WO2007027718A1 - Methods of altering an immune response induced by cpg oligodeoxynucleotides - Google Patents
Methods of altering an immune response induced by cpg oligodeoxynucleotides Download PDFInfo
- Publication number
- WO2007027718A1 WO2007027718A1 PCT/US2006/033774 US2006033774W WO2007027718A1 WO 2007027718 A1 WO2007027718 A1 WO 2007027718A1 US 2006033774 W US2006033774 W US 2006033774W WO 2007027718 A1 WO2007027718 A1 WO 2007027718A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- agent
- oligodeoxynucleotide
- cxcll
- odn
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/04—Drugs for disorders of the respiratory system for throat disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
- A61P31/06—Antibacterial agents for tuberculosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/10—Antimycotics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
Definitions
- This application relates to the field of immunology, specifically to agents that can be used to alter the uptake of immunostimulatory oligodeoxynucleotides (ODNs).
- ODNs immunostimulatory oligodeoxynucleotides
- DNA is a complex macromolecule whose activities are influenced by its base composition and base modification, as well as helical orientation.
- Bacterial DNA, as well as certain synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG sequences can induce proliferation and immunoglobulin production by murine B cells.
- Unmethylated CpG dinucleotides are more frequent in the genomes of bacteria and viruses than vertebrates. Studies have suggested that immune recognition of these motifs may contribute to the host's innate immune response. (Klinman et al., Proc. Natl. Acad. Sci. USA 93:2879, 1996; Yi et al., J. Immun. 157:5394, 1996; Liang et al., J. Clin. Invest. //9:89, 1996; Krieg et al., Nature 374:546, 1995).
- a CpG oligodeoxynucleotide is an oligodeoxynucleotide including a CpG motif, wherein the pyrimidine ring of the cytosine is unmethylated.
- C-type, K-type and D-type ODNs Three types of CpG ODNs have been identified: C-type, K-type and D-type ODNs.
- CpG ODNs range from about 8 to 30 bases in size.
- D- and K-type nucleic acid sequences have been described in the published PCT Publication No.
- ODNs can stimulate a humoral immune response.
- Unmethylated CpG motifs including both D-type ODNs and K-type ODNs, are recognized by the Toll-like receptor 9 (TLR9) expressed on immune cells (such as B cells, macrophages, and dendritic cells).
- TLR9 Toll-like receptor 9
- the CpG DNA is taken up by an endocytic/phagocytic pathway. It is known that the interaction of CpG ODN with TLR9 triggers recruitment of a MyD 88 adaptor molecule, activation of an IL-IR kinase- 1 and other factors, resulting in the production of cytokines (see Latz et al., Nat. Immunol. 5:190-8, 2004).
- CpG ODNs can be used to induce an immune response. Thus, they have been found to have many uses, such as to induce an immune response to antigens, in the production of vaccines, and as adjuvants. It would be advantageous to be able to alter the uptake of CpG ODN by cells, in order to alter the immune response produced by these oligonucleotides. Methods to alter the uptake and subsequent immune activation triggered by CpG ODN are disclosed herein.
- agents that affect the activity and/or expression of CXCLl 6 can be used to alter the uptake of CpG oligodeoxynucleotides (ODN), specifically D-type CpG oligodeoxynucleotides (D ODN).
- ODN CpG oligodeoxynucleotides
- D ODN D-type CpG oligodeoxynucleotides
- agents that affect the activity and/or expression of CXCLl 6 can be used to alter an immune response induced by D ODN.
- the agent increases the activity and/or expression of CXCLl 6, thereby increasing the uptake of D ODN.
- Agents that increase the activity and/or expression of CXCLl 6 can be used to increase an immune response induced by a D ODN.
- Agents that decrease the activity and/or expression of CXCLl 6 can be used to decrease an immune response induced by D ODN.
- compositions including one or more D-type ODNs and an agent that modulates that activity and/or expression of CXCLl 6 are provided herein. These compositions are of use to induce an immune response, such as to a specific antigen.
- FIGS. 1A-1C are graphs and digital images illustrating that CXCLl 6 selectively recognizes D ODN.
- FIG. IA is a line graph showing CpG ODN binding to recombinant CXCLl 6.
- 96-well flat bottom ELISA plates were coated with 0.4 ⁇ g/ml anti-CXCL16 antibody and then incubated without (dotted lines) or with 200 ng/ml of recombinant CXCL16 (full lines).
- FIG. IB is a set of digital images and plots showing that D but not K ODN colocalize with CXCLl 6 and its uptake is enhanced in transfected HEK293 cells.
- CXCLl 6 transfected HEK293 cells were incubated with 3 ⁇ M of FITC conjugated CpG ODN at 37 0 C for 20 minutes.
- FIG. 1 C is a bar graph showing that anti-CXCL16 inhibit D ODN binding to pDC.
- Binding of FITC conjugated ODN to CD123/BDCA-2 double positive pDC was determined in the absence or presence of anti-CXCL16 or isotype matched control (100 ⁇ g/ml each). Percent inhibition of uptake was determined comparative to the isotype matched control group. Results represent the mean ⁇ SD of 2 experiments (*, P ⁇ 0.05; **, PO.01).
- FIGS. 2A-2D are graphs and plots showing that CXCLl 6 positive cells preferentially respond to D ODN.
- FIG. 2A is a plot showing that CXCLl 6 expression versus cytokine production in pDCs stimulated with CpG ODN.
- FIG. 2B is a bar graph showing that antibodies against CXCLl 6 inhibit D ODN induced cytokine production.
- FIG. 2C is a plot showing the effect of anti-CXCL16 on the upregulation of HLA-DR and CD86 by CpG ODN.
- Elutriated monocytes were preincubated with anti-CXCL16 or isotype matched control antibody and then stimulated with Control (3 ⁇ M), K (1 ⁇ M) or D (3 ⁇ M) ODN for 24 hours.
- FIG. 2D is a bar graph of the results showing HEK293 cells transfected with CXCLl 6 gain responsiveness to D ODN.
- HEK293 cells stably expressing TLR9 were co-transfected with p5xNF- kB.
- the ratio of NF-kB induction in CXCLl 6 transfected over mock transfected is displayed for each ODN. All ODN names are shown on the X-axis.
- FIGS. 3A-3D are bar graphs and plots showing the effect of scavenger receptor ligands on the binding and activity of CpG ODN.
- FIG. 3 A is a bar graph of the results obtained when purified pDC were preincubated (20 minutes at 4°C) with medium or with 50 ⁇ g/ml each of inhibitors followed by addition of 1 ⁇ M FITC conjugated ODN. Mean fluorescence intensity representing binding of FITC-ODN was assessed using flow cytometry. Results represent the mean ⁇ S. D of three independent experiments.
- FIG. 3B is a bar graph showing D ODN induced IFN- ⁇ from peripheral blood mononuclear cells (PBMC).
- PBMC peripheral blood mononuclear cells
- FIG. 3C is a plot showing K ODN induced TNF- ⁇ production in pDC (in the absence or presence of 50 ⁇ g/ml dextran sulfate). TNF- ⁇ production was determined using intracytoplasmic cytokine staining (representative plots of three independent experiments).
- 3D is a plot showing the results obtained when purified pDC were incubated with 1 ⁇ M each of K or with 3 ⁇ M D ODN in the absence or presence of 50 ⁇ g/ml dextran sulfate. Upregulation of HLA-DR/CD54 was determined 24 hours later using flow cytometry.
- FIGS. 4A-4B are plots showing the expression of CXCLl 6.
- FIG. 4A shows pDCs express CXCLl 6 on their surface. pDCs were enriched from PBMC using the BDCA-4 magnetic cell separation kit. Expression of CXCLl 6 versus isotype matched control was analyzed on CD123/BDCA-2 double positive cells. Data is representative of at least five independent experiments.
- FIG. 4B is a plot showing that anti-CXCL16 specifically inhibits binding of D ODN to pDC. Binding of FITC conjugated D ODN to CD 123 gated cells was analyzed using flow cytometry.
- the figure shows that both basophils (BDCA-2 negative ) and pDCs (BDCA-2 positive ) bind D ODN in the presence of isotype matched antibody and that only binding to the pDC but not to the basophil population (which do not express CXCL 16) is inhibited by anti-CXCL16, providing evidence for the specificity of this antibody.
- FIG. 5 is a set of plots of the results obtained when elutriated monocytes were stained for pDC markers and CXCL 16 and BDCA-2/CD123 gated cells were sorted into the CXCLl 6 negative or CXCLl 6 positive + negative populations using FACSAria cell sorter. The resulting populations were then incubated with 1 and 3 ⁇ M of K and D ODN, respectively, or with 1 xlO7 pfu/ml of UV-inactivated HSV-I. Twenty-four hours later, cells were stained and expression of HLA-DR/CD86 was assessed by flow cytometry.
- FIG. 6 is a bar graph showing the expression of CXCLl 6 in HEK293 cells stably expressing TLR9 confers D ODN responsiveness.
- Stable TLR9 expressing HEK293 cells were co-transfected with 0.5 ⁇ g p5xNF- kB B-luc and 1 ⁇ g of CXCLl 6 or control plasmid for 24 hours.
- Data show relative luciferase units obtained following 24 hours incubation with 3 ⁇ M ODN in mock transfected (open bars) and CXCLl 6 (filled bars) transfected TLR9 expressing HEK293 cells.
- FIGS. 7A-7B are a plot and a bar graph showing the metalloproteinase inhibitor GM-6001 enhances CXCLl 6 expression and subsequent cytokine production induced by D ODN.
- PBMC peripheral blood mononuclear cells
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 CF. R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand where appropriate.
- SEQ ID NOs: 1-17 are the nucleic acid sequences of D ODN.
- SEQ ID NOs: 18-20 are the nucleic acid sequences of CXCLl 6 probes and primers.
- SEQ ID NO: 21 is the consensus nucleic acid sequence of a D ODN.
- SEQ ID NO: 22 is the consensus nucleic aid sequence of a K ODN.
- ADAM-10 A protein that is an enzyme also known as disintegrin, metalloprotease domain 10, and MADM mammalian disintegrin metalloprotease. It is a member of the ADAM protein family. The protein has been shown to be a physiologically relevant TNF-processing enzyme (TNF-alpha convertase, TNF- alpha converting enzyme). It cleaves the 26 kDa membrane-bound precursor form of TNF-alpha to release the soluble mature 17 kDa TNF form.
- TNF-alpha convertase TNF- alpha converting enzyme
- ADAM-10 contains the canonical zinc metalloproteinase motif, and has been shown to be proteolytically active. ADAM-10 from bovine kidney was shown to have type- IV collagenolytic activity, making ADAM-10 a "gelatinase.” ADAM-10 is efficiently inhibited by the endogenous MMP inhibitors TIMP-I and TIMP-3, but not by TIMP-2 and TIMP-4.
- ADAM-10 The full length ADAM-10 sequence codes for a 748 amino acid protein, with a predicted mass, is 84.142 kD. Glycosylation and the cyteine-rich regions make the protein run at 98 kD on reduced SDS PAGE, and 60-58 kD when Furin processed. A smaller 691 amino acid sequence for ADAM-10, lacking the transmembrane domain, has been reported, with a predicted molecular weight of 77.633 kD. ADAM-10 is thought to be membrane-anchored under normal conditions. The sequence of ADAM-10 can be found, for example, as GENB ANKTM Accession Nos. AAC51766 (September 26, 1997), AF009615 (September 27, 1997) and CAA88463 (April 18, 2005, MADAM), which are all incorporated herein by reference.
- Antigen A compound, composition, or substance that can stimulate the production of antibodies or a T cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens.
- the term "antigen" includes all related antigenic epitopes.
- C class oligodeoxynucleotides ODNs that resemble K ODNs and are composed of only phosphorothiote nucleotides.
- C class ODNs have a TCGTCG motif at the 5' end and have a CpG motif imbedded in a palindromic sequence.
- Backbone modifications like 2'-0-methyl modifications especially in the 5 ' part of the ODN influence IFN-alpha-producing capacity of these ODN.
- C class ODNs have combined properties of D- and K-type ODNs.
- CpG or CpG motif A nucleic acid having a cytosine followed by a guanine linked by a phosphate bond in which the pyrimidine ring of the cytosine is unmethylated.
- methylated CpG refers to the methylation of the cytosine on the pyrimidine ring, usually occurring at the 5-position of the pyrimidine ring.
- a CpG motif is a pattern of bases that include an unmethylated central CpG surrounded by at least one base flanking (on the 3' and the 5' side of) the central
- a CpG oligonucleotide is an oligonucleotide that is at least about ten nucleotides in length and includes an unmethylated CpG.
- CpG oligonucleotides include both D- and K-type oligodeoxynucleotides (see below).
- CpG oligodeoxynucleotides are single-stranded.
- the entire CpG oligodeoxynucleotide can be unmethylated or portions may be unmethylated. In one embodiment, at least the C of the 5' CG 3' is unmethylated.
- a malignant neoplasm that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis.
- thyroid cancer is a malignant neoplasm that arises in or from thyroid tissue
- breast cancer is a malignant neoplasm that arises in or from breast tissue (such as a ductal carcinoma).
- Residual cancer is cancer that remains in a subject after any form of treatment given to the subject to reduce or eradicate the cancer.
- Metastatic cancer is a cancer at one or more sites in the body other than the site of origin of the original (primary) cancer from which the metastatic cancer is derived.
- Chemotherapy or chemotherapeutic agents any chemical agent with therapeutic usefulness in the treatment of diseases characterized by abnormal cell growth. Such diseases include tumors, neoplasms, and cancer as well as diseases characterized by hyperplastic growth such as psoriasis.
- a chemotherapeutic agent is an agent of use in treating neoplasms such as solid tumors.
- a chemotherapeutic agent is a radioactive molecule.
- chemotherapeutic agent of use e.g. see Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch.
- Chemotherapeutic agents include those known by those skilled in the art, including but not limited to: 5-fluorouracil (5-FU), azathioprine, cyclophosphamide, antimetabolites (such as Fludarabine), antineoplastics (such as Etoposide,
- CXCL16 A chemokine that specifically binds to the CXCLl 6 receptor (CXCR6, also known as Bonzo), also known as SR-PSOX.
- CXCR6 CXCLl 6 receptor
- Bonzo also known as SR-PSOX.
- Exemplary amino acid sequences for CXCL16, and nucleotide sequence(s) encoding CXCL16 are set forth as GENBANKTM/EMBL Data Bank as Accession Nos. AF275260 (human SR- PSOX, January 2, 2001), AF277001 (murine SR-PSOX, January 8, 2001), and AF277000 (porcine SR-PSOX, January 8, 2001), which are all incorporated herein by reference).
- Variants of CXCLl 6 that bind to their receptor are also encompassed by this disclosure.
- the CXCLl 6 receptor is a type I membrane protein which is expressed on macrophages and dendritic cells and has a molecular weight of approximately 30 KDa.
- - CXCLl 6 is a ligand for the CXC-chemokine receptor CXCR6, and is a scavenger receptor for oxidized low density lipoprotein (LDL).
- LDL low density lipoprotein
- CXCLl 6 is expressed on the cell membrane as a multidomain molecule including a chemokine domain followed by a glycosylated mucin-like stalk and single transmembrane helix followed by a short cytoplasmic tail.
- CXCLl 6 is expressed on antigen presenting cells (APCs).
- CXCLl 6 induces chemotaxis of activated T cells and bone marrow plasma cells.
- Cell expressed CXCLl 6 is released from the cell membrane by proteolytic cleavage.
- the disintegrin-like metalloproteinase ADAM-IO plays a role in CXCLl 6 cleavage.
- CXCLl 6 is induced by IFN- ⁇ and TNF- ⁇ Cytokine: Proteins made by cells that affect the behavior of other cells, such as lymphocytes.
- a cytokine is a chemokine, a molecule that affects cellular trafficking.
- D ODN D-Type Oligodeoxynucleotide
- D-type oligodeoxynucleotides include an unmethylated CpG dinucleotide. Inversion, replacement or methylation of the CpG reduces or abrogates the activity of the D oligodeoxynucleotide.
- a D-type ODN is at least about 16 nucleotides in length and includes a sequence represented by the formula:
- an "effective amount” or “therapeutically effective amount” of a D ODN is an amount of the D ODN sufficient to stimulate a response.
- Epitope An antigenic determinant. These are particular chemical groups or peptide sequences on a molecule that are antigenic, i.e. that elicit a specific immune response. An antibody binds a particular antigenic epitope.
- Sequence alterations for example in a D-type ODN, that yield the same results as described herein.
- sequence alterations can include, but are not limited to, deletions, base modifications, mutations, labeling, and insertions.
- Immune response A response of a cell of the immune system, such as a B cell, or a T cell, to a stimulus.
- the response is specific for a particular antigen (an "antigen-specific response").
- a “parameter of an immune response” is any particular measurable aspect of an immune response, including, but not limited to, cytokine secretion (IL-6, IL-IO, IFN- ⁇ , etc.), immunoglobulin production, dendritic cell maturation, and proliferation of a cell of the immune system.
- cytokine secretion IL-6, IL-IO, IFN- ⁇ , etc.
- immunoglobulin production IL-6, IL-IO, IFN- ⁇ , etc.
- dendritic cell maturation a cell of the immune system.
- a substantial increase are at least about a 50% increase, at least about a 75% increase, at least about a 90% increase, at least about a 100% increase, at least about a 200% increase, at least about a 300% increase, and at least about a 500% increase.
- One of skill in the art can readily identify a significant increase using known statistical methods.
- One specific, non-limiting example of a statistical test used to assess a substantial increase is the use of a Z test to compare the percent of samples that respond to a D ODN as compared to the percent of samples that respond to a control.
- a non-paramentric ANOVA can be used to compare differences in the magnitude of the response induced by D ODN as compared to the percent of samples that respond using a control.
- Infectious agent An agent that can infect a subject, including, but not limited to, viruses, bacteria, and fungi.
- infectious virus examples include: Retroviridae; Picornaviridae (for example, polio viruses, hepatitis A virus; enteroviruses, human coxsackie viruses, rhinoviruses, echovirases); Calciviridae (such as strains that cause gastroenteritis); Togaviridae (for example, equine encephalitis viruses, rubella viruses); Flaviridae (for example, dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (for example, coronaviruses); Rhabdoviridae (for example, vesicular stomatitis viruses, rabies viruses); Filoviridae (for example, ebola viruses); Paramyxoviridae (for example, parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (for example, influenza viruses); Bungaviridae (for example, Hantaan viruses, bunga viruses
- infectious bacteria examples include: Helicobacter pylons; Borelia burgdorferi; Legionella pneumophilia; Mycobacteria sps (such as. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
- infectious fungi examples include, but are not limited to, Cryptococcus neoformans; Histoplasma capsulatum; Coccidioides immitis; Blastomyces dermatitidis; Chlamydia trachomatis; and Candida albicans.
- IFN-ce forms are produced by monocytes/macrophages, lymphoblastoid cells, fibroblasts, and a number of different cell types following induction by viruses, nucleic acids, glucocorticoid hormones, and low-molecular weight substances (n-butyrate, 5-bromodeoxy uridine). At least 23 different variants of IFN- ⁇ are known.
- the individual proteins have molecular masses between 19-26 kDa and consist of proteins with lengths of 156-166 and 172 amino acids.
- IFN- ⁇ subtypes possess a common conserved sequence region between amino acid positions 115-151 while the amino-terminal ends are variable. Many IFN- ⁇ ! subtypes differ in their sequences at only one or two positions. Naturally occurring variants also include proteins truncated by 10 amino acids at the carboxy- terminal end. Disulfide bonds are formed between cysteines at positions 1/98 and 29/138. The disulfide bond 29/138 is essential for biological activity while the 1/98 bond can be reduced without affecting biological activity.
- IFN- ⁇ genes There are at least 23 different IFN- ⁇ genes. They have a length of 1-2 kb and are clustered on human chromosome 9p22. IFN- ⁇ genes do not contain intron sequences found in many other eukaryotic genes. Based upon the structures two types of IFN- a genes, designated class I and II, are distinguished. They encode proteins of 156-166 and 172 amino acids, respectively.
- IFN- ⁇ All known subtypes of IFN- ⁇ show the same antiviral antiparasitic, antiproliferative activities in suitable bioassays although they may differ in relative activities.
- Human IFN- ⁇ is also a potent antiviral substance in murine, porcine, and bovine cell systems.
- IFN- ⁇ can be assayed by a cytopathic effect reduction test employing human and bovine cell lines. Minute amounts of IFN- ⁇ can be assayed also by detection of the Mx protein specifically induced by this interferon.
- Interferon gamma IFN- ⁇ is a dimeric protein with subunits of 146 amino acids. The protein is glycosylated at two sites, and the pi is 8.3-8.5. IFN- ⁇ is synthesized as a precursor protein of 166 amino acids including a secretory signal sequence of 23 amino acids. Two molecular forms of the biologically active protein of 20 and 25 kDa have been described. Both of them are glycosylated at position 25. The 25 kDa form is also glycosylated at position 97. The observed differences of natural IFN- ⁇ with respect to molecular mass and charge are due to variable glycosylation patterns. 40-60 kDa forms observed under non-denaturing conditions are dimers and tetramers of IFN- ⁇ . The human gene has a length of approximately 6 kb. It contains four exons and maps to chromosome 12q24.1.
- IFN- ⁇ can be detected by sensitive immunoassays, such as an ELSA test that allows detection of individual cells producing IFN- ⁇ . Minute amounts of IFN- ⁇ can be detected indirectly by measuring IFN-induced proteins such as Mx protein. The induction of the synthesis of IP-10 has been used also to measure IFN- ⁇ concentrations.
- bioassays can be used to detect IFN- ⁇ , such as an assay that employs induction of indoleamine 2,3-dioxygenase activity in 2D9 cells.
- Isolated An "isolated" biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been “isolated” thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- K ODN An oligodeoxynucleotide including an unmethylated CpG motif that has a sequence represented by the formula:
- K ODNs can stimulate a humoral response.
- K ODNs stimulate the production of immunoglobulins, such as IgM and IgG.
- K ODNs can also stimulate proliferation of peripheral blood mononuclear cells and increase expression of IL-6 and/or IL- 12, amongst other activities.
- Leukocyte Cells in the blood, also termed “white cells,” that are involved in defending the body against infective organisms and foreign substances. Leukocytes are produced in the bone marrow. There are 5 main types of white blood cells, subdivided between 2 main groups: polymorphonuclear leukocytes (neutrophils, eosinophils, basophils) and mononuclear leukocytes (monocytes and lymphocytes). When an infection is present, the production of leukocytes increases.
- Mammal This term includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects.
- Neoplasm An abnormal cellular proliferation, which includes benign and malignant tumors, as well as other proliferative disorders.
- Nucleic acid A deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.
- Oligonucleotide or "oligo” Multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (Py) (e.g. cytosine (C), thymine (T) or uracil (U)) or a substituted purine (Pu) (e.g. adenine (A) or guanine (G)).
- oligonucleotide refers to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs).
- oligonucleotide also includes oligonucleosides (i.e. an oligonucleotide minus the phosphate) and any other organic base polymer. Oligonucleotides can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis).
- a “stabilized oligonucleotide” is an oligonucleotide that is relatively resistant to in vivo degradation (for example via an exo- or endo-nuclease).
- a stabilized oligonucleotide has a modified phosphate backbone.
- One specific, non-limiting example of a stabilized oligonucleotide has a phosphothioate modified phosphate backbone (wherein at least one of the phosphate oxygens is replaced by sulfur).
- oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
- an “immunostimulatory oligonucleotide,” “immunostimulatory CpG containing oligodeoxynucleotide,” “CpG ODN,” refers to an oligodeoxynucleotide, which contains a cytosine, guanine dinucleotide sequence and stimulates (e.g. has a mitogenic effect or induces cytokine production) vertebrate immune cells. The cytosine, guanine is unmethylated.
- oligonucleotide delivery complex is an oligonucleotide associated with (for example, ionically or covalently bound to; or encapsulated within) a targeting means (such as a molecule that results in a higher affinity binding to a target cell ( B cell or natural killer (NK) cell) surface and/or increased cellular uptake by target cells).
- a targeting means such as a molecule that results in a higher affinity binding to a target cell ( B cell or natural killer (NK) cell surface and/or increased cellular uptake by target cells.
- oligonucleotide delivery complexes include oligonucleotides associated with: a sterol (for example, cholesterol), a lipid (for example, cationic lipid, virosome or liposome), or a target cell specific binding agent (for example, a ligand recognized by a target cell specific receptor).
- Preferred complexes must be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell.
- the complex should be cleavable or otherwise accessible under appropriate conditions within the cell so that the oligonucleotide is functional (Gursel, J. Immunol. 167:3324, 2001).
- Pharmaceutical agent or drug A chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject.
- Pharmaceutical agents include, but are not limited to, chemotherapeutic agents and anti-infective agents.
- compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions e.g., powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Salts encompassed within the term "pharmaceutically acceptable salts" refer to non-toxic salts.
- preparation of a salt, such as of an agonists of ADAM-10 are prepared by reacting the free base with a suitable organic or inorganic acid or by reacting the acid with a suitable organic or inorganic base.
- Representative salts include the following salts: Acetate, Benzenesulfonate, Benzoate, Bicarbonate, Bisulfate, Bitartrate, Borate, Bromide, Calcium Edetate, Camsylate, Carbonate, Chloride, Clavulanate, Citrate, Dihydrochloride, Edetate, Edisylate, Estolate, Esylate, Fumarate, Gluceptate, Gluconate, Glutamate,
- Glycollylarsanilate Hexylresorcinate, Hydrabamine, Hydrobromide, Hydrocloride, Hydroxynaphthoate, Iodide, Isethionate, Lactate, Lactobionate, Laurate, Malate, Maleate, Mandelate, Mesylate, Methylbromide, Methylnitrate, Methylsulfate, Monopotassium Maleate, Mucate, Napsylate, Nitrate, N-methylglucamine, Oxalate, Pamoate (Embonate), Palmitate, Pantothenate, Phosphate/diphosphate, Polygalacturonate, Potassium, Salicylate, Sodium, Stearate, Subacetate, Succinate, Tannate, Tartrate, Teoclate, Tosylate, Triethiodide, Trimethylammonium and Valerate.
- Preventing or treating a disease refers to inhibiting the full development of a disease, for example in a person who is known to have a predisposition to a disease, such as tumor or a disease caused by a pathogen, such as a virus or a bacteria.
- a pathogen such as a virus or a bacteria.
- An example of a person with a known predisposition is someone with a history of diabetes in the family, or who has been exposed to factors that predispose the subject to a condition.
- Treatment refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- Purified The term purified does not require absolute purity; rather, it is intended as a relative term.
- a purified peptide preparation is one in which the peptide or protein is more enriched than the peptide or protein is in its natural environment within a cell.
- a preparation is purified such that the protein or peptide represents at least 50% of the total peptide or protein content of the preparation.
- Self-complementary nucleic acid sequence A nucleic acid sequence that can form Watson-Crick base pairs.
- the four bases characteristic of deoxyribonucleic unit of DNA are the purines (adenine and guanine) and the pyrimidines (cytosine and thymine). Adenine pairs with thymine via two hydrogen bonds, while guanine pairs with cytosine via three hydrogen bonds. If a nucleic acid sequence includes two or more bases in sequence that can form hydrogen bonds with two or more other bases in the same nucleic acid sequence, then the nucleic acid includes a self-complementary sequence.
- a self- complementary nucleic acid sequence includes 3, 4, 5, 6 or more bases that could form hydrogen bonds with 3, 4, 5, 6 or more bases, respectively, of the same nucleic acid sequence.
- TherapeuticaIIy effective dose A dose sufficient to prevent advancement, or to cause regression of the disease, or which is capable of relieving symptoms caused by the disease, such as pain or swelling.
- Vaccine A preparation of attenuated microorganisms (including but not limited to bacteria and viruses), living microorganisms, antigen, or killed microorganisms, administered for the prevention, amelioration or treatment of infectious disease.
- CXCLl 6 can be used in conjunction with a D-type oligodeoxynucleotide (ODN).
- ODN D-type oligodeoxynucleotide
- compositions including one or more D-type ODNs and an agent that modulates that activity and/or expression of CXCL 16 are provided herein. These compositions are of use to induce an immune response.
- the immune response can be to any antigen of interest, including by not limited to, an antigen from a pathogen or a tumor.
- ODNs D Oligodeoxynucletotides
- D ODNs differ both in structure and activity from K ODNs (also known as “B” class ODNs) and a third type of ODNs, known as "C” class ODNs.
- D ODNs stimulate the release of cytokines from cells of the immune system, and induce the maturation of dendritic cells.
- D ODNs stimulate the release or production of IP-IO and IFN- ⁇ by monocytes and/or plasmacytoid dendritic cells.
- a CpG motif in a D ODN has been described by the formula:
- D-type oligonucleotides include an unmethylated CpG dinucleotide. Inversion, replacement or methylation of the CpG reduces or abrogates the activity of the D oligonucleotide.
- a D-type ODN is at least about 16 nucleotides in length and includes a sequence represented by the formula:
- the region Pui Py 2 CpG Pu 3 Py 4 is termed the CpG motif.
- the region XiX 2 X 3 is termed the 5' flanking region, and the region X 4 X 5 X 6 is termed the 3' flanking region. If nucleotides are included 5' OfX]X 2 X 3 in the D ODN, these nucleotides are termed the 5' far-flanking region. Nucleotides 3' OfX 4 X 5 X 6 in the D ODN are termed the 3 ' far-flanking region.
- Py 2 is a cytosine.
- Pu 3 is a guanidine.
- Py 2 is a thymidine and Pu 3 is an adenine.
- Pu 1 is an adenine and Py 2 is a tyrosine.
- Pu 3 is an adenine and Py 4 is a tyrosine.
- N is from about 4 to about 8. In another specific, non-limiting example, N is about 6.
- the D ODN is at least about 16 nucleotides in length.
- the D ODNs can be from about 16 to about 50 nucleotides in length, or from about 18 to about 50 nucleotides in length, or from about 18 to about 40 nucleotides in length, or from about 18 to about 30 nucleotides in length. Exemplary D ODNs are disclosed below.
- D ODNs can include modified nucleotides.
- modified nucleotides can be included to increase the stability of a D ODN.
- the D ODNs are "stabilized” by incorporating phosphothioate-modified nucleotides.
- the CpG dinucleotide motif and its immediate flanking regions include phosphodiester rather than phosphothioate nucleotides.
- the sequence Pu 1 Py 2 CpG Pu 3 Py 4 includes phosphodiester bases.
- all of the bases in the sequence Pui Py 2 CpG Pu 3 Py 4 are phosphodiester bases.
- XiX 2 X 3 and X 4 X 5 X 6 (W) M (G) N include phosphodiester bases.
- X 1 X 2 X 3 Pu 1 Py 2 CpG Pu 3 Py 4 X 4 X 5 X 6 (W)M (G) N (SEQ ID NO:21)include phosphodiester bases.
- sequence X 1 X 2 X 3 includes at most one or at most two phosphothioate bases and/or the sequence X 4 X 5 X 6 includes at most one or at most two phosphothioate bases.
- X 4 X 5 X 6 (W)M (G)N includes at least 1, at least 2, at least 3, at least 4, or at least 5 phosphothioate bases.
- a D ODN can be a phosphothioate/phosphodiester chimera.
- any suitable modification can be used to render the D ODN resistant to degradation in vivo (for example, via an exo- or endo-nuclease).
- a modification that renders the oligodeoxynucleotide less susceptible to degradation is the inclusion of nontraditional bases such as inosine and quesine, as well as acetyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine.
- modified nucleotides include nonionic DNA analogs, such as alkyl or aryl phosphonates (i.e., the charged phosphonate oxygen is replaced with an alkyl or aryl group, as set forth in U.S. Patent No. 4,469,863), phosphodiesters and alkylphosphotriesters (i.e., the charged oxygen moiety is alkylated, as set forth in U.S. Patent No. 5,023,243 and European Patent No. 0 092 574).
- Oligonucleotides containing a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini, have also been shown to be more resistant to degradation.
- the D-type oligodeoxynucleotides can also be modified to contain a secondary structure (e.g., stem-loop structure).
- a secondary structure e.g., stem-loop structure
- Pu 1 Py 2 and Pu 3 Py 4 are self-complementary.
- X[X 2 X 3 andX 4 X 5 X 6 are self-complementary.
- X 1 X 2 X 3 Pu 1 Py 2 and Pu 3 Py 4 X 4 X 5 X 6 are self-complementary.
- Specific non-limiting examples of a D ODN wherein Pu 1 Py 2 and Pu 3 Py 4 are self-complementary include, but are not limited to, ATCGAT, ACCGGT, ATCGAC, ACCGAT, GTCGAC, or GCCGGC (wherein the CpG is underlined).
- the self-complementary base sequences can help to form a stem-loop structure with the CpG dinucleotide at the apex to facilitate immunostimulatory functions.
- ODNs wherein Pui Py 2 and Pu 3 Py 4 are self-complementary induce higher levels of IFN- ⁇ production from a cell of the immune system.
- the self-complementary need not be limited to Pui Py 2 and Pu 3 Py 4 .
- additional bases on each side of the three bases on each side of the CpG-containing hexamer form a self-complementary sequence (see above).
- GGTGCATCGATACAGGGGGG (DVl 13, SEQ ID NO: 6, see Table 1)
- This oligodeoxynucleotide has a far- flanking region that is not self- complementary and induces high levels of IFN- ⁇ and IFN- ⁇
- Another specific, non-limiting example of a D ODN is: GGTGCGTCGATGCAGGGGGG (DV28, SEQ ID NO: 3, see Table 1)
- This D ODN is of use for inducing production and/or release of cytokines from immune cells, although it lacks a self-complementary motif.
- the D ODNs are at least about 16 nucleotides in length.
- a D ODN is at least about 18 nucleotides in length. In another embodiment, a D ODN is from about 16 nucleotides in length to about 100 nucleotides in length. In yet another embodiment, a D ODN is from about 16 nucleotides in length to about 50 nucleotides in length. In a further embodiment, a D ODN is from about 18 nucleotides in length to about 30 nucleotides in length.
- the D ODN is at least 18 nucleotides in length, and at least two G's are included at the 5' end of the molecule, such that the oligodeoxynucleotide includes a sequence represented by the formula:
- the D ODN can include additional G' s at the 5 ' end of the oligodeoxynucleotide. In one specific example, about 1 or about 2 G's are included at the 5' end of an oligodeoxynucleotide including a sequence as set forth as the above formula.
- Examples of a D ODN include, but are not limited to the sequence shown in the following table:
- ODN SEQUENCE SEQUENCE IDENTIFIER DODN
- D ODN can be used in combination to induce an immune response.
- multiple D ODNs can be utilized to induce an immune response.
- two, three, four, five or more D ODNs can be utilized to induce an immune response.
- a single ODN can be generated that includes the two or more D ODN CpG motifs disclosed herein.
- the D ODN can be synthesized de novo using any of a number of procedures well known in the art.
- the oligodeoxynucleotides can be synthesized as set forth in U.S. Patent No. 6,194,388, which is herein incorporated by reference in its entirety.
- a D ODN can be synthesized using, for example, the B-cyanoethyl phosphoramidite method or nucleoside H-phosphonate method. These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market.
- oligodeoxynucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as employing restriction enzymes, exonucleases or endonucleases, although this method is less efficient than direct synthesis.
- TLR9 Tol-like receptor 9
- a method is disclosed herein for altering the uptake of a D ODN. Increasing the uptake of a D ODN can be used to increase the immunostimulatory activity of the D ODN. Similarly, decreasing the uptake of a D ODN can be used to attenuate the immunostimulatory activity of the D ODN.
- D ODNs are of use in producing an immune response (see also PCT Publication Nos. WO0061151 A3, WO9956755A1, WO9840100A1, WO9818810A1, WO0122990A2, which are all herein incorporated by reference in their entirety).
- Administration of a D ODN can be by any suitable method, including in vivo or ex vivo administration.
- a D ODN can be used to stimulate monocytes and/or natural killer cells, and/or to induce the maturation of dendritic cells.
- a D ODN can be used to increase the production of cytokines (for example IP-IO, IFN- ⁇ or IFN- ⁇ ) by a cell of the immune system.
- cytokines for example IP-IO, IFN- ⁇ or IFN- ⁇
- D ODNs can be used to induce a T cell response to an antigen of interest.
- D ODNs are also of use in producing an immune response against pathogens (such as bacterial, viral, or fungal pathogens).
- D ODNs can be used to induce a protective immune response.
- D ODNs can be used to increase an immune response to a tumor antigen.
- D ODNs are of use in a variety of therapeutic applications, and can also be utilized in vaccine formulations.
- An agent that increases the activity and/or expression of CXCLl 6 can be used to increase one or more immune response induced by a D ODN.
- a method is provided for increasing the uptake of a D ODN. The method includes administering an effective amount of an agent that increases the activity and/or expression of CXCLl 6.
- a method is disclosed herein for inducing an immune response in a subject by administering a D ODN and an agent that increases the activity and/or expression of CXCLl 6.
- the immune response can include, but is not limited to, induction of the maturation of a dendritic cell or the activation of a natural killer cell and/or a monocyte.
- the immune response can also include the production of a cytokine, such as, for example, IL-IO, IP-IO, IFN- ⁇ or IFN- ⁇ .
- the immune response can also include an immune response against an antigen, such as a bacterial, viral, or fungal antigen.
- the immune response can include an immune response to a tumor antigen.
- a D ODN is administered in conjunction with an agent that increases the expression and/or activity of CXCLl 6 to a subject that has an autoimmune disease.
- Exemplary autoimmune diseases affecting mammals include rheumatoid arthritis, juvenile oligoarthritis, collagen-induced arthritis, adjuvant- induced arthritis, Sjogren's syndrome, multiple sclerosis, experimental autoimmune encephalomyelitis, inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis), autoimmune gastric atrophy, pemphigus vulgaris, psoriasis, vitiligo, type 1 diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, sclerosing cholangitis, sclerosing sialadenitis, systemic lupus erythematosis, autoimmune thrombocytopenia purpura, Goodpasture's syndrome, Addison's disease, systemic sclerosis, polymyositis, dermatomyositis, autoimmune hemolytic anemia, pernicious anemia, and the like. Specific, non-
- a D ODN is administered in conjunction with an agent that increases the expression and/or activity of CXCLl 6 to treat, prevent, or ameliorate an allergic reaction in a subject.
- An allergy refers to an acquired hypersensitivity to a substance (an allergen). Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, uticaria (hives), food allergies, and other atopic conditions.
- allergens is extensive and includes pollens, insect venoms, animal dander, dust, fungal spores, and drugs (such as antibiotics like penicillin or tetracycline). Examples of natural, animal, and plant allergens can be found in PCT Publication No.
- a D ODN is administered to a subject in conjunction with an agent that increases the expression and/or activity of CXCLl 6 to treat an allergic condition such as allergic asthma.
- the D ODN and the agent that increases the uptake and/or activity of CXCLl 6 can also be administered in combination with an anti-allergenic agent.
- Suitable anti-allergenic agents include those substances given in treatment of the various allergic conditions described above, examples of which can be found in the Physicians' Desk Reference (1998).
- a D ODN is administered to a subject that has a neoplasm.
- the subject has cancer.
- the D ODN is administered in conjunction with an agent that increases the expression and/or activity of
- neoplasms include benign and malignant cancer.
- the neoplasm can be from any origin, and include, but are not limited to, solid tumors such as cancers of the brain, lung (e.g., small cell and non-small cell), ovary, breast, prostate, liver, lung, skin, and colon, as well as carcinomas and sarcomas.
- the neoplasm can also be a lymphoma or a leukemia.
- hematological tumors include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, and myelodysplasia.
- acute leukemias such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia
- solid tumors such as sarcomas and carcinomas
- solid tumors include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder carcinoma, and CNS tumors
- the administration of the D ODN and the agent that increases the expression and/or activity of CXCLl 6 can be used to reduce tumor burden.
- a method is provided to enhance the efficacy of any suitable vaccine.
- the method includes the administration of a D ODN in conjunction with an agent that increases the expression and/or activity of CXCLl 6 and a vaccine component.
- Suitable vaccines include those directed against Leishmania, Hepatitis A, B, and C, examples of which can be found in the Physicians' Desk Reference (1998), and DNA vaccines directed against, for example, malaria. (See generally Klinman et al., Vaccine 17:19, 1999; McCluskie and Davis, J Immun. 161 :4463, 1998).
- the vaccine can be a subunit vaccine, or can include an attenuated or heat-killed virus.
- D ODN and the agent that induces the expression and/or activity CXCLl 6 can be used to treat or ameliorate any condition associated with an infectious agent.
- the D ODN and the agent that increases the activity and/or expression of CXCLl 6 can be administered to a subject infected with the infectious agent.
- infectious agents are viruses, bacteria, fungi, and other organisms (such as protists) can be found in PCT Publication No. WO 98/18810.
- the D ODN and the agent that induces the expression and/or activity of CXCLl 6 can be administered in combination with any suitable anti-infectious agent, such as an antiviral, anti-fungal or anti-bacterial agent (see Physicians' Desk Reference, 1998).
- the agent that increases the activity and/or expression of CXCLl 6 can be one or more cytokines.
- the cytokines interferon gamma (IFN- ⁇ , see, for example GENBANK® Accession No. AAM28885, May 16, 2002) and tumor necrosis factor alpha (TNF-o; see, for example GENBANK® Accession No. NP_000585, August 20, 2006, incorporated herein by reference) induce CXCLl 6, either alone or in combination.
- IFN- ⁇ and/or TNF- ⁇ could be used to increase the uptake of a D ODN.
- Nucleic acids encoding IFN- ⁇ or TNF-ce could be administered to the subject in order increase the uptake of a D ODN.
- the agents that induce the expression and/or activity of CXCLl 6 include nucleic acids encoding CXCLl 6, such as human CXCLl 6.
- Agents that increase the activity and/or expression of CXCLl 6 include, but are not limited to, antagonists of ADAM- 10.
- Exemplary antagonists of ADAM- 10 are GW280264X, G1254023X or GM6001.
- GM6001 has the chemical formula C 2O H 28 N 4 O 4 , and has the structure shown below:
- GW280264X ((2R,3S)-3-(formyl-hydroxyamino)-2-(2-methyl-l-propyl) hexanoic acid [( 1 S)-5-benzyloxycarbamoylamino- 1 -( 1 ,3 -thiazol-2-ylcarbamoyl)- 1 - pentyl] amide
- GI254023X ((2R,3S)-3-(formyl-hydroxyamino)-2-(3-phenyl-l- propyl) butanoic acid[( 1 S)-2,2-dimethyl- 1 -methylcarbamoyl- 1 -propyl] amide
- Patent No. 6,172,064, U.S. Patent No. 6,191,150 and U.S. Patent No. 6,329,400 The compounds can be administered as a single or polymorphic crystalline form or forms, an amorphous form, a single enantiomer, a racemic mixture, a single stereoisomer, a mixture of stereoisomers, a single diastereoisomer, a mixture of diastereoisomers, a solvate, a pharmaceutically acceptable salt, a solvate, a prodrug, a biohydrolyzable ester, or a biohydrolyzable amide thereof.
- These compounds can also be administered as pharmaceutically acceptable salt, solvate, biohydrolyzable ester, biohydrolyzable amide, affinity reagent, or prodrug thereof for use in therapy.
- MMP-2 inhibitors are of use, such as batimastat.
- an inhibitor such as inhibitor of the formula CisH 35 NO 2 :
- Additional agents can be administered in conjunction with the D ODN and the agent that alters the activity and/or expression of CXCLl 6.
- These agents include a protein, an antigenic epitope, a hydrocarbon, lipid, mitogen, an anti-infectious agent (such as antiviral, antifungal, or anti-bacterial agent), a chemotherapeutic agent or a vaccine (such as a live, attenuated, or heat-killed vaccine).
- Additional agents can be administered simultaneously or sequentially with the D ODN and the agent that increases the activity and/or expression of CXCLl 6.
- a method for activating an antigen presenting cell or lymphocyte in vitro.
- the method includes contacting a monocyte or a dendritic cell precursor in vitro with a D ODN and an agent that increases CXCLl 6 expression and/or activity to produce an activated antigen presenting cell.
- the monocytes or dendritic cell precursors can be contacted with the D ODN and the agent that increases CXCLl 6 expression and/or activity in the presence of or in the absence of an antigen.
- the activated antigen presenting cell can be administered to the subject to induce an immune response.
- lymphocytes or natural killer cells are contacted with the activated antigen presenting cells in vitro, or with cytokines secreted by the activated antigen presenting cells in vitro, to produce activated lymphocytes or activated natural killer cells.
- the activated lymphocytes or natural killer cells can then be administered to the subject to induce an immune response.
- a method for decreasing the uptake of a D ODN.
- the method includes providing an agent that decreases the activity and/or expression of CXCLl 6.
- the agent that decreases the uptake of a D ODN is ionomycin.
- the agent that decreases the activity and/or expression of CXCLl 6 is an antisense oligonucleotide, small inhibitory mRNA (simRNA) or a ribozyme that cleaves CXCLl 6 mRNA.
- imRNA small inhibitory mRNA
- a ribozyme that cleaves CXCLl 6 mRNA.
- the agent that decreases the activity and/or expression of CXCLl 6 is an antibody.
- the antibody or antibody fragment can be a humanized immunoglobulin.
- the humanized immunoglobulin specifically binds to the CXCLl 6, or a molecule that regulates CXCLl 6, with an affinity constant of at least 10 7 M "1 , such as at least 10 8 M '1 or 10 9 M "1 .
- the use of antibody components derived from humanized monoclonal antibodies obviates potential problems associated with the immunogenicity of the constant regions of the donor antibody.
- Antibodies include intact molecules as well as fragments thereof, such as Fab, F(ab') 2 , and Fv which include a heavy chain and light chain variable region and are capable of binding the epitopic determinant. These antibody fragments retain some ability to selectively bind with their antigen or receptor and are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab 1 fragments are obtained per antibody molecule; (3) (Fab') 2 , the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab') 2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, a
- An epitope is any antigenic determinant on an antigen to which the paratope of an antibody binds.
- Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics
- agents that increase intracellular calcium are of use in decreasing CXCLl 6 activity.
- agents that increase intracellular calcium are of use in increasing ADAM- 10 activity resulting in increased cleavage of CXCL-16.
- a cross-linking agent can be used to cross link the BDCA-2 receptor on the surface of plasmacytoid dendritic cells. This results in increased intracellular calcium flux and a corresponding decrease in CXCLl 6 activity. Plasmacytoid dendritic cells treated with a cross-linking agent fail to produce interferon alpha in response to a D ODN.
- CXCLl 6 plays a role in atherosclerosis and Alzheimer's disease.
- reduced levels of CXCL 16 can be used to treat subjects with atherosclerosis and Alzheimer's disease.
- Reducing CXCL 16 on the surface of plasmacytoid dendritic cells can also be effective in treating SLE.
- a method is provided herein for the treatment of subjects with atherosclerosis, Alzheimer's disease, and systemic lupus Erythematosus.
- the method includes administering an antibody that specifically binds CXCLl 6, an agent that increases the activity of ADAM-IO, such as ionomycin.
- compositions including a therapeutically effective amount of the agent that alters CXCLl 6 expression and/or activity are administered to the subject of interest.
- a D ODN is also administered to the subject of interest.
- the agent that alters CXCL 16 expression and/or activity can be included in the same composition as the D ODN.
- compositions are provided herein that include a therapeutically effective amount agent that alters CXCLl 6 and a therapeutically effective amount D ODN in a pharmaceutically acceptable carrier.
- additional therapeutic agents can be included, such as, but not limited to chemotherapeutic agents, antigens, attenuated or heat killed virus, and/or cytokines.
- the CXCLl 6 can be included in a first composition, and the D ODN included in a second composition, and the two compositions administered to a subject of interest sequentially.
- parenteral formulations usually comprise injectable fluids that are pharmaceutically and physiologically acceptable fluid vehicles such as water, physiological saline, other balanced salt solutions, aqueous dextrose, glycerol or the like.
- injectable fluids that are pharmaceutically and physiologically acceptable fluid vehicles such as water, physiological saline, other balanced salt solutions, aqueous dextrose, glycerol or the like.
- Excipients that can be included are, for instance, proteins, such as human serum albumin or plasma preparations.
- the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- the dosage form of the pharmaceutical composition will be determined by the mode of administration chosen.
- Agents that increase the expression and/or activity of CXCL- 16 and D ODN can be administered systemically or locally.
- the agents can be administered in oral (including buccal and sublingual) dosage forms as tablets, capsules (each including timed release and sustained release formulations), pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions.
- Topical preparations can include eye drops, ointments, sprays and the like.
- Oral formulations may be liquid (e.g., syrups, solutions, or suspensions), or solid (e.g., powders, pills, tablets, or capsules).
- conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. Actual methods of preparing such dosage forms are known, or will be apparent, to those of ordinary skill in the art.
- oral dosages of antagonists of ADAM-IO when used for the indicated effects, will range between about 0.1 to 2000 mg/kg of body weight per day, and particularly 1 to 1000 mg/kg of body weight per day.
- Oral dosage units are generally administered in the range of from 1 to about 250 mg, such as from about 25 to 250 mg.
- the daily dosage for a 70 kg mammal can be, for example, in the range of about 10 mg to 5 grams of a compound.
- the dosage regimen is generally selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound or salt thereof employed.
- compositions will be formulated in unit dosage form, suitable for individual administration of precise dosages.
- the amount of active compound(s) administered will be dependent on the subject being treated, the severity of the affliction, and the manner of administration, and is best left to the judgment of the prescribing clinician.
- the formulation to be administered will contain a quantity of the active component(s) in amounts effective to achieve the desired effect in the subject being treated. See for example, U.S. Patent No. 6,172,064, for a discussion of the preparation of tablets capsules, suppositories, formulations for injection, and formulations for inhalation therapy, such as for use with ADAM- 10 inhibitors.
- compositions can be formulated with an appropriate solid or liquid carrier, depending upon the particular mode of administration chosen.
- the disclosed pharmaceutical compositions can also contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Excipients that can be included in the disclosed compositions include flow conditioners and lubricants, for example silicic acid, talc, stearic acid or salts thereof, such as magnesium or calcium stearate, and/or polyethylene glycol, or derivatives thereof.
- the compositions can be provided as parenteral compositions, such as for injection or infusion.
- compositions are formulated generally by mixing a disclosed therapeutic agent at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, for example one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- a disclosed therapeutic agent can be suspended in an aqueous carrier, for example, in an isotonic buffer solution at a pH of about 3.0 to about 8.0, preferably at a pH of about 3.5 to about 7.4, 3.5 to 6.0, or 3.5 to about 5.0.
- Useful buffers include sodium citrate-citric acid and sodium phosphate-phosphoric acid, and sodium acetate/acetic acid buffers.
- the active ingredient can also be in the form of a lyophilisate and can be made into a solution prior to parenteral administration by the addition of suitable solvents. Solutions such as those that are used, for example, for parenteral administration can also be used as infusion solutions.
- compositions can be formulated in unit dosage form, suitable for individual administration of precise dosages.
- a bolus administration is provided, followed by a time-period wherein no disclosed agent that affects
- CXCLl 6 activity/ D ODN is administered to the subject, followed by a second bolus administration.
- a therapeutically effective amount of the composition can be administered in a single dose, or in multiple doses, for example daily, during a course of treatment.
- pulse doses are administered during the course of a day, during the course of a week, or during the course of a month.
- a form of repository or "depot” slow release preparation can be used so that therapeutically effective amounts of the preparation are delivered into the bloodstream over many hours or days following transdermal injection or delivery.
- Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
- the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- suitable polymeric or hydrophobic materials for example as an emulsion in an acceptable oil
- ion exchange resins for example as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- the therapeutic compositions that can be delivered by way of a pump see
- a pump is implanted (for example see U.S. Patent Nos. 6,436,091; 5,939,380; and 5,993,414).
- Implantable drug infusion devices are used to provide patients with a constant and long-term dosage or infusion of a therapeutic agent. Such device can be categorized as either active or passive. Active drag or programmable infusion devices feature a pump or a metering system to deliver the agent into the patient's system.
- An example of such an active infusion device currently available is the Medtronic SYNCHROMEDTM programmable pump.
- Passive infusion devices in contrast, do not feature a pump, but rather rely upon a pressurized drag reservoir to deliver the agent of interest.
- An example of such a device includes the Medtronic ISOMEDTM.
- compositions including an agent that affects CXCLl 6 activity and/or expression are administered by sustained-release systems.
- the D ODN can also be administered by sustained release systems, alone or in combination with the agent that affects CXCLl 6 activity and/or expression.
- sustained-release systems include suitable polymeric materials (such as, semipermeable polymer matrices in the form of shaped articles, for example films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt).
- Sustained-release compositions can be administered orally, parenterally, intracistemally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), or as an oral or nasal spray.
- Sustained-release matrices include polylactides (U.S. Patent No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556, 1983, poly(2-hydroxyethyl methacrylate)); (Langer et al., J. Biomed. Mater.
- Polymers can be used for ion-controlled release.
- Various degradable and nondegradable polymeric matrices for use in controlled drag delivery are known in the art (Langer, Accounts Chem. Res. 26:537, 1993).
- the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res. 9:425, 1992; and Pec, J. Parent. Sd. Tech.
- hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al., Int. J. Pharm. 112:215, 1994).
- liposomes are used for controlled release as well as drug targeting of the lipid-capsulated drug (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA, 1993).
- Numerous additional systems for controlled delivery of therapeutic proteins are known (for example, U.S. Patent No. 5,055,303; U.S. Patent No. 5,188,837; U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No.
- an in vitro method for screening for an agent that affects the immune response induced by a D ODN.
- the method includes contacting a cell with an agent in vitro, and assessing the expression and/or activity of CXCLl 6.
- An increase in the expression and/or activity of CXCLl 6 indicates that the agent is of use in increasing the uptake of a D ODN.
- An increase in the expression or activity of CXCLl 6 also indicates that the agent will increase an immune response induced by an ODN.
- a decrease in the expression and/or activity of CXCLl 6 indicates that the agent is of use in decreasing the uptake of a D ODN.
- a decrease in the expression or activity of CXCLl 6 also indicates that the agent will decrease an immune response induced by an ODN.
- a parameter of an immune response can also be measured.
- cytokine production is measured.
- the production of interferon- ⁇ or IL-6 can be measured.
- expression of a protein is assess, such as, but not limited to, the expression of HLA.
- CXCLl 6 can be measured by any method known to those of skill in the art.
- the expression of CXCLl 6 can be measured by polymerase chain reaction, Western blot, and ELISA and flow cytometry (see Abel et al., J. Immunol. 172:6362-6372, 2004, incorporated herein by reference for a detailed description of these methods).
- One exemplary non-limiting method for measuring CXCLl 6 is reverse transcriptase polymerase chain reaction (RT-PCR).
- RT-PCR reverse transcriptase polymerase chain reaction
- One exemplary non-liming method utilizes RNA isolated from cultured cells using TRIzol reagent. Total RNA (1 ⁇ g) is treated with DNaseI and is reverse transcribed to cDNA using a suitable commercially available polymerase.
- a control without polymerase is run parallel to allow assessment of genomic DNA contamination.
- Each cDNA sample is analyzed for expression of CXCLl 6 and GAPDH by real-time quantitative RT-PCR using the fluorescent TAQMANTM 5 '-nuclease assay.
- Exemplary sequences of forward primer, reverse primer, and probe for CXCLl 6 are 5'-GAG CTC ACT CGT CCC AAT GAA-3 ' (SEQ ID NO: 18), 5'-TCA GGC CCA ACT GCC AGA C-3' (SEQ ID NO: 19), and 5'-FAM CAC CAT TCA CAC TGC GGG CCA C TAMRA-3' (SEQ ID NO: 20).
- Levels of CXCLl 6 mRNA can be quantified by comparison of the fluorescence of each sample with that of a serially diluted standard of human genomic DNA.
- One exemplary and non-limiting method for an ELISA assay for a CXCLl 6 is as follows: Microlon 96-well plates (Greiner, Nurtingen, Germany) at room temperature, are utilized with a reaction volume was 50 ⁇ l. The plate is coated overnight with 2 mg/ml goat anti-human CXCLl 6 in 50 mM Na 2 CO 3 (pH9.3), washed three times with 0.05% TWEEN in phosphate buffered saline (PBS-T), and blocked with PBS-T containing 2% bovine serum album (BSA) for 2 hours.
- PBS-T phosphate buffered saline
- the plate is dried and the samples are added for 2 hours.
- a standard prepared as nine serial 1/2 dilutions of 1.25 nM recombinant human CXCL16 in either PBS-T with 1% BSA, serum-free medium, or cell lysis buffer is run in parallel.
- 200 ng/ml biotinylated rabbit anti-human CXCLl 6 in PBS-T/1% BSA is added to each well and the plate is incubated at room temperature for 1 hour.
- 100 mU/ml streptavidin-peroxidase conjugate (Roche) in PBS-T/1% BSA is added for 1 hour.
- chromogenic peroxidase substrate is added.
- One exemplary and non-limiting method for FACS analysis of CXCLl 6 expression is as follows: cells are suspended in ice-cold PBS containing 0.1% BSA and 0.01% NaN 3 at 3 X 10 5 cells/ml and incubated with purified rabbit anti-human CXCLl 6 or rabbit IgG control (both at 2 ⁇ g/ml in PBS with 0.1% BSA and 0.01% NaN 3 ) for 1 hour on ice. Following two-fold washing, cells are incubated with secondary fluorescein-conjugated goat anti-rabbit IgG for 1 hour on ice.
- MFI median fluorescence intensity
- the expression or activity of CXCLl 6 can be compared to a control. Suitable controls also include a standard value or a cell contacted with the D ODN in the absence of the agent.
- An in vivo method is provided herein for screening for an agent that affects the immune response induced by a D ODN.
- the method includes administering of the agent to a non-human mammal, such as a mouse, rat, cat, sheep, dog, goat, pig or monkey, and assessing the expression and/or activity of CXCLl 6 in a sample taken from the non-human mammal.
- An increase in the expression and/or activity of CXCLl 6 indicates that the agent is of use in increasing the uptake of a D ODN.
- An increase in the expression or activity of CXCLl 6 also indicates that the agent will increase an immune response induced by an ODN.
- a decrease in the expression and/or activity of CXCLl 6 indicates that the agent is of use in decreasing the uptake of a D ODN.
- a decrease in the expression or activity of CXCLl 6 also indicates that the agent will decrease an immune response induced by an ODN.
- CXCLl 6 can be measured by any method known to those of skill in the art.
- the expression of CXCLl 6 can be measured by polymerase chain reaction, Western blot, and ELISA and flow cytometry (see Abel et al., J. Immunol 172:6362-6372, 2004, for a detailed description of these methods).
- an immune response can be evaluated in the animal model. For example, the production of a cytokine or the number of cells (such as activated T cells) can be measured.
- Suitable controls also include a standard value. Suitable controls also include a sample obtained from an animal administered the D ODN in the absence of the agent.
- Dextran sulfate inhibited the binding of D but not K ODN to pDC by >50% (p ⁇ 0.001). Similar levels of inhibition were achieved in the presence of another SR ligand fucoidan but not with the non-ligand chondroitin sulfate. These SR ligands also abolished D ODN induced IFN ⁇ secretion and up-regulation of HLA-DR/CD54 by > 90% (p ⁇ 0.001) (Table 2 and Supplementary FIGS. 3B and 3D) but failed to affect K ODN induced TNFce production and HLA-DR/CD54 up-regulation (Table 2 and FIGS. 3C and 3D). These results suggested a SR-mediated recognition mechanism for D ODN.
- CXCLl 6 is an unusual chemokine with SR activity when expressed as a transmembrane molecule at the surface of professional antigen presenting cells (Shimaoka et al., J Biol Chem. 275(52):40663-6, 2000).
- TNF ⁇ and IFN ⁇ production from CXCL16 bright or dim/negative cells was analyzed by intracellular cytokine staining (FIG. 2A).
- K but not D ODN produced significant amounts of TNF ⁇ from pDCs and 83.21 + 0.74 % of all producers were in the CXCLl 6 negative/dim population.
- D ODNs induced significant amounts of IFN ⁇ and almost all of this cytokine (85.51 ⁇ 0.22 %) was produced by the CXCLl 6 positive pDCs.
- anti-CXCL16 antibodies reduced D ODNs dependent IFN ⁇ production by 55.9 % (p ⁇ 0.005 when compared to isotype control, FIG. 2B), but had no significant effect on the ability of K ODNs to stimulate IP-IO production.
- anti-CXCL16 Abs significantly reduced the ability of D (but not K) ODNs to activate pDC as manifest by the up-regulation of HLA-DR/CD86 expression in elutriated monocytes (FIG. 2C, 68.7 % suppression as opposed to 1.4 % p.
- CXCLl 6 transfection increases background luciferase activity almost 2-fold for all ODNs irrespective of whether they contain CpG or not except for D class, where significantly higher responses were achieved (6-fold, PO.05, FIG 2D) in the presence of CXCLl 6.
- Example 5 ADAM-IO CXCLl 6 expressed on the cell surface is cleaved by the metalloproteinase
- ADAM-IO (Abel et al., J Immunol. 2004 172(10): 6362-72, 2004; Gough et al., J Immunol. 172(6):3678-85, 2004).
- GM6001 the metalloproteinase inhibitor
- Metalloproteinase inhibitor treatment increased the expression of CXCLl 6 (FIG.
- HEK293 cells transfected to express TLR9 responded to stimulation by K ODNs. This observation suggests that K-type CpG ODNs do not require CXCLl 6 for uptake or activity.
- D ODNs The selective binding of D but not K ODNs to CXCLl 6 could be mediated by the poly G tail unique to D ODNs.
- the poly G tail present on all D ODNs allows the formation of G-tetrads, and the resultant generation of higher order tertiary structures (Kerkman et al, J Biol Chem. 280(9):8086-93, 2005).
- D ODNs with its nanoparticle forming ability, is recognized specifically by the scavenger receptor CXCL 16 and this highly specific interaction and subsequent internalization may alter the subcellular distribution of this ODN.
- Human pDC are known to produce high amounts of IFN ⁇ when exposed to enveloped viruses.
- PS phosphatidylserine
- HSV herpes simplex virus
- the viral membrane was shown to contain a 3-fold higher concentration of PS compared to the host nuclear membrane (van Genderen et al., Virology 200(2):831-6, 1994).
- PS was one of the first molecules described as being recognized by CXCLl 6 (Shimaoka et al., J Biol Chem. 275(52):40663-6, 2000). Therefore, PS that is expressed on viral envelopes could be recognized by transmembrane CXCL 16 on pDC, thereby facilitating virus internalization and subsequent IFN ⁇ production.
- Cancer cells such as mammary cancer cells 1 IA-I (Cancer Res, 55: 3310-7, 1995), Meth A sarcoma cells (DeLeo et al., J Exp Med, 146: 720-34, 1977), or MC- 38 (Tan et al., J Natl Cancer Inst (Bethesda), 56: 871-3, 1976) are .
- Meth A is passaged as an ascitic tumor. Cells are harvested, counted, and washed with PBS before use.
- mice are treated with 15 nmol of D ODN (or a non-CpG ODN control) by intraperitoneal (i.p.) injection on days 4, 9, and 14.
- Groups of mice are administered an agent that induces the expression of CXCLl 6, such as antagonists of ADAM-IO, for example G1254023X or GM6001 in conjunction with the D ODN (see Table 1 for D ODN sequences).
- the mice are immunized i.p. with 5 X 10 7 pfu of MVAp53, 5 X 10 7 pfu of MVApp65, or PBS.
- the subcutaneous tumors were measured twice weekly in three dimensions with calipers.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Pulmonology (AREA)
- Oncology (AREA)
- Diabetes (AREA)
- Communicable Diseases (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Dermatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Tropical Medicine & Parasitology (AREA)
- Neurology (AREA)
- Physical Education & Sports Medicine (AREA)
- Endocrinology (AREA)
- Otolaryngology (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP06813920.3A EP1929014B1 (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by d-type cpg oligodeoxynucleotides |
| AU2006284889A AU2006284889B2 (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
| US12/065,085 US7892569B2 (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
| JP2008529207A JP5481068B2 (ja) | 2005-08-31 | 2006-08-28 | CpGオリゴデオキシヌクレオチドによって誘発される免疫応答を変化させる方法 |
| CA2620582A CA2620582C (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by cpg oligodeoxynucleotides |
| US13/005,488 US8470342B2 (en) | 2005-08-31 | 2011-01-12 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US71354705P | 2005-08-31 | 2005-08-31 | |
| US60/713,547 | 2005-08-31 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/065,085 A-371-Of-International US7892569B2 (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
| US13/005,488 Continuation US8470342B2 (en) | 2005-08-31 | 2011-01-12 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
| US13/005,488 Division US8470342B2 (en) | 2005-08-31 | 2011-01-12 | Methods of altering an immune response induced by CpG oligodeoxynucleotides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007027718A1 true WO2007027718A1 (en) | 2007-03-08 |
Family
ID=37606913
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/033774 Ceased WO2007027718A1 (en) | 2005-08-31 | 2006-08-28 | Methods of altering an immune response induced by cpg oligodeoxynucleotides |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US7892569B2 (enExample) |
| EP (1) | EP1929014B1 (enExample) |
| JP (1) | JP5481068B2 (enExample) |
| AU (1) | AU2006284889B2 (enExample) |
| CA (1) | CA2620582C (enExample) |
| WO (1) | WO2007027718A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012005229A1 (ja) | 2010-07-08 | 2012-01-12 | 科研製薬株式会社 | N-ヒドロキシホルムアミド誘導体およびそれを含有する医薬 |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030026782A1 (en) * | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
| US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO2000061151A2 (en) * | 1999-04-12 | 2000-10-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| US6977245B2 (en) | 1999-04-12 | 2005-12-20 | The United States Of America As Represented By The Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| AU2001227889A1 (en) * | 2000-01-14 | 2001-07-24 | The United States of America, represented by The Secretary, Department of Health & Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| AU2004275876B2 (en) * | 2003-09-25 | 2011-03-31 | Coley Pharmaceutical Gmbh | Nucleic acid-lipophilic conjugates |
| CA2745096C (en) | 2008-12-09 | 2013-11-05 | Coley Pharmaceutical Group, Inc. | Immunostimulatory oligonucleotides |
| US8552165B2 (en) * | 2008-12-09 | 2013-10-08 | Heather Davis | Immunostimulatory oligonucleotides |
| US20100233270A1 (en) | 2009-01-08 | 2010-09-16 | Northwestern University | Delivery of Oligonucleotide-Functionalized Nanoparticles |
| MX2011010050A (es) | 2009-03-25 | 2011-12-14 | Univ Texas | Composiciones para estimulación de resistencia inmune innata de mamiferos a patógenos. |
| CN103555726B (zh) * | 2013-10-14 | 2015-05-13 | 中国科学院海洋研究所 | 一种含有未甲基化CpG的DNA序列(CpG-DNA)及其应用 |
| US10434064B2 (en) | 2014-06-04 | 2019-10-08 | Exicure, Inc. | Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications |
| WO2016044839A2 (en) | 2014-09-19 | 2016-03-24 | The Board Of Regents Of The University Of Texas System | Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds |
| US11696954B2 (en) * | 2017-04-28 | 2023-07-11 | Exicure Operating Company | Synthesis of spherical nucleic acids using lipophilic moieties |
| EP3752194A4 (en) | 2018-02-13 | 2022-03-16 | Checkmate Pharmaceuticals, Inc. | COMPOSITIONS AND METHODS FOR TUMOR IMMUNOTHERAPY |
| EP3775218A1 (en) | 2018-04-09 | 2021-02-17 | Checkmate Pharmaceuticals | Packaging oligonucleotides into virus-like particles |
| WO2024137496A1 (en) | 2022-12-19 | 2024-06-27 | Six Therapeutics Inc. | Compositions and methods of using cpg oligonucleotides |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999056755A1 (en) * | 1998-05-06 | 1999-11-11 | University Of Iowa Research Foundation | Methods for the prevention and treatment of parasitic infections and related diseases using cpg oligonucleotides |
| WO2000061151A2 (en) * | 1999-04-12 | 2000-10-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| WO2001022990A2 (en) * | 1999-09-27 | 2001-04-05 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH02138868A (ja) * | 1988-11-18 | 1990-05-28 | Eisai Co Ltd | 男性不妊症の診断試薬 |
-
2006
- 2006-08-28 JP JP2008529207A patent/JP5481068B2/ja active Active
- 2006-08-28 WO PCT/US2006/033774 patent/WO2007027718A1/en not_active Ceased
- 2006-08-28 CA CA2620582A patent/CA2620582C/en not_active Expired - Fee Related
- 2006-08-28 AU AU2006284889A patent/AU2006284889B2/en not_active Ceased
- 2006-08-28 EP EP06813920.3A patent/EP1929014B1/en not_active Ceased
- 2006-08-28 US US12/065,085 patent/US7892569B2/en not_active Expired - Fee Related
-
2011
- 2011-01-12 US US13/005,488 patent/US8470342B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999056755A1 (en) * | 1998-05-06 | 1999-11-11 | University Of Iowa Research Foundation | Methods for the prevention and treatment of parasitic infections and related diseases using cpg oligonucleotides |
| WO2000061151A2 (en) * | 1999-04-12 | 2000-10-19 | The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
| WO2001022990A2 (en) * | 1999-09-27 | 2001-04-05 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
Non-Patent Citations (3)
| Title |
|---|
| ABEL SOEREN ET AL: "The transmembrane CXC-chemokine ligand 16 is induced by IFN-gamma and TNF-alpha and shed by the activity of the disintegrin-like metalloproteinase ADAM10", JOURNAL OF IMMUNOLOGY, vol. 172, no. 10, 15 May 2004 (2004-05-15), pages 6362 - 6372, XP002415922, ISSN: 0022-1767 * |
| GURSEL MAYDA ET AL: "CXCL16 influences the nature and specificity of CpG-Induced immune activation", JOURNAL OF IMMUNOLOGY, vol. 177, no. 3, August 2006 (2006-08-01), pages 1575 - 1580, XP002415923, ISSN: 0022-1767 * |
| VERTHELYI D ET AL: "Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs", JOURNAL OF IMMUNOLOGY, vol. 166, no. 4, 15 February 2001 (2001-02-15), pages 2372 - 2377, XP002299044, ISSN: 0022-1767 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012005229A1 (ja) | 2010-07-08 | 2012-01-12 | 科研製薬株式会社 | N-ヒドロキシホルムアミド誘導体およびそれを含有する医薬 |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2006284889B2 (en) | 2011-08-18 |
| US20080249056A1 (en) | 2008-10-09 |
| JP5481068B2 (ja) | 2014-04-23 |
| CA2620582C (en) | 2015-11-10 |
| JP2009506122A (ja) | 2009-02-12 |
| EP1929014B1 (en) | 2014-08-13 |
| AU2006284889A1 (en) | 2007-03-08 |
| US20110110883A1 (en) | 2011-05-12 |
| CA2620582A1 (en) | 2007-03-08 |
| EP1929014A1 (en) | 2008-06-11 |
| US8470342B2 (en) | 2013-06-25 |
| US7892569B2 (en) | 2011-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8470342B2 (en) | Methods of altering an immune response induced by CpG oligodeoxynucleotides | |
| JP5738593B2 (ja) | 修飾糖部分を含有する免疫刺激オリゴヌクレオチド類似体 | |
| KR20090058584A (ko) | 올리고리보뉴클레오티드 및 그의 용도 | |
| US20060241076A1 (en) | Modified oligoribonucleotide analogs with enhanced immunostimulatory activity | |
| WO2007062107A2 (en) | Immunostimulatory oligoribonucleotides | |
| KR20080047463A (ko) | 뉴클레오티드 변형에 의한 짧은 간섭 리보핵산(sirna)의 면역자극 특성의 조절 | |
| US8227447B2 (en) | RNA sequence motifs in the context of defined internucleotide linkages inducing specific immune modulatory profiles | |
| JP2019500873A (ja) | Tlr阻害性オリゴヌクレオチドおよびそれらの使用 | |
| JP2024513131A (ja) | オリゴヌクレオチド | |
| CA2790802C (en) | Immunostimulatory oligoribonucleotides | |
| HK1133043A (en) | Oligoribonucleotides and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 12065085 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2620582 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008529207 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006284889 Country of ref document: AU |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006813920 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2006284889 Country of ref document: AU Date of ref document: 20060828 Kind code of ref document: A |