WO2007050990A2 - Nucleic acid amplification using non-random primers - Google Patents

Nucleic acid amplification using non-random primers Download PDF

Info

Publication number
WO2007050990A2
WO2007050990A2 PCT/US2006/042250 US2006042250W WO2007050990A2 WO 2007050990 A2 WO2007050990 A2 WO 2007050990A2 US 2006042250 W US2006042250 W US 2006042250W WO 2007050990 A2 WO2007050990 A2 WO 2007050990A2
Authority
WO
WIPO (PCT)
Prior art keywords
population
oligonucleotides
nucleic acid
seq
hybridizing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2006/042250
Other languages
English (en)
French (fr)
Other versions
WO2007050990A3 (en
Inventor
John Castle
Christopher K. Raymond
Christopher Armour
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rosetta Inpharmatics LLC
Original Assignee
Rosetta Inpharmatics LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rosetta Inpharmatics LLC filed Critical Rosetta Inpharmatics LLC
Priority to CA002626977A priority Critical patent/CA2626977A1/en
Priority to JP2008538067A priority patent/JP5409005B2/ja
Priority to EP06827033A priority patent/EP1941058A4/en
Publication of WO2007050990A2 publication Critical patent/WO2007050990A2/en
Publication of WO2007050990A3 publication Critical patent/WO2007050990A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • the present invention relates to oligonucleotides useful for priming the amplification of nucleic acid molecules.
  • Amplification of nucleic acid molecules may be accomplished by reverse transcription (RT), in vitro transcription (IVT) or the polymerase chain reaction (PCR), either individually or in combination.
  • the starting nucleic acid molecules may be mRNA molecules, which are amplified by first synthesizing complementary cDNA molecules, then synthesizing second cDNA molecules that are complementary to the first cDNA molecules, thereby producing double stranded cDNA molecules.
  • the synthesis of first strand cDNA is typically accomplished using a reverse transcriptase and the synthesis of second strand cDNA is typically accomplished using a DNA polymerase.
  • the double stranded cDNA molecules may be used to make complementary RNA molecules using an
  • RNA polymerase resulting in amplification of the original starting mRNA molecules.
  • the RNA polymerase requires a promoter sequence to direct initiation of RNA synthesis.
  • Complementary RNA molecules may, for example, be used as a template to make additional complementary DNA molecules.
  • oligonucleotide primers that specifically hybridize to one or more target nucleic acid molecules in the starting material.
  • Each oligonucleotide primer may include a promoter sequence that is located 5' to the hybridizing portion of the oligonucleotide that hybridizes to the target nucleic acid molecule(s). If the hybridizing portion of an oligonucleotide is too short, then the oligonucleotide does not stably hybridize to a target nucleic acid molecule and priming and subsequent amplification does not occur.
  • the hybridizing portion of an oligonucleotide is too short, then the oligonucleotide does not specifically hybridize to one or a small number of target nucleic acid molecules, but non-specifically hybridizes to numerous target nucleic acid molecules.
  • Amplification of a complex mixture of different target nucleic acid molecules typically requires the use of a population of numerous oligonucleotides having different nucleic acid sequences.
  • the cost of the oligonucleotides increases with the length of the oligonucleotides.
  • oligonucleotide primers that selectively amplify desired nucleic acid molecules within a population of nucleic acid molecules (e.g., oligonucleotide primers that selectively amplify all mRNAs that are expressed in a cell except for the most highly expressed mRNAs).
  • the hybridizing portion of each oligonucleotide should be no longer than necessary to ensure specific hybridization to a desired target sequence under defined conditions.
  • the present invention provides methods for selectively amplifying a target population of nucleic acid molecules (e.g., all mRNA molecules expressed in a cell type except for the most highly expressed mRNA species).
  • the methods of this aspect of the invention each include the step of using a population of oligonucleotides to prime the amplification of a target population of nucleic acid molecules within a larger population of nucleic acid molecules.
  • the population of oligonucleotides is selected based on its ability to hybridize under defined conditions to a first subpopulation of a target nucleic acid population, but not to hybridize under the defined conditions to a second subpopulation of the target nucleic acid population.
  • the present invention provides populations of oligonucleotides including the nucleic acid sequences set forth in SEQ ID NOS: 1-933. These oligonucleotides can be used, for example, to prime the synthesis of cDNA molecules complementary to mRNA molecules isolated from mammalian blood without priming the synthesis of cDNA molecules complementary to globin mRNA or ribosomal RNA molecules.
  • each oligonucleotide in the population of oligonucleotides further comprises a defined sequence portion located 5' to the hybridizing portion.
  • the defined sequence portion comprises a transcriptional promoter, which may be used as a primer binding site in PCR amplification, or for in vitro transcription.
  • the defined sequence portion comprises a primer binding site that is not a transcriptional promoter.
  • the present invention provides populations of oligonucleotides wherein a transcriptional promoter, such as the T7 promoter (SEQ ID NO:934), is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5 ! to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides populations of oligonucleotides wherein the defined sequence portion comprises at least one primer binding site which is useful for priming a PCR synthesis reaction, and which does not include an RNA polymerase promoter sequence.
  • a representative example of a defined sequence portion for use in such embodiments is provided as 5' CCGAACTACCC ACTTGC ATT 3' (SEQ ID NO:956), which is preferably located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:l-933.
  • the present invention provides a reagent for selectively amplifying a target population of nucleic acid molecules (e.g., all mRNA molecules expressed in a cell type except for the most highly expressed mRNA species).
  • the reagent of this aspect of the invention comprises a population of oligonucleotides to prime the amplification of a target population of nucleic acid molecules, wherein each oligonucleotide comprises a hybridizing portion that consists of 6, 7, or 8 nucleotides.
  • the present invention provides a reagent comprising a population of oligonucleotides wherein the hybridizing portion is a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent comprising a population of oligonucleotides that includes at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent comprising populations of oligonucleotides wherein a defined sequence portion, such as a transcriptional promoter, (e.g., the T7 promoter (SEQ ID NO:934)) or a primer binding site (e.g., SEQ ID NO:956) is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • a transcriptional promoter e.g., the T7 promoter (SEQ ID NO:934)
  • a primer binding site e.g., SEQ ID NO:956
  • the present invention provides a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:l-933.
  • the present invention provides a kit for selectively amplifying a target population of nucleic acid molecules (e.g., all mRNA molecules expressed in a cell type except for the most highly expressed mRNA species).
  • the kit of this aspect of the invention includes a reagent comprising a population of oligonucleotides to prime the amplification of a target population of nucleic acid molecules, wherein each oligonucleotide comprises a hybridizing portion that consists of 6, 7, or 8 nucleotides.
  • the present invention provides a kit that includes a reagent comprising a population of oligonucleotides wherein the hybridizing portion is a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a kit including a reagent that comprises a population of oligonucleotides that includes at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a kit that includes a reagent comprising populations of oligonucleotides wherein a defined sequence portion, such as the transcriptional promoter, (e.g., the T7 promoter (SEQ ID NO:934)), is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • a defined sequence portion such as the transcriptional promoter, (e.g., the T7 promoter (SEQ ID NO:934)
  • the present invention provides a kit including a reagent that comprises populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate amplified RNA molecules.
  • the method comprises: (a) providing a population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and transcriptional promoter portion located 5 1 to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS:l-933, (b) annealing the population of oligonucleotides to a sample comprising mRNA isolated from a mammalian subject, (c) synthesizing cDNA from the mRNA using a reverse transcriptase enzyme, (d)synthesizing double stranded cDNA using a DNA polymerase; and (e) transcribing the double-stranded cDNA into RNA using an RNA polymerase that binds to the transcriptional promoter portion of each oligonucleot
  • the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate amplified DNA molecules.
  • the method comprises: (a) providing a first population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and a first PCR primer binding site located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-933, (b) annealing the population of oligonucleotides to a sample comprising mRNA isolated from a mammalian subject, (c)synthesizing cDNA from the mRNA using a reverse transcriptase enzyme, (d) synthesizing double stranded cDNA using a DNA polymerase and a second population of oligonucleotides, wherein each oligonucleotide comprises a random hybridizing portion and a second PCR binding site located 5' to the hybrid
  • FIGURE IA shows the number of exact matches for random 6-mers (N6) oligonucleotides on nucleotide sequences in the human RefSeq transcript database as described in EXAMPLE 2;
  • FIGURE IB shows the number of exact matches for Not-So-Random (NSR) 6-mer oligonucleotides on nucleotide sequences in the human RefSeq transcript database as described in EXAMPLE 2;
  • FIGURE 1C shows a representative embodiment of the methods of the invention for synthesizing a preparation of amplified RNA molecules using a mixture of NSR 6-mer oligonucleotides as described in EXAMPLE 4;
  • FIGURE ID shows a representative embodiment of the methods of the invention for synthesizing a preparation of amplified DNA molecules using a mixture of NSR 6-mer oligonucleotides as described in EXAMPLE 12;
  • FIGURE 2 is a histogram plot showing the number of NSR 6-mer binding sites per 100 nucleotides present in the human RefSeq transcript database as described in EXAMPLE 2;
  • FIGURE 3 is a histogram plot showing the yield of amplified RNA from
  • FIGURE 4 is a histogram plot showing the yield of amplified RNA from T7-NSR6-mer and T7-N8 primed cDNA for reporter and background genes as a function of primer and dNTP concentrations as described in EXAMPLE 7;
  • FIGURE 5 is a histogram plot showing the yield of amplified RNA from T7-NSR and T7-N7 primed cDNA as a function of the amount of input RNA template as described in EXAMPLE 9;
  • FIGURE 6 is a histogram plot on a linear scale showing the relative composition of T7-NSR and T7-N7 primed cDNA (normalized to N8) following amplification by in viti'o transcription as described in EXAMPLE 9;
  • FIGURE 7 is a histogram plot on a logarithmic scale showing the relative composition of T7-NSR and T7-N7 primed cDNA (normalized to N8) following amplification by in vitro transcription as described in EXAMPLE 9;
  • FIGURE 8 is a histogram plot of relative abundance of in vitro transcription products from T7-NSR-primed cDNA as a function of RNA template amount as described in EXAMPLE 9;
  • FIGURE 9 is a histogram plot of relative abundance of in vitro transcription products from T7-N7-primed cDNA as a function of RNA template amount as described in EXAMPLE 9;
  • FIGURE 10 graphically illustrates the correlation in expression values from a panel of 34 reporter genes as measured by quantitative PCR of T7-NSR-primed cDNA (x-axis) versus amplified DNA (aDNA) (y-axis) generated from T7-NSR-primed cDNA as described in EXAMPLE 12;
  • FIGURE 11 is a histogram plot of the gene specific activities of a panel of 10 reporter genes as measured by quantitative PCR of amplified DNA generated using a range of primer concentrations.
  • the present invention provides methods for selectively amplifying a target population of nucleic acid molecules.
  • the methods of this aspect of the invention each include the step of using a population of oligonucleotides to prime the amplification (e.g., by reverse transcription, in vitro transcription, or polymerase chain reaction (PCR), or a combination thereof) of a target population of nucleic acid molecules within a larger population of nucleic acid molecules, wherein (a) each oligonucleotide comprises a hybridizing portion that consists of 6 nucleotides, or 7 nucleotides, or 8 nucleotides; and (b) the population of oligonucleotides is selected to hybridize under defined conditions to a first subpopulation of a target nucleic acid population, but not hybridize under the defined conditions to a second subpopulation of the target nucleic acid population.
  • a population of oligonucleotides to prime the amplification (e.g., by reverse transcription, in vitro transcription
  • the population of oligonucleotides may also include a defined sequence portion located 5' to the hybridizing portion.
  • the defined sequence portion comprises a transcriptional promoter, which can also be used as a primer binding site. Therefore, in certain embodiments of this aspect of the invention, each oligonucleotide of the population of oligonucleotides comprises a hybridizing portion that consists of 6 nucleotides, or 7 nucleotides, or 8 nucleotides; and a transcriptional promoter portion located 5' to the hybridizing portion.
  • the defined sequence portion includes a first primer binding site for use in a PCR amplification reaction, and which may optionally include a transcriptional promoter.
  • the populations of oligonucleotides provided by the present invention are useful in the practice of the methods of this aspect of the invention.
  • a population of oligonucleotides (SEQ ID NOS:l-933), that each have a length of 6 nucleotides, was identified that can be used as primers to prime the amplification of all, or substantially all, mRNA molecules from mammalian blood cells, but that do not prime the amplification of globin mRNA or ribosomal RNAs from mammalian blood cells.
  • the identified population of oligonucleotides (SEQ ID NOS:l-933) is referred to as Not-So-Random (NSR) primers.
  • this population of oligonucleotides (SEQ ID NOS:l-933) can be used to prime the synthesis of a population of nucleic acid molecules (e.g., cDNAs) that are representative of a starting population of mRNA molecules isolated from mammalian blood cells, but that does not include a large number of cDNA molecules that correspond to globin rnRNAs or to ribosomal RNAs.
  • each oligonucleotide may include a hybridizing portion (selected from SEQ ID NOS: 1-933) that hybridizes to target nucleic acid molecules (e.g., mRNAs), and a promoter sequence located 5 ? to the hybridizing portion.
  • the promoter sequence may be incorporated into DNA molecules amplified using the oligonucleotides (that include the T7 promoter) as primers, and can thereafter promote transcription from the DNA molecules.
  • a defined sequence portion such as a transcriptional promoter may be covalently attached to the cDNA molecule, for example, by DNA ligase enzyme.
  • the first subpopulation of a target nucleic acid population can include, for example, all mRNAs expressed in a cell or tissue except for a selected group of mRNAs, such as, for example, the most abundantly expressed mRNAs.
  • An abundantly expressed mRNA typically constitutes at least 0.1% of all the mRNA expressed in the cell or tissue (and may constitute, for example, more than 50%, or more than 60%, or more than 70% of all the mRNA expressed in the cell or tissue).
  • An example of an abundantly expressed mRNA is globin mRNA in certain blood cells.
  • Useful transcription promoter sequences include the T7 promoter (5'AATTAATACGACTCACTATAGGGAGAS') (SEQ ID NO:934)), the SP6 promoter (5'ATTTAGGTGACACTATAGAAGNGS' (SEQ ID NO:935)), and the T3 promoter (5 ⁇ ATTAACCCTCACTAAAGGGAGA3' (SEQ ID NO:936)).
  • the methods of the invention are useful for transcriptome profiling of total RNA in a biological sample, such as whole blood, in which it is desirable to reduce the presence of a group of mRNAs (that do not hybridize to the NSR primers) from an amplified sample, such as, for example, highly expressed RNAs (e.g.
  • the methods of the invention may be used to reduce the amount of a group of nucleic acid molecules that do not hybridize to the NSR primers in amplified nucleic acid derived from an mRNA sample by at least 2 fold up to 1000 fold, such as at least 10 fold, 50 fold, 100 fold, 500 fold, or greater, in comparison to the amount of amplified nucleic acid molecules that do hybridize to the NSR primers.
  • Populations of oligonucleotides used to practice the method of this aspect of the invention are selected from within a larger population of oligonucleotides, wherein (a) the subpopulation of oligonucleotides is selected based on its ability to hybridize under defined conditions to a first subpopulation of a target nucleic acid population, but not hybridize under the defined conditions to a second subpopulation of the target nucleic acid population; and (b) the population of oligonucleotides comprises all possible oligonucleotides having a length of 6 nucleotides, 7 nucleotides, or 8 nucleotides.
  • the population of oligonucleotides includes all possible oligonucleotides having a length of 6 nucleotides, or 7 nucleotides, or 8 nucleotides.
  • the population of oligonucleotides may include only all possible oligonucleotides having a length of 6 nucleotides, or all possible oligonucleotides having a length of 7 nucleotides, or all possible oligonucleotides having a length of 8 nucleotides.
  • the population of oligonucleotides may include other oligonucleotides in addition to all possible oligonucleotides having a length of 6 nucleotides, or all possible oligonucleotides having a length of 7 nucleotides, or all possible oligonucleotides having a length of 8 nucleotides.
  • each member of the population of oligonucleotides is no more than 30 nucleotides long.
  • Sequences of population of oligonucleotides There are 4,096 possible oligonucleotides having a length of 6 nucleotides; 16,384 possible oligonucleotides having a length of 7 nucleotides; and 65,536 possible oligonucleotides having a length of 8 nucleotides.
  • the sequences of the oligonucleotides that constitute the population of oligonucleotides can readily be generated by a computer program, such as Microsoft Word. Selection of subpopulation of oligonucleotides.
  • the subpopulation of oligonucleotides is selected from the population of oligonucleotides based on the ability of the members of the subpopulation of oligonucleotides to hybridize, under defined conditions, to a first subpopulation of a target nucleic acid population, but not hybridize under the same defined conditions to a substantial number of members of a second subpopulation of the target nucleic acid population.
  • a target nucleic acid population is a population of nucleic acid molecules (e.g., mRNA or DNA molecules) that includes nucleic acid molecules that are to be amplified (e.g., using reverse transcription, in vitro transcription, the polymerase chain reaction, or a combination thereof) to produce amplified RNA, single stranded DNA 5 or double stranded DNA 5 and also includes nucleic acid molecules that are not to be amplified.
  • nucleic acid molecules e.g., mRNA or DNA molecules
  • nucleic acid molecules that are to be amplified e.g., using reverse transcription, in vitro transcription, the polymerase chain reaction, or a combination thereof
  • the subpopulation of oligonucleotides is made up of oligonucleotides that each hybridize, under defined conditions, to sequences distributed throughout the population of the nucleic acid molecules that are to be amplified, but that do not hybridize, under the same defined conditions, to most (or any) of the nucleic acid molecules that are not to be amplified.
  • the subpopulation of oligonucleotides hybridizes, under defined conditions, to target nucleic acid sequences other than those that have been intentionally avoided.
  • the population of all mRNA molecules expressed in mammalian blood cells can be a target population of nucleic acid molecules.
  • This target population contains many mRNA molecules that encode globin proteins.
  • This target population also contains many ribosomal RNA molecules (e.g., 5S, 18S, and 28S ribosomal RNAs). It is typically undesirable to amplify the globin mRNAs or the ribosomal RNAs.
  • amplification of numerous copies of abundant globin mRNAs, or ribosomal RNAs may obscure subtle changes in the levels of less abundant mRNAs.
  • a subpopulation of oligonucleotides is selected that does not hybridize, under defined conditions, to most (or any) globin mRNAs or to most (or any) ribosomal RNAs, but that does hybridize, under the same defined conditions, to most (preferably all) of the other mRNA molecules expressed in the blood cells.
  • blood cells include leukocytes (e.g., neutrophils, eosinophils, basophils, lymphocytes, and monocytes), erythrocytes, and platelets.
  • the second subpopulation includes globin mRNAs and ribosomal RNAs
  • a suitable software program is then used to compare the sequences of all of the oligonucleotides in the population of oligonucleotides (e.g., the population of all possible 6 nucleic acid oligonucleotides) to the sequences of the globin mRNA(s) and ribosomal RNAs to determine which of the oligonucleotides will hybridize to any portion of the globin mRNA(s) and ribosomal RNAs under defined hybridization conditions. Only the oligonucleotides that do not hybridize to any portion of the globin mRNA(s) and ribosomal RNAs, under defined hybridization conditions, are selected. Perl script may easily be written that permits comparison of nucleic acid sequences, and identification of sequences that hybridize to each other under defined hybridization conditions.
  • the subpopulation of all possible 6 nucleic acid oligonucleotides that were not exactly complementary to any portion of any ribosomal RNA sequence or that were not exactly complementary to any portion of a globin mRNA sequence were identified.
  • the subpopulation of oligonucleotides (that hybridizes under defined conditions to a first subpopulation of a target nucleic acid population, but does not hybridize under the defined conditions to a second subpopulation of the target nucleic acid population) must contain enough different oligonucleotide sequences to hybridize to all, or substantially all, nucleic acid molecules in the target nucleic acid population.
  • Example 2 herein shows that the population of oligonucleotides having the nucleic acid sequences set forth in SEQ ID NOS: 1-933 hybridizes to all, or substantially all, nucleic acid sequences within a population of gene transcripts stored in the publicly accessible database called RefSeq.
  • the selected subpopulation of oligonucleotides can be used to prime the amplification of a target population of nucleic acid molecules.
  • a population of oligonucleotides can be used as primers wherein each oligonucleotide includes the sequence of one member of the selected subpopulation of oligonucleotides, and also includes an additional defined nucleic acid sequence.
  • the additional defined nucleic acid sequence is typically located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
  • the population of oligonucleotides includes the sequences of all members of the selected subpopulation of oligonucleotides (e.g., the population of oligonucleotides can include all of the sequences set forth in SEQ ID NOS: 1-933).
  • each oligonucleotide can include a transcriptional promoter sequence located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
  • the promoter sequence may be incorporated into the amplified nucleic acid molecules which can, therefore, be used as templates for the synthesis of RNA.
  • Any RNA polymerase promoter sequence can be included in the defined sequence portion of the population of oligonucleotides. Representative examples include the T7 promoter (SEQ ID NO:934), the SP6 promoter (SEQ ID NO:935), and the T3 promoter (SEQ ID NO:936).
  • each oligonucleotide can include a defined sequence comprising a primer binding site located 5' to the sequence of the member of the selected subpopulation of oligonucleotides.
  • the primer binding site is incorporated into the amplified nucleic acids which can then be used as a PCR primer binding site for the generation of double-stranded amplified DNA products from the cDNA.
  • the primer binding site may be a portion of a transcriptional promoter sequence, as shown for example in TABLE 35. Alternatively, the primer binding site may not include a portion of a transcriptional promoter sequence, (e.g., SEQ ID NO:956, as described in Example 11).
  • one embodiment of the present invention provides a population of oligonucleotides wherein each oligonucleotide of the population includes: (a) a sequence of a 6 nucleic acid oligonucleotide that is a member of a subpopulation of oligonucleotides (SEQ ID NOS: 1-933), wherein the subpopulation of oligonucleotides hybridizes to all, or substantially all, mRNAs expressed in mammalian blood cells, but does not hybridize to globin mRNAs or to ribosomal RNAs; and (b) a T7 transcriptional promoter sequence (SEQ ID NO:934) located 5' to the sequence of the 6 nucleic acid oligonucleotide.
  • SEQ ID NOS: 1-933 a subpopulation of oligonucleotides
  • the population of oligonucleotides includes all of the 6 nucleotide sequences set forth in SEQ ID NOS: 1-933. In another embodiment, the population of oligonucleotides includes at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS:l-933.
  • a spacer portion is located between the defined sequence portion and the hybridizing portion.
  • the spacer portion is typically from 1 to 12 nucleotides long (e.g., from 1 to 6 nucleotides long) and can include any combination of nucleotides.
  • the spacer portion can, for example, be composed of a random selection of nucleotides. All or part of the spacer portion may, or may not, hybridize to the same target nucleic acid sequence as the hybridizing portion. If all, or part, of the spacer portion hybridizes to the same target nucleic acid sequence as the hybridizing portion, then the effect is to enhance the efficiency of cDNA synthesis primed by the oligonucleotide that includes the hybridizing portion and the hybridizing spacer portion.
  • a subpopulation of oligonucleotides is selected from a population of oligonucleotides based on the ability of the members of the subpopulation of oligonucleotides to hybridize, under defined conditions, to a first subpopulation of a target nucleic acid population, but not hybridize under the same defined conditions to a second subpopulation of the target nucleic acid population.
  • the defined hybridization conditions permit the oligonucleotides to specifically hybridize to all nucleic acid molecules that are present in the sample except for globin mRNAs or ribosomal RNAs.
  • hybridization conditions are no more than 25 € to 3CPC (for example, ICPC) below the melting temperature (Tm) of the native duplex.
  • Tm melting temperature
  • exemplary hybridization conditions are 5 to ICPC below Tm.
  • the Tm of a short oligonucleotide duplex is reduced by approximately (500/oligonucleotide lengtbJC.
  • the hybridization temperature is in the range of from 4OC to 5CPC.
  • the appropriate hybridization conditions may also be identified empirically, without undue experimentation.
  • Amplification Conditions In the practice of the present invention, the amplification of the first subpopulation of a target nucleic acid population occurs under defined amplification conditions. Hybridization conditions can be chosen as described, supra. Typically, the defined amplification conditions include first strand cDNA synthesis using a reverse transcriptase enzyme. The reverse transcription reaction is performed in the presence of defined concentrations of deoxynucleoside triphosphates (dNTPs).
  • dNTPs deoxynucleoside triphosphates
  • the dNTP concentration is in a range from about 1000 to about 2000 microMolar in order to enrich the amplified product for target genes, as described in Examples 5-9.
  • An oligonucleotide primer useful in the practice of the present invention can be DNA, RNA, PNA, chimeric mixtures, or derivatives or modified versions thereof, so long as it is still capable of priming the desired reaction.
  • the oligonucleotide primer can be modified at the base moiety, sugar moiety, or phosphate backbone, and may include other appending groups or labels, so long as it is still capable of priming the desired amplification reaction.
  • an oligonucleotide primer may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fmorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueo
  • an oligonucleotide primer can include at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • an oligonucleotide primer can include at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal, or analog thereof.
  • An oligonucleotide primer for use in the methods of the present invention may be derived by cleavage of a larger nucleic acid fragment using non-specific nucleic acid cleaving chemicals or enzymes, or site-specific restriction endonucleases, or by synthesis by standard methods known in the art, for example, by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.) and standard phosphoramidite chemistry.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (Nucl. Acids Res.
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., Proc. Natl. Acad. ScL U.S.A. 55:7448-7451, 1988).
  • the desired oligonucleotide is synthesized, it is cleaved from the solid support on which it was synthesized, and treated, by methods known in the art, to remove any protecting groups present.
  • the oligonucleotide may then be purified by any method known in the art, including extraction and gel purification.
  • concentration and purity of the oligonucleotide may be determined by examining an oligonucleotide that has been separated on an acrylamide gel, or by measuring the optical density at 260 nm in a spectrophotometer.
  • the methods of this aspect of the invention can be used, for example, to selectively amplify coding regions of mRNAs, introns, alternatively spliced forms of a gene, and non-coding RNAs that regulate gene expression.
  • the present invention provides populations of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the nucleic acid sequences set forth in SEQ ID NOS: 1-933.
  • These oligonucleotides can be used, for example, to prime the synthesis of cDNA molecules complementary to mRNA molecules isolated from mammalian blood without priming the synthesis of cDNA molecules complementary to globin mRNA or ribosomal RNA molecules.
  • these oligonucleotides can be used, for example, to prime the synthesis of cDNA using any population of mRNA molecules as templates, without amplifying a significant amount of globin mRNAs or ribosomal RNAs.
  • the present invention provides populations of oligonucleotides wherein a defined sequence portion, such as a transcriptional promoter, such as the T7 promoter (SEQ ID NO:934), is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the population of oligonucleotides includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent for selectively amplifying a target population of nucleic acid molecules.
  • the reagent can be used, for example, to prime the synthesis of cDNA molecules complementary to mRNA molecules isolated from mammalian blood cells without priming the synthesis of cDNA molecules complementary to globin mRNA or ribosomal RNA molecules.
  • the reagent of the present invention comprises a population of oligonucleotides comprising at least 10% of the nucleic acid sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent comprising a population of oligonucleotides that includes at least 10% (such as 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS: 1-933.
  • the population of oligonucleotides is selected to hybridize to substantially all nucleic acid molecules that are present in a sample except for globin mRNAs or ribosomal RNAs.
  • the population of oligonucleotides is selected to hybridize to a subset of nucleic acid molecules that are present in a sample, wherein the subset of nucleic acid molecules does not include globin mRNAs or ribosomal RNAs.
  • the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a transcriptional promoter, such as the T7 promoter, is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent that comprises a population of oligonucleotides wherein a defined sequence portion comprising a primer binding site is located 5' to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the present invention provides a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the primer binding site (SEQ ID NO:956) located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS:l-933.
  • the reagent of the present invention can be provided as an aqueous solution, or an aqueous solution with the water removed, or a lyophilized solid.
  • the reagent of the present invention may include one or more of the following components for the production of double-stranded cDNA: a reverse transcriptase, a DNA polymerase, a DNA ligase, a RNase H enzyme, a Tris buffer, a potassium salt, a magnesium salt, an ammonium salt, a reducing agent, deoxynucleoside triphosphates (dNTPs), [beta] -nicotinamide adenine dinucleotide ( ⁇ -NAD+), and a ribonuclease inhibitor.
  • dNTPs deoxynucleoside triphosphates
  • ⁇ -NAD+ [beta] -nicotinamide adenine dinucleotide
  • the reagent may include components optimized for first strand cDNA synthesis, such as a reverse transcriptase with reduced RNase H activity and increased thermal stability (e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen), and a final concentration of dNTPs in the range of from 50 to 5000 microMolar, or more preferably in the range of from 1000 to 2000 microMolar.
  • a reverse transcriptase with reduced RNase H activity and increased thermal stability e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen
  • a final concentration of dNTPs in the range of from 50 to 5000 microMolar, or more preferably in the range of from 1000 to 2000 microMolar.
  • kits for selectively amplifying a target population of nucleic acid molecules comprise a reagent that comprises a population of oligonucleotides wherein a defined sequence portion, such as a transcriptional promoter, (e.g., the T7 promoter), is located 5 ! to a member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • a transcriptional promoter e.g., the T7 promoter
  • kits containing a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of the T7 promoter (SEQ ID NO:934) located 5' to a different member of the population of oligonucleotides having the sequences set forth, in SEQ ID NOS: 1-933.
  • the kits according to this embodiment are useful for producing in vitro transcribed RNA from cDNA generated using the not-so-random primers of the invention.
  • kits contain a reagent comprising populations of oligonucleotides wherein each oligonucleotide consists of a defined sequence suitable for use as a primer binding site located 5' to a different member of the population of oligonucleotides having the sequences set forth in SEQ ID NOS: 1-933.
  • the kits according to this embodiment are useful for producing double-stranded DNA generated from PCR amplification of cDNA generated using the not-so-random primers of the invention.
  • kits of the invention may be designed to detect any subpopulation of a target nucleic acid population, for example, all mRNAs expressed in a cell or tissue except for the most abundantly expressed mRNAs, in accordance with the methods described herein.
  • a target nucleic acid population for example, all mRNAs expressed in a cell or tissue except for the most abundantly expressed mRNAs, in accordance with the methods described herein.
  • mammalian mRNA target molecules include all or substantially all of the mRNA molecules from mammalian blood cells.
  • Nonlimiting examples of exemplary oligonucleotide primers include SEQ ID NOS:l-933.
  • Nonlimiting examples of the transcription promoter are set forth as
  • the spacer portion may include any combination of nucleotides, including nucleotides that hybridize to the target mRNA.
  • the kit comprises a reagent comprising oligonucleotide primers with hybridizing portions of 6, 7, or 8 nucleotides.
  • the kit comprises a reagent comprising a population of oligonucleotide primers that may be used to detect a plurality of mammalian mRNA targets.
  • the kit comprises oligonucleotides that hybridize in the temperature range of from 4CPC to 5CPC.
  • the kit comprises a subpopulation of oligonucleotides that do not detect rRNA or globin mRNA.
  • Exemplary oligonucleotides for use in accordance with this embodiment of the kit are provided in SEQ ID NOS:l-933.
  • the kits comprises a reagent comprising a population of oligonucleotides comprising at least 10% (such as at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%) of the 6 nucleotide sequences set forth in SEQ ID NOS:l-933.
  • the kit includes oligonucleotides wherein the transcription promoter comprises the T7 promoter (SEQ ID NO:934), the SP6 promoter (SEQ ID NO:935), or the T3 promoter (SEQ ID NO:936).
  • the kit may comprise oligonucleotides with a spacer portion of from 1 to 12 nucleotides that comprises any combination of nucleotides.
  • the kit may further comprise one or more of the following components for the production of cDNA — a reverse transcriptase enzyme, a DNA polymerase enzyme, a DNA ligase enzyme, a RNase H enzyme, a Tris buffer, a potassium salt (e.g., potassium chloride), a magnesium salt (e.g., magnesium chloride), an ammonium salt (e.g., ammonium sulfate), a reducing agent (e.g., dithiothreitol), deoxynucleoside triphosphates (dNTPs), [beta] -nicotinamide adem ' ne dinucleotide ( ⁇ -NAD+), and a ribonuclease inhibitor.
  • a reverse transcriptase enzyme e.g., potassium chloride
  • the kit may include components optimized for first strand cDNA synthesis, such as a reverse transcriptase with reduced RNase H activity and increased thermal stability (e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen), and a dNTP stock solution to provide a final concentration of dNTPs in the range of from 50 to 5,000 microMolar, or more preferably in the range of from 1000 to 2000 microMolar.
  • a reverse transcriptase with reduced RNase H activity and increased thermal stability e.g., SuperscriptTM III Reverse Transcriptase, Invitrogen
  • a dNTP stock solution to provide a final concentration of dNTPs in the range of from 50 to 5,000 microMolar, or more preferably in the range of from 1000 to 2000 microMolar.
  • the kit may include a detection reagent such as SYBR green dye or BEBO dye that preferentially or exclusively binds to double stranded DNA during a PCR amplification step.
  • the kit may include a forward and/or reverse primer that includes a fluorophore and quencher to measure the amount of the PCR amplification products.
  • kits of the invention can also provide reagents for in vitro transcription of the amplified cDNAs.
  • the kit may further include one or more of the following components — a RNA polymerase enzyme, an IPPase (Inositol polyphosphate 1 -phosphatase) enzyme, a transcription buffer, a Tris buffer, a sodium salt (e.g., sodium chloride), a magnesium salt (e.g., magnesium chloride), spermidine, a reducing agent (e.g., dithiothreitol), nucleoside triphosphates (ATP, CTP, GTP, UTP), and amino-allyl-UTP.
  • the kit may include reagents for labeling the in vitro transcription products with Cy3 or Cy5 dye for use in hybridizing the labeled cDNA samples to microarrays.
  • the kit optionally includes instructions for using the kit in the selective amplification of mRNA targets.
  • the kit can also be optionally provided with instructions for in vitro transcription of the amplified cDNA molecules, and with instructions for labeling and hybridizing the in vitro transcription products to microarrays.
  • the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate amplified RNA ⁇ molecules.
  • the method comprises: (a) providing a population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and transcriptional promoter portion located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-933, (b) annealing the population of oligonucleotides to a sample comprising mRNA isolated from a mammalian subject, (c) synthesizing cDNA from the mRNA using a reverse transcriptase enzyme, (d)synthesizing double stranded cDNA using a DNA polymerase; and (e) transcribing the double-stranded cDNA into RNA using an RNA polymerase that binds to the transcriptional promoter portion of each oligonucleo
  • the present invention provides methods of selectively amplifying a target population of nucleic acid molecules to generate amplified DNA molecules.
  • the method comprises: (a) providing a first population of oligonucleotides, wherein each oligonucleotide comprises a hybridizing portion and a first PCR primer binding site located 5' to the hybridizing portion, wherein the hybridizing portion is a member of the population of oligonucleotides comprising SEQ ID NOS: 1-933, (b) annealing the population of oligonucleotides to a sample comprising mRNA isolated from a mammalian subject, (c)synthesizing cDNA from the mRNA using a reverse transcriptase enzyme, (d) synthesizing double stranded cDNA using a DNA polymerase and a second population of oligonucleotides, wherein each oligonucleotide comprises a random hybridizing portion and a second PCR binding site located 5' to the hybrid
  • any DNA-dependent DNA polymerase may be utilized to synthesize second-strand DNA molecules from the first strand cDNA.
  • the Klenow fragment of DNA Polymerase I can be utilized to synthesize the second-strand DNA molecules.
  • the synthesis of second-strand DNA molecules is primed using a second population of oligonucleotides comprising a hybridizing portion consisting of from 6 to 9 random nucleotides and further comprising a defined sequence portion 5' to the hybridizing portion.
  • the defined sequence portion may include any suitable sequence, provided that the sequence differs from the defined sequence contained in the first population of oligonucleotides.
  • these defined sequence portions can be used, for example, to selectively direct DNA-dependent RNA synthesis from the second DNA molecule and/or to amplify the double-stranded cDNA template via DNA-dependent DNA synthesis.
  • the second DNA molecules yields a population of double-stranded DNA molecules wherein the first DNA molecules are hybridized to the second DNA molecules, as shown in FIGURE ID.
  • the double-stranded DNA molecules are purified to remove substantially all nucleic acid molecules shorter than 50 base pairs, including all, or substantially all (i.e., typically more than 99%), of the second primers.
  • the purification method selectively purifies DNA molecules that are substantially double-stranded and removes substantially all unpaired, single-stranded nucleic acid molecules, such as single-stranded primers. Purification can be achieved by any art-recognized means, such as by elution through a size-fractionation column.
  • the purified, second DNA molecules can then, for example, be precipitated and redissolved in a suitable buffer for the next step of the methods of this aspect of the invention.
  • Amplification of the double-stranded DNA molecules In the practice of the methods of this aspect of the invention, the double-stranded DNA molecules are utilized as templates that are enzymatically amplified using the polymerase chain reaction. Any suitable primers can be used to prime the polymerase chain reaction. Typically two primers are used, one primer hybridizes to the defined portion of the first primer sequence .(or to the complement thereof); and the other primer hybridizes to the defined portion of the second primer sequence (or to the complement thereof).
  • a desirable number of amplification cycles is between 5 and 40 amplification cycles, such as from five to 35, such as from 10 to 30 amplification cycles.
  • a cycle comprises a melting temperature, such as 95C; an annealing temperature, which varies from about 4CPC to
  • the annealing temperature is from about 55 3 C to 65 0 C, more preferably about 6(PC.
  • amplification conditions for use in this aspect of the invention comprise 10 cycles of (95 0 C, 30 sec; 6(PC, 30 sec; 72PC, 60 sec), then 20 cycles of (95 0 C, 30 sec; 6O 3 C, 30 sec, 72PC, 60 sec (+ 10 sec added to the elongation step with each cycle)).
  • dNTPs are typically present in the reaction in a range from 5OuM to 2000 ⁇ M dNTPs, and more preferably from 800 to 1000
  • MgCl 2 is typically present in the reaction in a range from 0.25 mM to 10 mM, and more preferably about 4 mM.
  • the forward and reverse PCR primers are typically present in the reaction from about 50 nM to 2000 nM, and more preferably present at a concentration of about 1000 nM.
  • the amplified DNA molecules can be labeled with a dye molecule to facilitate use as a probe in a hybridization experiment, such as a probe used to screen a DNA chip.
  • a dye molecule to facilitate use as a probe in a hybridization experiment, such as a probe used to screen a DNA chip.
  • Any suitable dye molecules can be utilized, such as fluorophores and chemiluminescers.
  • An exemplary method for attaching the dye molecules to the amplified DNA molecules is provided in EXAMPLE 15.
  • the methods according this aspect of the invention may be used, for example, for transcriptome profiling in a biological sample containing total RNA, such as whole blood.
  • the amplified DNA produced in accordance with the methods of this aspect of the invention is labeled for use in gene expression experiments, thereby providing a hybridization based reagent that typically produces a lower level of background than amplified RNA generated from NSR-primed cDNA.
  • the defined sequence portion of the first and/or second primer binding regions further includes one or more restriction enzyme sites, thereby generating a population of amplifed double-stranded DNA products having one or more restriction enzyme sites flanking the amplified portions.
  • These amplified products may be used directly for sequence analysis, or may be released by digestion with restriction enzymes and subcloned into any desired vector, such as an expression vector for further analysis.
  • the following examples merely illustrate the best mode now contemplated for practicing the invention, but should not be construed to limit the invention.
  • This Example describes the selection of a population of 933 6-mer oligonucleotides (SEQ ID NOS: 1-933) that hybridizes to all, or substantially all, mRNA molecules expressed in blood cells, but that does not hybridize to globin mRNA or to ribosomal RNA.
  • each nucleotide was A, T (or U), C, or G.
  • the reverse complement of each 6-mer oligonucleotide was compared to the nucleotide sequences of 18S and 28S rRNAs, and to the nucleotide sequences of the following six hemoglobin genes, selected based on their high level of expression in blood samples:
  • Reverse-complement 6-mer oligonucleotides having perfect matches to any of the eight transcript sequences were eliminated.
  • the reverse complements of 933 6-mers (SEQ ID NOS: 1-933) did not perfectly match any portion of the globin or rRNA transcripts.
  • the 933 6-mer oligonucleotides (SEQ ID NOS: 1-933) that do not have a perfect match to any portion of the globin or rRNA genes are referred to as "Not-So- Random" (“NSR”) primers.
  • This Example shows that the population of oligonucleotides having the nucleic acid sequences set forth in SEQ ID NOS: 1-933 hybridize to every 4 to 5 nucleotides on a nucleic acid sequence within the RefSeq database accessible at the website of the National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894, U.S.A. NCBI's reference sequence transcript database (RefSeq) contains what is considered a gold-standard of human protein coding transcripts.
  • NCBI National Center for Biotechnology Information
  • RefSeq reference sequence transcript database
  • Random 6-mers can anneal at every nucleotide position on a transcript sequence from the RefSeq database (represented as "nucleotide sequence"), as shown in FIGURE IA.
  • the remaining NSR oligonucleotides show a perfect match to every 4 to 5 nucleotides on nucleic acid sequences within the RefSeq database (represented as “nucleotide sequence"), as shown in FIGURE IB.
  • NSR oligonucleotide binding sites are not present in the hemoglobin genes (represented as “A” in FIGURE T).
  • One atypical gene family (represented as “B” in FIGURE 2) consisting of 3 genes (LCElA, CLElD, LCElF) contains only four NSR 6-mer binding sites per 100 nucleotides).
  • RefSeq transcripts typically have anywhere from 5 to 30 NSR oligonucleotide (SEQ ID NOS: 1-933) binding sites per 100 nucleotides, with most transcripts having 15-20 NSR binding sites per 100 nucleotides (represented as "C” in FIGURE 2).
  • the population of 933 6-mers (SEQ ID NOS: 1-933) is capable of amplifying all transcripts except 18S, 28S, and hemoglobin transcripts.
  • EXAMPLE 3 is capable of amplifying all transcripts except 18S, 28S, and hemoglobin transcripts.
  • This Example shows that PCR amplification of an actin reporter mRNA using the
  • MMLV (Moloney Murine Leukemia Virus) reverse transcriptase (Epicentre Biotechnologies, Madison, WI) was used to synthesize cDNA from 100 ng of template RNA with 5 ⁇ M 6-mers (SEQ ID NOS:l-933) (T7-NSR6) or random 9-mers with the T7 promoter covalently attached at the 5' end (T7-N9).
  • 5 ⁇ L of water containing primers and template were denatured at 65C for 5 min, snap cooled at ⁇ C and equilibrated to 23 ⁇ C.
  • RT master mix containing 1 ⁇ l of water, 2 ⁇ l of 5X First Strand Buffer (250 niM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl 2 ; Invitrogen Corporation, Carlsbad, CA), 0.5 ⁇ l of 100 mM DTT, 0.5 ⁇ l of 10 mM dNTPs and 1.0 ⁇ l of MMLV reverse transcriptase (50 units/ ⁇ l) was added to the sample mix. The 10 ⁇ l reaction was incubated at 40 € for 120 min, 95O for 5 min, cooled to room temperature, and diluted 5 -fold with water.
  • 5X First Strand Buffer 250 niM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl 2 ; Invitrogen Corporation, Carlsbad, CA
  • 0.5 ⁇ l of 100 mM DTT 0.5 ⁇ l of 10 mM dNTPs
  • T7-NSR 6 primed cDNA showed reduced abundance of alpha globin (58% reduction), beta globin (85% reduction) and 18S rRNA (75% reduction) as compared to cDNA generated with random 9-mers (T7-N9).
  • T7-NSR6 primed cDNA showed reduced abundance of beta globin (HBB) (94% reduction), and 18S rRNA (91% reduction), as compared to cDNA generated with random 9-mers.
  • beta actin cDNA levels for the two primer pools were comparable after amplification of RNA, a result that was confirmed using three independent donors (data not shown).
  • the amplification experiment was conducted as follows. Total RNA and mRNA were obtained from Ambion, Inc. (Austin, TX) for the cell lines Jurkat (T lymphocyte, ATCC No.
  • RNA amplified RNA
  • NSR cDNA was synthesized from 1 ⁇ g of total RNA and 5 ⁇ M primer in a 20 ⁇ L reaction volume as described in Example 3, but with a prolonged incubation step at 4OC for 6 hrs.
  • cDNA was synthesized from 100 ng of mRNA using 10 ⁇ M random 9-mer in a 20 ⁇ L reaction volume as described in Example 3.
  • the 933 6-mers (SEQ ID NOS: 1-933) and the random 9-mers were covalently linked to the T7 promoter sequence (SEQ ID NO: 934) at the 5' end.
  • the 20 ⁇ L RT reaction was added to 60 ⁇ L of IVT pre-mix containing 16 ⁇ L of 5X Transcription Buffer (0.2 M Tris-HCl, pH 7.5, 50 mM NaCl, 30 mM MgCl 2 , and 10 mM spermidine; Epicentre Biotechnologies, Madison, WI), 6 ⁇ L of 100 mM DTT, 3.3 ⁇ L of 200 mM MgCl 2 , 8 ⁇ L of NTP (25 mM ATP, 25 mM CTP, 25 mM GTP, 6 mM UTP), 2 ⁇ L of 75 mM amino allyl-UTP, 0.6 ⁇ L of IPPase (2 U ⁇ L), 0.08 ⁇ L of T7 RNA polymerase (2.5 kU/ ⁇ L), 24 ⁇ L of water and incubated for 16 hrs at 4CPC, 5 min at 7CPC, and cooled to room temperature.
  • 5X Transcription Buffer 0.2 M Tris
  • Custom high density oligonucleotide arrays were obtained from Agilent
  • Probe sequences were selected on the basis of nucleotide composition and cross-hybridization potential, and positioned at least
  • NSR primers comprising SEQ ID NOS: 1-933 (that each have the T7 promoter (SEQ ID NO:934) covalently attached at the 5' end), relative to globin mRNA and rRNA.
  • NSR primers were used in this Example as follows:
  • the 933 6-mers (SEQ ID NOS:l-933) plus a single random nucleotide inserted between the 6-mer sequence and the T7 promoter (SEQ ID NO:934), referred to as "NSR7.”
  • MMLV reverse transcriptase Superscript IIITM (“SSIII"), Invitrogen Corporation, Carlsbad, CA
  • SSIII Superscript IIITM
  • First strand synthesis was performed as described in Example 3, except that the reaction volume was 20 ⁇ L, 2 ⁇ L SSIII reverse transcriptase (200 units/ ⁇ l) was added to the reaction mix, and the concentration of dNTPs varied from 500 to 5,000 ⁇ M.
  • the reaction was incubated at 4CPC for 120 min, 7CPC for 15 min, cooled to room temperature, and diluted two-fold with 10 mM Tris pH 7.6, 0.1 rnM EDTA.
  • qPCR was performed as described in Example 3, except that ABI TaqMan assays for human insulin growth factor one receptor (IGFRlR) (ABI Catalog # Hs00181385) and human glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) (ABI Catalog # 43100884E-0507028) were substituted for human beta actin as reporters.
  • IGFRlR human insulin growth factor one receptor
  • GPDH human glyceraldehyde-3 -phosphate dehydrogenase
  • the ratios of reporters to backgrounds were then calculated for the NSR7 and N8 primer pools. As shown in Tables 7 and 8, the NSR7-primed reporter/background ratio increased dramatically with increasing dNTP concentrations.
  • the ratios of ratios is a comparison of reporter to background ratios for the NSR7 and N8 primer pools, and measures the specificity of the NSR-primed reactions. As shown in Table 9 and Table 10, the ratios of ratios increased dramatically at higher dNTP concentrations.
  • the yield ratio measures the output of cDNA conversion primed by NSR7 versus N8, expressed as a percentage (NSR divided by N8).
  • NSR the number of cDNA conversion primed by NSR7 versus N8, expressed as a percentage (NSR divided by N8).
  • the NSR to N8 yield ratio was substantially higher for the IGFlR and GAPDH reporters than for the rRNA and globin niRNA.
  • the ratio was relatively constant across dNTP concentrations for the IGFlR and GAPDH reporters, but decreased with increasing dNTP concentrations for the rRNA and globin genes, consistent with enrichment of reporters at higher dNTP concentrations.
  • this example shows that the absolute yields of cDNA primed with the NSR7 primers (comprising SEQ ID NOS:l-933) were highest at low dNTP concentrations, whereas the specificity relative to random 8-mers increased at higher dNTP concentrations. Based on this data, it appears that the optimal concentration of dNTPs to achieve high yield and high specificity is in the range of about 1000 to about 2000 ⁇ M dNTPs.
  • NSR primers comprising SEQ ID NOS: 1-933
  • T7 promoter SEQ ID NO:934
  • IVTT in vitro transcription
  • First strand cDNA synthesis was performed as described in Example 5 using 1000 ⁇ M dNTPs, and 50 ng, 100 ng, and 200 ng of whole blood total RNA template with the NSR7 primer pool. 100 ng of RNA template was used with random 7-mers that each have the T7 promoter (SEQ ID NO: 934) covalently attached at the 5' end (T7-N7) and random 8-mer (N8) primers.
  • Second-Strand Reaction Buffer 10O mM Tris-HCl (pH 6.9), 450 mM KCl, 23 mM MgCl 2 , 0.75 mM ⁇ -NAD+ 50 niM (NH 4 ) 2 SO 4 ) 3 ⁇ L
  • the double stranded cDNA template was amplified by in vitro transcription using T7 polymerase to transcribe antisense RNA (aRNA) complementary to the original mRNA targets.
  • aRNA transcribe antisense RNA
  • the volume of the purified cDNA was adjusted to 23 ⁇ L with water, added to 17 ⁇ L of IVT reaction mix containing 4 ⁇ L 10X T7 Reaction Buffer (Invitrogen), 7 ⁇ L of T7 Enzyme Mix (includes T7 RNA polymerase), 8 ⁇ L NTP (25 mM each of ATP, CTP, GTP, and UTP), and incubated at 3 TC for 6 to 16 hours.
  • the resulting amplified aRNA was purified using the Spin Cartridges and aRNA Binding and Wash Buffers supplied by Invitrogen, and the yield of aRNA was quantified using Nanodrop Technologies.
  • the aRNA was reverse transcribed with random 8-mers (N8) to produce single stranded cDNA.
  • N8 random 8-mers
  • 500 ng or 1000 ng of aRNA was added to 20 ⁇ l of RT mix containing 4 ⁇ l 5X first strand buffer (250 mM Tris-HCl, pH 8.3; 375 mM KCl; 15 mM MgCl 2 ), 2 ⁇ l 1O mM dNTPs, 1 ⁇ l 10O mM DTT,
  • RNAseOUTTM 40 units/ ⁇ l
  • Superscript III Reverse Transcriptase 200 units/ ⁇ l
  • qPCR was performed as described in Example 3 using ABI Taqman® assays for IGFRl (catalog #Hs00181385), GAPDH (catalog #43100884E-0507028), GUSB (catalog #4310888E), ACTIN (catalog #431088 IE), eukaryotic 18S rRNA (catalog #Hs99999901sl) 5 and human hemoglobin beta (HBB) (catalog #Hs00747223 gl)
  • eukaryotic 28S rRNA and human hemoglobin alpha custom primers and probes (containing a 5'-FAM (6-carboxyfluorescein) reporter dye and a no fluorescent quencher (NFQ) at the 3' end of the probe) were used as follows:
  • Reverse primer 5' TCGGCAGGTGAGTTGTTACAC 3' (SEQ ID NO:941);
  • FAM Probe 5' ACTCCTTAGCGGATTCC 3' (SEQ ID NO:942)
  • HBA Human hemoglobin alpha
  • Quantitative PCR (qPCR) analysis of the cDNA and reverse transcribed FVT products (IVT-RT) from varying amounts of RNA template is shown in Table 13 (raw Ct values) and Table 14 (absolute abundance).
  • Primer pool indicates the primers used for first strand cDNA synthesis.
  • Product indicates either the cDNA or IVT-RT product was the template for qPCR.
  • the ratio of reporter to background RNA is shown in Table 15. There was little substantial NSR7 specificity relative to T7-N7 observed during the initial first strand cDNA step (left columns). Importantly, the ratio of reporter to background RNAs increased going from the first strand synthesis step to the IVT step (right columns) for both the NSR7 and T7-N7 primers (the data was normalized to N8).
  • composition refers to normalized yields of reporter and background IVT products. As shown in Table 16, the normalized yields were very similar for both the reporter and background genes across a 4-fold range of input RNA. This data suggests that the FVT products were amplified from the appropriate target RNA and the reaction was not overwhelmed with nonspecific transcript material.
  • NSR7 primers comprising SEQ ID NOS:l-933
  • T7 promoter SEQ ID NO:934
  • these products can be amplified with the SuperscriptTM RNA Amplification System (Invitrogen) to produce high yields of IVT product substantially enriched for target genes.
  • FIGURE 4 shows that the specific activity of the reporter genes IGFlR and GAPDH was increased in the presence of high dNTP concentrations, whereas the specific activity of background rRNA and globin mRNA was decreased in the presence of high dNTP concentrations.
  • the raw Ct and abundance values following qPCR of the IVT-RT reaction products is shown in Tables 19 and 20.
  • the reporter to background ratios for first strand NSR7 and IVT-RT are shown in Table 21.
  • the ratio of ratios data allows a comparison of first strand synthesis yields with IVT yields following conversion to cDNA and qPCR.
  • Comparison of reporter to background ratios and NSR7 to N8 ratios shows that increasing the dNTP concentration from 100O mM to 250O mM resulted in a pronounced increase in NSR7-mediated specificity, as shown in Table 22.
  • the primer concentration had a less noticeable impact on the NSR7-mediated specificity, hi addition, comparing the ratios of NSR7-primed cDNA synthesis yields to the IVT yields showed a dramatic relative reduction in rRNAs
  • this Example shows that high dNTP concentrations in combination with the NSR7 primers (comprising SEQ ID NOS: 1-933) generate first strand reverse transcription products with high NSR7 specificity.
  • the first strand products can then be amplified using the SuperscriptTM RNA Amplification System (Invitrogen) to produce high yields of IVT product that is substantially enriched for target genes.
  • 25 and 2500 means 25 ⁇ Mprimer and 250OuMdNTPs; 10 and 2500 means lO ⁇ Mprimer and 250OuMdNTPs; 25 and 1000 means 25 ⁇ Mprimer and lOOO ⁇ MdNTPs; 10 and 1000 means lO ⁇ Mprimer and lOOO ⁇ MdNTPs;
  • SEQ ID NOS: 1-933) that each have the T7 promoter (SEQ ID NO:934) covalently attached at the 5' end, with high concentrations of dNTPs occurs over a wide range of whole blood total RNA template concentrations.
  • Total human whole blood RNA was reverse transcribed and analyzed by qPCR as described in Example 5.
  • the amount of template RNA was 20 ng, 50 ng, 100 ng, 500 ng, 1000 ng, 2000 ng, and 5000 ng.
  • the data show that the NSR7 mediated enrichment of IGFlR and GAPDH reporters relative to rRNA and globin niRNA (as determined by the ratio of ratios for NSR7 versus N8) is observed at all template amounts (Table 25 and Table 26).
  • the reporter/background ratio of ratios for NSR versus N8 increases at higher template amounts, but the overall yield of first strand cDNA product is compromised (Table 27).
  • RNA template RNA represents an optimal compromise between cDNA yields and NSR7-mediated amplification specificity.
  • RNA template amounts 2000 ng and 5000 ng
  • the cDNA yields in Table 28 were determined by multiplying the absolute yields of product (from Table 29) by the dilution factor relative to 5000 ng of template RNA, then normalizing to the N8 yield from 20 ng of template RNA which consistently produced the highest yield values.
  • the normalized cDNA yields of IGFlR and GAPDH were similar across all template amounts for both NSR7 and N8, with a decreased yield at the highest RNA template concentrations.
  • the yield of l8S, 28S, alpha globin, and beta globin products was substantially higher when primed with N8 than when primed with NSR7.
  • the "NSR effect defined as a high percentage of conversion by the
  • NSR7 primers (comprising SEQ ID NOS: 1-933) of reporter mRNA to cDNA relative to N8, but a low percentage of conversion by the NSR7 primers of background RNAs to cDNA relative to N8, is conserved across all template concentrations tested. This provides the advantage that reaction conditions do not need to be customized to template amounts. TABLE 25. Ratio of ratios for reporter/background and NSR/N8 at different RNA tem late amounts.
  • NSR7 primers comprising SEQ ID NOS: 1-933
  • SEQ ID NO:934 the T7 promoter
  • RNA template amounts were 100 ng, 200 ng, 500 ng, and 1000 ng of whole blood total RNA.
  • the reaction volumes were 40 ⁇ and the reactions were incubated at 4CPC for 180 min, 7CPC for lO min, and chilled on ice.
  • the dNTP concentration was 200OuM.
  • Second strand synthesis reaction was for 120 min at l ⁇ C.
  • the ratio of ratios shows that reporters are enriched relative to background when comparing NSR7 to T7-N7 for both the first strand and IVT reactions, and this effect was observed at all RNA input amounts tested (Table 32).
  • Table 33 shows the raw qPCR data from the NSR7, T7-N7 and N8-primed first strand cDNA and IVT-RT reactions.
  • Table 34 shows the raw abundance data from the NSR7, T7-N7 and N8-primed first strand cDNA and IVT-RT reactions.
  • FIGURE 5 is a histogram plot showing the yield of amplified RNA from T7-NSR primed and T7-N7 primed cDNA as a function of the amount of input RNA template. The amount of input RNA tested ranged from 100 ng, 200 ng, 500 ng, and 1000 ng.
  • FIGURE 6 is a histogram plot on a linear scale showing the relative composition of T7-NSR-primed and T7-N7 primed cDNA (normalized to N8) following amplification by in vitro transcription (IVT). As shown in FIGURES 5 and 6, the composition of the NSR-primed IVT product is substantially different than the composition of the N8-primed cDNA.
  • FIGURE 6 is a histogram plot on a logarithmic scale showing the relative composition of T7-NSR primed and T7-N7 primed cDNA (normalized of N8) following amplification by in vitro transcription.
  • FIGURE 8 is a histogram plot showing the relative abundance of in vitro transcription products from T7-NSR primed cDNA as a function of RNA template amount.
  • FIGURE 9 is a histogram plot showing the relative abundance of in vitro transcription products from T7-N7-primed cDNA as a function of RNA template amount.
  • composition of the NSR-primed IVT product is substantially different than the T7-N7 and N8 primed product, such that IGFlR and GAPDH levels increased while rRNA and globin levels decreased when primed with NSR, but were not substantially different than the N8-primed starting material when primed with T7-N7.
  • composition of the NSR-primed FVT product was relatively uniform across a range of RNA template amounts.
  • Ratio of ratios for NSR versus T7-N7 primed first strand cDNA usin the data from Table 24.
  • This Example describes an exemplary method of using NSR-primed first strand reverse transcription, followed by second strand synthesis and in vitro transcription for the preparation of microarray samples.
  • the sample is mixed, centrifuged and transferred to a 4CPC pre-warmed thermal cycler (to provide a "hot start"), and the sample is incubated at 4CPC for three hours, 7CPC for 10 minutes and chilled to 4 0 C.
  • a second strand synthesis cocktail is prepared using the components of the SuperscriptTM RNA Amplification System (Invitrogen, Catalog No. L1016-01) as follows: • 91 ⁇ l DEPC-treated water
  • AnIn Vitro Transcription Cocktail is prepared as follows (18 ⁇ l volume) • 1.5 ⁇ l 10O mM ATP
  • Each Spin Cartridge is pre-inserted into a collection tube. Load the entire aRNA/buffer solution directly onto the Spin Cartridge. 4. Centrifuge at 12,000xg in a microcentrifuge for 15 seconds at room temperature. Remove the collection tube and discard the flow-through.
  • This Example shows that cDNA generated using the 933 6-mers (SEQ ID NOS:l-933 either with or without T7 promoter (SEQ ID NO:934) covalently attached) can be converted into aDNA by PCR.
  • NSR primers used in this Example were as follows:
  • the 933 6-mers (SEQ ID NOS:l-933) plus a single random nucleotide inserted between the 6-mer sequence and the T7 promoter (SEQ ID NO:934), referred to as "NSR7.”
  • RNA for the cell line Jurkat was obtained from Ambion, Inc. (Austin, TX).
  • the protocol involves a three-step amplification approach.
  • first strand cDNA is generated from RNA using reverse transcription that is primed with NSR primers comprising a first primer binding site to generate NSR primed first strand cDNA,
  • second strand cDNA synthesis that is primed with random primers (e.g., 9-mers) comprising a second primer binding site; and
  • NSR7 primers including the T7 promoter (comprising 933 6-mers (SEQ ID NOS: 1-933) plus a single random nucleotide inserted between the 6-mer sequence and the T7 promoter (SEQ ID NOS: 1-933)
  • First Strand cDN ⁇ synthesis was primed with the NSR7 primer pool comprising the T7 promoter (SEQ ID NO:934) plus one random nucleotide (N) plus the 933 6-mers (SEQ ID NOS: 1-933)
  • Second Strand cDNA synthesis was carried out using the following primer pool:
  • R RT 1 5' TGCATTGAGAGGGTGTAATTTGNNNNNNNNN 3' (SEQ ID NO:947) (referred to as R RT 1 comprising random 9-mers plus second PCR primer binding site, or "tail").
  • PCR Amplification was primed using the following PCR Primers:
  • Forward PCR 1 5' CGCAATTAATACGACTCACTATAGG 3 1 (SEQ ID NO: 946) (binds to T7 promoter (first primer binding site))
  • NSR7 including the T7 promoter
  • the method of producing aDNA may be practiced using a pool of not-so-random primers (NSR) tailed with any defined sequence containing at least one primer binding sequence.
  • NSR not-so-random primers
  • a primer pool was used comprising a pool of NSR primers that included the 933 6-mers (SEQ ID NO: 1
  • Second sti 'and synthesis was carried out using the following primer pool: 5' CCACTCCATTTGTTCGTGTGNNNNNNNNN 3 1 (SEQ ID NO:957)
  • PCR amplification of the double-stranded cDNA was then carried out using the following PCR primers:
  • Reverse PCR Primer 5' CCACTCCATTTGTTCGTGTG 3' (SEQ ID NO:959) (binds to second PCR primer binding site)
  • Test samples 1-8 were carried out using Primer sets 1-8 shown above in TABLE 35 and were tested in parallel as described for primer set #1 below. Control samples were included as follows:
  • First Strand Reverse Transcription was carried out as follows: Combine: • 1 ⁇ l of ⁇ . Jurkat total RNA template (obtained from Ambion, Inc.
  • RNAse H (1 -4 units ⁇ l) was then added and the sample was incubated at 3 TC for 20 minutes, then heated to 95 5 C for 5 minutes and snap chilled at 4 3 C.
  • a second strand synthesis cocktail was prepared as follows: • lO ⁇ l 1OX Klenow Buffer
  • 80 ⁇ l of the second strand synthesis cocktail was added to the 20 ⁇ l first strand template reaction mixture, mixed and incubated at 3TC for 30 minutes.
  • cDNA Purification The resulting double stranded cDNA was purified using Spin Cartridges obtained from Invitrogen and buffers supplied in the kit according to the manufacturer's directions. A total volume of 30 ⁇ l was eluted from the column, of which 20 ⁇ l was used for follow-on PCR.
  • Results The results were analyzed in terms of (1) measuring the level of amplification of selected reporter genes by qPCR, (2) measuring amplified DNA "aDNA” yield, and (3) evaluation of an aliquot of the aDNA on an agarose gel to confirm that the population of species in the cDNA were equally represented.
  • the data in TABLE 36 shows the raw abundance values (adjusted for dilution) for reporter genes GAPDH, GUSB, hPO and Actin following qPCR of the double-stranded cDNA and aDNA products for samples 1-10.
  • This amplification factor was introduced to weight amplification in favor of samples that had robust cDNA synthesis levels and robust PCR yields (e.g., sample 2), over samples with poor cDNA and PCR yields, but high levels of cDNA to PCR amplification (e.g., sample 7).
  • sample 2 samples that had robust cDNA synthesis levels and robust PCR yields
  • high levels of cDNA to PCR amplification e.g., sample 7
  • PCR yield was generally good, especially with Primer Sets 1 and 2. Amplification was observed for all reporter genes tested. An aliquot of the aDNA from samples 1-8 and controls 1-2 were run on 1.6% agarose gels (not shown) and each test sample showed a smear of amplified material, indicating that the amplified products were representative of rnRNA species present in the starting total RNA.
  • the overall yield of aDNA obtained using an annealing temperature at 6CPC during PCR amplification is greater than that obtained with 51FC for seven out of the eight primer sets tested.
  • This Example demonstrates that aDNA amplified from double stranded cDNA templates generated using the 933 6-mers (SEQ ID NOS: 1-933), as described in EXAMPLE 11, preserved the expression ratios observed in the double-stranded cDNA templates.
  • First strand cDNA synthesis was performed as described in Example 11 using I ⁇ g of total RNA template from Jurkat or K562 cells (obtained from Ambion, Inc. Austin TX) with the NSR7 primer pool. Two Jurkat samples were run in parallel. For second strand synthesis and cDNA purification were also carried out as described in Example 11. PCR Amplification ofcDNA
  • the cDNA template was diluted 10-fold and 100-fold prior to use in PCR reaction, and either 10 ⁇ l purified, or 10 ⁇ l diluted cDNA was used. Add to the 10 ⁇ l of cDNA template:
  • Post-PCR clean-up 100 ⁇ l PCR reaction was diluted with 500 ⁇ l buffer and purified using Spin Cartridges obtained from Invitrogen and buffers supplied in the kit according to the manufacturer's directions. A total volume of 55 ⁇ l was eluted from the column.
  • Results The results were analyzed in terms of total aDNA yield, evaluation of aDNA on agarose gels to verify the presence of the expected smear indicating amplification of substantially all species in the transcriptome, and by measuring a panel of reporter genes by qPCR.
  • FIGURE 10 shows a plot of the expression values from TABLE 42 measured in the cDNA (x-axis) versus the aDNA (y-axis). Importantly, the results shown in FIGURE 10 demonstrate the preservation of expression ratios from the actual sample (cDNA) to the PCR amplified material (aDNA), such that gene x is y-fold amplified by the NSR- PCR regardless of whether its expression is high or low. Overall, these experiments indicates that NSR PCR aDNA may be used to amplify total RNA to aDNA while preserving expression ratios.
  • This Example demonstrates that aDNA amplified from double stranded cDNA templates generated using the 933 6-mers (SEQ ID NOS: 1-933), as described in EXAMPLE 11, preserved the enrichment of target genes relative to rRNA and globin. Rationale: To determine whether the enrichment of target genes relative to rRNA and globin previously observed from in- vitro transcription products generated from NSR- primer cDNA is preserved in amplified DNA product generated from PCR amplification of the NSR-primed cDNA.
  • First strand cDNA synthesis was performed on I ⁇ g of total RNA isolated from whole blood, as described in Example 11 with duplicate samples generated with either (1) the NSR7 primer pool (comprising SEQ ID NOS: 1-933 that each had the T7 promoter (SEQ ID NO: 934) covalently attached at the 5' end); or (2) a random 8-mer (N8) primer pool with the T7 promoter (SEQ ID NO: 934) covalently attached at the 5' end.
  • Second strand synthesis and cDNA purification was performed as described in
  • Example 11 with either SEQ ID NO: 947 for both the NSR7 primed samples, and the random 8-mers (N8) primed samples.
  • This Example shows that the yield of amplified DNA can be increased in a PCR reaction through the use of an elevated concentration of primers, dNTPs and MgC ⁇ thereby allowing for the implementation of NSR-PCR in high-throughput applications.
  • cDNA was prepared from Jurkat total RNA using NSR7 primers, as described in Example 13.
  • PCR reactions were prepared as described in Example 13. PCR Amplification Conditions: Perform 30 total PCR cycles:
  • Post-PCR clean-up 10Od PCR reaction was diluted with 500 ⁇ l buffer and purified using Spin Cartridges obtained from mvitrogen and buffers supplied in the kit according to the manufacturer's directions. A total volume of 50ul was eluted from the column.
  • the aDNA was also analyzed by agarose gel and was confirmed to contain a smear of amplified material, indicating that the amplified products were representative of mRNA species present in the starting total RNA.
  • FIGURE 11 shows the results of the qPCR plotted as the log 10 expression of each of the genes.
  • the amplified aDNA yields produced in the PCR reaction having 800 nM primer, 500 uM dNTP and 4 iriM MgCl 2 have the same gene specific activities as aDNA produced at lower primer, dNTP and Mg++ concentrations.
  • the values of control sample 9 (18S rRNA) and sample 10 (28S rRNA) shown in FIGURE 11 are higher than some of the reporter genes, it is important to note that these values (18S and 28S RNA) have actually been reduced by approximately 99 fold in comparison to the amount of rRNA present in samples that are randomly primed (e.g., not primed using the NSR primers).
  • rRNA constitutes about 98% of total RNA, even when the abundance of the rRNA is reduced to 1% of the original value, the total amount present still represents about 1/3 of the RNA in the sample. Importantly, this 99% decrease in rRNA observed in samples treated in accordance with the methods of the invention has been observed by the present inventors to be more than sufficient to eliminate the problem of rRNA obscured signal (i.e. "cross-talk") typically observed in samples that are randomly primed (data not shown).
  • Cy3 and Cy5 direct label kits were obtained from Minis (Madison, WI, kit MIR product numbers 3625 and 3725). lO ⁇ g of PCR product (aDNA), obtained as described in Example 11, was incubated with labeling reagent as described by the manufacturer. The labeling reagents covalently attached Cy3 or Cy5 to the nucleic acid sample, which can then be used in almost any molecular biology application, such as gene expression monitoring. The labeled aDNA was then purified and its fluorescence was measured relative to the starting label. Results: Four aDNA samples were labeled as described above, and fluorescence was measured. A range of 0.9 to 1.5% of retained label was observed across the four labeled aDNA samples (otherwise referred to as a labeling efficiency of 0.9 to 1.5%).
  • PCR Reaction 5 to 20 cycles of PCR (94 0 C 30 seconds, 6ffC 30 seconds, 72 €
  • PCR Reaction 5 to 20 cycles of PCR (94 3 C 30 seconds, 6CPC 30 seconds, 72 € 30 seconds), during which time both strands of the double-stranded PCR template are synthesized.
  • the double-stranded, aa-labeled aDNA PCR product is then purified and a Cy3 or Cy5 label is incorporated by standard chemical coupling.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2006/042250 2005-10-27 2006-10-27 Nucleic acid amplification using non-random primers Ceased WO2007050990A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CA002626977A CA2626977A1 (en) 2005-10-27 2006-10-27 Nucleic acid amplification using non-random primers
JP2008538067A JP5409005B2 (ja) 2005-10-27 2006-10-27 非ランダムプライマーを用いる核酸増幅
EP06827033A EP1941058A4 (en) 2005-10-27 2006-10-27 NUCLEIC ACID REINFORCEMENT FROM NON-INCIDENTIAL PRIMERS

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US73152905P 2005-10-27 2005-10-27
US60/731,529 2005-10-27
US79045806P 2006-04-07 2006-04-07
US60/790,458 2006-04-07

Publications (2)

Publication Number Publication Date
WO2007050990A2 true WO2007050990A2 (en) 2007-05-03
WO2007050990A3 WO2007050990A3 (en) 2007-12-13

Family

ID=37968610

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/042250 Ceased WO2007050990A2 (en) 2005-10-27 2006-10-27 Nucleic acid amplification using non-random primers

Country Status (5)

Country Link
US (2) US20080187969A1 (https=)
EP (2) EP2479291A1 (https=)
JP (1) JP5409005B2 (https=)
CA (1) CA2626977A1 (https=)
WO (1) WO2007050990A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008106803A1 (en) * 2007-03-07 2008-09-12 Nventa Biopharmaceuticals Corporation Double-stranded locked nucleic acid compositions
WO2009055732A1 (en) * 2007-10-26 2009-04-30 Rosetta Inpharmatics Llc Cdna synthesis using non-random primers
WO2010059914A2 (en) 2008-11-24 2010-05-27 Sequenom, Inc. Nucleic acid quantification products and processes
JP2011519579A (ja) * 2008-05-15 2011-07-14 トピジェン ファーマスーティカルズ インク 炎症および新生細胞増殖の治療のためのオリゴヌクレオチド
US8192941B2 (en) 2008-01-14 2012-06-05 Applied Biosystems, Llc Amplification and detection of ribonucleic acid
US8268987B2 (en) 2005-12-06 2012-09-18 Applied Biosystems, Llc Reverse transcription primers and methods of design

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100159533A1 (en) * 2008-11-24 2010-06-24 Helicos Biosciences Corporation Simplified sample preparation for rna analysis
EP2475777A4 (en) * 2009-09-11 2013-03-06 Nugen Technologies Inc COMPOSITIONS AND METHODS FOR COMPLETE TRANSCRIPTOMAL ANALYSIS
WO2012064739A2 (en) * 2010-11-08 2012-05-18 The Trustees Of Columbia University In The City Of New York Microbial enrichment primers
US12595500B2 (en) 2011-09-26 2026-04-07 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
WO2014153188A2 (en) 2013-03-14 2014-09-25 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
CN107058059B (zh) 2011-09-26 2020-08-07 基因技术股份公司 高效的小体积核酸合成
US10407676B2 (en) 2014-12-09 2019-09-10 Life Technologies Corporation High efficiency, small volume nucleic acid synthesis
US20220251639A1 (en) * 2019-05-20 2022-08-11 Kyushu University, National University Corporation Oligonucleotide, omics analysis method, and omics analysis kit

Family Cites Families (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5723597A (en) * 1983-01-10 1998-03-03 Gen-Probe Incorporated Ribosomal nucleic acid probes for detecting organisms or groups of organisms
US6221581B1 (en) * 1984-04-27 2001-04-24 Enzo Diagnostics, Inc. Processes for detecting polynucleotides, determining genetic mutations or defects in genetic material, separating or isolating nucleic acid of interest from samples, and useful compositions of matter and multihybrid complex compositions
US6150517A (en) * 1986-11-24 2000-11-21 Gen-Probe Methods for making oligonucleotide probes for the detection and/or quantitation of non-viral organisms
US5541308A (en) * 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5639604A (en) * 1987-09-21 1997-06-17 Gen-Probe Incorporated Homogeneous protection assay
US5084565A (en) * 1988-08-18 1992-01-28 Gene-Trak Systems Probes for the specific detection of escherichia coli and shigella
US5512439A (en) * 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5708154A (en) * 1989-02-24 1998-01-13 City Of Hope RNA-DNA hybrid molecules of nucleic acid
WO1990010717A1 (en) * 1989-03-10 1990-09-20 Gene-Trak Systems Preventing interference with affinity capture schemes
CA2031499A1 (en) * 1989-05-31 1990-12-01 David J. Lane Universal eubacteria nucleic acid probes and methods
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5545522A (en) * 1989-09-22 1996-08-13 Van Gelder; Russell N. Process for amplifying a target polynucleotide sequence using a single primer-promoter complex
CA2025181A1 (en) * 1989-10-12 1991-04-13 William G. Weisburg Nucleic acid probes and methods for detecting fungi
EP0675966B1 (en) * 1992-02-19 2004-10-06 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
KR100249110B1 (ko) * 1992-05-06 2000-04-01 다니엘 엘. 캐시앙 핵산 서열 증폭 방법, 이에 이용되는 조성물 및 키트
GB9211979D0 (en) * 1992-06-05 1992-07-15 Buchard Ole Uses of nucleic acid analogues
US5633134A (en) * 1992-10-06 1997-05-27 Ig Laboratories, Inc. Method for simultaneously detecting multiple mutations in a DNA sample
US5500356A (en) * 1993-08-10 1996-03-19 Life Technologies, Inc. Method of nucleic acid sequence selection
US6309823B1 (en) * 1993-10-26 2001-10-30 Affymetrix, Inc. Arrays of nucleic acid probes for analyzing biotransformation genes and methods of using the same
US5639428A (en) * 1994-07-19 1997-06-17 Becton Dickinson And Company Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay
FR2737502B1 (fr) * 1995-07-31 1997-10-24 Genset Sa Procede de detection d'acides nucleiques utilisant des sondes nucleotidiques permettant a la fois une capture specifique et une detection
US6013440A (en) * 1996-03-11 2000-01-11 Affymetrix, Inc. Nucleic acid affinity columns
JPH11509427A (ja) * 1996-05-14 1999-08-24 ベーリンガー マンハイム ゲーエムベーハー 試料中の核酸分子の発現の同定方法および/または定量方法
US6203978B1 (en) * 1996-05-31 2001-03-20 Du Vergier Ltd. Capture of single stranded nucleic acids
WO1998012354A1 (en) * 1996-09-19 1998-03-26 Affymetrix, Inc. Identification of molecular sequence signatures and methods involving the same
EP0972830A4 (en) * 1997-02-21 2003-02-05 Takara Shuzo Co GENES ASSOCIATED WITH CANCER
EP0975807B1 (en) * 1997-05-02 2006-09-27 Gen-Probe Incorporated Two-step hybridization and capture of a polynucleotide
EP1007739A2 (en) * 1997-09-05 2000-06-14 Sidney Kimmel Cancer Center Selection of pcr primer pairs to amplify a group of nucleotide sequences
US5932451A (en) * 1997-11-19 1999-08-03 Incyte Pharmaceuticals, Inc. Method for unbiased mRNA amplification
US6270973B1 (en) * 1998-03-13 2001-08-07 Promega Corporation Multiplex method for nucleic acid detection
US6197510B1 (en) * 1998-10-01 2001-03-06 Bio-Id Diagnostic Inc. Multi-loci genomic analysis
US6316193B1 (en) * 1998-10-06 2001-11-13 Origene Technologies, Inc. Rapid-screen cDNA library panels
US6951722B2 (en) * 1999-03-19 2005-10-04 Takara Bio Inc. Method for amplifying nucleic acid sequence
US6582906B1 (en) * 1999-04-05 2003-06-24 Affymetrix, Inc. Proportional amplification of nucleic acids
US6132997A (en) * 1999-05-28 2000-10-17 Agilent Technologies Method for linear mRNA amplification
US6465183B2 (en) * 1999-07-01 2002-10-15 Agilent Technologies, Inc. Multidentate arrays
US6495320B1 (en) * 1999-07-21 2002-12-17 Affymetrix, Inc. Even length proportional amplification of nucleic acids
AU781570B2 (en) * 1999-07-23 2005-06-02 Gen-Probe Incorporated Polynucleotide amplification method
US20020072061A1 (en) * 1999-07-30 2002-06-13 Alex Chenchik Methods and compositions for use in synthesizing nucleic acids
EP1276901A2 (en) * 2000-01-13 2003-01-22 Amsterdam Support Diagnostics B.V. A universal nucleic acid amplification system for nucleic acids in a sample
US20030022318A1 (en) * 2000-01-25 2003-01-30 Epiclone, Inc. Method for thermocycling amplification of nucleic acid sequences and the generation of related peptides thereof
US6235483B1 (en) * 2000-01-31 2001-05-22 Agilent Technologies, Inc. Methods and kits for indirect labeling of nucleic acids
US20010031468A1 (en) * 2000-02-08 2001-10-18 Alex Chenchik Analyte assays employing universal arrays
US7601497B2 (en) * 2000-06-15 2009-10-13 Qiagen Gaithersburg, Inc. Detection of nucleic acids by target-specific hybrid capture method
US6465219B1 (en) * 2000-08-07 2002-10-15 Genemed Biotechnologies, Inc. Polynucleotide pools enriched in either high-abundance or low-abundance sequences
WO2002044399A2 (en) * 2000-11-28 2002-06-06 Rosetta Inpharmatics, Inc. In vitro transcription method for rna amplification
US6391592B1 (en) * 2000-12-14 2002-05-21 Affymetrix, Inc. Blocker-aided target amplification of nucleic acids
US6448387B1 (en) * 2000-12-18 2002-09-10 Monsanto Technology, Llc Polymeric arrays adapted for high expressing polynucleotides
US20030104432A1 (en) * 2001-07-27 2003-06-05 The Regents Of The University Of California Methods of amplifying sense strand RNA
WO2003050304A1 (en) * 2001-12-08 2003-06-19 Seegene, Inc Annealing control primer system for regulating primer annealing specificity and its applications
EP1572902B1 (en) * 2002-02-01 2014-06-11 Life Technologies Corporation HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
US20030211483A1 (en) * 2002-05-09 2003-11-13 Schroeder Benjamin G. Methods for the enrichment of low-abundance polynucleotides
US20040248094A1 (en) * 2002-06-12 2004-12-09 Ford Lance P. Methods and compositions relating to labeled RNA molecules that reduce gene expression
GB2406169B (en) * 2002-06-12 2006-11-01 Ambion Inc Methods and compositions relating to labeled rna molecules that reduce gene expression
US20040029275A1 (en) * 2002-08-10 2004-02-12 David Brown Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs
US20050003369A1 (en) * 2002-10-10 2005-01-06 Affymetrix, Inc. Method for depleting specific nucleic acids from a mixture
US20060281092A1 (en) * 2003-07-24 2006-12-14 Tanja Wille Method for the reverse transcription and/or amplification of nucleic acids
US20050059024A1 (en) * 2003-07-25 2005-03-17 Ambion, Inc. Methods and compositions for isolating small RNA molecules
US7265448B2 (en) * 2004-01-26 2007-09-04 Marvell World Trade Ltd. Interconnect structure for power transistors
EP1871913A2 (en) * 2005-03-25 2008-01-02 Ambion, Inc. Methods and compositions for depleting abundant rna transcripts
US20060255053A1 (en) * 2005-05-16 2006-11-16 Empire Industrial Corp. Sealable container

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1941058A4 *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8809513B2 (en) 2005-12-06 2014-08-19 Applied Biosystems, Llc Reverse transcription primers and methods of design
US8268987B2 (en) 2005-12-06 2012-09-18 Applied Biosystems, Llc Reverse transcription primers and methods of design
WO2008106803A1 (en) * 2007-03-07 2008-09-12 Nventa Biopharmaceuticals Corporation Double-stranded locked nucleic acid compositions
JP2011500092A (ja) * 2007-10-26 2011-01-06 ロゼッタ、インファーマティクス、リミテッド、ライアビリティ、カンパニー 非ランダムプライマーを用いたcDNA合成の方法
WO2009055732A1 (en) * 2007-10-26 2009-04-30 Rosetta Inpharmatics Llc Cdna synthesis using non-random primers
US9624534B2 (en) 2008-01-14 2017-04-18 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
US8192941B2 (en) 2008-01-14 2012-06-05 Applied Biosystems, Llc Amplification and detection of ribonucleic acid
US10829808B2 (en) 2008-01-14 2020-11-10 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
US10240191B2 (en) 2008-01-14 2019-03-26 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
US9834816B2 (en) 2008-01-14 2017-12-05 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
US8932816B2 (en) 2008-01-14 2015-01-13 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
US9416406B2 (en) 2008-01-14 2016-08-16 Applied Biosystems, Llc Amplification and detection of ribonucleic acids
JP2011519579A (ja) * 2008-05-15 2011-07-14 トピジェン ファーマスーティカルズ インク 炎症および新生細胞増殖の治療のためのオリゴヌクレオチド
CN102224259A (zh) * 2008-11-24 2011-10-19 塞昆纳姆股份有限公司 核酸定量的产品和方法
EP3181702A1 (en) * 2008-11-24 2017-06-21 Sequenom, Inc. Nucleic acid quantification products and processes
CN102224259B (zh) * 2008-11-24 2014-08-27 塞昆纳姆股份有限公司 核酸定量的产品和方法
EP2358911A4 (en) * 2008-11-24 2013-01-23 Sequenom Inc PRODUCTS AND METHOD FOR NUCLEIC ACID SEQUENCING
EP3584324A1 (en) * 2008-11-24 2019-12-25 Sequenom, Inc. Nucleic acid quantification products and processes
US10533215B2 (en) 2008-11-24 2020-01-14 Sequenom, Inc. Nucleic acid quantification products and processes
WO2010059914A2 (en) 2008-11-24 2010-05-27 Sequenom, Inc. Nucleic acid quantification products and processes

Also Published As

Publication number Publication date
WO2007050990A3 (en) 2007-12-13
EP1941058A4 (en) 2010-01-20
JP2009513142A (ja) 2009-04-02
EP2479291A1 (en) 2012-07-25
EP1941058A2 (en) 2008-07-09
US20110294701A1 (en) 2011-12-01
CA2626977A1 (en) 2007-05-03
JP5409005B2 (ja) 2014-02-05
US20080187969A1 (en) 2008-08-07

Similar Documents

Publication Publication Date Title
US20110294701A1 (en) Nucleic acid amplification using non-random primers
US20220033891A1 (en) Amplification with primers of limited nucleotide composition
CA2750029C (en) Method for quantification of small rna species
JP2011500092A (ja) 非ランダムプライマーを用いたcDNA合成の方法
US20050003369A1 (en) Method for depleting specific nucleic acids from a mixture
NO339577B1 (no) Oligonukleotid med dobbel spesifisitet, og fremgangsmåter som anvender samme
WO2006102309A2 (en) Methods, compositions, and kits for detection of micro rna
US12545950B2 (en) Methods for preparing CDNA samples for RNA sequencing, and CDNA samples and uses thereof
CN114341353A (zh) 扩增mRNA和制备全长mRNA文库的方法
CN113604466A (zh) 通用逆转录引物及miRNA的cDNA合成方法、合成试剂盒和miRNA检测方法
KR102343373B1 (ko) miRNA 동시 다중 검출 방법 및 이를 이용한 miRNA 검출용 키트
US20020072061A1 (en) Methods and compositions for use in synthesizing nucleic acids
EP1275734A1 (en) Method for random cDNA synthesis and amplification
CN113166742B (zh) 用于消耗和富集核酸序列的方法和试剂盒
MXPA05005168A (es) Cuantificacion absoluta de acidos nucleicos mediante rt-pcr.
US20060234277A1 (en) Method for selectively blocking hemoglobin RNA amplification
WO2026023609A1 (ja) ポリa配列付加方法
WO2000018966A2 (en) A new strategy for genome-wide gene analysis: integrated procedures for gene identification
US20070092904A1 (en) Method for preparing limiting quantities of nucleic acids
HK1162196B (en) Method for quantification of small rna species

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006827033

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008538067

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2626977

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE