CA2613101A1

CA2613101A1 - Compositions and methods for detecting, amplifying, and/or isolating nucleic acids

Info

Publication number: CA2613101A1
Application number: CA002613101A
Authority: CA
Inventors: David Carlson
Original assignee: Individual
Current assignee: Bioveris Corp
Priority date: 2005-07-01
Filing date: 2006-06-30
Publication date: 2007-01-11
Also published as: JP2009500020A; WO2007005626A1

Abstract

The invention provides compositions, methods, and kits for detecting, amplifying, and/or isolating one or more target nucleic acid sequences in a sample.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

COMPOSITIONS AND METHODS FOR DETECTING, AMPLIFYING, AND/OR
ISOLATING NUCLEIC ACIDS

This application claims priority to U.S. Provisional Patent Application Nos.
60/695,407, filed July 1, 2005, and 60/705,167, filed August 4, 2005.
[001] The invention relates generally to the field of molecular biology.
Certain embodiments of the invention provide compositions, methods, and kits for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample.

[002] Nucleic acids, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), are large macromolecules comprised of covalently linked nucleotide subunits. Nucleic acids encode and transmit from generation to generation the genetic blueprint of all biological organisms including all multi-cellular organisms such as animals and plants, unicellular organisms such as yeast and bacteria, and cellular parasites such as viruses. Nucleic acid sequence analysis can be used to aid in understanding both an organism's phenotypic traits as well as the biochemical processes underlying a given trait. Thus, detecting, amplifying, isolating, and sequencing specific nucleic acid sequences provides a first step in gaining insight into many normal or pathological biological process.

[003] A variety of techniques suitable for detecting nucleic acid sequences have been described (See, e.g., Lodish et al., 2000, Molecular Cell Biology.
4th ed. New York: W. H. Freeman & Co). Laboratory techniques that amplify a target nucleic acid sequence allow the skilled artisan to accomplish many different tasks with the target sequence. These tasks include detecting minute quantities of the target sequence in a sample, sequencing the target sequence, as well as obtaining sufficient quantities of the target sequence to facilitate joining various nucleic acid sequences via cloning techniques.

[004] The polymerase chain reaction (PCR) can be used to amplify a target nucleic acid sequence. See, e.g., U.S. Patent Nos. 4,683,195; 4,683,202; and 4,800,159. While PCR is useful, the method is not without its shortcomings.
The reagents used in PCR are typically mixed together just prior to performing the reaction, requiring multiple pipetting steps that can aerosolize reagents and sample DNA sequences. Because of the exponential amplification of a target nucleic acid molecule, PCR is highly sensitive. Minute quantities of contaminating DNA can undermine the results obtained after amplification by providing false positive signals. The more each reaction tube is manipulated in the process of setting up a PCR reaction, the more likely such contaminating DNA will be introduced into the reaction tube either via contaminated pipette tips or contaminated PCR reagent solutions.

[005] Thus, there is a need to provide a convenient method to amplify, detect, and/or sequence a target nucleic acid in a sample, while minimizing the effects of human error that result from pipetting errors and PCR reagents contaminated with foreign DNA. There is also a need to provide PCR reagents that are stable over a wide range of physical conditions such as temperature.
Stability of the reagents over a wide temperature range can permit reagents to be shipped and stored with relative ease and can provide a more economical way of performing PCR. There is also a need for a more rapid, less labor intensive means of isolating the target nucleic acid after amplification. In certain embodiments, the present invention fulfills each of these needs.

SUMMARY OF THE INVENTION

[006] - The invention includes compositions that can be used for amplifying, detecting, and/or isolating a target nucleic acid sequence in a sample, by providing a single formulation containing all reagents necessary for a PCR
reaction, except for the sample target nucleic acid sequence or its complement, in a single container. The compositions of the invention can also comprise a solid support to which the PCR product can be attached after amplification. The solid support can facilitate rapid isolation and detection of PCR products. The invention includes compositions that can be used for sequencing a target nucleic acid sequence in a sample, by providing a single formulation containing all reagents necessary for a PCR sequencing reaction, except for the sample target nucleic acid sequence, in a single container. The invention also includes dry compositions that can be used for detecting, amplifying, and/or isolating a target nucleic acid sequence, thereby enhancing the stability and shelf life of the composition. The invention also includes methods of detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample, methods of sequencing a target nucleic acid sequence in a sample, and methods of making the compositions of the invention. The invention further includes kits useful for detecting, amplifying, isolating, and/or sequencing a target nucleic acid sequence in a sample.

[007] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of (1) the target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the target nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label;
and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[008] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;

(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence-then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[009] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein the second oligonucleotide is not linked to the solid support until the target nucleic acid sequence has been amplified, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[010] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences corrmprising:__ (a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing with a first part of the ith target nucleic acid sequence;
(i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing with a nucieic acid sequence complementary to a second part of the ith target nucleic acid sequence; and (j) N third oligonucleotides, wherein the ith third oligonucleotide is linked to the it" discrete area on the at least one solid support and is capable of hybridizing with a third part of (1) the ith target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the it"
target nucleic acid sequence;
wherein N is a integer greater than or equal to 1; wherein it" represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the ith first oligonucleotide, and (i) the ith second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[011] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) - at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas, wherein the it" discrete area is modified with an ith first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing to a first part of the ith target nucleic acid sequence or a sequence that is complementary to the it" target nucleic acid sequence; and (i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing to a second part of the ith target nucleic acid sequence or a sequence that is complementary to the ith target nucleic acid sequence and comprises an ith second member of the pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[012] In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining the following:
(a) - at least one polymerase; -(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of (1) the target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the target nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) -(j) in a container thereby forming a composition for detecting, amplifying, and/or isolating the target nucleic acid sequence.

[013] In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - (i) in a container thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.

[014] In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample comprising:
(1) obtaining the following components:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein the second oligonucleotide is not linked to the solid support until the target nucleic acid sequence has been amplified, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - (i) in a single container thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.

[015] In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one -nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing with a first part of the ith target nucleic acid sequence;
(i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the ith target nucleic acid sequence; and wherein at least one of (b) the at least one nucleoside triphosphate, (h) the it" first oligonucleotide, and (i) the itn second oligonucleotide is modified with a label; and (j) N third oligonucleotides, wherein the it" third oligonucleotide is linked to the it" discrete area on the at least one solid support and is capable of hybridizing with a third part of (1) the ith target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the itn target nucleic acid sequence, (2) linking the ith third oligonucleotide to the ith discrete area on the at least one solid support; and (3) combining (a) -(j) in a container thereby forming a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences;
wherein N is a integer greater than or equal to 1; wherein ith represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; and wherein the composition does not comprise the target nucleic acid sequence or its-complement.

[016] In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas, wherein the ith discrete area is modified with an it" first member of a pair of binding partners;
(g) at least one cryoprotectant;

(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing to a first part of the ith target nucleic acid sequence or a sequence that is complementary to the itn target nucleic acid sequence; and (i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing to a second part of the ith target nucleic acid sequence or a sequence that is complementary to the ith target nucleic acid sequence and comprises an itn second member of the pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith represents in turn all integers between I and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable-of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence; and (2) combining (a) -(i) in a container thereby forming a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences.

[017] In certain embodiments, the method of the invention can comprise freeze-drying the composition for detecting, amplifying, and/or isolating a target nucleic acid sequence. In certain embodiments, the method of the invention can comprise lyophilizing the composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.

[018] In various embodiments, the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by the method of paragraph [012] or [013];
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence are made;
(4) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (5) optionally detecting the label thereby detecting the target nucleic acid in the sample.

[019] In certain embodiments, the method of detecting, amplifying, and/or isolating a target nucleic acid sequence can comprise freeze-drying or lyophilizing the composition -of step (1) before performing steps 2-5.

[020] In some embodiments, the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by the method of paragraph [014];
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence can be made;
(4) linking the second oligonucleotide to the solid support;
(5) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (6) optionally detecting the label thereby detecting the target nucleic acid in the sample.

[021] In some embodiments, the invention provides a method of detecting, amplifying, and/or isolating a N target nucleic acid sequences comprising:
(1) obtaining a first composition of paragraph [010] or [011];
(2) adding a sample which may contain the N target nucleic acid sequences to the first composition to form a second composition;
(3) alternately heating and cooling the second composition such that multiple copies of each of the N target nucleic acid sequences that are in the sample are made;
(4) allowing the multiple copies to link to the N discrete areas on the at least one solid support; and (5) optionally detecting or isolating the label thereby detecting the N
target nucleic acid sequences in the sample;
wherein N is an integer greater than or equal to 1.

[022] The invention can also provide kits that can be used to carry out the methods for detecting, amplifying, and/or isolating a target nucleic acid sequence according to the invention.

[023] The foregoing general description and the following detailed description -are exemplary and explanatory only and are not restrictive of the ---invention as claimed.
BRIEF DESCRIPTION OF THE DRAWINGS

[024] Figure 1 is a graph showing the relationship between the starting concentration of Bacillus anthracis (B. anthracis) DNA and the electrochemiluminescent signal detected after PCR amplification of the B.
anthracis DNA. The symbols represent averages of duplicate measurements and the line is a mathematical curve fit to the measurements.

[025] Figure 2 is a graph showing the electrochemiluminescent signal generated over time, after PCR amplification of a reconstituted dry composition to which B. anthracis genomic DNA was added. Three portions of the genomic B.
anthracis DNA (chromosomal locus BA4070, protective antigen, and capsular protein B) were measured at two quantities (100 fg and 5 pg of B. anthracis DNA) at three times (A. 1 day and 7 days post lyophilization) (B. 28 days post lyophilization). The bars represent the averages of triplicate measurements.
The error bars represent I standard deviation of the triplicates.
[026] Figure 3 is a graph showing the relationship of the electrochemiluminescent signal and copy number of Severe Acute Respiratory Syndrome (SARS) coronavirus after reverse transcriptase and PCR amplification using premixed reagents. The circle symbols represent averages of duplicate measurements for compositions that were kept in liquid form and used the same day the composition was made. The plus symbols represent averages of duplicate measurements for compositions that were lyophilized to form a dry composition and used after the dry composition was stored for 5 days at room temperature. At the RNA copy number near 2,000 particles, the liquid and dry composition measurements overlap. The line is a mathematical curve fit to the dry composition measurements.

DETAILED DESCRIPTION OF THE INVENTION

[027] In certain embodiments, the invention provides a composition comprising premixed reagents for amplifying or detecting a target nucleic acid sequence in a-sample: In- other embodiments, the invention also provides a--means for isolating a target nucleic acid sequence. The composition of the invention can avoid (1) the potential inaccuracies due to measuring errors that arise when adding each component separately and (2) the risk of component contamination with foreign nucleic acids that increases with the number of times pipette tips are introduced into each component solution. In addition, the composition of the invention can be more convenient to use. All components necessary for detecting, amplifying, and/or isolating a nucleic acid sequence, except the sample itself, can be inside a single container.

[028] The invention also provides a method of making the composition of the invention as well as a method of detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample. The composition of the invention can be part of a kit that is useful for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample.

1. Definitions [029] The term "hybridize" refers to the binding between complementary oligonucleotides and/or polynucleotides. When two molecules hybridize, they form a combination of the two molecules through complementary base pairing.
Oligonucleotides can hybridize to oligonucleotides or polynucleotides under a variety of circumstances. For example, an oligonucleotide can hybridize to a target sequence or to the complement of a target sequence during a PCR
reaction. In this situation, an oligonucleotide is "capable of hybridizing" to the target nucleic acid sequence or its complement under salt and temperature conditions used for target sequence amplification. A portion of an oligonucleotide can also hybridize to a second oligonucleotide in the process of linking the oligonucleotide to a solid support. For example, a solid support can have polyA
oligonucleotides 10 residues long covalently attached to the solid support allowing an oligonucleotide with 10 thymidine residues at its end to be linked to the solid support via hybridization. In this situation, an oligonucleotide is "capable of hybridizing" under salt and temperature conditions used for linking an oligonucleotide to a solid support. An oligonucleotide can also hybridize to a target sequence to capture or isolate the target sequence. In this situation, an oligonucleotide is "capable of hybridizing" under salt and temperature conditions used for capturing or isolating a target nucleic acid sequence. The skilled artisan can readily determine the appropriate hybridization temperature to capture a target sequence, given the length of the capture oligonucleotide, the C/G
content of the oligonucleotide, and the salt concentration of the hybridization reaction.

[030] The term "complementary" refers to nucleotides that form base pairs.
For example, adenine is complementary to thymidine, adenine is complementary to uracil, and cytosine is complementary to guanine. Each strand of a double-stranded oligonucleotide or polynucleotide is complementary when at each nucleotide position the nucleotides from each strand form base pairs.. The term "sufficiently complementary" refers to two sequences that, though they are not exact complements, can hybridize with each other under a set of hybridization conditions. For example, one strand can be longer than the other, but still have base pairs form at enough positions to result in hybridization. In another example, the two strands can be the same length and not form base pairs at every position, but enough base pairs are formed to result in hybridization. Factors including the length of a sequence, the number of G and C residues the sequence has, the salt concentration of the hybridization reaction, and the temperature of the hybridization reaction can determine how much nucleotide mismatching can be present and still result in hybridization between two sufficiently complementary sequences. Appropriate hybridization conditions can be selected by those skilled in the art with minimal experimentation as exemplified in Dieffenbach, C.W and Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold Spring Harbor, USA or PCR Protocols: A Guide to Methods and Applications, Innis, M.A.
et al. eds., Academic Press, San Diego, USA 1990. For example, sufficiently complementary sequences can hybridize to each other at 60 C in the presence of 1.5 mM Mg2+ and 50 mM Na+.

[031] The term "primer" refers to an oligonucleotide that is capable of hybridizing to a target nucleic acid sequence and allowing the synthesis of a complementary strand. The term "forward primer" refers to a primer that can hybridize with the non-coding strand of a DNA molecule. The term "reverse primer" refers to a-primer-that can hybridize with the coding strand of a DNA--molecule.

[032] The term "oligonucleotide" refers to a molecule comprising nucleotides or nucleic acid analogs that is less than 100 nucleotides in length. The term "capture oligonucleotide" refers to an oligonucleotide that tethers an amplified target nucleic acid sequence to a solid support. The term "poly A tail" refers to a series of adenine nucleotides added to the end of the oligonucleotide. The term "poly T tail" refers to a series of thymidine nucleotides added to the end of the oligonucleotide. The term "poly A oligonucleotide" refers to an oligonucleotide containing only adenine residues. The term "poly T oligonucleotide" refers to an oligonucleotide containing only thymidine residues. The terms "poly G tail,"
"poly U tail," "poly C tail," "poly G oligonucleotide," "poly U oligonucleotide,"
and "poly C
oligonucleotide" are similarly defined.

[033] The term "polynucleotide" refers to a molecule comprising nucleotides or nucleotide analogs that is 100 nucleotides or greater in length.

[034] The term "target nucleic acid sequence" or "target sequence" refers to a compound comprising nucleic acids or nucleic acid analogs ordered in a sequence, wherein the compound is sought to be detected, amplified, or isolated in a sample. If a nucleic acid is double-stranded, the target nucleic acid sequence can be either one of the strands.

[035] The term "nucleic acid" refers to a nucleotide sequence-containing oligomer or polymer having a backbone formed solely from naturally occurring nucleotides. The term "nucleic acid analog" means an oligomer or polymer comprising at least one modified nucleotide or subunits derived directly from a modification of nucleotides and/or at least one nucleotide analog.

[036] The term "nucleic acid analog" also refers to synthetic molecules that can bind to a target nucleic acid sequence or to the complement of a target nucleic acid sequence. For example, a nucleic acid analog can be comprised of ribo or deoxyribo nucleotides, modified nucleotides, and/or nucleotide analogs.
The term "nucleotide analog" refers to a synthetic moiety that can be used in place of a natural nucleotide or a modified nucleotide.

[037] The term "nucleoside triphosphate" or "nucleotide" refers to a nitrogenous base such as a purine or a pyrimidine that can be covalently bound to a sugar molecule such as ribose or deoxyribose that can be covalently bound to phosphate groups. Nucleoside triphosphates can encompass both ribonucleoside and deoxyribonucleoside triphosphates. The term "modified nucleotide" refers to a nucleotide that has been chemically modified.

[038] The term "polymerase," as used herein, refers to an enzyme that catalyzes a reaction between chemical moieties to form larger molecules. For example, a polymerase can catalyze the polymerization of nucleotides to form polynucleotides. Nucleic acid polymerases can catalyze the reaction between nucleoside triphosphates to form linear nucleic acid molecules linked together by phosphodiester bonds. The term "processivity" refers to the number of nucleotides a polymerase can add to a growing nucleic acid chain before the enzyme falls off of the template-substrate complex.

[039] The term "polymerization" refers to the process of chemically connecting smaller subunits to form a larger molecule. For example, the polymerization of nucleotides can result in formation of a polynucleotide.

[040] The term "buffering agent" refers to a reagent that can reduce changes to the concentration of free hydrogen ions in a solution, and thus can maintain a particular pH or pH range.

[041] The term "cryoprotectant" refers to a compound or composition that can protect the activity of a biologically active molecule or a reagent during freezing, drying, and/or reconstitution of the dried substance. The term "freeze-dry" refers to rapid freezing and subsequently drying a substance in a vacuum.
The term "lyophilized" or "lyophilization" refers to drying a substance by freezing it in a high vacuum or to removing water from a frozen substance by sublimation under lowered pressure. The terms "lyophilize" and "freeze-dry" are used interchangeably throughout this specification. Sublimation refers to the process by which a solid evaporates without passing through a liquid phase.

[042] Cations can provide a means for neutralizing the negative charges associated with nucleic acids. Cations useful in the invention can be monovalent and divalent cations. The term "monovalent cation" refers to an ion with a net positive charge of 1. The term "divalent cation" refers to an ion with a net positive charge of 2.

[043] The term "linked" or "linking" refers to an association between two moieties. For example, hybridization can be a form of linking in that it involves the association of complementary oligonucleotides and/or polynucleotides.

[044] The term "pair of binding partners" refers to a first entity that can bind to a second entity. In general, such complexes are characterized by a relatively high affinity and a relatively low to moderate capacity. Nonspecific binding can have a low affinity with a moderate to high capacity.

[045] The term "solid support" refers to any material that can be linked to an oligonucleotide capable of hybridizing to a target nucleic acid sequence.

[046] The term "label" refers to a moiety, molecule, or collection of molecules that can be attached to an oligonucleotide and/or a polynucleotide, incorporated into an oligonucleotide and/or a polynucleotide, and/or attached to a nucleoside triphosphate, wherein the moiety, molecule, or collection of molecules can render the polynucleotide, oligonucleotide, or nucleoside triphosphate detectable by an instrument or method. In some embodiments, labels are capable of generating, modifying or modulating a detectable signal either directly or indirectly.

[047] The term "ECL moiety" refers to any compound that can be induced to repeatedly emit electromagnetic radiation by exposure to an efectrochemical energy source. Representative ECL moieties are described in Electrogenerated Chemiluminescence, Bard, Editor, Marcel Dekker, (2004); Knight, A and Greenway, G. Analyst 119:879-890 1994; and in U.S. Patent Nos. 5,221,605;
5,591,581; 5,858,676; and 6,808,939.

[048] The tem "ECL coreactant," as used herein, pertains to a chemical compound that either by itself or via its electrochemical reduction or oxidation product(s), plays a role in the ECL reaction sequence. Often ECL coreactants can permit the use of simpler means for generating ECL (e.g., the use of only half of the double-step oxidation-reduction cycle) and/or improved ECL intensity.

[049] The term "container" refers to a vessel that is suitable for carrying out a DNA polymerization reaction.

[050] The term "thermostable" refers to the property of being substantially unaffected by high temperatures. For example, a polymerase can be considered thermostable if the polymerase maintains at least 50% of its original activity after 1 hour at 60 C.

[051] The term "dry composition," as used herein, means that the composition has a moisture content of less than or equal to 5% by weight, relative to the total weight of the composition.

[052] The term "liquid-contact," as used herein, refers to the addition of a liquid to a dry composition, wherein the components of the dry composition are in contact with the same liquid. In some embodiments, the liquid is water.

[053] The term "magnetizable bead," as used herein, encompasses magnetic, paramagnetic, and superparamagnetic beads.

[054] The term "and/or", as used herein, means at least one in a series of alternatives. For example, A, B, and/or C means any of the following: A; B; C;
A
and B; A and C; B and C; A and B and C.

H. Compositions of the Invention [055] The invention pertains to compositions for amplifying, detecting, and/or isolating a target nucleic acid sequence in a sample. These compositions can provide all reagents necessary for a PCR reaction in a single formulation, except for the sample target nucleic acid sequence or its complement. In some embodiments, an end user need only add a target nucleic acid sequence and possibly water to the composition before beginning amplification of the target nucleic acid sequence, optimizing consistency between test samples by minimizing the amount of pipetting needed to prepare a sample. In some embodiments, at least one of the oligonucleotides present in the compositions of the invention serves multiple purposes. For example a single oligonucleotide can both prime a PCR reaction and attach the resulting PCR product to a solid support. Additional examples of multifunctional primers are discussed in the sections that follow. Finally, the compositions of the invention can be lyophilized, thereby improving the composition's stability.

A. Compositions Comprising Two Oligonucleotides [056] In some embodiments, the composition of the invention can comprise two oligonucleotides. In these embodiments, one oligonucleotide serves two functions, to prime the PCR reaction and link the PCR product to a solid support.
In some embodiments, the other oligonucleotide primes the PCR reaction and labels the PCR product. In some embodiments, the other oligonucleotide serves only one function and primes the PCR reaction while the nucleotides that are incorporated into the PCR product label the PCR product.

[057] An oligonucleotide can be linked to a solid support via a pair of binding partners. In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;

(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if-the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[058] In certain embodiments, the solid support can comprise a bead modified with a first member of a pair of binding partners. In certain embodiments, the bead can be a magnetizable bead. In certain embodiments, the solid support can comprise magnetizable beads that can be modified with a first member of a pair of binding partner. In certain embodiments, the solid support can comprise a bead modified with a first member of a pair of binding partners wherein the first member comprises an oligonucleotide or a polynucleotide. In certain embodiments, the solid support can comprise carboxylated magnetizable beads.

[059] In certain embodiments, the second oligonucleotide can be modified with a second member of the pair of binding partners and either the at least one nucleoside triphosphate or the first oligonucleotide can be modified with at least one electrochemiluminescent moiety, i.e., ECL moiety. The pair of binding partners can permit reversible binding between the second oligonucleotide and the at least one solid support. In some embodiments, the interaction between the first member and the second member of a pair of binding partners is (1) unstable at temperatures used for amplifying DNA, such that the first and second members will not stably bind to each other during the amplification reaction; and (2) stable at or below the temperature used for amplifying DNA. For example, binding between a small number of adenine and thymidine residues is temperature sensitive. In some embodiments, the solid support can be modified with a poly T tail that is 10, 20, 30, 40, or 50 thymidine residues long or any intermediate length. In some embodiments, the oligonucleotide primer can have a poly A tail at its 5'-end that is 10, 20, 30, 40, or 50 adenine residues long or any intermediate length. In other embodiments, the poly A tail can be linked to the solid support and the oligonucleotide primer can have a poly T tail at its 5'-end. In some embodiments, the melting-temperature (Tm) of the poly dA or poly dT tail can be at least 10 C
less than the Tm of the PCR primers used. For example, an oligonucleotide primer can have a poly T tail, wherein the poly T tail has a Tm of 50 C and a collection of beads could have poly A tails that are the same length as the primer poly T tail. This primer and bead could be present together during an amplification reaction such as PCR and not link to each other during amplification because the temperatures used for amplification are higher than 50 C. For example, a PCR cycle could use temperatures of 95 C for melting, 60 C for primer hybridization, and 72 C for polymerization. During these temperatures, the poly T tail of the primer and the poly A tail of the bead do not interact. But once amplification is complete, and the sample cools down to 50 C or less, the poly T
tail of the primer and the poly A tail of the bead can interact, thereby attaching the amplified sequence to the bead.

[060] In some embodiments, the second oligonucleotide can contain one strand of a restriction endonuclease recognition site that is not contained in the target nucleic acid sequence. The solid support can be modified with an oligonucleotide that contains a sufficiently complementary strand of the same endonuclease recognition site. After amplification of the target nucleic acid sequence, one strand of the amplified target can be hybridized to the oligonucleotide linked to the solid support, thereby creating a restriction endonuclease cleavage site. In certain embodiments, the restriction endonuclease cleavage can be cleaved allowing the isolation of the amplified target strand.

[061] An oligonucleotide can also be linked to a solid support via a linker substance. In such embodiments, the linking oligonucleotide is not linked to the solid support until after amplification has occurred. In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least onebuffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein the second oligonucleotide is not linked to the solid support until the target nucleic acid sequence has been amplified, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[062] In some embodiments, the second oligonucleotide and the solid support can be modified with moieties that allow crosslinking to the solid support.
Such moieties can be, for example, photoactivatable crosslinkers known to the art.
In certain embodiments, the solid support can comprise a bead.

[063] In some embodiments, the DNA polymerization reaction is a PCR
reaction. In PCR, two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.

[064] In some embodiments that use two oligonucleotides the first oligonucleotide is modified with an ECL moiety. In some embodiments that use two oligonucleotides, the nucleoside triphosphates are modified with an ECL
moiety.

[065] In a more specific exemplary embodiment, the invention provides a dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;
(f) magnetizable beads covalently linked to the first member of a pair of complementary oligonucleotides;
(g) trehalose;

(h) a first oligonucleotide labeled with [Ru(bpy)3]2+ or [Ru(sulfo-bpy)2bpy]2+ and is capable of hybridizing to a first part of the target nucleic acid sequence; and (i) a second oligonucleotide that is capable of hybridizing to a sequence that is complementary to a second part of the target nucleic acid sequence and comprising the second member of the pair of complementary oligonucleotides.

[066] In certain embodiments, the invention provides a dry composition comprising:
(a) at least one thermostable polymerase;
(b) at least four different nucleoside triphosphates;
(c) at least one salt comprising a monovalent cation;
(d) at least one salt comprising a divalent cation;
(e) at least one buffering agent with an effective buffering capacity in the pH range of 8.1 to 8.5;
(f) at least one solid support comprising a bead modified with a first member of a pair of binding partners;
(g) at least one disaccharide;
(h) a first oligonucleotide capable of binding to a first part of the target nucleic acid sequence; and (i)- a second oligonucleotide capable of binding to a second part of the target nucleic acid sequence and modified with a second member of a pair of binding partners, wherein at least one of (b) the at least four nucleoside triphosphates and (h) the first oligonucleotide is modified with a label.

[067] In certain embodiments, the invention provides a dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;

(f) magnetizable beads modified with a first member of a pair of binding partners;
(g) trehalose;
(h) a first oligonucleotide capable of binding to a first part of the target nucleic acid sequence; and (i) a second oligonucleotide capable of binding to a second part of the target nucleic acid sequence and modified with a second member of a pair of binding partners, wherein at least one of (b) the nucleoside triphosphates and (h) the first oligonucleotide is modified with a label.

[068] Embodiments using two oligonucleotides can be modified to detect, amplify, or isolate multiple target nucleic acid sequences. Such modifications are discussed in greater detail below in the "Multiple Array" section.

B. Compositions Comprising Three Oligonucleotides [069] In some embodiments, the composition of the invention can comprise three oligonucleotides, two which act as primers and a third oligo. In some embodiments, the third oligonucleotide links the PCR product to a solid support._ In some embodiments, the third oligonucleotide is linked to a solid support via a covalent bond. In some embodiments, the third oligonucleotide is reversibly bound to a solid support. For example, the third oligonucleotide can be linked to a solid support via a pair of binding partners. Both of the remaining oligonucleotides prime the PCR reaction. In some embodiments, one of the remaining oligonucleotides also labels the PCR product. In some embodiments, the third oligonucleotide labels the PCR product while one of the two primer oligonucleotides attaches the amplified product to a solid support. In some embodiments, nucleotides that are incorporated into the PCR product label the PCR product.

[070] In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;

(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence (i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of (1) the target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the target nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label;
and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[071] Several moieties can be used to bind the third oligonucleotide to the solid support. In some embodiments, the third oligonucleotide can be linked to the solid support via a pair of binding partners such as those discussed above at paragraphs [058] to [060]. For example, in some embodiments, avidin can bind to biotin before beginning the PCR reaction, in which case the avidin/biotin interaction remains stable throughout the PCR reaction. In some embodiments, the solid support can be coated with avidin while the third oligonucleotide can be biotinylated. In some embodiments, the solid support can be coated with streptavidin while the third oligonucleotide can be biotinylated. For example, in some embodiments, the solid support can be coated with anti-DNP antibodies while the third oligonucleotide can comprise DNP. In some embodiments, the solid support can be coated with anti-fluorescein antibodies while the third oligonucleotide comprises fluorescein.

[072] In some embodiments, the third oligonucleotide can be covalently bound to the solid support, for example, by synthesizing oligonucleotides with a primary amine at the 5' end and reacting those oligonucleotides with carboxylated magnetizable beads. In some embodiments, the third oligonucleotide can be covalently attached to the surface of the solid support by a variety of well-known chemistries, such as carbodiimide coupling (see, e.g., Katz et. al., 1994, J.
Electroanal. Chem. 367:59; Narvaez et a(., 1997, J. Electroanal. Chem.
430:227) or maleimide reactions (see, e.g., Marty et al. 2004, CMLS Cellular and Molecular Life Sci. 61:1785).

[073] In some embodiments, the third oligonucleotide can be linked to the solid support by a cleavable linkage, thus providing a means of separating the target sequence from the solid support after the complex comprising the target sequence, the third oligonucleotide and the solid support has been isolated.
Cleavage of the linkage between the third oligonucleotide and the solid support can be achieved using enzymatic, photolytic or chemical means. Examples of suitable chemically cleavable groups can be, but are not limited to, dialkoxysilane, disulfide, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, and ribose.
Dialkoxysilane can be cleaved -with fluoride ion. Disulfide bonds can be cleaved with reducing agents such as dithiothreitol. Phosphorothioate internucleotide linkage can be selectively cleaved under mild oxidative conditions. Selective cleavage of ribose linkages can be carried out by treatment with dilute ammonium hydroxide. Suitable enzyme cleavable sites can be nucleotides cleavable by glycosylases or nucleases. A DNA glycosylase can be uracil-DNA glycosylase.
In this method, a uracil can be synthetically incorporated in a polynucleotide, replacing a thymidine. The uracil can be site-specifically removed by treatment with uracil DNA glycosylase. The cleavable site can also be a restriction endonuclease cleavable site, such as class Ils restriction enzymes. Examples include Bpml, Bsgl, BseRl, BsmFl, and Fokl recognition. The sequence of the third oligonucleotide can be selected so that it incorporates a restriction endonuclease site present in the target sequence and after binding of the amplified target to the third oligonucleotide, can be subsequently cleaved to release the linked polynucleotide. The sequences of these and other restriction enzyme sites have been described in the art. See New England BioLabs Catalog (New England Biolabs, Beverly, MA).

[074] The third oligonucleotide can also be cleaved from the solid support using a photocleavable linker, such as ortho-nitrobenzyl class of photocleavable linkers. Photocleavable linkers can be, for example, hydroxymethyl, hydroxyethyl, and Fmoc-aminoethyl carboxylic acid.

[075] The skilled artisan will understand that the third oligonucleotide need not be linked to the at least one solid support before reaching the end-user as long as the end-user links the third oligonucleotide to the at least one solid support prior to starting the PCR reaction, for example, using photoactivatable crosslinkers which can be present in the composition as supplied.

[076] In certain embodiments, the third oligonucleotide can be linked to a magnetizable bead, providing a means for isolating and/or detecting a target nucleic acid sequence. The complex comprising the oligonucleotide linked to the magnetizable bead and the target sequence can be isolated by subjecting the complex to a magnetic field.

[077] In certain embodiments that use three oligonucleotides, the third oligonucleotide can bind to a nucleic acid sequence that overlaps, at least partially, with a nucleic acid sequence that can bind to the first oligonucleotide, the second oligonucleotide or both the first and second oligonucleotides.

[078] Embodiments using three oligonucleotides can be modified to detect, amplify, or isolate multiple target nucleic acid sequences. Such modifications are discussed in greater detail below in the "Multiple Array" section.

[079] In some embodiments that use three oligonucleotides, at least one of the first oligonucleotide and the second oligonucleotide is modified with an ECL
moiety. In some embodiments that use three oligonucleotides, the nucleoside triphosphates are modified with an ECL moiety.

[080] In certain embodiments, the first and second oligonucleotides can serve as primers in a DNA polymerization reaction. In some embodiments, the DNA polymerization reaction is a PCR reaction. In PCR, two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.

[081] The following embodiment provides a composition that comprises particular examples of the components of the composition. For example, a polymerase such as Taq polymerase, a monovalent cation such as potassium chloride, a divalent cation such as magnesium chloride, biotin as a linking substance and so forth. In some embodiments, the invention provides a dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;
(f) magnetizable beads coated with avidin or streptavidin ;
(g) trehalose;
(h) a first oligonucleotide capable of hybridizing to a first part of a target nucleic acid sequence and labeled with [Ru(bpy)3]2+ or [Ru(sulfo-bpy)2bpy]2+;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide, wherein the third oligonucleotide is biotinylated and is capable of hybridizing to a third part of the target nucleic acid sequence or to a nucleic acid sequence complementary to the target nucleic acid sequence.

[082] Some embodiments can use a primary amine as a lining agent. In some embodiments, the invention provides a dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;

(d) magnesium chloride;
(e) Tris-HCI;
(f) carboxylated magnetizable beads;
(g) trehalose;
(h) a first oligonucleotide capable of hybridizing to a first part of a target nucleic acid sequence and labeled with [Ru(bpy)3]2+ or [Ru(sulfo-bpY)2bpY]2+;
(i) a second oligonucleotide, capable of hybridizing with a nucleic acid sequence complementary to a second part of a target nucleic acid sequence; and (j) a third oligonucleotide linked to the carboxylated magnetizable beads through a primary amine at the 5' end, wherein in the third oligonucleotide is capable of hybridizing to a third part of the target nucleic acid sequence or to a nucleic acid sequence complementary to the target nucleic acid sequence.

[083] In certain embodiments, the invention provides a dry composition comprising:
a - at least one thermostable polymerase;
(b) at least four different nucleoside triphosphates;
(c) at least one salt comprising a monovalent cation;
(d) at least one salt comprising a divalent cation;
(e) at least one buffering agent with an effective buffering capacity in the pH range of 8.1 to 8.5;
(f) at least one solid support;
(g) at least one disaccharide;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing to a third part of a target nucleic acid sequence;

wherein at least one of the at least four nucleoside triphosphates, the first oligonucleotide, and second oligonucleotide is modified with an ECL moiety.

C. Compositions for Multiple Arrays [084] In some embodiments, the invention can be used to detect, amplify, and/or isolate multiple target nucleic acid sequences. When multiple target nucleic acid sequences are detected, oligonucleotides that are sufficiently complementary to each target nucleic acid sequence are linked to discrete sections of a solid support. Oligonucleotides can be linked to discrete sections of a solid support via the linking agents discussed above in paragraphs [058] to [060], [062], and [071] to [073]. For example, each unique oligonucleotide can be linked to a solid support by a unique pair of binding partners, where one of the binding partners is attached to a discrete location on the solid support. Or each unique oligonucleotide can be linked to a solid support at different discrete locations. The multiple target nucleic acid sequences can be multiple sequences from one organism or target nucleic acid sequences from multiple organisms. In some embodiments involving multiple target nucleic acid sequences, the solid support can be a planar structure with discrete areas arranged to capture different targets. In some embodiments, each target nucleic acid sequence can have a different first oligonucleotide; second oligonucleotide; if present, third oligonucleotide; and if present, pair of binding partners. For example, each discrete area can be linked to differing third oligonucleotides in order to detect different target sequences. This multiple array can be used with the two oligonucleotide format as discussed above in Section II.A. In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating N
target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;

(f) at least one solid support comprising N discrete areas, wherein the ith discrete area is modified with an it" first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing to a first part of the ith target nucleic acid sequence or a sequence that is complementary to the it" target nucleic acid sequence; and (i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing to a second part of the ith target nucleic acid sequence or a sequence that is complementary to the ith target nucleic acid sequence and comprises an ith second member of the pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith represents in turn all integers between I and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is -modified with a label; wherein if the-first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[085] This multiple array can also be used with the three oligonucleotide format as discussed above in Section II.B. In some embodiments, the invention provides a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;

(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is capable of hybridizing with a first part of the ith target nucleic acid sequence;
(i) N second oligonucleotides, wherein the ith second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the ith target nucleic acid sequence; and Q) N third oligonucleotides, wherein the ith third oligonucleotide is linked to the ith discrete area on the at least one solid support and is capable of hybridizing with a third part of (1) the it" target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the itn target nucleic acid sequence;
wherein N is a integer greater than or equal to 1; wherein it" represents in turn all integers between I and N, including both 1 and N, and is used to designate -target-nucleic-acid-specific elements-of the composition; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the ith first oligonucleotide, and (i) the ith second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement.

[086] In certain embodiments, the first and second oligonucleotides can serve as primers in a DNA polymerization reaction. In some embodiments, the DNA polymerization reaction is a PCR reaction. In PCR, two primers that hybridize to a sufficiently complementary member of a specific DNA sequence can be used, thus facilitating the initiation of DNA synthesis by the polymerase.

D. General Aspects of the Compositions of the Invention [087] All of the embodiments discussed in Sections II.A-C above share several features in common such as, for example, the source from which a sample can be prepared, types of oligonucleotides used, types of labels used, PCR reaction conditions, and the types of solid supports used. These common aspects of the compositions of the invention are discussed in the following section.
1. Samples [088] A sample can comprise DNA, RNA, or a mixture thereof. The sample can be a biological sample. The sample can be derived from an in vitro chemical synthesis of nucleic acid molecules. The sample can also be prepared from an organism that contains nucleic acids. Such organisms can be, for example, bacteria, viruses, protozoa, worms, fungi, invertebrate animals, and vertebrate animals.

[089] In certain embodiments, target nucleic acid sequences can be found in pathogenic bacteria such as: Aeromonas hydrophila and other spp.; Bacillus anthracis; Bacillus cereus; Botulinum neurotoxin producing species of Clostridium;
Brucella abortus; Brucella melitensis; Brucella suis; Burkholderia mallei (formally Pseudomonas mallei); Burkholderia pseudomallei (formerly Pseudomonas pseudomallei); Campylobacterjejuni; Chlamydia psittaci; Clostridium botulinum;
Clostridium botulinum; Clostridium perfringens; Coccidioides immitis;
Coccidioides posa asii; Cowdria ruminantium (Heartwater); Coxiella burnetii; Enterovirulent Escherichia coli group (EEC Group) such as Escherichia coli - enterotoxigenic (ETEC), Escherichia coli - enteropathogenic (EPEC), Escherichia coli - 0157:H7 enterohemorrhagic (EHEC), and Escherichia coli - enteroinvasive (EIEC);
Ehrlichia spp. such as Ehrlichia chaffeensis; Francisella tularensis;
Legionella pneumophilia; Liberobacter africanus; Liberobacter asiaticus; Listeria monocytogenes; miscellaneous enterics such as Klebsiella, Enterobacter, Proteus, Citrobacter, Aerobacter, Providencia, and Serratia; Mycobacterium bovis;
Mycobacterium tuberculosis; Mycoplasma capricolum; Mycoplasma mycoides mycoides; Peronosclerospora philippinensis; Phakopsora pachyrhizi; Plesiomonas shigelloides; Ralstonia solanacearum race 3, biovar 2; Rickettsia prowazekii;
Rickettsia rickettsii; Salmonella spp; Schlerophthora rayssiae var zeae;
Shigella spp.; Staphylococcus aureus; Staphylococcus aureus; Streptococcus;
Synchytrium endobioticum; Vibrio cholerae non-O 1; Vibrio cholerae 01; Vibrio parahaemolyticus and other vibrios species; Vibrio vulnificus; Xanthomonas oryzae; Xylella fastidiosa (citrus variegated chlorosis strain); Yersinia enterocolitica and Yersinia pseudotuberculosis; and Yersinia pestis. In certain embodiments, target nucleic acid sequences can be found in non-pathogenic bacteria.

[090] In certain embodiments, target nucleic acid sequences can be found in viruses belonging to the families Adenoviridae, Arenaviridae, Arterivirus, Astroviridae, Baculoviridae, Badnavirus, Barnaviridae, Birnaviridae, Bromoviridae, Bunyaviridae, Caliciviridae, Capillovirus, Carlavirus, Caulimovirus, Circoviridae, Closterovirus, Comoviridae, Coronaviridae, Corticoviridae, Cystoviridae, Deltavirus, Dianthovirus, Enamovirus, Filoviridae, Flaviviridae, Furovirus, Fuselloviridae, Geminiviridae, Hepadnaviridae, Herpesviridae, Hordeivirus, Hypoviridae, Idaeovirus, Inoviridae, Iridoviridae, Leviviridae, Lipothrixviridae, Luteovirus, Machlomovirus, Marafivirus, Microviridae, Myoviridae, Necrovirus, Nodaviridae, Orthomyxoviridae, Paramyxoviridae, Partitiviridae, Parvoviridae, Phycodnaviridae, Plasmaviridae, Podoviridae, Polydnaviridae, Potexvirus, Potyviridae, Poxviridae, Reoviridae, Retroviridae, Rhabdoviridae, Rhizidiovirus, Sequiviridae, Siphoviridae, Sobemovirus, Tectiviridae, Tenuivirus, Tetraviridae, Tobamovirus, Tobravirus, Togaviridae, -Tombusviridae, Totiviridae, Tymovirus, and Umbravirus.

[091] Examples of such viruses can include, but are not limited to, African horse sickness virus; African swine fever virus; Akabane virus; Avian influenza virus (highly pathogenic); Bhanja virus; Blue tongue virus (Exotic); Camel pox virus; Cercopithecine herpesvirus 1; Chikungunya virus; Classical swine fever virus; Coronavirus (SARS); Crimean-Congo hemorrhagic fever virus; Dengue viruses; Dugbe virus; Ebola viruses; Encephalitic viruses such as Eastern equine encephalitis virus, Japanese encephalitis virus, Murray Valley encephalitis, and Venezuelan equine encephalitis virus; Equine morbillivirus; Flexal virus; Foot and mouth disease virus; Germiston virus; Goat pox virus; Hantaan or other Hanta viruses; Hendra virus; lssyk-kul virus; Koutango virus; Lassa fever virus;
Louping ill virus; Lumpy skin disease virus; Lymphocytic choriomeningitis virus;
Malignant catarrhal fever virus (Exotic); Marburg virus; Mayaro virus; Menangle virus;
Monkeypox virus; Mucambo virus; Newcastle disease virus (VVND); Nipah Virus;

Norwalk virus group; Oropouche virus; Orungo virus; Peste Des Petits Ruminants virus; Piry virus; Plum Pox Potyvirus; Poliovirus; Potato virus; Powassan virus; Rift Valley fever virus; Rinderpest virus; Rotavirus; Semliki Forest virus; Sheep pox virus; South American hemorrhagic fever viruses such as Flexal, Guanarito, Junin, Machupo, and Sabia; Spondweni virus; Swine vesicular disease virus; Tick-borne encephalitis complex (flavi) viruses such as Central European tick-borne encephalitis, Far Eastern tick-borne encephalitis, Russian spring and summer encephalitis, Kyasanur forest disease, and Omsk hemorrhagic fever; Variola major virus (Smallpox virus); Variola minor virus (Alastrim); Vesicular stomatitis virus (Exotic); Wesselbron virus; West Nile virus; Yellow fever virus; South American hemorrhagic fever viruses such as Junin, Machupo, Sabia, Flexal, and Guanarito; viruses from the family papovaviridae, including polyomaviruses such as SV40, JC and BK and including papillomaviruses (e.g., HPV); parvoviruses (e.g., B19 and RA-1; viruses from the family Picornaviridae, including rhinoviruses.

[092] In certain embodiments, target nucleic acid sequences can be found in parasitic protozoa and worms, such as: Acanthamoeba and other free-living amoebae; Anisakis sp. -and-other related- worms Ascaris lumbricoides and Trichuris trichiura; Cryptosporidium parvum; Cyclospora cayetanensis;
Diphyllobothrium spp.; Entamoeba histolytica; Eustrongylides sp.; Giardia lamblia;
Nanophyetus spp.; Shistosoma spp.; Toxoplasma gondii; and Trichinella.

[093] In certain embodiments, target nucleic acid sequences can be found in fungi such as: Aspergillus spp.; Blastomyces dermatitidis; Candida;
Coccidioides immitis; Coccidiodes posadasil; Cryptococcus neoformans;
Histoplasma capsulatum; Maize rust; Rice blast; Rice brown spot disease; Rye blast; Sporothrix schenckii; and wheat fungus.

[094] In certain embodiments, target nucleic acid sequences can be found in invertebrate animals and vertebrate animals such as mammals, including but not limited to, humans. In certain embodiments, target nucleic acid sequences can be found in plants. In certain embodiments, target nucleic acid sequences can be found in species from the domain Archaea.

2. Polynucleotides and Oligonucleotides [095] The invention provides compositions for detecting, amplifying, and/or isolating target nucleic acid sequences from a sample. In some embodiments, target nucleic acid sequences can be polynucleotides. Polynucleotides can vary in length. For example, a polynucleotide can be 100 to 2000 nucleotides long.
A
polynucleotide can be 100 to 1500 nucleotides long. A polynucleotide can be to 1000 nucleotides long. A polynucleotide can be 100 to 500 nucleotides long.
A
polynucleotide can be 100 to 200 nucleotides long. In some embodiments, conditions suitable for target sequence amplification can be 72 C. In some embodiments, conditions suitable for target sequence amplification can be 41 C.
One skilled in the art can readily identify other temperatures suitable for target amplification.

[096] In some embodiments, the composition of the invention can contain oligonucleotides. An oligonucleotide can be 10 to 100 nucleotides long. An oligonucleotide can be 10 to 90 nucleotides long. An oligonucleotide can be 10 to 70 nucleotides long. An oligonucleotide can be 10 to 50 nucleotides long. An oligonucleotide can be 10 to 40 nucleotides long. An oligonucleotide can be 10 to 30 nucleotides long: An oligonUcleotide can be 10 to 20 nucleotides long. In some embodiments, an oligonucleotide can comprise a poly A tail. In some embodiments, an oligonucleotide can comprise a poly T tail. In some embodiments, an oligonucleotide can be a poly A oligonucleotide. In some embodiments, an oligonucleotide can be a poly T oligonucleotide.

[097] In some embodiments, oligonucleotides can be primers. Bases in an oligonucleotide primer can be joined by a phosphodiester bond or by a linkage other than a phosphodiester bond, so long as the linkage does not prevent hybridization to a part of the target nucleic acid sequence. For example, oligonucleotide primers can have constituent bases joined by peptide bonds rather than phosphodiester linkages. In some embodiments, a primer can be prepared to be sufficiently complementary to a target nucleic acid sequence. Exact complementarity is not necessary to achieve hybridization in a particular set of conditions. Factors including the length of a sequence, the number of G and C
residues the sequence has, the salt concentration of the hybridization reaction, and the temperature of the hybridization reaction can determine how much nucleotide mismatching can be present and still result in hybridization between two sequences. Appropriate hybridization conditions can be selected by those skilled in the art with minimal experimentation as exemplified in Dieffenbach, C.W
and Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold Spring Harbor, USA or PCR Protocols: A Guide to Methods and Applications, Innis, M.A. et al. eds., Academic Press, San Diego, USA 1990.

[098] In certain embodiments, primers can comprise nucleotides, modified nucieotides, or nucleic acid analogs. A nucleotide can be used as a building block to form a polynucleotide. Nitrogenous bases can be, but are not limited to, cytosine, guanine, adenine, thymidine, uracil, and inosine. Nucleoside triphosphates can be, but are not limited to, deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), deoxyuraci( triphosphate (dUTP), and deoxyinosine triphosphate (dITP), 7-deaza-dGTP, 2-aza-dATP, and N4-methyl-dCTP. Non-limiting examples of modified nucleotides can be: 5-propynyl-uracil, thio-5-propynyl-uracil, 5-methyicytosine, pseudoisocytosine, 2-thiouracil and thiothymine, 2-aminopurine, N9-(2-amino-6-chloropurine), N9-(2,6-diaminopurine), hypoxanthine, N9-(7-deaza-guanine), N9-(7-deaza-8-aza-guanine) and N8-(7-deaza-8-aza-adenine). Nucleic acid analogs can be, but are not limited to, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or any derivatized form of a nucleic acid.

[099] In some embodiments, the composition can contain at least four different nucleoside triphosphates. In some embodiments, the at least four different nucleoside triphosphates can be deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), and deoxythymidine 5'-triphosphate (dTTP).
3. Labels [0100] Several types of labels can be used in the composition of the invention. In certain embodiments, at least one of the oligonucleotides or nucleoside triphosphates can be modified with a label. Labels can be, but are not limited to, fluorophores, haptens, luminescent labels, radioactive labels, electrochemiluminescent moieties (i.e., ECL moieties), quantum dots, beads, aminohexyl, pyrene, metal particles, spin labels, enzymes, and dyes. Examples of directly detectable labels include, but are not limited to, ECL moieties, fluorophores, and enzymatic labels. Examples of indirectly detectable labels include, but are not limited to, haptens, enzymes, and biotin. Labels also include molecular beacons (i.e., a conformation-sensitive label attached to a hairpin loop-containing o(igonucleotide) as described, for example, in Kostrikis, L. et al., Science 279:1228-29 1998 and in Tyagi, S. et al., Nat. Biotechnol. 16:49-52 1998. In some embodiments, a label can reduce a detectable signal. For example, a label can be a substance that quenches or reduces the detectable signal emitted by a detectable substance. In some embodiments, a label can be an ECL quencher, such that when the quencher is present as a result of target nucleic acid amplification, an ECL signal is reduced. For example, an ECL
moiety can be associated with a bead so when a PCR product containing the quencher is linked to the bead, the ECL signal is reduced. Reduction of signal can be detected by comparing the signal from beads with an ECL moiety to beads with the ECL moiety that have participated in an amplification reaction. Examples of quenchers include, but-are-not limited-to, methylviologen carboxylate, compounds comprising at least one benzene moiety, and, more particularly, compounds comprising at least one phenol moiety, quinone moiety, benzene carboxylic acid, and/or benzene carboxylate moiety.

[0101] Examples of quenching agents which comprise at least one phenol moiety, and from which quenching moieties comprising at least one phenol moiety may be derived, include, but are not limited to phenol; alkyl-phenois (such as C1_6 alkyl-phenois including o-alkyl-phenol, m-alkyl-phenol, and p-alkyl-phenol, such as o-methyl-phenol (i.e., o-cresol), m-methyl-phenol (i.e., m-cresol), p-methyl-phenol (i.e., o-cresol), o-ethyl-phenol, m-ethyl-phenol, p-ethyl-phenol, o-propyl-phenol, m-propyl-phenol, and p-propyl-phenol); aryl-phenols (such as C7_10 aryl-phenols, including o-aryl-phenol, m-aryl-phenol, and p-aryl-phenol, such as p-phenyl-phenol); halo-phenois (such as o-halo-phenol, m-halo-phenol, and p-halo-phenol, such as o-fluoro-phenol, m-fluoro-phenol, and p-fluoro-phenol); hydroxy-phenois (such as o-hydroxy-phenol (i.e., catechol), m-hydroxy-phenol (i.e., resorcinol), and p-hydroxy-phenol (i.e., hydroxyquinone)); and biphenols (such as 4,4'-biphenol).

[0102] Examples of quenching agents which comprise at least one quinone moiety and from which quenching moieties comprising at least one quinone moiety may be derived, include, but are not limited to, quinones (i.e., benzoquinones), such as o-quinone (i.e., 1,2-benzoquinone) and p-quinone (i.e., 1,4-benzoquinone); alkyl-quinones, such as C1_6 alkyl-quinones including C1_6 alkyl-1,4-benzoquinones, such as 2-methyl-1,4-benzoquinone, 2-ethyl-1,4-benzoquinone, 2-n-propyl-1,4-benzoquinone, 2,6-dimethyl-1,4-benzoquinone, and 2,5-dimethyl-1,4-benzoquinone; halo-quinones, such as halo-1,4-benzoquinones, including 2-fluoro- 1,4-benzoquinone, 2-chloro-1,4-benzoquinone, 2-bromo-1,4-benzoquinone, 2-iodo-1,4-benzoquinone, 2,6-difluoro-1,4-benzoquinone, 2,5-difluoro- 1,4-benzoquinone; 2,6-dichloro-1,4-benzoquinone, 2,5-dichloro-1,4-benzoquinone; 2,6-dibromo-1,4-benzoquinone, and 2,5-dibromo-1,4-benzoquinone; naphthoquinones, such as 1,2-napththoquinones and 1,4-naphthoquinones, including 2-methoxy-3-methyl-1,4-naphthoquinone;
anthraquinones, such as 1,2-anthraquinones, 1,4-anthraquinones, 9,10-anthraquinones, including 1-;5-dihydr-oxy-9,10-anthraquinone, 1,2,3,4-tetrafluoro-5,8-dihydroxy-9,10-anthraquinone, 9,1 0-anthraquinone-2-carboxylic acid, 9,10-anthraquinone-2-sulfonic acid, 9,1 0-anthraquinone-1,5-disulfonic acid, and 9,10-anthraquinone-2,6-disulfonic acid. Quinone and its derivatives may usually be chemically modified to possess reactive groups (i.e., to form chemically activated species). For example, on one or more reactive groups may be attached (e.g., at the ortho- or meta-positions of 1,4-benzoquinone) optionally via a linker group, which then permits the attachment of the quinone-like moiety (as a quenching moiety) to other molecules. For example, a 1,4-benzoquinone may be derivatized to possess a carboxylic acid group (i.e., -COOH) attached to an ortho- or meta-carbon via a linker group, such as an alkyl group. Such a compound is 2-(1-carboxy-but-2-yl)-5-methyl-1,4-benzoquinone. This carboxylic acid derivative may be derivatized to form the N-succinimidyl ester (shown below), which permits the easy attachment of the quinone-like quenching moiety to molecules which possess, for example, an amino group.

O O
O
\N

O O

[0103] Examples of quenching agents which comprise at least one benzene carboxylic acid or benzene carboxylate moiety, and from which quenching moieties comprising at least one benzene carboxylic acid or benzene carboxylate moiety may be derived, include, but are not limited to benzoic acid;
aminobenzoic acids, such as o-aminophenol, m-aminophenol, and p-aminophenol;
hydroxybenzoic acids, such as o-hydroxyphenol, m-hydroxyphenol, and p-hydroxyphenoi; and nitrobenzoic acids, such as o-nitrophenol, m-nitrophenol, and p-nitrophenol.

[0104] Fluorophores can be, but are not limited to, 5(6)-carboxyfluorescein, 5- or 6-carboxyfluorescein, 6-(fluorescein)-5-(and 6)-carboxamido hexanoic acid, fluorescein (i.e., FITC), rhodamine, tetramethyirhodamine, cyanine dyes (i.e., Cy2, Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7), phycoerythrine, conjugates of R-phycoerythrin, conjugates of allophycoerythrin, cascade blue, Oregon green 488, pacific blue, -rhodamine green, optionally substituted coumarin, AMCA, (diethyl-amino)coumarin, PerCP, phycobiliproteins, R-phycoerythrin (RPE), allophycoerythrin (APC), Texas Red, Princeton Red, IR dyes, Dyomics (Jena, Gremany) dyes, tetramethylrhodamine, lissamine, TRITC, and Alexa dyes.
Fluorophores can also include inorganic fluorophores such as particles based on semiconductor material like coated CdSe nanocrystallites. See, for example, the Dynomics catalogue of Fluorescent Dyes for Bioanalytical and Hightech Applications (4th edition, 2005) and The Handbook - A Guide to Fluorescent Probes and Labeling Technologies (10th edition, Invitrogen, Carlsbad, CA, USA).

[0105] Labels can be haptens or antigens including, but not limited to, dinitrophenyl (DNP), fluorescein isothiocyanate (FITC), 5(6)-carboxyfluorescein, 2,4-dinitrophenyl, digoxigenin, rhodamine, bromodeoxy uridine, acetylaminofluorene, mercury trinitrophenol, estradiol, and biotin.

[0106] Luminescent labels can be, but are not limited to, luminol, isoluminol, acridinium esters, acridinedione 1,2-dioxetanes, pyridopyridazines, green fluorescent protein (GFP), GFP analogues, reef coral fluorescent proteins (RCFPs), and RCFP analogues.

[0107] Radioactive labels can be, but are not limited to, radioactive isotopes of carbon such as'4C, radioactive isotopes of hydrogen such as 3H, radioactive isotopes of phosphorous such as 32P, and radioactive isotopes of sulfur such as 355..

[0108] For example, radioactive nucleoside triphosphates are commercially available from a variety of sources such as New England Nuclear, Boston, MA.
Other examples of nucleoside triphosphates that can be modified with a label include 5-(3-aminoallyl)-dUTP, and 5-[3-(E)-(4-azido-2,3,5,6-tetrafluorobenzamido)propenyl-1 ]-2'-deoxyu rid ine-5'-triphosphate.
4. ECL Labels [0109] In certain embodiments, the label can comprise an ECL moiety. ECL
moieties can be transition metals. For example, the ECL moiety can comprise a metal-containing organic compound wherein the metal can be chosen, for example, from ruthenium, osmium, rhenium, iridium, rhodium, platinum, palladium, molybdenum, and technetium. For example, the metal can be ruthenium or osmium. For example, the ECL moiety can be a ruthenium chelate or an osmium chelate. For example, the ECL moiety can comprise bis(2,2'-bipyridyl)ruthenium(II) and tris(2,2'-bipyridyl)ruthenium(II). For example, the ECL
moiety can be ruthenium (11) tris bipyridine ([Ru(bpy)3]2+). The metal can also be chosen, for example, from rare earth metals, including but not limited to cerium, dysprosium, erbium, europium, gadolinium, holmium, lanthanum, lutetium, neodymium, praseodymium, promethium, terbium, thulium, and ytterbium. For example, the metal can be cerium, europium, terbium, or ytterbium.

[0110] Metal-containing ECL moieties can have the formula M(P)m (L1)n (L2)0 (L3)p (L4)q (L5)r (L6)s wherein M is a metal; P is a polydentate ligand of M; L1, L2, L3, L4, L5 and L6 is ligands of M, each of which can be the same as, or different from, each other;
m is an integer equal to or greater than 1; each of n, o, p, q, r and s is an integer equal to or greater than zero; and P, L1, L2, L3, L4, L5 and L6 are of such composition and number that the ECL moiety can be induced to emit electromagnetic radiation and the total number of bonds to M provided by the ligands of M equals the coordination number of M. For example, M can be ruthenium. For example, M
can be osmium.

[0111] Some examples of the ECL moiety can have one polydentate ligand of M. The ECL moiety can also have more than one polydentate ligand. In examples comprising more than one polydentate ligand of M, the polydentate ligands can be the same or different. Polydentate ligands can be aromatic or aliphatic ligands. Suitable aromatic polydentate ligands can be aromatic heterocyclic ligands and can be nitrogen-containing, such as, for example, bipyridyl, bipyrazyl, terpyridyl, 1,10 phenanthroline, and porphyrins.

[0112] Suitable polydentate ligands can be unsubstituted, or substituted by any of a large number of substituents known to the art. Suitable substituents include, but are not limited to, alkyl, substituted alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate, carboxaldehyde, carboxamide, cyano, amino, hydroxy, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidinium, ureide, maleimide-sulfur-containing groups, phosphorus containing groups, and the carboxylate ester of N-hydroxysuccinimide.

[0113] In some embodiments, at least one of LI, L2, L3, L4, L5 and L6 can be a polydentate aromatic heterocyclic ligand. For example, at least one of these polydentate aromatic heterocyclic ligands can contain nitrogen. Suitable polydentate ligands can be, but are not limited to, bipyridyl, bipyrazyl, terpyridyl, 1,10 phenanthroline, a porphyrin, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl, substituted 1,10 phenanthroline or a substituted porphyrin.
These substituted polydentate ligands can be substituted with an alkyl, substituted alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate, carboxaldehyde, carboxamide, cyano, amino, hydroxy, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidinium, ureide, maleimide a sulfur-containing group, a phosphorus-containing group or the carboxylate ester of N-hydroxysuccinimide.

[0114] Some examples of the ECL moiety can contain two bidentate ligands, each of which can be bipyridyl, bipyrazyl, terpyridyl, 1,10 phenanthroline, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or substituted 1,10 phenanthroline.

[0115] Some examples of the ECL moiety can contain three bidentate ligands, each of which can be bipyridyl, bipyrazyl, terpyridyl, 1,10-phenanthroline, substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or substituted 1,10-phenanthroline. For example, the ECL moiety can comprise ruthenium, two bidentate bipyridyl ligands, and one substituted bidentate bipyridyl ligand.
For example, the ECL moiety can contain a tetradentate ligand such as a porphyrin or substituted porphyrin.

[0116] For example, the ECL moiety can have one or more monodentate ligands, a wide variety of which are known to the art. Suitable monodentate ligands can be, for example, carbon monoxide, cyanides, isocyanides, halides, and aliphatic, aromatic and heterocyclic phosphines, amines, stibines, and arsines.

[0117] For example, one or more of the ligands of M can be attached to additional chemical labels, such as, for example, radioactive-isotopes,-fluorescent components, or additional luminescent ruthenium- or osmium-containing centers.

[0118] For example, the ECL moiety can be tris(2,2'-bipyridyl)ruthenium(II) tetrakis(pentafluorophenyl)borate. For example, the ECL moiety can be bis[(4,4'-carbomethoxy)-2,2'-bipyridine] 2-[3-(4-methyl-2,2'-bipyridine-4-yl)propyl]-1,3-dioxolane ruthenium (II). For example, the ECL moiety can be bis(2,2'bipyridine) [4-(butan-1 -al)-4'-methyl-2,2'-bipyrid ine] ruthenium (II). For example, the ECL
moiety can be bis(2,2'-bipyridine) [4-(4'-methyl-2,2',bipyridine-4'-yi)-butyric acid]ruthenium (II). For example, the ECL moiety can be (2,2'-bipyridine)[cis-bis(1,2-diphenylphosphino)ethylene]{2-[3-(4-methyl- 2,2'-bipyridine-4'-yl)propyl]-1,3-dioxolane}osmium (li). For example, the ECL moiety can be bis(2,2'-bipyridine) [4-(4'-methyl-2,2'-bipyridine)-butylamine]ruthenium (ll). For example, the ECL moiety can be bis(2,2'-bipyridine) [1-bromo-4(4'-methyl-2,2'-bipyridine-4-yl)butane]ruthenium (II). For example, the ECL moiety can be bis(2,2'-_Ipynaine)maleimiaonexanoic acid, 4-methyl-2,2'-bipyridine-4'-butylamide ruthenium (II).

[0119] In some embodiments, the ECL moiety comprises a metal ion chosen from osmium and ruthenium or a derivative of trisbipyridyl ruthenium (II) [Ru(bpy)32+]. For example, the ECL moiety can be [Ru(sulfo-bpy)2bpy]2+ whose structure is S03' W

I \ N i SO3Na I ,.N
~Ru(II) N N

N

NaO3S

wherein W is a functional group attached to the ECL moiety that can react with a biological material, binding reagent, enzyme substrate or other assay reagent so as to form a covalent linkage such as an NHS ester,an activated carboxyl, an amino group, a hydroxyl group, a carboxyl group, a hydrazide, a maleimide, or a phosphoramidite.

[0120] In some examples of ECL moieties, the moiety does not comprise a metal. Such non-metal ECL moieties can be, but are not limited to, rubrene and 9,10-diphenylanthracene.

[0121] Preparation of primers comprising ECL moieties is well known in the art, as described, for example, in U.S. Patent 6,174,709. In certain embodiments, the label can be attached to the 5' end or to the 3' end of an oligonucleotide primer. In certain embodiments, the label can be incorporated directly into an oligonucleotide primer. Primers can be labeled at an amino group introduced during synthesis, or can be labeled directly during synthesis using, e.g., tag NHS
and tag phosphoramidite, respectively, where the tag can be an ECL moiety. In some embodiments, the tag comprises a fluorophore, hapten, enzymatic label, or a luminescent label. Likewise, fluorescently labeled nucleoside triphosphates can be used to produce oligonucleotides. High throughput, automated, synthesis of oligonucleotides modified with a variety of labels, including fluorophores and biotin, has been described. See Andrus, et al., 1997, Nucleic Acid Symp. Ser.
37:317. In addition, methods of modifying oligonucleotides with detectable transition metals including ruthenium, osmium, iron, rhodium, copper, and ferrocene have been described (see, e.g., Meade et al., 1995, Chem. Int. Engl.
34:352; (hara et al., 1997, Chem. Commun. 1609; Holmin et al., 1999, Inorg.
Chem. 38:174; Hall et al., 1997, J. Am. Chem. Soc. 119:5045; Bashkin et al., 1994, J. Am. Chem. Soc. 116:5981; Yu et al., 2000, J. Am. Chem. Soc.

122:6767).
5. ECL Coreactants [0122] In some embodiments, the composition comprises an ECL coreactant.
In some embodiments, coreactants can be chemical compounds which, upon electrochemical oxidation / reduction, yield, either directly or upon further reaction, strong oxidizing or reducing species in solution. A coreactant can be peroxodisulfate (i.e., S2082-, persulfate) which is irreversibly electro-reduced to form oxidizing S04-- ions. The coreactant can also be oxalate (i.e., C2042-) which is irreversibly electro-oxidized to form reducing C02-- ions. A class of coreactants that can act as reducing agents is amines or compounds containing amine groups, including, for example, tri-n-propylamine (i.e., N(CH2CH2CH2)3, TPA).
In some embodiments, tertiary amines can be better coreactants than secondary amines. In some embodiments, secondary amines can be better coreactants than primary amines.

[0123] Coreactants include, but are not limited to, lincomycin; clindamycin-2-phosphate; erythromycin; 1-methylpyrrolidone; diphenidol; atropine; trazodone;
hydroflumethiazide; hydrochlorothiazide; clindamycin; tetracycline;
streptomycin;
gentamicin; reserpine; trimethylamine; tri-n-butylphosphine; piperidine; N,N-dimethylaniline; pheniramine; bromopheniramine; chloropheniramine;
diphenylhydramine; 2-dimethylaminopyridine; pyrilamine; 2-benzylaminopyridine;
leucine; valine; glutamic acid; phenylaianine; alanine; arginine; histidine;
cysteine;
tryptophan; tyrosine; hydroxyproline; asparagine; methionine; threonine;
serine;
cyclothiazide; trichlormethiazide; 1,3-diaminopropane; piperazine, chlorothiazide;

hydrazinothalazine; barbituric acid; persulfate; penicillin; 1-piperidinyl ethanol; 1,4-diaminobutane; 1,5-diaminopentane; 1,6-diaminohexane; ethylenediamine;
benzenesulfonamide; tetramethylsulfone; ethylamine; di-ethylamine; tri-ethylamine; tri-iso-propylamine; di-n-propylamine; di-iso-propylamine; di-n-butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-butylamine; t-butylamine; di-n-pentylamine; tri-n-pentylamine; n-hexylamine; hydrazine sulfate;
glucose; n-methylacetamide; phosphonoacetic acid; and/or salts thereof.

[0124] Coreactants also include, but are not limited to, N-ethylmorpholine;
sparteine; tri-n-butylamine; piperazine-1,4-bis(2-ethanesulfonic acid);
triethanolamine; dihydronicotinamide adenine dinucleotide; 1,4-diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1-ethylpiperidine; di-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane;
DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic acid;
-Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymefihyl)-2,2',2"--nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid);
N, N-B is (2-h yd roxyethyl)-3-a min o-2- hyd roxyp ro pan esu lfon ic acid; 4-(N-Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-l-(2-hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-l-propanesulfonic acid; N,N-Bis(2-hydroxyethyl)glycine; N-(2-Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.
6. Solid Supports [0125] In certain embodiments, the composition comprises a solid support.
Solid supports can be, but are not limited to, beads, membranes, gels, hydrogels, synthetic organic polymers, electrodes, and inorganic oxides. In some embodiments, a solid support can be used to amplify and/or detect one target nucleic acid sequence. In some embodiments, solid supports can be used to Jetect multiple target nucleic acid sequences. When multiple target nucleic acid sequences are detected, oligonucleotides that are sufficiently complementary to each target nucleic acid sequence are linked to discrete sections of the solid support. Examples of solid supports that can be used with multiple oligonucleotides include, but are not limited to membranes, semi-conductor chips, multiwell plates, and electrodes (See, e.g., U.S. patent application publication 2004/0189311 and 2005/0052646). For example, a patterned array of electrodes can be used with some electrodes configured to link to differing nucleic acid sequences. These electrodes could be used, for example, as working electrodes in an ECL reaction to detect an ECL label linked to the electrode by the amplified target nucleic acid. In some embodiments, the electrodes comprise carbon. In other embodiments, a solid support can be patterned to allow for amplification of different target nucleic acid sequences at discrete sections of the solid support, wherein a fluorophore is detectable either by exciting only one section at a time and/or detecting fluorescent emissions from sections independently.

[0126] Beads can also be used with multiple oligonucleotide configurations.
For example, if the purpose is to amplify multiple targets, no separation among the amplified targets- is required._ In some embodiments, one_ may wish to distinguish between the different amplified sequences. This can be done by either making the labels for the different nucleic acid sequences and separately measuring each label (e.g., each label could luminesce at a different wavelength) and/or by separating beads that bind with only one amplified target nucleic acid sequence.
Beads can be separated by using beads comprising at least one differing property such as, but not limited to, different sizes, different density, different magnetic content, different fluorescent tags acting as a bead barcode (e.g., xMAP from Luminex Corp, Austin, TX, USA), etc. Separated beads can then be detected either individually or as a group sharing the same target.

[0127] Beads that can be used with the invention include, but are not limited to, polystyrene beads. Beads can also include magnetizable beads including superparamagnetic beads. In certain embodiments, the solid support can comprise carboxylated magnetizable beads. Beads can also include metallic beads, including gold beads. In some embodiments, beads can have a diameter in the range of 0.01 pm - 100 pm, 0.1 pm - 50 pm, 1 pm - 20 pm, 0.5 pm - 10 pm, 0.05 pm - 5 pm, 1 pm - 3 pm, or 0.1 pm - 1 pm.

[0128] Membranes that can be used with the invention comprise, for example, nitrocellulose, nylon, polyvinylidene fluoride (PVDF) or carboxylated polyvinylidene (U.S. Patent No.: 6,037,124). Membranes can be coated with various materials, including polyvinyl benzyl dimethyl hydroxyethyl ammonium chloride, polyvinyl benzyl benzoyl aminoethyl dimethyl ammonium chloride, polyvinyl benzyl tributyl ammonium chloride, copolymers of polyvinyl benzyl trihexyl ammonium chloride and polyvinyl benzyl tributyl ammonium chloride, copolymers of polyvinyl benzyl benzoyl dimethyl ammonium chloride and polyvinyl aminoethyl dimethyl ammonium chloride, and copolymers of polyvinyl benzyl phenyl ureidoethyl dimethyl ammonium chloride and polyvinyl benzyl benzoyl dimethyl ammonium chloride (U.S. Patent No.: 5,336,596).

[0129] Gels and hydrogels that can be used with the invention comprise, for example, acrylamide, cellulose and agarose gels.

[0130] Synthetic organic polymers can be, but are not limited to, such as polyacrylic, vinyl polymers, acrylate, polymethacrylate, polyacrylamide, polyacylonitriles, polyolefins, and carbohydrate polymers. Examples of carbohydrate polymers can be, but are not limited to, agarose, cellulose, hyaluronic acid, chitin, acyl gellan, dextran, carboxymethylcellulose, carboxymethyl starch, carboxymethyl chitin, poly(lactide-co-ethylene glycol) and polyethylene glycol. Solid supports can be comprised of polystyrene, Sepharose , or Sephadex .

[0131] Electrodes can comprise any conductive material including, but not limited to, carbon, carbon black, carbon nanotubes, silver, silver/silver chloride, gold, platinum, iridium, indium-tin-oxide (ITO) and platinum/iridium alloys.

[0132] Inorganic oxides can be, but are not limited to, silica, zirconia, carbon clad zirconia (U.S. Patent No.:5,182,016), titania, ceria, alumina, manganese, magnesia (i.e., magnesium oxide), calcium oxide, and controlled pore glass (CPG). The solid support can also comprise combinations of some of the above-mentioned supports including, but not limited to, dextran-acrylamide.

7. Linking Agents [0133] In some embodiments, a solid support can be linked to one or more oligonucleotides. In some embodiments, covalent bonds can link the oligonucleotides to a solid support. In some embodiments, oligonucleotides can be linked to a solid support via hybridization. In some embodiments, non-covalent associations can link the two moieties. Non-covalent associations can be, but are not limited to, ionic interactions, hydrogen bonds, and van der Waals forces.
In some embodiments, oligonucleotides can be passively absorbed onto a solid support (e.g., a carbon electrode). In some embodiments, a solid support can be linked to an oligonucleotide via a pair of binding partners. Typically, specific interactions between the binding partners can occur when the affinity constant Ka is higher than 106 M"1, or is higher than 108 M"1. A higher affinity constant can indicate greater affinity, and thus greater specificity. For example, antibodies can bind antigens with an affinity constant in the range of 106 M-1 to 109 M"' or higher.
If desired, nonspecific binding can be reduced without substantially affecting specific binding by varying the binding conditions using routine techniques known in the art. The conditions can be defined, for example, in terms of molecular concentration, ionic strength of the solution, temperature, time allowed for binding, or concentration of other molecules in a binding reaction.

[0134] Examples of pairs of binding partner can be, but are not limited to, sufficiently complementary nucleic acid sequences. Sufficiently complementary nucleic acid sequences can hybridize as DNA/DNA hybrids, RNA/RNA hybrids, or DNA/RNA hybrids. For example, in some embodiments, adenine nucleotides in one DNA sequence can hybridize with thymidine nucleotides in another DNA
sequence. In some embodiments, adenine nucleotides in a RNA sequence can hybridize with thymidine nucleotides in a DNA sequence.
8. Lyophilization or Freeze Drying [0135] In certain embodiments the compositions of the invention can be frozen and then dried (i.e., freeze-dried) to form dry compositions. In certain embodiments, the composition of the invention can be lyophilized to form dry compositions. Using lyophilization to stabilize biological reagents is described, for example in U.S. Patent No. 5,834,254 and in U.S. Patent Application No.

10/147,965. Examples of dry compositions include compositions that have a moisture content of less than or equal to 3% by weight, relative to the total weight of the composition and compositions that have a moisture content ranging from 0% to 3% by weight, relative to the total weight of the composition. Forming a dry composition can provide a means for protecting the activity of the reagents comprising the composition from fluctuations of various physical parameters such as temperature. Thus, in certain embodiments, the invention provides a dry composition that can be stable at ambient temperature and can be useful for detecting, amplifying, and/or isolating a target nucleic acid sequence. In various embodiments, the dry composition can have longer shelf-lives compared to a mixture comprising the same reagents that is not dry and can be stable over a wide range of temperatures: from, for example, -40 C to 60 C; -40 C to 4 C; 0 C
to 40 C; 0 C to 100 C; 4 C to 60 C; 10 C to 30 C; 10 C to 60 C; 15 C to 45 C;
20 C to 60 C; or 25 C to 40 C.

[0136] In some embodiments, the composition comprises a cryoprotectant.
A variety of cryoprotectants have been described. See, e.g., Clegg et al.
1982, Cryobiology 19: 306; Carpenter et al., 1987, Cryobiology 24: 455.
Cryoprotectants suitable for use in the instant invention can be, but are-not limited to, disaccharides, polysaccharides, and polyalcohols. In certain embodiments, the cryoprotectant can be trehalose. In certain embodiments, the cryoprotectant can be mannitol, lactose, maltose, sucrose, dextrose, and/or polyvinylpyrrolidone (PVP). Combinations of more than one cryoprotectant can also be contemplated.
Disaccharides can be, but are not limited to, trehalose.
9. Containers for Use with the Invention [0137] Containers can be, but are not limited to, multiwell plates and tubes, including, e.g., microcentrifuge tubes. In some embodiments, the containers that may hold the dry composition can be hermetically sealed. In some embodiments, the container can be sealed with an elastomeric, thermoset, or a thermoplastic material, such as EVA or Santoprene , that has been pressed into the container's opening. In some embodiments, the container can be sealed with a laminate comprising a metallic layer, such as a foil microplate seal. In various embodiments, the container can be sealed with a laminate comprising a thermally modifiable layer, such as a laminate that can be heat-sealed to the container.
In some embodiments, the container can be sealed with a laminate comprising an adhesive layer that can bond the laminate to the container.

[0138] In some embodiments, the container comprises at least one enclosure, such as one or more sealed enclosures (containers) inside a sealed outer container (e.g., a sealed bag). In some embodiments, the sealed outer container can, for example, comprise polyethylene, polyester, aluminum, nickel, a trilaminate of polyester-foil-polyethylene, or a bilaminate of polyester-polyethylene.
In some embodiments, a desiccant can be added between the innermost enclosure and the outermost enclosure. The desiccant can, for example, comprise calcium oxide, calcium chloride, calcium sulfate, silica, amorphous silicate, aluminosilicates, clay, activated alumina, zeolite, or molecular sieves. In some embodiments, a humidity indicator can be added between the innermost enclosure and the outermost enclosure. The humidity indicator can, for example, be used as an indication that the dry composition is still sufficiently dry that its stability has not been compromised. In some embodiments, the humidity indicator can be viewed through the outermost enclosure. In certain embodiments, the humidity indicator can be a card_or disc wherein the humidity is indicated by a color change, such as one designed to meet the US military standard MS20003.

[0139] In some embodiments, the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 37 C and 100% relative humidity for 10 days, 20 days, 40 days, 67 days, 3 months, 6 months, 12 months, 18 months, 24 months, or longer.

[0140] In some embodiments, the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 25 C and 100% relative humidity for 1 day, 1 week, 1 month, 3 months, 6 months, 12 months, 18 months, 24 months, or longer.

[0141] In some embodiments, the humidity barrier created by the container can be sufficient to keep the dry composition dry when the external conditions are 4 C and 30% relative humidity for 3 months, 6 months, 12 months, 18 months, 24 months, or longer.

10. Polymerases [0142] Polymerases include, but are not limited to, DNA polymerases and RNA polymerases. Some polymerases, such as Klenow fragment, can use DNA
as a template. Other polymerases can use RNA as a template. These RNA-dependent polymerases can be, but are not limited to, reverse transcriptase.
Yet other polymerases, for example Tth polymerase and TZ05 polymerase, can use DNA or RNA as a template. Thus exemplary polymerases can be a DNA-dependent DNA polymerase, an RNA-dependent DNA polymerase, a DNA-dependent RNA polymerase, and an RNA-dependent RNA polymerase. A
polymerase can have a combination of these activities. For example, reverse transcriptase can be a DNA-dependent DNA polymerase and an RNA-dependent DNA polymerase.

[0143] A polymerase can have other activities associated with it besides polymerase activity. For example, a polymerase can also have RNAase activity that confers the ability to degrade RNA. Reverse transcriptase's RNAase activity can allow this polymerase to degrade RNA in a RNA/DNA hybrid molecule.
Moreover, a polymerase such as Taq polymerase can have high processivity. A
polymerase such as terminal deoxynucleotidyl transferase can have Iow processivity. A polymerase such as Klenow fragment can have moderate processivity.

[0144] In some embodiments, the polymerase can be a thermostable polymerase. In some embodiments, the polymerase can be derived from a mesophilic organism, thus having maximum polymerase activity in the range of 20-40 C. Polymerases from mesophilic organisms can be, but are not limited to, phi29 DNA polymerase (from the Bacillus subtilis), T4 DNA polymerase (from a strain of Escherichia coli that carries a T4 DNA Polymerase overproducing plasmid), T7 DNA polymerase (from T7 phage), and Klenow fragment (from Escherichia coli). Thermostable polymerases can be derived from thermophilic organisms. For example, thermostable polymerases can be derived from thermophilic archaea. Thermostable polymerases can also be derived from thermophilic bacteria. Thermostable polymerases can also be derived from thermophilic Eukarya. Examples of thermostable polymerases include, but are not limited to, Taq polymerase derived from Thermus aquaticus, Pfu polymerase derived from Pyrococcus furiosus, vent polymerase derived from Thermococcus litoralis, Tli polymerase derived from Thermococcus litoralis, DyNAzymeTM
polymerase derived from Thermus brockianus, or Isis DNA polymeraseTM derived from Pyrococcus abyssi. Yet other thermostable polymerases can be, for example Tth polymerase and TZ05 polymerase.
11. Cations, Detergents, and Carrier Proteins [0145] In some embodiments, monovalent cations can be provided by at least one salt comprising a monovalent cation. Examples of monovalent cations can be, but are not limited to, sodium (Na+), potassium (K+), ammonium (NH4+), silver (Ag+), and quaternary ammonium cations such as tetramethylammonium ions and tetraethylammonium ions. In some embodiments, divalent cations can be provided by at least one salt comprising a divalent cation. Examples of divalent cations can be, but are not limited to, magnesium (Mg2{), manganese (Mn2+), calcium (Ca2+), and copper (Cu2+). In some embodiments, the salt can be chosen from at least one of potassium chloride and magnesium chloride.

[0146] In some embodiments, a buffering agent can be any buffer that has an effective buffering capacity in the pH range of 6.0 to 9Ø In certain embodiments, a suitable buffer can be any buffer that has an effective buffering capacity in the pH range of 8.0 to 8.8. In some embodiments, the buffering agent can be a buffer having an effective buffering capacity in the pH range of 8.1 to 8.5. In some embodiments, the buffering agent can be Tris-HCI. Buffering agents can be, but are not limited to, N,N-Bis(2-hydroxyethyl)glycine, Tris(hydroxymethyl)aminomethane hydrochloride, and N-[Tris(hydroxymethyl)methyl]glycine. Buffering agents may shift the pH of a solution as function of temperature. For example, Tris(hydroxymethyl)aminomethane hydrochloride has a temperature dependence in the range of -0.028 pH to -0.021 units/ C. Accordingly, ali pH values herein should be interpreted as the pH of the solution at 23 C.

[0147] In certain embodiments, a composition of the invention can comprise a detergent. Examples of detergents can be, but are not limited to, ionic, non-ionic, and zwitterionic detergents. Examples of detergents can be, but are not limited to, Tween 20, Triton X-1 00, Thesit (polyoxyethylene 9 lauryl ether).
Other exemplary detergents can be found in the Sigma-Aldrich catalog.

[0148] In some embodiments, a composition of the invention can comprise a carrier protein. Carrier proteins include, but are not limited to bovine serum albumin.

III. Methods of Making Compositions of the Invention A. Methods for Making Compositions Comprising Two Oligonucleotides [0149] Compositions of the invention can generaliy be made by gathering the components present in the composition and combining those ingredients in one composition. In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraphs [057], [061], [065], [066], or [067] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence. In various embodiments, the ingredients used in these methods have the characteristics described in Sections II.A and II.D above.

B. Methods for Making Compositions Comprising Three Oligonucleotides [0150] Compositions of the invention can generally be made by gathering the components present in the composition and combining those ingredients in one composition. In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraphs [070], [081], [082], or [083] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence. In various embodiments, the ingredients used in these methods have the characteristics described in Sections II.B and II.D above.

C. Methods of Making Compositions for Multiple Arrays [0151] Compositions of the invention can generally be made by gathering the components present in the composition and combining those ingredients in one composition. In some embodiments, components associated with the solid phase (e.g., different oligonucleotides linked to different beads or different areas of a solid phase) can be made separately and then combined with the rest of the ingredients. In some embodiments, the invention provides a method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising obtaining the ingredients recited in the composition of paragraph [084] or [085] and combining these ingredients thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence. In various embodiments, the ingredients used in these methods have the characteristics described in Sections II.C and II.D above.

D. General Aspects of Making the Composition of the Invention [0152] In some embodiments, the method of making a composition of the invention can comprise lyophilizing the components once they are combined by first freezing the composition described above and then dehydrating the composition. In some embodiments, the composition can be frozen by placing it in a commercial freezer at an appropriate temperature. For example, the composition can be frozen by placing the container at -20 C for 2-30 minutes.
Alternatively, the composition can be frozen by placing it in an ice bath, for example an ethanol-dry ice bath, for 2-30 minutes.

[0153] In some embodiments, the components of the composition can be combined to result in various concentrations of each component. In some embodiments, the polymerase can be present at a concentration of 25 to 250 units/milliliter. In some embodiments, the nucleoside triphosphates can be present at a concentration of 100 to 500 nanomolar. In some embodiments, the monovalent cations can be present at a concentration of 50 to 150 millimolar.
In certain embodiments, where the solid support is a bead, the beads can be present at a concentration of 200 to 2000 milligrams/liter. In some embodiments, the cryoprotectant can be present at a concentration of 4 to 15 g/100 milliliter.
In some embodiments, the first oligonucleotide can be present at a concentration of 300 to 500 nanomolar. In some embodiments, the second oligonucleotide can be present at a concentration of 300 to nanomolar. In some embodiments, the third oligonucleotide can be present at a concentration of 1011 to 1019 copies per m2 of the solid support. In some embodiments, the third oligonucleotide can be present at a concentration of 1013 to 1018 copies per m2 of the solid support. In some embodiments, the third oligonucleotide can be present at a concentration of to 1017 copies per m2 of the solid support.

IV. Methods of Detecting, Amplifying, and/or Isolating Target Nucleic Acids [0154] In some embodiments, the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by any of the methods of paragraphs [0149] or [0150];
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence are made;
(4) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (5) optionally detecting the label thereby detecting the target nucleic acid in the sample.

[0155] In some embodiments, the invention provides a method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by any of the methods of paragraph [0149];
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence can be made;

(4) linking the second oligonucleotide to the solid support;
(5) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (6) optionally detecting the label thereby detecting the target nucleic acid in the sample.

[0156] In some embodiments, the invention provides a method of detecting, amplifying, and/or isolating a N target nucleic acid sequences comprising:
(1) obtaining a first composition of paragraph [084] or [085];
(2) adding a sample which may contain the N target nucleic acid sequences to the first composition to form a second composition;
(3) alternately heating and cooling the second composition such that multiple copies of each of the N target nucleic acid sequences that are in the sample are made;
(4) allowing the multiple copies to link to the N discrete areas on the at least one solid support; and (5) optionally detecting or isolating the label thereby detecting the N
target nucleic acid sequences in the sample;
wherein- N is an integer greater than or equal to 1.

[0157] In various embodiments of methods of amplifying or detecting, amplifying, and/or isolating a target nucleic acid sequence, the compositions of paragraphs [057], [061], [070], [084], and [085] can be modified to encompass the various embodiments described in Section II above. In various embodiments of the methods of amplifying or detecting, amplifying, and/or isolating a target nucleic acid sequence, the compositions produced by the methods of paragraphs [0149], [0150], and [0151] can be modified to encompass the various embodiments described in Section II above.

[0158] In certain embodiments, the methods can comprise performing a PCR
reaction where all of the necessary reagents, except the sample containing the target nucleic acid, are premixed in a container. The sample can be added to the premixed reagents before starting a PCR reaction. In some embodiments, the amplified target nucleic acid sequence can be removed from the container after PCR and isolated via standard techniques, such as on an agarose gel, for further study or manipulation. In some embodiments, the amplified target nucleic acid sequence can bind to the solid support. Depending on the solid support used, the container can be centrifuged or exposed to a magnetic source to concentrate the PCR products before detecting or isolating the products by detecting the label associated with the PCR products.

[0159] Once the DNA amplification reaction is complete, the reaction container can be cooled to a temperature at which the amplification products can bind to the solid support via the pair of binding partners. In some embodiments, the interaction between the first member and the second member of a pair of binding partners is unstable at temperatures 10 C lower than the lowest temperature in the amplification reaction and stable at temperatures above 20 C.
For example, the interaction between the first member and the second member of a pair of binding partners can be unstable at about the same temperature as the lowest temperature in the amplification reaction and stable at temperatures above 30 C. The nucleic acid sequences used for the pair of binding partners can be a mixture of nucleotides to provide, for example, the desired thermal stability and unique binding for measuring one or more target sequences.
- [0160] In some embodiments, multiple target nucleic acid sequences can be amplified, detected, or isolated by using the solid support to separate the labeled and amplified target sequences. In some embodiments, the invention can detect N target nucleic acid sequences, where N is an integer greater than or equal to 1;
2; 10; 20; 30; 40; 50; 60; 70; 80; 90; 100; 200; 300; 400; 500; 600; 700; 800;
900;
1000; 2000; 3000; 4000; 5000; 10,000; 50,000; 100,000; 300,000; 500,000;
700,000 or 1,000,000. In some embodiments, 2:5 N<_ 1,000,000. In some embodiments, 2:5 N<_ 1,000. In some embodiments, 2:5 N<_ 1,000. In some embodiments, 2 s N 5 100. In some embodiments, 2 s N s 30. in some embodiments, 2:5 N< 10. In some embodiments, N>_ 10. In some embodiments, N _ 50.

[0161] In some embodiments, each target nucleic acid sequence can be amplified with 1 pair of oligonucleotides. In some embodiments, "i" target nucleic acid sequences can be amplified with "i" pairs of oligonucleotides, wherein "i" is an integer between I and N and wherein each pair of oligonucleotides amplifies a different target nucleic acid sequence. In some embodiments, each target nucleic acid sequence can be amplified with pairs of oligonucleotides containing nucleic acid sequences unique to each target nucleic acid sequence. For example, if 10 different target nucleic acid sequences are to be detected, 10 different pairs of oligonucleotides are used, each pair amplifying one of the 10 different target nucleic acid sequences. In some embodiments using three oligonucleotides, each target nucleic acid sequence can be amplified with a pair of oligonucleotides containing nucleic acid sequences common to more than one target nucleic acid sequence. In such embodiments, the sequence of the third oligonucleotide can be unique to each target nucleic acid sequence.
[0162] In some embodiments involving multiple target nucleic acid sequences, the solid support can be a planar structure with discrete areas arranged to capture different targets. In some embodiments, the discrete areas can be electrodes, wherein each electrode is surrounded by an electrical insulator.
For example, each discrete area can comprise a working electrode and a counter electrode separated from each other and from other discrete areas by electrical insulators. The working electrode can be prepared to capture a target nucleic acid sequence. For example, each discrete area can be linked to differing third oligonucleotides in order to detect different target sequences. In some embodiments, the counter electrode can be shared across multiple working electrodes and therefore the counter electrodes are not considered to be in the discrete areas. In some embodiments, each target nucleic acid sequence can have a different first oligonucleotide; second oligonucleotide; if present, third oligonucleotide; and if present, pair of binding partners.
[0163] For example, each discrete area can be linked to a different first member of pairs of binding partners where the pairs of binding partners can permit reversible binding between the different second oligonucleotides and the different discrete areas. In some embodiments, the interaction between the first members and the second members of the pairs of binding partners are (1) unstable at temperatures used for amplifying DNA, such that the first and second members will not stably bind to each other during the amplification reaction; and (2) stable below the temperature used for amplifying DNA. Once the DNA amplification reactions are complete, the reaction container can be cooled to a temperature at which the amplification products bind to their respective discrete areas via the pair of binding partners.
[0164] In some embodiments, electrochemiluminescence can be used to detect multiple target nucleic acid sequences by using electrodes as the discrete areas of the solid support, each area being arranged to specifically bind to one of the target sequences. In some embodiments, fluorescence can be used to detect multiple target nucleic acid sequences with each discrete area of the solid support being arranged to specifically bind to one of the target sequences.
[0165] In certain embodiments, the method of detecting, amplifying, and/or isolating a target nucleic acid sequence further comprises forming a dry composition from the composition of step (1) (e.g., by freeze-drying or lyophilizing) before performing steps 2-5 described at the beginning of section IV. In some embodiments, the components can be frozen. For example, the dry composition may be formed by first snap freezing the composition of step (1) in, for example, a dry ice ethanol bath or in liquid nitrogen. After freezing, the components can be lyophilized at temperatures and pressures that maintain the sample in a solid state, for example, a temperature of -30 C to 0 C and a pressure of 10 to 20 millitorr for a time sufficient to reduce the water content to 0% to 5%, e.g., 1 to 48 hours. Longer durations and lower pressures are also contemplated. After initial water removal at cold temperatures, the lyophilization temperature may, in some cases, be increased to as high as 37 C to accelerate the rate of water removal in the reduced pressure environment. In some embodiments, rehydration can occur when at least one of water, buffer, or the sample containing the target nucleic acid sequence is added to the dried composition of step (1). The skilled artisan will understand that if rehydration is achieved by adding water and/or buffer, the sample can be added subsequently, but prior to commencing the PCR reaction.
Alternatively, water and/or buffer could be added after the sample is added but prior to commencing the PCR reaction.
[0166] Those skilled in the art can use PCR to amplify DNA or RNA
sequences. PCR involves subjecting each sample to a series of amplification cycles. Typically, each amplification cycle can include (1) a melting step in which double-stranded nucleic acids separate into single strands, (2) an annealing step in which first and second oligonucleotides, also called primers in the context of PCR, hybridize to sufficiently complementary sequences contained in the target nucleic acid, and (3) a primer extension or polymerase step in which a polymerase enzyme extends the primers by adding nucleoside triphosphates to the growing polynucleotide, thus creating multiple copies of the target nucleic acid. In some embodiments, when the target nucleic acid sequence is an RNA sequence, the composition of the invention can comprise an RNA dependent polymerase such as reverse transcriptase, to convert the RNA into DNA, and a DNA-dependent polymerase to facilitate amplification of the resulting DNA sequence.
[0167] In some embodiments, the target DNA is a single-stranded target nucleic acid molecule. The PCR melting step can eliminate secondary structure in the single-stranded target. Only the primer sufficiently complementary to the single strand can initially hybridize with the target sequence during the first amplification cycle. Once the first amplification step is complete, the target DNA is then double-stranded, allowing both primers to bind to their sufficiently complementary sequences in subsequent PCR cycles.
[0168] Suitable melting temperatures are in the-range of 85 C to 99 C. The -duration of the melting step can be in the range of 10 seconds to 5 minutes.
In some embodiments, the target nucleic acid sequence can be incubated at 95 C
for 30 seconds to allow strand separation and/or secondary structure removal.
In some embodiments, the target nucleic acid sequence can be incubated at 97 C
for 15 seconds to allow strand separation and/or secondary structure removal.
[0169] The temperature and amount of time needed for optimal primer annealing to the target sequence can vary according to the primer sequence, primer length, and primer concentration in the PCR reaction. For example, in certain embodiments, the annealing temperature can be 5 C below the melting temperature (Tm) of the primer. In general, an approximate primer Tm can be calculated by adding 2 C for each A or T in the primer and 4 C for each G or C
in the primer. Alternatively, Tm can be calculated using the following formulas.
For sequences that are less than 14 nucleotides long: Tm = (wA+xT) x 2 + (yG+zC) x 4. For sequences that are more than 13 nucleotides long: Tm = 64.9 + 41 x (yG
+

zC - 16.4)/(wA + xT + yG + zC). In each formula, w, x, y, and z are the number of As, Ts, Gs, and Cs in the nucleotide sequence for which the Tm can be calculated. In some embodiments, suitable temperatures for annealing primers to a target nucleic acid sequence can be in the range of 45 C to 65 C. In some embodiments, the duration of the annealing step can be in the range of 2 seconds to 5 minutes. In some embodiments, suitable temperatures for annealing primers to a target nucleic acid sequence can be in the range of 55 C to 72 C. In some embodiments, the concentration of each primer in the PCR reaction can be 0.1 pM to 0.5 pM. In some embodiments, the concentration of each primer in the PCR reaction can be 0.2 pM. The skilled artisan can easily determine the appropriate annealing temperature and primer concentration to achieve optimal primer binding and specificity.
[0170] Successful primer extension can depend on the length of the target nucleic acid sequence, the concentration of the target nucleic acid sequence in the PCR reaction, and upon the temperature at which polymerization occurs. In some embodiments, primer extension temperatures can range from 60 C to 85 C
or 70 C to 75 C. In some embodiments, the primer extension temperature can be 72 C.- The duration of the primer extension step can be in the range of I
second to 30 minutes or in the range of 20 seconds to 5 minutes. In some embodiments, the PCR reaction can be incubated at 72 C for one minute to allow primer extension.
[0171] The number of amplification cycles required for successful target nucleic acid amplification can depend on the concentration of the target nucleic acid sequence in the PCR reaction. In some embodiments, the PCR reaction can undergo 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, or 40 to amplification cycles.
[0172] Optionally, prior to beginning the amplification cycles, the PCR
reaction can be pre-incubated to minimize secondary structure in the target nucleic acid sequence and to maximize the completeness of target sequence double strand separation. In some embodiments, the temperature for this pre-incubation step can be in the range of 85 C to 99 C, and the duration of this step can be in the range of 1 to 10 minutes. In addition, a final primer extension/polymerization step can be added after the cycling is complete to allow the amplified copies to replicate the target sequence in its entirety. In some embodiments, this final step can be performed at a temperature in the range of 70 C to 75 C for a duration of 1 to 15 minutes.
[0173] !n some embodiments, the PCR reaction container can be manipulated after completion of the PCR reaction. In some embodiments, when the PCR reaction is complete, the contents of the container can be mixed in order to resuspend the third oligonucleotide linked to the solid support. In some embodiments where the interaction between an oligonucleotide and the solid support is unstable at high temperatures, the contents of the container can be mixed at a temperature where the interaction is stable to facilitate the linkage of the oligonucleotide to the solid support.
[0174] In some embodiments, the contents of the container can be heated to a temperature in the range of 85 C to 99 C for I to 15 minutes to permit the double stranded nucleic acid product of the PCR reaction to melt into single strands. In some embodiments using a third oligonucleotide linked to the solid support, the third oligonucleotide can hybridize to the target sequence by lowering the temperature to the range of 20 C to 65 C for-a duration in the range of 5 minutes to 2 hours. ln some embodiments where the interaction between the third oligonucleotide and the solid support is unstable at high temperatures, the PCR
reaction can be incubated at a temperature where the interaction is stable to facilitate the linkage of the oligonucleotide to the solid support and where the third oligonucleotide can hybridize to the target nucleic acid sequence. For example, the third oligonucleotide can contain a poly-T tail at its 5' terminus that does not bind to the target nucleic acid sequence. This single-stranded poly T tail can bind to a poly A oligonucleotide that can be covalently bound to the solid support, using 2 C for each A/T pair.
[0175] The target sequence can then be physically separated from the rest of the contents of the container. In some embodiments, physical separation can be achieved through gravity. In some embodiments, the container can be centrifuged, e.g. 1,000 x g for 10 minutes. ln certain embodiments where the solid support is a magnetizable bead, separation can be achieved by applying a magnetic field to the container and decanting, aspirating, or otherwise removing the unbound reagents, thereby isolating the target nucleic acid sequence.
[0176] In some embodiments, the target sequence can be detected after the PCR reaction is complete. Where the label is an ECL moiety or fluorophore, the amplified target sequence can be placed in a cell connected to a photomultiplier tube. One skilled in the art will recognize that the target sequence can be isolated and detected in the cell of an instrument designed for this purpose, e.g., an M-SERIES M1-M Analyzer (BioVeris Corp., Gaithersburg, MD). Where the label is a radioactive isotope, the amplified target sequence can be detected using, for example, a gamma counter, a Geiger counter, or a scintillation counter.

V. Kits [0177] In some embodiments, the invention also provides kits for carrying out the methods of detecting, amplifying, and/or isolating target nucleic acids.
In some embodiments, kits of the invention can comprise at least one of the compositions of paragraphs [057], [061], [070], [084], and [085]. In some embodiments, a kit can comprise a container in which kit components can be packaged. In some embodiments, a kit can comprise directions on how to use the kit components to detect, amplify, and/or isolate target nucleic acids.
EXAMPLES
Example 1: Detection of DNA from pathogenic bacteria [0178] Three oligonucleotides were designed to hybridize to a portion of the DNA sequence encoding the protective antigen of B. anthracis. The sequence of the first oligonucleotide was as follows:
5'- TAGAAGGATATACGGTTGATGT-3' SEQ ID NO. 1 SEQ ID NO. 1 is a forward primer.
The second oligonucleotide's sequence was as follows:
5'- TGTCTTGCCTCTGGTGAT-3' SEQ ID NO. 2 SEQ ID NO. 2 is a reverse primer.
The two oligonucleotide primers amplified a PCR product 193 bases long. SEQ
ID NO. 2 was synthesized with a ruthenium at the 5' end by phosphoramidite chemistry using the methods described in US patent 5,597,910.

The third oligonucleotide, used to capture the resulting labeled PCR product, had the following sequence:
5'- C6 amino-GGTTACAGGACGGATTGATA -3' SEQ ID NO. 3 This oligonucleotide was sufficiently complementary to the same target strand as the unlabeled PCR primer at a location on the target nucleic acid sequence between the locations where the first and second oligonucleotides hybridized to the target nucleic acid sequence. The third oligonucleotide was synthesized with a primary amine group at the 5'-terminus, purchased from Biosource International (Camarillo, CA). The capture oligonucleotides were coupled to Dynal 2.8-micron carboxylated superparamagnetic beads (Dynal Biotech, Brown Deer, WI, M-270 carboxylated beads, part number 143.06) by using [1-ethyl-3-(dimethylaminopropyl)carbodiimide] hydrochloride as a cross-linking agent.
Briefly, 200 pl M-270 carboxylated beads (30 mg/mI) were prepared for coupling by washing twice with 200 pl 0.01 M sodium hydroxide and three times with 200 pl deionized water. The washed beads were resuspended in 140 pl of a solution containing 25 mM 2-morpholinoethanesulfonate buffer (MES, Sigma Aldrich, St.
Louis, MO) pH 5.0 and 30 pM amino-labeled oligonucleotide. The mixture was incubated at-room temperature with end-over-end mixing for 30 minutes, and then 60 pl freshly made solution of 100 mg/mI [1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (EDC, Pierce Biotechnology, Rockford, IL) in 100 mM MES pH 5.0 was added and incubated 18 hours at 4 C.
Unreacted oligonucleotide was removed by washing the beads four times with 400 pl 10 mM Tris-HCI pH 8.0, 0.1 mM EDTA, 0.1% Tween20 (Sigma Aldrich, St.
Louis, MO). Conjugated beads were resuspended in 400 pl of the same buffer (15 mg beads/ml) and stored at 4 C.
[0179] A liquid formulation of the following reagents was prepared: 5 mM
Tris-HCI pH 8.3 25 mM KCI, 2.5 mM MgCi2, 0.1 mM dATP, 0.1 mM dCTP, 0.1 mM
dGTP, 0.1 mM dTTP, 0.1 pM unlabeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM
EDTA, 0.1 pM ([Ru(bpy)3]2+-labeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM
EDTA, 2.5% w/v trehalose, 0.125% v/v Tween 20, 0.02 units/pl Taq DNA
polymerase, 0.3 pg of the above-described oligonucleotide-superparamagnetic beads coupled to the third oligonucleotide. Buffer, magnesium chloride solution and Taq DNA polymerase were purchased from Applied Biosystems. A dNTP mix solution was purchased from Bioline. Trehalose and Tween 20 were purchased from Sigma Aldrich. Oligonucleotides were purchased from Biosource.
[0180] Fifty microliters of the liquid formulation was placed in 0.2 mi polypropylene PCR tubes, snap frozen in a dry ice ethanol bath, and dried by lyophilization for 46 hours in a Labconco model 7934000 lyophilizer with a shelf temperature -30 C. The dry formulations were used the same day for the following experiments. PCR reactions were prepared by adding 25 pl water to each tube.
One microliter of 200 pg/iai B. anthracis DNA, prepared using a silica spin column (Qiagen) from the Sterne strain was added to the highest concentration tube, and six serial dilutions of DNA were performed in the reaction mixes. The PCR
tubes were capped, mixed briefly, and then placed in a thermal cycler (MJ Research PTC-200) to undergo 35 cycles of DNA amplification. The PCR tubes were pre-incubated at 95 C for 7 minutes before starting the amplification cycles. Each amplification cycle consisted of incubating the PCR tubes at 95 C for 30 seconds, 55 C for 30 seconds, and then at 72 C for 1 minute. After completing the 35 cycles, the PCR tubes were incubated at 72 C for 4 minutes.
- [0181] The reactions were then mixed briefly to resuspend the beads, heated for 5 minutes at 95 C, and then incubated for 30 minutes at 40 C to permit the capture oligonucleotide to hybridize with the PCR products. Labeled via the incorporated labeled primer, the PCR products were then diluted with 210 pi of phosphate-buffered saline (PBS) and the amount of [Ru(bpy)3]2+ bound to the beads was quantified in a BioVeris M-SERIES Ml R Analyzer (BioVeris Corp., Gaithersburg, MD). As shown in Figure 1, the results demonstrated a correlation between the ECL signal detected and the amount of target B. anthracis DNA
present.
Example 2: Stability of the lyophilized product [0182] PCR reaction mixtures were prepared for amplifying and detecting DNA sequences that encode a portion of the following B. anthracis targets:
protective antigen, capsular protein B, and a chromosomal locus. The following primer pairs were used for each target Protective antigen:

forward primer: SEQ ID NO. 1 reverse primer: SEQ ID NO. 2 Capsular protein B:
forward primer: 5'- AGATATTCCAACGCAAGAGT -3' SEQ ID NO.

reverse primer: 5'- CCACTCCATATACAATCCGAT -3' SEQ ID NO.
Chromosomal locus BA4070:
forward primer: 5'- TAAGGAGGAGGTAATATGGAG -3' SEQ ID
NO. 6 reverse primer: 5'- CAGTAGGGAAAGTTGGGAGTT -3' SEQ ID
NO. 7.
The sequences of the capture oligonucleotides were as follows:
Protective antigen:
SEQ ID NO. 3 Capsular protein B:
5'- C6 amino-TTATGTCTCGTATGCGTCC -3' SEQ ID NO. 9 Chromosomal locus BA4070:
5'- C6 amino-AATCAGCCAATCAACATTAA -3' SEQ ID NO. 10.
As described in Example 1, capture oligonucleotides were synthesized with a primary amine group at the 5'-terminus. Each reaction mix consisted of 10 mM
Tris-HCI pH 8.3, 50 mM KCI, 4 mM MgCI2, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM
dGTP, 0.4 mM dUTP, 5% w/v trehalose, 0.25% Tween 20, 0.02% bovine serum albumin (BSA), 0.2 pM unlabeled forward primer, 0.2 pM [Ru(bpy)3]2+-labeled reverse primer, 0.6 pg M-270 superparamagnetic beads linked to a capture oligonucleotide (prepared as in Example 1), and 0.04 units/tal Taq DNA
polymerase. A total of 6 ml of each mix was made, 4 ml of which was lyophilized.
The reverse primers were synthesized with a ruthenium-chelate detectable group at the 5'-terminus, as described in Example 1.
[0183] Twenty-five microliter aliquots of the reaction mix were dispensed into 0.2 ml PCR reaction tubes and snap frozen in a dry ice-ethanol bath. The frozen tubes were placed in a model 7934000 Labconco lyophilizer and dried using a program of increasing shelf temperature: -30 C for 1.5 hr, ramp to -10 C over the next 12 hours, ramp to 0 C over the next 6 hours, and finished by 20 hours at C. The dried reaction tubes were stored at 37 C in aluminum foil pouches containing 5 g silica gel desiccant packets (Ulead). At one day, 7 days, and days post-lyophilization, reaction tubes were reconstituted by adding 0, 0.1, or 5 pg B. anthracis DNA suspended in 25 pl of water. The PCR tubes were capped, mixed briefly, and then placed in a MJ Research PTC225 thermal cycler to undergo 38 cycles of DNA amplification. The PCR tubes were pre-incubated at 95 C for 7 minutes before starting the amplification cycles. Each amplification cycle consisted of incubating the PCR tubes at 95 C for 15 seconds and 50 C
for 30 seconds repeated 38 times. The samples were then incubated at 72 C for 2 minutes [0184] The reactions were then mixed briefly to resuspend the beads, heated for 5 minutes at 95 C, and then incubated for 30 minutes at 40 C to permit the capture oligonucleotide to hybridize with the PCR products. Labeled via the incorporated labeled primer, the PCR products were then diluted with 210 ial of water and the amount of [Ru(bpy)3]2+ bound to the beads was quantified in a BioVeris M-SERIES -M1 R Analyzer (BioVeris Corp., Gaithersburg, MD). As-shown in Figure 2A and 2B, the reaction mixtures provided detectable PCR
products at each DNA concentration tested. Thus, the reaction mixtures for all three target sites were stable for at least 28 days when stored at 37 C.
Example 3: Detection of RNA
[0185] A reaction mixture was prepared to amplify and detect a portion of the RNA genome of the coronavirus that causes Severe Acute Respiratory Syndrome (SARS). The oligonucleotides used had the following sequences:
forward primer: 5'- AAGCAGCCCACTGTGACTC -3' SEQ ID NO.

reverse primer: 5'- Ru(bpy)32+-CATAACCAGTCGGTACAGCT -3' SEQ ID NO. 12 capture oligonucleotide: 5- C6 amino-GAAGCTATTCGTCACGTTCG -3' SEQ ID NO. 13.

The primers and capture oligonucleotide were prepared as described above in Examples I and 2. The reaction mixture contained 20 mM Tris-HCI pH 8.3, 100 mM KCI, 2 mM magnesium chloride, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.4 mM dUTP, 5% trehalose, 0.2 pM unlabeled forward primer, 0.2 pM
[Ru(bpy)3]2+-labeled reverse primer, 0.6 pg superparamagnetic beads (1 pm diameter MyOneTM carboxylated beads from Dynal Biotech, part number 650.12) linked to the capture oligonucleotide, and 0.15 units/pI Thermus sp. Z05 polymerase (Applied Biosystems, Foster City, CA). Superparamagnetic beads were prepared as described in Example 1.
[0186] Twenty-five microliters of the reaction mixture were dispensed into 0.2 ml PCR reaction tubes. The tubes were snap frozen on dry ice, and were placed in a VirTis Ultra 35 lyophilizer precooled to -30 C. The temperature was held at -30 C for 360 minutes, increased to -10 C at 0.1 C/min, held at -10 C for 480 minutes, increased to 0 C at 0.1 C/min, held at 0 C for 300 minutes, increased to 10 C at 0.1 C/min, held at 10 C for 300 minutes, increased to 25 C
at 0.17 C/min, and held at 25 C for 13 hours. The pressure throughout was 15-millitorr. Dried reactions were reconstituted by adding 25 pl deionized water.
The test template for the reconstituted reactions was SARS-CoV Armored RNA
(Ambion, Austin, TX). Three microliters Armored RNA (1 x 105 particles) were activated by heating for 3 minutes at 75 C, and then added to an RT-PCR
reaction. Dilutions of RNA were performed by serially transferring 3 lal to six tubes. The PCR tubes were capped, mixed briefly, and then placed in a in a MJ
Research PTC-200 thermal cycler to undergo 40 cycles of amplification. The PCR tubes were first pre-incubated at 65 C for 30 minutes to allow synthesis of an initial DNA strand from the RNA template. Samples were then incubated at 95 C
for 1 minute to allow the strands of the resulting RNA/DNA hybrids to separate before starting the amplification cycles. Each amplification cycle consisted of incubating the PCR tubes at 95 C for 15 seconds and 55 C for 30 seconds. After completing the 40 cycles, the PCR tubes were incubated at 45 C for 30 minutes to permit the capture oligonucleotide to hybridize with the PCR products. Labeled via the incorporated labeled reverse primer, the PCR products were then diluted with 210 pl of PBS and the amount of [Ru(bpy)3]2+ bound to the beads was quantified in a BioVeris M-SERIES Ml R Analyzer (BioVeris Corp., Gaithersburg, MD). As shown in Figure 3, the intensity of the resulting ECL signal correlated with the viral RNA copy number present in the sample.
[0187] All references cited herein are incorporated by reference in their entirety. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.
[0188] All numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.
-[0189] Many modifications and variations of this- invention can be made --without departing from its spirit and scope, as will be apparent to those skilled in the art. For example, although the specification refers to PCR for nucleic amplification, other amplification techniques are also within the scope of the invention, such as target polynucleotide amplification methods such as self-sustained sequence replication (3SR) and strand-displacement amplification (SDA); methods based on amplification of a signal attached to the target polynucleotide, such as "branched chain" DNA amplification; methods based on amplification of probe DNA, such as ligase chain reaction (LCR) and QB
replicase amplification (QBR); transcription-based methods, such as ligation activated transcription (LAT) and nucleic acid sequence-based amplification (NASBA); and various other amplification methods, such as repair chain reaction (RCR) and cycling probe reaction (CPR).
[0190] The specification is most thoroughly understood in light of the teachings of the references cited within the specification. The embodiments within the specification provide an illustration of embodiments of the invention and should not be construed to limit the scope of the invention. The skilled artisan readily recognizes that many other embodiments are encompassed by the invention. All publications and patents cited in this disclosure are incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material. The citation of any references herein is not an admission that such references are prior art to the present invention. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims

1. A composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence (i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of (1) the target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the target nucleic acid sequence, wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label;
and wherein the composition does not comprise the target nucleic acid sequence or its complement.

2. The composition of claim 1, wherein the third oligonucleotide is covalently linked to the at least one solid support.

3. The composition of claim 1, wherein the third oligonucleotide can be cleaved from the at least one solid support.

4. The composition of claim 1, 2, or 3, wherein at least one of the first and second oligonucleotides comprises a label.

5. A composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:

(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

6. A composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker substance;

(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein the second oligonucleotide is not linked to the solid support until the target nucleic acid sequence has been amplified, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

7. The composition of claim 6, wherein the linker substance is photoactivatable so that the linker substance can be linked to the solid support.

8. The composition of claim 7, where the linker substance comprises an aryl azide.

9. The composition of claim 5 or 6, wherein the first oligonucleotide is modified with a label.

10. The composition of claim 1, 5, or 6, further comprising an ECL
coreactant.

11. The composition of claim 10, wherein the ECL coreactant comprises a secondary amine and/or a tertiary amine.

12. The composition of claim 10, wherein the ECL coreactant is at least one of peroxodisulfate; ethylamine; di-ethylamine; tri-ethylamine; tri-iso-propylamine; di-n-propylamine; di-iso-propylamine; di-n-butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-butylamine; t-butylamine;
di-n-pentylamine; tri-n-pentylamine; N-ethylmorpholine; sparteine; tri-n-butylamine;
triethanolamine; dihydronicotinamide adenine dinucleotide; 1,4-diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1-ethylpiperidine; di-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane;
DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic acid;
Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymethyl)-2,2',2"-nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid);

N,N-Bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid; 4-(N-Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-1-(2-hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-1-propanesulfonic acid; and N,N-Bis(2-hydroxyethyl)glycine; N-(2-Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.

13. The composition of claim 10, wherein the ECL coreactant is at least one of piperazine-1,4-bis(2-ethanesulfonic acid), tri-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane; and/or salts thereof.

14. The composition of any of claims 1-13, (a) wherein the composition is a dry composition;
(b) wherein the composition further comprises a container that forms a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C and 30% relative humidity;
(c) wherein the at least one solid support is at least one magnetizable bead having a diameter of about 1 to about 3 microns;
(d) wherein the first and second oligonucleotides are each about to about 90 nucleotides long;

(e) wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5;
(e) wherein the at least one polymerase comprises a thermostable polymerase; and (f) wherein at least one of the first and second oligonucleotides comprises an ECL moiety, a fluorophore, or a chemiluminescent label provided, however, that in embodiments not comprising the third oligonucleotide, the second oligonucleotide does not comprise an ECL moiety, a fluorophore, or a chemiluminescent label.

15. The composition of any of claims 1 to 14, wherein the at the least one nucleoside triphosphate is modified with a label.

16. The composition of any of claims 1 to 15, wherein the composition is a dry composition.

17. The composition of any of claims 1 to 16, further comprising a container that forms a humidity barrier sufficient to keep the dry composition dry for 20 days when the external conditions are 37°C and 100% relative humidity.

18. The composition of any of claims 1 to 18, further comprising (a) an inner container that holds the dry composition;
(b) an outer container; and (c) a desiccant located between the inner container and the outer container;
wherein the resultant humidity barrier is sufficient to keep the dry composition dry for 20 days when the external conditions are 37°C and 100% relative humidity.

19. The composition of claim 16, further comprising a container that forms a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C and 30% relative humidity.

20. The composition of any of claims 1 to 19, wherein the at least one nucleoside triphosphate is a deoxyribonucleoside triphosphate.

21. The composition of 20, wherein the at least one deoxyribonucleoside triphosphate is chosen from deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP), deoxyuracil 5'-triphosphate (dUTP), and/or deoxyinosine 5'-triphosphate (dITP).

22. The composition of any of claims 1 to 21, wherein the at least one solid support is at least one bead.

23. The composition of claim 22, wherein the at least one bead has a diameter of about 1 to about 3 microns.

24. The composition of claim 22, wherein the at least one bead is at least one polystyrene bead.

25. The composition of claim 22, wherein the at least one bead is at least one magnetizable bead.

26. The composition of any of claims 1 to 21, wherein the at least one solid support is at least one electrode.

27. The composition of any of claims 1 to 26, wherein the first and second oligonucleotides are each about 15 to about 60 nucleotides long.

28. The composition of any of claims 1 to 27, wherein the at least one monovalent cation comprises at least one of potassium ions, ammonium ions, tetramethylammonium ions, and tetraethylammonium ions.

29. The composition of any of claims 1 to 28, wherein the at least one divalent cation comprises magnesium or manganese.

30. The composition of any of claims 1 to 29, wherein the at least one polymerase comprises a thermostable polymerase.

31. The composition of any of claims 1 to 29, wherein the at least one polymerase comprises a reverse transcriptase.

32. The composition of any of claims 1 to 29, wherein the at least one polymerase comprises Taq polymerase, Tth polymerase, TZ05 polymerase, Pfu polymerase, DyNAzyme TM polymerase derived from Thermus brockianus, Isis DNA polymerase TM derived from Pyrococcus abyssi or a Klenow fragment of DNA
polymerase I.

33. The composition of any of claims 1 to 32, wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5.

34. The composition of any of claims 1 to 33, wherein the at least one cryoprotectant comprises a disaccharide, a polysaccharide, or a polyalcohol.

35. The composition of claim 34, wherein the at least one cryoprotectant comprises sucrose or ficoll.

36. The composition of claim 34, wherein the at least one cryoprotectant comprises trehalose.

37. The composition of any of claims 1 to 36, wherein the label comprises an ECL moiety, a fluorophore, an enzyme label, a radioisotope, a chemiluminescent label, a bioluminescent label, a hapten, an antibody, or a dye.

38. The composition of any of claims 1 to 37, wherein the label comprises a ruthenium chelate, an osmium chelate, biotin, digoxigenin, fluorescein, rhodamine, or cyanine.

39. The composition of any of claims 1 to 38, wherein the label comprises bis(2,2'-bipyridyl)ruthenium(II) or tris(2,2'-bipyridyl)ruthenium(II).

40. A method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid sequence complementary to a second part of the target nucleic acid sequence; and (j) a third oligonucleotide linked to the at least one solid support and is capable of hybridizing with a third part of (1) the target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the target nucleic acid sequence, wherein at least one of (b) the at least one nucleoside triphosphate, (h) the first oligonucleotide, and (i) the second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - (j) in a container thereby forming a composition for detecting, amplifying, and/or isolating the target nucleic acid sequence.

41. The method of claim 40, wherein the third oligonucleotide is covalently linked to the solid support.

42. The method of claim 40, wherein the third oligonucleotide can be cleaved from the solid support.

43. The method of claim 40, 41, or 42, wherein at least one of the first and second oligonucleotides is modified with a label.

44. A method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - (i) in a container thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.

45. A method of making a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample comprising:
(1) obtaining the following components:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence; and (i) a second oligonucleotide capable of hybridizing to a second part of the target nucleic acid sequence or a sequence that is complementary to the target nucleic acid sequence and comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label, wherein the second oligonucleotide is not linked to the solid support until the target nucleic acid sequence has been amplified, wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement; and (2) combining (a) - (i) in a single container thereby forming a composition for detecting, amplifying, and/or isolating a target nucleic acid sequence.

46. The method of claim 45, wherein the linker substance is photoactivatable so that the linker substance can be linked to the solid support.

47. The method of claim 46, where the linker substance comprises an aryl azide.

48. The method of claim 40, 44, or 45, wherein the first oligonucleotide is modified with a label.

49. The method of any of claims 40 to 48, wherein a sample contains a nucleic acid sequence complementary to the target nucleic acid sequence.

50. The method of any of claims 40 to 48, wherein a sample does not contain a nucleic acid sequence complementary to the target nucleic acid sequence.

51. The method of any of claims 40 to 50, wherein an ECL coreactant is added to the composition of step (2).

52. The method of claim 51, wherein the ECL coreactant comprises a secondary amine and/or a tertiary amine.

53. The method of claim 51, wherein the ECL coreactant is at least one of peroxodisulfate; ethylamine; di-ethylamine; tri-ethylamine; tri-iso-propylamine;
di-n-propylamine; di-iso-propylamine; di-n-butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-butylamine; t-butylamine; di-n-pentylamine;
tri-n-pentylamine; N-ethylmorpholine; sparteine; tri-n-butylamine; triethanolamine;
dihydronicotinamide adenine dinucleotide; 1,4-diazobicyclo(2.2.2)octane;
ethylenediamine tetraacetic acid; oxalic acid; 1-ethylpiperidine; di-n-propylamine;
N,N,N',N'-Tetrapropyl-1,3-diaminopropane; DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer;
DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic acid; Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymethyl)-2,2',2"-nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid); N,N-Bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid; 4-(N-Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-1-(2-hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-propanesulfonic acid; and N,N-Bis(2-hydroxyethyl)glycine; N-(2-Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.

54. The method of claim 51, wherein the ECL coreactant is at least one of piperazine-1,4-bis(2-ethanesulfonic acid), tri-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane; and/or salts thereof.

55. The method of any of claims 40 to 54, wherein the at least one nucleoside triphosphate is modified with a label.

56. The method of any of claims 40 to 55, further comprising the step of lyophilizing the composition of step (2) to form a dry composition.

57. The method of claim 56, further comprising the step of sealing a container that holds the dry composition to form a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C
and 30% relative humidity.

58. The method of any of claims 40 to 57, (a) wherein the at least one solid support is at least one magnetizable bead having a diameter of about 1 to about 3 microns;
(b) wherein the first and second oligonucleotides are each about to about 90 nucleotides long;
(c) wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5;
(d) wherein the at least one polymerase comprises a thermostable polymerase; and (e) wherein at least one of the first and second oligonucleotides comprises an ECL moiety, a fluorophore, or a chemiluminescent label provided, however, that in embodiments not comprising the third oligonucleotide, the second oligonucleotide does not comprise an ECL moiety, a fluorophore, or a chemiluminescent label.

59. The method of any of claims 40 to 58, wherein the at least one nucleoside triphosphate is a deoxyribonucleoside triphosphate.

60. The method of claim 59, wherein the at least one deoxyribonucleoside triphosphate is chosen from deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP), deoxyuracil 5'-triphosphate (dUTP), and deoxyinosine 5'-triphosphate (dITP).

61. The method of any of claims 40 to 60, wherein the at least one solid support is at least one bead.

62. The method of claim 61, wherein the at least one bead has a diameter of about 1 to about 3 microns.

63. The method of claim 61, wherein the at least one bead is at least one polystyrene bead.

64. The method of claim 61, wherein the at least one bead is at least one magnetizable bead.

65. The method of any of claims 40 to 64, wherein the first and second oligonucleotides are each about 15 to about 60 nucleotides long.

66. The method of any of claims 40 to 65, wherein the monovalent cation is at least one of potassium ions, ammonium ions, tetramethylammonium ions, or tetraethylammonium ions.

67. The method of any of claims 40 to 66, wherein the divalent cation is magnesium or manganese.

68. The method of any of claims 40 to 67, wherein the polymerase is a thermostable polymerase.

69. The method of any of claims 40 to 67, wherein the polymerase is a reverse transcriptase.

70. The method of any of claims 40 to 67, wherein the at least one polymerase comprises Taq polymerase, Tth polymerase, TZ05 polymerase, Pfu polymerase, DyNAzyme TM polymerase derived from Thermus brockianus, Isis DNA polymerase TM derived from Pyrococcus abyssi or a Klenow fragment of DNA
polymerase I.

71. The method of any of claims 40 to 70, wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5

72. The method of any of claims 40 to 71, wherein the cryoprotectant comprises a disaccharide, a polysaccharide, or a polyalcohol.

73. The method of claim 72, wherein the cryoprotectant comprises sucrose or ficoll.

74. The method of claim 72, wherein the cryoprotectant comprises trehalose.

75. The method of any of claims 40 to 74, wherein the label comprises an ECL moiety, a fluorophore, an enzyme label, a radioisotope, a chemiluminescent label, a bioluminescent label, a hapten, an antibody, or a dye.

76. The method of claim 75, wherein the label comprises a ruthenium chelate, an osmium chelate, biotin, digoxigenin, fluorescein, rhodamine, or cyanine.

77. The method of claim 76, wherein the label comprises bis(2,2'-bipyridyl)ruthenium(II) or tris(2,2'-bipyridyl)ruthenium(II).

78. A method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by the method of claim 40 or 44;
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence are made;
(4) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (5) optionally detecting the label thereby detecting the target nucleic acid in the sample.

79. A method of detecting, amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or isolating a target nucleic acid sequence produced by the method of claim 45;
(2) adding a sample containing the target nucleic acid sequence to the first composition to form a second composition;
(3) alternately heating and cooling the second composition so that multiple copies of the target nucleic acid sequence can be made;
(4) linking the second oligonucleotide to the solid support;
(5) optionally isolating the multiple copies of the target nucleic acid sequence from step (3); and (6) optionally detecting the label thereby detecting the target nucleic acid in the sample.

80. The method of claim 78 or 79, wherein the sample contains the target nucleic acid sequence and a nucleic acid sequence complementary to the target nucleic acid sequence.

81. The method of claim 78 or 79, wherein the sample does not contain a nucleic acid sequence complementary to the target nucleic acid sequence.

82. The method of any of claims 78 to 81, wherein the target nucleic acid sequence comprises ribonucleic acid.

83. The method of any of claims 78 to 81, wherein the target nucleic acid sequence comprises deoxyribonucleic acid.

84. A kit for detecting, amplifying, and/or isolating a target nucleic acid sequence in a sample comprising a single container comprising the composition of any of claims 1 to 39.

85. The kit of claim 84, wherein the composition is a dry composition.

86. The kit of claim 84, further comprising instructions on how to use the kit.

87. A composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete-areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the i th first oligonucleotide is capable of hybridizing with a first part of the i th target nucleic acid sequence;
(i) N second oligonucleotides, wherein the i th second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the i th target nucleic acid sequence; and (j) N third oligonucleotides, wherein the i th third oligonucleotide is linked to the i th discrete area on the at least one solid support and is capable of hybridizing with a third part of (1) the i th target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the i th target nucleic acid sequence;

wherein N is a integer greater than or equal to 1; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate, (h) the i th first oligonucleotide, and (i) the i th second oligonucleotide is modified with a label; and wherein the composition does not comprise the target nucleic acid sequence or its complement.

88. The composition of claim 87, wherein at least one of the i th first and i th second oligonucleotides comprises a label.

89. The composition of claims 87 or 88, further comprising a container that holds the composition, wherein upon the addition of water to the container, the elements (a) - (j) are in liquid-contact with one another.

90. A composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas, wherein the i th discrete area is modified with an ith first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the i th first oligonucleotide is capable of hybridizing to a first part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence; and (i) N second oligonucleotides, wherein the i th second oligonucleotide is capable of hybridizing to a second part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence and comprises an i th second member of the pair of binding partners;

wherein N is a integer greater than or equal to 1; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence or its complement.

91. The composition of claim 90, further comprising a container that holds the composition, wherein upon the addition of water to the container, the elements (a) - (i) are in liquid-contact with one another.

92. The composition of claim 87, 89, 90, or 91, wherein 2<=5 N <=
1,000,000.

93. The composition of claim 87, 89, 90, or 91, wherein 2<=5 N <=
1,000.

94. The composition of claim 87, 89, 90, or 91, wherein N >= 10.

95. The composition of claim 87, 89, 90, or 91, wherein N >= 50.

96. The composition of claim 90 or 91, wherein the i th first oligonucleotide is modified with a label.

97. The composition of any of claims 87 to 96, further comprising an ECL coreactant.

98. The composition of claim 97, wherein the ECL coreactant comprises a secondary amine and/or a tertiary amine.

99. The composition of claim 97, wherein the ECL coreactant is at least one of peroxodisulfate; ethylamine; di-ethylamine; tri-ethylamine; tri-iso-propylamine; di-n-propylamine; di-iso-propylamine; di-n-butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-butylamine; t-butylamine;
di-n-pentylamine; tri-n-pentylamine; N-ethylmorpholine; sparteine; tri-n-butylamine;
triethanolamine; dihydronicotinamide adenine dinucleotide; 1,4-diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1-ethylpiperidine; di-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane;
DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic acid;
Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymethyl)-2,2',2"-nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid);

N,N-Bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid; 4-(N-Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-1-(2-hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-1-propanesulfonic acid; and N,N-Bis(2-hydroxyethyl)glycine; N-(2-Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.

100. The composition of claim 97, wherein the ECL coreactant is at least one of piperazine-1,4-bis(2-ethanesulfonic acid), tri-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane; and/or salts thereof.

101. The composition of any of claims 87 to 100, wherein the at the least one nucleoside triphosphate is modified with a label.

102. The composition of any of claims 87 to 101, wherein the composition is a dry composition.

103. The composition of claim 102, further comprising a container that forms a humidity barrier sufficient to keep the dry composition dry for 20 days when external conditions are 37°C and 100% relative humidity.

104. The composition of claim 102, further comprising (a) an inner container that holds the dry composition;
(b) an outer container; and (c) a desiccant located between the inner container and the outer container;
wherein the resultant humidity barrier is sufficient to keep the dry composition dry for 20 days when the external conditions are 37°C and 100% relative humidity.

105. The composition of claim 102, further comprising a container that forms a humidity barrier sufficient to keep the dry composition dry for 3 months when external conditions are 4°C and 30% relative humidity.

106. The composition of any of claims 87 to 105, wherein the at least one nucleoside triphosphate is a deoxyribonucleoside triphosphate.

107. The composition of claim 106, wherein the at least one deoxyribonucleoside triphosphate is chosen from deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP), deoxyuracil 5'-triphosphate (dUTP), and/or deoxyinosine 5'-triphosphate (dITP).

108. The composition of any of claims 87 to 107, wherein the at least one solid support is at least one electrode.

109. The composition of any of claims 87 to 108, wherein each of the N
discrete areas is a discrete electrode.

110. The composition of any of claims 87 to 109, wherein at least one of the N first oligonucleotides is about 15 to about 60 nucleotides long and wherein at least one of the N second oligonucleotides is about 15 to about 60 nucleotides long.

111. The composition of any of claims 87 to 110, wherein the at least one monovalent cation comprises at least one of potassium ions, ammonium ions, tetramethylammonium ions, and tetraethylammonium ions.

112. The composition of any of claims 87 to 111, wherein the at least one divalent cation comprises magnesium or manganese.

113. The composition of any of claims 87 to 112, wherein the at least one polymerase comprises a thermostable polymerase.

114. The composition of any of claims 87 to 112, wherein the at least one polymerase comprises a reverse transcriptase.

115. The composition of any of claims 87 to 112, wherein the at least one polymerase comprises Taq polymerase, Tth polymerase, TZ05 polymerase, Pfu polymerase, DyNAzyme.TM. polymerase derived from Thermus brockianus, Isis DNA polymerase.TM. derived from Pyrococcus abyssi or a Klenow fragment of DNA
polymerase I.

116. The composition of any of claims 87 to 115, wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5

117. The composition of any of claims 87 to 116, wherein the at least one cryoprotectant comprises a disaccharide, a polysaccharide, or a polyalcohol.

118. The composition of claim 117, wherein the at least one cryoprotectant comprises sucrose or ficoll.

119. The composition of claim 117, wherein the at least one cryoprotectant comprises trehalose.

120. The composition of any of claims 87 to 119, wherein the label comprises an ECL moiety, a fluorophore, an enzyme label, a radioisotope, a chemiluminescent label, a bioluminescent label, a hapten, an antibody, or a dye.

121. The composition of claim 120, wherein the label comprises a ruthenium chelate, an osmium chelate, biotin, digoxigenin, fluorescein, rhodamine, or cyanine.

122. The composition of claim 121, wherein the label comprises bis(2,2'-bipyridyl)ruthenium(II) or tris(2,2'-bipyridyl)ruthenium(II).

123. The composition of any of claims 87 to 122, (a) wherein the composition further comprises an ECL coreactant is at least one of piperazine-1,4 bis(2-ethanesulfonic acid), tri-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane;
and/or salts thereof;
(b) wherein the composition is a dry composition;
(c) wherein the composition further comprises a container that forms a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C and 30% relative humidity;
(e) wherein at least one of the N first oligonucleotides is about 10 to about 90 nucleotides long and wherein at least one of the N second oligonucleotides is about 10 to about 90 nucleotides long;

(f) wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5;
(g) wherein the at least one polymerase comprises a thermostable polymerase; and (h) wherein at least one of the i th first and i th second oligonucleotides comprises an ECL moiety, a fluorophore, or a chemiluminescent label provided, however, that in embodiments not comprising the i th third oligonucleotide, the i th second oligonucleotide does not comprise an ECL moiety, a fluorophore, or a chemiluminescent label.

124. A method of making a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the i th first oligonucleotide is capable of hybridizing with a first part of the i th target nucleic acid sequence;
(i) N second oligonucleotides, wherein the i th second oligonucleotide is capable of hybridizing with a nucleic acid sequence complementary to a second part of the i th target nucleic acid sequence; and wherein at least one of (b) the at least one nucleoside triphosphate, (h) the i th first oligonucleotide, and (i) the i th second oligonucleotide is modified with a label; and (j) N third oligonucleotides, wherein the i th third oligonucleotide is linked to the i th discrete area on the at least one solid support and is capable of hybridizing with a third part of (1) the i th target nucleic acid sequence; or (2) a nucleic acid sequence complementary to the i th target nucleic acid sequence, (2) linking the i th third oligonucleotide to the i th discrete area on the at least one solid support; and (3) combining (a) -(j) in a container thereby forming a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences;
wherein N is a integer greater than or equal to 1; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; and wherein the composition does not comprise the target nucleic acid sequence or its complement.

125. The method of claim 124, wherein upon the addition of water to the container, the elements (a) -(j)- are in liquid-contact with one another.

126. The method of claim 124 or 125, wherein the third oligonucleotide is covalently linked to the solid support.

127. The method of claim 124 or 125, wherein the third oligonucleotide can be cleaved from the solid support.

128. The method of any of claims 124 to 127, wherein at least one of the i th first and i th second oligonucleotides comprises a label.

129. The method of any of claims 124 to 128, further comprising the step of lyophilizing the composition of step (3) to form a dry composition.

130. The method of claim 129, further comprising the step of sealing a container that holds the dry composition to form a humidity barrier sufficient to keep the dry composition dry for 3 months when external conditions are 4°C and 30% relative humidity.

131. A method of making a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences comprising:

(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas, wherein the i th discrete area is modified with an i th first member of a pair of binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the i th first oligonucleotide is capable of hybridizing to a first part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence; and (i) N second oligonucleotides, wherein the i th second oligonucleotide is capable of hybridizing to a second part of the i th target nucleic acid sequence or a sequence that is complementary to the i th target nucleic acid sequence and comprises an i th second member of the pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein i th represents in turn all integers between 1 and N, including both 1 and N, and is used to designate target-nucleic-acid-specific elements of the composition; wherein at least one of (b) the at least one nucleoside triphosphate and (h) the first oligonucleotide is modified with a label; wherein if the first oligonucleotide is capable of hybridizing to the target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the complement of the target nucleic acid sequence, wherein if the first oligonucleotide is capable of hybridizing to the complement of target nucleic acid sequence then the second oligonucleotide is capable of hybridizing to the target nucleic acid sequence, and wherein the composition does not comprise the target nucleic acid sequence; and (2) combining (a) - (i) in a container thereby forming a composition for detecting, amplifying, and/or isolating N target nucleic acid sequences.

132. The method of claim 131, wherein upon the addition of water to the container, the elements (a) -(i) are in liquid-contact with one another.

133. The method of claim 124, 125, 131, or 132, wherein 2 <= N <=
1000,000.

134. The method of claim 124, 125, 131, or 132, wherein 2 <= N <=
1,000.

135. The method of claim 124, 125, 131, or 132, wherein N >= 10.

136. The method of claim 124, 125, 131, or 132, wherein N >= 50.

137. The method of any of claims 131 to 136, wherein the first oligonucleotide is modified with a label.

138. The method of any of claims 124 to 137, wherein the at least one nucleoside triphosphate is modified with a label.

139. The method of any of claims 124 to 138, wherein an ECL coreactant is added to the composition of step (2).

140. The method of claim 139, wherein the ECL coreactant comprises a secondary amine and/or a tertiary amine.

141. The method of claim 139, wherein the ECL coreactant is at least one of peroxodisulfate; ethylamine; di-ethylamine; tri-ethylamine; tri-iso-propylamine; di-n-propylamine; di-iso-propylamine; di-n-butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-butylamine; t-butylamine;
di-n-pentylamine; tri-n-pentylamine; N-ethylmorpholine; sparteine; tri-n-butylamine;
triethanolamine; dihydronicotinamide adenine dinucleotide; 1,4-diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1-ethylpiperidine; di-n-propylamine; N,N,N',N'-Tetrapropyl-l,3-diaminopropane;
DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8, Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic acid;
Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymethyl)-2,2',2"-nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid);

N,N-Bis(2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid; 4-(N-Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-1-(2-hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-1-propanesulfonic acid; and N,N-Bis(2-hydroxyethyl)glycine; N-(2-Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.

142. The method of claim 139, wherein the ECL coreactant is at least one of piperazine-1,4-bis(2-ethanesulfonic acid), tri-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane; and/or salts thereof.

143. The method of any of claims 124 to 142, (a) wherein the composition is a dry composition;
(b) wherein the composition further comprises a container that forms a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C and 30% relative humidity;
(c) wherein the at least one solid support is at least one electrode;
(d) wherein the first and second oligonucleotides are each about to about 90 nucleotides long;
(e) wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5;
(f) wherein the at least one polymerase comprises a thermostable polymerase; and (g) wherein at least one of the i th first and second oligonucleotides comprises an ECL moiety, a fluorophore, or a chemiluminescent label provided, however, that in embodiments not comprising the i th third oligonucleotide, the i th second oligonucleotide does not comprise an ECL moiety, a fluorophore, or a chemiluminescent label.

144. The method of claim 131 or 132, further comprising the step of lyophilizing the composition of step (2) to form a dry composition.

145. The method of claim 144, further comprising the step of sealing a container that holds the dry composition to form a humidity barrier sufficient to keep the dry composition dry for 3 months when the external conditions are 4°C
and 30% relative humidity.

146. The method of any of claims 124 to 145, wherein the at least one nucleoside triphosphate is a deoxyribonucleoside triphosphate.

147. The method of claim 146, wherein the at least one deoxyribonucleoside triphosphate is chosen from deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP), deoxythymidine 5'-triphosphate (dTTP), deoxyuracil 5'-triphosphate (dUTP), and deoxyinosine 5'-triphosphate (dITP).

148. The method of any of claims 124 to 147, wherein the at least one solid support is at least one electrode.

149. The method of any of claims 124 to 147, wherein each of the N
discrete areas is a discrete electrode.

150. The method of any of claims 124 to 149, wherein at least one of the N first oligonucleotides is about 15 to about 60 nucleotides long and wherein at least one of the N second oligonucleotides is about 15 to about 60 nucleotides long.

151. The method of any of claims 124 to 150, wherein the monovalent cation is at least one of potassium ions, ammonium ions, tetramethylammonium ions, or tetraethylammonium ions.

152. The method of any of claims 124 to 151, wherein the divalent cation is magnesium or manganese.

153. The method of any of claims 124 to 152, wherein the polymerase is a thermostable polymerase.

154. The method of any of claims 124 to 152, wherein the polymerase is a reverse transcriptase.

155. The method of any of claims 124 to 152, wherein the at least one polymerase comprises Taq polymerase, Tth polymerase, TZ05 polymerase, Pfu polymerase, DyNAzyme.TM. polymerase derived from Thermus brockianus, Isis DNA polymerase.TM. derived from Pyrococcus abyssi or a Klenow fragment of DNA
polymerase I.

156. The method of any of claims 124 to 155, wherein at least one buffering agent has an effective buffering capacity in the pH range of about 8.1 to about 8.5.

157. The method of any of claims 124 to 156, wherein the cryoprotectant comprises a disaccharide, a polysaccharide, or a polyalcohol.

158. The method of any of claims 124 to 156, wherein the cryoprotectant comprises sucrose or ficoll.

159. The method of any of claims 124 to 156, wherein the cryoprotectant comprises trehalose.

160. The method of any of claims 124 to 159, wherein the label comprises an ECL moiety, a fluorophore, an enzyme label, a radioisotope, a chemiluminescent label, a bioluminescent label, a hapten, an antibody, or a dye.

161. The method of claim 160, wherein the label comprises a ruthenium chelate, an osmium chelate, biotin, digoxigenin, fluorescein, rhodamine, or cyanine.

162. The method of claim 161, wherein the label comprises bis(2,2'-bipyridyl)ruthenium(II) or tris(2,2'-bipyridyl)ruthenium(II).

163. A method of detecting, amplifying, and/or isolating a N target nucleic acid sequences comprising:
(1) obtaining a first composition of claim 87 or 90;
(2) adding a sample which may contain the N target nucleic acid sequences to the first composition to form a second composition;
(3) alternately heating and cooling the second composition such that multiple copies of each of the N target nucleic acid sequences that are in the sample are made;
(4) allowing the multiple copies to link to the N discrete areas on the at least one solid support; and (5) optionally detecting or isolating the label thereby detecting the N
target nucleic acid sequences in the sample;
wherein N is an integer greater than or equal to 1.

164. The method of claim 163 wherein the first composition further comprises a container, wherein upon the addition of water to the container the elements of the first composition are in liquid-contact with one another.

165. The method of claim 163 wherein the first composition is a dry composition.

166. The method of claim 163, 164, or 165 wherein the sample contains N target nucleic acid sequences and at least one nucleic acid sequence complementary to at least one of the N target nucleic acid sequences.

167. The method of claim 163, 164, or 165, wherein the sample does not contain a nucleic acid sequence complementary to at least one of the N target nucleic acid sequences.

168. The method of any of claims 163 to 167, wherein at least one of the N target nucleic acid sequences comprises ribonucleic acid.

169. The method of any of claims 163 to 167, wherein at least one of the N target nucleic acid sequences comprises deoxyribonucleic acid: