Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6844—Nucleic acid amplification reactions

Definitions

• the invention relates generally to the field of molecular biology. Certain embodiments of the invention provide compositions, methods, and kits for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample.
• Nucleic acids such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are large macromolecules comprised of covalently linked nucleotide subunits. Nucleic acids encode and transmit from generation to generation the genetic blueprint of all biological organisms including all multi-cellular organisms such as animals and plants, unicellular organisms such as yeast and bacteria, and cellular parasites such as viruses. Nucleic acid sequence analysis can be used to aid in understanding both an organism's phenotypic traits as well as the biochemical processes underlying a given trait. Thus, detecting, amplifying, isolating, and sequencing specific nucleic acid sequences provides a first step in gaining insight into many normal or pathological biological process.
• DNA deoxyribonucleic acid
• RNA ribonucleic acid
• a variety of techniques suitable for detecting nucleic acid sequences have been described (See, e.g., Lodish et al., 2000, Molecular Cell Biology. 4th ed. New York: W. H. Freeman & Co). Laboratory techniques that amplify a target nucleic acid sequence allow the skilled artisan to accomplish many different tasks with the target sequence. These tasks include detecting minute quantities of the target sequence in a sample, sequencing the target sequence, as well as obtaining sufficient quantities of the target sequence to facilitate joining various nucleic acid sequences via cloning techniques.
• PCR polymerase chain reaction
• U.S. Patent Nos. 4,683,195; 4,683,202; and 4,800,159 While PCR is useful, the method is not without its shortcomings.
• the reagents used in PCR are typically mixed together just prior to performing the reaction, requiring multiple pipetting steps that can aerosolize reagents and sample DNA sequences. Because of the exponential amplification of a target nucleic acid molecule, PCR is highly sensitive. Minute quantities of contaminating DNA can undermine the results obtained after amplification by providing false positive signals. The more each reaction tube is manipulated in the process of setting up a PCR reaction, the more likely such contaminating DNA will be introduced into the reaction tube either via contaminated pipette tips or contaminated PCR reagent solutions.
• the invention includes compositions that can be used for amplifying, detecting, and/or isolating a target nucleic acid sequence in a sample, by providing a single formulation containing all reagents necessary for a PCR reaction, except for the sample target nucleic acid sequence or its complement, in a single container.
• the compositions of the invention can also comprise a solid support to which the PCR product can be attached after amplification. The solid support can facilitate rapid isolation and detection of PCR products.
• the invention includes compositions that can be used for sequencing a target nucleic acid sequence in a sample, by providing a single formulation containing all reagents necessary for a PCR sequencing reaction, except for the sample target nucleic acid sequence, in a single container.
• the invention also includes dry compositions that can be used for detecting, amplifying, and/or isolating a target nucleic acid sequence, thereby enhancing the stability and shelf life of the composition.
• the invention also includes methods of detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample, methods of sequencing a target nucleic acid sequence in a sample, and methods of making the compositions of the invention.
• the invention further includes kits useful for detecting, amplifying, isolating, and/or sequencing a target nucleic acid sequence in a sample.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence (i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of
• composition does not comprise the target nucleic acid sequence or its complement.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
• N first oligonucleotides wherein the i th first oligonucleotide is capable of hybridizing with a first part of the i th target nucleic acid sequence
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the i th target nucleic acid sequence; and (j) N third oligonucleotides, wherein the i th third oligonucleotide is linked to the i th discrete area on the at least one solid support and is capable of hybridizing with a third part of
• nucleic acid sequence complementary to the i th target nucleic acid sequence wherein N is a integer greater than or equal to 1 ; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the i th first oligonucleotide, and (i) the i th second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement.
• the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
• N first oligonucleotides wherein the i th first oligonucleotide is capable of hybridizing to a first part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence;
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing to a second part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence and comprises an i th second member of the pair of binding partners; wherein N is a integer greater than or equal to 1 ; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleo
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence (i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of
• the target nucleic acid sequence or (2) a nucleic acid sequence complementary to the target nucleic acid sequence; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - G) in a container thereby forming a composition for detecting, amplifying, and/or isolating the target nucleic acid sequence.
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample comprising:
• N first oligonucleotides wherein the i th first oligonucleotide is capable of hybridizing with a first part of the i th target nucleic acid sequence
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the i th target nucleic acid sequence; and wherein at least one of (b) the at least one nucleoside triphosphate, (h) the i th first oligonucleotide, and (i) the i th second oligonucleotide is modified with a label; and 0) N third oligonucleotides, wherein the i th third oligonucleotide is linked to the i th discrete area on the at least one solid support and is capable of hybridizing with a third part of
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing to a second part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence and comprises an i th second member of the pair of binding partners; wherein N is a integer greater than or equal to 1 ; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid- specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleo
• the method of the invention can comprise freeze-drying the composition for detecting, amplifying, and/or isolating a target nucleic acid sequence. In certain embodiments, the method of the invention can comprise lyophilizing the composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.
• the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the method of detecting, amplifying, and/or isolating a target nucleic acid sequence can comprise freeze-drying or lyophilizing the composition of step (1 ) before performing steps 2-5.
• the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the invention provides a method of detecting, amplifying, and/or isolating a N target nucleic acid sequences comprising:
• N is an integer greater than or equal to 1.
• kits that can be used to carry out the methods for detecting, amplifying, and/or isolating a target nucleic acid sequence according to the invention.
• Figure 1 is a graph showing the relationship between the starting concentration of Bacillus anthracis (B. anthracis) DNA and the electrochemiluminescent signal detected after PCR amplification of the B. anthracis DNA.
• the symbols represent averages of duplicate measurements and the line is a mathematical curve fit to the measurements.
• FIG. 2 is a graph showing the electrochemiluminescent signal generated over time, after PCR amplification of a reconstituted dry composition to which B. anthracis genomic DNA was added.
• Three portions of the genomic B. anthracis DNA (chromosomal locus BA4070, protective antigen, and capsular protein B) were measured at two quantities (100 fg and 5 pg of ⁇ . anthracis DNA) at three times (A. 1 day and 7 days post lyophilization) (B. 28 days post lyophilization).
• the bars represent the averages of triplicate measurements.
• the error bars represent 1 standard deviation of the triplicates.
• Figure 3 is a graph showing the relationship of the electrochemiluminescent signal and copy number of Severe Acute Respiratory Syndrome (SARS) coronavirus after reverse transcriptase and PCR amplification using premixed reagents.
• the circle symbols represent averages of duplicate measurements for compositions that were kept in liquid form and used the same day the composition was made.
• the plus symbols represent averages of duplicate measurements for compositions that were lyophilized to form a dry composition and used after the dry composition was stored for 5 days at room temperature.
• the line is a mathematical curve fit to the dry composition measurements.
• the invention provides a composition comprising premixed reagents for amplifying or detecting a target nucleic acid sequence in a sample.
• the invention also provides a means for isolating a target nucleic acid sequence.
• the composition of the invention can avoid (1 ) the potential inaccuracies due to measuring errors that arise when adding each component separately and (2) the risk of component contamination with foreign nucleic acids that increases with the number of times pipette tips are introduced into each component solution.
• the composition of the invention can be more convenient to use. All components necessary for detecting, amplifying, and/or isolating a nucleic acid sequence, except the sample itself, can be inside a single container.
• the invention also provides a method of making the composition of the invention as well as a method of detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample.
• the composition of the invention can be part of a kit that is useful for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample.
• hybridize refers to the binding between complementary oligonucleotides and/or polynucleotides. When two molecules hybridize, they form a combination of the two molecules through complementary base pairing. Oligonucleotides can hybridize to oligonucleotides or polynucleotides under a variety of circumstances. For example, an oligonucleotide can hybridize to a target sequence or to the complement of a target sequence during a PCR reaction. In this situation, an oligonucleotide is "capable of hybridizing" to the target nucleic acid sequence or its complement under salt and temperature conditions used for target sequence amplification.
• a portion of an oligonucleotide can also hybridize to a second oligonucleotide in the process of linking the oligonucleotide to a solid support.
• a solid support can have polyA oligonucleotides 10 residues long covalently attached to the solid support allowing an oligonucleotide with 10 thymidine residues at its end to be linked to the solid support via hybridization.
• an oligonucleotide is "capable of hybridizing" under salt and temperature conditions used for linking an oligonucleotide to a solid support.
• An oligonucleotide can also hybridize to a target sequence to capture or isolate the target sequence.
• an oligonucleotide is "capable of hybridizing" under salt and temperature conditions used for capturing or isolating a target nucleic acid sequence.
• the skilled artisan can readily determine the appropriate hybridization temperature to capture a target sequence, given the length of the capture oligonucleotide, the C/G content of the oligonucleotide, and the salt concentration of the hybridization reaction.
• complementary refers to nucleotides that form base pairs.
• adenine is complementary to thymidine
• adenine is complementary to uracil
• cytosine is complementary to guanine.
• Each strand of a double- stranded oligonucleotide or polynucleotide is complementary when at each nucleotide position the nucleotides from each strand form base pairs.
• the term “sufficiently complementary” refers to two sequences that, though they are not exact complements, can hybridize with each other under a set of hybridization conditions. For example, one strand can be longer than the other, but still have base pairs form at enough positions to result in hybridization.
• the two strands can be the same length and not form base pairs at every position, but enough base pairs are formed to result in hybridization.
• Factors including the length of a sequence, the number of G and C residues the sequence has, the salt concentration of the hybridization reaction, and the temperature of the hybridization reaction can determine how much nucleotide mismatching can be present and still result in hybridization between two sufficiently complementary sequences.
• Appropriate hybridization conditions can be selected by those skilled in the art with minimal experimentation as exemplified in Dieffenbach, CW and Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold Spring Harbor, USA or PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al. eds., Academic Press, San Diego, USA 1990.
• sufficiently complementary sequences can hybridize to each other at 60 0 C in the presence of 1.5 mM Mg 2+ and 50 mM Na + .
• primer refers to an oligonucleotide that is capable of hybridizing to a target nucleic acid sequence and allowing the synthesis of a complementary strand.
• forward primer refers to a primer that can hybridize with the non-coding strand of a DNA molecule.
• reverse primer refers to a primer that can hybridize with the coding strand of a DNA molecule.
• oligonucleotide refers to a molecule comprising nucleotides or nucleic acid analogs that is less than 100 nucleotides in length.
• capture oligonucleotide refers to an oligonucleotide that tethers an amplified target nucleic acid sequence to a solid support.
• poly A tail refers to a series of adenine nucleotides added to the end of the oligonucleotide.
• poly T tail refers to a series of thymidine nucleotides added to the end of the oligonucleotide.
• poly A oligonucleotide refers to an oligonucleotide containing only adenine residues.
• poly T oligonucleotide refers to an oligonucleotide containing only thymidine residues.
• poly G tail refers to an oligonucleotide containing only thymidine residues.
• poly G tail refers to an oligonucleotide containing only thymidine residues.
• poly G tail refers to an oligonucleotide containing only thymidine residues.
• polynucleotide refers to a molecule comprising nucleotides or nucleotide analogs that is 100 nucleotides or greater in length.
• target nucleic acid sequence or “target sequence” refers to a compound comprising nucleic acids or nucleic acid analogs ordered in a sequence, wherein the compound is sought to be detected, amplified, or isolated in a sample. If a nucleic acid is double-stranded, the target nucleic acid sequence can be either one of the strands.
• nucleic acid refers to a nucleotide sequence-containing oligomer or polymer having a backbone formed solely from naturally occurring nucleotides.
• nucleic acid analog means an oligomer or polymer comprising at least one modified nucleotide or subunits derived directly from a modification of nucleotides and/or at least one nucleotide analog.
• nucleic acid analog also refers to synthetic molecules that can bind to a target nucleic acid sequence or to the complement of a target nucleic acid sequence.
• a nucleic acid analog can be comprised of ribo or deoxyribo nucleotides, modified nucleotides, and/or nucleotide analogs.
• nucleotide analog refers to a synthetic moiety that can be used in place of a natural nucleotide or a modified nucleotide.
• nucleoside triphosphate or “nucleotide” refers to a nitrogenous base such as a purine or a pyrimidine that can be covalently bound to a sugar molecule such as ribose or deoxyribose that can be covalently bound to 3 phosphate groups. Nucleoside triphosphates can encompass both ribonucleoside and deoxyribonucleoside triphosphates.
• modified nucleotide refers to a nucleotide that has been chemically modified.
• polymerase refers to an enzyme that catalyzes a reaction between chemical moieties to form larger molecules.
• a polymerase can catalyze the polymerization of nucleotides to form polynucleotides.
• Nucleic acid polymerases can catalyze the reaction between nucleoside triphosphates to form linear nucleic acid molecules linked together by phosphodiester bonds.
• processing refers to the number of nucleotides a polymerase can add to a growing nucleic acid chain before the enzyme falls off of the template-substrate complex.
• polymerization refers to the process of chemically connecting smaller subunits to form a larger molecule. For example, the polymerization of nucleotides can result in formation of a polynucleotide.
• buffering agent refers to a reagent that can reduce changes to the concentration of free hydrogen ions in a solution, and thus can maintain a particular pH or pH range.
• cryoprotectant refers to a compound or composition that can protect the activity of a biologically active molecule or a reagent during freezing, drying, and/or reconstitution of the dried substance.
• freeze- dry refers to rapid freezing and subsequently drying a substance in a vacuum.
• lyophilized or “lyophilization” refers to drying a substance by freezing it in a high vacuum or to removing water from a frozen substance by sublimation under lowered pressure.
• lyophilize and “freeze-dry” are used interchangeably throughout this specification. Sublimation refers to the process by which a solid evaporates without passing through a liquid phase.
• Cations can provide a means for neutralizing the negative charges associated with nucleic acids.
• Cations useful in the invention can be monovalent and divalent cations.
• the term "monovalent cation” refers to an ion with a net positive charge of 1.
• divalent cation refers to an ion with a net positive charge of 2.
• linking refers to an association between two moieties.
• hybridization can be a form of linking in that it involves the association of complementary oligonucleotides and/or polynucleotides.
• binding partners refers to a first entity that can bind to a second entity.
• such complexes are characterized by a relatively high affinity and a relatively low to moderate capacity.
• Nonspecific binding can have a low affinity with a moderate to high capacity.
• solid support refers to any material that can be linked to an oligonucleotide capable of hybridizing to a target nucleic acid sequence.
• label refers to a moiety, molecule, or collection of molecules that can be attached to an oligonucleotide and/or a polynucleotide, incorporated into an oligonucleotide and/or a polynucleotide, and/or attached to a nucleoside triphosphate, wherein the moiety, molecule, or collection of molecules can render the polynucleotide, oligonucleotide, or nucleoside triphosphate detectable by an instrument or method.
• labels are capable of generating, modifying or modulating a detectable signal either directly or indirectly.
• ECL moiety refers to any compound that can be induced to repeatedly emit electromagnetic radiation by exposure to an electrochemical energy source. Representative ECL moieties are described in Electrogenerated Chemiluminescence, Bard, Editor, Marcel Dekker, (2004); Knight, A and Greenway, G. Analyst 119:879-890 1994; and in U.S. Patent Nos. 5,221 ,605; 5,591 ,581 ; 5,858,676; and 6,808,939.
• ECL coreactant pertains to a chemical compound that either by itself or via its electrochemical reduction or oxidation product(s), plays a role in the ECL reaction sequence. Often ECL coreactants can permit the use of simpler means for generating ECL (e.g., the use of only half of the double-step oxidation-reduction cycle) and/or improved ECL intensity.
• the term "container” refers to a vessel that is suitable for carrying out a DNA polymerization reaction.
• thermostable refers to the property of being substantially unaffected by high temperatures.
• a polymerase can be considered thermostable if the polymerase maintains at least 50% of its original activity after 1 hour at 6O 0 C.
• dry composition means that the composition has a moisture content of less than or equal to 5% by weight, relative to the total weight of the composition.
• liquid-contact refers to the addition of a liquid to a dry composition, wherein the components of the dry composition are in contact with the same liquid.
• the liquid is water.
• magnetizable bead encompasses magnetic, paramagnetic, and superparamagnetic beads.
• and/or means at least one in a series of alternatives.
• A, B, and/or C means any of the following: A; B; C; A and B; A and C; B and C; A and B and C.
• the invention pertains to compositions for amplifying, detecting, and/or isolating a target nucleic acid sequence in a sample.
• These compositions can provide all reagents necessary for a PCR reaction in a single formulation, except for the sample target nucleic acid sequence or its complement.
• an end user need only add a target nucleic acid sequence and possibly water to the composition before beginning amplification of the target nucleic acid sequence, optimizing consistency between test samples by minimizing the amount of pipetting needed to prepare a sample.
• at least one of the oligonucleotides present in the compositions of the invention serves multiple purposes.
• compositions of the invention can be lyophilized, thereby improving the composition's stability.
• compositions Comprising Two Oligonucleotides
• the composition of the invention can comprise two oligonucleotides.
• one oligonucleotide serves two functions, to prime the PCR reaction and link the PCR product to a solid support.
• the other oligonucleotide primes the PCR reaction and labels the PCR product.
• the other oligonucleotide serves only one function and primes the PCR reaction while the nucleotides that are incorporated into the PCR product label the PCR product.
• An oligonucleotide can be linked to a solid support via a pair of binding partners.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.
• the solid support can comprise a bead modified with a first member of a pair of binding partners.
• the bead can be a magnetizable bead.
• the solid support can comprise magnetizable beads that can be modified with a first member of a pair of binding partner.
• the solid support can comprise a bead modified with a first member of a pair of binding partners wherein the first member comprises an oligonucleotide or a polynucleotide.
• the solid support can comprise carboxylated magnetizable beads.
• the second oligonucleotide can be modified with a second member of the pair of binding partners and either the at least one nucleoside triphosphate or the first oligonucleotide can be modified with at least one electrochemiluminescent moiety, i.e., ECL moiety.
• the pair of binding partners can permit reversible binding between the second oligonucleotide and the at least one solid support.
• the interaction between the first member and the second member of a pair of binding partners is (1 ) unstable at temperatures used for amplifying DNA, such that the first and second members will not stably bind to each other during the amplification reaction; and (2) stable at or below the temperature used for amplifying DNA.
• the solid support can be modified with a poly T tail that is 10, 20, 30, 40, or 50 thymidine residues long or any intermediate length.
• the oligonucleotide primer can have a poly A tail at its 5'-end that is 10, 20, 30, 40, or 50 adenine residues long or any intermediate length.
• the poly A tail can be linked to the solid support and the oligonucleotide primer can have a poly T tail at its 5'-end.
• the melting temperature (T m ) of the poly dA or poly dT tail can be at least 10 0 C less than the T m of the PCR primers used.
• an oligonucleotide primer can have a poly T tail, wherein the poly T tail has a T m of 5O 0 C and a collection of beads could have poly A tails that are the same length as the primer poly T tail.
• This primer and bead could be present together during an amplification reaction such as PCR and not link to each other during amplification because the temperatures used for amplification are higher than 50°C.
• a PCR cycle could use temperatures of 95°C for melting, 6O 0 C for primer hybridization, and 72°C for polymerization. During these temperatures, the poly T tail of the primer and the poly A tail of the bead do not interact. But once amplification is complete, and the sample cools down to 50 0 C or less, the poly T tail of the primer and the poly A tail of the bead can interact, thereby attaching the amplified sequence to the bead.
• the second oligonucleotide can contain one strand of a restriction endonuclease recognition site that is not contained in the target nucleic acid sequence.
• the solid support can be modified with an oligonucleotide that contains a sufficiently complementary strand of the same endonuclease recognition site. After amplification of the target nucleic acid sequence, one strand of the amplified target can be hybridized to the oligonucleotide linked to the solid support, thereby creating a restriction endonuclease cleavage site.
• the restriction endonuclease cleavage can be cleaved allowing the isolation of the amplified target strand.
• An oligonucleotide can also be linked to a solid support via a linker substance.
• the linking oligonucleotide is not linked to the solid support until after amplification has occurred.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the second oligonucleotide and the solid support can be modified with moieties that allow crosslinking to the solid support.
• moieties can be, for example, photoactivatable crosslinkers known to the art.
• the solid support can comprise a bead.
• the DNA polymerization reaction is a PCR reaction.
• PCR two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.
• the first oligonucleotide is modified with an ECL moiety.
• the nucleoside triphosphates are modified with an ECL moiety.
• the invention provides a dry composition comprising:
• deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'- triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine ⁇ '-triphosphate (dTTP);
• the invention provides a dry composition comprising:
• thermostable polymerase (a) at least one thermostable polymerase
• a second oligonucleotide capable of binding to a second part of the target nucleic acid sequence and modified with a second member of a pair of binding partners, wherein at least one of (b) the at least four nucleoside triphosphates and (h) the first oligonucleotide is modified with a label.
• the invention provides a dry composition comprising:
• deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5 1 - triphosphate (dATP), deoxyguanosine ⁇ '-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP);
• a second oligonucleotide capable of binding to a second part of the target nucleic acid sequence and modified with a second member of a pair of binding partners, wherein at least one of (b) the nucleoside triphosphates and (h) the first oligonucleotide is modified with a label.
• Embodiments using two oligonucleotides can be modified to detect, amplify, or isolate multiple target nucleic acid sequences. Such modifications are discussed in greater detail below in the "Multiple Array" section.
• the composition of the invention can comprise three oligonucleotides, two which act as primers and a third oligo.
• the third oligonucleotide links the PCR product to a solid support.
• the third oligonucleotide is linked to a solid support via a covalent bond.
• the third oligonucleotide is reversibly bound to a solid support.
• the third oligonucleotide can be linked to a solid support via a pair of binding partners. Both of the remaining oligonucleotides prime the PCR reaction.
• one of the remaining oligonucleotides also labels the PCR product.
• the third oligonucleotide labels the PCR product while one of the two primer oligonucleotides attaches the amplified product to a solid support.
• nucleotides that are incorporated into the PCR product label the PCR product.
• the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence (i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of
• composition does not comprise the target nucleic acid sequence or its complement.
• the third oligonucleotide can be linked to the solid support via a pair of binding partners such as those discussed above at paragraphs [058] to [060].
• avidin can bind to biotin before beginning the PCR reaction, in which case the avidin/biotin interaction remains stable throughout the PCR reaction.
• the solid support can be coated with avidin while the third oligonucleotide can be biotinylated.
• the solid support can be coated with streptavidin while the third oligonucleotide can be biotinylated.
• the solid support can be coated with anti-DNP antibodies while the third oligonucleotide can comprise DNP.
• the solid support can be coated with anti-fluorescein antibodies while the third oligonucleotide comprises fluorescein.
• the third oligonucleotide can be covalently bound to the solid support, for example, by synthesizing oligonucleotides with a primary amine at the 5' end and reacting those oligonucleotides with carboxylated magnetizable beads.
• the third oligonucleotide can be covalently attached to the surface of the solid support by a variety of well-known chemistries, such as carbodiimide coupling (see, e.g., Katz et. al., 1994, J. Electroanal. Chem. 367:59; Narvaez et a!., 1997, J. Electroanal. Chem. 430:227) or maleimide reactions (see, e.g., Marty et al. 2004, CMLS Cellular and Molecular Life ScL 61 :1785).
• carbodiimide coupling see, e.g., Katz et. al., 1994, J. Electroanal. Chem. 367:59; Narvaez et a!., 1997, J. Electroanal. Chem. 430:227) or maleimide reactions (see, e.g., Marty et al. 2004, CMLS Cellular and Molecular Life ScL 61 :1785).
• the third oligonucleotide can be linked to the solid support by a cleavable linkage, thus providing a means of separating the target sequence from the solid support after the complex comprising the target sequence, the third oligonucleotide and the solid support has been isolated.
• Cleavage of the linkage between the third oligonucleotide and the solid support can be achieved using enzymatic, photolytic or chemical means.
• suitable chemically cleavable groups can be, but are not limited to, dialkoxysilane, disulfide, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, and ribose.
• Dialkoxysilane can be cleaved with fluoride ion. Disulfide bonds can be cleaved with reducing agents such as dithiothreitol. Phosphorothioate internucleotide linkage can be selectively cleaved under mild oxidative conditions. Selective cleavage of ribose linkages can be carried out by treatment with dilute ammonium hydroxide. Suitable enzyme cleavable sites can be nucleotides cleavable by glycosylases or nucleases. A DNA glycosylase can be uracii-DNA glycosylase.
• a uracil can be synthetically incorporated in a polynucleotide, replacing a thymidine.
• the uracil can be site-specifically removed by treatment with uracil DNA glycosylase.
• the cleavable site can also be a restriction endonuclease cleavable site, such as class Ns restriction enzymes. Examples include Bpml, Bsgl, BseRI, BsmFI, and Fokl recognition.
• the sequence of the third oligonucleotide can be selected so that it incorporates a restriction endonuclease site present in the target sequence and after binding of the amplified target to the third oligonucleotide, can be subsequently cleaved to release the linked polynucleotide.
• the sequences of these and other restriction enzyme sites have been described in the art. See New England BioLabs Catalog (New England Biolabs, Beverly, MA).
• the third oligonucleotide can also be cleaved from the solid support using a photocleavable linker, such as ortho-nitrobenzyl class of photocleavable linkers.
• Photocleavable linkers can be, for example, hydroxymethyl, hydroxyethyl, and Fmoc-aminoethyl carboxylic acid.
• the third oligonucleotide need not be linked to the at least one solid support before reaching the end-user as long as the end-user links the third oligonucleotide to the at least one solid support prior to starting the PCR reaction, for example, using photoactivatable crosslinkers which can be present in the composition as supplied.
• the third oligonucleotide can be linked to a magnetizable bead, providing a means for isolating and/or detecting a target nucleic acid sequence.
• the complex comprising the oligonucleotide linked to the magnetizable bead and the target sequence can be isolated by subjecting the complex to a magnetic field.
• the third oligonucleotide can bind to a nucleic acid sequence that overlaps, at least partially, with a nucleic acid sequence that can bind to the first oligonucleotide, the second oligonucleotide or both the first and second oligonucleotides.
• Embodiments using three oligonucleotides can be modified to detect, amplify, or isolate multiple target nucleic acid sequences. Such modifications are discussed in greater detail below in the "Multiple Array" section.
• At least one of the first oligonucleotide and the second oligonucleotide is modified with an ECL moiety.
• the nucleoside triphosphates are modified with an ECL moiety.
• the first and second oligonucleotides can serve as primers in a DNA polymerization reaction.
• the DNA polymerization reaction is a PCR reaction.
• two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.
• the following embodiment provides a composition that comprises particular examples of the components of the composition.
• a polymerase such as Taq polymerase
• a monovalent cation such as potassium chloride
• a divalent cation such as magnesium chloride
• biotin as a linking substance and so forth.
• the invention provides a dry composition comprising:
• deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'- triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine ⁇ '-triphosphate (dTTP);
• a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence
• a third oligonucleotide wherein the third oligonucleotide is biotinylated and is capable of hybridizing to a third part of the target nucleic acid sequence or to a nucleic acid sequence complementary to the target nucleic acid sequence.
• Some embodiments can use a primary amine as a lining agent.
• the invention provides a dry composition comprising:
• deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine ⁇ '- triphosphate (dATP), deoxyguanosine ⁇ '-triphosphate (dGTP), deoxythymidine ⁇ '-triphosphate (dTTP);
• a first oligonucleotide capable of hybridizing to a first part of a target nucleic acid sequence and labeled with [Ru(bpy)3]2 + or [Ru(sulfo- bpy)2bpy] 2+ ;
• a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of a target nucleic acid sequence;
• the invention provides a dry composition comprising:
• thermostable polymerase (a) at least one thermostable polymerase
• the invention can be used to detect, amplify, and/or isolate multiple target nucleic acid sequences.
• oligonucleotides that are sufficiently complementary to each target nucleic acid sequence are linked to discrete sections of a solid support.
• Oligonucleotides can be linked to discrete sections of a solid support via the linking agents discussed above in paragraphs [058] to [060], [062], and [071] to [073].
• each unique oligonucleotide can be linked to a solid support by a unique pair of binding partners, where one of the binding partners is attached to a discrete location on the solid support.
• each unique oligonucleotide can be linked to a solid support at different discrete locations.
• the multiple target nucleic acid sequences can be multiple sequences from one organism or target nucleic acid sequences from multiple organisms.
• the solid support can be a planar structure with discrete areas arranged to capture different targets.
• each target nucleic acid sequence can have a different first oligonucleotide; second oligonucleotide; if present, third oligonucleotide; and if present, pair of binding partners.
• each discrete area can be linked to differing third oligonucleotides in order to detect different target sequences.
• This multiple array can be used with the two oligonucleotide format as discussed above in Section ILA.
• the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
• N first oligonucleotides wherein the i th first oligonucleotide is capable of hybridizing to a first part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence;
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing to a second part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence and comprises an i th second member of the pair of binding partners; wherein N is a integer greater than or equal to 1 ; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleo
• the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
• N first oligonucleotides wherein the i th first oligonucleotide is capable of hybridizing with a first part of the i th target nucleic acid sequence
• N second oligonucleotides wherein the i th second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the i th target nucleic acid sequence;
• N third oligonucleotides wherein the i th third oligonucleotide is linked to the i th discrete area on the at least one solid support and is capable of hybridizing with a third part of
• nucleic acid sequence complementary to the i th target nucleic acid sequence wherein N is a integer greater than or equal to 1 ; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the i th first oligonucleotide, and (i) the i th second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement.
• the first and second oligonucleotides can serve as primers in a DNA polymerization reaction.
• the DNA polymerization reaction is a PCR reaction.
• PCR two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.
• a sample can comprise DNA, RNA, or a mixture thereof.
• the sample can be a biological sample.
• the sample can be derived from an in vitro chemical synthesis of nucleic acid molecules.
• the sample can also be prepared from an organism that contains nucleic acids. Such organisms can be, for example, bacteria, viruses, protozoa, worms, fungi, invertebrate animals, and vertebrate animals.
• target nucleic acid sequences can be found in pathogenic bacteria such as: Aeromonas hydrophila and other spp.; Bacillus anthracis; Bacillus cereus; Botulinum neurotoxin producing species of Clostridium; Brucella abortus; Brucella melitensis; Brucella suis; Burkholderia mallei (formally Pseudomonas mallei); Burkholderia pseudomallei (formerly Pseudomonas pseudomallei); Campylobacter jejuni; Chlamydia psittaci; Clostridium botulinum; Clostridium botulinum; Clostridium perfringens; Coccidioides immitis; Coccidioides posadasii; Cowdria ruminantium (Heartwater); Coxiella burnetii; Enterovirulent Escherichia coli group (EEC Group) such as Escherichia coli- enter
• pathogenic bacteria such as:
• target nucleic acid sequences can be found in viruses belonging to the families Adenoviridae, Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Badnavirus, Barnaviridae, Birnaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Capillovirus, Carlavirus, Caulimovirus, Circoviridae, Closterovirus, Comoviridae, Coronaviridae, Corticoviridae, Cystoviridae, Deltavirus, Dianthovirus, Enamovirus, Filoviridae, Flaviviridae, Furovirus, Fuselloviridae, Geminiviridae, Hepadnaviridae, Herpesviridae, Hordeivirus, Hypoviridae, Idaeovirus, Inoviridae, Iridoviridae, Leviviridae, Lipothrixviridae
• viruses can include, but are not limited to, African horse sickness virus; African swine fever virus; Akabane virus; Avian influenza virus (highly pathogenic); Bhanja virus; Blue tongue virus (Exotic); Camel pox virus; Cercopithecine herpesvirus 1 ; Chikungunya virus; Classical swine fever virus; Coronavirus (SARS); Crimean-Congo hemorrhagic fever virus; Dengue viruses; Dugbe virus; Ebola viruses; Encephalitic viruses such as Eastern equine encephalitis virus, Japanese encephalitis virus, Murray Valley encephalitis, and Venezuelan equine encephalitis virus; Equine morbillivirus; Flexal virus; Foot and mouth disease virus; Germiston virus; Goat pox virus; Hantaan or other Hanta viruses; Hendra virus; Issyk-kul virus; Koutango virus; Lassa fever virus; Louping ill virus; Lumpy skin disease virus; Lymphocy
• target nucleic acid sequences can be found in parasitic protozoa and worms, such as: Acanthamoeba and other free-living amoebae; Anisakis sp. and other related worms Ascaris lumbricoides and Trichuris trichiura; Cryptosporidium parv ⁇ m; Cyclospora cayetanensis; Diphyllobothri ⁇ m spp.; Entamoeba histolytica; Eustrongylides sp.; Giardia lamblia; Nanophyetus spp.; Shistosoma spp.; Toxoplasma gondii; and Trichinella.
• parasitic protozoa and worms such as: Acanthamoeba and other free-living amoebae; Anisakis sp. and other related worms Ascaris lumbricoides and Trichuris trichiura; Cryptosporidium parv ⁇ m; Cyclospora
• target nucleic acid sequences can be found in fungi such as: Aspergillus spp.; Blastomyces dermatitidis; Candida; Coccidioides immitis; Coccidiodes posadasil; Cryptococcus neoformans; Histoplasma capsulatum; Maize rust; Rice blast; Rice brown spot disease; Rye blast; Sporothrix schenckii; and wheat fungus.
• fungi such as: Aspergillus spp.; Blastomyces dermatitidis; Candida; Coccidioides immitis; Coccidiodes posadasil; Cryptococcus neoformans; Histoplasma capsulatum; Maize rust; Rice blast; Rice brown spot disease; Rye blast; Sporothrix schenckii; and wheat fungus.
• target nucleic acid sequences can be found in invertebrate animals and vertebrate animals such as mammals, including but not limited to, humans. In certain embodiments, target nucleic acid sequences can be found in plants. In certain embodiments, target nucleic acid sequences can be found in species from the domain Archaea. 2. Polynucleotides and Oligonucleotides
• target nucleic acid sequences can be polynucleotides.
• Polynucleotides can vary in length. For example, a polynucleotide can be 100 to 2000 nucleotides long. A polynucleotide can be 100 to 1500 nucleotides long. A polynucleotide can be 100 to 1000 nucleotides long. A polynucleotide can be 100 to 500 nucleotides long. A polynucleotide can be 100 to 200 nucleotides long.
• conditions suitable for target sequence amplification can be 72°C. In some embodiments, conditions suitable for target sequence amplification can be 41 0 C.
• conditions suitable for target amplification can be 72°C. In some embodiments, conditions suitable for target sequence amplification can be 41 0 C.
• the composition of the invention can contain oligonucleotides.
• An oligonucleotide can be 10 to 100 nucleotides long.
• An oligonucleotide can be 10 to 90 nucleotides long.
• An oligonucleotide can be 10 to 70 nucleotides long.
• An oligonucleotide can be 10 to 50 nucleotides long.
• An oligonucleotide can be 10 to 40 nucleotides long.
• An oligonucleotide can be 10 to 30 nucleotides long.
• An oligonucleotide can be 10 to 20 nucleotides long.
• an oligonucleotide can comprise a poly A tail. In some embodiments, an oligonucleotide can comprise a poly T tail. In some embodiments, an oligonucleotide can be a poly A oligonucleotide. In some embodiments, an oligonucleotide can be a poly T oligonucleotide.
• oligonucleotides can be primers. Bases in an oligonucleotide primer can be joined by a phosphodiester bond or by a linkage other than a phosphodiester bond, so long as the linkage does not prevent hybridization to a part of the target nucleic acid sequence.
• oligonucleotide primers can have constituent bases joined by peptide bonds rather than phosphodiester linkages.
• a primer can be prepared to be sufficiently complementary to a target nucleic acid sequence. Exact complementarity is not necessary to achieve hybridization in a particular set of conditions.
• Factors including the length of a sequence, the number of G and C residues the sequence has, the salt concentration of the hybridization reaction, and the temperature of the hybridization reaction can determine how much nucleotide mismatching can be present and still result in hybridization between two sequences.
• Appropriate hybridization conditions can be selected by those skilled in the art with minimal experimentation as exemplified in Dieffenbach, CW and Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold Spring Harbor, USA or PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al. eds., Academic Press, San Diego, USA 1990.
• primers can comprise nucleotides, modified nucleotides, or nucleic acid analogs.
• a nucleotide can be used as a building block to form a polynucleotide.
• Nitrogenous bases can be, but are not limited to, cytosine, guanine, adenine, thymidine, uracil, and inosine.
• Nucleoside triphosphates can be, but are not limited to, deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), deoxyuracil triphosphate (dUTP), and deoxyinosine triphosphate (dlTP), 7-deaza-dGTP, 2-aza-dATP, and N4-methyl- dCTP.
• dATP deoxyadenosine triphosphate
• dCTP deoxycytidine triphosphate
• dGTP deoxyguanosine triphosphate
• dTTP deoxythymidine triphosphate
• dUTP deoxyuracil triphosphate
• dlTP deoxyinosine triphosphate
• Non-limiting examples of modified nucleotides can be: 5-propynyl-uracil, 2- thio-5-propynyl-uraciI, 5-methylcytosine, pseudoisocytosine, 2-thiouracil and 2- thiothymine, 2-aminopurine, N9-(2-amino-6-chloropurine), N9-(2,6-diaminopurine), hypoxanthine, N9-(7-deaza-guanine), N9-(7-deaza-8-aza-guanine) and N8-(7- deaza-8-aza-adenine).
• Nucleic acid analogs can be, but are not limited to, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or any derivatized form of a nucleic acid.
• the composition can contain at least four different nucleoside triphosphates.
• the at least four different nucleoside triphosphates can be deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), and deoxythymidine 5'-triphosphate (dTTP).
• labels can be used in the composition of the invention.
• at least one of the oligonucleotides or nucleoside triphosphates can be modified with a label.
• Labels can be, but are not limited to, fluorophores, haptens, luminescent labels, radioactive labels, electrochemiluminescent moieties (i.e., ECL moieties), quantum dots, beads, aminohexyl, pyrene, metal particles, spin labels, enzymes, and dyes.
• directly detectable labels include, but are not limited to, ECL moieties, fluorophores, and enzymatic labels.
• a label can reduce a detectable signal.
• a label can be a substance that quenches or reduces the detectable signal emitted by a detectable substance.
• a label can be an ECL quencher, such that when the quencher is present as a result of target nucleic acid amplification, an ECL signal is reduced.
• an ECL moiety can be associated with a bead so when a PCR product containing the quencher is linked to the bead, the ECL signal is reduced. Reduction of signal can be detected by comparing the signal from beads with an ECL moiety to beads with the ECL moiety that have participated in an amplification reaction.
• quenchers include, but are not limited to, methylviologen carboxylate, compounds comprising at least one benzene moiety, and, more particularly, compounds comprising at least one phenol moiety, quinone moiety, benzene carboxylic acid, and/or benzene carboxylate moiety.
• quenching agents which comprise at least one phenol moiety, and from which quenching moieties comprising at least one phenol moiety may be derived, include, but are not limited to phenol; alkyl-phenols (such as C- ⁇ - 6 alkyl-phenols including o-alkyl-phenol, m-alkyl-phenol, and p-alkyl-phenol, such as o-methyl-phenol (i.e., o-cresol), /n-methyl-phenol (i.e., m-cresol), p-methyl-phenol (i.e., o-cresol), oethyl-phenol, m-ethyl-phenol, p-ethyl-phenol, o-propyl-phenol, m- propyl-phenol, and p-propyl-phenol); aryl-phenols (such as C 7-10 aryl-phenols, including o-aryl-phenol, m-aryl-phenol, and p-alkyl-
• quenching agents which comprise at least one quinone moiety and from which quenching moieties comprising at least one quinone moiety may be derived, include, but are not limited to, quinones (Ae., benzoquinones), such as o-quinone (Ae., 1 ,2-benzoquinone) and p-quinone (i.e., l,4-benzoquinone); alkyl-quinones, such as C- ⁇ - 6 alkyl-quinones including Ci -6 alkyl- 1 ,4-benzoquinones, such as 2-methyl-1 ,4-benzoquinone, 2-ethyl-1 ,4- benzoquinone, 2-r?-propyl-1 ,4-benzoquinone, 2, 6-dimethyl-1 ,4-benzoquinone, and 2, 5-dimethyl-1 ,4-benzoquinone; halo-quinones, such as halo-1 ,4-benzoquinones, including
• Quinone and its derivatives may usually be chemically modified to possess reactive groups (Ae., to form chemically activated species).
• reactive groups may be attached (e.g., at the ortho- or met ⁇ -positions of 1 ,4-benzoquinone) optionally via a linker group, which then permits the attachment of the quinone-like moiety (as a quenching moiety) to other molecules.
• a 1 ,4-benzoquinone may be derivatized to possess a carboxylic acid group (Ae., -COOH) attached to an ortho- or meta- carbon via a linker group, such as an alkyl group.
• Such a compound is 2-(1 ⁇ carboxy-but ⁇ 2-yl)-5-methyl-1 ,4-benzoquinone.
• This carboxylic acid derivative may be derivatized to form the N-succinimidyl ester (shown below), which permits the easy attachment of the quinone-like quenching moiety to molecules which possess, for example, an amino group.
• quenching agents which comprise at least one benzene carboxylic acid or benzene carboxylate moiety, and from which quenching moieties comprising at least one benzene carboxylic acid or benzene carboxylate moiety may be derived, include, but are not limited to benzoic acid; aminobenzoic acids, such as o-aminophenol, m-aminophenol, and p-aminophenol; hydroxybenzoic acids, such as o-hydroxyphenol, m-hydroxyphenol, and p- hydroxyphenol; and nitrobenzoic acids, such as o-nitrophenol, m-nitrophenol, and p-nitrophenol.
• aminobenzoic acids such as o-aminophenol, m-aminophenol, and p-aminophenol
• hydroxybenzoic acids such as o-hydroxyphenol, m-hydroxyphenol, and p- hydroxyphenol
• nitrobenzoic acids such as o-nitrophenol, m-nitrophenol, and
• Fluorophores can be, but are not limited to, 5(6)-carboxyfluorescein, 5- or 6-carboxyfluorescein, 6-(fluorescein)-5-(and 6)-carboxamido hexanoic acid, fluorescein (i.e., FITC), rhodamine, tetramethylrhodamine, cyanine dyes (i.e., Cy2, Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7), phycoerythrine, conjugates of R-phycoerythrin, conjugates of allophycoerythrin, cascade blue, Oregon green 488, pacific blue, rhodamine green, optionally substituted coumarin, AMCA, (diethyl- amino)coumarin, PerCP, phycobiliproteins, R-phycoerythrin (RPE), allophycoerythrin (APC), Texas Red, Princeton Red, IR dyes, Dyomics (Jena, Greman
• Fluorophores can also include inorganic fluorophores such as particles based on semiconductor material like coated CdSe nanocrystallites. See, for example, the Dynomics catalogue of Fluorescent Dyes for Bioanalytical and Hightech Applications (4 th edition, 2005) and The Handbook - A Guide to Fluorescent Probes and Labeling Technologies (10 th edition, Invitrogen, Carlsbad, CA, USA).
• Labels can be haptens or antigens including, but not limited to, dinitrophenyl (DNP), fluorescein isothiocyanate (FITC), 5(6)-carboxyfluorescein, 2,4-dinitrophenyl, digoxigenin, rhodamine, bromodeoxy uridine, acetylaminofluorene, mercury trinitrophenol, estradiol, and biotin.
• DNP dinitrophenyl
• FITC fluorescein isothiocyanate
• 5(6)-carboxyfluorescein 2,4-dinitrophenyl
• digoxigenin digoxigenin
• rhodamine bromodeoxy uridine
• acetylaminofluorene mercury trinitrophenol
• estradiol and biotin.
• Luminescent labels can be, but are not limited to, luminol, isoluminol, acridinium esters, acridinedione 1 ,2-dioxetanes, pyridopyridazines, green fluorescent protein (GFP), GFP analogues, reef coral fluorescent proteins (RCFPs), and RCFP analogues.
• GFP green fluorescent protein
• RCFP reef coral fluorescent proteins
• Radioactive labels can be, but are not limited to, radioactive isotopes of carbon such as 14 C, radioactive isotopes of hydrogen such as 3 H, radioactive isotopes of phosphorous such as 32 P, and radioactive isotopes of sulfur such as 35 S..
• radioactive nucleoside triphosphates are commercially available from a variety of sources such as New England Nuclear, Boston, MA.
• Other examples of nucleoside triphosphates that can be modified with a label include 5-(3-aminoallyl)-dUTP, and 5-[3-(E)-(4-azido-2,3,5,6- tetrafluorobenzamido)propenyl-1]-2'-deoxyuridine-5'-triphosphate. 4. ECL Labels
• the label can comprise an ECL moiety.
• ECL moieties can be transition metals.
• the ECL moiety can comprise a metal-containing organic compound wherein the metal can be chosen, for example, from ruthenium, osmium, rhenium, iridium, rhodium, platinum, palladium, molybdenum, and technetium.
• the metal can be ruthenium or osmium.
• the ECL moiety can be a ruthenium chelate or an osmium chelate.
• the ECL moiety can comprise bis(2,2'- bipyridyl)ruthenium(ll) and tris(2,2'-bipyridyl)ruthenium(ll).
• the ECL moiety can be ruthenium (II) tris bipyridine ([Ru(bpy)3]2 + ).
• the metal can also be chosen, for example, from rare earth metals, including but not limited to cerium, dysprosium, erbium, europium, gadolinium, holmium, lanthanum, lutetium, neodymium, praseodymium, promethium, terbium, thulium, and ytterbium.
• the metal can be cerium, europium, terbium, or ytterbium.
• Metal-containing ECL moieties can have the formula
• M (PV, (LI) n (L2)o (L3)p (L4) q (L5) r (L6) s
• M is a metal
• P is a polydentate ligand of M
• L1 , L2, L3, L4, L5 and L6 is ligands of M, each of which can be the same as, or different from, each other
• m is an integer equal to or greater than 1
• each of n, o, p, q, r and s is an integer equal to or greater than zero
• P, L1 , L2, L3, L4, L5 and L6 are of such composition and number that the ECL moiety can be induced to emit electromagnetic radiation and the total number of bonds to M provided by the ligands of M equals the coordination number of M.
• M can be ruthenium.
• M can be osmium.
• ECL moiety can have one polydentate ligand of M.
• the ECL moiety can also have more than one polydentate ligand.
• the polydentate ligands can be the same or different.
• Polydentate ligands can be aromatic or aliphatic ligands. Suitable aromatic polydentate ligands can be aromatic heterocyclic ligands and can be nitrogen-containing, such as, for example, bipyridyl, bipyrazyl, terpyridyl, 1 ,10 phenanthroline, and porphyrins.
• Suitable polydentate ligands can be unsubstituted, or substituted by any of a large number of substituents known to the art.
• Suitable substituents include, but are not limited to, alkyl, substituted alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate, carboxaldehyde, carboxamide, cyano, amino, hydroxy, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidinium, ureide, maleimide sulfur-containing groups, phosphorus containing groups, and the carboxylate ester of N-hydroxysuccinimide.
• At least one of L1 , L2, L3, L4, L5 and L6 can be a polydentate aromatic heterocyclic ligand.
• at least one of these polydentate aromatic heterocyclic ligands can contain nitrogen.
• Suitable polydentate ligands can be, but are not limited to, bipyridyl, bipyrazyl, terpyridyl, 1 ,10 phenanthroline, a porphyrin, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl, substituted 1 ,10 phenanthroline or a substituted porphyrin.
• substituted polydentate ligands can be substituted with an alkyl, substituted alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate, carboxaldehyde, carboxamide, cyano, amino, hydroxy, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidinium, ureide, maleimide a sulfur-containing group, a phosphorus-containing group or the carboxylate ester of N- hydroxysuccinimide.
• ECL moiety can contain two bidentate ligands, each of which can be bipyridyl, bipyrazyl, terpyridyl, 1 ,10 phenanthroline, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or substituted 1 ,10 phenanthroline.
• the ECL moiety can contain three bidentate ligands, each of which can be bipyridyl, bipyrazyl, terpyridyl, 1 ,10-phenanthroline, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or substituted 1 ,10-phenanthroline.
• the ECL moiety can comprise ruthenium, two bidentate bipyridyl ligands, and one substituted bidentate bipyridyl ligand.
• the ECL moiety can contain a tetradentate ligand such as a porphyrin or substituted porphyrin.
• the ECL moiety can have one or more monodentate ligands, a wide variety of which are known to the art.
• Suitable monodentate ligands can be, for example, carbon monoxide, cyanides, isocyanides, halides, and aliphatic, aromatic and heterocyclic phosphines, amines, stibines, and arsines.
• one or more of the ligands of M can be attached to additional chemical labels, such as, for example, radioactive isotopes, fluorescent components, or additional luminescent ruthenium- or osmium-containing centers.
• the ECL moiety can be tris(2,2'-bipyridyl)ruthenium(ll) tetrakis(pentafluorophenyl)borate.
• the ECL moiety can be bis[(4,4'- carbomethoxy)-2,2'-bipyridine] 2-[3-(4-methyl-2,2'-bipyridine-4-yl)propyl]-1 ,3- dioxolane ruthenium (II).
• the ECL moiety can be bis(2,2'bipyridine) [4-(butan-1-al)-4'-methyl-2,2'-bipyridine]ruthenium (II).
• the ECL moiety can be bis(2,2'-bipyridine) [4-(4'-methyl-2,2'-bipyridine-4'-yl)-butyric acid]ruthenium (II).
• the ECL moiety can be (2,2'-bipyridine)[cis- bis(1 ,2-diphenylphosphino)ethylene] ⁇ 2-[3-(4-methyl- 2,2'-bipyridine-4'-yl)propyl]- 1,3-dioxolane ⁇ osmium (II).
• the ECL moiety can be bis(2,2'- bipyridine) [4-(4'-methyl-2,2'-bipyridine)-butyIamine]ruthenium (II).
• the ECL moiety can be bis(2,2'-bipyridine) [1-bromo-4(4'-methyI-2,2'-bipyridine-4- yl)butane]ruthenium (II).
• the ECL moiety can be bis(2,2'- ruthenium (II).
• the ECL moiety comprises a metal ion chosen from osmium and ruthenium or a derivative of trisbipyridyl ruthenium (II) [Ru(bpy) 3 2+ ].
• the ECL moiety can be [Ru(sulfo-bpy) 2 bpy] 2+ whose structure is
• W is a functional group attached to the ECL moiety that can react with a biological material, binding reagent, enzyme substrate or other assay reagent so as to form a covalent linkage such as an NHS ester, an activated carboxyl, an amino group, a hydroxyl group, a carboxyl group, a hydrazide, a maleimide, or a phosphoramidite.
• ECL moieties the moiety does not comprise a metal.
• non-metal ECL moieties can be, but are not limited to, rubrene and 9,10-diphenylanthracene.
• the label can be attached to the 5' end or to the 3' end of an oligonucleotide primer.
• the label can be incorporated directly into an oligonucleotide primer.
• Primers can be labeled at an amino group introduced during synthesis, or can be labeled directly during synthesis using, e.g., tag NHS and tag phosphoramidite, respectively, where the tag can be an ECL moiety.
• the tag comprises a fluorophore, hapten, enzymatic label, or a luminescent label.
• fluorescently labeled nucleoside triphosphates can be used to produce oligonucleotides.
• methods of modifying oligonucleotides with detectable transition metals including ruthenium, osmium, iron, rhodium, copper, and ferrocene have been described (see, e.g., Meade et al., 1995, Chem. Int. Engl.
• the composition comprises an ECL coreactant.
• coreactants can be chemical compounds which, upon electrochemical oxidation / reduction, yield, either directly or upon further reaction, strong oxidizing or reducing species in solution.
• a coreactant can be peroxodisulfate (i.e., S2O 8 2 ⁇ , persulfate) which is irreversibly electro-reduced to form oxidizing SO 4 * " ions.
• the coreactant can also be oxalate (i.e., C ⁇ O 4 2" ) which is irreversibly electro-oxidized to form reducing CO 2 * " ions.
• a class of coreactants that can act as reducing agents is amines or compounds containing amine groups, including, for example, tri-n-propylamine (i.e., N(CH 2 CH 2 CH 2 ) 3 , TPA).
• amines or compounds containing amine groups including, for example, tri-n-propylamine (i.e., N(CH 2 CH 2 CH 2 ) 3 , TPA).
• tertiary amines can be better coreactants than secondary amines.
• secondary amines can be better coreactants than primary amines.
• Coreactants include, but are not limited to, lincomycin; clindamycin-2- phosphate; erythromycin; 1-methylpyrrolidone; diphenidol; atropine; trazodone; hydroflumethiazide; hydrochlorothiazide; clindamycin; tetracycline; streptomycin; gentamicin; reserpine; trimethylamine; tri-n-butylphosphine; piperidine; N 1 N- dimethylaniline; pheniramine; bromopheniramine; chloropheniramine; diphenylhydramine; 2-dimethylaminopyridine; pyrilamine; 2-benzylaminopyridine; leucine; valine; glutamic acid; phenylalanine; alanine; arginine; histidine; cysteine; tryptophan; tyrosine; hydroxyproline; asparagine; methionine;
• Coreactants also include, but are not limited to, N-ethylmorpholine; sparteine; tri-n-butylamine; piperazine-1 ,4-bis(2-ethanesulfonic acid); triethanolamine; dihydronicotinamide adenine dinucleotide; 1 ,4- diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1- ethylpiperidine; di-n-propylamine; N.N.N'.N'-Tetrapropyl-1 ,3-diaminopropane; DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacon
• the composition comprises a solid support.
• Solid supports can be, but are not limited to, beads, membranes, gels, hydrogels, synthetic organic polymers, electrodes, and inorganic oxides.
• a solid support can be used to amplify and/or detect one target nucleic acid sequence.
• solid supports can be used to detect multiple target nucleic acid sequences. When multiple target nucleic acid sequences are detected, oligonucleotides that are sufficiently complementary to each target nucleic acid sequence are linked to discrete sections of the solid support.
• solid supports that can be used with multiple oligonucleotides include, but are not limited to membranes, semi-conductor chips, multiwell plates, and electrodes (See, e.g., U.S. patent application publication 2004/0189311 and 2005/0052646).
• a patterned array of electrodes can be used with some electrodes configured to link to differing nucleic acid sequences. These electrodes could be used, for example, as working electrodes in an ECL reaction to detect an ECL label linked to the electrode by the amplified target nucleic acid.
• the electrodes comprise carbon.
• a solid support can be patterned to allow for amplification of different target nucleic acid sequences at discrete sections of the solid support, wherein a fluorophore is detectable either by exciting only one section at a time and/or detecting fluorescent emissions from sections independently.
• Beads can also be used with multiple oligonucleotide configurations. For example, if the purpose is to amplify multiple targets, no separation among the amplified targets is required. In some embodiments, one may wish to distinguish between the different amplified sequences. This can be done by either making the labels for the different nucleic acid sequences and separately measuring each label (e.g., each label could luminesce at a different wavelength) and/or by separating beads that bind with only one amplified target nucleic acid sequence.
• Beads can be separated by using beads comprising at least one differing property such as, but not limited to, different sizes, different density, different magnetic content, different fluorescent tags acting as a bead barcode (e.g., xMAP ® from Luminex Corp, Austin, TX, USA), etc. Separated beads can then be detected either individually or as a group sharing the same target.
• beads comprising at least one differing property such as, but not limited to, different sizes, different density, different magnetic content, different fluorescent tags acting as a bead barcode (e.g., xMAP ® from Luminex Corp, Austin, TX, USA), etc. Separated beads can then be detected either individually or as a group sharing the same target.
• Beads that can be used with the invention include, but are not limited to, polystyrene beads. Beads can also include magnetizable beads including superparamagnetic beads. In certain embodiments, the solid support can comprise carboxylated magnetizable beads. Beads can also include metallic beads, including gold beads. In some embodiments, beads can have a diameter in the range of 0.01 ⁇ m - 100 ⁇ m, 0.1 ⁇ m - 50 ⁇ m, 1 ⁇ m - 20 ⁇ m, 0.5 ⁇ m - 10 ⁇ m, 0.05 ⁇ m - 5 ⁇ m, 1 ⁇ m - 3 ⁇ m, or 0.1 ⁇ m - 1 ⁇ m.
• Membranes that can be used with the invention comprise, for example, nitrocellulose, nylon, polyvinylidene fluoride (PVDF) or carboxylated polyvinylidene (U.S. Patent No.: 6,037,124).
• PVDF polyvinylidene fluoride
• carboxylated polyvinylidene U.S. Patent No.: 6,037,124.
• Membranes can be coated with various materials, including polyvinyl benzyl dimethyl hydroxyethyl ammonium chloride, polyvinyl benzyl benzoyl aminoethyl dimethyl ammonium chloride, polyvinyl benzyl tributyl ammonium chloride, copolymers of polyvinyl benzyl trihexyl ammonium chloride and polyvinyl benzyl tributyl ammonium chloride, copolymers of polyvinyl benzyl benzoyl dimethyl ammonium chloride and polyvinyl aminoethyl dimethyl ammonium chloride, and copolymers of polyvinyl benzyl phenyl ureidoethyl dimethyl ammonium chloride and polyvinyl benzyl benzoyl dimethyl ammonium chloride (U.S. Patent No.: 5,336,596).
• Gels and hydrogels that can be used with the invention comprise, for example, acrylamide, cellulose and agarose gels.
• Synthetic organic polymers can be, but are not limited to, such as polyacrylic, vinyl polymers, acrylate, polymethacrylate, polyacrylamide, polyacylonitriles, polyolefins, and carbohydrate polymers.
• carbohydrate polymers can be, but are not limited to, agarose, cellulose, hyaluronic acid, chitin, acyl gellan, dextran, carboxymethylcellulose, carboxymethyl starch, carboxymethyl chitin, poly(lactide-co-ethylene glycol) and polyethylene glycol.
• Solid supports can be comprised of polystyrene, Sepharose ® , or Sephadex ® .
• Electrodes can comprise any conductive material including, but not limited to, carbon, carbon black, carbon nanotubes, silver, silver/silver chloride, gold, platinum, iridium, indium-tin-oxide (ITO) and platinum/indium alloys.
• conductive material including, but not limited to, carbon, carbon black, carbon nanotubes, silver, silver/silver chloride, gold, platinum, iridium, indium-tin-oxide (ITO) and platinum/indium alloys.
• Inorganic oxides can be, but are not limited to, silica, zirconia, carbon clad zirconia (U.S. Patent No.:5,182,016), titania, ceria, alumina, manganese, magnesia (i.e., magnesium oxide), calcium oxide, and controlled pore glass (CPG).
• the solid support can also comprise combinations of some of the above- mentioned supports including, but not limited to, dextran-acrylamide. 7.
• a solid support can be linked to one or more oligonucleotides.
• covalent bonds can link the oligonucleotides to a solid support.
• oligonucleotides can be linked to a solid support via hybridization.
• non-covalent associations can link the two moieties. Non-covalent associations can be, but are not limited to, ionic interactions, hydrogen bonds, and van der Waals forces.
• oligonucleotides can be passively absorbed onto a solid support (e.g., a carbon electrode).
• a solid support can be linked to an oligonucleotide via a pair of binding partners.
• affinity constant Ka is higher than 10 6 M "1 , or is higher than 10 8 M "1 .
• a higher affinity constant can indicate greater affinity, and thus greater specificity.
• antibodies can bind antigens with an affinity constant in the range of 10 6 M '1 to 10 9 M "1 or higher. If desired, nonspecific binding can be reduced without substantially affecting specific binding by varying the binding conditions using routine techniques known in the art.
• the conditions can be defined, for example, in terms of molecular concentration, ionic strength of the solution, temperature, time allowed for binding, or concentration of other molecules in a binding reaction.
• pairs of binding partner can be, but are not limited to, sufficiently complementary nucleic acid sequences.
• Sufficiently complementary nucleic acid sequences can hybridize as DNA/DNA hybrids, RNA/RNA hybrids, or DNA/RNA hybrids.
• adenine nucleotides in one DNA sequence can hybridize with thymidine nucleotides in another DNA sequence.
• adenine nucleotides in a RNA sequence can hybridize with thymidine nucleotides in a DNA sequence.
• compositions of the invention can be frozen and then dried (i.e., freeze-dried) to form dry compositions.
• the composition of the invention can be lyophilized to form dry compositions. Using lyophilization to stabilize biological reagents is described, for example in U.S. Patent No. 5,834,254 and in U.S. Patent Application No. 10/147,965.
• dry compositions include compositions that have a moisture content of less than or equal to 3% by weight, relative to the total weight of the composition and compositions that have a moisture content ranging from 0% to 3% by weight, relative to the total weight of the composition.
• Forming a dry composition can provide a means for protecting the activity of the reagents comprising the composition from fluctuations of various physical parameters such as temperature.
• the invention provides a dry composition that can be stable at ambient temperature and can be useful for detecting, amplifying, and/or isolating a target nucleic acid sequence.
• the dry composition can have longer shelf-lives compared to a mixture comprising the same reagents that is not dry and can be stable over a wide range of temperatures: from, for example, -4O 0 C to 6O 0 C; -40 0 C to 4 0 C; O 0 C to 40 0 C; 0 0 C to 100 0 C; 4 0 C to 60 0 C; 10°C to 3O 0 C; 10 0 C to 60 0 C; 15 0 C to 45°C; 2O 0 C to 60 0 C; or 25 0 C to 4O 0 C.
• the composition comprises a cryoprotectant.
• cryoprotectants A variety of cryoprotectants have been described. See, e.g., Clegg et al. 1982, Cryobiology 19: 306; Carpenter et al., 1987, Cryobiology 24: 455.
• Cryoprotectants suitable for use in the instant invention can be, but are not limited to, disaccharides, polysaccharides, and polyalcohols.
• the cryoprotectant can be trehalose.
• the cryoprotectant can be mannitol, lactose, maltose, sucrose, dextrose, and/or polyvinylpyrrolidone (PVP). Combinations of more than one cryoprotectant can also be contemplated.
• Disaccharides can be, but are not limited to, trehalose.
• Containers can be, but are not limited to, multiwell plates and tubes, including, e.g., microcentrifuge tubes.
• the containers that may hold the dry composition can be hermetically sealed.
• the container can be sealed with an elastomeric, thermoset, or a thermoplastic material, such as EVA or Santoprene®, that has been pressed into the container's opening.
• the container can be sealed with a laminate comprising a metallic layer, such as a foil microplate seal.
• the container can be sealed with a laminate comprising a thermally modifiable layer, such as a laminate that can be heat-sealed to the container.
• the container can be sealed with a laminate comprising an adhesive layer that can bond the laminate to the container.
• the container comprises at least one enclosure, such as one or more sealed enclosures (containers) inside a sealed outer container (e.g., a sealed bag).
• a sealed outer container e.g., a sealed bag.
• the sealed outer container can, for example, comprise polyethylene, polyester, aluminum, nickel, a trilaminate of polyester-foil-polyethylene, or a bilaminate of polyester-polyethylene.
• a desiccant can be added between the innermost enclosure and the outermost enclosure.
• the desiccant can, for example, comprise calcium oxide, calcium chloride, calcium sulfate, silica, amorphous silicate, aluminosilicates, clay, activated alumina, zeolite, or molecular sieves.
• a humidity indicator can be added between the innermost enclosure and the outermost enclosure.
• the humidity indicator can, for example, be used as an indication that the dry composition is still sufficiently dry that its stability has not been compromised.
• the humidity indicator can be viewed through the outermost enclosure.
• the humidity indicator can be a card or disc wherein the humidity is indicated by a color change, such as one designed to meet the US military standard MS20003.
• the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 37 0 C and 100% relative humidity for 10 days, 20 days, 40 days, 67 days, 3 months, 6 months, 12 months, 18 months, 24 months, or longer.
• the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 25 0 C and 100% relative humidity for 1 day, 1 week, 1 month, 3 months, 6 months, 12 months, 18 months, 24 months, or longer.
• the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 4 0 C and 30% relative humidity for 3 months, 6 months, 12 months, 18 months, 24 months, or longer. 10.
• Polymerases include, but are not limited to, DNA polymerases and RNA polymerases. Some polymerases, such as Klenow fragment, can use DNA as a template. Other polymerases can use RNA as a template. These RNA- dependent polymerases can be, but are not limited to, reverse transcriptase. Yet other polymerases, for example Tth polymerase and TZ05 polymerase, can use DNA or RNA as a template. Thus exemplary polymerases can be a DNA- dependent DNA polymerase, an RNA-dependent DNA polymerase, a DNA- dependent RNA polymerase, and an RNA-dependent RNA polymerase. A polymerase can have a combination of these activities. For example, reverse transcriptase can be a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase.
• a polymerase can have other activities associated with it besides polymerase activity.
• a polymerase can also have RNAase activity that confers the ability to degrade RNA. Reverse transcriptase's RNAase activity can allow this polymerase to degrade RNA in a RNA/DNA hybrid molecule.
• a polymerase such as Taq polymerase can have high processivity.
• a polymerase such as terminal deoxynucleotidyl transferase can have low processivity.
• a polymerase such as Klenow fragment can have moderate processivity.
• the polymerase can be a thermostable polymerase.
• the polymerase can be derived from a mesophilic organism, thus having maximum polymerase activity in the range of 20-40 0 C.
• Polymerases from mesophilic organisms can be, but are not limited to, phi29 DNA polymerase (from the Bacillus subtilis), T4 DNA polymerase (from a strain of Escherichia coli that carries a T4 DNA Polymerase overproducing plasmid), T7 DNA polymerase (from T7 phage), and Klenow fragment (from Escherichia coli).
• Thermostable polymerases can be derived from thermophilic organisms.
• thermostable polymerases can be derived from thermophilic archaea.
• Thermostable polymerases can also be derived from thermophilic bacteria.
• Thermostable polymerases can also be derived from thermophilic Eukarya.
• thermostable polymerases include, but are not limited to, Taq polymerase derived from Thermus aquaticus, Pfu polymerase derived from Pyrococcus furiosus, vent polymerase derived from Thermococcus litoralis, TIi polymerase derived from Thermococcus litoralis, DyNAzymeTM polymerase derived from Thermus brockianus, or lsis DNA polymeraseTM derived from Pyrococcus abyssi.
• thermostable polymerases can be, for example Tth polymerase and TZ05 polymerase.
• monovalent cations can be provided by at least one salt comprising a monovalent cation.
• monovalent cations can be, but are not limited to, sodium (Na + ), potassium (K + ), ammonium (NH 4 + ), silver (Ag + ), and quaternary ammonium cations such as tetramethylammonium ions and tetraethylammonium ions.
• divalent cations can be provided by at least one salt comprising a divalent cation.
• divalent cations can be, but are not limited to, magnesium (Mg 2+ ), manganese (Mn 2+ ), calcium (Ca 2+ ), and copper (Cu 2+ ).
• the salt can be chosen from at least one of potassium chloride and magnesium chloride.
• a buffering agent can be any buffer that has an effective buffering capacity in the pH range of 6.0 to 9.0.
• a suitable buffer can be any buffer that has an effective buffering capacity in the pH range of 8.0 to 8.8.
• the buffering agent can be a buffer having an effective buffering capacity in the pH range of 8.1 to 8.5.
• the buffering agent can be Tris-HCI.
• Buffering agents can be, but are not limited to, N,N-Bis(2-hydroxyethyl)glycine, Tris(hydroxymethyl)aminomethane hydrochloride, and N- [Tris(hydroxymethyl)methyl]glycine. Buffering agents may shift the pH of a solution as function of temperature. For example,
• Tris(hydroxymethyl)aminomethane hydrochloride has a temperature dependence in the range of -0.028 pH to -0.021 units/°C. Accordingly, all pH values herein should be interpreted as the pH of the solution at 23 0 C.
• a composition of the invention can comprise a detergent.
• detergents can be, but are not limited to, ionic, non- ionic, and zwitterionic detergents.
• detergents can be, but are not limited to, Tween ® 20, Triton ® X-100, Thesit ® (polyoxyethylene 9 lauryl ether).
• Other exemplary detergents can be found in the Sigma-AIdrich ® catalog.
• a composition of the invention can comprise a carrier protein.
• Carrier proteins include, but are not limited to bovine serum albumin.
• compositions of the invention can generally be made by gathering the components present in the composition and combining those ingredients in one composition.
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraphs [057], [061], [065], [066], or [067] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.
• the ingredients used in these methods have the characteristics described in Sections 11. A and 11. D above.
• compositions of the invention can generally be made by gathering the components present in the composition and combining those ingredients in one composition.
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraphs [070], [081], [082], or [083] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.
• the ingredients used in these methods have the characteristics described in Sections II. B and II. D above. C. Methods of Making Compositions for Multiple Arrays
• compositions of the invention can generally be made by gathering the components present in the composition and combining those ingredients in one composition.
• components associated with the solid phase e.g., different oligonucleotides linked to different beads or different areas of a solid phase
• the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraph [084] or [085] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.
• the ingredients used in these methods have the characteristics described in Sections II. C and II. D above.
• the method of making a composition of the invention can comprise lyophilizing the components once they are combined by first freezing the composition described above and then dehydrating the composition.
• the composition can be frozen by placing it in a commercial freezer at an appropriate temperature.
• the composition can be frozen by placing the container at -20 0 C for 2-30 minutes.
• the composition can be frozen by placing it in an ice bath, for example an ethanol-dry ice bath, for 2-30 minutes.
• the components of the composition can be combined to result in various concentrations of each component.
• the polymerase can be present at a concentration of 25 to 250 units/milliliter.
• the nucleoside triphosphates can be present at a concentration of 100 to 500 nanomolar.
• the monovalent cations can be present at a concentration of 50 to 150 miHimolar.
• the beads can be present at a concentration of 200 to 2000 milligrams/liter.
• the cryoprotectant can be present at a concentration of 4 to 15 g/100 milliliter.
• the first oligonucleotide can be present at a concentration of 300 to 500 nanomolar. In some embodiments, the second oligonucleotide can be present at a concentration of 300 to nanomolar. In some embodiments, the third oligonucleotide can be present at a concentration of 10 11 to 10 19 copies per m 2 of the solid support. In some embodiments, the third oligonucleotide can be present at a concentration of 10 13 to 10 18 copies per m 2 of the solid support. In some embodiments, the third oligonucleotide can be present at a concentration of 10 15 to 10 17 copies per m 2 of the solid support.
• the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
• the invention provides a method of detecting, amplifying, and/or isolating a N target nucleic acid sequences comprising:
• N is an integer greater than or equal to 1.
• compositions of paragraphs [057], [061], [070], [084], and [085] can be modified to encompass the various embodiments described in Section Il above.
• compositions produced by the methods of paragraphs [0149], [0150], and [0151] can be modified to encompass the various embodiments described in Section Il above.
• the methods can comprise performing a PCR reaction where all of the necessary reagents, except the sample containing the target nucleic acid, are premixed in a container.
• the sample can be added to the premixed reagents before starting a PCR reaction.
• the amplified target nucleic acid sequence can be removed from the container after PCR and isolated via standard techniques, such as on an agarose gel, for further study or manipulation.
• the amplified target nucleic acid sequence can bind to the solid support.
• the container can be centrifuged or exposed to a magnetic source to concentrate the PCR products before detecting or isolating the products by detecting the label associated with the PCR products.
• the reaction container can be cooled to a temperature at which the amplification products can bind to the solid support via the pair of binding partners.
• the interaction between the first member and the second member of a pair of binding partners is unstable at temperatures 1O 0 C lower than the lowest temperature in the amplification reaction and stable at temperatures above 2O 0 C.
• the interaction between the first member and the second member of a pair of binding partners can be unstable at about the same temperature as the lowest temperature in the amplification reaction and stable at temperatures above 3O 0 C.
• the nucleic acid sequences used for the pair of binding partners can be a mixture of nucleotides to provide, for example, the desired thermal stability and unique binding for measuring one or more target sequences.
• multiple target nucleic acid sequences can be amplified, detected, or isolated by using the solid support to separate the labeled and amplified target sequences.
• the invention can detect N target nucleic acid sequences, where N is an integer greater than or equal to 1 ; 2; 10; 20; 30; 40; 50; 60; 70; 80; 90; 100; 200; 300; 400; 500; 600; 700; 800; 900; 1000; 2000; 3000; 4000; 5000; 10,000; 50,000; 100,000; 300,000; 500,000; 700,000 or 1 ,000,000.
• 2 ⁇ N ⁇ 1 ,000,000 In some embodiments, 2 ⁇ N ⁇ 1 ,000.
• 2 ⁇ N 1,000. In some embodiments, 2 ⁇ N ⁇ 100. In some embodiments, 2 ⁇ N ⁇ 30. In some embodiments, 2 ⁇ N ⁇ 10. In some embodiments, N > 10. In some embodiments, N > 50.
• each target nucleic acid sequence can be amplified with 1 pair of oligonucleotides.
• "i" target nucleic acid sequences can be amplified with "i” pairs of oligonucleotides, wherein “i” is an integer between 1 and N and wherein each pair of oligonucleotides amplifies a different target nucleic acid sequence.
• each target nucleic acid sequence can be amplified with pairs of oligonucleotides containing nucleic acid sequences unique to each target nucleic acid sequence.
• each target nucleic acid sequence can be amplified with a pair of oligonucleotides containing nucleic acid sequences common to more than one target nucleic acid sequence.
• the sequence of the third oligonucleotide can be unique to each target nucleic acid sequence.
• the solid support can be a planar structure with discrete areas arranged to capture different targets.
• the discrete areas can be electrodes, wherein each electrode is surrounded by an electrical insulator.
• each discrete area can comprise a working electrode and a counter electrode separated from each other and from other discrete areas by electrical insulators.
• the working electrode can be prepared to capture a target nucleic acid sequence.
• each discrete area can be linked to differing third oligonucleotides in order to detect different target sequences.
• the counter electrode can be shared across multiple working electrodes and therefore the counter electrodes are not considered to be in the discrete areas.
• each target nucleic acid sequence can have a different first oligonucleotide; second oligonucleotide; if present, third oligonucleotide; and if present, pair of binding partners.
• each discrete area can be linked to a different first member of pairs of binding partners where the pairs of binding partners can permit reversible binding between the different second oligonucleotides and the different discrete areas.
• the interaction between the first members and the second members of the pairs of binding partners are (1) unstable at temperatures used for amplifying DNA, such that the first and second members will not stably bind to each other during the amplification reaction; and (2) stable below the temperature used for amplifying DNA.
• the reaction container can be cooled to a temperature at which the amplification products bind to their respective discrete areas via the pair of binding partners.
• electrochemiluminescence can be used to detect multiple target nucleic acid sequences by using electrodes as the discrete areas of the solid support, each area being arranged to specifically bind to one of the target sequences.
• fluorescence can be used to detect multiple target nucleic acid sequences with each discrete area of the solid support being arranged to specifically bind to one of the target sequences.
• the method of detecting, amplifying, and/or isolating a target nucleic acid sequence further comprises forming a dry composition from the composition of step (1) (e.g., by freeze-drying or lyophilizing) before performing steps 2-5 described at the beginning of section IV.
• the components can be frozen.
• the dry composition may be formed by first snap freezing the composition of step (1 ) in, for example, a dry ice ethanol bath or in liquid nitrogen.
• the components can be lyophilized at temperatures and pressures that maintain the sample in a solid state, for example, a temperature of -30 0 C to 0 0 C and a pressure of 10 to 20 millitorr for a time sufficient to reduce the water content to 0% to 5%, e.g., 1 to 48 hours. Longer durations and lower pressures are also contemplated.
• the lyophilization temperature may, in some cases, be increased to as high as 37 0 C to accelerate the rate of water removal in the reduced pressure environment.
• rehydration can occur when at least one of water, buffer, or the sample containing the target nucleic acid sequence is added to the dried composition of step (1 ).
• the sample can be added subsequently, but prior to commencing the PCR reaction.
• water and/or buffer could be added after the sample is added but prior to commencing the PCR reaction.
• PCR involves subjecting each sample to a series of amplification cycles.
• each amplification cycle can include (1) a melting step in which double-stranded nucleic acids separate into single strands, (2) an annealing step in which first and second oligonucleotides, also called primers in the context of PCR, hybridize to sufficiently complementary sequences contained in the target nucleic acid, and (3) a primer extension or polymerase step in which a polymerase enzyme extends the primers by adding nucleoside triphosphates to the growing polynucleotide, thus creating multiple copies of the target nucleic acid.
• the composition of the invention can comprise an RNA dependent polymerase such as reverse transcriptase, to convert the RNA into DNA, and a DNA-dependent polymerase to facilitate amplification of the resulting DNA sequence.
• RNA dependent polymerase such as reverse transcriptase
• the target DNA is a single-stranded target nucleic acid molecule.
• the PCR melting step can eliminate secondary structure in the single-stranded target. Only the primer sufficiently complementary to the single strand can initially hybridize with the target sequence during the first amplification cycle. Once the first amplification step is complete, the target DNA is then double-stranded, allowing both primers to bind to their sufficiently complementary sequences in subsequent PCR cycles.
• Suitable melting temperatures are in the range of 85 0 C to 99°C.
• the duration of the melting step can be in the range of 10 seconds to 5 minutes.
• the target nucleic acid sequence can be incubated at 95 0 C for 30 seconds to allow strand separation and/or secondary structure removal. In some embodiments, the target nucleic acid sequence can be incubated at 97 0 C for 15 seconds to allow strand separation and/or secondary structure removal.
• the temperature and amount of time needed for optimal primer annealing to the target sequence can vary according to the primer sequence, primer length, and primer concentration in the PCR reaction.
• the annealing temperature can be 5°C below the melting temperature (T m ) of the primer.
• T m melting temperature
• an approximate primer T m can be calculated by adding 2°C for each A or T in the primer and 4°C for each G or C in the primer.
• T m 64.9 + 41 x (yG + zC - 16.4)/(wA + xT + yG + zC).
• w, x, y, and z are the number of As, Ts, Gs, and Cs in the nucleotide sequence for which the Tm can be calculated.
• suitable temperatures for annealing primers to a target nucleic acid sequence can be in the range of 45°C to 65 0 C.
• the duration of the annealing step can be in the range of 2 seconds to 5 minutes.
• suitable temperatures for annealing primers to a target nucleic acid sequence can be in the range of 55°C to 72°C.
• the concentration of each primer in the PCR reaction can be 0.1 ⁇ M to 0.5 ⁇ M. In some embodiments, the concentration of each primer in the PCR reaction can be 0.2 ⁇ M. The skilled artisan can easily determine the appropriate annealing temperature and primer concentration to achieve optimal primer binding and specificity.
• primer extension temperatures can range from 60 0 C to 85°C or 70°C to 75°C.
• the primer extension temperature can be 72°C.
• the duration of the primer extension step can be in the range of 1 second to 30 minutes or in the range of 20 seconds to 5 minutes.
• the PCR reaction can be incubated at 72°C for one minute to allow primer extension.
• the number of amplification cycles required for successful target nucleic acid amplification can depend on the concentration of the target nucleic acid sequence in the PCR reaction. In some embodiments, the PCR reaction can undergo 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, or 40 to 45 amplification cycles.
• the PCR reaction can be pre-incubated to minimize secondary structure in the target nucleic acid sequence and to maximize the completeness of target sequence double strand separation.
• the temperature for this preincubation step can be in the range of 85 0 C to 99°C, and the duration of this step can be in the range of 1 to 10 minutes.
• a final primer extension/polymerization step can be added after the cycling is complete to allow the amplified copies to replicate the target sequence in its entirety. In some embodiments, this final step can be performed at a temperature in the range of 70°C to 75°C for a duration of 1 to 15 minutes.
• the PCR reaction container can be manipulated after completion of the PCR reaction.
• the contents of the container can be mixed in order to resuspend the third oligonucleotide linked to the solid support.
• the contents of the container can be mixed at a temperature where the interaction is stable to facilitate the linkage of the oligonucleotide to the solid support.
• the contents of the container can be heated to a temperature in the range of 85 0 C to 99°C for 1 to 15 minutes to permit the double stranded nucleic acid product of the PCR reaction to melt into single strands.
• the third oligonucleotide can hybridize to the target sequence by lowering the temperature to the range of 20 0 C to 65°C for a duration in the range of 5 minutes to 2 hours.
• the PCR reaction can be incubated at a temperature where the interaction is stable to facilitate the linkage of the oligonucleotide to the solid support and where the third oligonucleotide can hybridize to the target nucleic acid sequence.
• the third oligonucleotide can contain a poIy-T tail at its 5' terminus that does not bind to the target nucleic acid sequence. This single-stranded poly T tail can bind to a poly A oligonucleotide that can be covalently bound to the solid support, using 2 0 C for each A/T pair.
• the target sequence can then be physically separated from the rest of the contents of the container.
• physical separation can be achieved through gravity.
• the container can be centrifuged, e.g. 1 ,000 x g for 10 minutes.
• separation can be achieved by applying a magnetic field to the container and decanting, aspirating, or otherwise removing the unbound reagents, thereby isolating the target nucleic acid sequence.
• the target sequence can be detected after the PCR reaction is complete.
• the amplified target sequence can be placed in a cell connected to a photomultiplier tube.
• the target sequence can be isolated and detected in the cell of an instrument designed for this purpose, e.g., an M- SERIES M1-M Analyzer (BioVeris Corp., Gaithersburg, MD).
• the amplified target sequence can be detected using, for example, a gamma counter, a Geiger counter, or a scintillation counter.
• kits of the invention also provides kits for carrying out the methods of detecting, amplifying, and/or isolating target nucleic acids.
• kits of the invention can comprise at least one of the compositions of paragraphs [057], [061], [070], [084], and [085].
• a kit can comprise a container in which kit components can be packaged.
• a kit can comprise directions on how to use the kit components to detect, amplify, and/or isolate target nucleic acids.
• oligonucleotides were designed to hybridize to a portion of the DNA sequence encoding the protective antigen of B. anthracis.
• the sequence of the first oligonucleotide was as follows:
• SEQ ID NO. 1 is a forward primer.
• the second oligonucleotide's sequence was as follows:
• SEQ ID NO. 2 is a reverse primer.
• the two oligonucleotide primers amplified a PCR product 193 bases long.
• SEQ ID NO. 2 was synthesized with a ruthenium at the 5' end by phosphoramidite chemistry using the methods described in US patent 5,597,910.
• the third oligonucleotide, used to capture the resulting labeled PCR product had the following sequence:
• This oligonucleotide was sufficiently complementary to the same target strand as the unlabeled PCR primer at a location on the target nucleic acid sequence between the locations where the first and second oligonucleotides hybridized to the target nucleic acid sequence.
• the third oligonucleotide was synthesized with a primary amine group at the 5'-terminus, purchased from Biosource International (Camarillo, CA).
• the capture oligonucleotides were coupled to Dynal 2.8-micron carboxylated superparamagnetic beads (Dynal Biotech, Brown Deer, Wl, M-270 carboxylated beads, part number 143.06) by using [1-ethyl-3- (dimethylaminopropyl)carbodiimide] hydrochloride as a cross-linking agent.
• Dynal 2.8-micron carboxylated superparamagnetic beads Dynal 2.8-micron carboxylated superparamagnetic beads (Dynal Biotech, Brown Deer, Wl, M-270 carboxylated beads, part number 143.06) by using [1-ethyl-3- (dimethylaminopropyl)carbodiimide] hydrochloride] hydrochloride as a cross-linking agent.
• 200 ⁇ l M-270 carboxylated beads (30 mg/ml) were prepared for coupling by washing twice with 200 ⁇ l 0.01 M sodium hydrox
• the washed beads were resuspended in 140 ⁇ l of a solution containing 25 mM 2-morpholinoethanesulfonate buffer (MES, Sigma Aldrich, St. Louis, MO) pH 5.0 and 30 ⁇ M amino-Iabeled oligonucleotide.
• MES 2-morpholinoethanesulfonate buffer
• the mixture was incubated at room temperature with end-over-end mixing for 30 minutes, and then 60 ⁇ l freshly made solution of 100 mg/ml [1-ethyI-3-
• a liquid formulation of the following reagents was prepared: 5 mM Tris-HCI pH 8.3 25 mM KCl, 2.5 mM MgCI 2 , 0.1 mM dATP, 0.1 mM dCTP, 0.1 mM dGTP, 0.1 mM dTTP, 0.1 ⁇ M unlabeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM EDTA, 0.1 ⁇ M ([Ru(bpy) 3 ] 2+ -labeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM EDTA, 2.5% w/v trehalose, 0.125% v/v Tween ® 20 , 0.02 units/ ⁇ l Taq DNA polymerase, 0.3 ⁇ g of the above-described oligonucleotide-superparamagnetic beads coupled to the third oligonucleotide.
• Buffer, magnesium chloride solution and Taq DNA polymerase were purchased from Applied Biosystems.
• a dNTP mix solution was purchased from Bioline.
• Trehalose and Tween ® 20 were purchased from Sigma Aldrich.
• Oligonucleotides were purchased from Biosource.
• PCR reactions were prepared by adding 25 ⁇ l water to each tube.
• One microliter of 200 pg/ ⁇ l S. anthracis DNA, prepared using a silica spin column (Qiagen) from the Sterne strain was added to the highest concentration tube, and six serial dilutions of DNA were performed in the reaction mixes.
• the PCR tubes were capped, mixed briefly, and then placed in a thermal cycler (MJ Research PTC-200) to undergo 35 cycles of DNA amplification.
• the PCR tubes were pre- incubated at 95°C for 7 minutes before starting the amplification cycles.
• Each amplification cycle consisted of incubating the PCR tubes at 95 0 C for 30 seconds, 55°C for 30 seconds, and then at 72 0 C for 1 minute. After completing the 35 cycles, the PCR tubes were incubated at 72°C for 4 minutes.
• PCR reaction mixtures were prepared for amplifying and detecting DNA sequences that encode a portion of the following B. anthracis targets: protective antigen, capsular protein B, and a chromosomal locus.
• protective antigen forward primer: SEQ ID NO. 1 reverse primer.
• SEQ ID NO. 2 Capsular protein B: forward primer: 5'- AG ATATTCCAACG CAAGAGT -3 1 SEQ ID NO.
• Chromosomal locus BA4070 forward primer: 5 1 - TAAGGAGGAGGTAATATGGAG -3 1 SEQ ID NO: 1
• reaction tubes were reconstituted by adding 0, 0.1, or 5 pg S. anthracis DNA suspended in 25 ⁇ l of water.
• the PCR tubes were capped, mixed briefly, and then placed in a MJ Research PTC225 thermal cycler to undergo 38 cycles of DNA amplification.
• the PCR tubes were pre-incubated at 95 0 C for 7 minutes before starting the amplification cycles.
• Each amplification cycle consisted of incubating the PCR tubes at 95°C for 15 seconds and 50 0 C for 30 seconds repeated 38 times. The samples were then incubated at 72°C for 2 minutes
• a reaction mixture was prepared to amplify and detect a portion of the RNA genome of the coronavirus that causes Severe Acute Respiratory Syndrome (SARS).
• SARS Severe Acute Respiratory Syndrome
• the oligonucleotides used had the following sequences: forward primer: 5 1 - AAGCAGCCCACTGTGACTC -3' SEQ ID NO.
• SEQ ID NO. 12 capture oligonucleotide: 5 1 - C6 amino-
• the primers and capture oligonucleotide were prepared as described above in Examples 1 and 2.
• the reaction mixture contained 20 mM Tris-HCI pH 8.3, 100 mM KCI, 2 mM magnesium chloride, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.4 mM dllTP, 5% trehalose, 0.2 ⁇ M unlabeled forward primer, 0.2 ⁇ M [Ru(bpy) 3 ] 2+ -labeled reverse primer, 0.6 ⁇ g superparamagnetic beads (1 ⁇ m diameter MyOneTM carboxylated beads from Dynal Biotech, part number 650.12) linked to the capture oligonucleotide, and 0.15 units/ ⁇ l Thermus sp. Z05 polymerase (Applied Biosystems, Foster City, CA).
• Superparamagnetic beads were prepared as described in Example 1.
• Dried reactions were reconstituted by adding 25 ⁇ l deionized water.
• the test template for the reconstituted reactions was SARS-CoV Armored RNA (Ambion, Austin, TX). Three microliters Armored RNA (1 x 10 5 particles) were activated by heating for 3 minutes at 75°C, and then added to an RT-PCR reaction. Dilutions of RNA were performed by serially transferring 3 ⁇ l to six tubes.
• the PCR tubes were capped, mixed briefly, and then placed in a in a MJ Research PTC-200 thermal cycler to undergo 40 cycles of amplification.
• the PCR tubes were first pre-incubated at 65 0 C for 30 minutes to allow synthesis of an initial DNA strand from the RNA template.
• RNA/DNA hybrids were then incubated at 95°C for 1 minute to allow the strands of the resulting RNA/DNA hybrids to separate before starting the amplification cycles.
• Each amplification cycle consisted of incubating the PCR tubes at 95°C for 15 seconds and 55°C for 30 seconds. After completing the 40 cycles, the PCR tubes were incubated at 45 0 C for 30 minutes to permit the capture oligonucleotide to hybridize with the PCR products.
• the PCR products were then diluted with 210 ⁇ l of PBS and the amount of [Ru(bpy)3] 2+ bound to the beads was quantified in a BioVeris M-SERIES ® M1 R Analyzer (BioVeris Corp., Gaithersburg, MD). As shown in Figure 3, the intensity of the resulting ECL signal correlated with the viral RNA copy number present in the sample.
• PCR for nucleic amplification
• target polynucleotide amplification methods such as self- sustained sequence replication (3SR) and strand-displacement amplification (SDA); methods based on amplification of a signal attached to the target polynucleotide, such as "branched chain” DNA amplification; methods based on amplification of probe DNA, such as ligase chain reaction (LCR) and QB replicase amplification (QBR); transcription-based methods, such as ligation activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA); and various other amplification methods, such as repair chain reaction (RCR) and cycling probe reaction (CPR).
• SSR self- sustained sequence replication
• SDA strand-displacement amplification
• LCR ligase chain reaction
• QBR QB replicase amplification
• transcription-based methods such as ligation activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA)

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Analytical Chemistry (AREA)
• Physics & Mathematics (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (4)

Publications (1)

Family

ID=37093562

Family Applications (1)

Country Status (3)

Cited By (16)

Families Citing this family (3)

Citations (8)

• 2006
  • 2006-06-30 JP JP2008519621A patent/JP2009500020A/ja not_active Ceased
  • 2006-06-30 CA CA002613101A patent/CA2613101A1/en not_active Abandoned
  • 2006-06-30 WO PCT/US2006/025619 patent/WO2007005626A1/en active Application Filing

Patent Citations (8)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events