was estimated by determining the binding of D1.3 Fab to lysoszyme (antigen) in an ELISA assay by reference to a standard curve prepared with purified active D1.3 Fab.
- the accumulation of biologically active D1.3 Fab in the periplasm of E.coli and in the residual growth medium is presented in Table 14.
- the accumulation of D1.3 Fab in the periplasm and residual growth medium was normalised as " ⁇ g active material per litre of culture per unit of biomass (OD 60 o)-
- the accumulation of biologically active D1.3 Fab in the soluble periplasmic extract and residual growth medium was estimated by determining the binding of D1.3 Fab to lysoszyme (antigen) in an ELISA assay by reference to a standard curve prepared with purified active D1.3 Fab.
- the accumulation of D1.3 Fab in the periplasm and residual growth medium was normalised as "mg active material per litre of culture”.
- a synthetic bispecific single chain tetravalent diabody (bsctDb) was designed, in which the variable light and variable heavy regions from D1.3 (anti-lysozyme) and A5B7 (anti-CEA (carcinoembryonic antigen)), were linked on a single polypeptide chain.
- the DNA sequence for this molecule is shown in Figure 5 (SEQ ID NO 22). This was cloned as an Nde I/Not I fragment into pAVE046 which had been digested with Nde I and Not I. Recombinant plasmids were screened by restriction digest and confirmed by sequencing. The resultant plasmid was named pAVE078. pAVE078 was transformed into E. coli W3110 to make CLD073, which was purified and maintained in glycerol stocks at -8O 0 C.
- a vial of CLD0073 was removed from the -8O 0 C freezer and allowed to thaw. 10 ⁇ l of the thawed glycerol stock was inoculated into 5ml Luria Broth (LB, 5g/L yeast extract (Oxoid), 10g/L tryptone (Oxoid), and 5g/L sodium chloride) supplemented with tetracycline (10 ⁇ g/ml) and glucose (1g/L). This was incubated at 37 0 C in an orbital shaker for 16h. 500 ⁇ l of this culture was then used to inoculate two 250ml Erlenmeyer flasks containing 50ml of Luria Broth (composition as described above).
- the expression, secretion, folding and accumulation of biologically active D1.3-A5B7 bsctDb in the periplasmic extract and residual growth medium was estimated by determining the inhibition of binding of an anti-CEA monoclonal antibody to CEA (antigen) in a competitive ELISA assay and by the binding of an anti-lysozyme Fab antibody fragment to lysozyme (antigen) in a competitive ELISA assay.
- the data obtained indicated that the majority of D1.3-A5B7 bsctDb partitioned in the residual growth medium (leakage from the periplasm) at the end of the induction.
- This data (binding of bsctDb in competitive ELISA) is shown in Table 16.
- the data obtained demonstrates that the residual growth medium sample from the culture induced with 0.5mM IPTG completely inhibits the binding of both the anti-CEA and anti-lysozyme antibodies in the competition ELISA assays.
- the residual growth medium sample from the culture induced with 0.1mM IPTG shows a reduced level of inhibition indicating a lower accumulation level of biologically active D1.3-A5B7 bsctDb in this sample.
- the glutathione-S-transferase-3C proteinase fusion (GST-3C) gene was cloned as an Nde I/Xho I fragment into pAVE011 digested with Nde I and Xho I.
- the sequence of the insert is shown in Figure 6 (SEQ ID NO 23).
- Recombinant plasmids were screened by restriction digest and confirmed by sequencing.
- the resultant plasmid was named pAVE052.
- pAVE052 was transformed into E.coli BL21 to make CLD054, which was purified and maintained in glycerol stocks at -80°C.
- the human Interferon ⁇ 2 (IFN ⁇ 2) gene was cloned as an Nde I/Xho I fragment into pAVE011 digested with Nde I and Xho I.
- the DNA sequence of the insert is shown in Figure 7 (SEQ ID NO 24).
- Recombinant plasmids were screened by restriction digest and confirmed by sequencing.
- the resultant plasmid was named pAVE058.
- pAVE058 was transformed into E. coli W3110 to make CLD059, which was purified and maintained in glycerol stocks at -80 ° C.
- the human erythropoietin (EPO) gene which had been codon optimised for expression in E coli, was cloned as an Nde I/Xho I fragment into pAVEO.11 digested with Nde I and Xho I.
- the DNA sequence of the insert is shown in Figure 8 (SEQ ID NO 25).
- Recombinant plasmids were screened by restriction digest and confirmed by sequencing.
- the resultant plasmid was named pAVE061.
- pAVE061 was transformed into E.coli W3110 to make CLD060, which was purified and maintained in glycerol stocks at -80°C.
- Example 17 The L-2-haloalkanoate dehalogenase (hadL) gene from Pseudomonas putida was cloned using Nde I and Spe I sites that had been engineered using PCR. The gene sequence is shown in Figure 9 (SEQ ID NO 26). Plasmid pAVEO11 was digested with Nde I and Spe I and the band was gel extracted. The hadL gene was digested with Nde I and Spe I and the hadL gene was gel extracted and ligated to pAVEO11 to produce pAVE075. The Pseudomonas savastanoi origin of replication was copied using the PCR from Plasmid pCN60 (ATCC 77101; Nieto C, et al. (1990) Gene 87: 145-149). The primers used were:
- F37A Sequence: 5' AGATCTACGCTTATGGGTGCCTTTCC (SEQ ID NO 27), and B29a: Sequence: 5' AGATCTAATACGCAAACCGCCTCTCC (SEQ ID NO 28).
- the PCR product was cloned initially into TOPO TA pCR2.1 (lnvitrogen) and then into pAVE075 by BgI Il digestion.
- the resultant plasmid, pAVEO ⁇ was transformed into Pseudomonas putida NCIMB 12018, via electroporation to make CLD075, which was purified and maintained in glycerol stocks at -80 ° C.
- a vial of CLD075 was removed from a -80 0 C freezer and allowed to thaw.
- Example 19 A synthetic GaI repressor gene (E.coli) was cloned into vector pZenO42 (as described in EP 0 502 637) as a Pstl fragment into the Pstl site. Clones were identified with the GaI repressor gene in both clockwise and anticlockwise orientations. A clone with anticlockwise orientation was selected to generate pAVE071.
- pZT7#2.0 Construction of the GaI promoter and operator sequences was initiated in plasmid pZT7#2.0, prepared as described in US 6,537,779.
- pZT7#2.0 has a pAT153 vector backbone, cer stability sequence, tet A/R, a single native lac operator sequence upstream of the gene of interest and an upstream T4 transcription terminator.
- the native GaI operator sequence was modified to produce a perfect palindromic operator sequence. This was cloned into the plasmid described above using synthetic linkers by means of
- the linker GaIB was prepared by annealing the oligonucleotides GaIBI and GalB2:
- GaIBI SEQ ID NO 29 5'AATTCATACCATAAGCCTAATTCTACGAATTATCAGAGTTCTGGTTACCGGT GTAAGCGCTTACACTGT
- the hTNF ⁇ gene and partial GaI perfect palindromic operator sequence were cloned by digesting with Xmal and Mscl and ligating into pAVE071 digested with Xmnl and Xmal. Clones were screened for the presence of the hTNF ⁇ gene by restriction digestion. Upstream perfect palindromic GaI operator and GaI promotor were each cloned into this plasmid using synthetic linkers by means of Stul and EcoRI sites. Linker GaIA was prepared by annealing the oligonucleotides GaIAI and GalA2:
- GaIAI SEQ ID NO 31: 5'CAATTGTGTAAGCGCTTACACAACTTTATTCCATGTCACACTTTTCGCATCTT TGTTATGCTATGGTG
- a non-integrating yeast vector was constructed as follows:
- Clone Sequence 1 E. coli Lac I downstream of a Saccharomyces cerevisiae CYC1 promoter as a Xho I fragment into Xho I digested pCR2.1 (Invitrogen). Clone Sequence 1 is shown in Figure 15 (SEQ ID NO 35).
- Clone Sequence 2 (which consists of the Saccharomyces cerevisiae MF- ⁇ 1 gene promoter with perfect palindromic lac operator sequences either side of the MF- crt promoter region, with the gene sequence for the protein elafin with a C-terminal c-myc tag (elafin-cmyc) positioned downstream) as a Hind III fragment (made by PCR) into Hind 111 digested plasmid constructed in Step 1 to produce plasmid 2.
- Clone Sequence 2 is shown in Figure 16 (SEQ ID NO 36).
- the flasks were incubated at 3O 0 C, at 200rpm in an orbital shaker.
- the clones were grown to an OD of ⁇ 3 and induced with 0.5 mM IPTG (final concentration).
- the incubation was continued for a further 16h, under the conditions described above, during which samples were taken for measurement of growth and secretion of elafin-cmyc protein into the growth medium.
- the secretion of elafin-cmyc into the residual growth medium was determined using an elastase inhibition enzyme assay, as described in Wiedow O, et al, J Biol Chem. (1990) 265(25): 14791-5. After 4 hours of IPTG induction there was 30 mg/L of active elafin protein in the growth medium. This demonstrates that the expression systems of the present invention are effective in yeasts.
- a DNA fragment was synthesised which contained the constitutive human Cytomegalovirus (hCMV) promoter flanked by dual perfect palindromic lac operator sequences. This was cloned into an expression vector, which expressed IgG Fc protein. The resulting plasmid was named pAVE081 , and is derived from pCMV-Script
- the 6-well tissue culture plates were then incubated overnight (16h) in a humidified 37 ° C incubator with 5% CO 2 before transfection mixes were prepared containing 2 ⁇ g of pAVE081 DNA with an equal quantity of pCMVIacl (Stratagene) DNA 1 6 ⁇ l of transfection reagent and 94 ⁇ l of growth medium per well. 100 ⁇ l of transfection mix was added to each well containing the CHO cells. The 6-well tissue culture plates were then incubated in humidified 37 ° C incubator with 5% CO 2 . To determine the level of expression/secretion of IgG Fc protein into the growth medium a set of wells (day 2) were induced with 5 mM IPTG (final concentration) and set of wells left un-induced.
- the expression system can be used to control powerful constitutive promoters typically used with mammalian cell systems, such as the hCMV promoter, to express proteins in mammalian cells in a contollable, inducible manner.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (15)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/223,527 US8530188B2 (en) | 2006-02-03 | 2007-02-01 | Expression system |
| PL07712658T PL1984506T3 (pl) | 2006-02-03 | 2007-02-01 | System do ekspresji |
| ES07712658.9T ES2436883T3 (es) | 2006-02-03 | 2007-02-01 | Sistema de expresión |
| KR1020147026047A KR101624345B1 (ko) | 2006-02-03 | 2007-02-01 | 발현 시스템 |
| KR1020147017744A KR101512776B1 (ko) | 2006-02-03 | 2007-02-01 | 발현 시스템 |
| CA2637818A CA2637818C (en) | 2006-02-03 | 2007-02-01 | Expression system |
| EP07712658.9A EP1984506B1 (en) | 2006-02-03 | 2007-02-01 | Expression system |
| KR1020087018552A KR101492844B1 (ko) | 2006-02-03 | 2007-02-01 | 발현 시스템 |
| CN2007800112768A CN101410523B (zh) | 2006-02-03 | 2007-02-01 | 表达系统 |
| JP2008552885A JP5221385B2 (ja) | 2006-02-03 | 2007-02-01 | 発現系 |
| CN201810774783.7A CN108841848B (zh) | 2006-02-03 | 2007-02-01 | 表达系统 |
| DK07712658.9T DK1984506T3 (da) | 2006-02-03 | 2007-02-01 | Ekspressionssystem |
| US13/966,600 US9677103B2 (en) | 2006-02-03 | 2013-08-14 | Expression system |
| US15/588,851 US11098335B2 (en) | 2006-02-03 | 2017-05-08 | Expression system |
| US17/377,805 US20210348205A1 (en) | 2006-02-03 | 2021-07-16 | Expression System |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0602173.7A GB0602173D0 (en) | 2006-02-03 | 2006-02-03 | Expression system |
| GB0602173.7 | 2006-02-03 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/223,527 A-371-Of-International US8530188B2 (en) | 2006-02-03 | 2007-02-01 | Expression system |
| US13/966,600 Continuation US9677103B2 (en) | 2006-02-03 | 2013-08-14 | Expression system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007088371A2 true WO2007088371A2 (en) | 2007-08-09 |
| WO2007088371A3 WO2007088371A3 (en) | 2007-10-04 |
Family
ID=36100973
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2007/000351 Ceased WO2007088371A2 (en) | 2006-02-03 | 2007-02-01 | Expression system |
Country Status (15)
| Country | Link |
|---|---|
| US (4) | US8530188B2 (cg-RX-API-DMAC7.html) |
| EP (6) | EP1984506B1 (cg-RX-API-DMAC7.html) |
| JP (5) | JP5221385B2 (cg-RX-API-DMAC7.html) |
| KR (3) | KR101624345B1 (cg-RX-API-DMAC7.html) |
| CN (3) | CN102690834B (cg-RX-API-DMAC7.html) |
| CA (2) | CA2959915C (cg-RX-API-DMAC7.html) |
| DK (4) | DK2695943T3 (cg-RX-API-DMAC7.html) |
| ES (3) | ES2569075T3 (cg-RX-API-DMAC7.html) |
| GB (1) | GB0602173D0 (cg-RX-API-DMAC7.html) |
| HU (1) | HUE027350T2 (cg-RX-API-DMAC7.html) |
| PL (3) | PL2695943T3 (cg-RX-API-DMAC7.html) |
| PT (2) | PT1984506E (cg-RX-API-DMAC7.html) |
| SG (3) | SG169390A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2007088371A2 (cg-RX-API-DMAC7.html) |
| ZA (2) | ZA200806238B (cg-RX-API-DMAC7.html) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008139153A3 (en) * | 2007-05-11 | 2009-01-08 | Avecia Biolog Ltd | Expression system |
| US20110086391A1 (en) * | 2008-06-04 | 2011-04-14 | Bhupendra Vallabh Kara | Expression Vector |
| WO2012059715A1 (en) | 2010-11-05 | 2012-05-10 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| WO2012085496A1 (en) | 2010-12-21 | 2012-06-28 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| JP2012521752A (ja) * | 2009-03-27 | 2012-09-20 | フジフィルム・ダイオシンス・バイオテクノロジーズ ・ユーケイ・リミテッド | 発現プロセス |
| WO2013178974A1 (en) | 2012-06-01 | 2013-12-05 | Fujifilm Diosynth Biotechnologies Uk Limited | Process for expression of crm197 |
| WO2014118220A1 (en) | 2013-01-31 | 2014-08-07 | Glaxo Group Limited | Method of producing a protein |
| WO2015001285A1 (en) | 2013-07-01 | 2015-01-08 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| WO2015071623A1 (en) | 2013-11-12 | 2015-05-21 | Fujifilm Diosynth Biotechnologies Uk Limited | Use of mete gene as auxotrophic marker in genetic constructs |
| WO2017191255A1 (en) | 2016-05-06 | 2017-11-09 | Glaxosmithkline Intellectual Property Development Limited | Method of producing a recombinant protein |
| WO2018172739A1 (en) * | 2017-03-24 | 2018-09-27 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression system |
| WO2023111569A1 (en) | 2021-12-17 | 2023-06-22 | University Of Kent | Sequences and methods for production of recombinant biological molecules in vesicles |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0602173D0 (en) * | 2006-02-03 | 2006-03-15 | Avecia Ltd | Expression system |
| US9873891B2 (en) * | 2013-05-03 | 2018-01-23 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| JP6803328B2 (ja) * | 2014-08-28 | 2021-01-06 | シンセティック バイオロジクス,インコーポレイテッド | 大腸菌ベースでのベータラクタマーゼ生産 |
| US9791697B2 (en) | 2015-12-11 | 2017-10-17 | Panasonic Intellectual Property Management Co., Ltd. | Screen |
| EP3436610A1 (en) * | 2016-03-29 | 2019-02-06 | Geltor, Inc. | Expression of proteins in gram-negative bacteria wherein the ratio of periplasmic volume to cytoplasmic volume is between 0.5:1 and 10:1 |
| US20230151071A1 (en) * | 2020-04-09 | 2023-05-18 | United States Government As Represented By The Department Of Veterans Affairs | Compositions comprising recombinant epo and methods of use thereof |
| US20230167467A1 (en) * | 2020-04-15 | 2023-06-01 | University of Alaska Anchorage | Methods and compositions for the production of isobutene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0502637A2 (en) | 1991-02-26 | 1992-09-09 | Zeneca Limited | Vector |
| US6537779B1 (en) | 1997-07-25 | 2003-03-25 | Zeneca Limited | T7 promoter-based expression system |
Family Cites Families (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8517071D0 (en) * | 1985-07-05 | 1985-08-14 | Hoffmann La Roche | Gram-positive expression control sequence |
| US5059530A (en) * | 1985-09-30 | 1991-10-22 | Suntory Ltd. | Expression vector for human TNF |
| JPS63267288A (ja) | 1986-12-26 | 1988-11-04 | Hoechst Japan Kk | 増幅された遺伝子によつて蛋白質を生産する方法およびそのための遺伝子 |
| US5510099A (en) * | 1987-05-01 | 1996-04-23 | Stratagene | Mutagenesis testing using transgenic non-human animals carrying test DNA sequences |
| US5223407A (en) * | 1988-08-31 | 1993-06-29 | Allelix Inc. | Excretion of heterologous proteins from e. coli |
| WO1991013979A1 (en) | 1990-03-05 | 1991-09-19 | President And Fellows Of Harvard College | Transgenic mouse overexpressing il-4 and method of use |
| DE4029844A1 (de) * | 1990-09-20 | 1992-03-26 | Boehringer Mannheim Gmbh | Carbamoylsarcosinhydrolase, kloniert |
| US5589392A (en) | 1991-01-14 | 1996-12-31 | Stratagene | Nucleic acid construct encoding a nuclear transport peptide operatively linked to an inducible promoter |
| GB2253210B (en) * | 1991-02-26 | 1995-06-07 | Ici Plc | Soluble heterologous polypeptide produced by culture of recombinant microorganisms |
| CA2130081A1 (en) | 1992-02-14 | 1993-08-19 | Jay M. Short | Mutagenesis testing using transgenic non-human animals carrying test dna sequences |
| WO1998022578A1 (fr) | 1996-11-15 | 1998-05-28 | Institute Of Cytosignal Research, Inc. | Procedes servant a detecter et a isoler des genes |
| WO1998022581A1 (fr) | 1996-11-15 | 1998-05-28 | Institute Of Cytosignal Research, Inc. | Represseur de transcription |
| WO1999005279A1 (en) | 1997-07-25 | 1999-02-04 | Zeneca Limited | Mcp-1 analogs |
| EP1183357A2 (en) * | 1999-05-20 | 2002-03-06 | Scios Inc. | Vascular endothelial growth factor dimers |
| EP1373297A4 (en) | 2001-03-05 | 2005-09-21 | Univ Virginia | A LAC OPERATOR REPRESSOR SYSTEM |
| GB0113318D0 (en) | 2001-06-01 | 2001-07-25 | Lonza Biologics Plc | Method for production of a protein |
| GB0227346D0 (en) * | 2002-11-22 | 2002-12-31 | Chiron Spa | 741 |
| AU2003299732A1 (en) | 2002-12-18 | 2004-07-14 | Genpath Pharmaceuticals, Incorporated | Vectors for inducible rna interference |
| WO2005052151A1 (en) | 2003-11-19 | 2005-06-09 | Dow Global Technologies Inc. | Improved protein expression systems |
| US20060177895A1 (en) * | 2003-12-12 | 2006-08-10 | Chung Chan | Methods for enhancing expression of recombinant proteins |
| WO2005071089A2 (en) | 2004-01-12 | 2005-08-04 | Vertex Pharmaceuticals Incorporated | Dual host expression vector system and screening methods |
| JP4854202B2 (ja) * | 2004-03-31 | 2012-01-18 | 株式会社日本触媒 | 新規改変型s−ヒドロキシニトリルリアーゼ |
| JP2005314252A (ja) * | 2004-04-27 | 2005-11-10 | Okayama Univ | 糖尿病性腎症の予防・治療剤 |
| JP2005341803A (ja) * | 2004-05-31 | 2005-12-15 | Institute Of Physical & Chemical Research | 非対称な塩基配列を認識して切断する酵素I−CsmI及びその製造方法 |
| GB0602173D0 (en) * | 2006-02-03 | 2006-03-15 | Avecia Ltd | Expression system |
| RU2006129690A (ru) | 2006-08-16 | 2008-02-27 | Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" (ЗАО АГРИ) (RU) | СПОСОБ ПОЛУЧЕНИЯ L-АМИНОКИСЛОТЫ С ИСПОЛЬЗОВАНИЕМ БАКТЕРИЙ СЕМЕЙСТВА Enterobacteriaceae, В КОТОРОЙ ОСЛАБЛЕНА ЭКСПРЕССИЯ ГЕНА ydiN, ГЕНА ydiB ИЛИ ИХ КОМБИНАЦИИ |
| US9388425B2 (en) | 2006-10-20 | 2016-07-12 | Trustees Of Boston University | Tunable genetic switch for regulating gene expression |
-
2006
- 2006-02-03 GB GBGB0602173.7A patent/GB0602173D0/en not_active Ceased
-
2007
- 2007-02-01 EP EP07712658.9A patent/EP1984506B1/en active Active
- 2007-02-01 PT PT77126589T patent/PT1984506E/pt unknown
- 2007-02-01 DK DK13191424.4T patent/DK2695943T3/en active
- 2007-02-01 PL PL13191424T patent/PL2695943T3/pl unknown
- 2007-02-01 CN CN201210056815.2A patent/CN102690834B/zh active Active
- 2007-02-01 EP EP11172434.0A patent/EP2390334B1/en not_active Not-in-force
- 2007-02-01 SG SG201100858-8A patent/SG169390A1/en unknown
- 2007-02-01 ES ES13191424.4T patent/ES2569075T3/es active Active
- 2007-02-01 DK DK07712658.9T patent/DK1984506T3/da active
- 2007-02-01 HU HUE13191424A patent/HUE027350T2/hu unknown
- 2007-02-01 ES ES11171994.4T patent/ES2445173T3/es active Active
- 2007-02-01 PL PL07712658T patent/PL1984506T3/pl unknown
- 2007-02-01 PL PL11171994T patent/PL2386642T3/pl unknown
- 2007-02-01 US US12/223,527 patent/US8530188B2/en active Active
- 2007-02-01 ES ES07712658.9T patent/ES2436883T3/es active Active
- 2007-02-01 SG SG201100857-0A patent/SG169389A1/en unknown
- 2007-02-01 CN CN2007800112768A patent/CN101410523B/zh active Active
- 2007-02-01 JP JP2008552885A patent/JP5221385B2/ja active Active
- 2007-02-01 CA CA2959915A patent/CA2959915C/en active Active
- 2007-02-01 KR KR1020147026047A patent/KR101624345B1/ko active Active
- 2007-02-01 EP EP13191424.4A patent/EP2695943B1/en active Active
- 2007-02-01 DK DK11172432.4T patent/DK2386644T3/en active
- 2007-02-01 EP EP11172432.4A patent/EP2386644B1/en active Active
- 2007-02-01 WO PCT/GB2007/000351 patent/WO2007088371A2/en not_active Ceased
- 2007-02-01 CA CA2637818A patent/CA2637818C/en active Active
- 2007-02-01 KR KR1020087018552A patent/KR101492844B1/ko active Active
- 2007-02-01 KR KR1020147017744A patent/KR101512776B1/ko active Active
- 2007-02-01 CN CN201810774783.7A patent/CN108841848B/zh active Active
- 2007-02-01 EP EP11172429.0A patent/EP2386643B1/en active Active
- 2007-02-01 PT PT111719944T patent/PT2386642E/pt unknown
- 2007-02-01 EP EP11171994.4A patent/EP2386642B1/en active Active
- 2007-02-01 SG SG201100856-2A patent/SG169388A1/en unknown
- 2007-02-01 DK DK11171994.4T patent/DK2386642T3/en active
-
2008
- 2008-07-17 ZA ZA200806238A patent/ZA200806238B/xx unknown
-
2010
- 2010-07-12 ZA ZA2010/04904A patent/ZA201004904B/en unknown
-
2012
- 2012-11-21 JP JP2012255098A patent/JP5713984B2/ja active Active
-
2013
- 2013-08-14 US US13/966,600 patent/US9677103B2/en active Active
-
2014
- 2014-08-21 JP JP2014168362A patent/JP2015006193A/ja active Pending
-
2016
- 2016-02-23 JP JP2016031742A patent/JP6298481B2/ja active Active
-
2017
- 2017-03-06 JP JP2017041457A patent/JP6571707B2/ja active Active
- 2017-05-08 US US15/588,851 patent/US11098335B2/en active Active
-
2021
- 2021-07-16 US US17/377,805 patent/US20210348205A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0502637A2 (en) | 1991-02-26 | 1992-09-09 | Zeneca Limited | Vector |
| US6537779B1 (en) | 1997-07-25 | 2003-03-25 | Zeneca Limited | T7 promoter-based expression system |
Non-Patent Citations (1)
| Title |
|---|
| NIETO C ET AL., GENE, vol. 87, 1990, pages 145 - 149 |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8394937B2 (en) | 2007-05-11 | 2013-03-12 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression system |
| WO2008139153A3 (en) * | 2007-05-11 | 2009-01-08 | Avecia Biolog Ltd | Expression system |
| US20110086391A1 (en) * | 2008-06-04 | 2011-04-14 | Bhupendra Vallabh Kara | Expression Vector |
| US9845475B2 (en) | 2008-06-04 | 2017-12-19 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression vector |
| US9157085B2 (en) * | 2008-06-04 | 2015-10-13 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression vector for expression of eukaryotic secretion leader sequence fused with a target polypeptide and methods of use thereof |
| JP2012521752A (ja) * | 2009-03-27 | 2012-09-20 | フジフィルム・ダイオシンス・バイオテクノロジーズ ・ユーケイ・リミテッド | 発現プロセス |
| WO2012059715A1 (en) | 2010-11-05 | 2012-05-10 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| US9677104B2 (en) | 2010-12-21 | 2017-06-13 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| WO2012085496A1 (en) | 2010-12-21 | 2012-06-28 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| WO2013178974A1 (en) | 2012-06-01 | 2013-12-05 | Fujifilm Diosynth Biotechnologies Uk Limited | Process for expression of crm197 |
| WO2014118220A1 (en) | 2013-01-31 | 2014-08-07 | Glaxo Group Limited | Method of producing a protein |
| WO2015001285A1 (en) | 2013-07-01 | 2015-01-08 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression process |
| WO2015071623A1 (en) | 2013-11-12 | 2015-05-21 | Fujifilm Diosynth Biotechnologies Uk Limited | Use of mete gene as auxotrophic marker in genetic constructs |
| WO2017191255A1 (en) | 2016-05-06 | 2017-11-09 | Glaxosmithkline Intellectual Property Development Limited | Method of producing a recombinant protein |
| US11098312B2 (en) | 2016-05-06 | 2021-08-24 | Glaxosmithkline Intellectual Property Development Limited | Method of producing a recombinant protein |
| WO2018172739A1 (en) * | 2017-03-24 | 2018-09-27 | Fujifilm Diosynth Biotechnologies Uk Limited | Expression system |
| WO2023111569A1 (en) | 2021-12-17 | 2023-06-22 | University Of Kent | Sequences and methods for production of recombinant biological molecules in vesicles |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210348205A1 (en) | Expression System | |
| US8394937B2 (en) | Expression system | |
| WO2007022623A1 (en) | Regulation of heterologous recombinant protein expression in methylotrophic and methanotrophic bacteria | |
| EP2655669B1 (en) | Expression process | |
| CN117965587A (zh) | 一种含hok/sok基因的菌株及其制备与应用 | |
| EP3601577A1 (en) | Expression system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2007712658 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2637818 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020087018552 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008552885 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780011276.8 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12223527 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020147026047 Country of ref document: KR |