WO2005100380A1 - Antibakterielle amid-makrozyklen ii - Google Patents

Antibakterielle amid-makrozyklen ii Download PDF

Info

Publication number
WO2005100380A1
WO2005100380A1 PCT/EP2005/003463 EP2005003463W WO2005100380A1 WO 2005100380 A1 WO2005100380 A1 WO 2005100380A1 EP 2005003463 W EP2005003463 W EP 2005003463W WO 2005100380 A1 WO2005100380 A1 WO 2005100380A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
formula
substituent
salts
solvates
Prior art date
Application number
PCT/EP2005/003463
Other languages
English (en)
French (fr)
Inventor
Rainer Endermann
Kerstin Ehlert
Siegfried Raddatz
Yolanda Cancho-Grande
Martin Michels
Joachim Schuhmacher
Stefan Weigand
Original Assignee
Aicuris Gmbh & Co.Kg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aicuris Gmbh & Co.Kg filed Critical Aicuris Gmbh & Co.Kg
Publication of WO2005100380A1 publication Critical patent/WO2005100380A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/08—Tripeptides
    • C07K5/0802—Tripeptides with the first amino acid being neutral
    • C07K5/0812—Tripeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/06—Dipeptides
    • C07K5/06008—Dipeptides with the first amino acid being neutral
    • C07K5/06078—Dipeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
    • C07K5/10—Tetrapeptides
    • C07K5/1002—Tetrapeptides with the first amino acid being neutral
    • C07K5/1016—Tetrapeptides with the first amino acid being neutral and aromatic or cycloaliphatic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the invention relates to antibacterial amide macrocycles and processes for their preparation, their use for the treatment and / or prophylaxis of diseases, and their use for the production of medicaments for the treatment and / or prophylaxis of diseases, in particular bacterial infections.
  • WO 03/106480 and WO 04/012816 describe antibacterial macrocycles of the biphenomycin B type with amide or ester substituents.
  • An object of the present invention is therefore to provide new and alternative compounds with the same or improved antibacterial activity for the treatment of bacterial diseases in humans and animals.
  • the invention relates to compounds of the formula
  • R 1 is hydrogen or hydroxyl
  • R 2 is hydrogen or methyl
  • R 3 is C, -C 6 -alkyl, where alkyl is substituted by a substituent, the substituent being selected from the group consisting of hydroxycarbonyl, aminocarbonyl, C] -C 6 -alkoxycarbonyl and CC 6 -alkylaminocarbonyl, in which Alkylaminocarbonyl may be substituted with one substituent, the substituent being selected from the group consisting of hydroxycarbonyl, CC 6 -alkoxycarbonyl and aminocarbonyl, and where alkyl may be substituted with one or two further substituents, the substituents being selected independently of one another from the group consisting of hydroxy, amino, hydroxycarbonyl, Ci-C ß -alkoxycarbonyl, aminocarbonyl, guanidino and hydroxy-substituted phenyl,
  • R is a group of the formula
  • R 4 is hydrogen
  • Compounds according to the invention are the compounds of the formula (I) and their salts, solvates and solvates of the salts, hereinafter referred to as exemplary embodiment (s) and their salts, solvates and solvates of the salts, insofar as they included those of the formula (I), the compounds mentioned below are not already salts, solvates and solvates of the salts.
  • the compounds according to the invention can exist in stereoisomeric forms (enantiomers, diastereomers).
  • the invention therefore relates to the enantiomers or diastereomers and their respective mixtures.
  • the stereoisomerically uniform constituents can be isolated in a known manner from such mixtures of enantiomers and / or diastereomers.
  • the present invention encompasses all tautomeric forms.
  • preferred salts are physiologically acceptable salts of the compounds according to the invention.
  • salts are also included which are not themselves suitable for pharmaceutical applications but can be used for example for the isolation or purification of the compounds according to the invention.
  • Physiologically acceptable salts of the compounds according to the invention include acid addition salts of mineral acids, carboxylic acids and sulfonic acids, for example salts of hydrochloric acid re, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, naphthalenedisulfonic acid, acetic acid, trifluoroacetic acid, propionic acid, lactic acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic acid and benzoic acid.
  • hydrochloric acid re hydrobromic acid
  • sulfuric acid sulfuric acid
  • phosphoric acid methanesulfonic acid
  • ethanesulfonic acid toluenesulfonic acid
  • benzenesulfonic acid naphthalenedisulfonic acid
  • acetic acid trifluoroacetic acid
  • Physiologically acceptable salts of the compounds according to the invention also include salts of conventional bases, such as, by way of example and by way of preference, alkali metal salts (for example sodium and potassium salts), alkaline earth metal salts (for example calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms such as, by way of example and by way of preference, ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine, N-methylmorpholine, arginine, lysine, ethylenediamine and N-methylpiperidine.
  • alkali metal salts for example sodium and potassium salts
  • alkaline earth metal salts for example calcium and magnesium salts
  • solvates are those forms of the compounds according to the invention which form a complex in the solid or liquid state by coordination with solvent molecules. Hydrates are a special form of solvate, in which coordination takes place with water.
  • Alkyl per se and "alk” and “alkyl” in alkylaminocarbonyl and alkoxycarbonyl stand for a linear or branched alkyl radical with 1 to 6 carbon atoms, preferably 1 to 4, particularly preferably 1 to 3 carbon atoms, for example and preferably for methyl, ethyl, n- Propyl, isopropyl, tert-butyl, n-pentyl and n-hexyl.
  • Alkylaminocarbonyl stands for an alkylaminocarbonyl radical with one or two (independently selected) alkyl substituents, for example and preferably for methylaminocarbonyl, ethylaminocarbonyl, n-propylaminocarbonyl, isopropylaminocarbonyl, tert-butylaminocarbonyl, n-pentylaminocarbonyl, n-hexylaminocarbonyl, NN-dimethylamine carbonyl, N-ethyl-N-methylaminocarbonyl, N-methyl-Nn-propylaminocarbonyl, N-isopropyl-Nn-propylaminocarbonyl, N-tert-butyl-N-me ylaminocarbonyl, N-ethyl-Nn-pentylaminocarbonyl and Nn-hexyl-N -methylaminocarbonyl.
  • C 1 -C 3 -alkylaminocarbonyl represents, for example, a monoalkylaminocarbonyl radical having 1 to 3 carbon atoms or a dialkylaminocarbonyl radical each having 1 to 3 carbon atoms per alkyl substituent.
  • Alkoxycarbonyl is exemplified and preferably methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, isopropoxycarbonyl, tert-butoxycarbonyl, n-pentoxycarbonyl and n-hexoxycarbonyl.
  • a symbol * on a bond means the point of attachment in the molecule.
  • R 1 is hydrogen or hydroxy
  • R 2 is hydrogen or methyl
  • R 3 is C 2 -C 4 alkyl, where alkyl is substituted by one substituent aminocarbonyl and another substituent, the substituent being selected from the group consisting of aminocarbonyl and guanidino, or where alkyl is substituted by one substituent hydroxycarbonyl and another Substituents hydroxy,
  • R 4 is hydrogen
  • the invention furthermore relates to a process for the preparation of the compounds of the formula (I) or their salts, their solvates or the solvates of their salts, using processes
  • R 1 and R 2 have the meaning given above and boc is tert-butoxycarbonyl
  • R 1 and R 2 have the meaning given above and Z is benzyloxycarbonyl
  • the free base of the salts can be obtained, for example, by chromatography on a reversed phase column using an acetonitrile-water gradient with the addition of a base, in particular by using an RP 18 Phenomenex Luna C 18 (2) column and diethylamine as the base.
  • the invention further relates to a process for the preparation of the compounds of the formula (I) or their solvates according to Claim 1, in which salts of the compounds or solvates of the salts of the compounds are converted into the compounds by chromatography with the addition of a base.
  • the hydroxy group on R 1 is optionally protected during the reaction with compounds of the formula (in) with a tert-butyldimethylsilyl group which is split off in the second reaction step.
  • Reactive functionalities in the radical R 3 of compounds of the formula (HI) are already protected and incorporated into the synthesis; acid-labile protective groups (for example boc) are preferred.
  • acid-labile protective groups for example boc
  • the protective groups can be split off by a deprotection reaction. This is done according to standard protective group chemistry. Deprotection reactions under acidic conditions or by hydrogenolysis are preferred.
  • the implementation of the first stage of processes [A] and [B] is generally carried out in inert solvents, if appropriate in the presence of a base, preferably in a temperature range from 0 ° C. to 40 ° C. at atmospheric pressure.
  • Suitable dehydration reagents are, for example, carbodiimides such as N, N'-diethyl, N, N'-dipropyl, N.N'-diisopropyl, NN'-dicyclohexylcarbodiimide, N- (3-dimethylaminoisopropyl) -N ' -ethylcarbodiimide hydrochloride (EDC), N-cyclohexylcarbodiimide-N'-propyloxy-methyl-polystyrene (PS-carbodiimide) or carbonyl compounds such as carbonyldiimidazole, or 1,2-oxazolium compounds such as 2-ethyl-5-phenyl-l, 2-oxazolium -3-sulfate or 2-tert-butyl-5-methyl-isoxazolium perchlorate, or acylamino compounds such as 2-ethoxy-l-ethoxycarbonyl-l, 2-
  • Bases are, for example, alkali carbonates, e.g. Sodium or potassium carbonate, or hydrogen carbonate, or organic bases such as trialkylamines e.g. Triethylamine, N-methylmorpholine, N-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
  • alkali carbonates e.g. Sodium or potassium carbonate
  • hydrogen carbonate or organic bases
  • organic bases such as trialkylamines e.g. Triethylamine, N-methylmorpholine, N-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
  • the condensation with HATU is preferably carried out in the presence of a base, in particular diisopropylethylamine.
  • Inert solvents are, for example, halogenated hydrocarbons such as dichloromethane or trichloromethane, hydrocarbons such as benzene, or nitromethane, dioxane, dimethylformamide or acetonitrile. It is also possible to use mixtures of the solvents. Dimethylformamide is particularly preferred.
  • the reaction with an acid in the second stage of processes [A] and [B] is preferably carried out in a temperature range from 0 ° C. to 40 ° C. at normal pressure.
  • Suitable acids are hydrogen chloride in dioxane, hydrogen bromide in acetic acid or trifluoroacetic acid in methylene chloride.
  • the hydrogenolysis in the second stage of process [B] is generally carried out in a solvent in the presence of hydrogen and palladium on activated carbon, preferably in a temperature range from 0 ° C. to 40 ° C. at normal pressure.
  • Solvents are, for example, alcohols such as methanol, ethanol, n-propanol or iso-propanol, in a mixture with water and glacial acetic acid, a mixture of ethanol, water and glacial acetic acid is preferred.
  • the compounds of the formula (HI) are known or can be prepared analogously to known processes.
  • the reaction is generally carried out in a solvent, preferably in a temperature range from 0 ° C. to 40 ° C. at normal pressure.
  • Bases are, for example, alkali metal hydroxides such as sodium or potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate, or other bases such as DBU, triethylamine or diisopropylethylamine; sodium hydroxide or sodium carbonate is preferred.
  • alkali metal hydroxides such as sodium or potassium hydroxide
  • alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate
  • other bases such as DBU, triethylamine or diisopropylethylamine
  • sodium hydroxide or sodium carbonate is preferred.
  • Solvents are, for example, halogenated hydrocarbons such as methylene chloride or 1,2-dichloroethane, alcohols such as methanol, ethanol or isopropanol, or water.
  • the reaction is preferably carried out with sodium hydroxide in water or sodium carbonate in methanol.
  • R 1 and R 2 have the meaning given above, and R 5 is benzyl, methyl or ethyl,
  • the sealing can take place, for example, as described in the reaction of compounds of the formula (VI) to compounds of the formula (TV).
  • the compounds of formula (IV) are known or can be prepared by saponifying the benzyl, methyl or ethyl ester in compounds of formula (VI).
  • the reaction is generally carried out in a solvent, in the presence of a base, preferably in a temperature range from 0 ° C. to 40 ° C. at normal pressure.
  • Bases are, for example, alkali metal hydroxides such as lithium, sodium or potassium hydroxide, lithium hydroxide is preferred.
  • Solvents are, for example, halogenated hydrocarbons such as dichloromethane or trichloromethane, ethers such as tetrahydrofuran or dioxane, or alcohols such as methanol, ethanol or isopropanol, or dimethylformamide. It is also possible to use mixtures of the solvents or mixtures of the solvents with water. Tetrahydrofuran or a mixture of methanol and water are particularly preferred.
  • R, R and R have the meaning given above, in the first stage with acids, as described for the second stage of processes [A] and [B], and in the second stage with bases.
  • the reaction with bases generally takes place in a solvent, preferably in a temperature range from 0 ° C. to 40 ° C. at normal pressure.
  • Bases are, for example, alkali metal hydroxides such as sodium or potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate, or other bases such as DBU, triethylamine or diisopropylethylamine, with triethylamine being preferred.
  • alkali metal hydroxides such as sodium or potassium hydroxide
  • alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate
  • other bases such as DBU, triethylamine or diisopropylethylamine, with triethylamine being preferred.
  • Solvents are, for example, halogenated hydrocarbons such as chloroform, methylene chloride or 1,2-dichloroethane, or tetrahydrofuran, or mixtures of the solvents, methylene chloride or tetrahydrofuran is preferred.
  • the reaction is preferably carried out with DMAP and EDC in dichloromethane in a temperature range from -40 ° C to 40 ° C at normal pressure.
  • fluoride in particular with tetrabutylammonium fluoride.
  • the reaction is generally carried out in a solvent, preferably in a temperature range from -10 ° C to 30 ° C at normal pressure.
  • Inert solvents are, for example, halogenated hydrocarbons such as dichloromethane, or hydrocarbons such as benzene or toluene, or ethers such as tetrahydrofuran or dioxane, or dimethylformamide. It is also possible to use mixtures of the solvents. Preferred solvents are tetrahydrofuran and dimethylformamide.
  • R 1 has the meaning given above
  • the compounds according to the invention show an unforeseeable, valuable pharmacological and pharmacokinetic spectrum of action.
  • the compounds according to the invention can be used alone or in combination with other active compounds for the treatment and / or prophylaxis of infectious diseases, in particular bacterial infections.
  • local and / or systemic diseases that are caused by the following pathogens or by mixtures of the following pathogens can be treated and / or prevented:
  • Gram-positive cocci eg staphylococci (Staph. Aureus, Staph. Epidermidis) and streptococci (Strept. Agalactiae, Strept. Faecalis, Strept. Pneumoniae, Strept. Pyogenes); gram-negative cocci (neisseria gonorrhoeae) and gram-negative rods such as enterobacteria, for example Escherichia coli, Haemophilus influenzae, Citrobacter (Citrob. freundii, Citrob. divernis), Salmonella and Shigella; also Klebsielles (Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent.
  • the antibacterial spectrum includes the genus Pseudomonas (Ps. Aeruginosa, Ps. Maltophilia) as well as strict anaerobic bacteria such as Bacteroides fragilis, representatives of the genus Peptococcus, Peptostreptococcus and the genus Clostridium; also mycoplasma (M. pneumoniae, M. hominis, M. urealyticum) as well as mycobacteria, eg Mycobacterium tuberculosis.
  • Pseudomonas Ps. Aeruginosa, Ps. Maltophilia
  • strict anaerobic bacteria such as Bacteroides fragilis, representatives of the genus Peptococcus, Peptostreptococcus and the genus Clostridium
  • mycoplasma M. pneumoniae, M. hominis, M. urealyticum
  • pathogens are only an example and is in no way to be interpreted as restrictive.
  • diseases which can be caused by the pathogens mentioned or mixed infections and which can be prevented, improved or cured by the topically applicable preparations according to the invention are:
  • Infectious diseases in humans such as B. septic infections, bone and joint infections, skin infections, postoperative wound infections, abscesses, phlegmon, wound infections, infected burns, burns, mouth infections, infections after dental surgery, septic arthritis, mastitis, tonsillitis, genital infections and eye infections.
  • bacterial infections can also be treated in other species. Examples include:
  • Pig coli diarrhea, enterotoxemia, sepsis, dysentery, salmonellosis, metritis-mastitis-agalactiae syndrome, mastitis;
  • Ruminants (cattle, sheep, goats): diarrhea, sepsis, bronchopneumonia, salmonellosis, pasteureless, mycoplasmosis, genital infections;
  • Horse bronchopneumonia, foal paralysis, puerperal and postpuerperal infections, salmonellus;
  • Dog and cat bronchopneumonia, diarrhea, dermatitis, otitis, urinary tract infections, prostatitis;
  • Poultry (chicken, turkey, quail, pigeon, ornamental birds and others): mycoplasmosis, E. coli infections, chronic respiratory diseases, salmonellosis, pasteurellosis, psittacosis.
  • Bacterial diseases in the rearing and keeping of farmed and ornamental fish can also be treated, the antibacterial spectrum extending beyond the previously mentioned pathogens to other pathogens such as e.g. Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris, Corynebacteria, Borellia, Treponema, Nocardia, Rikettsie, Yersinia.
  • Pasteurella Brucella, Campylobacter, Listeria, Erysipelothris, Corynebacteria, Borellia, Treponema, Nocardia, Rikettsie, Yersinia.
  • the present invention furthermore relates to the use of the compounds according to the invention for the treatment and / or prophylaxis of diseases, preferably bacterial diseases, in particular bacterial infections.
  • the present invention furthermore relates to the use of the compounds according to the invention for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
  • the present invention furthermore relates to the use of the compounds according to the invention for the production of a medicament for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
  • Another object of the present invention is a method for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases, using an antibacterially effective amount of the compounds according to the invention.
  • the compounds according to the invention can act systemically and / or locally.
  • they can be applied in a suitable manner, e.g. oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, conjunctival, otic or as an implant or stent.
  • the compounds according to the invention can be administered in suitable administration forms.
  • state-of-the-art, fast and / or modified application forms which release the compounds according to the invention and contain the compounds according to the invention in crystalline and / or amorphized and / or dissolved form, such as e.g. Tablets (non-coated or coated tablets, for example with gastric juice-resistant or delayed dissolving or insoluble coatings which control the release of the compound according to the invention), rapidly disintegrating tablets or films / wafers, films / lyophilisates, capsules (for example hard or soft gelatin capsules) in the oral cavity , Coated tablets, granules, pellets, powders, emulsions, suspensions, aerosols or solutions.
  • Tablets non-coated or coated tablets, for example with gastric juice-resistant or delayed dissolving or insoluble coatings which control the release of the compound according to the invention
  • rapidly disintegrating tablets or films / wafers, films / lyophilisates, capsules (for example hard or soft gelatin capsules) in the oral cavity Coated
  • Parenteral administration can be done by bypassing an absorption step (e.g. intravenous, intraarterial, intracardiac, intraspinal or intralumbal) or by switching on absorption (e.g. intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal).
  • absorption step e.g. intravenous, intraarterial, intracardiac, intraspinal or intralumbal
  • absorption e.g. intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal.
  • Suitable forms of application for parenteral administration include: Injection and fusion preparations in the form of solutions, suspensions, emulsions, lyophilisates or sterile powders.
  • inhalation pharmaceutical forms including powder inhalers, nebulizers
  • nasal drops, solutions, sprays are suitable; tablets, films / wafers or capsules, suppositories, ear or eye preparations, vaginal, lingual, sublingual or buccal application capsules, aqueous suspensions (lotions, shake mixtures), lipophilic suspensions, ointments, creams, transdermal therapeutic systems (such as plasters), milk, pastes, foams, scattering powders, implants or stents.
  • the compounds according to the invention can be converted into the application forms mentioned. This can be done in a manner known per se by mixing with inert, non-toxic, pharmaceutically suitable auxiliaries.
  • auxiliaries include Carriers (e.g. microcrystalline cellulose, lactose, mannitol), solvents (e.g. liquid polyethylene glycols), emulsifiers and dispersing or wetting agents (e.g. sodium dodecyl sulfate, polyoxysorbitanoleate), binders (e.g. polyvinylpyrrolidone), synthetic and natural polymers (e.g. albumin), Stabilizers (for example antioxidants such as ascorbic acid), dyes (for example inorganic pigments such as iron oxides) and taste and / or odor correctors.
  • Carriers e.g. microcrystalline cellulose, lactose, mannitol
  • solvents e.g. liquid polyethylene glycols
  • the present invention further relates to medicaments which contain at least one compound according to the invention, usually together with one or more inert, non-toxic, pharmaceutically suitable auxiliaries, and to their use for the purposes mentioned above.
  • Method 1 Device type MS: Micromass ZQ; Device type HPLC: Waters Alliance 2795; Column: Merck Chromolith SpeedROD RP-18e 50 mm x 4.6 mm; Eluent A: water + 500 ⁇ l 50% formic acid / 1; Eluent B: acetonitrile + 500 ⁇ l 50% formic acid / 1; Gradient: 0.0 min 10% B ⁇ 3.0 min 95% B- 4.0 min 95% B; Oven: 35 ° C; Flow: 0.0 min 1.0 ml / min ⁇ 3.0 min 3.0 ml / min- 4.0 min 3.0 ml / min; UV detection: 210 nm.
  • Method 2 Device type MS: Micromass ZQ; Device type HPLC: Waters Alliance 2795; Column: Phenomenex Synergi 2 ⁇ Hydro-RP Mercury 20mm x 4mm; Eluent A: 1 1 water + 0.5 ml 50% formic acid, eluent B: 1 1 acetonitrile + 0.5 ml 50% formic acid; Gradient: 0.0 min 90% A - 2.5 min 30% A - 3.0 min 5% A -> 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min 2 ml / min; Oven: 50 ° C; UV detection: 210 nm.
  • Method 3 Instrument: HP 1100 with DAD detection; Column: Kromasil RP-18, 60 mm x 2 mm, 3.5 ⁇ m; Eluent A: 5 ml perchloric acid / 1 water, eluent B: acetonitrile; Gradient: 0 min 2% B, 0.5 min 2% B, 4.5 min 90% B, 15 min 90% B; Flow: 0J5ml / min; Oven: 30 ° C; UV detection: 210 nm.
  • Method 4 Device type MS: Micromass ZQ; Device type HPLC: HP 1100 Series; UV DAD; Column: Phenomenex Synergi 2 ⁇ Hydro-RP Mercury 20mm x 4mm; Eluent A: 1 1 water + 0.5 ml 50% formic acid, eluent B: 1 1 acetonitrile + 0.5 ml 50% formic acid; Gradient: 0.0 min 90% A - »2.5 min 30% A -> 3.0 min 5% A -> 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min. 2 ml / min; Oven: 50 ° C; UV detection: 210 nm.
  • Method 5 Instrument: Micromass Quattro LCZ with HPLC Agilent Series 1100; Column: Phenomenex Synergi 2 ⁇ Hydro-RP Mercury 20mm x 4mm; Eluent A: 1 1 water + 0.5 ml 50% formic acid, eluent B: 1 1 acetonitrile + 0.5 ml 50% formic acid; Gradient: 0.0 min 90% A -> 2.5 min 30% A - 3.0 min 5% A -> 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min 2 ml / min; Oven: 50 ° C; UV detection: 208-400 nm.
  • Method 6 Device type MS: Micromass ZQ; Device type HPLC: HP 1100 Series; UV DAD; Column: Grom-Sil 120 ODS-4 HE 50 mm x 2 mm, 3.0 ⁇ m; Eluent A: water + 500 ⁇ l 50% formic acid / 1, eluent B: acetonitrile + 500 ⁇ l 50% formic acid / 1; Gradient: 0.0 min 70% B - 4.5 min 90% B; Oven: 50 ° C; Flow: 0.8 ml / min; UV detection: 210 nm.
  • Method 7 Instrument: HP 1100 with DAD detection; Column: Kromasil RP-18, 60 mm x 2 mm, 3.5 ⁇ m; Eluent A: 5 ml perchloric acid / 1 water, eluent B: acetonitrile; Gradient: 0 min 2% B, 0.5 min 2% B, 4.5 min 90% B, 6.5 min 90% B; Flow: 0.75 ml / min; Oven: 30 ° C; UV detection: 210 nm.
  • Example 83A from WO03 / 106480
  • 5.86 mg (0.05 mmol) 3-aminoazepan-2-one with 17.39 mg (0.05 mmol) HATU and a total of 16 mg (0.12 mmol) Hünig base in 3 ml abs. DMF.
  • Examples 14A to 18A listed in the following table are prepared analogously to the instructions in Example 13A.
  • Examples 21A and 22A listed in the following table are prepared analogously to the instructions in Example 20A.
  • Examples 24A and 25A listed in the following table are prepared analogously to the instructions in Example 23A.
  • example 23 A 163 mg (0.13 mmol) of example 23 A are dissolved in 6 ml of dioxane / hydrogen chloride solution (4M solution) under an agon atmosphere and the mixture is stirred at room temperature for 3 h. For working up, we dried in a high vacuum. The raw product is converted without further purification.
  • Examples 27A and 28A listed in the following table are prepared analogously to the instructions in Example 26A.
  • Example 14A Under an argon atmosphere, 150 mg (0.13 mmol) of Example 26A and 80 mg (0.16 mmol) of 5-benzyloxycarbonylamino-2 (S) -tert-butoxycarbonylamino-4 (R) - (tert-butyl-dimethylsilanyloxy) pentanoic acid (Example 14A from WO03 / 106480) dissolved in 5 ml DMF and successively mixed with 64 mg (0.17 mmol) HATU and 61 mg (0.47 mmol) Hünig base. Stir for 4 d at room temp. For working up, the reaction solution is purified directly via RP-HPLC HPLC (water / acetonitrile). The crude product thus obtained is reacted without further purification.
  • Example 29A 152 mg (0.09 mmol) of Example 29A are dissolved in 5 ml of DMF under an argon atmosphere and 0.50 ml of tetrabutylammonium fluoride (IM solution) are added. The mixture is stirred for 5 hours at room temperature and then mixed with 15 ml of water. The precipitated product is filtered off, washed with 100 ml of water and dried in a high vacuum. The crude product thus obtained is reacted without further purification.
  • IM solution tetrabutylammonium fluoride
  • Examples 33A and 34A listed in the following table are prepared analogously to the instructions in Example 32A.
  • Example 32A 131 mg (0.09 mmol) of Example 32A are dissolved in 3 ml of DMF under an argon atmosphere, and 87 mg (0.47 mmol) of pentafluorophenol and 2 mg of DMAP are added. The mixture is cooled to -25 ° C. and 23 mg (0.12 mmol) EDC are added. The mixture is allowed to warm to room temperature and stirred overnight. For working up, drying is carried out under a high vacuum. The crude product thus obtained is reacted without further purification. Examples 36A and 37A listed in the following table are prepared analogously to the instructions in Example 35A.
  • Example 35A 141 arg (0.09 mmol) of Example 35A are dissolved in 5 ml of dioxane / hydrogen chloride solution (4M solution) under an argon atmosphere. After stirring for 3 h at room temperature, the mixture is concentrated on a rotary evaporator and codistilled twice with methylene chloride. The crude product thus obtained is reacted without further purification.
  • Examples 39A and 40A listed in the following table are prepared analogously to the instructions in Example 38A.
  • Example 38A 141 mg (0.09 mmol) of Example 38A are dissolved in 5 ml of dioxane / hydrogen chloride solution (4M solution) under an argon atmosphere. After stirring for 3 h at room temperature, the mixture is concentrated on a rotary evaporator and codistilled twice with methylene chloride.
  • Examples 42A and 43A listed in the following table are prepared analogously to the instructions in Example 41A.
  • Example 8 The preparation is carried out analogously to Example 8 from 4 mg (0.01 mmol) of the compound from Example 3.
  • luciferin solution 20 mM tricine, 2.67 mM MgS0 4 , 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 ⁇ M CoA, 470 ⁇ M luciferin, 530 ⁇ M ATP
  • the IC 50 is the concentration of an inhibitor which leads to a 50% inhibition of the translation of Firefly luciferase.
  • the plasmid pBESTluc (Promega Corporation, USA) is used to construct a reporter plasmid which can be used in an in vitro S. aureus transcription-translation assay.
  • the primer CAPFor contains the capAl promoter, the ribosome binding site and the 5 'region of the luciferase gene.
  • a PCR product can be isolated which contains the Firefly Luciferase gene with the fused capAl promoter.
  • restriction with Clal and HindDI this is ligated into the vector pBESTluc, also digested with Clal and HindHI.
  • the resulting plasmid pla can be replicated in E. coli and used as a template in the S. aureus in vitro transcription-translation test.
  • BHI medium Six liters of BHI medium are inoculated with a 250 ml overnight culture of a S. aureus strain and grown at 37 ° C to an OD600nm of 2-4.
  • the cells are harvested by centrifugation and washed in 500 ml of cold buffer A (10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 1 M KCl). After centrifuging again, the cells are washed in 250 ml of cold buffer A with 50 mM KCl and the pellets obtained are frozen at -20 ° C. for 60 min.
  • the pellets are thawed on ice in 30 to 60 min and up to a total volume of 99 ml in buffer B (10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1mM DTT, 50mM KCl) added.
  • buffer B 10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1mM DTT, 50mM KCl
  • 1.5 ml of lysostaphin (0.8 mg / ml) in buffer B are placed in 3 pre-cooled centrifuge beakers and mixed with 33 ml of the cell suspension.
  • the samples are incubated for 45 to 60 min at 37 ° C with occasional shaking before adding 150 ⁇ l of a 0.5 M DTT solution.
  • the lysed cells are centrifuged at 30,000 xg for 30 min at 4 ° C.
  • the cell pellet After being taken up in buffer B, the cell pellet is centrifuged again under the same conditions and the collected supernatants are combined. The supernatants are centrifuged again under the same conditions and 0.25 volume of buffer C (670 mM tris-acetate, pH 8.0, 20 mM magnesium acetate, 7 mM Na 3 -phosphoenolpyruvate, 7 mM DTT, 5.5 mM ATP ) are added to the upper 2/3 of the supernatant , 70 ⁇ M amino acids (complete from Proma), 75 ⁇ g pyruvate kinase (Sigma, Germany)) / ml. The samples are incubated for 30 min at 37 ° C.
  • the supernatants are dialyzed overnight at 4 ° C. against 2 l dialysis buffer (10 mM trisacetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 60 mM potassium acetate) with a buffer change in a dialysis tube with 3500 Da exclusion.
  • the dialysate is concentrated to a protein concentration of about 10 mg / ml by covering the dialysis tube with cold PEG 8000 powder (Sigma, Germany) at 4 ° C.
  • the S30 extracts can be stored aliquoted at - 70 ° C.
  • the inhibition of the protein biosynthesis of the compounds can be demonstrated in an in vitro transcription-translation assay.
  • the assay is based on cell-free transcription and translation of Firefly Luciferase using the reporter plasmid pla as a template and cell-free S30 extracts obtained from S. aureus.
  • the activity of the resulting luciferase can be demonstrated by luminescence measurement.
  • the amount of S30 extract or plasmid pla to be used must be re-tested for each preparation in order to ensure an optimal concentration in the test. 3 ⁇ l of the substance to be tested dissolved in 5% DMSO are placed in an MTP. Then 10 ⁇ l of a suitably concentrated plasmid solution p1 are added.
  • luciferin solution (20 mM Tricine, 2.67 mM MgS0 4 , 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 ⁇ M CoA, 470 ⁇ M luciferin, 530 ⁇ M ATP) and the resulting bioluminescence are used for Measured for 1 min in a luminometer.
  • the IC 50 is the concentration of an inhibitor which leads to a 50% inhibition of the translation of Firefly luciferase. Determination of the minimum inhibitory concentration (MB-KP
  • the minimum inhibitory concentration is the minimum concentration of an antibiotic with which a test germ is inhibited in its growth over 18-24 h.
  • the inhibitor concentration can be determined using standard microbiological methods (see e.g. The National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard-fifth edition. NCCLS document M7-A5 [ISBN 1 -56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000).
  • the MIC of the compounds according to the invention is determined in the liquid dilution test on a 96-microtiter plate scale.
  • the bacterial germs are in a minimal medium (18.5 mM Na 2 HP0 4 , 5.7 mM KH 2 P0 4 , 9.3 mM NILC1, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid with the exception of phenylalanine; [H.-P. Kroll; unpublished]) cultured with the addition of 0.4% BH broth (test medium).
  • the lowest substance concentration at which no visible bacterial growth occurred is defined as the MIC.
  • the MIC values in ⁇ M of some compounds according to the invention compared to a number of test germs are listed in the table below as examples. The compounds show a graded antibacterial effect against most of the test germs.
  • the suitability of the compounds according to the invention for the treatment of bacterial infections can be shown in various animal models.
  • the animals are generally infected with a suitable virulent germ and then treated with the compound to be tested, which is present in a formulation adapted to the respective therapy model.
  • the suitability of the compounds according to the invention for the treatment of bacterial infections in a sepsis model in mice after infection with S. aureus can be demonstrated.
  • S. aureus 133 cells are grown overnight in BH broth (Oxoid, Germany). The overnight culture was diluted 1: 100 in fresh bra broth and turned up for 3 hours. The bacteria in the logarithmic growth phase are centrifuged off and washed twice with buffered, physiological saline. Then a cell suspension in saline with an absorbance of 50 units is set on the photometer (Dr. Lange LP 2W). After a dilution step (1:15), this suspension is mixed 1: 1 with a 10% mucin suspension. 0.2 ml / 20 g mouse ip is applied from this infection solution. This corresponds to a cell count of approximately 1-2 x 10 6 germs / mouse.
  • the compounds according to the invention can be converted into pharmaceutical preparations as follows:
  • the compound according to the invention is dissolved together with polyethylene glycol 400 in the water with stirring.
  • the solution is sterile filtered (pore diameter 0.22 ⁇ m) and filled into heat-sterilized infusion bottles under aseptic conditions. These are closed with infusion stoppers and crimp caps.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Communicable Diseases (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Die Erfindung betrifft antibakterielle Amid-Makrozyklen und Verfahren zu ihrer Herstellung, ihre Verwendung zur Behandlung und/oder Prophylaxe von Krankheiten sowie ihre Verwendung zur Herstellung von Arzneimitteln zur Behandlung und/oder Prophylaxe von Krankheiten, insbesondere von bakteriellen Infektionen.

Description

Antibakterielle Amid-Makrozyklen II
Die Erfindung betrifft antibakterielle Amid-Makrozyklen und Verfahren zu ihrer Herstellung, ihre Verwendung zur Behandlung und/oder Prophylaxe von Krankheiten sowie ihre Verwendung zur Herstellung von Arzneimitteln zur Behandlung und/oder Prophylaxe von Krankheiten, insbeson- dere von bakteriellen Infektionen.
In WO 03/106480 und WO 04/012816 werden antibakteriell wirkende Makrozyklen vom Biphenomycin B Typ mit Amid- bzw. Estersubstituenten beschrieben.
In US 3,452,136, Dissertation R. U. Meyer, Universität Stuttgart, Deutschland 1991, Dissertation V. Leitenberger, Universität Stuttgart, Deutschland 1991, Synthesis (1992), (10), 1025-30, J. Chem. Soc, Perkin Trans. 1 (1992), (1), 123-30, J. Chem. Soc, Chem. Commun. (1991), (10), 744, Synthesis (1991), (5), 409-13, J. Chem. Soc, Chem. Commun. (1991), (5), 275-7, J. Antibiot. (1985), 38(11), 1462-8, J. Antibiot. (1985), 38(11), 1453-61, wird der Naturstoff Biphenomycin B als antibakteriell wirksam beschrieben. Teilschritte der Synthese von Biphenomycin B werden in Synlett (2003), 4, 522-526 beschrieben.
Chirality (1995), 7(4), 181-92, J. Antibiot. (1991), 44(6), 674-7, J. Am. Chem. Soc. (1989), 111(19), 7323-7, J. Am. Chem. Soc. (1989), 111(19), 7328-33, J. Org. Chem. (1987), 52(24), 5435-7, Anal. Biochem. (1987), 165(1), 108-13, J. Org. Chem. (1985), 50(8), 1341-2, J. Antibiot. (1993), 46(3), C-2, J. Antibiot. (1993), 46(1), 135-40, Synthesis (1992), (12), 1248-54, Appl. Envi- ron. Microbiol. (1992), 58(12), 3879-82, J. Chem. Soc, Chem. Commun. (1992), (13), 951-3 be- schreiben einen strukturell verwandten Naturstoff, Biphenomycin A, der am Makrozyklus eine weitere Substitution mit einer Hydroxygruppe aufweist.
Die Naturstoffe entsprechen hinsichtlich ihrer Eigenschaften nicht den Anforderungen, die an antibakterielle Arzneimittel gestellt werden. Auf dem Markt sind zwar strukturell andersartige antibakteriell wirkende Mittel vorhanden, es kann aber regelmäßig zu einer Resistenzentwicklung kommen. Neue Mittel für eine gute und wirksamere Therapie sind daher wünschenswert.
Eine Aufgabe der vorliegenden Erfindung ist es daher, neue und alternative Verbindungen mit gleicher oder verbesserter antibakterieller Wirkung zur Behandlung von bakteriellen Erkrankungen bei Menschen und Tieren zur Verfügung zu stellen.
Gegenstand der Erfindung sind Verbindungen der Formel
Figure imgf000003_0001
in welcher
R1 gleich Wasserstoff oder Hydroxy i st,
R2 gleich Wasserstoff oder Methyl ist,
R3 gleich C,-C6-Alkyl bedeutet, wobei Alkyl substituiert ist mit einem Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe bestehend aus Hydroxycarbonyl, Aminocarbonyl, C]-C6-Alkoxy- carbonyl und C C6-Alkylaminocarbonyl, worin Alkylaminocarbonyl substituiert sein kann mit einem Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe bestehend aus Hydroxycarbonyl, C C6-Alkoxycarbonyl und Aminocarbonyl, und wobei Alkyl substituiert sein kann mit einem oder zwei weiteren Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe bestehend aus Hydroxy, Amino, Hydroxycarbonyl, Ci-Cß-Alkoxycarbonyl, Aminocarbonyl, Guanidino und Hydroxy substituiertes Phenyl,
oder
R gleich eine Gruppe der Formel
Figure imgf000003_0002
ist
und
R4 gleich Wasserstoff ist
oder
R3 und R4 zusammen mit dem Stickstoffatom, an das sie gebunden sind, eine Gruppe der Formel
Figure imgf000004_0001
bilden,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.
Erfindungsgemäße Verbindungen sind die Verbindungen der Formel (I) und deren Salze, Solvate und Solvate der Salze, nachfolgend als Ausfuhrungsbeispiel(e) genannten Verbindungen und deren Salze, Solvate und Solvate der Salze, soweit es sich bei den von Formel (I) umfassten, nachfolgend genannten Verbindungen nicht bereits um Salze, Solvate und Solvate der Salze handelt.
Die erfindungsgemäßen Verbindungen können in Abhängigkeit von ihrer Struktur in stereoisomeren Formen (Enantiomere, Diastereomere) existieren. Die Erfindung betrifft deshalb die Enan- tiomeren oder Diastereomeren und ihre jeweiligen Mischungen. Aus solchen Mischungen von Enantiomeren und/oder Diastereomeren lassen sich die stereoisomer einheitlichen Bestandteile in bekannter Weise isolieren.
Sofern die erfindungsgemäßen Verbindungen in tautomeren Formen vorkommen können, umfasst die vorliegende Erfindung sämtliche tautomere Formen.
Als Salze sind im Rahmen der vorliegenden Erfindung physiologisch unbedenkliche Salze der erfindungsgemäßen Verbindungen bevorzugt. Umfasst sind aber auch Salze, die für pharmazeutische Anwendungen selbst nicht geeignet sind aber beispielsweise für die Isolierung oder Reinigung der erfindungsgemäßen Verbindungen verwendet werden können.
Physiologisch unbedenkliche Salze der erfindungsgemäßen Verbindungen umfassen Säureadditi- onssalze von Mineralsäuren, Carbonsäuren und Sulfonsäuren, z.B. Salze der Chlorwasserstoffsäu- re, Bromwasserstoffsäure, Schwefelsäure, Phosphorsäure, Methansulfonsäure, Ethansulfonsäure, Toluolsulfonsäure, Benzolsulfonsäure, Naphthalindisulfonsäure, Essigsäure, Trifluoressigsäure, Propionsäure, Milchsäure, Weinsäure, Äpfelsäure, Zitronensäure, Fumarsäure, Maleinsäure und Benzoesäure.
Physiologisch unbedenkliche Salze der erfindungsgemäßen Verbindungen umfassen auch Salze üblicher Basen, wie beispielhaft und vorzugsweise Alkalimetallsalze (z.B. Natrium- und Kaliumsalze), Erdalkalisalze (z.B. Calcium- und Magnesiumsalze) und Ammoniumsalze, abgeleitet von Ammoniak oder organischen A inen mit 1 bis 16 C- Atomen, wie beispielhaft und vorzugsweise Ethylamin, Diethylamin, Triethylamin, Ethyldiisopropylamin, Monoethanolamin, Diethanolamin, Triethanolamin, Dicyclohexylamin, Dimethylaminoethanol, Prokain, Dibenzylamin, N- Methylmorpholin, Arginin, Lysin, Ethylendiamin und N-Methylpiperidin.
Als Solvate werden im Rahmen der Erfindung solche Formen der erfindungsgemäßen Verbindungen bezeichnet, welche in festem oder flüssigem Zustand durch Koordination mit Lösungsmittelmolekülen einen Komplex bilden. Hydrate sind eine spezielle Form der Solvate, bei denen die Koordination mit Wasser erfolgt.
Im Rahmen der vorliegenden Erfindung haben die Substituenten, soweit nicht anders spezifiziert, die folgende Bedeutung:
Alkyl per se und "Alk" und "Alkyl" in Alkylaminocarbonyl und Alkoxycarbonyl stehen fiir einen linearen oder verzweigten Alkylrest mit 1 bis 6 Kohlenstoffatomen, vorzugsweise 1 bis 4, besonders bevorzugt 1 bis 3 Kohlenstoffatomen, beispielhaft und vorzugsweise für Methyl, Ethyl, n-Propyl, Isopropyl, tert-Butyl, n-Pentyl und n-Hexyl.
Alkylaminocarbonyl steht für einen Alkylaminocarbonylrest mit einem oder zwei (unabhängig voneinander gewählten) Alkylsubstituenten, beispielhaft und vorzugsweise für Methylaminocarbonyl, Ethylaminocarbonyl, n-Propylaminocarbonyl, Isopropylaminocarbonyl, tert-Butylaminocarbonyl, n- Pentylaminocarbonyl, n-Hexylaminocarbonyl, NN-Dimethylaminocarbonyl, N-N-Diethylamino- carbonyl, N-Ethyl-N-methylaminocarbonyl, N-Methyl-N-n-propylaminocarbonyl, N-Isopropyl-N-n- propylaminocarbonyl, N-tert-Butyl-N-me ylaminocarbonyl, N-Ethyl-N-n-pentylaminocarbonyl und N-n-Hexyl-N-methylaminocarbonyl. Cι-C3-Alkylaminocarbonyl steht beispielsweise fiir einen Mo- noalkylaminόcarbonylrest mit 1 bis 3 Kohlenstoffatomen oder für einen Dialkylaminocarbonylrest mit jeweils 1 bis 3 Kohlenstoffatomen pro Alkylsubstituent. Alkoxycarbonyl steht beispielhaft und vorzugsweise für Methoxycarbonyl, Ethoxycarbonyl, n- Propoxycarbonyl, Isopropoxycarbonyl, tert-Butoxycarbonyl, n-Pentoxycarbonyl und n-Hexoxy- carbonyl.
Ein Symbol * an einer Bindung bedeutet die Verknüpfungsstelle im Molekül.
Bevorzugt im Rahmen der vorliegenden Erfindung sind Verbindungen der Formel (I), in welcher
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff oder Methyl ist,
R3 gleich C2-C4-Alkyl bedeutet, wobei Alkyl substituiert ist mit einem Substituenten Aminocarbonyl und einem weiteren Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe bestehend Aminocarbonyl und Guanidino, oder wobei Alkyl substituiert ist mit einem Substituenten Hydroxycarbonyl und einem weiteren Substituenten Hydroxy,
und
R4 gleich Wasserstoff ist,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.
Gegenstand der Erfindung ist weiterhin ein Verfahren zur Herstellung der Verbindungen der Formel (I) oder ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze, wobei nach Verfahren
[A] Verbindungen der Formel
Figure imgf000007_0001
worin R1 und R2 die oben angegebene Bedeutung haben und boc gleich tert-Butoxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren De- hydratisierungsreagenzien mit Verbindungen der Formel
HNR3R4 ( ),
worin R3 und R4 die oben angegebene Bedeutung haben,
und anschließend mit einer Säure umgesetzt werden,
oder
[B] Verbindungen der Formel
Figure imgf000007_0002
worin R1 und R2 die oben angegebene Bedeutung haben und Z gleich Benzyloxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren De- hydratisierungsreagenzien mit Verbindungen der Formel
HNR3R4 m, worin R3 und R4 die oben angegebene Bedeutung haben,
und anschließend mit einer Säure oder durch Hydrogenolyse umgesetzt werden.
Die freie Base der Salze kann zum Beispiel durch Chromatographie an einer Reversed Phase Säule mit einem Acetonitril-Wasser-Gradienten unter Zusatz einer Base erhalten werden, insbesondere durch Verwendung einer RP 18 Phenomenex Luna C 18(2) Säule und Diethylamin als Base.
Weiterer Gegenstand der Erfindung ist ein Verfahren zur Herstellung der Verbindungen der Formel (I) oder ihrer Solvate nach Anspruch 1, bei dem Salze der Verbindungen oder Solvate der Salze der Verbindungen durch Chromatographie unter Zusatz einer Base in die Verbindungen überführt werden.
Die Hydroxygruppe an R1 ist gegebenenfalls während der Umsetzung mit Verbindungen der Formel (in) mit einer tert-Butyldimethylsilyl-Gruppe geschützt, die im zweiten Reaktionsschritt abgespalten wird.
Reaktive Funktionalitäten in dem Rest R3 von Verbindungen der Formel (HI) werden bereits geschützt mit in die Synthese eingebracht, bevorzugt sind säurelabile Schutzgruppen (z.B. boc). Nach erfolgter Umsetzung zu Verbindungen der Formel (I) können die Schutzgruppen durch Entschüt- zungsreaktion abgespalten werden. Dies geschieht nach Standardverfahren der Schutzgruppenchemie. Bevorzugt sind Entschützungsreaktionen unter sauren Bedingungen oder durch Hydrogenolyse.
Die Umsetzung der ersten Stufe der Verfahren [A] und [B] erfolgt im Allgemeinen in inerten Lö- sungsmitteln, gegebenenfalls in Gegenwart einer Base, bevorzugt in einem Temperaturbereich von 0°C bis 40°C bei Normaldruck.
Als Dehydratisierungsreagenzien eignen sich hierbei beispielsweise Carbodiimide wie z.B. N,N'- Diethyl-, N,N'-Dipropyl-, N.N'-Diisopropyl-, NN'-Dicyclohexylcarbodiimid, N-(3-Dimethylamino- isopropyl)-N'-ethylcarbodiimid-Hydrochlorid (EDC), N-Cyclohexylcarbodiimid-N'-propyloxy- methyl-Polystyrol (PS-Carbodiimid) oder Carbonylverbindungen wie Carbonyldiimidazol, oder 1,2-Oxazoliumverbindungen wie 2-Ethyl-5-phenyl-l,2-oxazolium-3-sulfat oder 2-tert.-Butyl-5- methyl-isoxazolium-perchlorat, oder Acylaminoverbindungen wie 2-Ethoxy-l-ethoxycarbonyl-l,2- dihydrochinolin, oder Propanphosphonsäureanhydrid, oder Isobutylchloroformat, oder Bis-(2-oxo- 3-oxazolidinyl)-phosphorylchlorid oder Benzotriazolyloxy-tri(dimethylamino)phosphoniumhexa- fluorophosphat, oder < -(Benzotriazol-l-yl)-N,N,N'N'-tetra-methyluroniumhexafluorophosphat (HBTU), 2-(2-Oxo-l-(2H)-pyridyl)-l,l,3,3-tetramethyluroniumtetrafluoroborat (TPTU) oder 0-(7-Azabenzotriazol- 1 -yl)-N,N,N',N'-tetramethyluroniuπ-hexafluorophosphat (HATU), oder 1-Hydroxybenztriazol (HOBt), oder Benzotriazol-l-yloxytris(dimethylamino)-phosphonium- hexafluoro-phosphat (BOP), oder Mischungen aus diesen, oder Mischung aus diesen zusammen mit Basen.
Basen sind beispielsweise Alkalicarbonate, wie z.B. Natrium- oder Kaliumcarbonat, oder -hydro- gencarbonat, oder organische Basen wie Trialkylamine z.B. Triethylamin, N-Methylmorpholin, N- Methylpiperidin, 4-Dimethylaminopyridin oder Diisopropylethylamin.
Vorzugsweise wird die Kondensation mit HATU in Gegenwart einer Base, insbesondere Diisopropylethylamin, durchgeführt.
Inerte Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan oder Trichlormethan, Kohlenwasserstoff wie Benzol, oder Nitromethan, Dioxan, Dimethylformamid oder Acetonitril. Ebenso ist es möglich, Gemische der Lösemittel einzusetzen. Besonders bevorzugt ist Dimethylformamid.
Die Umsetzung mit einer Säure in der zweiten Stufe der Verfahren [A] und [B] erfolgt bevorzugt in einem Temperaturbereich von 0°C bis 40°C bei Normaldruck.
Als Säuren eignen sich hierbei Chlorwasserstoff in Dioxan, Bromwasserstoff in Essigsäure oder Trifluoressigsäure in Methylenchlorid.
Die Hydrogenolyse in der zweiten Stufe des Verfahrens [B] erfolgt im Allgemeinen in einem Lösungsmittel in Gegenwart von Wasserstoff und Palladium auf Aktivkohle, bevorzugt in einem Temperaturbereich von 0°C bis 40°C bei Normaldruck.
Lösungsmittel sind beispielsweise Alkohole wie Methanol, Ethanol, n-Propanol oder iso-Propanol, in einem Gemisch mit Wasser und Eisessig, bevorzugt ist ein Gemisch aus Ethanol, Wasser und Eisessig.
Die Verbindungen der Formel (HI) sind bekannt oder können analog bekannten Verfahren hergestellt werden.
Die Verbindungen der Formel (II) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000010_0001
worin R1 und R2 die oben angegebene Bedeutung haben,
mit Di-(tert-butyl)-dicarbonat in Gegenwart einer Base umgesetzt werden.
Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmitteln, bevorzugt in einem Tem- peraturbereich von 0°C bis 40°C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Natrium- oder Kaliumhydroxid, oder Alkalicarbo- nate wie Cäsiumcarbonat, Natrium- oder Kaliumcarbonat, oder andere Basen wie DBU, Triethy- lamin oder Diisopropylethylamin, bevorzugt ist Natriumhydroxid oder Natriumcarbonat.
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Methylenchlorid oder 1,2-Di- chlorethan, Alkohole wie Methanol, Ethanol oder iso-Propanol, oder Wasser.
Vorzugsweise wird die Umsetzung mit Natriumhydroxid in Wasser oder Natriumcarbonat in Methanol durchgeführt.
Die Verbindungen der Formel (V) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000010_0002
worin R1 und R2 die oben angegebene Bedeutung haben, und R5 gleich Benzyl, Methyl oder Ethyl ist,
mit einer Säure oder durch Hydrogenolyse, wie für die zweite Stufe des Verfahrens [B] beschrieben, gegebenenfalls durch anschließende Umsetzung mit einer Base zur Verseifung des Methyloder Ethylesters, umgesetzt werden.
Die Versei ung kann zum Beispiel erfolgen, wie bei der Umsetzung von Verbindungen der Formel (VI) zu Verbindungen der Formel (TV) beschrieben.
Die Verbindungen der Formel (IV) sind bekannt oder können hergestellt werden, indem in Verbindungen der Formel (VI) der Benzyl-, Methyl- oder Ethylester verseift wird.
Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmitteln, in Gegenwart einer Base, be- vorzugt in einem Temperaturbereich von 0°C bis 40°C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Lithium-, Natrium- oder Kaliumhydroxid, bevorzugt ist Lithiumhydroxid.
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan oder Trichlormethan, Ether wie Tetrahydrofuran oder Dioxan, oder Alkohole wie Methanol, Ethanol oder Iso- propanol, oder Dimethylformamid. Ebenso ist es möglich, Gemische der Lösungsmittel oder Gemische der Lösungsmittel mit Wasser einzusetzen. Besonders bevorzugt sind Tetrahydrofuran oder ein Gemisch aus Methanol und Wasser.
Die Verbindungen der Formel (VI) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000011_0001
worin R , R und R die oben angegebene Bedeutung haben, in der ersten Stufe mit Säuren, wie für die zweite Stufe der Verfahren [A] und [B] beschrieben, und in der zweiten Stufe mit Basen umgesetzt werden.
In der zweiten Stufe erfolgt die Umsetzung mit Basen im Allgemeinen in einem Lösungsmitteln, bevorzugt in einem Temperaturbereich von 0°C bis 40°C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Natrium- oder Kaliumhydroxid, oder Alkalicarbo- nate wie Cäsiumcarbonat, Natrium- oder Kaliumcarbonat, oder andere Basen wie DBU, Triethyl- amin oder Diisopropylethylamin, bevorzugt ist Triethylamin.
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Chloroform, Methylenchlorid oder 1 ,2-Dichlorethan, oder Tetrahydrofuran, oder Gemische der Lösungsmittel, bevorzugt ist Methylenchlorid oder Tetrahydrofuran.
Die Verbindungen der Formel (VII) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000012_0001
worin R1, R und R5 die oben angegebene Bedeutung haben,
mit Pentafluorphenol in Gegenwart von Dehydratisierungsreagenzien, wie für die erste Stufe der Verfahren [A] und [B] beschrieben, umgesetzt werden.
Die Umsetzung erfolgt bevorzugt mit DMAP und EDC in Dichlormethan in einem Temperaturbereich von -40°C bis 40°C bei Normaldruck.
Die Verbindungen der Formel (VIII) sind bekannt oder können hergestellt werden, indem Verbin- düngen der Formel
Figure imgf000013_0001
worin R , R und R die oben angegebene Bedeutung haben,
mit Fluorid, insbesondere mit Tetrabutylammoniumfluorid, umgesetzt werden.
Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmitteln, bevorzugt in einem Tempera- turbereich von -10°C bis 30°C bei Normaldruck.
Inerte Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan, oder Kohlenwasserstoffe wie Benzol oder Toluol, oder Ether wie Tetrahydrofuran oder Dioxan, oder Dimethylformamid. Ebenso ist es möglich, Gemische der Lösemittel einzusetzen. Bevorzugte Lösungsmittel sind Tetrahydrofuran und Dimethylformamid.
Die Verbindungen der Formel (IX) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000013_0002
worin R2 und R5 die oben angegebene Bedeutung haben,
mit Verbindungen der Formel
Figure imgf000014_0001
worin R1 die oben angegebene Bedeutung hat,
in Gegenwart von Dehydratisierungsreagenzien, wie für die erste Stufe der Verfahren [A] und [B] beschrieben, umgesetzt werden.
Die Verbindungen der Formel (X) sind bekannt oder können analog den im Beispielteil beschriebenen Verfahren hergestellt werden.
Die Verbindungen der Formel (XI) sind bekannt oder können analog bekannten Verfahren hergestellt werden.
Die erfindungsgemäßen Verbindungen zeigen ein nicht vorhersehbares, wertvolles pharmakologi- sches und pharmakokinetisches Wirkspektrum.
Sie eignen sich daher zur Verwendung als Arzneimittel zur Behandlung und/oder Prophylaxe von Krankheiten bei Menschen und Tieren.
Die erfindungsgemäßen Verbindungen können aufgrund ihrer pharmakologischen Eigenschaften allein oder in Kombination mit anderen Wirkstoffen zur Behandlung und/oder Prophylaxe von Infektionskrankheiten, insbesondere von bakteriellen Infektionen, eingesetzt werden.
Beispielsweise können lokale und/oder systemische Erkrankungen behandelt und/oder verhindert werden, die durch die folgenden Erreger oder durch Mischungen der folgenden Erreger verursacht werden:
Gram-positive Kokken, z.B. Staphylokokken (Staph. aureus, Staph. epidermidis) und Streptokok- ken (Strept. agalactiae, Strept. faecalis, Strept. pneumoniae, Strept. pyogenes); gram-negative Kokken (neisseria gonorrhoeae) sowie gram-negative Stäbchen wie Enterobakteriaceen, z.B. E- scherichia coli, Hämophilus influenzae, Citrobacter (Citrob. freundii, Citrob. divernis), Salmonella und Shigella; ferner Klebsiellen (Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent. aeroge- nes, Ent. agglomerans), Hafhia, Serratia (Serr. marcescens), Proteus (Pr. mirabilis, Pr. rettgeri, Pr. vulgaris), Providencia, Yersinia, sowie die Gattung Acinetobacter. Darüber hinaus umfaßt das antibakterielle Spektrum die Gattung Pseudomonas (Ps. aeruginosa, Ps. maltophilia) sowie strikt anaerobe Bakterien wie z.B. Bacteroides fragilis, Vertreter der Gattung Peptococcus, Peptostrepto- coccus sowie die Gattung Clostridium; ferner Mykoplasmen (M. pneumoniae, M. hominis, M. urealyticum) sowie Mykobakterien, z.B. Mycobacterium tuberculosis.
Die obige Aufzählung von Erregern ist lediglich beispielhaft und keineswegs beschränkend aufzu- fassen. Als Krankheiten, die durch die genannten Erreger oder Mischinfektionen verursacht und durch die erfindungsgemäßen topisch anwendbaren Zubereitungen verhindert, gebessert oder geheilt werden können, seien beispielsweise genannt:
Infektionskrankheiten beim Menschen wie z. B. septische Infektionen, Knochen- und Gelenkinfektionen, Hautinfektionen, postoperative Wundinfektionen, Abszesse, Phlegmone, Wundinfek- tionen, infizierte Verbrennungen, Brandwunden, Infektionen im Mundbereich, Infektionen nach Zahnoperationen, septische Arthritis, Mastitis, Tonsillitis, Genital-Infektionen und Augeninfektionen.
Außer beim Menschen können bakterielle Infektionen auch bei anderen Spezies behandelt werden. Beispielhaft seien genannt:
Schwein: Coli-diarrhoe, Enterotoxamie, Sepsis, Dysenterie, Salmonellose, Metritis-Mastitis-Aga- laktiae-Syndrom, Mastitis;
Wiederkäuer (Rind, Schaf, Ziege): Diarrhöe, Sepsis, Bronchopneumonie, Salmonellose, Pasteurel- lose, Mykoplasmose, Genitalinfektionen;
Pferd: Bronchopneumonien, Fohlenlähme, puerperale und postpuerperale Infektionen, Salmonel- lose;
Hund und Katze: Bronchopneumonie, Diarrhöe, Dermatitis, Otitis, Harnwegsinfekte, Prostatitis;
Geflügel (Huhn, Pute, Wachtel, Taube, Ziervögel und andere): Mycoplasmose, E. coli-Infektionen, chronische Luftwegserkrankungen, Salmonellose, Pasteurellose, Psittakose.
Ebenso können bakterielle Erkrankungen bei der Aufzucht und Haltung von Nutz- und Zierfischen behandelt werden, wobei sich das antibakterielle Spektrum über die vorher genannten Erreger hinaus auf weitere Erreger wie z.B. Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris, Corynebakterien, Borellia, Treponema, Nocardia, Rikettsie, Yersinia, erweitert.
Weiterer Gegenstand der vorliegenden Erfindung ist der Einsatz der erfindungsgemäßen Verbindungen zur Behandlung und/oder Prophylaxe von Erkrankungen, vorzugsweise von bakteriellen Krankheiten, insbesondere von bakteriellen Infektionen. Weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung der erfindungsgemäßen Verbindungen zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen.
Weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung der erfindungsgemäßen Ver- bindungen zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen.
Weiterer Gegenstand der vorliegenden Erfindung ist ein Verfahren zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen, unter Verwendung einer antibakteriell wirksamen Menge der erfindungsgemäßen Verbindungen.
Die erfindungsgemäßen Verbindungen können systemisch und/oder lokal wirken. Zu diesem Zweck können sie auf geeignete Weise appliziert werden, wie z.B. oral, parenteral, pulmonal, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, conjunctival, otisch oder als Implantat bzw. Stent.
Für diese Applikationswege können die erfindungsgemäßen Verbindungen in geeigneten Applika- tionsformen verabreicht werden.
Für die orale Applikation eignen sich nach dem Stand der Technik funktionierende schnell und/oder modifiziert die erfindungsgemäßen Verbindungen abgebende Applikationsformen, die die erfindungsgemäßen Verbindungen in kristalliner und/ oder amorphisierter und/oder gelöster Form enthalten, wie z.B. Tabletten (nichtüberzogene oder überzogene Tabletten, beispielsweise mit magensaftresistenten oder sich verzögert auflösenden oder unlöslichen Überzügen, die die Freisetzung der erfindungsgemäßen Verbindung kontrollieren), in der Mundhöhle schnell zerfallende Tabletten oder Filme/Oblaten, Filme/Lyophylisate, Kapseln (beispielsweise Hart- oder Weichgelatinekapseln), Dragees, Granulate, Pellets, Pulver, Emulsionen, Suspensionen, Aerosole oder Lösungen.
Die parenterale Applikation kann unter Umgehung eines Resorptionsschrittes geschehen (z.B. intravenös, intraarteriell, intrakardial, intraspinal oder intralumbal) oder unter Einschaltung einer Resorption (z.B. intramuskulär, subcutan, intracutan, percutan oder intraperitoneal). Für die parenterale Applikation eignen sich als Applikationsformen u.a. Injektions- und -hfusionszubereitungen in Form von Lösungen, Suspensionen, Emulsionen, Lyophilisaten oder sterilen Pulvern.
Für die sonstigen Applikationswege eignen sich z.B. Inhalationsarzneiformen (u.a. Pulverinhalato- ren, Nebulizer), Nasentropfen, -lösungen, -sprays; lingual, sublingual oder buccal zu applizierende Tabletten, Filme/Oblaten oder Kapseln, Suppositorien, Ohren- oder Augenpräparationen, Vaginal- kapseln, wässrige Suspensionen (Lotionen, Schüttelmixturen), lipophile Suspensionen, Salben, Cremes, transdermale therapeutische Systeme (wie beispielsweise Pflaster), Milch, Pasten, Schäume, Streupuder, Implantate oder Stents.
Die erfϊndungsgemäßen Verbindungen können in die angeführten Applikationsformen überfuhrt werden. Dies kann in an sich bekannter Weise durch Mischen mit inerten, nichttoxischen, pharmazeutisch geeigneten Hilfsstoffen geschehen. Zu diesen Hilfsstoffen zählen u.a. Trägerstoffe (beispielsweise mikrokristalline Cellulose, Laktose, Mannitol), Lösungsmittel (z.B. flüssige Polyethy- lenglycole), Emulgatoren und Dispergier- oder Netzmittel (beispielsweise Natriumdodecylsulfat, Polyoxysorbitanoleat), Bindemittel (beispielsweise Polyvinylpyrrolidon), synthetische und natürli- ehe Polymere (beispielsweise Albumin), Stabilisatoren (z.B. Antioxidantien wie beispielsweise Ascorbinsäure), Farbstoffe (z.B. anorganische Pigmente wie beispielsweise Eisenoxide) und Geschmacks- und / oder Geruchskorrigentien.
Weiterer Gegenstand der vorliegenden Erfindung sind Arzneimittel, die mindestens eine erfindungsgemäße Verbindung, üblicherweise zusammen mit einem oder mehreren inerten, nichttoxi- sehen, pharmazeutisch geeigneten Hilfsstoffen enthalten, sowie deren Verwendung zu den zuvor genannten Zwecken.
Im Allgemeinen hat es sich als vorteilhaft erwiesen, bei parenteraler Applikation Mengen von etwa 5 bis 250 mg/kg Körpergewicht je 24 h zur Erzielung wirksamer Ergebnisse zu verabreichen. Bei oraler Applikation beträgt die Menge etwa 5 bis 100 mg/kg Körpergewicht je 24 h.
Trotzdem kann es gegebenenfalls erforderlich sein, von den genannten Mengen abzuweichen, und zwar in Abhängigkeit von Körpergewicht, Applikationsweg, individuellem Verhalten gegenüber dem Wirkstoff, Art der Zubereitung und Zeitpunkt bzw. Intervall, zu welchem die Applikation erfolgt. So kann es in einigen Fällen ausreichend sein, mit weniger als der vorgenannten Mindestmenge auszukommen, während in anderen Fällen die genannte obere Grenze überschritten werden muss. Im Falle der Applikation größerer Mengen kann es empfehlenswert sein, diese in mehreren Einzelgaben über den Tag zu verteilen.
Die Prozentangaben in den folgenden Tests und Beispielen sind, sofern nicht anders angegeben, Gewichtsprozente; Teile sind Gewichtsteile. Lösungsmittelverhältnisse, Verdünnungsverhältnisse und Konzentrationsangaben von flüssig/flüssig-Lösungen beziehen sich jeweils auf das Volumen. Beispiele
Verwendete Abkürzungen:
abs. absolut aq. wässrig
Bn Benzyl boc tert-Butoxycarbonyl
CDCI3 Chloroform
CH Cyclohexan d dublett (im Η-NMR) dd dublett von dublett (im 'H-NMR)
DCC Dicyclohexylcarbodiimid
DIC Diisopropylcarbodiimid
DIEA Diisopropylethylamin (Hünig-Base)
DMSO Dimethylsulfoxid
DMAP 4-NN-Dimethylaminopyridin
DMF Dimethylformamid d. Th. der Theorie
EDC N'-(3-Dimethylaminopropyl)-N-ethylcarbodiimid x HCl
EE Ethylacetat (Essigsäureethylester)
ESI Elektrospray-Ionisation (bei MS) ges. gesättigt
HATU 0-(7-Azabenzotriazol-l-yl)-N,NN',N'-tetramethyluronium- hexafluorophosphat
HBTU O-CBenzotriazol-l-y^-NN.N'.N'-tetramethyluronium- hexafluorophosphat
HOBt 1 -Hydroxy- lH-benzotriazol x H20 h Stunde(n)
HPLC Hochdruck-, Hochleistungsflüssigchromatographie
LC-MS Flüssigchromatographie-gekoppelte Massenspektroskopie m multiple« (im Η-ΝMR) min Minute
MS Massenspektroskopie
NMR Kernresonanzspektroskopie
MTBE Methyl-tert-butylether
Pd/C Palladium/Kohle proz. Prozent q quartett (im Η-NMR)
Rf Retentionsindex (bei DC)
RP Reverse Phase (bei HPLC)
RT Raumtemperatur
R. Retentionszeit (bei HPLC) s singulett (im Η-NMR) t triplett (im Η-NMR)
TBS tert-Butyldimethylsilyl
TFA Trifluoressigsäure
THF Tetrahydrofuran
TMSE 2-(Trimethylsilyl)-ethyl
TPTU 2-(2-Oxo-l(2H)-pyridyl)-l,l,3,3-tetramethyluroniumtetrafluoroborat
Z Benzyloxycarbonyl
LC-MS- und HPLC-Methoden:
Methode 1 (LC-MS): Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: Waters Alliance 2795; Säule: Merck Chromolith SpeedROD RP-18e 50 mm x 4.6 mm; Eluent A: Wasser + 500 μl 50%ige Ameisensäure / 1; Eluent B: Acetonitril + 500 μl 50%ige Ameisensäure / 1; Gradient: 0.0 min 10%B^ 3.0 min 95%B- 4.0 min 95%B; Ofen: 35°C; Fluss: 0.0 min 1.0 ml/min^ 3.0 min 3.0 ml/min- 4.0 min 3.0 ml/min; UV-Detektion: 210 nm.
Methode 2 (LC-MS): Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: Waters Alliance 2795; Säule: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A - 2.5 min 30%A - 3.0 min 5%A -> 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min 2 ml/min; Ofen: 50°C; UV-Detektion: 210 nm.
Methode 3 (HPLC): Instrument: HP 1100 mit DAD-Detektion; Säule: Kromasil RP-18, 60 mm x 2 mm, 3.5 μm; Eluent A: 5 ml Perchlorsäure/1 Wasser, Eluent B: Acetonitril; Gradient: 0 min 2%B, 0.5 min 2%B, 4.5 min 90%B, 15 min 90%B; Fluss: 0J5ml/min; Ofen: 30°C; UV-Detektion: 210 nm.
Methode 4 (LC-MS): Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: HP 1100 Series; UV DAD; Säule: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A -» 2.5 min 30%A -> 3.0 min 5%A -> 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min. 2 ml/min; Ofen: 50°C; UV-Detektion: 210 nm.
Methode 5 (LC-MS): Instrument: Micromass Quattro LCZ mit HPLC Agilent Serie 1100; Säule: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A -> 2.5 min 30%A - 3.0 min 5%A -> 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min 2 ml/min; Ofen: 50°C; UV-Detektion: 208- 400 nm.
Methode 6 (LC-MS): Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: HP 1100 Series; UV DAD; Säule: Grom-Sil 120 ODS-4 HE 50 mm x 2 mm, 3.0 μm; Eluent A: Wasser + 500 μl 50%ige Ameisensäure / 1, Eluent B: Acetonitril + 500 μl 50%ige Ameisensäure / 1; Gradient: 0.0 min 70%B - 4.5 min 90%B; Ofen: 50°C; Fluss: 0.8 ml/min; UV-Detektion: 210 nm.
Methode 7 (HPLC): Instrument: HP 1100 mit DAD-Detektion; Säule: Kromasil RP-18, 60 mm x 2 mm, 3.5 μm; Eluent A: 5 ml Perchlorsäure/1 Wasser, Eluent B: Acetonitril; Gradient: 0 min 2%B, 0.5 min 2%B, 4.5 min 90%B, 6.5 min 90%B; Fluss: 0.75 ml/min; Ofen: 30°C; UV- Detektion: 210 nm.
Ausgangsverbindungen
Beispiel 1A
2-(Trimethylsilyl)ethyl-2-(benzyloxy)-N-[(benzyloxy)carbonyl]-5-(4,4,5,5-tetramethyl-l,3,2- dioxaborolan-2-yl)-L-phenylalaninat
Figure imgf000021_0001
Zu einer Lösung von 2.0 g (3.17 mmol) 2(S)-Benzyloxycarbonylamino-3-(2-benzyloxy-5-iod- phenyl)-propionsäure-(2-trimethylsilyl)-ethylester (Beispiel HA aus WO03/106480) in 30 ml DMSO werden 0.923 g (9.5 mmol) Kaliumacetat zugegeben. Die Mischung wird deoxygeniert, indem durch die kräftig gerührte Lösung 15 min lang Argon durchgeleitet wird. Dann werden 0.924 g (3.64 mmol) 4,4,4',4',5,5,5',5'-Octamethyl-2,2'-bi-l,3,2-dioxaborolan und 0.116 g (0.160 mmol, 0.05 Äquivalente) Bis-(diphenylphosphino)ferrocenpalladium(II)chlorid zugegeben. Unter leichtem Argonstrom wird auf 80°C erhitzt und nach 6 h wieder abgekühlt. Die Mischung wird über Silicagel (Laufmittel: Dichlormethan) filtriert. Der Rückstand wird säulenchromatographisch an Silicagel (Laufmittel: CyclohexamEthylacetat 4:1) gereinigt.
Ausbeute: 1.12 g (56% d. Th.)
LC-MS (Methode 6): R, = 4.50 min.
MS (EI): m/z = 632 [M+H]+
Η-ΝMR (200 MHz, CDC13): δ = 0.92 (dd, 2H), 1.31 (s, 12H), 2.95-3.95 (m, 2H), 4.11 (nie, 2H), 4.55 (11 (mc, 1H), 4.99 (s, 2H), 5.08 (s, 2H), 5.53 (d, 1H), 6.90 (d, 1H), 7.15-7.47 (m, 10H), 7.58 (d, 1H), 7.67 (dd, 1H).
Beispiel 2A
Benzyl-(8S, 11 S, 14S)-5 , 17-bis(benzyloxy)- 14- { [(benzyloxy)carbonyl]amino } - 11 -((2R)-3 - {[(benzyloxy)carbonyl]amino} -2- {[tert-butyl(dimethyl)silyl]oxy}propyl)-l 0,13-dioxo-9, 12- diazatricyclo[ 14.3.1.12,6]henicosa- 1 (20),2(21 ),3,5, 16, 18-hexaen-8-carboxylat
Figure imgf000022_0001
200 mg (0.20 mmol) 5,17-Bis-benzyloxy-14(S)-benzyloxycarbonylamino-l l(S)-(3-benzyloxy- carbonylamino-2(R)-hydroxy-propyl)- 10, 13-dioxo-9, 12-diaza-tricyclo-[ 14.3.1. l2'6]henicosa- l(19),2,4,6(21),16(20),17-hexaen-8(S)-carbonsäurebenzylester (Beispiel 19A aus WO03/106480) werden in 50 ml absolutem DMF gelöst und bei 0°C mit 210 mg (0.79 mmol) Trifluormethansul- fonsäure-tert-butyldimethylsilylester, 0.11 ml (0.79 mmol) Triethylamin und 20 mg (0.20 mmol) DMAP versetzt. Es wird 2 d bei RT gerührt. Nach Zugabe von 20 ml Methylenchlorid wäscht man die Lösung vorsichtig mit 10 ml gesättigter Natriumhydrogencarbonat-Lösung und 10 ml Wasser. Die organische Phase wird zur Trockne eingeengt und der Rückstand im Hochvakuum getrocknet.
Ausbeute: 215 mg (96% d. Th.)
LC-MS (Methode 2): Rt = 3.43 min.
MS (EI): m/z = 1125 [M+H]+
Beispiel 3A
(8S,l lS,14S)-5,17-Bis(benzyloxy)-14-{[(be--zyloxy)carbonyl]amino}-l l-((2R)-3-{[(benzyloxy)- carbonyljamino} -2- { [tert-butyl(dimethyl)silyl]oxy } propyl)- 10,13 -dioxo-9, 12-diazatricyclo- [14.3.1.12,6]henicosa-l(20),2(21),3,5,16,18-hexaen-8-carbonsäure
Figure imgf000023_0001
210 mg (0.19 mmol) der Verbindung aus Beispiel 2A werden in 2 ml THF gelöst und mit je 1 ml Wasser und Methanol versetzt. Nach Zugabe von 13 mg (0.56 mmol) Lithiumhydroxid wird 12 h bei RT gerührt. Anschließend wird die Reaktionslösung mit 30 ml Wasser verdünnt und durch Zugabe von IN Salzsäure auf pH = 3 gestellt. Der Niederschlag wird abfiltriert und im Hochvakuum getrocknet.
Ausbeute: 192 mg (99% d. Th.)
LC-MS (Methode 2): Rt = 3.24 min.
MS (EI): m/z = 1135 [M+H]+
Beispiel 4A
(8S,l lS,14S)-14-[(tert-Butoxycarbonyl)amino]-l l-{(2R)-3-[(tert-butoxy-carbonyl)amino]-2- hydroxypropyl } -5 , 17-dihydroxy-9-methyl- 10,13 -dioxo-9, 12-diazatricyclo [14.3.1.12,6]henicosa- 1 (20),2(21 ),3 ,5, 16, 18-hexaen-8-carbonsäure
Figure imgf000023_0002
90 mg (0.16 mmol) (8S,l lS,14S)-14-Amino-l l-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy- 9-methyl-10,13-dioxo-9,12-diazatricyclo[14.3.1.12,6]henicosa-l(20),2(21),3,5,16,18-hexaen- carbonsäure-Dihydrotrifluoracetat (Beispiel 120A aus WO03/106480) werden in 2.5 ml Wasser gelöst, mit 85.3 mg (0.8 mmol) Natriumcarbonat versetzt, im Eisbad gekühlt und mit 105.3 mg (0.48 mmol) Di-(tert-butyl)-dicarbonat in 1.2 ml Methanol versetzt. Man lässt über Nacht bei Raumtemperatur rühren, engt im Vakuum auf ein kleines Volumen ein und säuert mit IN Salzsäure bis pH = 2 an. Der anfallende Niederschlag wird abfiltriert und getrocknet.
Ausbeute: 89 mg (73% d.Th.)
LC-MS (Methode 12): R, = 1.80 min.
MS (EI): m/z = 687 [M+H]+
Beispiel 5A
tert-Butyl {(2R)-3-[(8S, 11 S, 14S)-8-( { [( 1 S)-4-amino- 1 -(aminocarbonyl)-4-oxobutyl]amino} - carbonyl)-l 4-[(tert-butoxycarbonyl)amino]-5 , 17-dihydroxy-9-methyl- 10, 13-dioxo-9, 12- diazatricyclo[ 14.3.1. l2'6]henicosa-l (20),2(21),3,5, 16, 18-hexaen-l 1 -yl]-2-hydroxypropyl}carbamat
Figure imgf000024_0001
Unter Argonatmosphäre werden 20 mg (0.03 mmol) (8S,l lS,14S)-14-[(tert-Butoxycarbonyl)- amino]-l l-{(2R)-3-[(tert-butoxy-carbonyl)amino]-2-hydroxypropyl}-5,17-dihydroxy-9-methyl- 10,13-dioxo-9, 12-diazatricyclo[14.3.1. l2,6]henicosa- 1 (20),2(21),3,5,16, 18-hexaen-8-carbonsäure (Beispiel 4A) und 10.58 mg (0.06 mmol) L-Glutamamid-Hydrochlorid in 1 ml DMF suspendiert, unter Rühren im Eisbad gekühlt und mit 14.4 mg (0.04 mmol) HATU und 5.02 mg (0.04 mmol) Hünig-Base versetzt. Man lässt 30 min bei 0°C reagieren, versetzt mit weiteren 10.04 mg (0.08 mmol) Hünig-Base und lässt alles bei langsamem Temperaturanstieg (RT) über Nacht rühren. Anschließend engt man im Vakuum zur Trockne ein und trennt den Rückstand mittels HPLC (Aceto- nitril/Wasser). Ausbeute: 3 mg (13% d.Th.)
LC-MS (Methode 4): Rt = 1.90 min.
MS(EI):m/z=814[M+H]+
Analog zur Vorschrift des Beispiels 5A werden die in der folgenden Tabelle aufgeführten Beispie- le 6A bis 11 A hergestellt.
Figure imgf000025_0001
Figure imgf000026_0001
Beispiel 12A
N- {[(8S, 11 S, 14S)- 14-[(tert-Butoxycarbonyl)amino]- 11 - {(2R)-3-[(tert-butoxycarbonyl)amino]-2- hydroxypropyl} -5, 17-dihydroxy-9-methyl- 10, 13-dioxo-9, 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1 (20),2(21),3,5, 16, 18-hexaen-8-yl]carbonyl} -L-serin
Figure imgf000027_0001
14 mg (0.02 mmol) der Verbindung aus Beispiel 9A werden in 14 ml Eisessig/Wasser/Ethanol (4/1/1) suspendiert, mit 7 mg Pd/C (10%-ig)-Katalysator versetzt und über Nacht bei Normalbedingungen hydriert. Man filtriert den Katalysator ab und dampft das Filtrat im Vakuum bis zur Gewichtskonstanz ein.
Ausbeute: 12 mg (quantitativ)
LC-MS (Methode 2): Rt = 1.73 min.
MS (EI): m/z = 774 [M+H]+
Beispiel 13A
tert-Butyl-{3-[(8S,HS,14S)-14-[(tert-butoxycarbonyl)amino]-5,17-dihydroxy-10,13-dioxo-8-{[(2- oxazepan-3-yl)amino]carbonyl} -9, 12-diazatricyclo-[14.3.1. l2,6]henicosa-l (20),2(21),3,5, 16,18- hexaen-1 l-yl]-propylcarbamat
Figure imgf000027_0002
Die Herstellung erfolgt analog Beispiel 5A aus 25 mg (0.04 mmol) (8S,l lS,14S)-14-[(tert- Butoxycarbonyl)-amino-l l-[3-[(tert-butoxycarbonyl)amino]propyl}-5,17-dihydroxy-10,13-dioxo- 9,12-diazatricyclo[14.3.1.l2,6]-henicosa-l(20),2(21),3,5,16,l 8-hexaen-8-carbonsäure (Beispiel 83A aus WO03/106480) und 5.86 mg (0.05 mmol) 3-Aminoazepan-2-on mit 17.39 mg (0.05 mmol) HATU und insgesamt 16 mg (0.12 mmol) Hünig-Base in 3 ml abs. DMF.
Ausbeute: 11.2 mg (38% d. Th.)
LC-MS (Methode 4): Rt = 2.64 min.
MS (EI): m/z = 767 [M+H]+
Analog zur Vorschrift des Beispiels 13A werden die in der folgenden Tabelle aufgeführten Beispiele 14A bis 18A hergestellt.
Figure imgf000028_0001
Figure imgf000029_0001
Beispiel 19A
N-{[(8S,l lS,14S)-5,17-Bis(benzyloxy)-14-{[(benzyloxy)carbonyl]amino}-l l-((2R)-3- {[(benzyloxy)carbonyl]amino}-2-{[tert-butyl(dimethyl)silyl]oxy}propyl)-10,13-dioxo-9,12- diazatricyclo[14.3.1. l2,6]henicosa-l (20),2(21),3,5,16, 18-hexaen-8-yl]carbonyl} -L-leucyl-L- leucinamid
Figure imgf000030_0001
Die Herstellung erfolgt analog Beispiel 5A aus 40 mg (0.039 mmol) (8S,11S,14S)-5,17- Bis(benzyloxy)- 14- { [(benzyloxy)carbonyl] amino } - 11 -((2R)-3 - { [(benzyl oxy)carbonyl] amino} -2- {[tert-butyl(dimefhyl)silyl]oxy} propyl)-l 0, 13-dioxo-9, 12-diazatricyclo[ 14.3.1.12,6]henicosa- l(20),2(21),3,5,16,18-hexaen-8-carbonsäure (Beispiel 3A) und 11.9 mg (0.043 mmol) L-Leucyl-L- leucinamid-Hydrochlorid mit 18.36 mg (0.048 mmol) HATU und insgesamt 22 mg (0.17 mmol) Hünig-Base in 2 ml abs. DMF.
Ausbeute: 29 mg (58% d. Th.)
LC-MS (Methode 2): Rt = 3.35 min.
MS (EI): m/z = 1260 [M+H]+
Beispiel 20A
Ben--yl-2-(benzyloxy)-N-(tert-butoxycarbonyl)-5-iod-L-phenylalanyl-O-benzyl-L-tyrosinat
Figure imgf000031_0001
Unter Argonatmosphäre werden 400 mg (0.80 mmol) 3-(2-Benzyloxy-5-iod-phenyl)-2(S)-tert- butoxycarbonylamino-propionsäure (Beispiel (-)-6A aus WO03/106480) und 400 mg (1.01 mmol) Benzyl-O-benzyl-L-tyrosinat-Hydrochlorid in 6 ml DMF suspendiert und mit 382 mg (1.01 mmol) HATU und 364 mg (2.82 mmol) Hünig-Base versetzt. Man lässt über Nacht bei Raumtemperatur rühren. Anschließend versetzt man mit 150 ml Wasser und filtriert das ausgefallene Produkt ab. Das Rohprodukt wird in 20 ml Diisopropylether ausgerührt und am Hochvakuum getrocknet.
Ausbeute: 650 mg (96% d.Th.)
LC-MS (Methode 2): Rt - 3.30 min.
MS (EI) : m/z = 841 [M+H]+
Analog zur Vorschrift des Beispiels 20A werden die in der folgenden Tabelle aufgeführten Beispiele 21 A und 22 A hergestellt.
Figure imgf000031_0002
Figure imgf000032_0002
Beispiel 23A
2-(Trimethylsilyl)e yl-2-{[(benzyloxy)carbonyl]amino}-3-(4,4'-bis(benzyloxy)-3,-{(2S)-3-({(lS)- 2-(benzyloxy)-l-[4-(benzyloxy)benzyl]-2-oxoethyl}amino)-2-[(tert-butoxycarbonyl)amino]-3- oxopropyl } biphenyl-3 -yl)propanoat
Figure imgf000032_0001
Unter Argonatmosphäre werden 446 mg (0.60 mmol) 2-(Trimethylsilyl)ethyl-2-(benzyloxy)-N- [(benzyloxy)carbonyl]-5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)-L-phenylalaninat (Beispiel 1A) und 639 mg (0.60 mmol) Beispiel 20A in 6 ml DMSO gelöst und 30 min mit Argon ge- spült. Man versetzt mit 44 mg (0.06 mmol) Bis(diphenylphosphino)ferrocen-palladium(II)chlorid und 391 mg (1.20 mmol) Cäsiumcarbonat und erhitzt für 8 h bei 80°C unter einem konstanten Argon-Strom. Anschließend wird über einen Spritzenfilter filtriert und per RP-HPLC (Was- ser/Acetonitril) gereinigt. Das Rohprodukt wird in Diethylether ausgerührt und am Hochvakuum getrocknet.
Ausbeute: 219 mg (30% d.Th.) LC-MS (Methode 4): R, = 3.69 min.
MS (EI): m/z = 1218 [M+H]+
Analog zur Vorschrift des Beispiels 23A werden die in der folgenden Tabelle aufgeführten Beispiele 24A und 25A hergestellt.
Figure imgf000033_0001
Beispiel 26A
2-(Trimethylsilyl)ethyl-3-[3,-[(2S)-2-amino-3-({(lS)-2-(benzyloxy)-l-[4-(benzyloxy)benzyl]-2- oxoethyl}amino)-3-oxopropyl]-4,4'-bis(benzyloxy)biphenyl-3-yl]-2-{[(benzyloxy)carbonyl]- amino}propanoat Hydrochlorid
Figure imgf000034_0001
Unter A gonatmosphäre werden 163 mg (0.13 mmol) Beispiel 23 A in 6 ml Dioxan/Chlor- wasserstoff-Lösung (4M Lösung) gelöst und 3 h bei Raumtemperatur gerührt. Zur Aufarbeitung wir am Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Analog zur Vorschrift des Beispiels 26A werden die in der folgenden Tabelle aufgeführten Beispiele 27 A und 28A hergestellt.
Figure imgf000034_0002
Beispiel 29A
Benzyl(6R,8S, 11 S, 14S)- 14-[4-(benzyloxy)benzyl]- 11 -[(4,4*-bis(benzyloxy)-3'- {2- { [(benzyloxy)- carbonyl]amino}-3-oxo-3-[2-(trimethylsilyl)ethoxy]propyl}biphenyl-3-yl)methyl]-8-[(tert- butoxycarbonyl)amino] -6- { [tert-butyl(dimethyl)silyl]oxy } -3,9,12-trioxo- 1 -phenyl-2-oxa-4, 10,13- triazapentadecan-15-oat
Figure imgf000035_0001
Unter Argonatmosphäre werden 150 mg (0.13 mmol) Beispiel 26A und 80 mg (0.16 mmol) 5- Benzyloxycarbonylamino-2(S)-tert-butoxycarbonylamino-4(R)-(tert-butyl-dimethylsilanyloxy)- pentansäure (Beispiel 14A aus WO03/106480) in 5 ml DMF gelöst und nacheinander mit 64 mg (0.17 mmol) HATU und 61 mg (0.47 mmol) Hünig-Base versetzt. Man rührt 4 d bei Raumtemp. Zur Aufarbeitung wird die Reaktionslösung direkt über RP-HPLC HPLC (Wasser/Acetonitril) gereinigt. Das so erhaltene Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: 152 mg (70% d.Th.)
Analog zur Vorschrift des Beispiels 29A werden die in der folgenden Tabelle aufgeführten Bei- spiele 30 A und 31 A hergestellt.
Figure imgf000036_0001
Beispiel 32A
2- {[(Benzyloxy)carbonyl]amino} -3- {4,4'-bis(benzyloxy)-3'-[(2S)-3-( {(1 S)-2-(benzyloxy)-l -[4- (ben--yloxy)benzyl]-2-oxoethyl}a-mno)-2-({(2S,4R)-5-{[(benzyloxy)carbonyl]amino}-2-[(tert- butoxycarbonyl)amino]-4-hydroxypentanoyl}amino)-3-oxopropyl]biphenyl-3-yl}propanäure
Figure imgf000037_0001
Unter Argonatmosphäre werden 152 mg (0.09 mmol) Beispiel 29A in 5 ml DMF gelöst und mit 0.50 ml Tetrabutylammoniumfluorid (IM Lösung) versetzt. Man rührt 5 h bei Raumtemperatur und versetzt anschließend mit 15 ml Wasser. Das ausgefallene Produkt wird abgesaugt, mit 100 ml Wasser gewaschen und am Hochvakuum getrocknet. Das so erhaltene Rohprodukt wird ohne weitere Reinigung umgesetzt.
Analog zur Vorschrift des Beispiels 32A werden die in der folgenden Tabelle aufgeführten Beispiele 33A und 34A hergestellt.
Figure imgf000037_0002
Figure imgf000038_0002
Beispiel 35A
Benzyl(6R,8S,l lS,14S)-14-[4-(benzyloxy)benzyl]-l l-({4,4'-bis(benzyloxy)-3,-[2- {[(benzyloxy)carbonyl]amino}-3-oxo-3-(pentafluo henoxy)propyl]biphenyl-3-yl}methyl)-8- [(tert-butoxycarbonyl)amino]-6-hydroxy-3,9, 12-trioxo-l -phenyl-2-oxa-4, 10, 13-triazapentadecan- 15-oat
Figure imgf000038_0001
Unter Argonatmosphäre werden 131 mg (0.09 mmol) Beispiel 32A in 3 ml DMF gelöst und mit 87 mg (0.47 mmol) Pentafluorphenol und 2 mg DMAP versetzt. Man kühlt auf -25°C und versetzt mit 23 mg (0.12 mmol) EDC. Man lässt auf Raumtemperatur erwärmen und rührt über Nacht. Zur Aufarbeitung wird am Hochvakuum getrocknet. Das so erhaltene Rohprodukt wird ohne weitere Reinigung umgesetzt. Analog zur Vorschrift des Beispiels 35A werden die in der folgenden Tabelle aufgeführten Beispiele 36A und 37A hergestellt.
Figure imgf000039_0001
Beispiel 38A
Benzyl(6R,8S,l lS,14S)-8-amino-14-[4-(benzyloxy)benzyl]-l l-({4,4'-bis(benzyloxy)-3*-[2- {[(benzyloxy)carbonyl]amino}-3-oxo-3-(pentafluorphenoxy)propyl]biphenyl-3-yl}methyl)-6- hydroxy-3 ,9,12-trioxo- 1 -phenyl-2-oxa-4, 10,13-triazapentadecan- 15 -oat Hydrochlorid
Figure imgf000040_0001
Unter Argonatmosphäre werden 141 rag (0.09 mmol) Beispiel 35A in 5 ml Dioxan/Chlorwasser- stoff-Lösung (4M Lösung) gelöst. Nach 3 h Rühren bei Raumtemperatur wird am Rotationsverdampfer eingeengt und zweimal mit Methylenchlorid codestilliert. Das so erhaltene Rohprodukt wird ohne weitere Reinigung umgesetzt.
Analog zur Vorschrift des Beispiels 38A werden die in der folgenden Tabelle aufgeführten Beispiele 39A und 40 A hergestellt.
Figure imgf000040_0002
Figure imgf000041_0001
Beispiel 41A
Benzyl-O-benzyl-N- { [(8S, 11 S, 14S)-5, 17-bis(benzyloxy)- 14- { [(benzyloxy)carbonyl]amino} -11- ((2R)-3 - { [(benzyloxy)carbonyl]amino} -2-hydroxypropyl)-l 0, 13-dioxo-9, 12-diazatri- cyclo[14.3.1.12,6]henicosa-l(20),2(21),3,5,16,18-hexaen-8-yl]carbonyl}-L-tyrosinat
Figure imgf000041_0002
Unter Argonatmosphäre werden 141 mg (0.09 mmol) Beispiel 38A in 5 ml Dioxan/Chlorwasser- stoff-Lösung (4M Lösung) gelöst. Nach 3 h Rühren bei Raumtemperatur wird am Rotationsverdampfer eingeengt und zweimal mit Methylenchlorid codestilliert.
Ausbeute: 35 mg (31 % d.Th.) LC-MS (Methode 2): Rt = 3.30 min.
MS (EI): m/z = 1281 [M+H]+
Analog zur Vorschrift des Beispiels 41 A werden die in der folgenden Tabelle aufgeführten Beispiele 42A und 43A hergestellt.
Figure imgf000042_0001
Herstellungsbeispiele
Beispiel 1
N2-{[(8S,l lS,14S)-14-Amino-l l-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-9-methyl- 10, 13-dioxo-9, 12-diazatricyclo[ 14.3.1.12,6]henicosa- 1 (20),2(21),3,5 , 16, 18-hexaen-8-yl]carbonyl} - L-glutamamid-Dihydrochlorid
Figure imgf000043_0001
3.7 mg (0.0045 mmol) der Verbindung aus Beispiel 5A werden unter Rühren mit 1 ml 4N Dioxan/ Chlorwasserstoff-Lösung übergössen und 1 h bei RT gerührt. Man dampft anschließend alles im Vakuum bis zur Gewichtskonstanz ein.
Ausbeute: 3 mg (96% d. Th.)
LC-MS (Methode 4): R, = 0.31 min.
MS (EI): m z = 614 [M-2HC1+H]+
Analog zur Vorschrift des Beispiels 1 werden die in der folgenden Tabelle aufgeführten Beispiele 2 bis 7 hergestellt.
Figure imgf000044_0001
Figure imgf000045_0002
Beispiel 8
Methyl-N2-{[(8S,l lS,14S)-14-amino-l l-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-9- methyl-10,13-dioxo-9,12-diazatricyclo[14.3.1.12'6]henicosa-l(20),2(21),3,5,16,18-hexaen-8- yl]carbonyl}-L-glutaminat-Dihydrochlorid
Figure imgf000045_0001
6 mg der Verbindung aus Beispiel 2 werden in 2 ml Methanol suspendiert, mit 10 Tropfen 4N Dioxan/Chlorwasserstoff-Lösung versetzt und zwei Tage bei RT gerührt. Man engt alles im Vakuum ein und trennt den Rückstand mittels Dickschichtchromatographie (Laufmittel: Dichlor- methan/Methanol/wässrige Ammoniak-Lösung = 70/25/7). Die das Produkt enthaltende Zone wird abgekratzt, mit Methanol eluiert, mit Dioxan/Chlorwasserstoff-Lösung versetzt und mit Acetonitril gefällt.
Ausbeute: 1.2 mg (21% d.Th.)
LC-MS (Methode 4): Rt = 0.39 min.
MS (EI): m/z = 629 [M-2HC1+H]+
Beispiel 9
Methyl-N- {[(8S, 11 S, 14S)-14-amino-14-[(2R)-3-amino-2-hydroxypropyl]-5, 17-dihydroxy-9- methyl-10,13-dioxo-9,12-diazatricyclo[14.3.1.12'6]henicosa-l(20),2(21),3,5,16,18-hexaen-8- yl]carbonyl}-L-leucylglycinat-Dihydrochlorid
Figure imgf000046_0001
Die Herstellung erfolgt analog Beispiel 8 aus 4 mg (0.01 mmol) der Verbindung aus Beispiel 3.
Ausbeute: 4 mg (82% d.Th.)
LC-MS (Methode 2): R, = 0.96 min.
MS (EI): m/z = 671 [M-2HC1+H]+
Die in der folgenden Tabelle aufgeführten L-Omithin-Derivate (Beispiele 10 bis 15) werden analog Beispiel 1 hergestellt.
Figure imgf000047_0001
Figure imgf000048_0001
Beispiel 16
N-{[(8S,l lS,14S)-14-Amino-l l-[(2R)-3-amino-2-hydroxypropyl]-5,17-dihydroxy-10,13-dioxo- 9, 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1 (20),2(21 ),3 ,5, 16, 18-hexaen-8-yl]carbonyl } -L-leucyl-L- leucinamid-Bis(hydrotrifluoracetat)
Figure imgf000048_0002
29 mg (0.023 mmol) der Verbindung aus Beispiel 19A werden in 12 ml Eisessig/Wasser/Ethanol = 4/1/1 suspendiert, mit 8 mg Pd/C-Katalysator (10%ig) versetzt und 24 h bei RT hydriert. Der Ka- talysator wird abfiltriert, das Filtrat wird im Vakuum eingedampft, und das Rohprodukt wird durch HPLC (Kromasil 100C18, Laufmittel Acetonitril / 0.2% wässrige TFA, Gradient) gereinigt.
Ausbeute: 2.6 mg (12% d. Th.)
LC-MS (Methode 2): R, = 1.04 min.
MS (EI): m/z = 698 [M-2TFA+H]+
'H-NMR (400 MHz, D20): δ = 0.84 (m,, 12H), 1.25 (nie, 2H), 1.45-1.7 (m, 6H), 1.84 (nie, 1H), 1.95 1H), 2.83 (n-c, 2H), 2.92-3.22 (m, 4H), 3.5 (π-c, 1H), 3.8 (nie, 1H), 4.28 (m-, 1H), 4.33-4.4 (m, 2H), 4.78 (n^, 1H), 4.87 (m,., 1H), 6.80 (d, 1H), 6.85 (d, 1H), 6.88 (s, 1H), 7.17 (s, 1H), 7.27 (d, 1H), 7.47 (d, 1H).
Beispiel 17
N- { [(8S, 11 S, 14S)-14-Amino- 11 -[(2R)-3-amino-2-hydroxypropyl]-5, 17-dihydroxy- 10, 13-dioxo- 9, 12-diazatricyclo[ 14.3.1.12,6]henicosa- 1 (20),2(21 ),3 ,5 , 16, 18-hexaen-8-yl]carbonyl} -L-tyrosin- Dihydrochlorid
Figure imgf000049_0001
Bei Raumtemperatur werden 35 mg (0.03 mmol) Beispiel 41 A in 6 ml Eisessig Wasser/Ethanol = 4/1/1 suspendiert. Nach Zugabe von 16 mg (0.15 mmol) Pd C-Katalysator (10%ig) wird 2 d bei Raumtemperatur unter Normaldruck hydriert. Die Reaktionslösung wird über einen Spritzenfϊlter filtriert und mit 560 μg 0.1M Salzsäure versetzt. Es wird am Rotationsverdampfer eingeengt und am Hochvakuum getrocknet.
Ausbeute: 12 mg (69% d.Th.)
LC-MS (Methode 4): Rt = 1.04 min. MS (El): m/z = 636 [M-2HC1+H]+
Analog zur Vorschrift des Beispiels 17 werden die in der folgenden Tabelle aufgeführten Beispiele 18 und 19 hergestellt.
Figure imgf000050_0001
B. Bewertung der physiologischen Wirksamkeit
Verwendete Abkürzungen:
AMP Adenosinmonophosphat
ATP Adenosintriphosphat
BHI Medium Brain heart infusion medium
CoA Coenzym A
DMSO Dimethylsulfoxid
DTT Dithiothreitol
EDTA Ethylendiamintetraessigsäure
KC1 Kaliumchlorid
KH2P04 Kaliumdihydrogenphosphat
MgSO4 Magnesiumsulfat
MHK Minimale Hemmkonzentration
MTP Mikrotiterplatte
NaCl Natriumchlorid
Na2HP04 Dinatriumhydrogenphosphat
NH4CI Ammoniumchlorid
NTP Nukleotidtriphosphat
PBS Phosphat Buffered Saline
PCR Polymerase Chain Reaction
PEG Polyethylenglykol
PEP Phosphoenolpyruvat
Tris Tris[hydroxymethyl]aminomethan
Die in vttro-Wirkung der erfindungsgemäßen Verbindungen kann in folgenden Assays gezeigt werden:
In vitro Transkription-Translation mit E. coli Extrakten
Zur Herstellung eines S30-Extraktes werden logarithmisch wachsende Escherichia coli MRE 600 (M. Müller; University Freiburg) geerntet, gewaschen und wie beschrieben für den in vitro Transkriptions-Translations-Test eingesetzt (Müller, M. and Blobel, G., Proc. Natl. Acad. Sei. US A 1984, 81, 7421-7425). Dem Reaktionsmix des in vitro Transkriptions-Translations-Tests werden zusätzlich 1 μl cAMP (11.25 mg/ml) je 50 μl Reaktionsmix zugegeben. Der Testansatz beträgt 105 μl, wobei 5 μl der zu testenden Substanz in 5%igem DMSO vorgelegt werden. Als Transkriptionsmatrize werden 1 μg/lOOμl Ansatz des Plasmides pBESTLuc (Promega, Deutschland) verwendet. Nach Inkubation für 60 min bei 30°C werden 50 μl Luziferinlösung (20 mM Tricine, 2.67 mM MgS04, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μM CoA, 470 μM Luziferin, 530 μM ATP) zugegeben und die entstehende Biolumineszenz für 1 Minute in einem Luminometer gemessen. Als IC50 wird die Konzentration eines Inhibitors angegeben, die zu einer 50%igen Inhibition der Translation von Firefly Luziferase führt.
In vitro Transkription-Translation mit S. aureus Extrakten
Konstruktion eines S. aureus Luziferase Reporterplasmids
Zur Konstruktion eines Reporterplasmids, welches in einem in vitro Transkriptions-Translations- Assay aus S. aureus verwendet werden kann, wird das Plasmid pBESTluc (Promega Corporation, USA) verwendet. Der in diesem Plasmid vor der Firefly Luziferase vorhandene E. coli tac Promo- ter wird gegen den capAl Promoter mit entsprechender Shine-Dalgamo Sequence aus S. aureus ausgetauscht. Dazu werden die Primer CAPFor 5'-CGGCC-
AAGCTTACTCGGATCCAGAGTTTGCAAAATATACAGGGGATTATATATAATGGAAAAC AAGAAAGGA-AAATAGGAGGTTTATATGGAAGACGCCA-3' und CAPRev 5'-
GTCATCGTCGGGAAGACCTG-3' verwendet. Der Primer CAPFor enthält den capAl Promotor, die Ribosomenbindestelle und die 5'-Region des Luziferase Gens. Nach PCR unter Verwendung von pBESTluc als Template kann ein PCR-Produkt isoliert werden, welches das Firefly Luziferase Gen mit dem fusionierten capAl Promotor enthält. Dieses wird nach einer Restriktion mit Clal und HindDI in den ebenfalls mit Clal und HindHI verdauten Vektor pBESTluc ligiert. Das entstandene Plasmid pla kann in E. coli repliziert werden und als Template im S. aureus in vitro Transkripti- ons-Translations-Test verwendet werden.
Herstellung von S30 Extrakten aus S. aureus
Sechs Liter BHI Medium werden mit einer 250 ml Übernachtkultur eines S. aureus Stammes inokuliert und bei 37°C bis zu einer OD600nm von 2-4 wachsen gelassen. Die Zellen werden durch Zentrifugation geerntet und in 500 ml kaltem Puffer A (10 mM Tris-acetat, pH 8.0, 14 mM Mag- nesiumacetat, 1 mM DTT, 1 M KCl) gewaschen. Nach erneutem Abzentrifugieren werden die Zellen in 250 ml kaltem Puffer A mit 50 mM KCl gewaschen und die erhaltenen Pellets bei -20°C für 60 min eingefroren. Die Pellets werden in 30 bis 60 min auf Eis aufgetaut und bis zu einem Gesamtvolumen von 99 ml in Puffer B (10 mM Tris-acetat, pH 8.0, 20 mM Magnesiumacetat, 1 mM DTT, 50 mM KCl) aufgenommen. Je 1.5 ml Lysostaphin (0.8 mg/ml) in Puffer B werden in 3 vorgekühlte Zentrifugenbecher vorgelegt und mit je 33 ml der Zellsuspension vermischt. Die Proben werden für 45 bis 60 min bei 37°C unter gelegentlichem Schütteln inkubiert, bevor 150 μl einer 0.5 M DTT Lösung zugesetzt werden. Die lysierten Zellen werden bei 30.000 x g 30 min bei 4°C abzentrifugiert. Das Zellpellet wird nach Aufnahme in Puffer B unter den gleichen Bedingungen nochmals zentrifugiert und die gesammelten Überstände werden vereinigt. Die Überstände werden nochmals unter gleichen Bedingungen zentrifugiert und zu den oberen 2/3 des Überstandes werden 0.25 Volumen Puffer C (670 mM Tris-acetat, pH 8.0, 20 mM Magnesiumacetat, 7 mM Na3-Phosphoenolpyruvat, 7 mM DTT, 5.5 mM ATP, 70 μM Aminosäuren (complete von Prome- ga), 75 μg Pyruvatkinase (Sigma, Deutschland))/ml gegeben. Die Proben werden für 30 min bei 37°C inkubiert. Die Überstände werden über Nacht bei 4°C gegen 2 1 Dialysepuffer (10 mM Tris- acetat, pH 8.0, 14 mM Magnesiumacetat, 1 mM DTT, 60 mM Kaliumacetat) mit einem Pufferwechsel in einem Dialyseschlauch mit 3500 Da Ausschluss dialysiert. Das Dialysat wird auf eine Proteinkonzentration von etwa 10 mg/ml konzentriert, indem der Dialyseschlauch mit kaltem PEG 8000 Pulver (Sigma, Deutschland) bei 4°C bedeckt wird. Die S30 Extrakte können aliquotiert bei - 70°C gelagert werden.
Bestimmung der ICgn im S. aureus in vitro Transcriptions-Translations-Assav
Die Inhibition der Proteinbiosynthese der Verbindungen kann in einem in vitro Transkriptions- Translations-Assay gezeigt werden. Der Assay beruht auf der zellfreien Transkription und Transla- tion von Firefly Luziferase unter Verwendung des Reporterplasmids pla als Template und aus S. aureus gewonnenen zellfreien S30 Extrakten. Die Aktivität der entstandenen Luziferase kann durch Lumineszenzmessung nachgewiesen werden.
Die Menge an einzusetzenden S30 Extrakt bzw. Plasmid pla muss für jede Präparation erneut ausgetestet werden, um eine optimale Konzentration im Test zu gewährleisten. 3 μl der zu testenden Substanz gelöst in 5% DMSO werden in eine MTP vorgelegt. Anschließend werden 10 μl einer geeignet konzentrierten Plasmidlösung pla zugegeben. Anschließend werden 46 μl eines Gemisches aus 23 μl Premix (500 mM Kaliumacetat, 87.5 mM Tris-acetat, pH 8.0, 67.5 mM Ammoni- umacetat, 5 mM DTT, 50 μg Folsäure/ml, 87.5 mg PEG 8000/ml, 5 mM ATP, 1.25 mM je NTP, 20 μM je Aminosäure, 50 mM PEP (Na3-Salz), 2.5 mM cAMP, 250 μg je E. coli tRNA ml) und 23 μl einer geeigneten Menge S. aureus S30 Extrakt zugegeben und vermischt. Nach Inkubation für 60 min bei 30°C werden 50 μl Luziferinlösung (20 mM Tricine, 2.67 mM MgS04, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μM CoA, 470 μM Luziferin, 530 μM ATP) und die entstehende Biolumineszenz für 1 min in einem Luminometer gemessen. Als IC50 wird die Konzentration eines Inhibitors angegeben, die zu einer 50%igen Inhibition der Translation von Firefly Luziferase führt. Bestimmung der Minimalen Hemmkonzentration (MB-KP
Die minimale Hemmkonzentration (MHK) ist die minimale Konzentration eines Antibiotikums, mit der ein Testkeim in seinem Wachstum über 18-24 h inhibiert wird. Die Hemmstoffkonzen- tration kann dabei nach mikrobiologischen Standardverfahren bestimmt werden (siehe z.B. The National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial suscep- tibility tests for bacteria that grow aerobically; approved standard-fϊfth edition. NCCLS document M7-A5 [ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000). Die MHK der erfindungsgemäßen Verbindungen wird im Flüssigdiluti- onstest im 96er-Mikrotiter-Platten-Maßstab bestimmt. Die Bakterienkeime werden in einem Mini- malmedium (18.5 mM Na2HP04, 5.7 mM KH2P04, 9.3 mM NILC1, 2.8 mM MgSO4, 17.1 mM NaCl, 0.033 μg/ml Thiaminhydrochlorid, 1.2 μg/ml Nicotinsäure, 0.003 μg/ml Biotin, 1% GIuco- se, 25 μg/ml von jeder proteinogenen Aminosäure mit Ausnahme von Phenylalanin; [H.-P. Kroll; unveröffentlicht]) unter Zusatz von 0.4% BH-Bouillon kultiviert (Testmedium). Im Fall von Ente- rococcus faecium L4001 wird dem Testmedium hitzeinaktiviertes fötales Kälberserum (FCS; Gib- coBRL, Deutschland) in einer Endkonzentration von 10% zugesetzt. Übernachtkulturen der Testkeime werden auf eine OD578 von 0.001 (im Falle der Enterokokken auf 0.01) in frisches Testmedium verdünnt und 1 : 1 mit Verdünnungen der Testsubstanzen (Verdünnungsstufen 1 :2) in Testmedium inkubiert (200 μl Endvolumen). Die Kulturen werden bei 37°C für 18-24 Stunden inkubiert; Enterokokken in Gegenwart von 5% C02.
Die jeweils niedrigste Substanzkonzentration, bei der kein sichtbares Bakterienwachstum mehr auftrat, wird als MHK definiert. Die MHK- Werte in μM einiger erfindungsgemäßer Verbindungen gegenüber einer Reihe von Testkeimen sind in der nachstehenden Tabelle beispielhaft aufgeführt. Die Verbindungen zeigen eine abgestufte antibakterielle Wirkung gegen die meisten der Testkeime.
Tabelle A
Figure imgf000054_0001
Figure imgf000055_0001
Alle Konzentrationsangaben in μM.
Systemische Infektion mit S. aureus 133
Die Eignung der erfindungsgemäßen Verbindungen zur Behandlung von bakteriellen Infektionen kann in verschiedenen Tiermodellen gezeigt werden. Dazu werden die Tiere im allgemeinen mit einem geeigneten virulenten Keim infiziert und anschließend mit der zu testenden Verbindung, die in einer an das jeweilige Therapiemodell angepassten Formulierung vorliegt, behandelt. Speziell kann die Eignung der erfindungsgemäßen Verbindungen zur Behandlung von bakteriellen Infektionen in einem Sepsismodell an Mäusen nach Infektion mit S. aureus demonstriert werden.
Dazu werden S. aureus 133 Zellen über Nacht in BH-Bouillon (Oxoid, Deutschland) angezüchtet. Die Übernachtkultur wurde 1:100 in frische BH-Bouillon verdünnt und für 3 Stunden hochgedreht. Die in der logarithmischen Wachstumsphase befindlichen Bakterien werden abzentrifugiert und zweimal mit gepufferter, physiologischer Kochsalzlösung gewaschen. Danach wird am Photometer (Dr. Lange LP 2W) eine Zellsuspension in Kochsalzlösung mit einer Extinktion von 50 Einheiten eingestellt. Nach einem Verdünnungsschritt (1:15) wird diese Suspension 1 :1 mit einer 10%-igen Mucinsuspension gemischt. Von dieser Infektionslösung wird 0.2 ml/20 g Maus i.p. appliziert. Dies entspricht einer Zellzahl von etwa 1-2 x 106 Keimen/Maus. Die i.v. -Therapie erfolgt 30 Minuten nach der Infektion. Für den Infektionsversuch werden weibliche CFWl-Mäuse verwendet. Das Überleben der Tiere wird über 6 Tage protokolliert. Das Tiermodell ist so eingestellt, dass unbe- handelte Tiere innerhalb von 24 h nach der Infektion versterben. Für die Beispielverbindung 2 konnte in diesem Modell eine therapeutische Wirkung von ED10o = 1-25 mg/kg demonstriert werden. C. Ausfuhrungsbeispiele für pharmazeutische Zusammensetzungen
Die erfindungsgemäßen Verbindungen können folgendermaßen in pharmazeutische Zubereitungen überführt werden:
Intravenös applizierbare Losung:
Zusammensetzung:
1 mg der Verbindung von Beispiel 1, 15 g Polyethylenglykol 400 und 250 g Wasser für Injektions- zwecke.
Herstellung:
Die erfindungsgemäße Verbindung wird zusammen mit Polyethylenglykol 400 in dem Wasser unter Rühren gelöst. Die Lösung wird sterilfiltriert (Porendurchmesser 0.22 μm) und unter aseptischen Bedingungen in hitzesterilisierte Infusionsflaschen abgefüllt. Diese werden mit Infusionsstopfen und Bördelkappen verschlossen.

Claims

Patentansprüche
1. Verbindung der Formel
Figure imgf000057_0001
in welcher
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff oder Methyl ist,
R3 gleich C,-C6-Alkyl bedeutet, wobei Alkyl substituiert ist mit einem Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe bestehend aus Hydroxycarbonyl, Aminocarbonyl, Q- C6-Alkoxycarbonyl und Cι-C6-Alkylaminocarbonyl, worin Alkylaminocarbonyl substituiert sein kann mit einem Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe bestehend aus Hydroxycarbonyl, Cι-C6-Alkoxycarbonyl und Aminocarbonyl, und wobei Alkyl substituiert sein kann mit einem oder zwei weiteren Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe bestehend aus Hydroxy, Amino, Hydroxycarbonyl, C C6-Alkoxycarbonyl, Aminocarbonyl, Guanidino und Hydroxy substituiertes Phenyl, oder
R3 gleich eine Gruppe der Formel
Figure imgf000058_0001
ist, und
R4 gleich Wasserstoff ist oder
R3 und R4 zusammen mit dem Stickstoffatom, an das sie gebunden sind, eine Grruppe der Formel
Figure imgf000058_0002
bilden, oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
2. Verbindung nach Anspruch 1, dadurch gekennzeichnet, dass
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff oder Methyl ist,
R3 gleich C2-C4-Alkyl bedeutet, wobei Alkyl substituiert ist mit einem Substituenten Aminocarbonyl und einem weiteren Substituenten, wobei der Substituent ausgewählt wird aus der Gruppe be^ stehend Aminocarbonyl und Guanidino, oder wobei Alkyl substituiert ist mit einem Substituenten Hydroxycarbonyl und einem weiteren Substituenten Hydroxy, und
R4 gleich Wasserstoff ist, oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
3. Verfahren zur Herstellung einer Verbindung der Formel (I) nach Anspruch 1 oder eines ihrer Salze, Solvate oder der Solvate ihrer Salze, dadurch gekennzeichnet, dass nach Verfahren
[A] eine Verbindung der Formel
Figure imgf000059_0001
worin R1 und R2 die in Anspruch 1 angegebene Bedeutung haben und boc gleich tert- Butoxycarbonyl ist, in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit einer Verbindung der Formel
HNR3R4 (ffl), worin R3 und R4 die in Anspruch 1 angegebene Bedeutung haben, und anschließend mit einer Säure umgesetzt wird, oder
[B] eine Verbindung der Formel
Figure imgf000060_0001
worin R1 und R2 die in Anspruch 1 angegebene Bedeutung haben und Z gleich Benzyloxy- carbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit einer Verbindung der Formel
Figure imgf000060_0002
worin R3 und R4 die in Anspruch 1 angegebene Bedeutung haben,
und anschließend mit einer Säure oder durch Hydrogenolyse umgesetzt wird.
Verfahren zur Herstellung einer Verbindung der Formel (I) nach Anspruch 1 oder eines ihrer Solvate, dadurch gekennzeichnet, dass ein Salz der Verbindung oder ein Solvat eines Salzes der Verbindung durch Chromatographie unter Zusatz einer Base in die Verbindung überfuhrt wird.
Verbindung nach einem der Ansprüche 1 oder 2 zur Behandlung und/oder Prophylaxe von Krankheiten.
Arzneimittel enthaltend eine Verbindung nach einem der Ansprüche 1 oder 2 in Kombination mit mindestens einem inerten, nichttoxischen, pharmazeutisch geeigneten Hilfsstoff.
Verwendung einer Verbindung nach einem der Ansprüche 1 oder 2 zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von Krankheiten.
Verwendung einer Verbindung nach einem der Ansprüche 1 oder 2 zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von bakteriellen Erkrankungen.
Arzneimittel nach Anspruch 6 zur Behandlung und oder Prophylaxe von bakteriellen Infektionen.
0. Verfahren zur Bekämpfung von bakteriellen Infektionen in Menschen und Tieren durch Verabreichung einer antibakteriell wirksamen Menge mindestens einer Verbindung nach einem der Ansprüche 1 oder 2, eines Arzneimittels nach Anspruch 6 oder eines nach Anspruch 7 oder 8 erhaltenen Arzneimittels.
PCT/EP2005/003463 2004-04-16 2005-04-02 Antibakterielle amid-makrozyklen ii WO2005100380A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102004018405.4 2004-04-16
DE102004018405A DE102004018405A1 (de) 2004-04-16 2004-04-16 Antibakterielle Amid-Makrozyklen II

Publications (1)

Publication Number Publication Date
WO2005100380A1 true WO2005100380A1 (de) 2005-10-27

Family

ID=34962899

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/003463 WO2005100380A1 (de) 2004-04-16 2005-04-02 Antibakterielle amid-makrozyklen ii

Country Status (2)

Country Link
DE (1) DE102004018405A1 (de)
WO (1) WO2005100380A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007006548A2 (de) * 2005-07-14 2007-01-18 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen vii
US7655643B2 (en) 2003-12-16 2010-02-02 Aicuris Gmbh & Co. Kg Antibacterial macrocycles with substituted biphenyl

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003106480A1 (de) * 2002-06-17 2003-12-24 Bayer Healthcare Ag Antibakterielle amid-makrozyklen

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003106480A1 (de) * 2002-06-17 2003-12-24 Bayer Healthcare Ag Antibakterielle amid-makrozyklen

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7655643B2 (en) 2003-12-16 2010-02-02 Aicuris Gmbh & Co. Kg Antibacterial macrocycles with substituted biphenyl
WO2007006548A2 (de) * 2005-07-14 2007-01-18 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen vii
WO2007006548A3 (de) * 2005-07-14 2007-03-22 Aicuris Gmbh & Co Kg Antibakterielle amid-makrozyklen vii

Also Published As

Publication number Publication date
DE102004018405A1 (de) 2005-11-03

Similar Documents

Publication Publication Date Title
WO2006103015A1 (de) Antibakterielle amid-makrozyklen v
EP1515983B1 (de) Antibakterielle amid-makrozyklen
EP1809657A1 (de) Cyclische nonapeptidamide
EP1866291B1 (de) Antibakterielle amid-makrozyklen vi
EP1697400B1 (de) Antibakterielle makrozyklen mit substituiertem biphenyl
WO2005118613A2 (de) Antibakterielle amid-makrozyklen
EP1981903B1 (de) Asparagin-10-substituierte nonadepsipeptide
EP1797110B1 (de) Antibakterielle amid-makrozyklen iv
EP1805212B1 (de) Desoxo-nonadepsipeptide
EP1809653B1 (de) Substituierte nonadepsipeptide
WO2005033129A1 (de) Antibakterielle amid-makrozyklen
EP1809654B1 (de) Heterocyclyl-substituierte nonadepsipeptide
WO2004012816A1 (de) Antibakterielle ester-makrozyklen
WO2005100380A1 (de) Antibakterielle amid-makrozyklen ii
DE102004053407A1 (de) Acylierte Nonadepsipeptide II
WO2007059908A1 (de) Neue cyclische iminopeptid-derivate und ein verfahren zur herstellung von cyclischen iminopeptid-derivaten
WO2007006548A2 (de) Antibakterielle amid-makrozyklen vii
EP1866312A1 (de) Cyclische iminopeptid-derivate

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase