WO2006007850A1 - Anti-rhesus d recombinant polyclonal antibody and methods of manufacture - Google Patents

Anti-rhesus d recombinant polyclonal antibody and methods of manufacture Download PDF

Info

Publication number
WO2006007850A1
WO2006007850A1 PCT/DK2005/000501 DK2005000501W WO2006007850A1 WO 2006007850 A1 WO2006007850 A1 WO 2006007850A1 DK 2005000501 W DK2005000501 W DK 2005000501W WO 2006007850 A1 WO2006007850 A1 WO 2006007850A1
Authority
WO
WIPO (PCT)
Prior art keywords
rhd
cells
antibody
library
individual
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2005/000501
Other languages
English (en)
French (fr)
Inventor
Søren Kofoed RASMUSSEN
Anne Bondgaard Tolstrup
Søren Bregenholt FREDERIKSEN
John Haurum
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Symphogen AS
Original Assignee
Symphogen AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EA200700249A priority Critical patent/EA014182B1/ru
Priority to JP2007521793A priority patent/JP4926054B2/ja
Priority to CA002574062A priority patent/CA2574062A1/en
Priority to BRPI0513706-3A priority patent/BRPI0513706A/pt
Priority to AU2005263331A priority patent/AU2005263331B8/en
Priority to US11/632,937 priority patent/US8198415B2/en
Priority to EP05760588A priority patent/EP1771483A1/en
Priority to NZ552265A priority patent/NZ552265A/en
Application filed by Symphogen AS filed Critical Symphogen AS
Priority to MX2007000644A priority patent/MX2007000644A/es
Publication of WO2006007850A1 publication Critical patent/WO2006007850A1/en
Priority to IL179658A priority patent/IL179658A/en
Anticipated expiration legal-status Critical
Priority to NO20070927A priority patent/NO20070927L/no
Priority to US13/493,623 priority patent/US20120322690A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/34Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against blood group antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/06Antiabortive agents; Labour repressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/005Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/77Internalization into the cell

Definitions

  • the present invention describes the production of an anti-Rhesus D recombinant polyclonal antibody (anti-RhD rpAb), as well as the general approach of generating a polyclonal working cell bank for later production of a desired polyclonal antibody.
  • the invention also relates to libraries encoding anti-RhD rpAb and to cell lines producing anti-RhD rpAb.
  • compositions comprising anti-RhD rpAb and their use in prophylaxis of hemolytic disease of the newborn (HDN), treatment of idiopathic thrombocytopenic purpura (ITP) and prevention of sensitization to the Rhesus D antigen after mistransfusions of RhD(+) blood to RhD(-) individuals.
  • HDN newborn
  • ITP idiopathic thrombocytopenic purpura
  • RhD(-) The Rhesus blood group antigens are located on transmembrane erythrocyte proteins encompassing the so-called C, c, E, e and D antigens. Approximately 16% of the Caucasian population is Rhesus D negative (RhD(-)) due to an inherited polymorphism. In addition, multiple genetic and serological variants of RhD exist (divided into category II- VII) of which RhD VI is the most clinically relevant. Since category VI positive red blood cells (RBC) carry fewer of the various epitopes of the D protein than RBC of other categories, RhD VI (+) individuals may form alloantibodies against RBC from other RhD positive (RhD(+)) individuals (Issitt, P. D. and Anstee, D. J., 1998. The Rh Blood Group System, Montgomery Scientific Publications, Durham, North Carolina, pp. 315-423). ⁇ Issitt & Anstee 1998 11809 /id ⁇
  • RhD negativity in itself is not associated with any medical conditions, but has important medical implications when a RhD(-) female carries a RhD(+) or RhD VI (+) fetus or a RhD VI (+) female carries a RhD(+) fetus. Fetomaternal RhD alloimmunization may then occur if fetal erythrocytes enter the maternal circulation, usually perinatally (during delivery), and thereby causes the induction of a maternal anti-RhD antibody response.
  • RhD-specific IgG-molecules from the mother will cross the placenta into the fetal circulation and mediate lysis of fetal erythrocytes, thereby causing Hemolytic Disease of Newborns (HDN). It has been estimated that on average 20% of RhD(-) women delivering a RhD(+) infant for the second time, and who are not protected appropriately with anti-D prophylaxis, will generate an anti-RhD antibody response. When untreated, approximately 30% of the newborn will have moderate anemia, jaundice, and hepatomegaly, and 20% develop severe anemia and hydrops fetalis, and severely affected newborns are at risk of neonatal death or permanent handicaps.
  • Polyclonal immunoglobulin preparations against RhD are used worldwide to prevent alloimmunization of pregnant RhD(-) and RhD VI (+) women, thereby preventing hemolytic disease of the newborn.
  • Polyclonal immunoglobulin preparations against RhD (anti-D) are currently obtained by pooling of blood plasma obtained from donors who have become hyperimmune, either through natural RhD alloimmunization or through vaccination of RhD negative volunteer males with RhD positive erythrocytes.
  • the efficacy of anti-RhD immunoglobulin preparations for prophylaxis of HDN is well established and has been in routine use for many years. As a result this severe disease has become a rarity.
  • anti-D immunoglobulin has also proven useful in the treatment of idiopathic thrombocytopenic purpura (ITP) (George, J. N., 2002. Blood Rev. 16, 37-38).
  • ITP is a hematological disorder, where autoantibodies results in an accelerated platelet clearance in the spleen and liver. Symptoms are decreased platelet levels resulting in bruising and bleeding. In severe cases the spleen is removed. This is however, not possible in infants due to severe side effect, thus alternative treatments like anti-D immunoglobulin are needed.
  • anti-D immunoglobulin is used after mistransfusions of RhD(+) blood to RhD(-) recipients in order to prevent sensitization to the Rhesus D antigen.
  • RhD VI (+) female carries a RhD(H-) fetus.
  • an anti-RhD VI mAb will not be able to prevent alloimmunization of the female.
  • a product with antibodies against Rhesus D category VI antigen as well as antibodies that do not bind category VI antigen but other common Rhesus D antigens is needed.
  • mAbs might be immunogenic. Although the mAbs are human, a first time treatment might result in an antibody response from the female treated with the mAb. Theoretically this may happen because the CDR regions of the mAb, which have never been seen by the immune system of the treated individual before, may be recognized as foreign if presented in a sufficiently large dose. Such a reaction will render the anti-RhD mAb useless in repeated prophylactic treatment.
  • the present invention provides a method for generating a manufacturing cell line which can express an anti-RhD recombinant polyclonal antibody (anti-RhD rpAb) as a single batch. DESCRIPTION OF THE INVENTION
  • the present invention provides methods for the consistent manufacturing of anti-RhD recombinant polyclonal antibody (anti-RhD rpAb). It is contemplated that the present invention will open up the possibility for large-scale manufacturing and production of a new class of prophylactic and therapeutic anti-RhD antibody products.
  • An anti-RhD rpAb of the present invention potentially has some advantages over monoclonal anti-Rhesus D antibodies. First of all every potential Rhesus D epitope will be covered by more than one antibody, thus an anti-RhD rpAb composition can be used in the prophylactic treatment of both RhD(-) and RhD VI females bearing a RhD(+) child. Hence, it will not be necessary to mix mAb from different production and purification batches in order to obtain full prophylactic effect.
  • an anti-RhD rpAb may be a good alternative. Since an anti-RhD rpAb according to the present invention is composed of between 5 and 56 variant antibody molecules, their individual concentration will be lower, and if one of the antibodies should be depleted due to immunogenicity, there will be plenty of others to cover the Rhesus D antigen, thus prophylaxis will still be efficient.
  • an anti-RhD rpAb antibody of the present invention can be performed from a single cell line, as a single batch.
  • the generation of a polyclonal manufacturing cell line for the anti-RhD rpAb production will be demonstrated in the detailed description and by a working example.
  • an "antibiotic resistance gene” is a gene encoding a protein that can overcome the inhibitory or toxic effect that an antibiotic has on a cell ensuring the survival and continued proliferation of cells in the presence of the antibiotic.
  • antibody describes a functional component of serum and is often referred to either as a collection of molecules (antibodies or immunoglobulin) or as one molecule (the antibody molecule or immunoglobulin molecule).
  • An antibody molecule is capable of binding to or reacting with a specific antigenic determinant (the antigen or the antigenic epitope), which in turn may lead to induction of immunological effector mechanisms.
  • An individual antibody molecule is usually regarded as monospecific, and a composition of antibody molecules may be monoclonal (i.e., consisting of identical antibody molecules) or polyclonal (i.e., consisting of different antibody molecules reacting with the same or different epitopes on the same antigen or even on distinct, different antigens).
  • Each antibody molecule has a unique structure that enables it to bind specifically to its corresponding antigen, and all natural antibody molecules have the same overall basic structure of two identical light chains and two identical heavy chains.
  • Antibodies are also known collectively as immunoglobulins.
  • the terms antibody or antibodies as used herein are also intended to include chimeric and single chain antibodies, as well as binding fragments of antibodies, such as Fab, Fab ' or F(ab) 2 molecules, Fv fragments or scFv fragments or any other stable fragment, as well as full-length antibody molecules and multimeric forms such as dimeric IgA molecules or pentavalent IgM.
  • anti-RhD antibody-encoding nucleic acid segment describes a nucleic acid segment comprising a pair of V H and V L genetic elements.
  • the segment may further comprise light chain and/or heavy chain constant region genetic elements, e.g. Kappa or Lambda light chain constant region and/or one or more of the constant region domains CHl, CH2, CH3 or CH4 selected from one of the isotypes IgGl, IgG2, IgG3, IgG4, IgAl, IgA2, IgM, IgD and IgE.
  • the preferred isotypes are IgGl and/or IgG3.
  • the nucleic acid segment may also comprise one or more promoter cassettes, either facilitating bi-directional or uni-directional transcription of the V H and V L -encoding sequences. Additional transcriptional or translational elements, such as functional leader sequences directing the gene product to the secretory pathway, poly A signal sequences, UCOE's and/or an IRES may also be present in the segment.
  • anti-RhD recombinant polyclonal antibody or "anti-RhD rpAb” describes a composition of recombinantly produced diverse antibody molecules, where the individual members are capable of binding to at least one epitope on the Rhesus D antigen.
  • the composition is produced from a single manufacturing cell line.
  • the diversity of the polyclonal antibody is located in the variable regions (V H and V L regions), in particular in the CDRl, CDR2 and CDR 3 regions.
  • bias is used to denote the phenomenon during recombinant polyclonal antibody production, wherein the composition of an expression library, polyclonal cell line, or polyclonal protein alters over time due to random genetic mutations, differences in proliferation kinetics between individual cells, differences in expression levels between different expression construct sequences, or differences in the cloning efficiency of DNA.
  • a distinct member of the anti-RhD rpAb denotes an individual antibody molecule of the recombinant polyclonal antibody composition, comprising one or more stretches within the variable regions, which are characterized by differences in the amino acid sequence compared to the other individual members of the polyclonal protein. These stretches are in particular located in the CDRl, CDR2 and CDR 3 regions.
  • the term "genome” is not to be taken literally as the normal complement of chromosomes present in a cell, but also extra-chromosomal elements that can be introduced into and maintained in a cell.
  • extra-chromosomal elements can include, but are not limited to, mini-chromosomes, YACs (yeast artificial chromosomes), MACs (mouse artificial chromosomes), or HACs (human artificial chromosomes).
  • head-to-head promoters refers to a promoter pair being placed in close proximity so that transcription of two genetic elements driven by the promoters occurs in opposite directions (bi-directional transcription). Construction of such a system is described in details in example 3 of US Patent No. 5,789,208, which is hereby incorporated by reference.
  • a head- to-head promoter can also be constructed with a stuffer composed of irrelevant nucleic acids between the two promoters. Such a stuffer fragment can easily contain more than 500 nucleotides.
  • hot-spot refers to a pre-established locus of the genome of the cell that has been selected or generated and characterized for highly efficient transcription of an integrated nucleic acid segment of interest upon integration of the expression vector into that site.
  • immunoglobulin commonly is used as a collective designation of the mixture of antibodies found in blood or serum, but may also be used to designate a mixture of antibodies derived from other sources or is used in the term "immunoglobulin molecule”.
  • IRES internal ribosome entry site
  • a first and a second polypeptide sequence can be translated from a single mRNA.
  • the first and second polynucleotide sequence can be transcriptionally fused via a linker sequence including an IRES sequence that enables translation of the polynucleotide sequence downstream of the IRES sequence.
  • a transcribed dicistronic RNA molecule will be translated from both the capped 5' end and from the internal IRES sequence of the dicistronic RNA molecule to thereby produce both the first and the second polypeptide.
  • the term "library” refers to a collection of variant nucleic acid sequences.
  • a member of the variant nucleic acid sequence is comprised of two variant genetic elements, e.g. V H and V L , it will often be termed a nucleic acid segment.
  • the collection of variant nucleic acid sequences/segments can either be in the form of a pool of such nucleic acid sequences, or it can be a collection of separate nucleic acid sequences (e.g. one unique sequence in each well of a 96 well plate).
  • a library of the present invention typically have at least 3, 5, 10, 20, 50, 1000, 10 4 , 10 5 or 10 5 distinct members.
  • library of vectors the variant nucleic acid sequences/segments have been inserted into a vector.
  • library and library of vectors can also be used interchangeably.
  • a library of anti-RhD antibody expression vectors refers to a collection of variant anti-RhD antibody-encoding nucleic acid sequences inserted into a vector carrying regulatory elements for transcription of the anti-RhD antibodies.
  • the regulatory elements can either be located in the inserted nucleic acid segments or in the vector framework.
  • the anti- RhD antibody expression vectors also carry at least one recombinase recognition sequences, e.g. a FRT site, it may also carry two different recombinase recognition sequences such as a FRT and a FRT' site.
  • a majority of the individual cells refers to a percentage of the cells such as more than 80%, preferably more than 85%, more preferably 90%, 95%, or even 99% or higher.
  • mass transfer or “transfer in-mass” is used to describe the transfer of nucleic acid segments of interest from one population of vectors to another population of vectors and doing so for each nucleic acid segments simultaneously without resorting to isolation of the individual segments of interest.
  • populations of vectors can be libraries containing for example variable regions, promoters, leaders or enhancing elements of interest.
  • These sequences can then be moved without prior isolation from for example a phage vector to a mammalian expression vector.
  • this technique ensures that the linkage between V H and V L diversity is not lost while moving libraries from, for example, a selection vector (e.g., a phage display vector) to a mammalian expression vector.
  • a selection vector e.g., a phage display vector
  • operably linked refers to a segment being linked to another segment when placed into a functional relationship with the other segment.
  • DNA encoding a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a leader that participates in the transfer of the polypeptide to the endoplasmic reticulum.
  • a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence.
  • polyclonal antibody describes a composition of different (diverse) antibody molecules which is capable of binding to or reacting with several different specific antigenic determinants on the same or on different antigens.
  • variability of a polyclonal antibody is located in the so-called variable regions of the polyclonal antibody, in particular in the CDR regions.
  • recombinant polyclonal manufacturing cell line refers to a mixture/population of protein expressing cells that are transfected with a library of variant nucleic acid segments of interest such that the individual cells, which together constitute the recombinant polyclonal manufacturing cell line, each carry only one transcriptionally active copy of a distinct nucleic acid segment of interest, which encodes one member of the recombinant polyclonal antibody of interest, and that each copy is integrated into the same site of the genome of each cell.
  • the cells constituting the recombinant polyclonal manufacturing cell line are selected for their ability to retain the integrated copy of the distinct nucleic acid segment of interest, for example by antibiotic selection.
  • Cells which can constitute such a manufacturing cell line can be for example bacteria, fungi, eukaryotic cells, such as yeast, insect cells or mammalian cells, especially immortal mammalian cell lines such as CHO cells, COS cells, BHK cells, myeloma cells (e.g., Sp2/0 cells, NSO), NIH 3T3, YB2/0 and immortalized human cells, such as HeLa cells, HEK 293 cells, or PER.C6.
  • immortal mammalian cell lines such as CHO cells, COS cells, BHK cells, myeloma cells (e.g., Sp2/0 cells, NSO), NIH 3T3, YB2/0 and immortalized human cells, such as HeLa cells, HEK 293 cells, or PER.C6.
  • recombinant antibody is used to describe an antibody molecule or several molecules that is/are expressed from a cell or cell line transfected with an expression vector comprising the coding sequence of the protein which is not naturally associated with the cell. If the antibody molecules are diverse or different, the term “recombinant polyclonal antibody” applies in accordance with the definition of a polyclonal antibody.
  • recombinase refers to an enzyme that catalyses recombination between two or more recombination sites or recombination recognition sequences.
  • Recombinases useful in the present invention catalyze recombination at specific recombination sites that are specific nucleic acid sequences recognized by a particular recombinase.
  • recombinase recognition site or "recombination site” describe a nucleic acid sequence which serves as site for both recognition and recombination by a site-specific recombinase enzyme.
  • a recombinase recognition site is generally comprised of short inverted repeat elements (11-13 bp in length) that flank a core sequence (6-8 bp in length).
  • Recombinase recognition sites are also termed recombinase target sites, recombination sites or integration sites and include as examples the FLP-site, loxP-site, attP/attB-sites, six-site, gix-site, R-site and Res-site.
  • Matching recombinase recognition sites for example are two wild type FRT sites considered to match, as well as an attB site and an attP site constitute a matching pair of recombinase recognition sites, whereas, a wildtype FRT site and a mutant FRT site will not necessarily constitute a matching pair of recombinase recognition sites; this will depend on the mutation.
  • RFLP analysis refers to "restriction fragment length polymorphism analysis", a method whereby the migratory gel pattern of nucleic acid molecule fragments is analyzed after cleavage with restriction enzymes.
  • V H and V L chains are distinct members of a polyclonal protein, where each member is comprised of two different polypeptide chains, e.g. V H and V L chains, is expressed from an individual cell. This situation may arise when the individual cell has integrated into the genome, more than one pair of genetic elements, where each pair of genetic elements encodes a distinct member of the polyclonal protein. In such situations unintended combinations of the polypeptide chains expressed from the genetic elements can be made.
  • V H -V L chain scrambling is an example of the scrambling defined above.
  • the scrambling occurs when unintended combinations of V H and V L polypeptides are produced from a cell where two different V H and V L -encoding nucleic acid segments are integrated into transcriptional active sites in the same cell. Such a scrambled antibody molecule is not likely to retain the original specificity, and thus might not have any therapeutic effect.
  • selection is used to describe a method where cells have acquired a certain characteristic that enable the isolation from cells that have not acquired that characteristic. Such characteristics can be resistance to a cytotoxic agent or production of an essential nutrient, enzyme, or color.
  • selectable marker gene e.g., a gene conferring resistance against some cytotoxic drug such as certain antibiotics, a gene capable of producing an essential nutrient which can be depleted from the growth medium, a gene encoding an enzyme producing analyzable metabolites or a gene encoding a colored protein which for example can be sorted by FACS) which is co-introduced into the cells together with the gene(s) of interest.
  • a selectable marker e.g., a gene conferring resistance against some cytotoxic drug such as certain antibiotics, a gene capable of producing an essential nutrient which can be depleted from the growth medium, a gene encoding an enzyme producing analyzable metabolites or a gene encoding a colored protein which for example can be sorted by FACS
  • transfection is herein used as a broad term for introducing foreign DNA into a cell.
  • the term is also meant to cover other functional equivalent methods for introducing foreign DNA into a cell, such as e.g., transformation, infection, transduction or fusion of a donor cell and an acceptor cell.
  • the term "vector” refers to a nucleic acid molecule into which a nucleic acid sequence can be inserted for transport between different genetic environments and/or for expression in a host cell.
  • a vector capable of integrating into the genome of a host cell at a pre-determined, specific locus in the genome is herein named "a vector for site-specific integration". If the vector carries regulatory elements for transcription of the nucleic acid sequence inserted in the vector (at least a suitable promoter), the vector is herein called “an expression vector”.
  • an isotype-encoding vector refers to a vector carrying nucleic acid sequences encoding an antibody isotype.
  • phagemid vector and “phage vector” are used interchangeably.
  • plasmid and "vector” are used interchangeably.
  • the invention is intended to include such other forms of vectors, which serve equivalent functions for example plasmids, phagemids and virus genomes or any nucleic acid molecules capable of directing the production of a desired protein in a proper host.
  • V H :LC and V H :V L indicate a particular pair of a variable heavy chain sequence with a light chain or a variable light chain sequence.
  • Such particular pairs of V H and V L sequences can either be nucleic acid sequences or polypeptides.
  • particular V H and V L pairs confer binding specificity towards the rhesus D antigen.
  • Ab antibody.
  • Anti-RhD rpAb anti-Rhesus D recombinant polyclonal antibody.
  • CASY Cell Counter + Analyzer System.
  • ELISA Enzyme-Linked Immunosorbent Assay.
  • FRT FIp Recombinase Target.
  • GFP Green Flourescent Proteins.
  • HDN hemolytic disease of the newborn.
  • ITP idiopathic thrombocytopenic purpura.
  • LTR Long Terminal Repeat.
  • mAb monoclonal antibody.
  • pMCB polyclonal master cell bank.
  • PVDF polyvinylidene difluorid.
  • pWCB polyclonal working cell bank.
  • RBC red blood cells.
  • RhD Rhesus D.
  • Fig. IA Flow chart outlining the generation of a recombinant polyclonal manufacturing cell line and the production of a recombinant polyclonal antibody.
  • 1) Illustrates a bulk transfection strategy; 2) illustrates a semi-bulk transfection strategy and 3) illustrates an individual transfection strategy.
  • A) Illustrates the library of anti-RhD antibody expression vectors (horizontal lines), the arrowheads illustrate the grouping of the vectors. In strategy 1 the vectors are grouped in bulk, in strategy 2 they are grouped in smaller fractions (semi- bulk), whereas in strategy 3 they are kept separate from each other (individual).
  • C) Illustrates selection of cells that site-specifically have integrated an anti-RhD antibody-encoding nucleic acid segment into the host cell genome,
  • D) Illustrates the generation of a polyclonal anti-RhD antibody library stock, where the selected cells constituting the integrated anti-RhD antibody-encoding nucleic acid segments are stored in a freezer. It is optional to bank individual clones or pool the clones.
  • F Illustrates the stage in the production where the polyclonal cell line is propagated for seeding of a larger bioreactor (intermediate seeding steps are an option although not illustrated). In strategy 2 and 3, this is the stage where the polyclonal cell clone stock no longer is kept as individual clones or semi-bulk fractions, but pooled into a collection of cells, forming a recombinant polyclonal manufacturing cell line (this polyclonal manufacturing cell line may also be stored as a frozen stock).
  • G Illustrates the final production obtained from the bioreactor manufacturing. Following the production phase, the polyclonal protein composition is harvested for purification and characterization of the product.
  • Fig. IB Flow chart outlining the generation a pWCB/pMCB and a sub-pWCB from individually transfected host cells and the seeding of a polyclonal manufacturing cell line.
  • A) Illustrates a library comprised of variable region-encoding nucleic acid segments, the arrowheads illustrate the individual members of the library.
  • B) Illustrates the transfection, where each individual member of the library is used to transfect a host ceil. The transfection requires as many separate tubes as there are individual members of the library.
  • C) Illustrates selection of cells that have integrated a variable region-encoding nucleic acid segment into their genome in a stable manner
  • D) Illustrates the selection of individual cell lines that have similar proliferation rates and/or productivity, e.g. by cloning and analysis of single cells sorted by FACS. This step is optional in the generation of a pWCB/pMCB and may also be performed after step E.
  • E) Illustrates the generation of a frozen library stock, constituted of n times individual cell lines each expressing one member of the library comprised of variable region-encoding nucleic acid segments used for transfection. It is optional to bank individual clones into a frozen library stock prior to the generation of a pWCB/pMCB.
  • F) Illustrates the mixing of the individual cell lines, where ampoules from the individual library stock are thawed and expanded in separate cell cultures, followed by the mixing of a predefined number of cells from each culture into a single cell culture.
  • G) Illustrates generation of a pWCB/pMCB by freezing down aliquots from the mixed cell culture in F, thereby generating a collection of vials.
  • H) Illustrates the generation of a sub-pWCB by expanding a single vial from the pMCB and freezing down aliquots with approximately the same number of cells as in the vial from the pMCB.
  • I) Illustrates the generation of a polyclonal manufacturing cell line from a seed train (intermediate seeding steps which are not illustrated) initiated either from the pWCB or the sub-pWCB.
  • Phage display vector Em351, an E. coli vector used to generate an anti-RhD Fab phage display library by inserting heavy chain variable region and the light chain fragments amplified from a suitable donor into the vector at the indicated Ascl/Xhol and IMhel/Notl restriction sites, respectively.
  • pUC Ori origin of replication.
  • Human CHl sequence encoding human immunoglobulin gamma 1 heavy chain domain 1.
  • PeIB modified bacterial PeIB leaders for targeting expression of the Fab to the periplasmic space of the E.coli.
  • Mycut proteinase recognition site.
  • Amber stop amber stop codon.
  • gIII phage M 13 truncated geneIII (from bp 198 to the C-terminal).
  • Fig. 3A-C Alignment of the nucleic acid sequences encoding the variable heavy chain (V H ) of the 56 selected RhD clones.
  • the individual clone names are indicated to the right of the alignment, and the position of CDR regions are indicated above the alignments.
  • Fig. 4A-E Alignment of the nucleic acid sequences encoding the entire light chain of the 56 selected RhD clones.
  • the individual clone names together with an indication of whether it is a Kappa or Lambda chain are indicated to the right of the alignment, and the position of CDR regions are indicated above the alignments.
  • Fig. 5 Alignment of the amino acid sequences corresponding to V H of the 56 selected RhD clones. The individual clone names are indicated to the right of the alignment, and the position of CDR regions are indicated above the alignments.
  • Fig. 6A-B Alignment of the amino acid sequences corresponding to V L of the 56 selected RhD clones, wherein (A) corresponds to the Kappa chains and (B) to the Lambda chains.
  • the individual clone names are indicated to the right of the alignment, and the position of CDR regions are indicated above the alignments.
  • Neo exp. vector Schematic representation of the mammalian expression vector used to facilitate site-specific integration into the genome of a host cell of the anti-RhD antibody- encoding nucleic acid segments.
  • pUC origin pUC origin of replication. Restriction enzyme sites: Xhol, Ascl, Nhel and Notl.
  • Pl/P2 promoter set driving the expression of the light chain and IgG heavy chain, respectively.
  • LH heavy chain leader sequence.
  • VH Sequence coding for the variable heavy chain of an anti-RhD Ab.
  • Human IgGl constant heavy Sequences coding for the human constant IgGl heavy chain.
  • RBG polyA Rabbit ⁇ -globin polyA signal sequence.
  • BGH polyA Bovine Growth Hormone polyA signal sequence.
  • LK kappa chain leader sequence.
  • Light chain Sequence coding for the light chain of an anti-RhD Ab.
  • FRT site FIp recombinase recognition sequence.
  • Neomycin Neomycin resistance gene.
  • SV40 polyA Simian virus 40 polyA signal sequence.
  • Fig. 8 Cation exchange chromatograms of anti-RhD rpAb composition from aliquots 3948 and 3949 after 9 weeks cultivation.
  • the lower diagram corresponds to aliquot 3949 and the upper one to aliquot 3948.
  • the Y-axis of the top diagram has been displaced in order to separate it from the lower diagram.
  • Peaks A - J comprise antibodies differing in net charge and individual antibodies appearing charge heterogeneous.
  • Fig. 9 Gel picture showing Hinfl RFLP analysis on RT-PCR product derived from polyclonal cell line aliquots 3948+ and 3949+ (FCW065) producing anti-RhD rpAb after 11 weeks cultivation. Bands which can be assigned to specific clones are identified.
  • Fig. 10 T-RFLP patterns of anti-Rhesus D antibody light chains from a polyclonal cell culture expressing anti-RhD rpAb with eight different anti-Rhesus D antibodies.
  • the eight different anti-Rhesus D clones have been assigned to the peaks indicated by arrows.
  • Fig. 11 T-RFLP patterns of anti-Rhesus D antibody heavy chain variable regions from a polyclonal cell culture expressing anti-RhD rpAb with twenty-five different anti-Rhesus D antibodies at a given time point. The twenty-five different anti-Rhesus D clones have been assigned to the peaks indicated by arrows.
  • Fig. 12 cDNA distribution estimated by T-RFLP of eight different anti-Rhesus D heavy chain- encoding sequences from a polyclonal cell culture which was cultivated for five weeks.
  • Fig. 13 Shows the relative content (%) of an anti-RhD rpAb with eight different antibodies analyzed using cation-exchange chromatography. Integrated chromatographic peaks were assigned to individual antibodies from the retention times and peak patterns obtained from single antibodies analyzed individually using cation-exchange chromatography under identical conditions.
  • Fig. 14 Cation-exchange chromatogram of an anti-RhD rpAb with twenty-five individual members from a sample obtained after 4 weeks cultivation. Peaks ACl to 25 comprise antibodies differing in net charge and individual antibodies appearing charge heterogeneous.
  • Fig 15 (A) Shows a comparison of the potency of three batches, SymO4:21, SymO4:23, and SymO4:24, of anti-RhD pAb with 25 individual members, produced by fed batch cultivation in 5 L scale. Binding of pAb to RhD-positive erythrocytes was measured by FACS and the mean fluorescence intensity (MFI) is shown as a function of pAb concentration in ng/ml. Further, the functional activity of an anti-RhD pAb with 25 individual members was measured on SymO4:21 and SymO4:24 in a combined ADCC/phagocytosis assay.
  • MFI mean fluorescence intensity
  • Fig. 16 Cation-exchange chromatography profiles showing samples taken at different stages during down-stream processing of an anti-RhD rpAb sample containing 25 individual members represented by material collected following capture elution (A), Sephadex G-25 (B), DEAE-Sepharose (C), and MEP Hypercel (D)
  • the present invention provides a recombinant polyclonal antibody expression system for the consistent manufacturing of anti-RhD recombinant polyclonal antibody (anti-RhD rpAb) from one or a few cell lines.
  • One of the major advantages of the manufacturing method of the present invention is that all the members constituting the anti-RhD rpAb can be produced in one or a few bioreactors or equivalents thereof. Further, the anti-RhD rpAb composition can be purified from the reactor as a single preparation without having to separate the individual members constituting the anti-RhD rpAb during the process.
  • anti-RhD mAbs purified anti-RhD monoclonal antibodies
  • anti-RhD mAbs purified anti-RhD monoclonal antibodies
  • Such a production of an anti-RhD mAb mixture would be very costly, and time and space consuming compared to the method of the present invention for producing an anti-RhD recombinant polyclonal.
  • the individual cells within the mixture of cells composing the polyclonal manufacturing cell line will need to be as uniform as possible.
  • the expression system of the present invention uses site- specific integration into the genome of the individual host cells.
  • the system of the present invention encompasses a library of anti-RhD antibody expression vectors for site-specific integration comprising the variant nucleic acid segments encoding the anti-RhD rpAb.
  • Individual nucleic acid segments from the library are inserted into individual cells at the same pre-established chromosomal location by site-specific integration at a predefined recombination recognition site or by a recombinase-mediated cassette exchange procedure, thereby generating a cell line, wherein the individual cells expresses a distinct member of the anti-RhD rpAb.
  • multiple integrations might occur in some of the cells constituting the recombinant polyclonal manufacturing cell line. This, however, is not considered to pose a problem as long as a majority of the individual cells express a single distinct member of the anti-RhD rpAb. Preferably this is achieved by ensuring a single integrant in the genome of the majority of the individual cells or if there are more integrants, ensuring that only one is transcribed.
  • Recombinases such as Cre, FIp, beta-recombinase, Gin, Pin, PinB, PinD, R/RS, Tn3 resolvase, XerC/D integrase/recombinase, lambda integrase, or phage ⁇ C31 integrase can be used.
  • Suitable recombinases for integration into the chromosomal location can be provided either (i) by expression from the cell's own genome into which said nucleic acid segment is introduced, (ii) by being operatively encoded by the vector inserted into the cell, (iii) through expression from a second nucleic acid molecule, or (iv) as a protein.
  • the anti-RhD antibody-encoding nucleic acid segment contained in an individual vector of the library is integrated into a locus that mediates high-level transcription and expression of the anti-RhD antibody nucleic acid segment, a so-called "hot-spot".
  • the host cell line used is preferably a mammalian cell line comprising those typically used for biopharmaceutical protein expression, e.g., CHO cells, COS cells, BHK cells, myeloma cells (e.g., Sp2/0 cells, NSO), YB2/0, NIH 3T3, and immortalized human cells, such as HeLa cells, HEK 293 cells, or PER.C6.
  • CHO cells were used.
  • a person of ordinary skill in the art would easily be able to substitute CHO cells with other mammalian cells as described, or even utilize other types of cells, including plant cells, yeast cells, insect cells, fungi and bacteria.
  • the choice of cell type is not intended to be limiting to the invention.
  • a mammalian cell line containing a pre-characterized hot-spot, mediating high expression levels of the anti-RhD rpAb is used for the manufacture.
  • the mammalian cell line contains a single recombinase recognition site located in a pre-identified hot-spot.
  • variant anti-RhD antibody-encoding nucleic acid segments are integrated in a site-specific manner utilizing the same chromosomal integration site in the host cells. Such incorporation into a single specific site minimizes positional effects otherwise seen with random integration or integration into multiple sites in a genome. Further, scrambling among V H and V L chains is not likely to occur when using a single specific site for integration.
  • the individual transfected host cells are expressing the same overall antibody apart from the differences observed in the variable region of the antibody. Therefore, a majority of cells within such a pool of cells should display similar characteristics with respect to productivity and genetic stability and hence this technology offers the possibility of a controlled production of an anti-RhD rpAb.
  • an anti-RhD rpAb may comprise antibody molecules that are characterized by sequence differences between the individual antibody molecules in the variable region (V region) as well as in the constant region.
  • the anti-RhD rpAb composition can be composed of antibodies with any heavy chain isotype mentioned above or combinations thereof.
  • Preferred anti-RhD rpAb compositions contain IgGl constant regions, IgG3 constant regions or IgGl and IgG3 constant regions.
  • each or some of the V H and V L pairs are expressed with a human IgGl, IgG3, IgAl and/or IgA2 constant heavy chain.
  • a first library comprising V H and V L -encoding segments may either be generated by combinatorial techniques (e.g. EP 0 368 684) or techniques maintaining the cognate pairing (pairs of variable region-encoding sequences derived from the same cell, described in WO 05/042774 claiming the priority of the unpublished patent application DK 200400782). Further, V H and V L -encoding segment libraries may be generated by incorporating isolated CDR gene fragments, into an appropriate framework (e.g. Soderlind, E. et al., 2000. Nat. Biotechnol.
  • This first library is screened for V H and V L -encoding nucleic acid segments producing antibodies or fragments with binding specificity towards RhD, thereby generating a library of anti-RhD Ab-encoding nucleic acid segments.
  • the screening is preceded by an enrichment step for example a so-called biopanning step.
  • biopanning technologies are phage display (Kang, A.S. et al. 1991. Proc Natl Acad Sci U S A 88, 4363-4366), ribosome display (Schaffitzel, C. et al. 1999. J. Immunol.
  • FACS and magnetic bead sorting are also applicable for enrichment (panning) purposes using labeled antigen.
  • the screening for Rhesus D binders are generally performed with immunodetection assays such as agglutination, FACS, ELISA, FLISA and/or immunodot assays.
  • the generated sub-library of V H and V L -encoding nucleic acid segments generally needs to be transferred from the screening vector to an expression vectors suitable for site-specific integration and expression in the desired host cell. It is important that the sequences encoding the individual V H :V L pairs are maintained during the transfer. This can either be achieved by having the individual members of the sub-library separate and moving V H and V L -encoding sequences one by one. Alternatively, the vectors constituting the sub- library are pooled, and the sequences encoding the V H :V L pairs are moved as segments, keeping the V H and V L -encoding sequences together during the transfer. This process is also termed mass transfer, and enables an easy transfer of all the selected V H :V L pairs from one vector to another.
  • an anti-RhD recombinant polyclonal antibody composition comprises a defined subset of individual antibodies, based on the common feature that they exhibit binding to at least one epitope on the Rhesus D antigen e.g. epDl, epD2, epD3, epD4, epD5, epD6/7, epD8 and/or epD9, but not or very weakly to Rhesus C, c, E, e antigens.
  • D antigen e.g. epDl, epD2, epD3, epD4, epD5, epD6/7, epD8 and/or epD9
  • the anti-RhD rpAb composition is composed of at least one antibody which bind to epD3, epD4 and epD9 (RhD category VI antigen binding antibody) and further antibodies which at least in combination binds to the remaining epitopes epDl, epD2, epD5, epD6/7 and epD8, e.g. an antibody against RhD category II or III antigen, or a RhD category IV or V antigen binding antibody combined with an antibody against category VII antigen.
  • an anti-RhD rpAb composition has at least 5, 10, 20, 50, 100 or 500 distinct variant members.
  • a further embodiment of the present invention is a recombinant polyclonal manufacturing cell line, comprising a collection of cells transfected with a library of anti-RhD polyclonal antibody-encoding nucleic acid segments, wherein each cell in the collection is capable of expressing one member of the library, which encodes a distinct member of an anti-RhD rpAb or fragment and which is located at the same site in the genome of individual cells in said collection, wherein said nucleic acid segment is not naturally associated with said cell in the collection.
  • variant nucleic acid segments encoding the anti-RhD rpAb are all derived from naturally occurring sequences, for example isolated from a donor, either as combinatorial V H : V L pairs or as cognate pairs, and not derived by mutation.
  • compositions of cells that contain variant nucleic acids located at a single specific site in the genome within each cell have been described in WO 02/44361. This document discloses the use of the cells to identify molecules having desirable properties, but the reference does not deal with the provision of a production system or with the provision of polyclonal antibody characterized by a specific binding to an antigen.
  • the host cell The host cell
  • a suitable host cell comprises, in a region of its genome, one or more suitable recombination sites, i.e., nucleic acid sequences recognizable by one or more recombinase enzymes, hence also termed recombinase recognition sequences.
  • suitable recombination sites i.e., nucleic acid sequences recognizable by one or more recombinase enzymes, hence also termed recombinase recognition sequences.
  • the recombination site is operably linked to a first selection gene (e.g., an antibiotic resistance gene) situated 3' (downstream) to the recombination site.
  • a weak promoter e.g., a truncated SV40 early promoter
  • a transcription start codon may be situated 5' (upstream) to the recombination site that constitutes an integral part of the resistance marker-coding region.
  • the transcription start codon initiates the start of transcription of the selection gene in the host cell before transfection with the library of anti- RhD antibody expression vectors encoding the anti-RhD rpAb.
  • the host cell line only has one recombination site, and if it has more than one recombinase recognition sequence, these should be non-homologous as described in the section "The vector for site- specific integration", and only allow for a single integration into the genome.
  • Host cells for site-specific integration as described above can be generated from any cell which can integrate DIMA into their chromosomes or retain extra-chromosomal elements such as mini-chromosomes, YACs (Yeast artificial chromosomes), MACs (Mouse artificial chromosomes), or HACs (Human artificial chromosomes).
  • YACs Yeast artificial chromosomes
  • MACs Mae artificial chromosomes
  • HACs Human artificial chromosomes
  • mammalian cells such as CHO cells, COS cells, BHK cells, myeloma cells (e.g., Sp2/0 or NSO cells), fibroblasts such as NIH 3T3, and immortalized human cells, such as HeLa cells, HEK 293 cells, or PER.C6, are used.
  • non-mammalian eukaryotic or prokaryotic cells such as plant cells, insect cells, yeast cells, fungi, E. coli etc., can also be employed.
  • the cell line which is to be used as starting material is sub-cloned by performing a so-called limiting dilution of the cell line down to a single cell level, followed by growing each single cell to a new population of cells prior to transfection with the library of vectors of interest. Such sub-cloning can also be performed later in the process of selecting the right cell line, if desired.
  • the host cells for site-specific integration may be obtained by transfection with a randomly integrating plasmid comprising a weak promoter (e.g., a truncated SV40 early promoter), a transcription start codon, a recombination site situated 3' to the start codon.
  • a weak promoter e.g., a truncated SV40 early promoter
  • the integrating plasmid also comprises a marker gene coupled to a first selection gene.
  • a marker gene can be used to evaluate the relative strength of expression at the genomic location used for inserting a nucleic acid sequence of interest.
  • a marker gene (e.g., beta- galactosidase (LacZ), green fluorescent protein (GFP) or a cell surface marker) can be linked to the first selection gene in a gene fusion or transcriptionally linked by an IRES (internal ribosomal entry site) such that co-expression of the first selection gene and marker gene occurs.
  • IRES internal ribosomal entry site
  • Cells with the recombination sequence inserted at a spot with particularly active transcription will lead to high expression of the marker gene e.g. GFP or LacZ.
  • High expressers can be selected by fluorescence activated cell sorting (FACS) and cloned. At this point it should also be analyzed whether the integrant is a single integrant. This can be performed by real-time PCR and Southern blotting. The preparation of cells having an FRT site at a pre-determined location in the genome was described in e.g. US 5,677,177.
  • Another method for evaluating relative expression levels from cells transfected with an integrating plasmid is to perform an additional integration-excision step on the cells generated as described above.
  • This pool of selected cells are transfected again, with a plasmid encoding a recombinase corresponding to the recombination site of the integrating plasmid and a second plasmid containing a second selection marker without a start codon, the coding region of which is preceded by a recombination sequence likewise corresponding to the first integrating plasmid.
  • This second plasmid also contains the coding sequence for a fluorescent marker protein (e.g., GFP (or equivalent fluorescent proteins) driven by a suitable promoter.
  • a fluorescent marker protein e.g., GFP (or equivalent fluorescent proteins
  • the recombinase mediates integration of this plasmid into the host cell genome where a similar recombination sequence previously has been inserted by the integrating plasmid.
  • Cells with the recombination sequence inserted at a spot with particularly active transcription will lead to high expression of the fluorescent protein.
  • High expressers are selected by fluorescence activated cell sorting (FACS) and cloned.
  • FACS fluorescence activated cell sorting
  • Clones with consistently high expression and containing one copy of the inserted plasmid are transfected with the recombinase and selected by the first selection marker, identifying cells where the second plasmid sequence has been removed by the recombinase, making the first selection marker work again. These cells still contain the first recombination sequence inserted at a transcriptional hot-spot and can now be used for the expression of genes of interest.
  • Cell lines which achieve high expression of the marker gene upon integration of a single copy of the plasmid, are used for transfection with the anti-RhD antibody expression library.
  • the recombination site in the host cell is preferably located in a gene or region of particularly active expression, i.e., in a so-called hot-spot.
  • the vector for site-specific integration is the vector for site-specific integration
  • a suitable vector comprises a suitable recombination site linked to a suitable selection gene different from the selection gene used for construction of the host cell.
  • suitable selection genes for use in mammalian cell expression include, but are not limited to, genes enabling for nutritional selection, such as the thymidine kinase gene (TK), glutamine synthetase gene (GS), tryptophan synthase gene (trpB) or histidinol dehydrogenase gene (hisD).
  • selection markers are antimetabolite resistance genes conferring drug resistance, such as the dihydrofolate reductase gene (dhfr) which can be selected for with hypoxanthine and thymidine deficient medium and further selected for with methotrexate, the xanthine-guanine phosphoribosyltransferase gene (gpt), which can be selected for with mycophenolic acid, the neomycin phosphotransferase gene (neo) which can be selected for with G418 in eukaryotic cells and neomycin or kanamycin in prokaryotic cells, the hygromycin B phosphotransferase (hyg, hph, hpt) gene which can be selected for with hygromycin, the puromycin N-acetyl- transferase gene (pac) which can be selected for with puromycin or the Blasticidin S deaminase gene(Bsd) which can be selected for with
  • genes encoding proteins that enables sorting e.g. by flow cytometry can also be used as selection markers, such as green fluorescent protein (GFP), the nerve growth factor receptor (NGFR) or other membrane proteins, or beta-galactosidase (LacZ).
  • GFP green fluorescent protein
  • NGFR nerve growth factor receptor
  • LacZ beta-galactosidase
  • the selectable gene is neither preceded by a promoter nor equipped with a translation initiating codon.
  • the promoter and ATG codon is provided at the selected site-specific recombination site. If the vector is integrated at a location other than the selected recombination site in the genome of the host cell, no expression of this second selection gene can occur due to lack of promoter and initiation codon. If integration occurs at the selected recombination site in the genome of the host cell, the second selection gene is expressed and expression of the first selection gene is lost.
  • Integration may e.g., be carried out using a so-called FRT site/Flp recombinase recognition sequence (5 ' -gaagttcctattccgaagttcctattctctagaaagtataggaacttc-3 ' (SEQ ID NO 1) or variants thereof) in the genome and on the vector for site-specific integration together with the FIp recombinase or mutants thereof from Saccharomyces cerevisiae.
  • FRT site/Flp recombinase recognition sequence 5 ' -gaagttcctattccgaagttcctattctctagaaagtataggaacttc-3 ' (SEQ ID NO 1) or variants thereof
  • recombinase systems may equally well be used, including those of Cre recombinase and a variety of lox sites such as loxP from bacteriophage Pl or variants or mutants thereof, e.g., Iox66, Iox71, Iox76, Iox75, Iox43, Iox44 and Iox511 (C. Gorman and C. Bullock, Curr. Opinion in Biotechnology 2000, 11: 455-460) or by using phage integrase ⁇ C31 or lambda integrase, which carries out recombination between the attP site and the attB site (A. C. Groth et al.
  • recombinase systems that could be utilized in the present invention are, but are not limited to, the ⁇ -recombinase-six system from bacterial plasmid pSM 19035 (Rojo and Alonso 1995), the Gin-gix system from bacteriophage Mu (Crisona et al 1994), the R-RS system from Zygosaccharomyces rouxii (Onouchi et al 1995), or Tn3 resolvase which recognize res recombination sites (Stark et al 1994) or the XerC/D system from E coli (Blakely and Sherratt 1994).
  • recombinase cassette mediated exchange uses non-homologous recombination sites.
  • two non-identical recombination sites are introduced into the host genome for the generation of specific target sites.
  • Recombination sites corresponding to those flanking the target site also flank the construct containing the gene of interest.
  • WO 99/25854 which is hereby incorporated by reference in its entirety.
  • the use of non ⁇ homologous recombination sites was shown to suppress excision of the gene of interest from the chromosome.
  • non-identical recombination sites can be composed of any of the recombination sites described above as long as the corresponding recombinases are provided and the sites cannot recombine with each other.
  • non-identical recombination sites could consist of a FRT site and a mutant FRT site utilizing a FIp recombinase for integration (Schlake and Bode 1994, Biochemistry 33, 12746-12751), a loxP site and a mutant non-compatible loxP site utilizing the Cre recombinase (Langer et al 2002, Nucleic
  • the integrating plasmid is transferred to the host cells by retroviral infection.
  • the plasmid consists of a combination of a reporter gene and a first selection marker gene as well as the retroviral elements required for infection.
  • the retroviral 3'LTR contains two different FRT sites.
  • a non functional second selection marker gene which lacks a promoter and the translation initiating codon is located 3' to these sites.
  • the 3'LTR sequence is copied to the 5'LTR. This results in the flanking of the reporter gene and the first selection marker gene by two different FRT sites on each side.
  • the sequence between the outer FRT sites can be exchanged against an anti-RhD antibody-encoding nucleic acid segment under the control of a strong promoter.
  • the cassette containing the anti-RhD antibody-encoding nucleic acid segment is flanked by the same set of FRT sites.
  • the reaction is catalyzed by the FIp recombinase.
  • an IRES element and a translation initiating codon are located further downstream of the nucleic acid segment.
  • the non functional selection marker gene located in the 3' LTR sequence outside the FRT sites is activated by the translation initiating codon provided by the cassette constituting the anti- RhD antibody-encoding nucleic acid segment.
  • the exchange status can further be enriched if a negative selection marker (e.g. thymidine kinase) is present in the integrating vector.
  • a negative selection marker e.g. thymidine kinase
  • the integrating vector can also be transferred to the host cells by standard transfection.
  • the integrating cassette is flanked by an FRT site at the 5' end and a different FRT' site at the 3' end.
  • the ATG-deficient second resistance marker gene is positioned further downstream of the 3' FRT' site.
  • the integrating vector is an isotype-encoding vector, where the constant regions (preferably including introns) are present in the vector prior to insertion of the V H and V L comprising segment from the screening vector.
  • the constant regions present in the vector can either be the entire heavy chain constant region (CHi to CH 3 or to CH 4 ) or the constant region encoding the Fc part of the antibody (CH 2 to CH 3 or to CH 4 ).
  • the light chain Kappa or Lambda constant region may also be present prior to transfer. The choice of the number of constant regions present, if any, depends on the screening and transfer system used.
  • the heavy chain constant regions can be selected from the isotypes IgGl, IgG2, IgG3, IgG4, IgAl, IgA2, IgM, IgD and IgE.
  • Preferred isotypes are IgGl and/or IgG3.
  • the vector for site-specific integration of the anti-RhD antibody-encoding nucleic acid segment contains suitable promoters or equivalent sequences directing high levels of expression of each of the V H and V L chains.
  • the promoters are of mammalian origin.
  • the V H and V L -encoding sequences are placed as pairs in the vector used for integration (one pair per vector molecule), thereby ensuring that they will be kept together throughout the integration process.
  • the promoters are located within the anti-RhD antibody-encoding nucleic acid segment.
  • a head-to-head promoter configuration in the expression vector is used (Fig. 7).
  • two promoters one in front of the V H genetic element and one in front of the V L genetic element, or one promoter in front of V H or V L combined with an IRES sequence between the heavy and light genetic elements, can be used to achieve expression.
  • a nucleic acid sequence encoding a functional leader sequence can be included in the expression vector to direct the gene product to the endoplasmic reticulum or a specific location within the cell such as an organelle.
  • a strong polyadenylation signal sequence can be situated 3' of the heavy chain and light chain-encoding sequences. The polyadenylation signal ensures termination and polyadenylation of the nascent RNA transcript and is correlated with message stability.
  • the expression vector for site-specific integration can carry additional transcriptional regulatory elements, such as enhancers or UCOE (ubiquitous chromatin opening elements) for increased expression at the site of integration.
  • Enhancers are nucleic acid sequences that interact specifically with cellular proteins involved in transcription.
  • the UCOE opens chromatin or maintains chromatin in an open state and facilitates reproducible expression of an operably-linked gene (described in more detail in WO 00/05393, hereby incorporated by reference in its entirety).
  • UCOE ubiquitous chromatin opening elements
  • Methods for introducing a nucleic acid sequence into a cell are known in the art. These methods typically include the use of a DNA vector to introduce the sequence of interest into the cell, the genome or an extra-chromosomal element. Transfection of cells may be accomplished by a number of methods known to those skilled in the art, including calcium phosphate precipitation, electroporation, microinjection, liposome fusion, RBC ghost fusion, protoplast fusion, and the like.
  • a library of anti-RhD antibody expression vectors wherein each individual vector comprises one single copy of a nucleic acid segment, encoding a distinct member of the anti-RhD rpAb, is used.
  • This library of anti-RhD antibody expression vectors collectively encodes the anti-RhD rpAb.
  • Suitable vectors for site-specific integration were described in the previous section.
  • the individual vectors constituting the library of anti- RhD antibody-encoding nucleic acid segments can either be mixed together into a single composition, or the individual vectors encoding an individual member of the anti-RhD rpAb can be kept in separate compositions or in mixtures of approximately 5 to 50 individual vectors of the library in a composition.
  • a recombinant polyclonal manufacturing cell line and the production of a recombinant polyclonal antibody from such a cell line can be obtained by several different transfection and manufacturing strategies. These strategies are outlined in Fig. IA and described in more detail below.
  • One way of generating the recombinant polyclonal manufacturing cell line is to use a library of vectors mixed together into a single composition for the transfection of the host cell line. This method is termed bulk transfection or transfection in bulk (all the individual members of the library are transfected into the host cell line in one tube). Generally, the vector and host cell design previously described will ensure that a polyclonal cell line will be obtained upon appropriate selection. In such a cell line a majority of the individual cells have integrated one copy of a nucleic acid segment, encoding a distinct member of the anti-RhD rpAb from the library of anti-RhD antibody expression vectors into the genome.
  • the single copy of the nucleic acid segment is integrated into a single specific site of the genome of each cell in the collection of cells, thereby generating a polyclonal cell line comprised of individual cells expressing individual members of the anti-RhD rpAb.
  • a frozen stock of the polyclonal cell line is generated before initiation of the anti-RhD rpAb manufacturing.
  • Another way of generating the recombinant polyclonal manufacturing cell line is to split the library of anti-RhD antibody expression vectors into fractions, containing approximately 5 to 50 individual vectors of the library before transfection.
  • a fraction of the library constitutes 10 to 15 individual vectors.
  • Each composition is then transfected into an aliquot of host cells. This method is termed semi-bulk transfection. The number of aliquots transfected will depend on the size of the library and the number of individual vectors in each fraction. If the library for example constitutes 50 distinct variant members, which are split into fractions containing 10 distinct variant members in a composition, 5 aliquots of host cells would need to be transfected with a library composition constituting a distinct fraction of the original library.
  • the aliquots of host cells are selected for site-specific integration.
  • the distinct aliquots are selected separately. However, they can also be pooled before selection.
  • the aliquots can be mixed before generating the frozen stock, immediately after they have been retrieved from the stock or after a short proliferation time.
  • the aliquots of cells are kept separate throughout production, and the polyclonal antibody composition is assembled by combining the products of each aliquot rather than the aliquots of cells before production.
  • a third way of generating the recombinant polyclonal manufacturing cell line is a high throughput method in which host cells are transfected separately using the individual vectors constituting the library of anti-RhD antibody expression vectors. This method is termed individual transfection.
  • the individually transfected host cells are preferably selected for site- specific integration separately. However, they can also be pooled before selection.
  • the individual cell clones generated upon selection may be analyzed with respect to proliferation time and integration pattern and preferably, those with similar growth rates and a single site- specific integrant are used to generate a frozen library stock.
  • the individual cell clones can be mixed to obtain the desired polyclonal cell line before generating the stock, immediately after they have been retrieved from the stock, or after a short proliferation time. Alternatively, the individually transfected host cells are mixed even earlier, namely before selection is performed.
  • a shared feature in the manufacturing strategies outlined in the above is that all the individual members constituting the anti-RhD rpAb can be produced in one, or a limited number of bioreactors, with approximately 5 to 10 as the maximum. The only difference is the stage at which one chooses to generate the collection of cells that constitutes the recombinant polyclonal manufacturing cell line.
  • the host cell line to be used for expression and production of an anti-RhD rpAb has at least one nucleic acid sequence recognizable by a recombinase enzyme. The preparation of such a host cell line was described in the section "The host cell”.
  • the vector for site-specific integration is preferably integrated in a predefined genomic locus that mediates high-level expression, a so-called hot-spot.
  • gene amplification can be performed using selection for a DHFR gene or a glutamine synthetase (GS) gene. This requires the use of vectors comprising such a selection marker.
  • the following description is one example of how to obtain a recombinant polyclonal antibody manufacturing cell line, where scrambling of the chains is minimal if existing at all.
  • a promoter cassette for inducible expression can also be used.
  • the promoters can be placed head-to-tail for unidirectional transcription.
  • CHO-FIp-In cells Invitrogen, Carlsbad, CA) which stably express the lacZ-
  • Zeocin fusion gene are used for the experiment, rendering the cells resistant to the antibiotic Zeocin.
  • the cells are maintained in a suitable media medium containing Zeocin.
  • the cells are co-transfected in bulk with a plasmid expressing the FIp recombinase and the library of anti- RhD antibody expression vectors for site-specific integration encoding the anti-RhD rpAb and a different selection marker (neomycin). After transfection, the cells are cultivated in the presence of neomycin. Cells that exhibit resistance to neomycin are then preferably adapted to growth in suspension as well as serum free conditions, this can be performed in one or two steps and with or without selection pressure.
  • the cells are adapted to grow in suspension under serum free conditions prior to transfection of the cells.
  • scaling up can be initiated using different culture systems, such as conventional small culture flasks, Nunc multilayer cell factories, small high yield bioreactors (MiniPerm, INTEGRA-CELLine, wavebags, BeIIoCeII) and spinner flasks to hollow fiber-and bioreactors.
  • the suitable production time and choice of final bioreactor size are dependent on the desired yield of protein from the batch and expression levels from the cell line. Times might vary from a couple of days up to three month.
  • the cells are tested for antibody production using ELISA.
  • the expressed anti-RhD rpAb is isolated from the supernatant.
  • the anti-RhD rpAb is purified and characterized. Examples of purification and characterization procedures are described later.
  • a polyclonal antibody is that it is constituted of a number of individual antibody molecules where each antibody molecule is homologous to the other molecules of the polyclonal antibody, but also has a variability that is characterized by differences in the amino acid sequence between the individual members of the polyclonal antibody. These differences are normally confined to the variable region in particular the CDR regions, CDRl, CDR2 and CDR3. This variability of a polyclonal antibody can also be described as diversity on the functional level, e.g., different specificity and affinity with respect to different antigenic determinants on the same or different antigens located on one or more targets.
  • the diversity constitutes a sub-set of the diversity observed in a donor derived immunoglobulin product.
  • Such a sub-set is carefully selected and characterized with respect to its ability to bind desired target antigens, in this particular case the Rhesus D antigen.
  • One of the concerns with respect to production of a recombinant polyclonal antibody may be whether the clonal diversity is maintained in the final product.
  • the clonal diversity may be analyzed by RFLP or sequencing of (RT)-PCR products from the cells expressing the anti-RhD rpAb.
  • the diversity can also be analyzed on protein level by functional tests (e.g., ELISA) on the anti-RhD rpAb produced by the cell line, by anti-idiotypic antibodies to individual members or by chromatographic methods.
  • Clonal bias if it exists, can be estimated by comparing the clonal diversity of the initial library, used for transfection, with the diversity found in the pool of cells (polyclonal cell line) expressing the anti-RhD rpAb.
  • Clonal diversity of an anti-RhD rpAb can be assessed as the distribution of individual members of the polyclonal composition. This distribution can be assessed as the total number of different individual members in the final polyclonal antibody composition compared to the number of different encoding sequences originally introduced into the cell line during transfection. In this case sufficient diversity is considered to be acquired when at least 50% of the encoding sequences originally used in the transfection can be identified as different individual members of the final anti-RhD rpAb.
  • At least 75% of the anti-RhD antibody-encoding sequences used for transfection can be identified as antibodies in the final composition. Even more preferred at least 85% to 95%, and most preferred a 100% of the anti-RhD antibody-encoding sequences used for transfection can be identified as antibodies in the final composition.
  • the distribution of individual members of the anti-RhD rpAb composition can also be assessed with respect to the mutual distribution among the individual members. In this case sufficient clonal diversity is considered to be acquired if no single member of the composition constitutes more than 75 % of the total number of individual members in the final anti-RhD rpAb composition. Preferably, no individual member exceeds more that 50%, even more preferred 25 % and most preferred 10% of the total number of individual members in the final polyclonal composition.
  • the assessment of clonal diversity based on the distribution of the individual members in the polyclonal composition can be performed by RFLP analysis, sequence analysis or protein analysis such as the approaches described later on for characterization of a polyclonal composition.
  • Clonal diversity may be reduced as a result of clonal bias which can arise a) during the cloning process, b) as a result of variations in cellular proliferation, or c) through scrambling of multiple integrants. If such biases arise, each of these sources of a loss of clonal diversity is easily remedied by minor modifications to the methods as described herein.
  • the transfer of the genes of interest from one vector to another may be designed in such a way that cloning bias is limited. Mass transfer techniques and a careful selection of the E. coli strain used for amplification can reduce the cloning bias. Another possibility is to perform an individual transfer of each polynucleotide encoding an individual member of the polyclonal antibody, between screening vectors and vectors for site-specific integration.
  • sub-cloning of the cell line prior to transfection with the library of interest may be performed using a limiting dilution of the cell line down to the single cell level and growing each single cell to a new population of cells (so- called cellular sub-cloning by limiting dilution).
  • a limiting dilution of the cell line down to the single cell level and growing each single cell to a new population of cells (so- called cellular sub-cloning by limiting dilution).
  • cellular sub-cloning by limiting dilution are then selected as starting material based on their proliferation and expression properties.
  • the selection pressure used to ensure that only cells that have received site-specific integrants will survive might affect proliferation rates of individual cells within a polyclonal cell line. This might be due to the favoring of cells that undergo certain genetic changes in order to adapt to the selection pressure. Thus, the choice of selection marker might also influence proliferation rate-induced bias. If this occurs, different selection markers should be tested. In cases where selection is based on a substance that is toxic to the cells, the optimal concentration should be tested carefully, as well as whether selection is needed throughout the entire production period or only in the initial phase.
  • Fluorescence labeled antibodies can be used to enrich for highly productive cells derived from a pool of cells transfected with IgG constructs (Brezinsky et al. 3. 2003. Immunol Methods 277, 141- 155). This method can also be used to sort cells expressing similar levels of immunoglobulin, thereby creating a homogenous cell population with respect to productivity. Likewise, by using labeling with the fluorescent dye 5,6-carboxylfluorescein diacetate succinimidyl ester (CFSE) cells showing similar proliferation rates can be selected by FACS methods. Further, differences in expression levels of the individual members of the anti-RhD rpAb may also introduce a bias into the final product over a prolonged period of time.
  • FACS fluorescence activated cell sorting
  • the polyclonal cell line is generated by mixing separately transfected clones after selection (the 3 rd approach in Fig. IA)
  • the following selection criteria may be set up for the individual clones at the cell culture level prior to mixing: proliferation rates have to be between 24 and 32 hours, the productivity should exceed 1.5 pg antibody per cell per day, and the culture should show a homogenous cell population assessed by an intra cellular staining method. If desired a more homogenous cell population for each individual clone can be obtained with the surface staining method described by Brezinsky prior to mixing the individual clones by gating on a particular area of the population in connection with the FACS analysis.
  • a host cell line is transfected in bulk with the library of anti-RhD antibody expression vectors.
  • Such a library constitutes many copies of each distinct member of the library. These copies should preferably be integrated into a large number of host cells.
  • Preferably at least 100, 1000, 10000 or 100000 individual cells are transfected with copies of distinct members of the library of variant nucleic acid segments.
  • a library of distinct variant nucleic acid segments is composed of 1000 distinct members which are each integrated into 1000 individual cells, 10 6 clones containing a site-specifically integrated anti-RhD antibody-encoding segment should arise from the transfection.
  • the gausian curve of individual cell doubling rates should influence the general population only in very small degrees. This will increase the probability of keeping the clonal composition constant, even if a low percentage of the manufacturing cells should exhibit aberrant growth and/or expression properties.
  • the section "Establishing an expression system for high-level expression of a polyclonal protein” describes three alternative ways of establishing a polyclonal manufacturing cell line.
  • the section describes the generation of a frozen library stock which is constituted of a collection of cells, obtained by bulk or semi-bulk transfection, where each individual cell in the library stock is capable of expressing an individual member from a library of anti-RhD antibody expression vectors.
  • the clonal diversity requirements already described is fulfilled by the collection of cells, such that essentially all members of the library can be expressed from a frozen library stock ampoule, when thawn and expanded to establish a polyclonal manufacturing cell line.
  • the frozen library stock can also be considered as a polyclonal working cell bank (pWCB), in that a single vial from the frozen library stock can be thawn and expanded into a polyclonal manufacturing cell line.
  • pWCB polyclonal working cell bank
  • the frozen library stock is composed of separate cell lines, which have been individually transfected with an individual member of a library of anti-RhD antibody expression vectors. The transfectants are selected for stable expression of the integrated vector-derived nucleic acid segment from their genome.
  • the nucleic acid segments are integrated site-specifically into one or more sites in the genome of the transfectants, and even more preferred in a single site of the genome.
  • the transfected cells obtained e.g. from clonal colonies upon selection may either be isolated and maintained as single clones or pooled to generate a pool of clones expressing the same anti-RhD antibody.
  • a single clone of cells as well as pool of clones expressing the same antibody is termed an individual cell line.
  • the frozen library stock in this third approach, would be composed of 25 individual cell lines (not a mixture of cell lines) each expressing an individual member from the library of anti-RhD antibody expression vectors.
  • one vial from this library stock will result in the generation of a monoclonal anti-RhD antibody if used for manufacturing.
  • the present invention exemplifies a library of anti-RhD antibody expression vectors.
  • the generation of a frozen library stock is independent of the antigen specificity of the polyclonal protein produced from a library comprised of variable region-encoding nucleic acid segments and may be used with any other library comprised of antibody V H and V L - encoding nucleic acid segments, or T cell receptor (TcR) ⁇ and ⁇ , or ⁇ and ⁇ -encoding nucleic acid segments.
  • a library comprised of variable region-encoding nucleic acid segments can in addition to the variable regions also encode one or more constant regions.
  • a library comprised of antibody V H and V L -encoding nucleic acid segments may result in Fv, scFv, Fab molecules or full-length antibody molecules
  • a library comprised of TcR variable region- encoding segments may result in molecules composed of TcR variable domain fragments, soluble TcRs or full-length TcRs.
  • the frozen library stock is composed of individual cell lines it will be appropriate to generate a pWCB which can be used for the establishment of the polyclonal manufacturing cell line by thawing and expanding the contents of a single ampoule.
  • the individual cell lines used to generate such a pWCB are either obtained from i) a single clone or ii) a pool of clones (a pool of single colonies obtained after selection).
  • the clones have been obtained from host cells individually transfected with, and selected for stable expression of an individual member of a library comprising variable region-encoding nucleic acid segments, such as antibody V H and V L -encoding segments or TcR ⁇ and ⁇ -, or ⁇ and ⁇ - encoding segments.
  • the individual cell lines are obtained from cloned or subcloned cells, e.g. by subjecting a cell line originating from i) or ii) (see previous description) to limiting dilution or single cell FACS analysis and selection, or by selecting high expression clones e.g. using a robot like the ClonePix FL (see below).
  • the individual cell lines used to generate the pWCB as described above may be pre-stored in a frozen library stock of individual cell lines, from which an ampoule of each individual cell line is thawn and expanded prior to the generation of a pWCB.
  • the individual cell lines express full-length antibodies with properties that differ from the properties of the antibodies produced by the other members of the pWBC, e.g. different antigen specificity, different affinity, different variable or CDR regions and/or different constant regions.
  • Each cell line used to generate the pWCB produces a different member of a polyclonal protein.
  • each distinct member of the polyclonal protein binds a particular antigen.
  • it is preferred that each distinct member is produced from a single specific site in the genome of each host cell.
  • a pWCB is generated by mixing a predefined number of cells from each individual cell line.
  • the cells are mixed in equal numbers (a 1: 1 ratio), although other ratios also may be desired (see later).
  • the mixture of cells is frozen down in aliquots, in that they are distributed into a number of vials with a defined number of cells in each vial. These vials are frozen and stored as the pWCB for later manufacturing purposes.
  • the number of vials constituting the pWCB exceeds 10, 25, 50, 75, 100, 200, 500 or 1000 vials.
  • the individual vials in a pWCB may be thawn at different points in time generating different batches of the polyclonal manufacturing cell line which are capable of producing a polyclonal protein with essentially the same composition from batch to batch (See Example 5).
  • the polyclonal manufacturing cell line may be expanded from a sub-pWCB, which is derived from a pWCB.
  • the sub-pWCB is generated by thawing a single vial from a pWCB and expanding the cells for a number of generations sufficient to produce a total number of cells which can be frozen down in a new series of aliquots (the sub-pWCB), with approximately the same number of cells in each sub- pWCB aliquot as in the pWCB vial originally used to generate the sub-pWCB.
  • the advantage of this approach is that the pWCB now serves as a master cell bank as known from other recombinant protein production protocols.
  • the pWCB may also be termed a polyclonal master cell bank (pMCB).
  • pMCB polyclonal master cell bank
  • individual cell lines which have been selected for stable expression of an individual member of a library of variable region- encoding nucleic acid segments as described above are further characterized with respect to their proliferation rates and/or productivity prior to generation of a pWCB.
  • cell lines with similar proliferation rates or productivity are selected for the generation of a pWCB.
  • cell lines with similar productivity as well as similar proliferation rates are selected for the generation of the pWCB.
  • the cell lines are adapted to serum free suspension culture prior to the characterization of proliferation rates and/or productivity.
  • the parental cells used for transfection are adapted to serum free suspension culture prior to transfection.
  • Proliferation rates can be assessed by methods known in the art, for example as described in example 2 of the current invention. Proliferation rates for mammalian cell lines should be between 18 and 100 hours, preferably between 22 and 40 hours and most preferred between 24 and 32 hours. The productivity should exceed 0.5 pg protein per cell per day (pg/(cell*day)), preferably it should exceed 1, 1.5, 3, 5 or 8 pg/(cell*day). Further, the cell line should show a homogenous cell population with respect to expression when assessed by an intra-cellular staining method. If desired a more homogeneous cell population for each individual cell line can be obtained by cloning e.g. by the FACS sorting methods described below.
  • the individual cell lines are FACS sorted to identify cells with a homogeneous expression level, after the transfection and selection procedures.
  • the possibility of sorting for individual high-expressing clones or a sub-pool of cells with high expression levels by gating on a particular area of the population in connection with the FACS analysis is therefore an additional embodiment of the present invention.
  • the generation of cloned cells by FACS analysis and selection is particularly useful when the individual cell lines are generated from a pool of clones.
  • Fluorescence labeled antibodies can be used to sort for cells expressing high levels of the desired protein e.g. antibody or TcR, thereby creating a homogeneous cell population with respect to productivity.
  • This technique is based on the observation that secreted proteins can be detected on the surface of the cell secreting them, and the amount of surface protein apparently corresponds to the expression levels of the individual cell.
  • the high producing cells can therefore be single cell sorted upon staining with a labeled antibody, followed by analysis by FACS.
  • the technique has been described by Brezinsky (Brezinsky et al. J. 2003. Immunol Methods 277, 141-155).
  • An alternative sorting technique is based on the coupling of a ligand, with specificity to the protein expressed from the cells, to the surface of the cells.
  • a ligand with specificity to the protein expressed from the cells
  • an anti-Fc antibody or an anti-idiotype antibody can be coupled to the surface of the protein secreting cell population via biotin.
  • the antibodies secreted by an individual cell are then captured by the anti-Fc antibodies on the surface of that cell.
  • the high producing cells can be sorted by FACS upon staining with a labeled antibody. This technique has been described in EP 667896.
  • single cells having a high expression level are analyzed based on the FACS profile obtained by one of the described techniques.
  • the individual cell clones are then expanded and potentially analyzed with respect to proliferation rates and productivity as described above.
  • a sub-pool of cells having the highest expression level as identified by the FACS profile is collected by sorting.
  • the sub-pool of cells from the individual cell line can likewise be analyzed with respect to proliferation rates and productivity if desired.
  • a robot such as the ClonePixFL robot (Genetix, UK) is used to select clones exhibiting high expression levels and/or similar growth properties. This is done as follows: The colonies obtained after transfection and selection are grown in a semi-solid medium which allows for detection of high-producing colonies by capturing the secreted protein product in the immediate proximity of the colony. The production level from each colony is determined by means of immunofluorescence labeling of the protein expressed by the cells followed by image software selection of the best clones based on predetermined selection criteria such as expression level and growth properties.
  • each colony can be assessed by the robot using light detection imaging. Colonies with the desired production and/or growth properties are then isolated by the robot and transferred to 96-well plates for further propagation.
  • individual cell lines with similar productivity are selected for the generation of the pWCB.
  • individual cell lines constituting the pWCB are generated from cloned cells, e.g. obtained by single cell sorting, limiting dilution or robot picking, with a high expression level or from a pool of cells with high expression level.
  • cloned cell lines are termed cloned cell lines.
  • cloned cell lines are used to generate the pWCB.
  • the individual cell lines are mixed at different ratios upon generation of a pWCB.
  • the individual cell lines can be mixed according to predetermined criteria based on the properties of the individual cell lines and/or individual protein member expressed by said cell line, e.g. specific productivity or binding affinity.
  • individual cell lines expressing certain antibodies binding particularly critical antigens or epitopes can be supplied in excess of the remaining member cell lines of the pWCB, e.g. in 2-fold, 3-fold, 5-fold or 10-fold higher amounts.
  • One member cell line may for example be added in a 2: 1 ratio over all the other members, e.g. 4 x 10 6 cells of member 1 and 2 x 10 6 cells of each of the remaining member cell lines.
  • a pWCB for production of an Anti-RhD rpAb is generated. Even more preferred such a pWCB is generated such that cell lines which produce antibodies with reactivity against a RhD category VI antigen constitute at least 5%, 8%, 10%, 12%, 15%, 20% or 25% of the total amount of cells included in the pWCB.
  • This approach of differentiated ratios of the individual cell lines in the pWCB may also be adopted to circumvent differences in proliferation rates and productivity among the individual cell lines, in particular if these have not been selected for similarity in these traits.
  • this particular member(s) may be added to the pWCB in an increased amount to compensate for its slow growth.
  • a cell line with a proliferation rate of 50 hours be added in a 2: 1 ration if the remaining cell lines constituting the pWCB have proliferation rates between 22 and 30 hours.
  • the ratio of cell lines with short doubling times may be reduced to ensure that these will not take over during manufacturing.
  • the ratios of the individual cell lines in a pWCB may be adjusted upon analysis of the polyclonal protein products produced from the polyclonal manufacturing cell lines generated from the pWCB. Such adjustments may for example be made based on IEX profiles or equivalent characterization tools.
  • a new pWCB may be generated, wherein the ratio of the cell lines producing these particular protein members are reduced. And visa versa, if a particular member is produced in a low amount, a pWCB with an increased ratio of the cell line producing this member may be generated.
  • Isolation of anti-RhD rpAb from culture supernatants is possible using various chromatographic techniques that utilize differences in the physico-chemical properties of proteins, e.g. differences in molecular weight, net charge, hydrophobicity, or affinity towards a specific ligand or protein. Proteins may thus be separated according to molecular weight using gel filtration chromatography or according to net charge using ion-exchange (cation/anion) chromatography or alternatively using chromatofocusing.
  • Affinity chromatography combined with subsequent purification steps such as ion-exchange chromatography, hydrophobic interactions and gel filtration has frequently been used for the purification of IgG (polyclonal as well as monoclonal) from different sources e.g., ascites fluid, cell culture supernatants and serum.
  • Affinity purification where the separation is based on a reversible interaction between the anti-RhD antibodies and a specific ligand coupled to a chromatographic matrix, is an easy and rapid method, which offers high selectivity, usually high capacity and concentration into a smaller volume.
  • Specific ligands in the form of peptides capable of binding to anti-RhD antibodies may be obtained according to the method described in EP 1 106 625 using peptide phage display.
  • Protein A and protein G two bacterial cell surface proteins, have high affinity for the F c region, and have, in an immobilized form, been used for many routine applications, including purification of polyclonal IgG and its subclasses from various species and absorption and purification of immune complexes.
  • downstream chromatography steps e.g. ion-exchange and/or hydrophobic interaction chromatography, can be performed to remove host cell proteins, leaked Protein A, and DNA.
  • ion-exchange and/or hydrophobic interaction chromatography With the protein A affinity and cation exchange chromatography it has been observed that pH-values above 5 may cause precipitation of the anti-RhD rpAb.
  • buffers should be adjusted carefully with appropriate buffering agents, e.g. Tris or acetate.
  • Gel filtration as a final purification step, can be used to remove contaminant molecules such as dimers and other aggregates, and transfer the sample into storage buffer. Depending on the source and expression conditions it may be necessary to include an additional purification step to achieve the required level of antibody purity. Hydrophobic interaction chromatography or ion-exchange chromatography are thus frequently used, in combination with Protein A and gelfiltration chromatography, to purify antibodies for therapeutic use.
  • immuno-affinity purification can be used (anti-IgA or anti-IgM monoclonal antibodies coupled to solid phase) or, alternatively, multistep purification strategies including ion-exchange and hydrophobic interaction can be employed.
  • Structural characterization of polyclonal antibodies requires high resolution due to the complexity of the mixture (clonal diversity, heterogeneity and glycosylation).
  • Traditional approaches such as gel filtration, ion-exchange chromatography or electrophoresis may not have sufficient resolution to differentiate among the individual antibodies in the anti-RhD rpAb.
  • Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) has been used for profiling of complex protein mixtures followed by mass spectrometry (MS) or liquid chromatography (LC)-MS (e.g., proteomics).
  • 2D-PAGE which combines separation on the basis of a protein's charge and mass, has proven useful for differentiating among polyclonal, oligoclonal and monoclonal immunoglobulin in serum samples.
  • this method has some limitations. Chromatographic techniques, in particular capillary and LC coupled to electrospray ionization MS are increasingly being applied for the analysis of complex peptide mixtures. LC-MS has been used for the characterization of monoclonal antibodies and recently also for profiling of polyclonal antibody light chains. The analysis of very complex samples requires more resolving power of the chromatographic system, which can be obtained by separation in two dimensions (or more). Such an approach is based on ion- exchange in the first dimension and reversed-phase chromatography (or hydrophobic interaction) in the second dimension optionally coupled to MS.
  • An anti-RhD rpAb antibody can for example be characterized functionally through comparability studies with anti-D immunoglobulin products or anti-RhD mAbs. Such studies can be performed in vitro as well as in vivo.
  • anti-RhD rpAb could for example be phagocytosis assays ( 51 Cr-based or FACS based), antibody dependent cellular cytotoxicity (ADCC) and rosetting assay. Briefly described the assays are performed as follows:
  • ADCC assay 51 Cr based: Human PBMC are used as effector cells and RhD negative and positive RBC (0 in the ABO system) are used as targets.
  • the RBC RhD(+) and RhD(-)
  • RhD antibodies e.g. anti-RhD rpAb, anti-D or anti-RhD mAb
  • the effector cells PMBC
  • PMBC effector cells
  • Cells are spun down and the supernatants from the wells are transferred to a Lumaplate (PerkinElmer). Controls for spontaneous release are included (RBC with 51 Cr only) and for total release (addition of Triton-X-100 to 51 Cr-labeled RBC).
  • the Lumaplate is dried and counted in a Topcounter (PerkinElmer).
  • Phagocytosis can be measured in combination with the ADCC assay. After harvesting the supernatant in the ADCC assay, the remaining supernatant is removed and the red blood cells are lysed by addition of a hypotonic buffer. The cells are washed and the supernatant is removed. PBS+1% Triton-X-100 is added to all wells and fixed amounts are transferred to a Lumaplate, dried and counted as before.
  • Phagocytosis assay (FACS based): This assay is based on adherence of the phagocytic cells.
  • the human leukemic monoblast cell line U937 can be used for this assay.
  • U937 cells are differentiated using 1OnM PMA. Two days later 60% of the medium is removed and replaced by medium without PMA.
  • the cell membrane of red blood cells (RhD(+) and RhD(-)) are stained with PKH26 (PE) according to the manufactures protocol (Sigma).
  • the RBCs are sensitized with anti-RhD antibodies in various dilutions and excess antibodies are removed by washing.
  • the non ⁇ adherent cells U937 cell are removed by washing and sensitized RBC (RhD(+) and RhD(-)) are added to the wells.
  • the plates are incubated overnight in the incubator.
  • Non- phagocytozed RBC are washed away by several steps. Attached but not phagocytozed RBC are lysed by addition of hypotonic buffer followed by additional washing.
  • the U937 cells detached from the wells by incubation with trypsin. Cells are analyzed on the FACS.
  • a rosetting assay is merely an Fc receptor binding assay. Sensitized red blood cells are incubated with differentiated U937 cells prepared as described above. RBC (RhD (-) and RhD(+)) are sensitized with anti-RhD antibodies in various dilutions and excess antibodies are removed by washing before they are mixed with U937 cells. Incubation is performed for one hour and non-bound RBC are washed away. The percentage of cells with two or more RBC attached to the surface is counted.
  • a pharmaceutical composition comprising anti-RhD rpAb or anti-RhD recombinant polyclonal Fab or another anti-RhD recombinant polyclonal fragment as active ingredient is intended for the prophylaxis of hemolytic disease of the newborn, treatment of idiopathic thrombocytopenic purpura (ITP) or prevention of sensitization to the Rhesus D antigen after mistransfusions of RhD(+) blood to RhD(-) individuals.
  • ITP idiopathic thrombocytopenic purpura
  • the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.
  • Anti-RhD rpAb or polyclonal fragments thereof may be administered within a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form.
  • Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer to female mothers or patients.
  • the administration is prophylactic. Any appropriate route of administration may be employed, for example, administration may be parenteral, intravenous, intra-arterial, subcutaneous, intramuscular, intraperitoneal, intranasal, aerosol, suppository, or oral administration.
  • therapeutic formulations may be in the form of, liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules chewing gum or pasta, and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
  • compositions of the present invention are prepared in a manner known per se, for example, by means of conventional dissolving, lyophilizing, mixing, granulating or confectioning processes.
  • the pharmaceutical compositions may be formulated according to conventional pharmaceutical practice (see for example, in Remington: The Science and Practice of Pharmacy (20th ed.), ed. A.R. Gennaro, 2000, Lippincott Williams & Wilkins, Philadelphia, PA and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York, NY).
  • Solutions of the active ingredient, and also suspensions, and especially isotonic aqueous solutions or suspensions are preferably used, it being possible, for example in the case of lyophilized compositions that comprise the active ingredient alone or together with a carrier, for example mannitol, for such solutions or suspensions to be produced prior to use.
  • the pharmaceutical compositions may be sterilized and/or may comprise excipients, for example preservatives, stabilizers, wetting and/or emulsifying agents, solubilizers, salts for regulating the osmotic pressure and/or buffers, and are prepared in a manner known per se, for example by means of conventional dissolving or lyophilizing processes.
  • the said solutions or suspensions may comprise viscosity-increasing substances, such as sodium carboxymethylcellulose, carboxymethylcellulose, dextran, polyvinylpyrrolidone or gelatin.
  • the injection compositions are prepared in customary manner under sterile conditions; the same applies also to introducing the compositions into ampoules or vials and sealing the containers.
  • compositions for oral administration can be obtained by combining the active ingredient with solid carriers, if desired granulating a resulting mixture, and processing the mixture, if desired or necessary, after the addition of appropriate excipients, into tablets, pills, or capsules, which may be coated with shellac, sugar or both. It is also possible for them to be incorporated into plastics carriers that allow the active ingredients to diffuse or be released in measured amounts.
  • compositions comprise from approximately 1% to approximately 95%, preferably from approximately 20% to approximately 90%, active ingredient.
  • Pharmaceutical compositions according to the invention may be, for example, in unit dose form, such as in the form of ampoules, vials, suppositories, tablets, pills, or capsules
  • the formulations can be administered to human individuals in therapeutically or prophylactic effective amounts (e.g., amounts which prevent, eliminate, or reduce a pathological condition) to provide therapy for a disease or condition.
  • the preferred dosage of therapeutic agent to be administered is likely to depend on such variables as the type and extent of the disorder, the overall health status of the particular patient, the formulation of the compound excipients, and its route of administration.
  • compositions according to the invention are therapeutically useful.
  • compositions according to the present invention may be used for the treatment, amelioration or prophylaxis of a disease in a mammal.
  • Conditions that can be treated or prevented with the present pharmaceutical compositions include prevention of hemolytic disease of the newborn, treatment of idiopathic thrombocytopenic purpura (ITP) or prevention of sensitization to the Rhesus D antigen after mistransfusions of RhD(+) blood to RhD(-) individuals.
  • One aspect of the present invention is a method for disease treatment, amelioration or prophylaxis in an animal, wherein an effective amount of anti-RhD rpAb or fragment is administered.
  • a further embodiment of the present invention is the use of an anti-RhD recombinant polyclonal antibody or polyclonal antibody fragment for the preparation of a composition for the prophylaxis of hemolytic disease of the newborn or treatment of idiopathic thrombocytopenic purpura (ITP).
  • ITP idiopathic thrombocytopenic purpura
  • Kits according to the present invention comprise an anti-RhD rpAb prepared according to the invention which protein may be labeled with a detectable label or non-labeled for non-label detection.
  • the kit may be used to identify RhD(+) individuals, or individuals with a particular Rhesus D category. Identification of the later can be achieved by having a anti-RhD rpAb composition which only react with that particular Rhesus D category.
  • V H and V L comprising nucleic acid segments or vector(s) have been inserted by site-specific integration into a pre-characterized chromosomal "hot-spot" site.
  • CHO cells were utilized as host cell.
  • the advantages thereof include the availability of suitable growth medium, their ability to grow efficiently to a high density in culture, and their ability to express mammalian proteins such as antibodies in a biologically active form.
  • transformation of E. coli and transfection of mammalian cells according to the subject invention will be performed according to conventional methods.
  • RhD(+) erythrocytes derived from RhD(+) individuals.
  • the donors had a varying history of the immunizations with respect to the number of boosts and the origin of RhD(+) erythrocytes for the immunization.
  • the immunization history of the different donors is given in the table 1.
  • Mononuclear cells were harvested by leukopheresis 5-7 days after the last boost. The cells were pelleted and immediately transferred to the cell lysis solution from a commercially available RNA preparation kit (NucleoSpin RNA L, Machery-Nagel, cat. no. 740 962.20). After lysis of the cells, the suspension was frozen before further processing.
  • RNA preparation kit NucleoSpin RNA L, Machery-Nagel, cat. no. 740 962.20.
  • V H forward primers (Xhol site in bold) :
  • Vn reverse primers (Ascl site in bold):
  • V ⁇ reverse primers (Nhel site in bold):
  • V x reverse primers (Nhel in bold):
  • V H Ascl/Xhol, Kappa and Lambda: Nhel/Notl
  • V H Ascl/Xhol, Kappa and Lambda: Nhel/Notl
  • the light chains were inserted into a Nhel/Notl treated Em351 phage display vector (Fig. 2), by ligation and amplified in E.coli XLl Blue (Stratagene). Plasmid DNA constituting the light chain library was isolated from the E.coli cells selected over night on Carbenicillin agar plates (two libraries for each donor, Kappa and Lambda, respectively).
  • This library DNA was subjected to digest with Ascl/Xhol, and after gel purification, the V H PCR products (subjected to digest with the same enzymes and gel purified) were ligated into the two light chain libraries from each donor and amplified in E.coli TGl cells (Stratagene) using Carbenicillin selection on agar plates. After overnight growth, bacteria were scraped off the plates, and glycerol stocks were prepared for proper library storage.
  • a plasmid DNA preparation containing the combinatorial variable heavy chain - light chain (V H :LC) library was also performed to secure the library for the future.
  • the combinatorial libraries contained in the TGl cells (two from each donor) were now ready for phage display and panning. The sizes of the combinatorial libraries (16 in total) were 10 6 or larger.
  • Phages displaying Fabs on their surface were generated as follows: 50 mL 2 x YT/1% glucose/100 ⁇ g/mL Carbenicillin was inoculated with TGl cells containing the combinatorial V H :V L library to obtain an OD 600 of approximately 0.08. The culture was shaking for Vh h, and helper phage was added (VSCM 13). The culture was incubated at 37°C for Vi h without shaking and for 1 Z. h with shaking.
  • the bacteria were pelleted (3200 x g, 10 minutes, 4°C), and re-suspended in 50 mL 2 x YT/100 ⁇ g/mL Carbenicillin/70 ⁇ g/mL Kanamycin, and the culture was shaken overnight at 30 0 C.
  • the phages were precipitated from the culture supernatant by adding 1/5 volume of 20% PEG/1.5 M NaCI, incubating on ice for 30 minutes, and centrifugation at 8000 x g for 30 minutes at 4°C. Precipitated phages were resuspended in PBS and used directly for panning.
  • RhD(-) red blood cells were washed three times in PBS (centrifugation at 2000 x g, 45 sec), and re-suspended in 150 ⁇ l panning buffer (2 % skim milk in 0.85 x PBS). Fifty ⁇ l freshly prepared phages were added to the RhD(-) cells (re-suspended in panning buffer) in order to perform a negative selection step, and incubated for 1 h on an end-over-end rotator at 4°C.
  • the cells were pelleted by centrifugation (2000 x g, 45 sec), and the phage-containing supernatant was incubated with 2 x 10 7 RhD(+) RBC (washed three times in PBS).
  • the phage: RhD(+) RBC mix was incubated for one hour on an end-over-end rotator at 4 0 C. Unbound phages were removed by washing five times with 1 mL panning buffer, and five times with PBS. Bound phages were eluted by addition of 200 ⁇ l H 2 O (which lyses the cells).
  • TGl cells infected with eluated phages were plated on Carb/glu agar dishes and incubated overnight at 37 0 C. The following day, the colonies were scraped off the plates, and 10 mL culture medium was inoculated for preparation of phages for the second round of panning. The second round of panning was performed as described for the first round.
  • the bacteria were pelleted by centrifugation (3200 x g, 4 0 C, 10 minutes), and re-suspended in 100 ⁇ l of 0,8 M NaCI, 0,2 x PBS, 8 mM EDTA, and incubated for 15 minutes on ice in order to perform a periplasmic extraction of the Fab fragments.
  • the plate was transferred to -2O 0 C and finally the suspension was thawed and centrifugation was performed for 10 minutes at 4°C and 3200 x g.
  • the periplasmic extract was used in ELISA assays for analysis of Fab content and in agglutination assays to evaluate the binding potential of the individual Fab fragments.
  • the agglutination assay was performed as follows: RhD(-) and RhD(+) RBC were mixed in a 1: 1 ratio, and washed 3 times in PBS. After the final wash, the cell mix was re-suspended in 1% BSA in PBS at a density of 1% cells, 50 ⁇ l was added to each well of a 96-plate. Periplasmic extracts were added to the wells. As a positive control Rhesogamma P immunoglobulin (Aventis) was used according to the manufacturer's instructions. The plates were incubated for one hour at room temperature with gentle shaking.
  • the cells were washed three times with PBS, before the secondary antibody was added (goat anti-human Fab/FITC conjugate, Sigma F5512) in a 1: 100 dilution.
  • the plates were left for agglutination for one hour at room temperature without shaking.
  • Fab fragments positive in the agglutination assay was determined by visual inspection, and recorded by taking a picture. Quantization of the binding activity of the Fab fragments was performed by FACS analysis of the agglutination samples.
  • RhD VI + erythrocytes When performing screening for clones with reactivity towards RhD VI + erythrocytes, such cells were used in conjunction with RhD(-) cells in a procedure otherwise identical to that described above.
  • RhD antigen binding clones were identified. All the positive clones were submitted for DNA sequencing. From these 56 clones were selected based on their unique set of heavy chain CDR sequences. For multiple clones which used the same heavy chain with different light chains, the clone which showed the highest binding activity in the FACS assay was selected. Thereby a sub-library comprised of pairs of variable heavy chain (V H ) and light chain (LC)-encoding sequences, representing a broad diversity with high RhD antigen specificity, was selected from all the positive clones.
  • V H variable heavy chain
  • LC light chain
  • Clones with such mutations were repaired as described in the following section relating to V H :LC transfer from the phagemid vector to the mammalian expression vector.
  • the numbering of the CDR3 regions in the polypeptide alignments does not follow Chothia (transition marked with an asterisk in the figures). In order to enable identification of the CDR3 region with respect to amino acid position, a continued numbering has been assigned after the asterisk.
  • the CDR3 region sequence for each individual clone can be derived from the figures based on this numbering.
  • the pairs of variable heavy chain and complete light chain which have been screened as Fabs and selected for their ability to bind RhD antigen can be identified by their identical clone numbers. All the 56 V H :LC pairs are listed by clone number, the nucleic acid (nuc.) SEQ IDs and the amino acid (a. a.) SEQ IDs in table 3.
  • the transfer and repair was performed as follows: First the V H -encoding sequence situated in the Em351 vector was re-amplified by PCR using the high fidelity polymerase, Phusion (Finnzymes) and a proper set of correcting primers. The V H PCR fragment was digested with Ascl and Xhol and subjected to gel purification. The Neo exp. vector (Fig. 7) was digested with the corresponding enzymes and gel purified thereby removing the nucleic acid sequence situated between the leader sequence and the heavy chain constant regions. The corrected V H fragment and the Neo exp. vector were ligated and amplified in E.coli ToplO cells. Plasmid DNA of the V H containing Neo exp. vector was isolated from the E.coli cells selected over night on Carbenicillin.
  • the corresponding LC sequence was re- amplified by PCR using the high fidelity polymerase, Phusion (Finnzymes) and a proper set of correcting primers.
  • the LC PCR fragment was digested with Nhel and Notl and subjected to gel purification.
  • the V H containing Neo exp. vector was digested with the corresponding enzymes and gel purified thereby removing the nucleic acid sequence situated between the kappa leader sequence and the BGHpolyA signal sequence.
  • the corrected LC fragment and the V H containing Neo exp. vector were ligated and amplified in E.coli ToplO cells. Glycerol stocks were prepared for each individual clone, and a high quality plasmid preparation suitable for transfection of mammalian cells was prepared from the bacterial cultures as well.
  • the V H :LC pairs originally selected by phage display were regenerated in the mammalian expression vector.
  • the nucleic acid segment was transferred without performing PCR prior to the digestion with the appropriate restriction enzymes.
  • the mammalian expression vectors generated by the transfer described are suitable for expressing a full-length anti-RhD recombinant polyclonal antibody. Although the vectors are kept separate at this point it is still considered as a library of anti-RhD antibody expression vectors.
  • the FIp-In CHO cell line (Invitrogen) was used as starting cell line for establishment of a recombinant polyclonal manufacturing cell line. However, to obtain a more homogenous cell line the parental FIp-In CHO cell line was sub-cloned. Briefly, the parental cell line was sub- cloned by limited dilution and several clones were selected and expanded. Based on growth behavior one clone, CHO-FIp-In (019), was selected as production cell line.
  • CHO-FIp-In (019) cell line All the 56 plasmid preparations were transfected individually into the CHO-FIp-In (019) cell line as follows: the CHO-FIp-In (019) cells were cultured as adherent cells in F12-HAM with 10% fetal calf serum (FCS). 2.5 x 10 6 cells were transfected with plasmid representing one clone using Fugene ⁇ (Roche). Cells were trypsinated 24 hours after transfection and transferred to 3 x T175 flasks. Selection pressure, in this case 450 ⁇ g/ml Neomycin, was added 48 hours after transfection. Approximately two weeks later clones appeared. Clones were counted and cells were trypsinated and hereafter cultured as pools of clones expressing one of the 56 specific anti-Rhesus-D antibodies.
  • FCS fetal calf serum
  • RhD157.119Dll, RhD158.119B06, RhD159.119B09, RhD161.119E09, RhD163.119A02, RhD190.119F05, RhD191.119E08, RhD192.119G06, RhD197.127A08 and RhD204.128A03 were selected to constitute the recombinant polyclonal manufacturing cell line.
  • the Rhdl97 and RhD204 were lambda clones whereas all the others were kappa clones.
  • the cell cultures expressing the individual anti-Rhesus antibodies were fully adapted to serum free suspension culture in shaker flasks they were mixed in equal cell number, thereby generating a polyclonal CHO-FIp-In (019) cell line.
  • the mixed cell culture was centrifuged and frozen down in aliquots of 10 x 10 s cells/tube.
  • the supernatant was harvested and filtered prior to purification of the anti-RhD rpAb.
  • the clonal diversity was assayed both on the protein level as well as on the mRNA level.
  • the supernatant sample used to analyze the antibody composition was taken after 9 weeks of cultivation, whereas the cell sample used to analyze the mRNA composition was taken at the harvest after 11 weeks of cultivation.
  • Antibody composition The anti-RhD rpAb expressed from the polyclonal CHO-FIp-In (019) cell line is an IgGl isotype antibody.
  • Anti-RhD rpAb was purified from both aliquots (3948 and 3949) using a column with immobilized Protein A. The individual antibodies interacted with immobilized Protein A at pH 7.4, whereas contaminating proteins were washed from the column. The bound antibodies were subsequently eluted from the column at low pH value (pH 2.7). The fractions containing antibodies, determined from absorbance measurements at 280 nm, were pooled and dialyzed against 5 mM sodium acetate pH 5.
  • the anti-RhD rpAb compositions obtained from aliquot 3948 and 3949 (FCW065) after 9 weeks of cultivation were analyzed using cation exchange chromatography.
  • the Protein A purified anti-RhD rpAb was applied onto a PolyCatA column (4.6 x 100 mm) in 25 mM sodium acetate, 150 mM sodium chloride, pH 5.0 at a flow rate of 60 ml h "1 operated at room temperature.
  • the antibody components were subsequently eluted using a linear gradient from 150 - 350 mM sodium chloride in 25 mM sodium acetate, pH 5.0 at a flow rate of 60 ml h ⁇ ⁇
  • the antibody components were detected spectrophotometry I Iy at 280 nm.
  • the chromatogram (Fig. 8) was subsequently integrated and the area of the individual peaks A-J was subsequently used to quantitate antibody components (table 4). The total area of the peaks was set to 100 %. The chromatograms from the two aliquots showed an identical peak distribution, as well as similar concentrations of the components in each peak. From these results it can be concluded that aliquots of the same polyclonal cell line grown under identical conditions will produce anti-RhD rpAb with a similar clonal diversity.
  • the individual members of the anti-RhD rpAb were allocated to one or more particular peaks (summarized in table 4). The allocation is based on chromatograms obtained for antibody products from each individual clone. No individual chromatogram was obtained for antibodies produced from RhD158.119B06, thus this clone was not assigned to any of the peaks. However it is considered likely that peak D constitute RhD158.119B06, the clone may also be represented in some of the other peaks due to heterogeneity. In particular the antibody product from clone RhD197.127A08 has a high degree of heterogeneity. Clone RhD190.119F05 should have been visible at 15.3 min.
  • RhD190.119F05 corresponds to a 10% reduction of diversity which is considered acceptable with respect to diversity of the final anti-RhD rpAb composition.
  • RT-PCR-RFLP analysis The clonal diversity within the polyclonal CHO-FIp-In (019) cell line after 11 weeks of cultivation was estimated by RT-PCR-RFLP analysis. Briefly, a cell suspension corresponding to 200 cells were subjected to a freeze-thaw procedure and these lysates were used as template in a RT-PCR using One-STEP RT-PCR kit (Qiagen) with primers amplifying the light chain.
  • the primer sequences were: forward primer 5'-CGTTC I I I I I I CGCAACGGGTTTG (SEQ ID 259) reverse primer 5'-AAGACCGATGGGCCCTTGGTGGA (SEQ ID 260)
  • RT-PCR products were digested with Hinfl and analyzed by agarose gel electrophoresis, visualizing the restriction product with ethidium bromide staining (Fig. 9).
  • the present experiment succeeded in generating a library of anti-Rhesus D antibody expression vectors comprising 56 variant anti-Rhesus D-encoding nucleic acid segments (Table 3).
  • Plasmids containing individual members of the library were used to transfect the CHO-FIp-In (019) cell line, generating 56 individual cell lines capable of expressing a specific anti-RhD antibody.
  • the clone selections were also based on growth and production characteristics of the individual cell cultures.
  • the 27 different cell cultures will be equally mixed in regard to cell number and this mix will constitute the working cell bank for a pilot plant production of anti-RhD rpAb.
  • the present example illustrates the characterization of a polyclonal cell culture with eight members over time.
  • the clonal diversity of the culture was assessed at the genetic level using RFLP analysis and at the protein level using a chromatographic technique in one dimension.
  • the polyclonal cell line of the present example was constituted of the following eight members: RhD191.119E08, RhD196.126Hll, RhD201.164H12, RhD203.179F07, RhD244.158B10, RhD306.223Ell, RhD319.187All and RhD324.231F07
  • T-RFLP terminal RFLP
  • the forward and/or reverse primer(s) are fluorescently labeled and therefore a proportion of the restriction fragments generated from the amplicons will contain the label.
  • the labeled fragments can subsequently be separated by capillary electrophoresis and detected by fluorescence.
  • the analysis can be performed both on the light chain and the variable region of the heavy chain- encoding sequences, depending on the primers applied.
  • a cell suspension corresponding to 200 cells was washed one time in PBS and subjected to a freeze-thaw procedure generating lysates used as template in a RT-PCR amplification using a One-Step RT-PCR kit (Qiagen) and suitable primers.
  • RT-PCR was carried out on a standard thermal cycler with the following conditions:
  • the reverse primer was 6-carboxyflorescein (FAM) labeled and the primer sequences were as follows:
  • VL Forward primer 5'-TCTCTTCCGCATCGCTGTCT
  • the labeled fragments were detected by fluorescence capillary electrophoresis on an ABI3700 (Applied Biosystems) at Statens Serum Institute, Copenhagen, DK.
  • the T-RFLP pattern is shown in Figure 10 and all eight anti-Rhesus D antibody producing clones have been assigned to specific peaks. Under the assumption that there was no template/primer competition during the RT-PCR, the relative peak area will correspond to the relative amount of mRNA transcribed from each antibody light chain gene represented in the polyclonal cell line.
  • VH-specific primers For analysis of the heavy chain variable region within the same polyclonal cell line the RT- PCR amplification was carried out with VH-specific primers.
  • the primer sequences were as follows:
  • VH Forward primer 5'-FAM CGTAGCTCTTTTAAGAGGTG
  • VH Reverse primer 5'-HEX-ACCGATGGGCCCTTGGTGGA
  • the labeled fragments were detected by fluorescence capillary electrophoresis on an ABI3700.
  • the analysis was performed by Statens Serum Institute, Copenhagen, DK.
  • the expected T-RFLP patterns are shown in Table 7, where the FAM labeled fragments are shown in bold and the HEX (6-Carboxy-2',4,4',5,7,7'-hexachlorofluorescein succinimidyl ester) labeled fragments are underscored.
  • the polyclonal cell line was cultivated over 5 weeks and once a week samples were taken for T-RFLP analyses. The analysis was performed on the variable heavy chain, but could have been performed on the light chain as well if desired.
  • RhD196 increase whereas RhD203 seems to decrease over time.
  • the quantities of the other clones are quite stable during the cultivation period and all eight cDNA could be detected after five weeks of cultivation.
  • T-RFLP By performing T-RFLP on both light chain and heavy chain as well as on both mRNA and DNA it should be possible to obtain a precise fingerprint of the clonal diversity within the polyclonal cell culture, for example in cells at the limit of in vitro cell age or at any given time point during cultivation.
  • the technique can therefore be used to monitor the stability of the clonal diversity in a cell culture over time during antibody production.
  • the technique can also be applied to monitor the batch-to-batch consistency for example of different ampoules frozen down from the same pWCB or in cells harvested after two or more manufacturing runs.
  • the protein A purified recombinantly produced polyclonal antibody was applied onto a PolyCatA column (4.6 x 100 mm) in 25 mM sodium acetate, 150 mM sodium chloride, pH 5.0 at a flow rate of 60 ml h "1 operated at room temperature.
  • the antibody components were subsequently eluted using a linear gradient from 150 - 350 mM sodium chloride in 25 mM sodium acetate, pH 5.0 at a flow rate of 60 ml h "1 .
  • the antibody components were detected spectrophotometrically at 280 nm and the chromatogram was subsequently integrated and the area of individual peaks was then used to quantitate antibody components.
  • the relative quantities over time are shown in Figure 13.
  • the present example illustrates the characterization of a polyclonal cell culture with twenty- five members over time.
  • the clonal diversity of the culture was assessed at the genetic level using T-RFLP analysis and at the protein level using a chromatographic technique in one dimension.
  • the polyclonal cell line of the present example was constituted of the twenty five members indicated in Table 8. Further, the growth characteristics of the individual clones are shown in Table 8.
  • RhD157 In the following the clone names are generally only identified by their first three digits, e.g. RhD157.119Dll is written as RhD157.
  • the polyclonal cell culture examined in the present example was composed of a mixture of cell cultures expressing twenty-five different anti-Rhesus D antibodies (generated as described in Example 1). The polyclonal cell culture was cultivated over 5 weeks and once a week samples were taken for T-RFLP analyses.
  • T-RFLP of the twenty-five different anti-Rhesus D-encoding sequences will, if all genotypes are present, result in seventeen different FAM labeled fragments. Some fragments will represent up to three different genotypes whereas others will represent a single genotype.
  • the expected sizes of FAM labeled fragments are shown in Table 9 together with the relative quantities of the different FAM labeled fragments over time. Further, one example of a T- RFLP profile is shown in Figure 11.
  • the protein A purified recombinantly produced polyclonal antibody was applied onto a PolyCatA column (4.6 x 100 mm) in 25 mM sodium acetate, 150 mM sodium chloride, pH 5.0 at a flow rate of 60 ml h "1 operated at room temperature.
  • the antibody components were subsequently eluted using a linear gradient from 150 - 350 mM sodium chloride in 25 mM sodium acetate, pH 5.0 at a flow rate of 60 ml h " ⁇
  • the antibody components were detected spectrophotometrically at 280 nm and the chromatogram was subsequently integrated and the area of individual peaks was used to quantitate the different antibody components.
  • Figure 14 shows the chromatogram produced from the sample obtained a week 4, the antibody containing peaks being numbered from 1 to 25. It is pure concurrence that the chromatogram contains an identical number of peaks as the number of individual antibodies in the polyclonal antibody analyzed.
  • Table 10 show the relative content in percent of the total antibody components (ACl to 25), as well as the representation of the individual antibodies in each antibody component (peak).
  • the assignment of individual antibodies to the integrated chromatographic peaks was based on the retention times and peak patterns obtained from monoclonal antibodies analyzed using cation-exchange chromatography under identical conditions.
  • Cation-exchange chromatography separates individual antibody members from a polyclonal antibody based on differences in net charge between the individual members and in addition separates forms of individual antibodies that appear charge heterogeneous.
  • Several antibodies were therefore represented in a single peak, e.g. AC 1 containing RhD293 and RhD319 (see Table 10) and some individual antibodies were further represented in several chromatographic peaks, e.g. RhD319 which is present both in ACl and 5 (see Table 10).
  • Peaks which contain more than one individual antibody could be subjected to additional protein chemical characterization techniques, such as quantitative analysis with anti-idiotype peptides, proteolytic peptide mapping, N-terminal sequencing or a second dimension chromatography.
  • the present example illustrates the combined use of T-RFLP analyses and cation-exchange chromatography for assessing the distribution of the primary transcripts and of antibody components, respectively, over a period of cultivation.
  • the T-RFLP analysis allows for unique identification of 12 individual clones of the 25 clones expressed in the polyclonal cell line and in the present example it is illustrated that these 12 clones could be detected during 4 weeks cultivation with the T-RFLP analysis. Potentially, more clones could be identified by sequence analysis of fragments representing more than one clone.
  • the distribution of antibody components was analyzed using cation-exchange chromatography and in the present example it is seen that the distribution of the 25 analyzed components is relatively stable during cultivation Although unique identification of all individual antibodies is difficult due to the inherent charge heterogeneous nature of the expressed antibodies it was demonstrated in the present example that antibody component 8 representing the RhD160 antibody showed the highest antibody level during the cultivation period in accordance with the high T- RFLP values obtained for group 13 representing the RhD160, 293, and 196 clones. Furthermore, the RhD 207 component, which could be uniquely identified by T-RFLP as well as by cation-exchange chromatography, showed T-RFLP levels of 10-11% and slightly lower levels of 5.5-10% obtained at antibody level.
  • the two techniques together demonstrate a relatively stable production at the mRNA and antibody level during cultivation; however, potential discrepancies between the two techniques could also be seen, illustrated by the apparent loss of transcription of some clones at weeks 5 of cultivation contrasting the results obtained at the antibody level.
  • the present example justifies the complementary use of both techniques to define cultivation intervals within which stable production of complex polyclonal protein can be obtained.
  • the present example demonstrates the generation of pWCB containing anti-RhD rpAb with 25 individual members and provides confirmation of a minimal batch-to-batch variation of rpAb products purified from different vials from the pWCB.
  • Vials from the pWCB were thawed in T75 flasks (Nunc, Roskilde, Denmark) and expanded in spinner flasks (Techne, Cambridge, UK).
  • 5 L bioreactors (Applikon, Schiedam, Netherlands) were inoculated with 0.6 x 10 s cells/ml in 1.5 L.
  • cells were fed on a daily basis with ExCeII 302 medium supplemented with concentrated feed solution, glutamine and glucose to a final volume of 4.5 L
  • the bioreactor runs were terminated after 16-17 days.
  • the three batches are termed SymO4:21, SymO4: 23 and SymO4:24. The batches were cultured at different points in time.
  • the recombinant polyclonal antibody samples were purified by affinity chromatography using HiTrapTM rProtein A columns (GE Healthcare, UK).
  • the purified recombinant polyclonal antibody samples were analyzed using cation-exchange chromatography employing a PoIyCAT A column (4,6 x 100 mm, from PoIyLC Inc., MA, US) in 25 mM sodium acetate, 150 mM sodium chloride, pH 5.0 at a flow rate of 60 ml/h (room temperature).
  • the antibody peaks were subsequently eluted using a linear gradient from 150 mM to 350 or 500 mM NaCI in 25 mM sodium acetate, pH 5.0 at a flow rate of 60 ml/h.
  • the antibody peaks were detected spectrophotometrically at 280 nm.
  • the chromatograms were integrated and the area of individual peaks used for quantification. As already mentioned some of the individual antibodies displayed charge heterogeneity and two antibodies may contribute to the same peak in the IEX chromatogram.
  • Table 11 show the relative content in percent of the total antibody components (AC). In the present example the relative area has been calculated for 35 AC, whereas Example 4 only calculated the relative area for 25 AC. This difference is strictly due to a different assignment of the peaks in the chromatogram and not to actual differences in the profile as such.
  • Table 11 shows that the reproducibility between the harvested antibody products from the three batches was high.
  • the variation in the size of individual antibody peaks was within 20% for most antibody components, whereas the variation for some of the smallest peaks was slightly larger.
  • the present example demonstrates that different batches of an anti-RhD rpAb with 25 individual members (same composition as in Example 4) bind to RhD-positive erythrocytes with similar potency and show comparable biological activity with respect to the relevant effector mechanisms: Antibody-dependent cellular cytotoxicity (ADCC) and phagocytosis.
  • ADCC Antibody-dependent cellular cytotoxicity
  • Red blood cells were prepared from whole blood obtained from healthy donors after informed consent at the Blood Bank, Aalborg Hospital, DK, by washing the blood three times in PBS (Gibco, Invitrogen, United Kingdom) containing 1 % bovine serum albumin (BSA, Sigma-Aldrich, Germany). The erythrocytes were resuspended and stored at 4°C as a 10% solution in ID-Cellstab (DiaMed, Switzerland).
  • Buffy coats containing blood from healthy donors were obtained from the Blood Bank at the National Hospital, Copenhagen, Denmark and peripheral blood mononuclear cells (PBMC) were purified on Lymphoprep (Axis-Shield, Norway).
  • PBMC peripheral blood mononuclear cells
  • the potency assay was adopted from the European Pharmacopoeia 4 (section 2.7.13 method C).
  • the binding capacity of an anti-RhD rpAb with 25 individual members was measured using RhD-positive erythrocytes at 5 x 10 4 cells/ ⁇ l in PBS, 1% BSA.
  • Anti-RhD rpAb batches, SymO4:21, SymO4:23, and SymO4:24, were obtained from individual 5 L fed batch bioreactor runs. Dilutions (lVz-fold) of the Anti-RhD rpAb batches were made in PBS, 1% BSA in triplicate in 96 well plates (Becton Dickinson Labware, NJ, USA).
  • RhD positive (RhD+) and RhD negative (RhD-) red blood cells (RBC) were labeled with radioactive Chromium.
  • RhD- RBC red blood cells
  • 1 x 10 8 RhD+ and RhD- RBC, respectively, were centrifuged (600xg for 10 min) and 100 ⁇ l Dulbeccos' modified eagles medium (DMEM) and 200 ⁇ l sodium chromate (0.2 ⁇ Ci) (GE Healthcare, UK) were added to each tube before incubation for 1.5 hours at 37 0 C.
  • DMEM Dulbeccos' modified eagles medium
  • sodium chromate 0.2 ⁇ Ci
  • the suspension was washed twice in 50 ml PBS and resuspended in 1 ml complete DMEM (containing 2 mM glutamine, 1% Penicillin-Streptomycin and 10% fetal calf serum) (Invitrogen, CA, US). Cells were adjusted to 4 x 10 6 cells/ml and 50 ⁇ l/well were added to 96-well cell culture plates (Nunc). Fifty ⁇ l of two-fold dilutions of Anti-RhD rpAb from batch SymO4:21 or SymO4:24, was then added to each well, except control wells. Control wells were supplied with complete DMEM and used for either spontaneous lysis/retention or maximum lysis.
  • the PBMC were adjusted to 2 x 10 7 cells/ml, and 100 ⁇ l were added to each well and incubated at 37 0 C overnight.
  • the plates were centrifuged (600xg for 2 min) and 50 ⁇ l of the supernatant was transferred to ADCC Lumaplates (Perkin Elmer, Belgium).
  • the cell culture plates were centrifuged (300xg for 2 min) and 50 ⁇ l supernatant from the maximum lysis wells were transferred to another LumaPlate (phagocytosis LumaPlate).
  • phagocytosis LumaPlate phagocytosis LumaPlate
  • the supernatant was removed from the remaining wells and lysis buffer (140 mM NH 4 CI, 17 mM Tris-HCI) was added, followed by 5 min incubation at 37°C.
  • lysis buffer 140 mM NH 4 CI, 17 mM Tris-HCI
  • Phagocytosis Immune phagocytosis (%)
  • the present example demonstrates that the clonal diversity of an anti-RhD rpAb with 25 individual members (same composition as in Example 4) is maintained during down-stream processing (DSP). Cation-exchange chromatographic analysis is used to estimate clonal diversity during DSP of the recombinant polyclonal antibody.
  • Cation-exchange chromatography was used to analyze the clonal diversity during DSP of a recombinant polyclonal antibody composition.
  • Samples taken after step 1, 3, 4 and 6 during DSP of a anti-RhD rpAb was applied onto a PolyCatA column (4.6 x 100 mm) in 25 mM sodium acetate, 150 mM sodium chloride, pH 5.0 at a flow rate of 60 ml h-1 operated at room temperature.
  • the antibody components were subsequently eluted using a linear gradient from 150 - 500 mM sodium chloride in 25 mM sodium acetate, pH 5.0 at a flow rate of 60 ml h-1.
  • the antibody components were detected spectrophotometrically at 280 nm and the chromatograms were compared (Fig. 16) to detect the potential loss of clonal diversity during DSP.
  • Fig. 16 the chromatograms were compared.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Diabetes (AREA)
  • Reproductive Health (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Pregnancy & Childbirth (AREA)
  • Transplantation (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/DK2005/000501 2004-07-20 2005-07-18 Anti-rhesus d recombinant polyclonal antibody and methods of manufacture Ceased WO2006007850A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
EP05760588A EP1771483A1 (en) 2004-07-20 2005-07-18 Anti-rhesus d recombinant polyclonal antibody and methods of manufacture
CA002574062A CA2574062A1 (en) 2004-07-20 2005-07-18 Anti-rhesus d recombinant polyclonal antibody and methods of manufacture
BRPI0513706-3A BRPI0513706A (pt) 2004-07-20 2005-07-18 anticorpo policlonal recombinante anti-rhesus d e métodos de produção
AU2005263331A AU2005263331B8 (en) 2004-07-20 2005-07-18 Anti-Rhesus D recombinant polyclonal antibody and methods of manufacture
US11/632,937 US8198415B2 (en) 2004-07-20 2005-07-18 Anti-rhesus D recombinant polyclonal antibody
NZ552265A NZ552265A (en) 2004-07-20 2005-07-18 Anti-rhesus D recombinant polyclonal antibody and methods of manufacture
MX2007000644A MX2007000644A (es) 2004-07-20 2005-07-18 Anticuerpo policlonal recombinante anti-rhesus d y metodos de fabricacion.
EA200700249A EA014182B1 (ru) 2004-07-20 2005-07-18 КОМПОЗИЦИЯ ПОЛИКЛОНАЛЬНЫХ АНТИ-RhD АНТИТЕЛ, СПОСОБ ЕЁ ПОЛУЧЕНИЯ И ПРИМЕНЕНИЕ КОМПОЗИЦИИ
JP2007521793A JP4926054B2 (ja) 2004-07-20 2005-07-18 抗−RhD組換えポリクローナル抗体及び製造方法
IL179658A IL179658A (en) 2004-07-20 2006-11-28 Anti-rhesus d recombinant polyclonal antibody and methods of manufacture
NO20070927A NO20070927L (no) 2004-07-20 2007-02-19 Anti-rhesus D rekombinant polyklonalt antistoff og fremgangsmater for fremstilling.
US13/493,623 US20120322690A1 (en) 2004-07-20 2012-06-11 Anti-Rhesus D Recombinant Polyclonal Antibody and Methods of Manufacture

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA200401133 2004-07-20
DKPA200401133 2004-07-20
DKPA200401992 2004-12-22
DKPA200401992 2004-12-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/493,623 Division US20120322690A1 (en) 2004-07-20 2012-06-11 Anti-Rhesus D Recombinant Polyclonal Antibody and Methods of Manufacture

Publications (1)

Publication Number Publication Date
WO2006007850A1 true WO2006007850A1 (en) 2006-01-26

Family

ID=35159789

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2005/000501 Ceased WO2006007850A1 (en) 2004-07-20 2005-07-18 Anti-rhesus d recombinant polyclonal antibody and methods of manufacture

Country Status (13)

Country Link
US (2) US8198415B2 (enExample)
EP (2) EP1771483A1 (enExample)
JP (1) JP4926054B2 (enExample)
KR (1) KR20070038556A (enExample)
AU (1) AU2005263331B8 (enExample)
BR (1) BRPI0513706A (enExample)
CA (1) CA2574062A1 (enExample)
EA (1) EA014182B1 (enExample)
IL (1) IL179658A (enExample)
MX (1) MX2007000644A (enExample)
NO (1) NO20070927L (enExample)
NZ (1) NZ552265A (enExample)
WO (1) WO2006007850A1 (enExample)

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008095504A1 (en) * 2007-02-09 2008-08-14 Symphogen A/S A polyclonal antibody product
WO2008145133A3 (en) * 2007-05-25 2009-02-05 Symphogen As Method for manufacturing a recombinant polyclonal protein
EP2045602A1 (en) 2007-10-04 2009-04-08 Symphogen A/S Potency assay
US7592430B2 (en) 2003-09-10 2009-09-22 Amgen Fremont Antibodies to M-CSF
WO2009129814A1 (en) * 2008-04-23 2009-10-29 Symphogen A/S Methods for manufacturing a polyclonal protein
US7658924B2 (en) 2001-10-11 2010-02-09 Amgen Inc. Angiopoietin-2 specific binding agents
WO2010022734A1 (en) * 2008-08-26 2010-03-04 Symphogen A/S Treatment of thrombocytopenia
WO2010019570A3 (en) * 2008-08-11 2010-06-17 Medarex, Inc. Human antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
US7749697B2 (en) 2003-09-18 2010-07-06 Symphogen A/S Method for linking sequences of interest
US7850965B2 (en) 2005-12-05 2010-12-14 Symphogen A/S Anti-orthopoxvirus recombinant polyclonal antibody
US7879329B2 (en) 2007-03-06 2011-02-01 Symphogen A/S Recombinant antibodies for treatment of respiratory syncytial virus infections
US7887805B2 (en) 2007-03-01 2011-02-15 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
WO2011042027A2 (en) 2009-10-09 2011-04-14 Symphogen A/S Multiplex quantitation of individual recombinant proteins in a mixture by signature peptides and mass spectrometry
US20110311556A1 (en) * 2009-03-06 2011-12-22 Lfb-Biotechnologies Anti-rhesus d monoclonal antibody
US8283294B2 (en) 2007-03-01 2012-10-09 Symphogen A/S Method for cloning cognate antibodies
US8288109B2 (en) 2004-07-20 2012-10-16 Symphogen A/S Procedure for structural characterization of a recombinant polyclonal protein or a polyclonal cell line
US8663640B2 (en) 2008-08-29 2014-03-04 Symphogen A/S Methods using recombinant anti-epidermal growth factor receptor antibody compositions
US9505839B2 (en) 2012-07-02 2016-11-29 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US9908936B2 (en) 2014-03-14 2018-03-06 Novartis Ag Antibody molecules to LAG-3 and uses thereof
US10081681B2 (en) 2013-09-20 2018-09-25 Bristol-Myers Squibb Company Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors
US10336820B2 (en) 2008-02-20 2019-07-02 Amgen Inc. Antibodies directed to angiopoietin-1 and angiopoietin-2 and uses thereof
US20200048627A1 (en) * 2008-04-11 2020-02-13 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly
WO2020084034A1 (en) 2018-10-26 2020-04-30 F. Hoffmann-La Roche Ag Multispecific antibody screening method using recombinase mediated cassette exchange
WO2020200983A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Method for the generation of an fcrn expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254356A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254357A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a protein expressing cell by targeted integration using cre mrna
WO2020254355A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254352A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254351A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
US11718678B2 (en) 2011-02-25 2023-08-08 Chugai Seiyaku Kabushiki Kaisha Method for altering plasma retention and immunogenicity of antigen-binding molecule
US11723975B2 (en) 2017-05-30 2023-08-15 Bristol-Myers Squibb Company Compositions comprising an anti-LAG-3 antibody or an anti-LAG-3 antibody and an anti-PD-1 or anti-PD-L1 antibody
US11807686B2 (en) 2017-05-30 2023-11-07 Bristol-Myers Squibb Company Treatment of LAG-3 positive tumors
US11827704B2 (en) 2014-01-24 2023-11-28 Novartis Ag Antibody molecules to PD-1 and uses thereof
WO2025039046A1 (en) * 2023-08-23 2025-02-27 The Walter And Eliza Hall Institute Of Medical Research Anti-rhesus d human monoclonal antibodies

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2512647C (en) * 2003-01-07 2013-10-08 Symphogen A/S Method for manufacturing recombinant polyclonal proteins
JP2008289483A (ja) * 2007-05-25 2008-12-04 Symphogen As 真核生物系において発現可能な形質転換体のスクリーニング
CN101821289A (zh) * 2007-09-07 2010-09-01 西福根有限公司 重组制造抗rsv抗体的方法
CA2702322A1 (en) * 2007-11-22 2009-05-28 Symphogen A/S A method for characterization of a recombinant polyclonal protein
MX2011001930A (es) * 2008-08-29 2011-04-21 Symphogen As Metodo para clonar anticuerpos derivados de aves.
AU2009301505A1 (en) * 2008-10-06 2010-04-15 Symphogen A/S Method for identifying and selecting drug candidates for combinatorial drug products
HRP20190030T1 (hr) * 2012-06-21 2019-02-22 Synthon Biopharmaceuticals B.V. Postupak pročišćavanja protutijela
EP2711428A1 (en) * 2012-09-21 2014-03-26 Lonza Biologics plc. Site-specific integration
US9683017B2 (en) 2014-07-17 2017-06-20 University Tennessee Research Foundation Inhibitory peptides of viral infection
EP3186273A4 (en) 2014-08-26 2018-05-02 University of Tennessee Research Foundation Targeting immunotherapy for amyloidosis
WO2017184973A1 (en) * 2016-04-22 2017-10-26 University Of Tennessee Research Foundation Identifying amyloidogenic proteins & amyloidogenic risk
MA52945A (fr) * 2018-06-22 2021-04-28 Genmab As Procédé de production d'un mélange contrôlé d'au moins deux anticorps différents
WO2020205775A1 (en) * 2019-03-29 2020-10-08 H. Lee Moffitt Cancer Center And Research Institute, Inc. Antibodies against programmed cell death protein 1 (pd1) and uses thereof
TW202237642A (zh) * 2021-01-08 2022-10-01 美商10X基因組學有限公司 對冠狀病毒具有特異性的抗原結合多肽及其用途
RU2770654C1 (ru) * 2021-06-17 2022-04-20 Федеральное государственное бюджетное образовательное учреждение высшего образования "Санкт-Петербургский государственный педиатрический медицинский университет" Министерства здравоохранения Российской Федерации (ФГБОУ ВО СПбГПМУ Минздрава России) Способ профилактики тяжелой формы гемолитической болезни новорожденных при резус-иммунизации у беременных с соматической патологией и потерями плода в анамнезе
CN119176879B (zh) * 2024-09-05 2025-08-05 西安市中心血站(陕西省血液中心) 一种中和抗d抗体的抗独特型抗体及其应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995020401A1 (en) * 1994-01-31 1995-08-03 Trustees Of Boston University Polyclonal antibody libraries
WO1997049809A1 (en) * 1996-06-24 1997-12-31 Rotkreuzstiftung Zentrallaboratorium Blutspendedienst Srk Polypeptides capable of forming antigen binding structures with specificity for the rhesus d antigens, the dna encoding them and the process for their preparation and use
WO2002044361A2 (en) * 2000-11-28 2002-06-06 Applied Molecular Evolution, Inc. Eukaryotic expression libraries based on double lox recombination and methods of use
WO2004061104A2 (en) * 2003-01-07 2004-07-22 Symphogen A/S Method for manufacturing recombinant polyclonal proteins

Family Cites Families (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0162918A1 (en) 1983-11-28 1985-12-04 The Board Of Trustees Of The Leland Stanford Junior University HUMAN MONOCLONAL ANTIBODY AGAINST Rh(D) ANTIGEN AND ITS USES
US5126130A (en) 1986-11-24 1992-06-30 The Childrens Hospital Incorporated Monoclonal antibodies reactive with specific antigenic sites on human cytomegalovirus glycoprotein a
GB8722020D0 (en) 1987-09-18 1987-10-28 Central Blood Lab Authority Human anti-rh(d)monoclonal antibodies
GB8722018D0 (en) 1987-09-18 1987-10-28 Central Blood Lab Authority Human anti-rh(d)monoclonal antibodies
GB8722019D0 (en) 1987-09-18 1987-10-28 Central Blood Lab Authority Human anti-rh(d)monoclonal antibodies
WO1990005144A1 (en) 1988-11-11 1990-05-17 Medical Research Council Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors
GB8906129D0 (en) 1989-03-17 1989-05-04 Central Blood Lab Authority Pharmaceutical preparations
GB8919761D0 (en) 1989-09-01 1989-10-18 Central Blood Lab Authority Chemical compounds
WO1992015694A1 (en) 1991-03-08 1992-09-17 The Salk Institute For Biological Studies Flp-mediated gene modification in mammalian cells, and compositions and cells useful therefor
US5837268A (en) 1991-10-16 1998-11-17 University Of Saskatchewan GnRH-leukotoxin chimeras
PL302438A1 (en) 1992-06-26 1994-07-25 Aetsrn Human anti-rh(d) monoclonal antibodies and cellular lines producing them
ES2191677T3 (es) 1992-10-21 2003-09-16 Stefan Miltenyi Seleccion directa de celulas mediante un producto de secrecion.
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
FR2724182B1 (fr) 1994-09-02 1996-12-13 Pasteur Institut Obtention d'un anticorps monoclonal recombinant a partir d'un anticorps monoclonal humain anti-rhesus d, sa production en cellules d'insecte, et ses utilisations
US6025155A (en) 1996-04-10 2000-02-15 Chromos Molecular Systems, Inc. Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US5876925A (en) 1996-10-11 1999-03-02 The Trustees Of The University Of Pennsylvania Magnetically activated cell sorting for production of proteins
US6255455B1 (en) 1996-10-11 2001-07-03 The Trustees Of The University Of Pennsylvania Rh(D)-binding proteins and magnetically activated cell sorting method for production thereof
GB9703369D0 (en) 1997-02-18 1997-04-09 Lindqvist Bjorn H Process
ATE401410T1 (de) 1997-11-18 2008-08-15 Pioneer Hi Bred Int Zusammensetzungen und verfahren für die genetische modifizierung von pflanzen
WO2000005393A2 (en) 1998-07-21 2000-02-03 Cobra Therapeutics Limited A polynucleotide comprising a ubiquitous chromatin opening element (ucoe)
US20020155114A1 (en) 1998-08-31 2002-10-24 James D. Marks Therapeutic monoclonal antibodies that neutralize botulinum neurotoxins
DK1234022T3 (da) 1999-07-23 2010-07-19 Univ California DNA-rekombination i eukaryote celler med bakteriofag PHIC31-rekombinationssystemet
EP1106625A1 (en) 1999-11-17 2001-06-13 ZLB Bioplasma AG Rhesus D specific peptide sequences
JP2003534533A (ja) 2000-02-08 2003-11-18 ザ リージェンツ オブ ザ ユニバーシティ オブ ミシガン タンパク質のディファレンシャルディスプレイのマッピング
EP1358202A2 (en) 2000-02-08 2003-11-05 The Regents Of The University Of Michigan Protein separation and display
AU2001234893A1 (en) 2000-02-08 2001-08-20 The Regents Of The University Of Michigan Protein mapping
EP1283720B1 (en) 2000-05-26 2007-04-18 Symphogen A/S Recombinant or purified polyclonal antibodies for treating allergy
AU2001277076A1 (en) 2000-07-21 2002-02-05 The United States Of America As Represented By The Secretary Of Agriculture Methods for the replacement, translocation and stacking of DNA in eukaryotic genomes
US6610472B1 (en) 2000-10-31 2003-08-26 Genetastix Corporation Assembly and screening of highly complex and fully human antibody repertoire in yeast
DE60142650D1 (de) 2000-12-26 2010-09-02 Inst Systems Biology Seattle Schnelle und quantitative Proteomanalyse und entsprechende Verfahren
AU2003237282A1 (en) 2002-05-31 2003-12-19 The Regents Of The University Of Michigan Automated protein analysis system comprising capillary electrophoresis-tandem mass spectrometry
SI1523496T1 (sl) 2002-07-18 2011-11-30 Merus B V Rekombinantno proizvajanje zmesi protiteles
WO2004035169A2 (en) 2002-10-15 2004-04-29 The Regents Of The University Of Michigan Multidimensional protein separation system
US20060275766A1 (en) 2003-01-07 2006-12-07 Haurum John S Method for manufacturing recombinant polyclonal proteins
TWI333977B (en) 2003-09-18 2010-12-01 Symphogen As Method for linking sequences of interest
RU2426795C2 (ru) 2004-07-20 2011-08-20 Симфоген А/С Способ структурной характеристики рекомбинантного поликлонального белка или поликлональной клеточной линии

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995020401A1 (en) * 1994-01-31 1995-08-03 Trustees Of Boston University Polyclonal antibody libraries
US5789208A (en) * 1994-01-31 1998-08-04 The Trustees Of Boston University Polyclonal antibody libraries
WO1997049809A1 (en) * 1996-06-24 1997-12-31 Rotkreuzstiftung Zentrallaboratorium Blutspendedienst Srk Polypeptides capable of forming antigen binding structures with specificity for the rhesus d antigens, the dna encoding them and the process for their preparation and use
WO2002044361A2 (en) * 2000-11-28 2002-06-06 Applied Molecular Evolution, Inc. Eukaryotic expression libraries based on double lox recombination and methods of use
WO2004061104A2 (en) * 2003-01-07 2004-07-22 Symphogen A/S Method for manufacturing recombinant polyclonal proteins

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BREGENHOLT S ET AL: "PATHOGEN-SPECIFIC RECOMBINANT HUMAN POLYCLONAL ANTIBODIES: BIODEFENCE APPLICATIONS", EXPERT OPINION ON BIOLOGICAL THERAPY, ASHLEY, LONDON, GB, vol. 4, no. 3, March 2004 (2004-03-01), pages 387 - 396, XP008030716, ISSN: 1471-2598 *
HAURUM JOHN ET AL: "Recombinant polyclonal antibodies: therapeutic antibody technologies come full circle.", IDRUGS : THE INVESTIGATIONAL DRUGS JOURNAL. MAY 2005, vol. 8, no. 5, May 2005 (2005-05-01), pages 404 - 409, XP002352885, ISSN: 1369-7056 *
SELINGER M: "Immunoprophylaxis for rhesus disease--expensive but worth it?", BRITISH JOURNAL OF OBSTETRICS AND GYNAECOLOGY. JUN 1991, vol. 98, no. 6, June 1991 (1991-06-01), pages 509 - 512, XP009056635, ISSN: 0306-5456 *
SHARON J ET AL: "CONSTRUCTION OF POLYCLONAL ANTIBODY LIBRARIES USING PHAGE DISPLAY", METHODS IN MOLECULAR BIOLOGY, HUMANA PRESS INC., CLIFTON, NJ, US, vol. 178, 2002, pages 101 - 112, XP008053600 *

Cited By (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7658924B2 (en) 2001-10-11 2010-02-09 Amgen Inc. Angiopoietin-2 specific binding agents
US10280219B2 (en) 2003-09-10 2019-05-07 Amgen Fremont Inc. Antibodies to M-CSF
US9718883B2 (en) 2003-09-10 2017-08-01 Amgen Fremont Inc. Antibodies to M-CSF
US7592430B2 (en) 2003-09-10 2009-09-22 Amgen Fremont Antibodies to M-CSF
US8188249B2 (en) 2003-09-10 2012-05-29 Amgen Fremont Inc. Nucleic acid molecules encoding antibodies to M-CSF
US7749697B2 (en) 2003-09-18 2010-07-06 Symphogen A/S Method for linking sequences of interest
US9029091B2 (en) 2004-07-20 2015-05-12 Symphogen A/S Procedure for structural characterization of a recombinant polyclonal protein or a polyclonal cell line
US8288109B2 (en) 2004-07-20 2012-10-16 Symphogen A/S Procedure for structural characterization of a recombinant polyclonal protein or a polyclonal cell line
US7850965B2 (en) 2005-12-05 2010-12-14 Symphogen A/S Anti-orthopoxvirus recombinant polyclonal antibody
WO2008095504A1 (en) * 2007-02-09 2008-08-14 Symphogen A/S A polyclonal antibody product
US8283294B2 (en) 2007-03-01 2012-10-09 Symphogen A/S Method for cloning cognate antibodies
US7887805B2 (en) 2007-03-01 2011-02-15 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
US8414896B2 (en) 2007-03-01 2013-04-09 Symphogen A/S Recombinant anti-epidermal growth factor receptor antibody compositions
US7879329B2 (en) 2007-03-06 2011-02-01 Symphogen A/S Recombinant antibodies for treatment of respiratory syncytial virus infections
JP2015037411A (ja) * 2007-05-25 2015-02-26 シムフォゲン・アクティーゼルスカブSymphogen A/S 組み換えポリクローナルタンパク質を製造する方法
JP2011504721A (ja) * 2007-05-25 2011-02-17 シムフォゲン・アクティーゼルスカブ 組み換えポリクローナルタンパク質を製造する方法
US7910332B2 (en) 2007-05-25 2011-03-22 Symphogen A/S Method for manufacturing a recombinant polyclonal protein
WO2008145133A3 (en) * 2007-05-25 2009-02-05 Symphogen As Method for manufacturing a recombinant polyclonal protein
AU2008255383B2 (en) * 2007-05-25 2012-11-01 Symphogen A/S Method for manufacturing a recombinant polyclonal protein
EP2045602A1 (en) 2007-10-04 2009-04-08 Symphogen A/S Potency assay
US10336820B2 (en) 2008-02-20 2019-07-02 Amgen Inc. Antibodies directed to angiopoietin-1 and angiopoietin-2 and uses thereof
US20200048627A1 (en) * 2008-04-11 2020-02-13 Chugai Seiyaku Kabushiki Kaisha Antigen-binding molecule capable of binding to two or more antigen molecules repeatedly
WO2009129814A1 (en) * 2008-04-23 2009-10-29 Symphogen A/S Methods for manufacturing a polyclonal protein
US11236165B2 (en) 2008-08-11 2022-02-01 E.R. Squibb & Sons, L.L.C. Human antibodies that bind Lymphocyte Activation Gene-3 (LAG-3), and uses thereof
US11236163B2 (en) 2008-08-11 2022-02-01 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US11512130B2 (en) 2008-08-11 2022-11-29 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
EA023032B1 (ru) * 2008-08-11 2016-04-29 Медарекс, Л.Л.К. Человеческие антитела, связывающие ген активации лимфоцитов-3 (lag-3), и их применение
US11236164B2 (en) 2008-08-11 2022-02-01 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US11530267B2 (en) 2008-08-11 2022-12-20 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US10988536B2 (en) 2008-08-11 2021-04-27 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US10988535B2 (en) 2008-08-11 2021-04-27 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US11001630B2 (en) 2008-08-11 2021-05-11 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation Gene-3 (LAG-3), and uses thereof
WO2010019570A3 (en) * 2008-08-11 2010-06-17 Medarex, Inc. Human antibodies that bind lymphocyte activation gene-3 (lag-3), and uses thereof
US10344089B2 (en) 2008-08-11 2019-07-09 E.R. Squibb & Sons, L.L.C. Human antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US20110217317A1 (en) * 2008-08-26 2011-09-08 Symphogen A/S Treatment of thrombocytopenia
WO2010022734A1 (en) * 2008-08-26 2010-03-04 Symphogen A/S Treatment of thrombocytopenia
US8663640B2 (en) 2008-08-29 2014-03-04 Symphogen A/S Methods using recombinant anti-epidermal growth factor receptor antibody compositions
US20110311556A1 (en) * 2009-03-06 2011-12-22 Lfb-Biotechnologies Anti-rhesus d monoclonal antibody
US8404241B2 (en) * 2009-03-06 2013-03-26 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Anti-rhesus D monoclonal antibody
WO2011042027A2 (en) 2009-10-09 2011-04-14 Symphogen A/S Multiplex quantitation of individual recombinant proteins in a mixture by signature peptides and mass spectrometry
US11718678B2 (en) 2011-02-25 2023-08-08 Chugai Seiyaku Kabushiki Kaisha Method for altering plasma retention and immunogenicity of antigen-binding molecule
US11345752B2 (en) 2012-07-02 2022-05-31 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US10377824B2 (en) 2012-07-02 2019-08-13 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US10266591B2 (en) 2012-07-02 2019-04-23 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US9505839B2 (en) 2012-07-02 2016-11-29 Bristol-Myers Squibb Company Optimization of antibodies that bind lymphocyte activation gene-3 (LAG-3), and uses thereof
US11274152B2 (en) 2013-09-20 2022-03-15 Bristol-Myers Squibb Company Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors
US10081681B2 (en) 2013-09-20 2018-09-25 Bristol-Myers Squibb Company Combination of anti-LAG-3 antibodies and anti-PD-1 antibodies to treat tumors
US11827704B2 (en) 2014-01-24 2023-11-28 Novartis Ag Antibody molecules to PD-1 and uses thereof
US12252535B2 (en) 2014-03-14 2025-03-18 Novartis Ag Antibody molecules to LAG-3 and uses thereof
US9908936B2 (en) 2014-03-14 2018-03-06 Novartis Ag Antibody molecules to LAG-3 and uses thereof
US11807686B2 (en) 2017-05-30 2023-11-07 Bristol-Myers Squibb Company Treatment of LAG-3 positive tumors
US11723975B2 (en) 2017-05-30 2023-08-15 Bristol-Myers Squibb Company Compositions comprising an anti-LAG-3 antibody or an anti-LAG-3 antibody and an anti-PD-1 or anti-PD-L1 antibody
US12049503B2 (en) 2017-05-30 2024-07-30 Bristol-Myers Squibb Company Treatment of LAG-3 positive tumors
WO2020084034A1 (en) 2018-10-26 2020-04-30 F. Hoffmann-La Roche Ag Multispecific antibody screening method using recombinase mediated cassette exchange
WO2020200983A1 (en) 2019-03-29 2020-10-08 F. Hoffmann-La Roche Ag Method for the generation of an fcrn expressing cell by targeted integration of multiple expression cassettes in a defined organization
US12466872B2 (en) 2019-03-29 2025-11-11 Hoffmann-La Roche Inc. Method for the generation of an FCRN expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254351A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254352A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254355A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2020254357A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a protein expressing cell by targeted integration using cre mrna
WO2020254356A1 (en) 2019-06-19 2020-12-24 F. Hoffmann-La Roche Ag Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization
WO2025039046A1 (en) * 2023-08-23 2025-02-27 The Walter And Eliza Hall Institute Of Medical Research Anti-rhesus d human monoclonal antibodies

Also Published As

Publication number Publication date
EP1967529A1 (en) 2008-09-10
NZ552265A (en) 2009-04-30
KR20070038556A (ko) 2007-04-10
AU2005263331B2 (en) 2011-05-26
US20090017017A1 (en) 2009-01-15
NO20070927L (no) 2007-04-19
BRPI0513706A (pt) 2008-05-13
MX2007000644A (es) 2007-03-28
AU2005263331A1 (en) 2006-01-26
CA2574062A1 (en) 2006-01-26
IL179658A0 (en) 2007-05-15
IL179658A (en) 2011-08-31
JP2008509658A (ja) 2008-04-03
AU2005263331B8 (en) 2011-06-16
EA200700249A1 (ru) 2007-06-29
US8198415B2 (en) 2012-06-12
JP4926054B2 (ja) 2012-05-09
EA014182B1 (ru) 2010-10-29
EP1771483A1 (en) 2007-04-11
AU2005263331A8 (en) 2011-06-16
US20120322690A1 (en) 2012-12-20

Similar Documents

Publication Publication Date Title
US8198415B2 (en) Anti-rhesus D recombinant polyclonal antibody
AU2004203727B2 (en) Method for manufacturing recombinant polyclonal proteins
AU2008255383B2 (en) Method for manufacturing a recombinant polyclonal protein
US9012371B2 (en) Mixtures of binding proteins
US20060275766A1 (en) Method for manufacturing recombinant polyclonal proteins
CN101023101A (zh) 抗-恒河猴d重组多克隆抗体和生产方法
CN100383244C (zh) 用于生产重组多克隆蛋白质的方法
AU2008201796A1 (en) Method for manufacturing recombinant polyclonal proteins
HK1078896B (en) Method for manufacturing recombinant polyclonal proteins
HK1134519B (en) Method for manufacturing a recombinant polyclonal protein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 179658

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2005263331

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2005760588

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2005263331

Country of ref document: AU

Date of ref document: 20050718

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 552265

Country of ref document: NZ

WWP Wipo information: published in national office

Ref document number: 2005263331

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2574062

Country of ref document: CA

Ref document number: MX/a/2007/000644

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 200580024606.8

Country of ref document: CN

Ref document number: 2007521793

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 200700249

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 520/KOLNP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 1020077003955

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 1020077003955

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2005760588

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11632937

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0513706

Country of ref document: BR