WO2007006548A2 - Antibakterielle amid-makrozyklen vii - Google Patents

Antibakterielle amid-makrozyklen vii Download PDF

Info

Publication number
WO2007006548A2
WO2007006548A2 PCT/EP2006/006770 EP2006006770W WO2007006548A2 WO 2007006548 A2 WO2007006548 A2 WO 2007006548A2 EP 2006006770 W EP2006006770 W EP 2006006770W WO 2007006548 A2 WO2007006548 A2 WO 2007006548A2
Authority
WO
WIPO (PCT)
Prior art keywords
hydrogen
formula
amino
independently
methyl
Prior art date
Application number
PCT/EP2006/006770
Other languages
English (en)
French (fr)
Other versions
WO2007006548A3 (de
Inventor
Rainer Endermann
Kerstin Ehlert
Martin Michels
Stefan Weigand
Guido Schiffer
Original Assignee
Aicuris Gmbh & Co. Kg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aicuris Gmbh & Co. Kg filed Critical Aicuris Gmbh & Co. Kg
Priority to EP06762521A priority Critical patent/EP1907413A2/de
Priority to JP2008520778A priority patent/JP2009501173A/ja
Publication of WO2007006548A2 publication Critical patent/WO2007006548A2/de
Publication of WO2007006548A3 publication Critical patent/WO2007006548A3/de
Priority to US12/008,662 priority patent/US20080306040A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
    • C07K5/02—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link
    • C07K5/0202—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link containing the structure -NH-X-X-C(=0)-, X being an optionally substituted carbon atom or a heteroatom, e.g. beta-amino acids

Definitions

  • the invention relates to antibacterial amide macrocycles and processes for their preparation, their use for the treatment and / or prophylaxis of diseases and their use for the preparation of medicaments for the treatment and / or prophylaxis of diseases, in particular of bacterial infections.
  • WO 03/106480, WO 04/012816, WO 05/033129 and WO 05/058943 describe antibacterial macrocycles of the biphenomycin B type with amide or ester substituents.
  • biphenomycin B is described as having antibacterial activity. Partial steps in the synthesis of biphenomycin B are described in Synlett (2003), 4, 522-526 and Org. Lett. (2005), (7), 2981-2984.
  • An object of the present invention is therefore to provide new and alternative compounds having the same or improved antibacterial activity for the treatment of bacterial diseases in humans and animals.
  • the invention relates to compounds of the formula
  • R 26 is hydrogen, halogen, hydroxy or methyl
  • R 7 is a group of the formula NH, S NH "
  • R 1 is hydrogen or hydroxy
  • A is a bond or phenyl
  • R 4 is hydrogen, amino or hydroxy
  • R 5 is a group of the formula
  • R 23 is hydrogen or a group of the formula * - (CH 2 J n -OH or * - (CH 2 ) o -NH 2 ,
  • n and o independently of one another are a number 1, 2, 3 or 4,
  • n is a number 0 or 1
  • d R 12 are independently of one another a group of the formula * -CONHR 14 or * -CH 2 CONHR 15 ,
  • R 14 and R 15 are independently a group of the formula
  • R 4a is hydrogen, amino or hydroxy
  • R 5a is hydrogen, methyl or aminoethyl
  • R 6a is hydrogen or aminoethyl
  • R 5a and R 6a together with the nitrogen atom to which they are attached form a piperazine ring
  • R 8a and R 12a are independently * - (CH 2 ) Zla -OH, * - (CH 2 ) z 2a -NHR 13a , * -CONHR 14a or * -CH 2 CONHR 15a ,
  • ZIa and Z2a are independently a number 1, 2 or 3,
  • R 13a is hydrogen or methyl
  • R 14a and R 15a are independently a group of the formula
  • R 4c is hydrogen, amino or hydroxy
  • R 5c is hydrogen, methyl or aminoethyl
  • R 6c is hydrogen or aminoethyl
  • kc is a number 0 or 1
  • Ic is a number 1, 2, 3 or 4,
  • R 9a and R 11a are independently hydrogen or methyl
  • R 10a is amino or hydroxy
  • R 16a is a group of the formula
  • R 4d is hydrogen, amino or hydroxyl
  • R 5d is hydrogen, methyl or aminoethyl
  • R 6d is hydrogen or aminoethyl
  • kd is a number 0 or 1
  • Id is a number 1, 2, 3 or 4,
  • ka is a number 0 or 1
  • Ia, wa, xa and ya are independently a number 1, 2, 3 or 4,
  • R 20 is hydrogen or * - (CH 2 ) i -NHR 22 ,
  • R 22 is hydrogen or methyl
  • i is a number 1, 2 or 3,
  • R 21 is hydrogen or methyl
  • f is a number 0, 1, 2 or 3,
  • g is a number 1, 2 or 3
  • h is a number 1, 2, 3 or 4, d R 7 independently represent a group of the formula
  • R 4b is hydrogen, amino or hydroxy
  • R sb is hydrogen, methyl or aminoethyl
  • R 6b is hydrogen or aminoethyl
  • R 8b and R 12b are independently * - (CH 2 ) Zlb -OH,
  • R 13b is hydrogen or methyl
  • ZIb and Z2b are independently a number 1, 2 or 3,
  • R 14b and R 15b are independently a group of the formula
  • R 4g is hydrogen, amino or hydroxy
  • R 5g is hydrogen, methyl or aminoethyl
  • R 6g is hydrogen or aminoethyl
  • kg is a number 0 or 1
  • Ig is a number 1, 2, 3 or 4,
  • R 9b and R llb are independently hydrogen or methyl
  • R 1Ob is amino or hydroxy
  • kb is a number 0 or 1
  • Ib, wb, xb and yb are independently a number 1, 2, 3 or 4,
  • R 18 is hydrogen, amino or hydroxy
  • R 19 is hydrogen, methyl or a group of the formula
  • R 25 is hydrogen or * - (CH 2 ) u -NHR 29 ,
  • R 29 is hydrogen or methyl
  • u is a number 1, 2 or 3,
  • R 28 is hydrogen or methyl
  • s is a number 0, 1, 2 or 3
  • t is a number 1, 2 or 3,
  • R 24 is hydrogen or aminoethyl
  • d is a number 1, 2 or 3
  • k and q are independently a number 0 or 1
  • 1, r, w and y are independently a number 1, 2, 3 or 4,
  • L jw, r or y can independently of one another carry a hydroxyl group at w, r or y equal to 3,
  • Compounds according to the invention are the compounds of the formula (I) and their salts, solvates and solvates of the salts, and the compounds of formula (I), hereinafter referred to as the exemplary embodiment (e) and their salts, solvates and solvates of the salts, insofar as the compounds of formula (I) mentioned below are not already salts, solvates and solvates of the salts.
  • the compounds according to the invention can exist in stereoisomeric forms (enantiomers, diastereomers).
  • the invention therefore relates to the enantiomers or diastereomers and their respective mixtures. From such mixtures of enantiomers and / or diastereomers can be isolated by known methods such as chromatography on chiral phase or crystallization with chiral amines or chiral acids, the stereoisomerically uniform components in a known manner.
  • the invention also relates to tautomers of the compounds, depending on the structure of the compounds.
  • physiologically acceptable salts of the compounds according to the invention are preferred in the context of the invention.
  • Physiologically acceptable salts of the compounds (I) include acid addition salts of mineral acids, carboxylic acids and sulfonic acids, e.g. Salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, naphthalenedisulfonic acid, acetic acid, propionic acid, lactic acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic acid, trifluoroacetic acid and benzoic acid.
  • Physiologically acceptable salts of the compounds (I) also include salts of customary bases, such as, by way of example and by way of preference, alkali metal salts (eg sodium and potassium salts), alkaline earth salts (eg calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms.
  • customary bases such as, by way of example and by way of preference, alkali metal salts (eg sodium and potassium salts), alkaline earth salts (eg calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms.
  • Atoms such as, by way of example and by way of preference, ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine, i-f-methylmorpholine, dihydroazylethylamine, arginine, lysine, ethylenediamine and methylpiperidine.
  • Solvates in the context of the invention are those forms of the compounds which form a complex in the solid or liquid state by coordination with solvent molecules. Hydrates are a special form of solvates that coordinate with water.
  • Halogen is fluorine, chlorine, bromine and iodine.
  • a symbol # on a carbon atom means that the compound is in enantiomerically pure form with regard to its configuration at this carbon atom, which in the context of the present invention is understood to mean an enantiomeric excess of more than 90% (> 90% ee ).
  • R 26 is hydrogen, halogen, hydroxy or methyl
  • R 1 is hydrogen or hydroxy
  • R 2 is hydrogen or methyl
  • R 3 is as defined above
  • R 26 is hydrogen, chlorine, hydroxyl or methyl.
  • R 26 is hydrogen or hydroxy
  • R 1 is hydrogen or hydroxy
  • R 2 is hydrogen
  • R 3 is a group of the formula
  • R 4 is hydrogen, amino or hydroxy
  • R 5 is a group of the formula
  • R 23 is hydrogen or a group of the formula * - (CH 2 ) n -OH or * - (CH 2 ) o -NH 2 , wherein
  • n and o independently of one another are a number 1, 2, 3 or 4,
  • n is a number 0 or 1
  • R 14 and R 15 are independently a group of the formula
  • R 4a is hydrogen, amino or hydroxy
  • R 5a is hydrogen, methyl or aminoethyl
  • R 6a is hydrogen or aminoethyl
  • R 5a and R 6a together with the nitrogen atom to which they are attached form a piperazine ring
  • R 8a and R 12a are independently * - (CH 2 ) zla -OH, * - (CH 2 ) z 2a -NHR 13a , * -CONHR 14a or * -CH 2 CONHR 15a ,
  • ZIa and Z2a are independently a number 1, 2 or 3,
  • R 13a is hydrogen or methyl
  • R 14a and R 15a are independently a group of the formula
  • R 4c is hydrogen, amino or hydroxy
  • R 5c is hydrogen, methyl or aminoethyl
  • R 6c is hydrogen or aminoethyl
  • k ⁇ is a number 0 or 1
  • Ic is a number 1, 2, 3 or 4,
  • R 9a and R 11a are independently hydrogen or methyl, R 10a is amino or hydroxy,
  • R 16a is a group of the formula
  • R 4d is hydrogen, amino or hydroxy
  • R 5d is hydrogen, methyl or aminoethyl
  • R 6d is hydrogen or aminoethyl
  • kd is a number 0 or 1
  • Id is a number 1, 2, 3 or 4,
  • ka is a number 0 or 1 and
  • Ia, wa, xa and ya are independently a number 1, 2, 3 or 4,
  • R 20 is hydrogen or * - (CH 2 J 1 -NHR 22 ,
  • R 22 is hydrogen or methyl
  • i is a number 1, 2 or 3,
  • R 21 is hydrogen or methyl, f is a number 0, 1, 2 or 3,
  • g is a number 1, 2 or 3
  • h is a number 1, 2, 3 or 4,
  • R 4b is hydrogen, amino or hydroxy
  • R 5b is hydrogen, methyl or aminoethyl
  • R 6b is hydrogen or aminoethyl
  • R 5b and R 6b together with the nitrogen atom to which they are attached form a piperazine ring
  • R 8b and R 12b are independently * - (CH 2 ) zlb -OH,
  • R 13b is hydrogen or methyl
  • ZIb and Z2b are independently a number 1, 2 or 3,
  • R 14b and R 15b are independently a group of the formula
  • R 4g is hydrogen, amino or hydroxy
  • R 5g is hydrogen, methyl or aminoethyl
  • R 6g is hydrogen or aminoethyl
  • kg is a number 0 or 1
  • Ig is a number 1, 2, 3 or 4,
  • R 9b and R llb are independently hydrogen or methyl
  • R 1Ob is amino or hydroxy
  • kb is a number 0 or 1
  • Ib, wb, xb and yb are independently a number 1, 2, 3 or 4,
  • R 1B is hydrogen, amino or hydroxy, equal to hydrogen, methyl or a group of the formula
  • R 25 is hydrogen or * - (CH 2 ) U -NHR 29 ,
  • R is hydrogen or methyl
  • u is a number 1, 2 or 3,
  • R 28 is hydrogen or methyl
  • s is a number 0, 1, 2 or 3
  • t is a number 1, 2 or 3
  • R 24 is hydrogen or aminoethyl
  • d is a number 1, 2 or 3
  • k and q are independently a number 0 or 1
  • 1, r and w are independently of one another a number 1, 2, 3 or 4,
  • L jw or r can independently of one another carry a hydroxy group at w or r equal to 3,
  • R 26 is hydrogen or hydroxy
  • R 1 is hydrogen or hydroxy
  • R 2 is hydrogen
  • R 3 is a group of the formula
  • R 4 is hydrogen, amino or hydroxy
  • R 5 is a group of the formula
  • R 23 is hydrogen or a group of the formula * - (CH 2 J n -OH or * - (CH 2 ) O -NH 2 , wherein
  • n and o independently of one another are a number 1, 2, 3 or 4,
  • n is a number 0 or 1
  • R 14 and R 15 are independently a group of the formula
  • R 4a is hydrogen, amino or hydroxy
  • R 5a is hydrogen
  • R 6a is hydrogen
  • R 12a is * - (CH 2 ) zla -OH or * -CH 2 CONHR 15a
  • ZIa is a number 1, 2 or 3
  • R 15a is a group of the formula
  • R 4c is hydrogen, amino or hydroxy
  • R 5c is hydrogen
  • R 6c is hydrogen
  • kc is a number 0 or 1
  • Ic is a number 1, 2, 3 or 4,
  • ka is a number 0 or 1
  • Ia and ya are independently of one another a number 1, 2, 3 or 4,
  • R 9 is hydrogen
  • R 17 is a group of the formula
  • R 4b is hydrogen, amino or hydroxy
  • R 5b is hydrogen
  • R 6b is hydrogen
  • kb is a number 0 or 1
  • Ib is a number 1, 2, 3 or 4,
  • R 18 is hydrogen, amino or hydroxy
  • R 19 is hydrogen
  • R 24 is hydrogen
  • d is a number 1, 2 or 3
  • k and q are independently a number 0 or 1
  • 1, r and w are independently of one another a number 1, 2, 3 or 4,
  • L jw or r can independently of one another carry a hydroxy group at w or r equal to 3,
  • the invention furthermore relates to a process for the preparation of the compounds of the formula (I) or their salts, their solvates or the solvates of their salts, according to processes
  • R 2 , R 7 and R 26 have the abovementioned meaning and boc is the same as tez-t-butoxycarbonyl
  • R 3 has the meaning given above
  • R 2 , R 7 and R 26 have the abovementioned meaning and Z is benzyloxycarbonyl
  • R 3 has the meaning given above
  • the free base of the salts can be obtained, for example, by chromatography on a reversed-phase column with an acetonitrile-water gradient with addition of a base, in particular by using a RP18 Phenomenex Luna C18 (2) column and diethylamine as base.
  • Another object of the invention is a process for the preparation of the compounds of formula (I) or their solvates according to claim 1, in which salts of the compounds or solvates of the salts of the compounds are converted by chromatography with the addition of a base in the compounds.
  • the hydroxy group on R 1 is optionally protected during the reaction with compounds of the formula (III) with a tert-butyldimethylsilyl group, which is cleaved off in the second reaction step.
  • the reaction of the first stage of the processes [A] and [B] is generally carried out in inert solvents, if appropriate in the presence of a base, preferably in a temperature range from 0 ° C. to 40 ° C. under atmospheric pressure.
  • Suitable dehydrating reagents in this case for example, carbodiimides such as iV, i ⁇ T'-diisopropyl, A ⁇ -V'-dicyclohexylcarbodiimide, N- (3-dimethyl-aminoisopropyl) -N'-ethylcarbodiimide hydrochloride (EDC), yy-cyclohexylcarbodiimide-iV'-propyloxymethyl-polystyrene (PS - Carbodiimid) or carbonyl compounds such as carbonyldiimidazole, or 1,2-oxazolium compounds such as 2-ethyl-5-phenyl-l, 2-oxazolium-3-sulfate or 2-tert-butyl-5-methyl-isoxazolium perchlorate, or acylamino compounds such as 2-ethoxy-1-ethoxy carbonyl-1,2-dihydroquinoline, or propanephosphonic
  • Bases are, for example, alkali carbonates, e.g. Sodium or potassium carbonate, or bicarbonate, or organic bases such as trialkylamines e.g. Triethylamine, JV-methylmorpholine, ⁇ T-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
  • alkali carbonates e.g. Sodium or potassium carbonate, or bicarbonate
  • organic bases such as trialkylamines e.g. Triethylamine, JV-methylmorpholine, ⁇ T-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
  • the condensation is preferably carried out with HATU in the presence of a base, in particular diisopropylethylamine, or with EDC and HOBt in the presence of a base, in particular triethylamine.
  • Inert solvents are, for example, halogenated hydrocarbons such as dichloromethane or trichloromethane, hydrocarbon such as benzene, or nitromethane, dioxane, dimethylformamide or acetonitrile. It is likewise possible to use mixtures of the solvents. Particularly preferred is dimethylformamide.
  • the reaction with an acid in the second stage of the processes [A] and [B] is preferably carried out in a temperature range from 0 0 C to 40 0 C at atmospheric pressure.
  • Suitable acids in this case are hydrogen chloride in dioxane, hydrogen bromide in acetic acid or trifluoroacetic acid in methylene chloride.
  • the hydrogenolysis in the second stage of the process [B] is generally carried out in a solvent in the presence of hydrogen and palladium on activated carbon, preferably in a temperature range from 0 0 C to 40 0 C at atmospheric pressure.
  • Solvents are, for example, alcohols, such as methanol, ethanol, n-propanol or isopropanol, in a mixture with water and glacial acetic acid; preference is given to a mixture of ethanol, water and glacial acetic acid.
  • R, R 7 and R 26 have the abovementioned meaning
  • reaction is generally carried out in a solvent, preferably in a temperature range from 0 0 C to 40 0 C at atmospheric pressure.
  • bases examples include alkali metal hydroxides such as sodium or potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate, or other bases such as DBU, triethylamine or diisopropylethylamine, preference being given to sodium hydroxide or sodium carbonate.
  • Solvents are, for example, halogenated hydrocarbons such as methylene chloride or 1,2-dichloroethane, alcohols such as methanol, ethanol or isopropanol, or water.
  • the reaction is carried out with sodium hydroxide in water or sodium carbonate in methanol.
  • the compounds of the formula (V) are known or can be prepared by reacting compounds of the formula
  • R 2 , R 7 and R 26 have the meaning given above, and
  • R 27 is benzyl, methyl or ethyl, with an acid or by hydrogenolysis as described for the second step of process [B], optionally followed by reaction with a base to saponify the methyl or ethyl ester.
  • the saponification can be carried out, for example, as described in the reaction of compounds of the formula (VI) to give compounds of the formula (IV).
  • the compounds of the formula (IV) are known or can be prepared by saponifying in compounds of the formula (VI) the benzyl, methyl or ethyl ester.
  • the reaction is generally carried out in a solvent, in the presence of a base, preferably in a temperature range from 0 ° C. to 40 ° C. under atmospheric pressure.
  • Bases are, for example, alkali metal hydroxides such as lithium, sodium or potassium hydroxide, lithium hydroxide is preferred.
  • Solvents are, for example, halogenated hydrocarbons such as dichloromethane or trichloromethane, ethers such as tetrahydrofuran or dioxane, or alcohols such as methanol, ethanol or isopropanol, or dimethylformamide. It is likewise possible to use mixtures of the solvents or mixtures of the solvents with water. Particularly preferred are tetrahydrofuran or a mixture of methanol and water.
  • the compounds of the formula (VI) are known or can be prepared by reacting compounds of the formula
  • R 2 , R 7 , R 26 and R 27 are as defined above,
  • the reaction with bases is generally carried out in a solvent, preferably in a temperature range from 0 0 C to 40 0 C at atmospheric pressure.
  • Bases are, for example, alkali metal hydroxides such as sodium or potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate, or other bases such as DBU, triethylamine or diisopropylethylamine, triethylamine is preferred.
  • alkali metal hydroxides such as sodium or potassium hydroxide
  • alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate
  • other bases such as DBU, triethylamine or diisopropylethylamine, triethylamine is preferred.
  • Solvents are, for example, halogenated hydrocarbons such as chloroform, methylene chloride or 1, 2-dichloroethane, or tetrahydrofuran, or mixtures of the solvents, preferably methylene chloride or tetrahydrofuran.
  • halogenated hydrocarbons such as chloroform, methylene chloride or 1, 2-dichloroethane, or tetrahydrofuran, or mixtures of the solvents, preferably methylene chloride or tetrahydrofuran.
  • the compounds of formula (VII) are known or can be prepared by reacting compounds of the formula (VII)
  • the reaction is preferably carried out with DMAP and EDC in dichloromethane in a temperature range from -40 0 C to 40 0 C at atmospheric pressure.
  • R 2 , R, R 2 and R have the abovementioned meaning, be reacted with fluoride, in particular with tetrabutylammonium fluoride.
  • the reaction is generally carried out in a solvent, preferably in a temperature range from -10 0 C to 3O 0 C at atmospheric pressure.
  • Inert solvents are, for example, halogenated hydrocarbons, such as dichloromethane, or hydrocarbons, such as benzene or toluene, or ethers, such as tetrahydrofuran or dioxane, or dimethylformamide. It is likewise possible to use mixtures of the solvents. Preferred solvents are tetrahydrofuran and dimethylformamide.
  • R 7 has the meaning indicated above
  • the compounds of the invention show an unpredictable, valuable pharmacological and pharmacokinetic activity spectrum.
  • the compounds according to the invention can be used alone or in combination with other active compounds for the treatment and / or prophylaxis of infectious diseases, in particular of bacterial infections.
  • Gram-positive cocci e.g. Staphylococci (Staph aureus, Staph epidermidis) and streptococci (Strept agalactiae, Strept faecalis, Strept pneumoniae, Strept pyogenes); Gram-negative cocci (Neisseria gonorrhoeae) and Gram-negative rods such as Enterobacteriaceae, e.g. Escherichia coli, Haemophilus influenzae, Citrobacter (Citrob.friendii, Citrob. Divernis), Salmonella and Shigella; Klebsiella (Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent.
  • Staphylococci Staph aureus, Staph epidermidis
  • streptococci Strept agalactiae, Strept faecalis, Strept pneumoniae, Strept pyogenes
  • the antibacterial spectrum comprises the genus Pseudomonas (Ps. Aeruginosa, Ps. Maltophilia) as well as strictly anaerobic bacteria such as e.g. Bacteroides fragilis, representatives of the genus Pepoccocus, Peptostreptococcus and the genus Clostridium; mycoplasmas (M. pneumoniae, M. hominis, M. urealyticum) as well as mycobacteria, e.g. Mycobacterium tuberculosis.
  • Pseudomonas Ps. Aeruginosa, Ps. Maltophilia
  • strictly anaerobic bacteria such as e.g. Bacteroides fragilis, representatives of the genus Pepoccocus, Peptostreptococcus and the genus Clostridium
  • mycoplasmas M. pneumoniae, M. hominis, M. urealyticum
  • mycobacteria
  • pathogens are merely exemplary and by no means limiting.
  • diseases which are caused by the named pathogens or mixed infections and which can be prevented, ameliorated or cured by the topically applicable preparations according to the invention are:
  • Infectious diseases in humans such. As septic infections, bone and joint infections, skin infections, postoperative wound infections, abscesses, phlegmon, wound infections, infected burns, burns, infections in the Mouth area, infections after dental surgery, septic arthritis, mastitis, tonsillitis, genital infections and eye infections.
  • bacterial infections can also be treated in other species. Examples include:
  • Pig coli-diarrhea, enterotoxemia, sepsis, dysentery, salmonellosis, metritis-mastitis-agalactiae syndrome, mastitis;
  • Ruminants (cattle, sheep, goats): diarrhea, sepsis, bronchopneumonia, salmonellosis, pasteurellosis, mycoplasmosis, genital infections;
  • Horse bronchopneumonia, foal disease, puerperal and postpuerperal infections, salmonellosis;
  • Dog and cat bronchopneumonia, diarrhea, dermatitis, otitis, urinary tract infections, prostatitis;
  • Poultry (chicken, turkey, quail, pigeon, ornamental birds and others): mycoplasmosis, E. coli infections, chronic respiratory diseases, salmonellosis, pasteurellosis, psittacosis.
  • bacterial diseases in the rearing and keeping of farmed and ornamental fish can be treated, the antibacterial spectrum on the aforementioned pathogens on other pathogens such as Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris, Corynebacteria, Borellia, Treponema , Nocardia, Rikettsie, Yersinia, expanded.
  • Another object of the present invention is the use of the compounds of the invention for the treatment and / or prophylaxis of diseases, preferably of bacterial diseases, in particular of bacterial infections.
  • Another object of the present invention is the use of the compounds of the invention for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
  • Another object of the present invention is the use of the compounds of the invention for the manufacture of a medicament for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
  • Another object of the present invention is a method for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases, using an antibacterially effective amount of the compounds of the invention.
  • the compounds according to the invention can act systemically and / or locally.
  • they may be applied in a suitable manner, e.g. oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, conjunctival, otic or as an implant or stent.
  • the compounds according to the invention can be administered in suitable administration forms.
  • suitable administration forms for the oral administration are according to the prior art functioning rapidly and / or modified compounds of the invention donating application forms containing the compounds of the invention in crystalline and / or morphed and / or dissolved form, such as tablets (uncoated or coated tablets , for example, with enteric or delayed-dissolving or insoluble coatings which control the release of the compound of the invention), rapidly disintegrating tablets or films / wafers, films / lyophilisates, capsules (eg hard or soft gelatin capsules), dragees, granules, pellets in the oral cavity , Powders, emulsions, suspensions, aerosols or solutions.
  • tablets uncoated or coated tablets , for example, with enteric or delayed-dissolving or insoluble coatings which control the release of the compound of the invention
  • rapidly disintegrating tablets or films / wafers films / lyophilisates
  • capsules eg hard or soft gelatin
  • Parenteral administration can be accomplished by bypassing a resorption step (e.g., intravenous, intraarterial, intracardiac, intraspinal, or intralumbar) or by resorting to absorption (e.g., intramuscular, subcutaneous, intracutaneous, percutaneous, or intraperitoneal).
  • a resorption step e.g., intravenous, intraarterial, intracardiac, intraspinal, or intralumbar
  • absorption e.g., intramuscular, subcutaneous, intracutaneous, percutaneous, or intraperitoneal.
  • parenteral administration are suitable as application forms u.a. Injection and infusion preparations in the form of solutions, suspensions, emulsions, lyophilisates or sterile powders.
  • inhalant medicines including powder inhalers, nebulizers
  • nasal drops solutions, sprays
  • lingual, sublingual or buccal tablets films / wafers or capsules
  • suppositories ear or ophthalmic preparations
  • vaginal capsules aqueous suspensions (lotions, shake mixtures)
  • lipophilic suspensions ointments
  • creams transdermal therapeutic systems (such as patches)
  • the compounds according to the invention can be converted into the stated administration forms. This can be done in a conventional manner by mixing with inert, non-toxic, pharmaceutically suitable excipients.
  • excipients include, but are not limited to, excipients (eg, microcrystalline cellulose, lactose, mannitol), solvents (eg, liquid polyethylene glycols), emulsifiers and dispersing or wetting agents (e.g., sodium dodecyl sulfate, polyoxy sorbitan oleate), binders (e.g., polyvinyl pyrrolidone), synthetic and natural polymers (eg, albumin), stabilizers (eg, antioxidants such as ascorbic acid), dyes (eg, inorganic pigments such as iron oxides), and flavor and / or odor remedies.
  • excipients eg, microcrystalline cellulose, lactose, mannitol
  • solvents eg, liquid polyethylene glycols
  • emulsifiers and dispersing or wetting agents e.g., sodium dodecyl sulfate, polyoxy sorbitan oleate
  • compositions containing at least one compound of the invention usually together with one or more inert, non-toxic, pharmaceutically suitable excipients, and their use for the purposes mentioned above.
  • Method 2 Device Type MS: Micromass ZQ; Device type HPLC: Waters Alliance 2795; Column: Phenomenex Synergi 2 ⁇ Hydro-RP Mercury 20mm x 4mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 l of acetonitrile + 0.5 ml of 50% formic acid; Gradient: 0.0 min 90% A -> 2.5 min 30% A -> 3.0 min 5% A -> 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min 2 ml / min; Oven: 50 ° C .; UV detection: 210 nm.
  • Method 3 Device Type MS: Micromass ZQ; Device type HPLC: HP 1100 Series; UV DAD; Column: Phenomenex Synergi 2 ⁇ Hydro-RP Mercury 20mm x 4mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 l of acetonitrile + 0.5 ml of 50% formic acid; Gradient: 0.0 min 90% A -> 2.5 min 30% A -> 3.0 min 5% A - ⁇ 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min. 2 ml / min; Oven: 50 ° C .; UV detection: 210 nm.
  • Method 4 Instrument: Micromass Platform LCZ with HPLC Agilent Series 1100; Column: Thermo Hypersil GOLD 3 ⁇ 20mm x 4mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 l of acetonitrile + 0.5 ml of 50% formic acid; Gradient: 0.0 min 100% A -> 0.2 min 100% A -> 2.9 min 30% A -> 3.1 min 10% A -> 5.5 min 10% A; Flow: 0.8 ml / min; Oven: 50 ° C .; UV detection: 210 nm.
  • a solution of 8.0 g (31.1 mmol) of 3-amino-4- (3-bromophenyl) butanoic acid in 100 ml of water is combined with 62 ml of 1N sodium hydroxide solution. While stirring, a solution of 20 g (93 mmol) of di-tert-butyl dicarbonate in 100 ml of methanol at RT is added and stirred for 2 h. By addition of 0. IN hydrochloric acid is adjusted to pH 3 and extracted twice with ethyl acetate. The organic phases are combined, dried with magnesium sulfate and evaporated to dryness in vacuo. The remaining solid is used without further purification.
  • a solution of 0.58 g (0.99 mmol) of the compound from Example 10A in 10 ml of water is mixed with 5 ml of 1N sodium hydroxide solution. With stirring, a solution of 0.65 g (2.96 mmol) of di-tert-butyl dicarbonate in 3.7 ml of methanol at RT is added and for Stirred for 2 h. The mixture is added to 25 ml of water, with 0.1N hydrochloric acid is adjusted to pH 3 and shaken out three times with ethyl acetate. The organic phases are combined, dried with magnesium sulfate and evaporated to dryness in vacuo. The remaining solid is purified in a high vacuum to constant weight.
  • a solution of 91 mg (0.10 mmol) of the compound from Example 18A in 10 ml of ethanol is hydrogenated after addition of 10 mg of palladium on activated carbon (10%) for 12 h at RT and normal pressure. It is filtered through kieselguhr and the residue is washed with ethanol. The filtrate is concentrated to dryness in vacuo. The product is reacted without further purification.
  • the solution is concentrated in vacuo and the residue is taken up in ethyl acetate.
  • the organic phase is washed successively with saturated sodium bicarbonate and sodium chloride solution, dried over magnesium sulfate and evaporated in vacuo. The remaining solid is dried under high vacuum to constant weight.
  • tert -butyl [(45,105,155) -10,15-bis [( ⁇ - ⁇ -butoxycarbonyl) amino] -4- ( ⁇ [(85, 115, 145) -14- [(tert-butoxycarbonyl) amino ] -ll- ⁇ 3- [(tert-butoxycarbony1) amino] propyl ⁇ -17-hydroxy-10,13-dioxo-9,12-diacatricyclo [14.3.1.1 2 ' 6 ] henicosa-1 (20), 2 (21), 3, 5, 16, 18-hexa-8-yl] -acetyl ⁇ -amino) -22,22-dimethyl-5,12,20-trioxo-21-oxa-6,13,19-triazatricos- 1-yl] carbamate
  • cAMP 11.25 mg / ml
  • the test batch is 105 .mu.l, wherein 5 .mu.l of the substance to be tested in 5% DMSO are submitted.
  • the transcription template used is 1 ⁇ g / 100 ⁇ l batch of the plasmid pBESTLuc (Promega, Germany).
  • luciferin solution (20 mM Tricine, 2.67 mM MgSO 4, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 uM CoA, 470 uM luciferin, 530 uM ATP) is added and the resulting bioluminescence measured for 1 minute in a luminometer.
  • the IC 50 is the concentration of an inhibitor which leads to a 50% inhibition of the translation of firefly luciferase.
  • plasmid pBESTluc Promega Corporation, USA
  • E. coli tac promoter present in this plasmid in front of the firefly luciferase is exchanged for the capAl promoter with corresponding Shine-Dalgarno sequence from S. aureus.
  • the primer CAPFor contains the capAl promoter, the ribosome binding parts and the 5 'region of the luciferase gene. After PCR using pBESTluc as a template, a PCR product containing the firefly luciferase gene with the fused capAl promoter can be isolated.
  • BHI medium Six liters of BHI medium are inoculated with a 250 ml overnight culture of a S. aureus strain and grown at 37 ° C to an OD 50 nm of 2-4.
  • the cells are harvested by centrifugation and washed in 500 ml of cold buffer A (10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 1 M KCl). After re-centrifugation, the cells in 250 ml of cold buffer A containing 50 mM KCl, and the resulting pellets at -20 0 C for 60 min to be frozen.
  • cold buffer A 10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 1 M KCl
  • the pellets are thawed on ice in 30 to 60 minutes and taken up to a total volume of 99 ml in buffer B (10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1 mM DTT, 50 mM KCl).
  • buffer B 10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1 mM DTT, 50 mM KCl.
  • 1.5 ml of lysostaphin (0.8 mg / ml) in buffer B are precooled in 3 Centrifuge cup presented and mixed with 33 ml of the cell suspension. The samples are incubated at 37 ° C. for 45-60 minutes with occasional shaking before adding 150 ⁇ l of a 0.5 M DTT solution.
  • the lysed cells are centrifuged min at 4 0 C at 30,000 xg 30th
  • the cell pellet after uptake in Buffer B, is recentrifuged under the same conditions and the collected supernatants are pooled.
  • the supernatants are again centrifuged under the same conditions and to the upper 2/3 of the supernatant 0.25 volumes of buffer C (670 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 7 mM Na 3 phosphoenolpyruvate, 7 mM DTT, 5.5 mM ATP, 70 ⁇ M amino acids (complete from Promega), 75 ⁇ g pyruvate kinase (Sigma, Germany)) / ml.
  • buffer C 670 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 7 mM Na 3 phosphoenolpyruvate, 7 mM DTT, 5.5 mM ATP, 70 ⁇ M amino acids
  • the samples are incubated for 30 min at 37 0 C.
  • the supernatants are dialyzed overnight at 4 0 C against 2 1 dialysis buffer (10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 60 mM potassium acetate) with a buffer change in a dialysis tube with 3500 Da exclusion ,
  • the dialysate is concentrated to a protein concentration ml of about 10 mg / by the dialysis tube with cold PEG 8000 powder (Sigma, Germany) is covered at 4 0 C.
  • the S30 extracts can be stored in aliquots at -70 0 C.
  • Inhibition of protein biosynthesis of the compounds can be demonstrated in an in vitro transcription-translation assay.
  • the assay is based on the cell-free transcription and translation of firefly luciferase using the template plasmid pla as template and cell-free S30 extracts obtained from S. aureus. The activity of the resulting luciferase can be detected by luminescence measurement.
  • the amount of S30 extract or plasmid pla to be used must be re-tested for each preparation in order to ensure an optimal concentration in the test. 3 ⁇ l of the substance to be tested dissolved in 5% DMSO are placed in an MTP. Then 10 .mu.l of a suitably concentrated plasmid solution pla are added.
  • luciferin solution (20 mM Tricine, 2.67 mM MgSO 4, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 uM CoA, 470 uM luciferin, 530 uM ATP), and the resulting bioluminescence for 1 min measured in a luminometer.
  • the IC 50 is the concentration of an inhibitor which leads to a 50% inhibition of the translation of firefly luciferase.
  • the minimum inhibitory concentration is the minimum concentration of antibiotic used to inhibit a test bacterium in its growth for 18-24 h.
  • the inhibitor concentration can be determined according to standard microbiological procedures (see, for example, The National Committee for Clinical Laboratory Standards, Methods for dilution, anti-microbial susceptibility tests for bacteria that grow aerobic, approved standard-fifth edition, NCCLS document M7-A5). ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-98 USA, 2000).
  • the MIC of the compounds according to the invention is measured in the liquid dilution test in the 96 Microtiter plate scale determined.
  • the bacterial germs are isolated in a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid except phenylalanine [H.P. Kroll, unpublished]) cultured with the addition of 0.4% BH broth (test medium).
  • a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇
  • the lowest substance concentration at which no visible bacterial growth occurs is defined as MIC.
  • the minimum inhibitory concentration is the minimum concentration of antibiotic used to inhibit a test bacterium in its growth for 18-24 h.
  • the inhibitor concentration can be determined in accordance with standard microbiological procedures using a modified medium as part of an agar dilution test (see, for example, The National Committee for Clinical Laboratory Standards, Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard-fifth edition. NCCLS document M7-A5 [ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-98 USA, 2000). The bacteria are cultured on 1.5% agar plates containing 20% defibrinated horse blood.
  • test organisms which are incubated overnight on Columbia blood agar plates (Becton-Dickinson), are diluted in PBS, adjusted to a bacterial count of about 5 ⁇ 10 5 germs / ml and dropped onto test plates (1-3 ⁇ l).
  • the test substances contain different dilutions of the test substances (dilution stages 1: 2).
  • the cultures are incubated at 37 ° C. for 18-24 hours in the presence of 5% CO 2 .
  • the lowest substance concentration at which no visible bacterial growth occurs is defined as MIC and expressed in ⁇ g / ml.
  • Concentration data MIC in ⁇ g / ml; IC 50 in ⁇ M. Systemic infection with S. aureus 133
  • the suitability of the compounds according to the invention for the treatment of bacterial infections can be demonstrated in various animal models.
  • the animals are generally infected with a suitable virulent germ and then treated with the compound to be tested, which is present in a formulation adapted to the respective therapeutic model.
  • the suitability of the compounds of the invention for the treatment of bacterial infections in a sepsis model in mice after infection with S. aureus can be demonstrated.
  • S. aureus 133 cells are grown overnight in BH broth (Oxoid, Germany). The overnight culture was diluted 1: 100 in fresh BH broth and spun for 3 hours. The bacteria in the logarithmic growth phase are centrifuged off and washed twice with buffered, physiological saline. Thereafter, a cell suspension in saline solution with an extinction of 50 units is set on the photometer (Dr. Lange LP 2W). After a dilution step (1:15), this suspension is mixed 1: 1 with a 10% mucin suspension. 0.2 ml / 20 g mouse ip is administered from this infectious solution. This corresponds to a cell number of about 1-2 x 10 6 germs / mouse.
  • the spontaneous resistance rates of the compounds according to the invention are determined as follows: the bacterial germs are dissolved in 30 ml of a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamin hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid with the addition of 0.4% BH broth) at 37 ° C overnight, 10 min Centrifuged at ⁇ .OOOxg and resuspended in 2 ml of phosphate-buffered physiological NaCl solution (about 2x10 9 germs / ml).
  • 100 ⁇ l of this cell suspension or 1:10 and 1: 100 dilutions are diluted on predried agar plates (1.5% agar, 20% defibrinated horse blood or 1.5% agar, 20% bovine serum in 1/10 Müller-Hinton medium diluted with PBS), which contains the compound of the invention to be tested in a concentration corresponding to 5xMHK or 1OxMHK, plated and incubated at 37 0 C for 48 h. The resulting colonies (cfu) are counted.
  • the S. aureus strain RN4220Bi R is isolated in vitro.
  • 100 ⁇ l of a S. aureus RN4220 cell suspension (approximately 1.2 ⁇ 10 8 cfu / ml) are applied to an antibiotic-free agar plate (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid with the addition of 0.4% BH broth and 1% agarose) and a Agar plate containing 2 ⁇ g / ml Biphenomycin B (10xMHK) and incubated overnight at 37 ° C.
  • the S. aureus strain T17 is isolated in vivo. CFWl mice are challenged with 4x10 ⁇ S. aureus 133 cells per mouse intraperitoneally. 0.5 hours after infection, the animals are treated with 50 mg / kg biphenomycin B intravenously. The survivors are removed from the kidneys on day 3 post-infection. After homogenization of the organs, the homogenates, as described in RN4220Bi R , on antibiotic-free and antibiotic-containing agar plates, plated and incubated overnight at 37 0 C incubated. About half of the colonies isolated from the kidney show growth on the antibiotic-containing plates (2.2 ⁇ 10 6 colonies), which demonstrates the accumulation of biphenomycin B-resistant S. aureus cells in the kidney of the treated animals. Approximately Twenty of these colonies are tested for biphenomycin B MIC and a colony with a MIC> 50 ⁇ M is selected for further culture and the strain is designated T17.
  • the compounds according to the invention can be converted into pharmaceutical preparations as follows:
  • the compound of the present invention is dissolved in the water with stirring together with polyethylene glycol 400.
  • the solution is sterile-filtered (pore diameter 0.22 ⁇ m) and filled under aseptic conditions into heat-sterilized infusion bottles. These are closed with infusion stoppers and crimp caps.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Die Erfindung betrifft antibakterielle Amid-Makrozyklen und Verfahren zu ihrer Herstellung, ihre Verwendung zur Behandlung und/oder Prophylaxe von Krankheiten sowie ihre Verwendung zur Herstellung von Arzneimitteln zur Behandlung und/oder Prophylaxe von Krankheiten, insbesondere von bakteriellen Infektionen.

Description

Antibakterielle Amid-Makrozyklen VII
Die Erfindung betrifft antibakterielle Amid-Makrozyklen und Verfahren zu ihrer Herstellung, ihre Verwendung zur Behandlung und/oder Prophylaxe von Krankheiten sowie ihre Verwendung zur Herstellung von Arzneimitteln zur Behandlung und/oder Prophylaxe von Krankheiten, insbesondere von bakteriellen Infektionen.
In WO 03/106480, WO 04/012816, WO 05/033129 und WO 05/058943 werden antibakteriell wirkende Makrozyklen vom Biphenomycin B Typ mit Amid- bzw. Estersubstituenten beschrieben. In US 3,452,136, Dissertation R. U. Meyer, Universität Stuttgart, Deutschland 1991, Dissertation V. Leitenberger, Universität Stuttgart, Deutschland 1991, Synthesis (1992), (10), 1025- 30, J. Chem. Soc . , Perkin Trans. 1 (1992), (1), 123-30, J. Chem. Soc, Chem. Commun. (1991), (10), 744, Synthesis (1991), (5), 409-13, J. Chem. Soc, Chem. Commun. (1991), (5), 21S-I , J. Antibiot. (1985), 38(11), 1462-8, J. Antibiot. (1985), 38(11), 1453-61, wird der Naturstoff Biphenomycin B als antibakteriell wirksam beschrieben. Teilschritte der Synthese von Biphenomycin B werden in Synlett (2003), 4, 522-526 und Org. Lett. (2005), (7), 2981-2984 beschrieben.
Chirality (1995), 7(4), 181-92, J. Antibiot. (1991), 44(6), 674-7, J. Am. Chem. Soc. (1989), 111(19), 7323-7, J. Am. Chem. Soc (1989), 111(19), 7328-33, J. Org. Chem. (1987), 52(24), 5435-7, Anal. Biochem. (1987), 165(1), 108-13, J. Org. Chem. (1985), 50(8), 1341-2, J. Antibiot. (1993), 46(3), C-2, J. Antibiot. (1993), 46(1), 135-40, Synthesis (1992), (12), 1248- 54, Appl. Environ. Microbiol. (1992), 58(12), 3879-8, J. Chem. Soc, Chem. Commun. (1992), (13), 951-3 beschreiben einen strukturell verwandten Naturstoff, Biphenomycin A, der am Makrozyklus eine weitere Substitution mit einer Hydroxygruppe aufweist.
Die Naturstoffe entsprechen hinsichtlich ihrer Eigenschaften nicht den Anforderungen, die an antibakterielle Arzneimittel gestellt werden. Auf dem Markt sind zwar strukturell andersartige antibakteriell wirkende Mittel vorhanden, es kann aber regelmäßig zu einer Resistenzentwicklung kommen. Neue Mittel für eine gute und wirksamere Therapie sind daher wünschenswert. Eine Aufgabe der vorliegenden Erfindung ist es daher, neue und alternative Verbindungen mit gleicher oder verbesserter antibakterieller Wirkung zur Behandlung von bakteriellen Erkrankungen bei Menschen und Tieren zur Verfügung zu stellen.
Überraschenderweise wurde gefunden, dass bestimmte Derivate dieser Naturstoffe, worin die Carboxylgruppe des Naturstoffs gegen eine Methylenamidgruppe ausgetauscht wird, die eine basische Gruppe enthält, antibakteriell wirksam sind.
Weiterhin zeigen die Derivate gegen Biphenomycin resistente 5". aureus Stämme (RN4220BiR und Tl7) eine antibakterielle Wirkung und gegen S. aureus Wildtyp-Stämme und Biphenomycin resistente S. aureus Stämme eine verbesserte oder gleiche Spontanresistenz-Frequenz wie Biphenomycin und die aus dem Stand der Technik bekannten Biphenomycin-Derivate.
Gegenstand der Erfindung sind Verbindungen der Formel
Figure imgf000004_0001
bei denen
R26 gleich Wasserstoff, Halogen, Hydroxy oder Methyl ist,
R7 gleich eine Gruppe der Formel NH, SNH„
Figure imgf000005_0001
ist,
wobei
R1 gleich Wasserstoff oder Hydroxy ist,
die Anknüpf stelle an das Kohlenstoff atom ist,
gleich Wasserstoff oder Methyl ist,
gleich eine Gruppe der Formel
Figure imgf000005_0002
ist,
wobei * die Anknüpfstelle an das Stickstoffatom ist,
A gleich eine Bindung oder Phenyl ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000006_0001
ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-(CH2Jn-OH oder *-(CH2)o-NH2 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
n und o unabhängig voneinander eine Zahl 1 , 2 , 3 oder 4 sind,
m eine Zahl 0 oder 1 ist, d R12 unabhängig voneinander eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R14 und R15 unabhängig voneinander eine Gruppe der Formel
Figure imgf000007_0001
sind ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4a gleich Wasserstoff, Amino oder Hydroxy ist,
R5a gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6a gleich Wasserstoff oder Aminoethyl ist, oder
R5a und R6a bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Piperazin-Ring,
R8a und R12a unabhängig voneinander *—(CH2) Zla-OH, *-(CH2)z2a-NHR13a, *-CONHR14a oder *-CH2CONHR15a sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa und Z2a unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
R13a gleich Wasserstoff oder Methyl ist
und
R14a und R15a unabhängig voneinander eine Gruppe der Formel
Figure imgf000008_0001
sind, worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4c gleich Wasserstoff, Amino oder Hydro- xy ist,
R5c gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6c gleich Wasserstoff oder Aminoethyl ist,
kc eine Zahl 0 oder 1 ist
und
Ic eine Zahl 1, 2, 3 oder 4 ist,
R9a und Rlla unabhängig voneinander Wasserstoff oder Methyl sind,
R1Oa gleich Amino oder Hydroxy ist,
R16a eine Gruppe der Formel
Figure imgf000009_0001
ist,
worin
* die Anknüpfstelle an das Stickstoff- atom ist,
R4d gleich Wasserstoff, Amino oder Hydro- xy ist,
R5d gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6d gleich Wasserstoff oder Aminoethyl ist,
kd eine Zahl 0 oder 1 ist
und
Id eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist
und
Ia, wa, xa und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
gleich Wasserstoff, Methyl, *-C(NH2)=NH oder eine Gruppe der Formel
Figure imgf000011_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R20 gleich Wasserstoff oder *-(CH2)i-NHR22 ist,
worin
R22 gleich Wasserstoff oder Methyl ist
und
i eine Zahl 1, 2 oder 3 ist,
R21 gleich Wasserstoff oder Methyl ist,
f eine Zahl 0, 1, 2 oder 3 ist,
g eine Zahl 1, 2 oder 3 ist
und
h eine Zahl 1, 2, 3 oder 4 ist, d R 7 unabhängig voneinander eine Gruppe der Formel
sind ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4b gleich Wasserstoff, Amino oder Hydroxy ist,
RSb gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6b gleich Wasserstoff oder Aminoethyl ist,
oder
R5b und R6b bilden zusammen mit dem Stickstof fatom an das sie gebunden sind einen Piperazin-Ring,
R8b und R12b unabhängig voneinander *— ( CH2 ) Zlb-OH ,
*-( CH2 ) z2b-NHR13b , *-CONHR14b oder *-CH2CONHR15b sind, worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R13b gleich Wasserstoff oder Methyl ist
und
ZIb und Z2b unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
und
R14b und R15b unabhängig voneinander eine Gruppe der Formel
Figure imgf000013_0001
sind ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4g gleich Wasserstoff, Amino oder Hydro- xy ist, R5g gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6g gleich Wasserstoff oder Aminoethyl ist,
kg eine Zahl 0 oder 1 ist
und
Ig eine Zahl 1, 2, 3 oder 4 ist,
R9b und Rllbunabhängig voneinander Wasserstoff oder Methyl sind
R1Ob gleich Amino oder Hydroxy ist,
kb eine Zahl 0 oder 1 ist,
Ib, wb, xb und yb unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R18 gleich Wasserstoff, Amino oder Hydroxy ist,
R19 gleich Wasserstoff, Methyl oder eine Gruppe der Formel
Figure imgf000014_0001
ist ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R25 gleich Wasserstoff oder *-(CH2)u-NHR29 ist,
worin
R29 gleich Wasserstoff oder Methyl ist
und
u eine Zahl 1, 2 oder 3 ist,
R28 gleich Wasserstoff oder Methyl ist,
s eine Zahl 0, 1, 2 oder 3 ist
und
t eine Zahl 1, 2 oder 3 ist,
R24 gleich Wasserstoff oder Aminoethyl ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind, 1, r, w und y unabhängig voneinander eine Zahl 1, 2, 3 o- der 4 sind,
L Jw,r oder y unabhängig voneinander bei w, r oder y gleich 3 eine Hydroxy-Gruppe tragen kann,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.
Erfindungsgemäße Verbindungen sind die Verbindungen der Formel (I) und deren Salze, Solvate und Solvate der Salze, sowie die von Formel (I) umfassten, nachfolgend als Ausführungs- beispiel(e) genannten Verbindungen und deren Salze, Solvate und Solvate der Salze, soweit es sich bei den von Formel (I) umfassten, nachfolgend genannten Verbindungen nicht bereits um Salze, Solvate und Solvate der Salze handelt.
Die erfindungsgemäßen Verbindungen können in Abhängigkeit von ihrer Struktur in stereoisomeren Formen (Enantiomere, Diastere- omere) existieren. Die Erfindung betrifft deshalb die Enantio- meren oder Diastereomeren und ihre jeweiligen Mischungen. Aus solchen Mischungen von Enantiomeren und/oder Diastereomeren lassen sich durch bekannte Verfahren wie Chromatographie an chiraler Phase oder Kristallisation mit chiralen Aminen oder chiralen Säuren die stereoisomer einheitlichen Bestandteile in bekannter Weise isolieren.
Die Erfindung betrifft in Abhängigkeit von der Struktur der Verbindungen auch Tautomere der Verbindungen. Als Salze sind im Rahmen der Erfindung physiologisch unbedenkliche Salze der erfindungsgemäßen Verbindungen bevorzugt.
Physiologisch unbedenkliche Salze der Verbindungen (I) umfassen Säureadditionssalze von Mineralsäuren, Carbonsäuren und SuIfon- säuren, z.B. Salze der Chlorwasserstoffsäure, BromwasserStoff- säure, Schwefelsäure, Phosphorsäure, Methansulfonsäure, Ethan- sulfonsäure, Toluolsulfonsäure, Benzolsulfonsäure, Naphthalindisulfonsäure, Essigsäure, Propionsäure, Milchsäure, Weinsäure, Äpfelsäure, Zitronensäure, Fumarsäure, Maleinsäure, Trifluores- sigsäure und Benzoesäure.
Physiologisch unbedenkliche Salze der Verbindungen (I) umfassen auch Salze üblicher Basen, wie beispielhaft und vorzugsweise Alkalimetallsalze (z.B. Natrium- und Kaliumsalze), Erdalkalisalze (z.B. Calcium- und Magnesiumsalze) und Ammoniumsalze, abgeleitet von Ammoniak oder organischen Aminen mit 1 bis 16 C- Atomen, wie beispielhaft und vorzugsweise Ethylamin, Di- ethylamin, Triethylamin, Ethyldiisopropylamin, Monoethanolamin, Diethanolamin, Triethanolamin, Dicyclohexylamin, Dimethylami- noethanol, Prokain, Dibenzylamin, i\f-Methylmorpholin, Dihydroa- bietylamin, Arginin, Lysin, Ethylendiamin und Methylpiperidin.
Als Solvate werden im Rahmen der Erfindung solche Formen der Verbindungen bezeichnet, welche in festem oder flüssigem Zustand durch Koordination mit Lösungsmittelmolekülen einen Komplex bilden. Hydrate sind eine spezielle Form der Solvate, bei denen die Koordination mit Wasser erfolgt.
Halogen steht für Fluor, Chlor, Brom und Jod. Ein Symbol # an einem Kohlenstoffatom bedeutet, dass die Verbindung hinsichtlich der Konfiguration an diesem Kohlenstoff- atom in enantiomerenreiner Form vorliegt, worunter im Rahmen der vorliegenden Erfindung ein Enantiomerenüberschuss (enantio- meric excess) von mehr als 90% verstanden wird (> 90% ee).
In den Formeln der Gruppen, für die R3 stehen kann, steht der Endpunkt der Linie, neben der jeweils ein * steht, nicht für ein Kohlenstoffatom beziehungsweise eine CH2-Gruppe sondern ist Bestandteil der Bindung zu dem Stickstoffatom, an das R3 gebunden ist.
In den Formeln der Gruppen, für die R7 stehen kann, steht der Endpunkt der Linie, neben der jeweils ein * steht, nicht für ein Kohlenstoffatom beziehungsweise eine CH2-Gruppe sondern ist Bestandteil der Bindung zu dem Kohlenstoffatom, an das R7 gebunden ist.
Bevorzugt im Rahmen der vorliegenden Erfindung sind auch Verbindungen der Formel
Figure imgf000018_0001
bei denen R26 gleich Wasserstoff, Halogen, Hydroxy oder Methyl ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff oder Methyl ist,
R3 wie oben definiert ist,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.
Bevorzugt im Rahmen der vorliegenden Erfindung sind auch Verbindungen der Formel (I) oder (Ia), bei denen R26 gleich Wasserstoff, Chlor, Hydroxy oder Methyl ist.
Bevorzugt im Rahmen der vorliegenden Erfindung sind auch Verbindungen der Formel (I) oder (Ia), bei denen R26 gleich Wasserstoff ist.
Bevorzugt im Rahmen der vorliegenden Erfindung sind auch Verbindungen der Formel (Ia) bei denen
R26 gleich Wasserstoff oder Hydroxy ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff ist,
R3 gleich eine Gruppe der Formel
Figure imgf000020_0001
ist ,
wobei
* die Anknüpfstelle an das Stickstoffatom ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000020_0002
ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-(CH2)n-OH oder *-(CH2)o-NH2 ist, worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
n und o unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
m eine Zahl 0 oder 1 ist,
eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R14 und R15 unabhängig voneinander eine Gruppe der Formel
Figure imgf000021_0001
sind,
worin * die Anknüpfstelle an das Stickstoffatom ist,
R4a gleich Wasserstoff, Amino oder Hydroxy ist,
R5a gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6a gleich Wasserstoff oder Aminoethyl ist,
oder
R5a und R6a bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Pipe- razin-Ring,
R8a und R12a unabhängig voneinander *—(CH2) zla-0H, *-(CH2)z2a-NHR13a, *-CONHR14a oder *-CH2CONHR15a sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa und Z2a unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
R13a gleich Wasserstoff oder Methyl ist
und R14a und R15a unabhängig voneinander eine Gruppe der Formel
Figure imgf000023_0001
sind,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4c gleich Wasserstoff, Amino oder Hydro- xy ist,
R5c gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6c gleich Wasserstoff oder Aminoethyl ist,
kσ eine Zahl 0 oder 1 ist
und
Ic eine Zahl 1, 2, 3 oder 4 ist,
R9a und Rlla unabhängig voneinander Wasserstoff oder Methyl sind, R1Oa gleich Amino oder Hydroxy ist,
R16a eine Gruppe der Formel
Figure imgf000024_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4d gleich Wasserstoff, Amino oder Hydroxy ist,
R5d gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6d gleich Wasserstoff oder Aminoethyl ist,
kd eine Zahl 0 oder 1 ist
und
Id eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist und
Ia, wa, xa und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
gleich Wasserstoff, Methyl, *-C(NH2J=NH oder eine Gruppe der Formel
Figure imgf000025_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R20 gleich Wasserstoff oder *-( CH2 J1-NHR22 ist,
worin
R22 gleich Wasserstoff oder Methyl ist
und
i eine Zahl 1, 2 oder 3 ist,
R21 gleich Wasserstoff oder Methyl ist, f eine Zahl 0 , 1 , 2 oder 3 ist,
g eine Zahl 1 , 2 oder 3 ist
und
h eine Zahl 1 , 2 , 3 oder 4 ist,
eine Gruppe der Formel
Figure imgf000026_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4b gleich Wasserstoff, Amino oder Hydroxy ist,
R5b gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6b gleich Wasserstoff oder Aminoethyl ist, oder
R5b und R6b bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Piperazin-Ring ,
R8b und R12b unabhängig voneinander *— (CH2 ) zlb-0H,
*-( CH2 )z2b-NHR13b, *-CONHR14b oder * -CH2CONHR151' sind ,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R13b gleich Wasserstoff oder Methyl ist
und
ZIb und Z2b unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
und
R14b und R15b unabhängig voneinander eine Gruppe der Formel
Figure imgf000027_0001
sind, worin
* die Anknüpfstelle an das Stickstoff- atom ist,
R4g gleich Wasserstoff, Amino oder Hydro- xy ist,
R5g gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6g gleich Wasserstoff oder Aminoethyl ist,
kg eine Zahl 0 oder 1 ist
und
Ig eine Zahl 1, 2, 3 oder 4 ist,
R9b und Rllb unabhängig voneinander Wasserstoff oder Methyl sind,
R1Ob gleich Amino oder Hydroxy ist,
kb eine Zahl 0 oder 1 ist,
Ib, wb, xb und yb unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R1B gleich Wasserstoff, Amino oder Hydroxy ist, gleich Wasserstoff, Methyl oder eine Gruppe der Formel
Figure imgf000029_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R25 gleich Wasserstoff oder *-(CH2 )U-NHR29 ist,
worin
R gleich Wasserstoff oder Methyl ist
und
u eine Zahl 1, 2 oder 3 ist,
R28 gleich Wasserstoff oder Methyl ist,
s eine Zahl 0, 1, 2 oder 3 ist
und
t eine Zahl 1, 2 oder 3 ist, R24 gleich Wasserstoff oder Aminoethyl ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind,
1, r und w unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
L Jw oder r unabhängig voneinander bei w oder r gleich 3 eine Hydroxy-Gruppe tragen kann,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.
Bevorzugt im Rahmen der vorliegenden Erfindung sind auch Verbindungen der Formel (Ia) bei denen
R26 gleich Wasserstoff oder Hydroxy ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff ist,
R3 gleich eine Gruppe der Formel
Figure imgf000031_0001
ist,
wobei
* die Anknüpfstelle an das Stickstoffatom ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000031_0002
ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-( CH2Jn-OH oder *-(CH2)O-NH2 ist, worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
n und o unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
m eine Zahl 0 oder 1 ist,
eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R14 und R15 unabhängig voneinander eine Gruppe der Formel
Figure imgf000032_0001
sind,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4a gleich Wasserstoff, Amino oder Hydroxy ist, R5a gleich Wasserstoff ist,
R6a gleich Wasserstoff ist,
R12a gleich *-(CH2)zla-OH oder *-CH2CONHR15a ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa eine Zahl 1, 2 oder 3 ist,
und
R15a eine Gruppe der Formel
Figure imgf000033_0001
ist ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4c gleich Wasserstoff, Amino oder Hydro- xy ist, R5c gleich Wasserstoff ist,
R6c gleich Wasserstoff ist,
kc eine Zahl 0 oder 1 ist
und
Ic eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist
und
Ia und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R9 gleich Wasserstoff ist,
R17 eine Gruppe der Formel
Figure imgf000034_0001
ist,
worin
die Anknüpfstelle an das Stickstoffatom ist, R4b gleich Wasserstoff, Amino oder Hydroxy ist,
R5b gleich Wasserstoff ist,
R6b gleich Wasserstoff ist,
kb eine Zahl 0 oder 1 ist,
Ib eine Zahl 1, 2, 3 oder 4 ist,
R18 gleich Wasserstoff, Amino oder Hydroxy ist,
R19 gleich Wasserstoff ist,
R24 gleich Wasserstoff ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind,
1, r und w unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
L Jw oder r unabhängig voneinander bei w oder r gleich 3 eine Hydroxy-Gruppe tragen kann,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze. Gegenstand der Erfindung ist weiterhin ein Verfahren zur Herstellung der Verbindungen der Formel (I) oder ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze, wobei nach Verfahren
[A] Verbindungen der Formel
Figure imgf000036_0001
worin R2, R7 und R26 die oben angegebene Bedeutung haben und boc gleich tez-t-Butoxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit Verbindungen der Formel
H2NR3 (IH),
worin R3 die oben angegebene Bedeutung hat,
und anschließend mit einer Säure und/oder durch Hydrogenolyse umgesetzt werden,
oder [ B ] Verbindungen der Formel
Figure imgf000037_0001
worin R2, R7 und R26 die oben angegebene Bedeutung haben und Z gleich Benzyloxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit Verbindungen der Formel
H2NR3 (IH),
worin R3 die oben angegebene Bedeutung hat,
und anschließend mit einer Säure oder durch Hydrogenolyse umgesetzt werden.
Die freie Base der Salze kann zum Beispiel durch Chromatographie an einer Reversed Phase Säule mit einem Acetonitril- Wasser-Gradienten unter Zusatz einer Base erhalten werden, insbesondere durch Verwendung einer RP18 Phenomenex Luna C18(2) Säule und Diethylamin als Base.
Weiterer Gegenstand der Erfindung ist ein Verfahren zur Herstellung der Verbindungen der Formel (I) oder ihrer Solvate nach Anspruch 1, bei dem Salze der Verbindungen oder Solvate der Salze der Verbindungen durch Chromatographie unter Zusatz einer Base in die Verbindungen überführt werden.
Die Hydroxygruppe an R1 ist gegebenenfalls während der Umsetzung mit Verbindungen der Formel (III) mit einer tert- Butyldimethylsilyl-Gruppe geschützt, die im zweiten Reaktionsschritt abgespalten wird.
Reaktive Funktionalitäten in dem Rest R3 von Verbindungen der Formel (III) werden bereits geschützt mit in die Synthese eingebracht, bevorzugt sind säurelabile Schutzgruppen (z.B. boc). Nach erfolgter Umsetzung zu Verbindungen der Formel (I) können die Schutzgruppen durch Entschützungsreaktion abgespalten werden. Dies geschieht nach Standardverfahren der Schutzgruppenchemie. Bevorzugt sind Entschützungsreaktionen unter sauren Bedingungen oder durch Hydrogenolyse.
Die Umsetzung der ersten Stufe der Verfahren [A] und [B] erfolgt im Allgemeinen in inerten Lösungsmitteln, gegebenenfalls in Gegenwart einer Base, bevorzugt in einem Temperaturbereich von 00C bis 400C bei Normaldruck.
Als Dehydratisierungsreagenzien eignen sich hierbei beispielsweise Carbodiimide wie z.B.
Figure imgf000038_0001
iV,i\T'-Diisopropyl-, A^-V'-Dicyclohexylcarbodümid, N- ( 3-Dimethyl- aminoisopropy1 ) -N'-ethylcarbodiimid-Hydrochlorid (EDC) , jy-Cyclohexylcarbodiimid-iV'-propyloxymethyl-Polystyrol (PS- Carbodiimid) oder Carbonylverbindungen wie Carbonyldiimidazol, oder 1,2-Oxazoliumverbindungen wie 2-Ethyl-5-phenyl-l,2- oxazolium-3-sulfat oder 2-tert.-Butyl-5-methyl-isoxazolium- perchlorat, oder Acylaminoverbindungen wie 2-Ethoxy-l-ethoxy- carbonyl-1, 2-dihydrochinolin, oder Propanphosphonsäureanhydrid, oder Isobutylchloroformat, oder Bis-( 2-oxo-3-oxazolidinyl)- phosphorylchlorid oder Benzotriazolyloxy-tri(dimethylamino)- phosphoniumhexafluorophosphat, oder O-(Benzotriazol-l-yl)- iV,W,.V',_V'-tetra-methyluroniumhexafluorophosphat (HBTU), 2-(2- Oxo-l-(2H)-pyridyl)-l ,1,3, 3-tetramethyluroniumtetrafluoroborat (TPTU) oder 0-(7-Azabenzotriazol-l-yl)-iV,Λr,.Λr,-V'-tetramethyl- uroniumhexafluorophosphat (HATU), oder 1-Hydroxybenztriazol (HOBt), oder Benzotriazol-l-yloxytris(dimethylamino)- phosphoniumhexafluoro-phosphat (BOP), oder Mischungen aus diesen, oder Mischung aus diesen zusammen mit Basen.
Basen sind beispielsweise Alkalicarbonate, wie z.B. Natriumoder Kaliumcarbonat, oder -hydrogencarbonat, oder organische Basen wie Trialkylamine z.B. Triethylamin, JV-Methylmorpholin, ΛT-Methylpiperidin, 4-Dimethylaminopyridin oder Diisopropyl- ethylamin.
Vorzugsweise wird die Kondensation mit HATU in Gegenwart einer Base, insbesondere Diisopropylethylamin, oder mit EDC und HOBt in Gegenwart einer Base, insbesondere Triethylamin, durchgeführt.
Inerte Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan oder Trichlormethan, Kohlenwasserstoff wie Benzol, oder Nitromethan, Dioxan, Dimethylformamid oder Acetonitril. Ebenso ist es möglich, Gemische der Lösemittel einzusetzen. Besonders bevorzugt ist Dimethylformamid.
Die Umsetzung mit einer Säure in der zweiten Stufe der Verfahren [A] und [B] erfolgt bevorzugt in einem Temperaturbereich von 00C bis 400C bei Normaldruck. Als Säuren eignen sich hierbei Chlorwasserstoff in Dioxan, Bromwasserstoff in Essigsäure oder Trifluoressigsäure in Methylenchlorid.
Die Hydrogenolyse in der zweiten Stufe des Verfahrens [B] erfolgt im Allgemeinen in einem Lösungsmittel in Gegenwart von Wasserstoff und Palladium auf Aktivkohle, bevorzugt in einem Temperaturbereich von 00C bis 400C bei Normaldruck.
Lösungsmittel sind beispielsweise Alkohole wie Methanol, Etha- nol, n-Propanol oder iso-Propanol, in einem Gemisch mit Wasser und Eisessig, bevorzugt ist ein Gemisch aus Ethanol, Wasser und Eisessig.
Die Verbindungen der Formel (III) sind bekannt oder können analog bekannten Verfahren hergestellt werden.
Die Verbindungen der Formel (II) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000040_0001
worin R , R7 und R26 die oben angegebene Bedeutung haben,
mit Di- ( tert-butyl)-dicarbonat in Gegenwart einer Base umgesetzt werden. Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmittel, bevorzugt in einem Temperaturbereich von 00C bis 400C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Natrium- oder Kaliumhydroxid, oder Alkalicarbonate wie Cäsiumcarbσnat, Natrium- oder Kaliumcarbonat, oder andere Basen wie DBU, Triethyla- min oder Diisopropylethylamin, bevorzugt ist Natriumhydroxid oder Natriumcarbonat .
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Methylenchlorid oder 1,2-Dichlorethan, Alkohole wie Methanol, Ethanol oder iso-Propanol, oder Wasser.
Vorzugsweise wird die Umsetzung mit Natriumhydroxid in Wasser oder Natriumcarbonat in Methanol durchgeführt.
Die Verbindungen der Formel (V) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000041_0001
worin R2, R7 und R26 die oben angegebene Bedeutung haben, und
R27 gleich Benzyl, Methyl oder Ethyl ist, mit einer Säure oder durch Hydrogenolyse, wie für die zweite Stufe des Verfahrens [B] beschrieben, gegebenenfalls durch anschließende Umsetzung mit einer Base zur Verseifung des Methyl- oder Ethylesters, umgesetzt werden.
Die Verseifung kann zum Beispiel erfolgen, wie bei der Umsetzung von Verbindungen der Formel (VI) zu Verbindungen der Formel (IV) beschrieben.
Die Verbindungen der Formel (IV) sind bekannt oder können hergestellt werden, indem in Verbindungen der Formel (VI) der Benzyl-, Methyl- oder Ethylester verseift wird.
Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmittel, in Gegenwart einer Base, bevorzugt in einem Temperaturbereich von 00C bis 400C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Lithium-, Natrium- oder Kaliumhydroxid, bevorzugt ist Lithiumhydroxid.
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan oder Trichlormethan, Ether wie Tetrahydrofuran oder Dioxan, oder Alkohole wie Methanol, Ethanol oder Iso- propanol, oder Dimethylformamid. Ebenso ist es möglich, Gemische der Lösungsmittel oder Gemische der Lösungsmittel mit Wasser einzusetzen. Besonders bevorzugt sind Tetrahydrofuran oder ein Gemisch aus Methanol und Wasser.
Die Verbindungen der Formel (VI) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000043_0001
worin R2, R7, R26 und R27 die oben angegebene Bedeutung haben,
in der ersten Stufe mit Säuren, wie für die zweite Stufe der Verfahren [A] und [B] beschrieben, und in der zweiten Stufe mit Basen umgesetzt werden.
In der zweiten Stufe erfolgt die Umsetzung mit Basen im Allgemeinen in einem Lösungsmittel, bevorzugt in einem Temperaturbereich von O0C bis 400C bei Normaldruck.
Basen sind beispielsweise Alkalihydroxide wie Natrium- oder Kaliumhydroxid, oder Alkalicarbonate wie Cäsiumcarbonat, Natrium- oder Kaliumcarbonat, oder andere Basen wie DBU, Triethyl- amin oder Diisopropylethylamin, bevorzugt ist Triethylamin.
Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Chloroform, Methylenchlorid oder 1, 2-Dichlorethan, oder Tetra- hydrofuran, oder Gemische der Lösungsmittel, bevorzugt ist Methylenchlorid oder Tetrahydrofuran. Die Verbindungen der Formel (VII) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000044_0001
worin R , R , R26 und R die oben angegebene Bedeutung haben,
mit Pentafluorphenol in Gegenwart von Dehydratisierungsreagen- zien, wie für die erste Stufe der Verfahren [A] und [B] beschrieben, umgesetzt werden.
Die Umsetzung erfolgt bevorzugt mit DMAP und EDC in Dichlor- methan in einem Temperaturbereich von -400C bis 400C bei Normaldruck.
Die Verbindungen der Formel (VIII) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000044_0002
worin R2, R , R2 und R die oben angegebene Bedeutung haben, mit Fluorid, insbesondere mit Tetrabutylammoniumfluorid, umgesetzt werden.
Die Umsetzung erfolgt im Allgemeinen in einem Lösungsmittel, bevorzugt in einem Temperaturbereich von -100C bis 3O0C bei Normaldruck.
Inerte Lösungsmittel sind beispielsweise Halogenkohlenwasserstoffe wie Dichlormethan, oder Kohlenwasserstoffe wie Benzol oder Toluol, oder Ether wie Tetrahydrofuran oder Dioxan, oder Dirnethylformamid. Ebenso ist es möglich, Gemische der Lösemittel einzusetzen. Bevorzugte Lösungsmittel sind Tetrahydrofuran und Dimethylformamid.
Die Verbindungen der Formel (IX) sind bekannt oder können hergestellt werden, indem Verbindungen der Formel
Figure imgf000045_0001
worin R2, R26 und R27 die oben angegebene Bedeutung haben,
mit Verbindungen der Formel
Figure imgf000046_0001
worin R7 die oben angegebene Bedeutung hat,
in Gegenwart von Dehydratisierungsreagenzien, wie für die erste Stufe der Verfahren [A] und [B] beschrieben, umgesetzt werden.
Die Verbindungen der Formel (X) sind bekannt oder können analog den im Beispielteil beschriebenen Verfahren hergestellt werden.
Die Verbindungen der Formel (XI) sind bekannt oder können analog bekannten Verfahren hergestellt werden.
Die erfindungsgemäßen Verbindungen zeigen ein nicht vorhersehbares, wertvolles pharmakologisches und pharmakokinetisches Wirkspektrum.
Sie eignen sich daher zur Verwendung als Arzneimittel zur Behandlung und/oder Prophylaxe von Krankheiten bei Menschen und Tieren.
Die erfindungsgemäßen Verbindungen können aufgrund ihrer pharmakologischen Eigenschaften allein oder in Kombination mit anderen Wirkstoffen zur Behandlung und/oder Prophylaxe von Infektionskrankheiten, insbesondere von bakteriellen Infektionen, eingesetzt werden.
Beispielsweise können lokale und/oder systemische Erkrankungen behandelt und/oder verhindert werden, die durch die folgenden Erreger oder durch Mischungen der folgenden Erreger verursacht werden :
Gram-positive Kokken, z.B. Staphylokokken (Staph. aureus, Staph. epidermidis) und Streptokokken (Strept. agalactiae, Strept. faecalis, Strept. pneumoniae, Strept. pyogenes); gram-negative Kokken (neisseria gonorrhoeae) sowie gramnegative Stäbchen wie Enterobakteriaceen, z.B. Escherichia coli, Hämophilus influenzae, Citrobacter (Citrob. freundii, Citrob. divernis), Salmonella und Shigella; ferner Klebsiellen (Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent. aeroge- nes, Ent. agglomerans) , Hafnia, Serratia (Serr. marcescens) , Proteus (Pr. mirabilis, Pr. rettgeri, Pr. vulgaris), Providen- cia, Yersinia, sowie die Gattung Acinetobacter . Darüber hinaus umfaßt das antibakterielle Spektrum die Gattung Pseudomonas (Ps. aeruginosa, Ps. maltophilia) sowie strikt anaerobe Bakterien wie z.B. Bacteroides fragilis, Vertreter der Gattung Pep- tococcus, Peptostreptococcus sowie die Gattung Clostridium; ferner Mykoplasmen (M. pneumoniae, M. hominis, M. urealyticum) sowie Mykobakterien, z.B. Mycobacterium tuberculosis.
Die obige Aufzählung von Erregern ist lediglich beispielhaft und keineswegs beschränkend aufzufassen. Als Krankheiten, die durch die genannten Erreger oder Mischinfektionen verursacht und durch die erfindungsgemäßen topisch anwendbaren Zubereitungen verhindert, gebessert oder geheilt werden können, seien beispielsweise genannt:
Infektionskrankheiten beim Menschen wie z. B. septische Infektionen, Knochen- und Gelenkinfektionen, Hautinfektionen, postoperative Wundinfektionen, Abszesse, Phlegmone, Wundinfektionen, infizierte Verbrennungen, Brandwunden, Infektionen im Mundbereich, Infektionen nach Zahnoperationen, septische Arthritis, Mastitis, Tonsillitis, Genital-Infektionen und Augeninfektionen.
Außer beim Menschen können bakterielle Infektionen auch bei anderen Spezies behandelt werden. Beispielhaft seien genannt:
Schwein: Coli-diarrhoe, Enterotoxamie, Sepsis, Dysenterie, Salmonellose, Metritis-Mastitis-Agalaktiae-Syndrom, Mastitis;
Wiederkäuer (Rind, Schaf, Ziege): Diarrhoe, Sepsis, Bronchopneumonie, Salmonellose, Pasteurellose, Mykoplasmose, Genitalinfektionen;
Pferd: Bronchopneumonien, Fohlenlähme, puerperale und postpuerperale Infektionen, Salmonellose;
Hund und Katze: Bronchopneumonie, Diarrhoe, Dermatitis, Otitis, Harnwegsinfekte, Prostatitis;
Geflügel (Huhn, Pute, Wachtel, Taube, Ziervögel und andere): Mycoplasmose, E. coli-Infektionen, chronische Luftwegserkrankungen, Salmonellose, Pasteurellose, Psittakose.
Ebenso können bakterielle Erkrankungen bei der Aufzucht und Haltung von Nutz- und Zierfischen behandelt werden, wobei sich das antibakterielle Spektrum über die vorher genannten Erreger hinaus auf weitere Erreger wie z.B. Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris, Corynebakterien, Bo- rellia, Treponema, Nocardia, Rikettsie, Yersinia, erweitert. Weiterer Gegenstand der vorliegenden Erfindung ist der Einsatz der erfindungsgemäßen Verbindungen zur Behandlung und/oder Prophylaxe von Erkrankungen, vorzugsweise von bakteriellen Krankheiten, insbesondere von bakteriellen Infektionen.
Weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung der erfindungsgemäßen Verbindungen zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen .
Weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung der erfindungsgemäßen Verbindungen zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen.
Weiterer Gegenstand der vorliegenden Erfindung ist ein Verfahren zur Behandlung und/oder Prophylaxe von Erkrankungen, insbesondere der zuvor genannten Erkrankungen, unter Verwendung einer antibakteriell wirksamen Menge der erfindungsgemäßen Verbindungen .
Die erfindungsgemäßen Verbindungen können systemisch und/oder lokal wirken. Zu diesem Zweck können sie auf geeignete Weise appliziert werden, wie z.B. oral, parenteral, pulmonal, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, con- junctival, otisch oder als Implantat bzw. Stent.
Für diese Applikationswege können die erfindungsgemäßen Verbindungen in geeigneten Applikationsformen verabreicht werden. Für die orale Applikation eignen sich nach dem Stand der Technik funktionierende schnell und/oder modifiziert die erfindungsgemäßen Verbindungen abgebende Applikationsformen, die die erfindungsgemäßen Verbindungen in kristalliner und/ oder a- morphisierter und/oder gelöster Form enthalten, wie z.B. Tabletten (nichtüberzogene oder überzogene Tabletten, beispielsweise mit magensaftresistenten oder sich verzögert auflösenden oder unlöslichen Überzügen, die die Freisetzung der erfindungsgemäßen Verbindung kontrollieren), in der Mundhöhle schnell zerfallende Tabletten oder Filme/Oblaten, Filme/Lyophylisate, Kapseln (beispielsweise Hart- oder Weichgelatinekapseln), Dragees, Granulate, Pellets, Pulver, Emulsionen, Suspensionen, Aerosole oder Lösungen.
Die parenterale Applikation kann unter Umgehung eines Resorptionsschrittes geschehen (z.B. intravenös, intraarteriell, intrakardial, intraspinal oder intralumbal) oder unter Einschaltung einer Resorption (z.B. intramuskulär, subcutan, intracutan, percutan oder intraperitoneal) . Für die parenterale Applikation eignen sich als Applikationsformen u.a. Injektions- und Infusionszubereitungen in Form von Lösungen, Suspensionen, Emulsionen, Lyophilisaten oder sterilen Pulvern.
Für die sonstigen Applikationswege eignen sich z.B. Inhalationsarzneiformen (u.a. Pulverinhalatoren, Nebulizer), Nasentropfen, -lösungen, -sprays; lingual, sublingual oder buccal zu applizierende Tabletten, Filme/Oblaten oder Kapseln, Supposito- rien, Ohren- oder Augenpräparationen, Vaginalkapseln, wässrige Suspensionen (Lotionen, Schüttelmixturen), lipophile Suspensionen, Salben, Cremes, transdermale therapeutische Systeme (wie beispielsweise Pflaster), Milch, Pasten, Schäume, Streupuder, Implantate oder Stents. Die erfindungsgemäßen Verbindungen können in die angeführten Applikationsformen überführt werden. Dies kann in an sich bekannter Weise durch Mischen mit inerten, nichttoxischen, pharmazeutisch geeigneten Hilfsstoffen geschehen. Zu diesen Hilfs- stoffen zählen u.a. Trägerstoffe (beispielsweise mikrokristalline Cellulose, Laktose, Mannitol), Lösungsmittel (z.B. flüssige Polyethylenglycole) , Emulgatoren und Dispergier- oder Netzmittel (beispielsweise Natriumdodecylsulfat, Polyoxy- sorbitanoleat) , Bindemittel (beispielsweise Polyvinylpyrroli- don), synthetische und natürliche Polymere (beispielsweise Albumin), Stabilisatoren (z.B. Antioxidantien wie beispielsweise Ascorbinsäure) , Farbstoffe (z.B. anorganische Pigmente wie beispielsweise Eisenoxide) und Geschmacks- und / oder Geruchskorrigentien .
Weiterer Gegenstand der vorliegenden Erfindung sind Arzneimittel, die mindestens eine erfindungsgemäße Verbindung, üblicherweise zusammen mit einem oder mehreren inerten, nichttoxischen, pharmazeutisch geeigneten Hilfsstoffen enthalten, sowie deren Verwendung zu den zuvor genannten Zwecken.
Im Allgemeinen hat es sich als vorteilhaft erwiesen, bei parenteraler Applikation Mengen von etwa 5 bis 250 mg/kg Körpergewicht je 24 h zur Erzielung wirksamer Ergebnisse zu verabreichen. Bei oraler Applikation beträgt die Menge etwa 5 bis 100 mg/kg Körpergewicht je 24 h.
Trotzdem kann es gegebenenfalls erforderlich sein, von den genannten Mengen abzuweichen, und zwar in Abhängigkeit von Körpergewicht, Applikationsweg, individuellem Verhalten gegenüber dem Wirkstoff, Art der Zubereitung und Zeitpunkt bzw. Intervall, zu welchem die Applikation erfolgt. So kann es in einigen Fällen ausreichend sein, mit weniger als der vorgenannten Mindestmenge auszukommen, während in anderen Fällen die genannte obere Grenze überschritten werden muss. Im Falle der Applikation größerer Mengen kann es empfehlenswert sein, diese in mehreren Einzelgaben über den Tag zu verteilen.
Die Prozentangaben in den folgenden Tests und Beispielen sind, sofern nicht anders angegeben, Gewichtsprozente; Teile sind Gewichtsteile. Lösungsmittelverhältnisse, Verdünnungsverhältnisse und Konzentrationsangaben von flüssig/flüssig-Lösungen beziehen sich jeweils auf das Volumen.
Beispiele
Verwendete Abkürzungen:
abs. absolut aq. wässrig
Bn Benzyl boc £e.rfc-Butoxycarbonyl
Bsp. Beispiel
CDCl3 Chloroform
CH Cyclohexan d dublett (im 1H-NMR) dd dublett von dublett (im 1H-NMR)
DC Dünnschichtchromatographie
DCC Dicyclohexylcarbodiimid
DIC Diisopropylcarbodiimid
DIEA Diisopropylethylamin (Hünig-Base)
DMSO Dimethylsulfoxid
DMAP 4--V,iy-Dimethylaminopyridin
DMF Dimethylformamid d. Th. der Theorie
EDC -V '- ( 3-Dimethylaminopropyl ) -_V-ethylcarbodiimid x HCl
EE Ethylacetat ( Essigsäureethylester )
ESI Elektrospray-Ionisation ( bei MS )
Fmoc 9-Fluorenylmethoxycarbonyl ges. gesättigt
HATU O- ( 7-Azabenzotriazol-1-y1) -N,N,N',N'- tetramethyluronium- hexafluorophosphat
HBTU 0-(Benzotriazol-l-yl)-N,N,N',N'- tetramethyluronium- hexafluorophosphat
HOBt 1-Hydroxy-lH-benzotriazol x H2O h Stunde (n)
HPLC Hochdruck-, Hochleistungsflüssigchromatographie
LC-MS Flüssigchromatographie-gekoppelte Massenspektroskopie m multiplett (im 1H-NMR) min Minute
MS Massenspektroskopie
NMR Kernresonanzspektroskopie
MTBE Methyl- tert-butylether
Pd/C Palladium/Kohle
PFP Pentafluorphenol proz . Prozent
PyBOP Benzotriazol-l-yloxytris(pyrrolidino)- phosphoniumhexafluorophosphat q quartett (im 1H-NMR)
Rf Retentionsindex (bei DC)
RP Reverse Phase (bei HPLC)
RT Raumtemperatur
Rt Retentionszeit (bei HPLC) s singulett (im 1H-NMR) t triplett (im 1H-NMR)
TBS tert-Butyldimethylsilyl
TFA Trifluoressigsäure
THF Tetrahydrofuran
TMSE 2-(Trimethylsilyl)-ethyl
TPTU 2- ( 2-Oxo-l ( 2H) -pyridyl ) -1 , 1 , 3 , 3- tetramethyluroniumtetrafluoroborat
Z Benzyloxycarbonyl
LC-MS- und HPLC-Methoden;
Methode 1 (LC-MS) ; Instrument: Micromass Quattro LCZ mit HPLC Agilent Serie 1100; Säule: Phenomenex Synergi 2μ Hydro-RP Mer- cury 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A -> 2.5 min 30%A -> 3.0 min 5%A -> 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min 2 ml/min; Ofen: 500C; UV-Detektion: 208-400 nm.
Methode 2 (LC-MS): Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: Waters Alliance 2795; Säule: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm x 4mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A -> 2.5 min 30%A -> 3.0 min 5%A -> 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min 2 ml/min; Ofen: 500C; UV-Detektion: 210 nm.
Methode 3 (LC-MS) : Gerätetyp MS: Micromass ZQ; Gerätetyp HPLC: HP 1100 Series; UV DAD; Säule: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 90%A -> 2.5 min 30%A -> 3.0 min 5%A -^ 4.5 min 5%A; Fluss: 0.0 min 1 ml/min, 2.5 min/3.0 min/4.5 min. 2 ml/min; Ofen: 500C; UV-Detektion: 210 nm.
Methode 4 (LCMS): Instrument: Micromass Platform LCZ mit HPLC Agilent Serie 1100; Säule: Thermo Hypersil GOLD 3μ 20 mm x 4 mm; Eluent A: 1 1 Wasser + 0.5 ml 50%ige Ameisensäure, Eluent B: 1 1 Acetonitril + 0.5 ml 50%ige Ameisensäure; Gradient: 0.0 min 100%A -> 0.2 min 100%A -> 2.9 min 30%A -> 3.1 min 10%A -> 5.5 min 10%A; Fluss: 0.8 ml/min; Ofen: 500C; UV-Detektion: 210 nm.
Ausganqsverbindunqen
Beispiel IA
4- ( 3-Bromphenyl ) -3- [ ( £e.rt-butoxycarbonyl ) amino ] butansäure
Figure imgf000057_0001
Eine Lösung von 8.0 g (31.1 mmol) 3-Amino-4-( 3-bromphenyl)butansäure in 100 ml Wasser wird mit 62 ml IN Natronlauge versetzt. Unter Rühren wird eine Lösung von 20 g (93 mmol) Di- tert-butyldicarbonat in 100 ml Methanol bei RT hinzu gegeben und für 2 h gerührt. Durch Zugabe von 0. IN Salzsäure stellt man pH 3 ein und extrahiert zweimal mit Essigsäureethylester . Die organischen Phasen werden vereinigt, mit Magnesiumsulfat getrocknet und im Vakuum zur Trockne eingedampft. Der verbleibende Feststoff wird ohne weitere Reinigung verwendet.
Ausbeute: 7.0 g (56% d. Th.)
LC-MS (Methode 3): Rt = 2.55 min
MS (EI): m/z = 359 (M+H)+ Beispiel 2A
4- ( 3-Bromphenyl ) -3- [ ( £e.ri-butoxycarbonyl ) amino] butansäure- methylester
Figure imgf000058_0001
Zu einer auf O0C gekühlten Lösung von 7.1 g (17.4 mmol) 4- (3- Bromphenyl ) -3- [ ( £e.r£-butoxycarbonyl )amino]butansäure (Beispiel IA) in 100 ml Methanol werden 5.68 g (30 mmol) EDC und 0.71 g (5.23 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natrium- hydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird mit Acetonitril verrührt, abfiltriert und im Hochvakuum getrocknet.
Ausbeute: 4.0 g (60% d. Th.)
LC-MS (Methode 3): Rt = 2.70 min.
MS (EI): m/z = 373 (M+H)+. Beispiel 3A
4- (4 '-(Benzyloxy)-3 ' -{ (2S)-2-{ [ (benzyloxy)carbonyl]amino}-3- oxo-3-[2-(trimethylsilyl)ethoxy]propyl}biphenyl-3-yl)-3-[ ( tert- butoxycarbonyl ) amino]butansäuremethylester
Figure imgf000059_0001
Eine Lösung von 1.0 g (2.66 mmol) 4-(3-Bromphenyl)-3-[ ( tert- butoxycarbonyl) amino]butansäuremethylester (Beispiel 2A) und 2.51 g (3.0 mmol) 2-(Trimethylsilyl)ethyl-2-(benzyloxy)-_V- [ (benzyloxy ) carbonyl ]-5-(4,4,5, 5-tetramethyl-l , 3 , 2-dioxa- borolan-2-yl) -i-phenylalaninat (Beispiel 84A aus WO03/106480) in 13 ml l-Methyl-2-pyrrolidon und 1 ml Wasser wird inertisiert und mit Argon gesättigt. Anschließend gibt man 0.2 g (0.27 mmol) Bis(diphenylphosphino)ferrocen-palladium (IΙ)chlorid (PdCl2 (dppf ) ) und 1.7 g (5.3 mmol) Cäsiumcarbonat hinzu. Das Reaktionsgemisch wird mit Argon leicht überströmt und für 6 h bei 500C gerührt. Die Mischung wird abgekühlt, in Essigsäure- ethylester aufgenommen und mehrmals mit Wasser gewaschen. Die organische Phase wird über Magnesiumsulfat getrocknet und das Lösungsmittel wird im Vakuum eingeengt. Der Rückstand wird säulenchromatographisch an Kieselgel gereinigt (Cyclohexan: Essigsäureethylester 20:1^ 10:1).
Ausbeute: 1.84 g (83% d. Th.). LC-MS (Methode 3): Rt = 3.72 min
MS (EI): m/z = 797 (M+H)\
Beispiel 4A
3-Amino-4- ( 4 ' - (benzyloxy) -3 ' -{ ( 25) -2-{ [ (benzyloxy)carbonyl ]- amino}-3-oxo-3-[2-(trimethylsilyl)ethoxy]propyl}biphenyl-3- yl)butansäuremethylester - Hydrochlorid
Figure imgf000060_0001
Zu einer auf 00C gekühlten Lösung von 1.84 g (2.22 mmol) der Verbindung aus Beispiel 3A in 20 ml wasserfreiem Dioxan werden 20 ml einer 4M Chlorwasserstoff-Dioxan-Lösung zugetropft. Nach 3 h Rühren bei Raumtemperatur wird das Lösungsmittel im Vakuum eingedampft, mehrmals mit Dichlormethan coevaporiert und im Hochvakuum bis zur Gewichtskonstanz getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: quant.
LC-MS (Methode 3): Rt = 2.38 min.
MS (EI): m/z = 733 (M-HC1+H)+. Beispiel 5A
4-(4'-(Benzyloxy)-3 ' -{(2S)-2-{[ (benzyloxy)carbonyl]amino}-3- oxo-3- [ 2- (trimethylsily1 )ethoxy]propy1}bipheny1-3-y1) -3- ( { ( 25) ■ 5-{[ (benzyloxy)carbonyl]amino}-2-[ ( tejrt-butoxycarbonyl )amino]- pentanoyl}amino)butansäuremethylester
Figure imgf000061_0001
Zu einer Lösung von 1.63 g (2.22 mmol) der Verbindung aus Beispiel 4A und 0.90 g (2.44 mmol) Ns -[ (Benzyloxy)carbonyl]-W2- ( tert-butoxycarbonyl) -Z-ornithin in 20 ml abs. DMF werden bei 00C (Badtemperatur) 0.93 g (2.44 mmol) HATU und 1.0 ml (6.2 mmol) Hünig-Base gegeben. Man rührt 30 min. bei dieser Temperatur, versetzt dann mit weiteren 0.3 ml (1.5 mmol) Hünig-Base und lässt die Temperatur auf RT ansteigen. Nach Reaktion über Nacht engt man alles im Vakuum zur Trockne ein und der Rückstand wird in Dichlormethan aufgenommen. Die organische Phase wird mit Wasser und gesättigter Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und eingeengt. Das Rohprodukt wird chromatographisch an Silicagel gereinigt (Laufmittel: Dichlormethan / Essigsäureethylester 20:1 -> 5:1). Ausbeute: 1.80 g (78% d. Th.)
LC-MS (Methode 1): Rt = 3.42 min.
MS (EI): m/z = 1045 (M+H)+
Beispiel 6A
( 2S) -3- [ 4- (Benzyloxy) -3 ' - ( 2-{ [ ( 25") -5-{ [ (benzyloxy)carbonyl ]- amino}-2- (carboxyamino)pentanoy1]amino}-4-methoxy-4-oxobuty1 )■ biphenyl-3-yl]-2-{ [ (benzyloxy)carbonyl]amino}propansäure
Figure imgf000062_0001
Zu einer Lösung von 1.80 g (1.72 mmol) der Verbindung aus Beispiel 5A in 30 ml absolutem DMF werden tropfenweise 3.44 ml IN Tetra-n-butylammoniumfluorid-Lösung in THF hinzugegeben. Nach 1 h bei RT wird auf 00C abgekühlt und mit Eiswasser und wenigen Tropfen IN Salzsäure versetzt. Es wird sofort mit Essigsäure- ethylester extrahiert. Die organische Phase wird über Magnesiumsulfat getrocknet, im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt. Ausbeute: quant.
LC-MS (Methode 3): Rt = 3.06 min.
MS (EI): m/z = 945 (M+H)+.
Beispiel 7A
4-{4 ' -(Benzyloxy)-3 ' -[ (2S)-2-{ [ (benzyloxy)carbonyl]amino}-3- oxo-3-(pentafluorphenoxy)propyl]biphenyl-3-yl}-3-( { ( 2S)-5- { [ (benzyloxy)carbonyl]amino}-2-[ ( £ert-butoxycarbonyl)amino]- pentanoyl}amino)butansäuremethylester
Figure imgf000063_0001
Eine Lösung aus 1.63 g (1.72 mmol) der Verbindung aus Beispiel 6A in 55 ml abs. Dichlormethan wird auf —25°C abgekühlt und unter Rühren mit 0.95 g (5.2 mmol) Pentafluorphenyl, 0.021 g (0.17 mmol) DMAP und 0.43 g (2.24 mmol) EDC versetzt. Man lässt die Temperatur langsam auf RT ansteigen und rührt über Nacht nach. Es wird im Vakuum eingeengt und das Rohprodukt im Hochvakuum bis zur Gewichtskonstanz getrocknet. Ausbeute: quant.
LC-MS (Methode 2): R,. = 3.24 min.
MS (EI): m/z = 1111 (M+H)+
Beispiel 8A
3-[ ( (2S)-2-Amino-5-{ [ (benzyloxy)carbonyl]amino}pentanoyl)- amino]-4-{4 ' -(benzyloxy)-3 ' -[ (2S)-2-{ [ (benzyloxy)carbonyl]- amino}-3-oxo-3-(pentafluorphenoxy)propyl]biphenyl-3-yl}butan- säuremethylester - Hydrochlorid
Figure imgf000064_0001
Eine Lösung aus 1.91 g (1.72 mmol) der Verbindung aus Beispiel 7A in 10 ml Dioxan wird unter Rühren bei 00C mit 26 ml einer 4N Chlorwasserstoff-Dioxan-Lösung versetzt. Man rührt 45 min bei 00C, lässt die Temperatur auf RT ansteigen, und engt dann alles im Vakuum zur Trockne ein. Nach Trocknen im Hochvakuum bis zur Gewichtskonstanz erhält man das Produkt. Ausbeute: quant.
LC-MS (Methode 2): Rt = 2.32 min.
MS (EI): m/z = 1011 (M-HC1+H)"1"
Beispiel 9A
[ (85, 115", 145")-17-(Benzyloxy)-14-{[ (benzyloxy)carbonyl]amino}- ll-(3-{ [ (benzyloxy)carbonyl]amino}propyl)-10,13-dioxo-9,12-di- azatricyclo[ 14.3.1.12'6 ]henicosa-l (20), 2(21), 3,5 , 16 , 18-hexaen-8- yl] essigsäuremethylester
Figure imgf000065_0001
Eine Lösung von 1.8 g (1.72 mmol) der Verbindung aus Beispiel 8A in 600 ml abs . Dichlormethan wird unter kräftigem Rühren tropfenweise in 20 min mit einer Lösung von 4.8 ml (34.4 mmol) Triethylamin in 200 ml Dichlormethan versetzt. Man lässt über Nacht weiterrühren und dampft alles im Vakuum ein (Badtemperatur < 4O0C). Der Rückstand wird mit Acetonitril verrührt und der zurückbleibende Feststoff wird abfiltriert und im Hochvakuum bis zur Gewichtskonstanz getrocknet. Ausbeute: 0.71 g (49% d. Th.)
LC-MS (Methode 2): Rt = 3.02 min.
MS (EI) : m/z = 827 (M+H)+
Beispiel IQA
[ ( 8S, 115", 14S)-14-Amino-11-( 3-aminopropy1 )-17-hydroxy-10,13-dioxo- 9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 (20), 2(21), 3, 5, 16, 18-hexa- en-8-yl]essigsäuremethylester - Dihydroacetat
Figure imgf000066_0001
Es werden 0.69 g (0.834 mmol) der Verbindung aus Beispiel 9A in ein Gemisch aus 50 ml Essigsäure/Wasser/Ethanol (4:1:1) gegeben. Dazu gibt man 70 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 24 h bei RT und Normaldruck. Das Reaktionsgemisch wird über vorgewaschenem Kieselgur filtriert, mit Ethanol gewaschen und das Filtrat im Vakuum einrotiert. Der Rückstand wird im Hochvakuum bis zur Gesichtskonstanz getrocknet.
Ausbeute : quant . LC-MS (Methode 4): Rt = 2.30 min.
MS (EI) : m/z = 469 (M-2HOAc+H)+.
1H-NMR (400 MHz, D2O): δ = 1.5-1.9 (m, 4H), 2.61 (IU0, IH), 2.78 (m,,, IH), 2.85-3.2 (m, 4H), 3.56 (Inn, IH), 3.64 (s, 3H), 4.38- 4.5 (m, 2H), 4.57 (ITi0, IH), 6.93 (d, IH), 6.98 (s, IH), 7.10 (d, IH), 7.27 (s, IH), 7.31 (t, IH), 7.36-7.46 (m, 2H) .
Beispiel IIA
[ (85, 115, 145)-14-[ ( £e_r£-Butoxycarbonyl)amino]-ll-{3-[ ( tert- butoxycarbonyl)amino]propyl}-17-hydroxy-10, 13-dioxo-9 , 12-di- azatricyclo[14.3.1. I2'6 ] henicosa-1 (20), 2(21), 3, 5, 16, 18-hexaen-8- yl]essigsäure
Figure imgf000067_0001
Eine Lösung von 0.58 g (0.99 mmol) der Verbindung aus Beispiel 10A in 10 ml Wasser wird mit 5 ml IN Natronlauge versetzt. Unter Rühren wird eine Lösung von 0.65 g (2.96 mmol) Di- tert- butyldicarbonat in 3.7 ml Methanol bei RT hinzu gegeben und für 2 h gerührt. Der Ansatz wird auf 25 ml Wasser gegeben, mit 0.1N Salzsäure stellt man pH 3 ein und schüttelt dreimal mit Essig- säureethylester aus. Die organischen Phasen werden vereinigt, mit Magnesiumsulfat getrocknet und im Vakuum zur Trockne eingedampft. Der verbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz gereinigt.
Ausbeute: 0.46 g (71% d. Th.)
LC-MS (Methode 1): Rt = 2.15 min.
MS (EI): m/z = 655 (M+H)+
Beispiel 12A
Benzyl-{ ( l_S)-4-[ ( £e_rt-butoxycarbonyl)amino]-l-[ ( {2-[ ( tert- butoxycarbonyl ) amino] ethyl}amino)carbonyl ]butyl}carbamat
Figure imgf000068_0001
Unter Argon werden 300 mg (0.82 mmol) N2-[ (Benzyloxy)carbonyl ]- N5-( tert-butoxycarbonyl) -ü-ornithin und 171 mg (1.06 mmol) te_rt-Butyl-( 2-aminoethyl)carbamat in 6 ml Dimethylformamid gelöst. Bei 00C (Eisbad) werden dann 204 mg (1.06 mmol) EDC und 33 mg (0.25 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum getrocknet.
Ausbeute: 392 mg (94% d. Th.)
LC-MS (Methode 2): Rt = 2.36 min.
MS (ESI): m/z = 509 (M+H)+
Beispiel 13A
-V5-( £e_rt-Butoxycarbonyl)-_V-{2-[ ( tex*t-butoxycarbonyl)amino]- ethyl} -L-ornithinamid
Figure imgf000069_0001
Eine Lösung von 390 mg (0.77 mmol) Benzyl-{ ( IS) -4- [( tert- butoxycarbonyl)amino]-l-[ ( {2-[ ( te.r£-butoxycarbonyl)amino]ethyl}- amino)carbonyl]butyl}carbamat (Beispiel 12A) in 50 ml Ethanol wird nach Zugabe von 40 mg Palladium auf Aktivkohle (10%ig) 4 h bei RT und Normaldruck hydriert. Es wird über Kieselgur filtriert und der Rückstand mit Ethanol gewaschen. Das Filtrat wird im Vakuum zur Trockne eingeengt. Das Produkt wird ohne weitere Reinigung umgesetzt.
Ausbeute: 263 mg (91% d. Th.)
MS (ESI): m/z = 375 (M+H)+; 397 (M+Na)+.
Beispiel 14A
Benzyl- tejrt-butyl[ ( 2S) -3-( { ( 2S) -2 , 5-bis [ ( tert-butoxycarbonyl ) - amino]penty1}amino) -3-oxopropan-1 , 2-diy1 ]biscarbamat
Figure imgf000070_0001
Unter Argon werden 0.127 g (0.37 mmol) N- [ (Benzyloxy)carbonyl]- 3-[ ( tez*£-butoxycarbonyl) -amino ]--£-alanin und 0.193 g (0.49 mmol) tert-Butyl-{ ( 4S)-5-amino-4-[ ( tert-butoxycarbonyl) amino]- pentyl}carbamat (Beispiel 140A aus WO 05/033129) in 6 ml DirnethyIformamid gelöst. Bei 00C (Eisbad) werden dann 0.093 g (0.49 mmol) EDC und 0.015 g (0.11 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäure- ethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbonat- und Natriumchlorid- Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird per präparativer HPLC (Kromasil, Laufmittel Acetonitril/ 0.25% wässrige Trifluo- ressigsäure 5:95 -> 95:5) gereinigt.
Ausbeute: 0.126 g, (53% d. Th.)
LC-MS (Methode 1): Rt = 2.65 min.
MS (ESI): m/z = 638 (M+H)+
Beispiel 15A
£ert-Butyl-[ (25)-2-amino-3-( { (2S")-2,5-bis[ ( tez*t-butoxy- carbony1) amino]penty1}amino) -3-oxopropyl ]carbamat
Figure imgf000071_0001
Zu einer Mischung aus 0.122 g (0.19 mmol) der Verbindung aus Beispiel 14A in 50 ml Ethanol gibt man 20 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 4 h bei Normaldruck. Das Reaktionsgemisch wird über Kieselgur filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: quant.
MS (ESI): m/z = 504 (M+H)+ Beispiel 16A
Benzyl- { ( 4_?) -6- ( { ( 25) -2 , 5-bis [ ( fcert-butoxycarbonyl ) amino ] - pentyl}amino ) -4- [ ( tert-butoxycarbonyl ) amino ] -6-oxohexyl}- carbamat
Figure imgf000072_0001
Unter Argon werden 0.1 g (0.263 mmol) ( 3S)-6-{ [ (Benzyloxy)- carbonyl ] amino}-3- [ ( £e_rt-butoxycarbonyl ) amino] hexancarbonsäure (Bioorg. Med. Chem. Lett. 1998, 8, 1477-1482) und 0.108 g (0.342 mmol) tez*t-Butyl-{ (45) -5-amino-4-[ ( tert-butoxycarbonyl) - amino]pentyl}carbamat (Beispiel 140A aus WO 05/033129) in 6 ml Dimethylformamid gelöst. Bei 00C (Eisbad) werden dann 0.066 g (0.342 mmol) EDC und 0.011 g (0.079 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 0.127 g, (71% d. Th.)
LC-MS ( Methode 1 ) : Rt = 2 . 36 min . MS ( ESI ) : m/ z = 680 ( M+H ) "
Beispiel 17A
tert-Butyl-{ ( IS) -4-amino-l- [ 2- ( { ( 25) -2 , 5-bis [ ( tert-butoxy- carbony1 ) amino]penty1}amino) -2-oxoethy1]buty1}carbamat
Figure imgf000073_0001
Zu einer Mischung aus 0.127 g (0.19 mmol) der Verbindung aus Beispiel 16A in 10 ml Ethanol gibt man 20 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 12 h bei Normaldruck. Das Reaktionsgemisch wird über Kieselgur filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute : quant .
MS (ESI): m/z = 546 (M+H)+ Beispiel 18A
Benzyl-( ( IS, IS, 125) -7 , 12-bis[ ( £e.rt-butoxycarbonyl)amino]-l-{3- [ ( tert-butoxycarbonyl)amino]propyl}-19, 19-dimethyl-2, 9 , 17-tri- oxo-18-oxa-3, 10, 16-triazaicos-l-yl)carbamat
Figure imgf000074_0001
Unter Argon werden 44 mg (0.12 mmol) N2 -[ (Benzyloxy)carbonylJ- N5 -( te_r£-butoxycarbonyl) -L-ornithin und 85 mg (0.16 mmol) der Verbindung aus Beispiel 17A in 8 ml Dimethylformamid gelöst. Bei 00C (Eisbad) werden dann 30 mg (0.16 mmol) EDC und 4.9 mg (0.036 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natrium- hydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum getrocknet
Ausbeute: 91 mg (85% d. Th.)
LC-MS (Methode 1): Rt = 2.35 min. MS ( ESI ) : m/z = 894 ( M+H ) '
Beispiel 19A
tert-Butyl-{ (45, 105, 155)-4-amino-10, 15-bis[ ( tert-butoxycarbon- yl )amino] -22 , 22-dimethyl-5 , 12 , 20-trioxo-21-oxa-6 , 13 , 19-triaza- tricos-l-yl}carbamat
Figure imgf000075_0001
Eine Lösung von 91 mg (0.10 mmol) der Verbindung aus Beispiel 18A in 10 ml Ethanol wird nach Zugabe von 10 mg Palladium auf Aktivkohle (10%ig) 12 h bei RT und Normaldruck hydriert. Es wird über Kieselgur filtriert und der Rückstand mit Ethanol gewaschen. Das Filtrat wird im Vakuum zur Trockne eingeengt. Das Produkt wird ohne weitere Reinigung umgesetzt.
Ausbeute: quant.
MS (ESI): m/z = 760 (M+H)+. Beispiel 2OA
Benzyl- { ( 15") -l - [ 2- ( { ( 2S) -2 , 5-bis [ ( £e.r£-butoxycarbonyl ) ainino ] - pentyl}amino ) -2-oxoethyl ] -4- [ ( £ert-butoxycarbonyl ) amino ] butyl}- carbamat
Figure imgf000076_0001
Unter Argon werden 0.1 g (0.26 mmol) ( 3_7)-3-{ [ (Benzyloxy)- carbonyl]amino}-6- [ ( £e.r£-butoxycarbonyl)amino]hexancarbonsäure (J. Med. Chem. 2002, 45, 4246-4253) und 0.11 g (0.34 mmol) tert-Butyl-{ (45) -5-amino-4-[ ( tez*t-butoxycarbonyl)amino]pentyl}- carbamat (Beispiel 140A aus WO 05/033129) in 6 ml Dirnethylform- amid gelöst. Bei 00C (Eisbad) werden dann 0.065 g (0.34 mmol) EDC und 0.011 g (0.079 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethyles- ter aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet .
Ausbeute: 0.146 g, (82% d. Th.) LC-MS (Methode 2): Rt = 2.5 min.
MS (ESI): m/z = 680 (M+H)+
Beispiel 2IA
£ert-Butyl-[ ( 4S) -4-amino-6- ( { ( 2S) -2 , 5-bis[ ( tejrt-butoxycarb- onyl ) amino ]penty1}amino) -6-oxohexyl ]carbamat
Figure imgf000077_0001
Zu einer Mischung aus 0.146 g (0.22 mmol) der Verbindung aus Beispiel 20A in 10 ml Ethanol gibt man 22 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 12 h bei Normaldruck. Das Reaktionsgemisch wird über Kieselgur filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute : quant .
MS (ESI): m/z = 546 (M+H)+ Beispiel 22A
Benzyl-{(lS)-4-[ ( tert-butoxycarbonyl)amino]-l-[ ({(45)-4-[ ( tert- butoxycarbonyl)amino]-5-hydroxypentyl}amino)carbonyl]butyl}- carbamat
Figure imgf000078_0001
Unter Argon werden 0.155 g (0.42 mmol) N2 -[ (Benzyloxy)- carbonyl] -N5-( tert-butoxycarbonyl) -i-ornithin und 0.12 g (0.55 mmol) tert-Butyl-[ ( l_9)-4-amino-l-(hydroxymethyl)butyl]carbamat (Beispiel 172A aus WO 05/033129) in 6 ml Dimethylformamid gelöst. Bei O0C (Eisbad) werden dann 0.105 g (0.55 mmol) EDC und 0.017 g (0.13 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird per präparativer HPLC (Kromasil, Laufmittel Acetonitril/ 0.25% wässrige Trifluores- sigsäure 5:95 "^ 95:5) gereinigt.
Ausbeute: 0.164 g (69% d. Th.)
LC-MS (Methode 2): Rt = 2.05 min. MS (EI): m/z = 567 (M+H)+
Beispiel 23A
N5 -( te.r£-Butoxycarbonyl)-iV-{ (4_?)-4-[ ( te^-t-butoxycarbonyl) amino]-5-hydroxypentyl} -i-ornithinamid
Figure imgf000079_0001
Zu einer Mischung aus 0.164 g (0.29 mmol) der Verbindung aus Beispiel 22A in 10 ml Ethanol gibt man 30 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 12 h bei Normaldruck. Das Reaktionsgemisch wird über Kieselgur filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: 0.125 g (quant.)
MS (EI): m/z = 433 (M+H)+
Beispiel 24A
Benzyl-{ ( lS)-4-{ [ (benzyloxy)carbonyl]amino}-l-[ ( {3-[ ( tert-hut- oxycarbony1) amino] -2-hydroxypropy1}amino)carbony1]buty1}carb- amat
Figure imgf000080_0001
Unter Argon werden 0.20 g (0.50 mmol) N2 , N5 -Bis[ (benzyloxy)- carbonyl] -ii-ornithin und 0.124 g (0.65 mmol) tert-Butyl- ( 3- amino-2-hydroxypropyl)carbamat in 6 ml Dimethylformamid gelöst. Bei 00C (Eisbad) werden dann 0.124 g (0.65 mmol) EDC und 0.02 g (0.15 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natrium- hydrogencarbonat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 0.245 g (86% d. Th.)
LC-MS (Methode 2): Rt = 2.15 min.
MS (EI): m/z = 573 (M+H)+
Beispiel 25A
Benzyl-( ( 4£>)-5-[ ( 3-amino-2-hydroxypropyl)amino]-4-{ [ (benzyl- oxy)carbonyl]amino}-5-oxopentyl)carbamat - Hydrochlorid
Figure imgf000081_0001
Eine Lösung von 0.263 g (0.46 mmol) der Verbindung aus Beispiel 24A in 1 ml Dioxan wird bei 00C mit 6.8 ml einer 4N Chlorwas- serstoff-Dioxan-Lösung versetzt. Nach 2 h bei RT wird die Reaktionslösung im Vakuum eingeengt und mehrmals mit Dichlormethan coevaporiert . Der zurückbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 0.205 g (88% d. Th.)
LC-MS (Methode 2): Rt = 1.47 min.
MS (EI): m/z = 473 (M-HC1+H)+
Beispiel 26A
Benzyl-[ 3-({(25)-2, 5-bis[ ( te.rt-butoxycarbonyl)amino]pentyl}- amino) -3-oxopropyl ] carbamat
Figure imgf000081_0002
Unter Argon werden 0.10 g (0.45 mmol) N-[ (Benzyloxy)carbonyl]- beta-alanin und 0.185 g (0.58 mmol) tert-Butyl-{ ( 4S) -5-amino-4- [ ( tert-butoxycarbonyl)amino]pentyl}carbamat (Beispiel 140A aus WO 05/033129) in 6 ml Dimethylformamid gelöst. Bei 00C (Eisbad) werden dann 0.112 g (0.58 mmol) EDC und 0.018 g (0.134 mmol) HOBt zugegeben. Es wird langsam auf RT erwärmt und für 12 h bei RT gerührt. Die Lösung wird im Vakuum eingeengt und der Rückstand wird mit Essigsäureethylester aufgenommen. Die organische Phase wird nacheinander mit gesättigter Natriumhydrogencarbo- nat- und Natriumchlorid-Lösung gewaschen, über Magnesiumsulfat getrocknet und im Vakuum eingedampft. Der verbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 0.215 g (92% d. Th.)
LC-MS (Methode 2): Rt = 2.19 min.
MS (EI) : m/z = 523 (M+H)+
Beispiel 27A
tex"t-Butyl-{ (4_?)-5-[ ( 3-aminopropanoyl)amino]-4-[ ( tert-butoxy- carbonyl ) amino]penty1}carbamat
Figure imgf000082_0001
Zu einer Mischung aus 0.215 g (0.41 mmol) der Verbindung aus Beispiel 26A in 10 ml Ethanol gibt man 40 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 12 h bei Normaldruck. Das Reaktionsgemisch wird über Kieselgur filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: 0.160 g (quant.)
MS (EI) : m/z = 389 (M+H)+
Beispiel 28A
tert-Butyl- [ (45")-6-( { ( 2S) -2, 5-bis[ ( te.rt-butoxycarbonyl)amino]- pentyl}amino)-4-( {[ (BS, HS, 145) -14-[ ( te.rt-butoxycarbonyl)amino]- ll-{3-[ ( tert-butoxycarbonyl)amino]propyl}-17-hydroxy-10, 13-dioxo- 9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 (20), 2(21), 3, 5, 16, 18- hexaen-8-yl]acetyl}amino)-6-oxohexyl]carbamat
Figure imgf000083_0001
Es werden 30 mg (0.046 mmol) [ ( 85, 115, 145)-14-[ ( iert-Butoxy- carbony1 ) amino ] -11-{3- [ ( tert-butoxycarbony1 ) amino ] propy1}-17- hydroxy-10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1(20) ,2(21) ,3,5,16, 18-hexaen-8-yl]essigsäure (Beispiel IIA) und 32.5 mg (0.06 mmol) der Verbindung aus Beispiel 2IA in 2.0 ml DMF gelöst und auf 00C gekühlt. Man versetzt mit 11.4 mg (0.06 mmol) EDC und 1.9 mg (0.014 mmol) HOBt und rührt 12 h bei Raumtemperatur. Das Reaktionsgemisch wird im Vakuum einrotiert und chromatographisch über Sephadex-LH20 (Laufmittel: Methanol / Essigsäure 0.25%) gereinigt.
Ausbeute: 21 mg (38% d. Th.)
LC-MS (Methode 3): Rt = 2.79 min.
MS (ESI): m/z = 1182 (M+H)+
Beispiel 29A
tert-Butyl-{3- [ ( 85, 115, 145) -8- [ 2- ( { ( 25) -2 , 5-bis [ ( έert-butoxy- carbonyl)amino]pentyl}amino)-2-oxoethyl]-14-[ ( £e.rt-butoxy- carbonyl) amino ]-17-hydroxy-10 , 13-dioxo-9, 12-diazatricyclo- [14.3.1.12'6 ] henicosa-1 ( 20 ) , 2 ( 21 ) , 3 , 5 , 16 , 18-hexaen-l1-yl ] - propyl}carbamat
Figure imgf000085_0001
Es werden 30 mg (0.046 mmol) [ (8S1IlS, 14S)-14-[ (tert-Butoxy- carbony1 ) amino ] -11-{3- [ ( tert-butoxycarbony1 ) amino] propy1}-17- hydroxy-10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1(20) ,2(21) ,3, 5,16, 18-hexaen-8-yl]essigsäure (Beispiel IIA) und 18.9 mg (0.06 mmol) tert-Butyl-{ (45")-5-amino-4-[ ( tert-butoxy- carbonyl) amino]pentyl}carbamat (Beispiel 140A aus WO 05/033129) in 2.0 ml DMF gelöst und auf 00C gekühlt. Man versetzt mit 11.4 mg (0.06 mmol) EDC und 1.9 mg (0.014 mmol) HOBt und rührt 12 h bei Raumtemperatur. Das Reaktionsgemisch wird im Vakuum einrotiert und chromatographisch über Sephadex-LH20 (Laufmittel: Methanol / Essigsäure 0.25%) gereinigt.
Ausbeute: 21 mg (48% d. Th.)
LC-MS (Methode 1): Rt = 2.63 min.
MS (ESI): m/z = 954 (M+H)+ Beispiel 3OA
Benzyl-[(lS1)-4-{[(benzyloxy)carbonyl]amino}-l-({[3-({[(85,115, 145). 14-[ ( £er£-butoxycarbonyl)amino]-ll-{3-[ ( terfc-butoxycarbonyl ) ami- no]propyl}-17-hydroxy-10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]- henicosa-1 (20), 2(21), 3, 5, 16, 18-hexaen-8-yl ] acetyl}amino) -2-hy- droxypropyl ] amino}carbonyl ) butyl ] carbamat
Figure imgf000086_0001
Es werden 35 mg (0.053 mmol) [ ( 85, 115, 14.9) -14-[ ( £e.r£-Butoxy- carbonyl ) amino] -ll-{ 3- [ ( tert-butoxycarbonyl ) amino ]propyl}-17- hydroxy-10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1(20) ,2(21) ,3, 5,16, 18-hexaen-8-yl]essigsäure (Beispiel IIA) und 35.4 mg (0.069 mmol) der Verbindung aus Beispiel 25A in 2.0 ml DMF gelöst und auf 00C gekühlt. Man versetzt mit 30.6 mg (0.06 mmol) PyBOP und 0.03 ml Diisopropylethylamin und rührt 12 h bei Raumtemperatur. Das Reaktionsgemisch wird im Vakuum einrotiert, der Rückstand wird mit Acetonitril/Wasser (1:1) verrührt, abfiltriert und im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 16 mg (27% d. Th.) LC-MS (Methode 3): Rt = 2.58 min.
MS (ESI): m/z = 1109 (M+H)+
Beispiel 3 IA
tejrt-Butyl-{3-[ ( 8S1 IIS, 14S)-14-[ ( tert- butoxycarbonyl)amino] -17- hydroxy-8- ( 2-{ [ 2-hydroxy-3- (L-ornithylamino )propyl ] amino}- 2-oxoethyl ) -10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6 Jhenicosa- 1(20), 2(21), 3,5, 16, 18-hexaen-l 1-yl ] propyl}carbamat
Figure imgf000087_0001
Zu einer Mischung aus 15.8 mg (0.014 mmol) der Verbindung aus Beispiel 3OA in 5 ml Ethanol gibt man 5 mg Palladium auf Aktivkohle (10%ig) und hydriert anschließend 12 h bei Normaldruck. Das Reaktionsgemisch wird über einen Milliporefilter filtriert, das Filtrat im Vakuum eingeengt und im Hochvakuum getrocknet. Das Rohprodukt wird ohne weitere Reinigung umgesetzt.
Ausbeute: 11.8 mg (99% d. Th.)
LC-MS (Methode 2) : Rt = 1.21 min, MS (ESI): m/z = 841 (M+H)+
Beispiel 32A
ter£-Butyl-[ (45,105, 155) -10, 15-bis[ ( £er£-butoxycarbonyl)amino]- 4-({[ (85, 115, 145) -14- [ ( tert-butoxycarbonyl) amino]-ll-{3-[ ( tert- butoxycarbony1 )amino]propy1}-17-hydroxy-10,13-dioxo-9,12-di- azatricyclo[14.3.1.12'6] henicosa-1 (20), 2(21), 3, 5, 16, 18-hexaen-8- yl ] acetyl}amino ) -22 , 22-dimethyl-5 , 12 , 20-trioxo-21-oxa-6 ,13,19- triazatricos-1-yl ] carbamat
Figure imgf000088_0001
Es werden 27.3 mg (0.042 mmol) [ ( 85, 115, 145) -14- [ ( iert-Butoxy- carbonyl ) amino]-ll-{3-[ ( tert-butoxycarbonyl ) amino]propyl}-17- hydroxy-10, 13-dioxo-9, 12-diazatricyclo[ 14.3.1.12'6]henicosa- 1(20) ,2(21) ,3, 5,16, 18-hexaen-8-yl]essigsäure (Beispiel IIA) und 38 mg (0.05 mmol) der Verbindung aus Beispiel 19A in 2.0 ml DMF gelöst und auf 00C gekühlt. Man versetzt mit 10.4 mg (0.054 mmol) EDC und 1.7 mg (0.013 mmol) HOBt und rührt 12 h bei Raumtemperatur. Das Reaktionsgemisch wird im Vakuum einrotiert und chromatographisch über Sephadex-LH20 (Laufmittel: Methanol / Essigsäure 0.25%) gereinigt. Ausbeute: 19.2 mg (33% d. Th.)
LC-MS (Methode 3): Rt = 2.87 min.
MS (ESI): m/z = 1396 (M+H)+
Analog zur Vorschrift des Beispiels 28A werden die in der folgenden Tabelle aufgeführten Beispiele 33A bis 37A hergestellt.
Figure imgf000089_0001
Figure imgf000090_0001
Au s f ührung sbeispiele
Beispiel 1
(3S)-6-Amino-3-( { [ ( 8S, 115", 14-?)-14-amino-ll-( 3-aminopropyl)-17- hydroxy-10, 13-dioxo-9, 12-diazatricyclo[ 14.3.1.12'6] henicosa- l(20),2(21),3,5, 16 , 18-hexaen-8-yl ] acetyl}amino ) -N- [(2S) -2 ,5- diaminopentyl ] hexanamid - Pentahydrochlorid
Figure imgf000091_0001
Eine Lösung von 20.7 mg (0.018 mmol) der Verbindung aus Beispiel 28A in 1 ml Dioxan wird bei 00C mit 2 ml einer 4N Chlorwasserstoff-Dioxan-Lösung versetzt. Nach 2 h bei RT wird die Reaktionslösung im Vakuum eingeengt und mehrmals mit Dichlor- methan coevaporiert . Der zurückbleibende Feststoff wird im Hochvakuum bis zur Gewichtskonstanz getrocknet.
Ausbeute: 14 mg (93% d. Th.)
MS (ESI): m/z = 682 (M-5HC1+H)+. 1H-NMR (400 MHz, D2O): δ = 1.45-1.95 (m, 12H), 2.3-2.6 (m, 3H),
2.75 (ItI0, IH), 2.9-3.2 (m, HH), 3.3-3.7 (m, 3H), 4.13 (ItI0, IH),
4.32 (ItI0, IH), 4.47 (mc, IH), 6.9-7.0 (m, 2H), 7.09 (d, IH), 7.28 (s, IH), 7.33 (t, IH), 7.4-7.5 (in, 2H).
Analog zur Vorschrift des Beispiels 1 werden die im folgenden aufgeführten Beispiele 2 bis 9 aus den entsprechenden Edukten hergestellt.
Beispiel 2
-V2-{[ (85", 115, 145)-14-Amino-ll-(3-aminopropyl)-17-hydroxy-10,13- dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 ( 20), 2(21), 3, 5, 16,18- hexaen-8-yl]acetyl}-iΫ-(2-aminoethyl)-.&-ornithinainid - Tetrahy- drochlorid
Figure imgf000092_0001
Hergestellt aus Beispiel 33A; Ausbeute: 93% d. Th.
LC-MS (Methode 3): Rt = 0.56 min.
MS (ESI): m/z = 611 (M-4HC1+H)+. 1H-NMR (400 MHz, D2O): δ = 1.55-1.95 (m, 8H), 2.48 (mo, IH), 2.7-2.85 (m, 2H), 2.87-3.2 (m, 7H), 3.35-3.8 (m, 4H), 4.17 (mc, IH), 4.40 (mo, IH), 4.48 (mc, IH), 4.58 (mc, IH), 6.9-7.0 (m, 2H), 7.09 (d, IH), 7.28 (s, IH), 7.33 (t, IH), 7.4-7.5 (m, 2H).
Beispiel 3
2-[ (8S,llS,14S)-14-Amino-ll-(3-aminopropyl)-17-hydroxy-10,13- dioxo-9 , 12-diazatricyclo [ 14.3.1. I2'6 ] henicosa-1 (20), 2(21), 3, 5, 16, 18- hexaen-8-yl]-W-(2-aminoethyl)acetamid - Trihydrochlorid
Figure imgf000093_0001
Hergestellt aus Beispiel 34A; Ausbeute: 81% d. Th,
LC-MS (Methode 4): R1. = 1.74 min.
MS (ESI): m/z = 497 (M-3HCl+H)+.
1H-NMR (400 MHz, D2O): δ = 1.6-1.9 (m, 4H), 2.45 (mc, IH), 2.67
(mo, IH), 2.7-3.2 (m, 7H), 3.34-3.62 (m, 3H), 4.38-4.50 (m,
2H), 4.57 (mc, IH), 6.93 (d, IH), 6.97 (s, IH), 7.10 (d, IH), 7.28 (S, IH), 7.32 (t, IH), 7.37-7.46 (m, 2H). Beispiel 4
_V2-{[ (85, 115, 145) -14-Amino-ll-(3-aminopropyl)-17-hydroxy-l 0,13- dioxo-9 , 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 ( 20 ) , 2 ( 21 ) , 3 , 5 , 16 , 18- hexaen-8-yl]acetyl}--V-[ (55)-5-amino-6-hydroxyhexyl]-ü-ornithin- amid - Tetrahydrochlorid
Figure imgf000094_0001
Hergestellt aus Beispiel 35A; Ausbeute: 97% d. Th.
LC-MS (Methode 2): Rt = 0.32 min.
MS (ESI): m/z = 682 (M-4HC1+H)+.
1H-NMR (400 MHz, D2O) : δ = 1.25-1.95 (m, 14H), 2.48 (m,., IH), 2.62-2.83 (m, 2H), 2.85-3.30 (m, 8H), 3.45-3.8 (m, 4H), 4.12 (In0, IH), 4.40 (ITin, IH), 4.48 (Inn, IH), 4.58 (Ta0, IH), 6.93 (d, IH), 6.98 (s, IH), 7.10 (d, IH), 7.29 (s, IH), 7.33 (t, IH), 7.4-7.5 (m, 2H). Beispiel 5
2-[ (85, 115, 145)-14-Amino-ll-( 3-aminopropyl)-17-hydroxy-10 , 13- dioxo-9, 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 ( 20 ) , 2 ( 21 ) , 3 , 5 , 16 , 18- hexaen-8-yl]--V-[ (25)-2, 5-diaminopentyl]acetamid - Tetrahydro- chlorid
Figure imgf000095_0001
Hergestellt aus Beispiel 29A; Ausbeute: 97% d. Th.
MS (ESI): m/z = 554 (M-4HC1+H)+.
1H-NMR (400 MHz, D2O): δ = 1.55-1.9 (m, 8H), 2.48 (In0, IH), 2.67 (In0, IH), 2.8-3.2 (m, 7H), 3.3-3.7 (m, 4H), 4.38-4.50 (m, 2H), 4.58 (In0, IH), 6.9-7.0 (m, 2H), 6.95 (m,., IH), 7.25-7.50 (m 4H).
Beispiel 6
3-Amino-#2-{[ ( 85, 115, 145)-14-amino-ll- ( 3-aminopropyl)-17- hydroxy-10 , 13-dioxo-9 , 12-diazatricyclo[ 14.3.1. I2'6]henicosa- 1(20), 2(21), 3, 5, 16, 18-hexaen-8-yl ] acetyl}--V- ( 2 , 5-diamino- pentyl)-£-alaninamid - Tetrahydrochlorid
Figure imgf000096_0001
Hergestellt aus Beispiel 36A; Ausbeute: 99% d. Th.
MS (ESI): m/z = 640 (M-5HC1+H)+.
1H-NMR (400 MHz, D2O): δ = 1.5-1.9 (m, 8H), 2.53 (In0, IH), 2.68- 2.85 (m, 2H), 2.9-3.1 (m, 7H), 3.23 (mc, IH), 3.33-3.63 (m, 4H), 4.48 (m, 2H), 4.55-4.75 (m, 2H, unter D2O), 6.91-7.0 (m, 2H), 7.10 (d, IH), 7.29 (s, IH), 7.34 (t, IH), 7.4-7.5 (m, 2H).
Beispiel 7
(35)-3-Amino-6-[ (N2-{[ ( 8S, HS, 14S)-14-amino-ll-( 3-aminopropyl)- 17-hydroxy-10, 13-dioxo-9, 12-diazatricyclo[ 14.3.1. I2'6]henicosa- 1(20), 2(21), 3, 5, 16, 18-hexaen-8-yl ] acetyl}-ü-ornithyl ) amino] -N- [ (25") -2 , 5-diaminopentyl]hexanamid - Hexahydrochlorid
Figure imgf000097_0001
Hergestellt aus Beispiel 32A; Ausbeute: 99% d. Th.
LC-MS (Methode 3): Rt = 0.23 min.
MS (ESI): m/z = 796 (M-6HC1+H)+.
1H-NMR (400 MHz, D2O): δ = 1.45-1.95 (m, 16H), 2.45-2.6 (m, 2H), 2.62-2.85 (m, 3H), 2.9-3.7 (m, 15H), 4.12 (m,., IH), 4.40 (In0, IH), 4.48 (It^, IH), 4.58 (m,., IH), 6.91-7.0 (d, IH), 7.09 (s, IH), 7.27 (d, IH), 7.27 (s, IH), 7.32 (t, IH), 7.38-7.46 (m, 2H) .
Beispiel 8
N3-{[ (8Sr 115, 145")-14-Amino-ll-(3-aminopropyl)-17-hydroxy-10,13- dioxo-9, 12-diazatricyclo[ 14.3.1.12'6]henicosa-1 (20), 2(21), 3,5, 16,18- hexaen-8-yl] acetyl}-ΛT- [ ( 2S) -2 , 5-diaminopentyl ] -beta-alaninamid - Tetrahydrochlorid
Figure imgf000098_0001
Hergestellt aus Beispiel 37A; Ausbeute: 99% d. Th.
LC-MS (Methode 3): Rt = 0.26 min.
MS (ESI): m/z = 625 (M-4HCl+H)+.
1H-NMR (400 MHz, D2O): δ = 1.55-1.9 (m, 8H), 2.38-2.5 (m, 3H),
2.58 (In0, IH), 2.7-3.2 (m, 8H), 3.21-3.6 (m, 5H), 4.36 (In0, IH),
4.48 (ItI0, IH), 4.58 (Hi0, IH), 6.94 (d, IH), 6.99 (s, IH), 7.10 (d, IH), 7.28 (s, IH), 7.32 (t, IH), 7.37-7.47 (m, 2H).
Beispiel 9
N-[3-( { [ ( 85, HS, 14_?)-14-Amino-ll-( 3-aminopropyl)-17-hydroxy-10, 13- dioxo-9, 12-diazatricyclo[14.3.1.12'6]henicosa-l (20), 2(21), 3, 5, 16, 18- hexaen-8-yl]acetyl}amino)-2-hydroxypropyl]-i-ornithinamid - Tetra- hydrochlorid
Figure imgf000099_0001
Hergestellt aus Beispiel 31A; Ausbeute: 73% d. Th.
LC-MS (Methode 2): R1. = 0.28 min.
MS (ESI): m/z = 641 (M-4HC1+H)+.
1H-NMR (400 MHz, D2O): δ = 1.58-1.95 (i, 8H), 2.48 (mo, IH), 2.64 (mc, IH), 2.77 (mo, IH), 2.85-3.4 (m, 9H), 3.57 (mc, IH), 3.64-3.85 (m, 2H), 3.96 (mc, IH), 4.35-4.51 (m, 2H), 4.58 (mo, IH), 6.94 (d, IH), 6.99 (s, IH), 7.10 (d, IH), 7.28 (s, IH), 7.32 (t, IH), 7.38-7.46 (m, 2H).
B. Bewertung der physiologischen Wirksamkeit
Verwendete Abkürzungen:
AMP Adenosinmonophosphat
ATP Adenosintriphosphat
BHI Medium Brain heart infusion medium
CoA Coenzym A
DMSO Dimethylsulfoxid
DTT Dithiothreitol
EDTA Ethylendiamintetraessigsäure
KCl Kaliumchlorid
KH2PO4 Kaliumdihydrogenphosphat
MgSO4 Magnesiumsulfat
MHK Minimale Hemmkonzentration
MTP Mikrotiterplatte
NaCl Natriumchlorid
Na2HPO4 Dinatriumhydrogenphosphat
NH4Cl Ammoniumchlorid
NTP Nukleotidtriphosphat
PBS Phosphat Buffered Saline
PCR Polymerase Chain Reaction
PEG Polyethylenglykol
PEP Phosphoenolpyruvat
Tris Tris [hydroxymethy1 ] aminomethan Die in vitro-Wirkung der erfindungsgemäßen Verbindungen kann in folgenden Assays gezeigt werden:
In vitro Transkription-Translation mit E. coli Extrakten
Zur Herstellung eines S30-Extraktes werden logarithmisch wachsende Escherichia coli MRE 600 (M. Müller; University Freiburg) geerntet, gewaschen und wie beschrieben für den in vitro Transkriptions-Translations-Test eingesetzt (Müller, M. and Blobel, G. Proc Natl Acad Sei U S A (1984) 81, pp.7421-7425 ).
Dem Reaktionsmix des in vitro Transkriptions-Translations-Tests werden zusätzlich 1 μl cAMP (11.25 mg/ml) je 50 μl Reaktionsmix zugegeben. Der Testansatz beträgt 105 μl, wobei 5 μl der zu testenden Substanz in 5%igem DMSO vorgelegt werden. Als Transkriptionsmatrize werden 1 μg/lOOμl Ansatz des Plasmides pBESTLuc (Promega, Deutschland) verwendet. Nach Inkubation für 60 min bei 3O0C werden 50 μl Luziferinlösung (20 mM Tricine, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μM CoA, 470 μM Luziferin, 530 μM ATP) zugegeben und die entstehende Biolumineszenz für 1 Minute in einem Luminometer gemessen. Als IC50 wird die Konzentration eines Inhibitors angegeben, die zu einer 50%igen Inhibition der Translation von Firefly Luziferase führt.
In vitro Transkription-Translation mit S. aureus Extrakten
Konstruktion eines S. aureus Luziferase Reporterplasmids
Zur Konstruktion eines Reporterplasmids, welches in einem in vitro Transkriptions-Translations-Assay aus S. aureus verwendet werden kann, wird das Plasmid pBESTluc (Promega Corporation, USA) verwendet. Der in diesem Plasmid vor der Firefly Luzifera- se vorhandene E. coli tac Promoter wird gegen den capAl Promoter mit entsprechender Shine-Dalgarno Sequence aus S. aureus ausgetauscht. Dazu werden die Primer CAPFor 5 ' -CGGCC- AAGCTTACTCGGATCCAGAGTTTGCAAAATATACAGGGGATTATATATAATGGAAAACAAGAA AGGAAAATAGGAGGTTTATATGGAAGACGCCA-S ' und CAPRev 5'- GTCATCGTCGGGAAGACCTG-3 ' verwendet. Der Primer CAPFor enthält den capAl Promotor, die Ribosomenbindesteile und die 5 ' -Region des Luziferase Gens . Nach PCR unter Verwendung von pBESTluc als Template kann ein PCR-Produkt isoliert werden, welches das Firefly Luziferase Gen mit dem fusionierten capAl Promotor enthält. Dieses wird nach einer Restriktion mit CIaI und Hindl- II in den ebenfalls mit CIaI und Hindlll verdauten Vektor pBESTluc ligiert. Das entstandene Plasmid pla kann in E. coli repliziert werden und als Template im S. aureus in vitro Transkriptions-Translations-Test verwendet werden.
Herstellung von S30 Extrakten aus S. aureus
Sechs Liter BHI Medium werden mit einer 250 ml Übernachtkultur eines S. aureus Stammes inokuliert und bei 37°C bis zu einer ODβOOnm von 2-4 wachsen gelassen. Die Zellen werden durch Zentrifugation geerntet und in 500 ml kaltem Puffer A (10 mM Tris-acetat, pH 8.0, 14 mM Magnesiumacetat, 1 mM DTT, 1 M KCl) gewaschen. Nach erneutem Abzentrifugieren werden die Zellen in 250 ml kaltem Puffer A mit 50 mM KCl gewaschen und die erhaltenen Pellets bei —200C für 60 min eingefroren. Die Pellets werden in 30 bis 60 min auf Eis aufgetaut und bis zu einem Gesamtvolumen von 99 ml in Puffer B (10 mM Tris-acetat, pH 8.0, 20 mM Magnesiumacetat, 1 mM DTT, 50 mM KCl) aufgenommen. Je 1.5 ml Lysostaphin (0.8 mg/ml) in Puffer B werden in 3 vorgekühlte Zentrifugenbecher vorgelegt und mit je 33 ml der Zellsuspension vermischt. Die Proben werden für 45 bis 60 min bei 370C unter gelegentlichem Schütteln inkubiert, bevor 150 μl einer 0.5 M DTT Lösung zugesetzt werden. Die lysierten Zellen werden bei 30.000 x g 30 min bei 40C abzentrifugiert. Das Zellpellet wird nach Aufnahme in Puffer B unter den gleichen Bedingungen nochmals zentrifugiert und die gesammelten Überstände werden vereinigt. Die überstände werden nochmals unter gleichen Bedingungen zentrifugiert und zu den oberen 2/3 des Überstandes werden 0.25 Volumen Puffer C (670 mM Tris-acetat, pH 8.0, 20 mM Magne- siumacetat, 7 mM Na3-Phosphoenolpyruvat, 7 mM DTT, 5.5 mM ATP, 70 μM Aminosäuren (complete von Promega), 75 μg Pyruvatkinase (Sigma, Deutschland) ) /ml gegeben. Die Proben werden für 30 min bei 370C inkubiert. Die Überstände werden über Nacht bei 40C gegen 2 1 Dialysepuffer (10 mM Tris-acetat, pH 8.0, 14 mM Mag- nesiumacetat, 1 mM DTT, 60 mM Kaliumacetat) mit einem Pufferwechsel in einem Dialyseschlauch mit 3500 Da Ausschluss dialy- siert. Das Dialysat wird auf eine Proteinkonzentration von etwa 10 mg/ml konzentriert, indem der Dialyseschlauch mit kaltem PEG 8000 Pulver (Sigma, Deutschland) bei 40C bedeckt wird. Die S30 Extrakte können aliquotiert bei —700C gelagert werden.
Bestimmung der ICcn im S. aureus in vitro Transcriptions- Translations-Assay
Die Inhibition der Proteinbiosynthese der Verbindungen kann in einem in vitro Transkriptions-Translations-Assay gezeigt werden. Der Assay beruht auf der zellfreien Transkription und Translation von Firefly Luziferase unter Verwendung des Repor- terplasmids pla als Template und aus S. aureus gewonnenen zellfreien S30 Extrakten. Die Aktivität der entstandenen Luziferase kann durch Lumineszenzmessung nachgewiesen werden. Die Menge an einzusetzenden S30 Extrakt bzw. Plasmid pla muss für jede Präparation erneut ausgetestet werden, um eine optimale Konzentration im Test zu gewährleisten. 3 μl der zu testenden Substanz gelöst in 5% DMSO werden in eine MTP vorgelegt. Anschließend werden 10 μl einer geeignet konzentrierten Plas- midlösung pla zugegeben. Anschließend werden 46 μl eines Gemisches aus 23 μl Premix (500 mM Kaliumacetat, 87.5 mM Tris- acetat, pH 8.0, 67.5 mM Ammoniumacetat, 5 mM DTT, 50 μg Folsäure/ml, 87.5 mg PEG 8000/ml, 5 mM ATP, 1.25 mM je NTP, 20 μM je Aminosäure, 50 mM PEP (Na3-SaIz), 2.5 mM cAMP, 250 μg je E. coli tRNA/ml) und 23 μl einer geeigneten Menge S. aureυs S30 Extrakt zugegeben und vermischt. Nach Inkubation für 60 min bei 300C werden 50 μl Luziferinlösung (20 mM Tricine, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 μM CoA, 470 μM Luziferin, 530 μM ATP) und die entstehende Biolumineszenz für 1 min in einem Luminometer gemessen. Als IC50 wird die Konzentration eines Inhibitors angegeben, die zu einer 50%igen Inhibition der Translation von Firefly Luziferase führt.
Bestimmung der Minimalen Hemmkonzentration (MHK)
Die minimale Hemmkonzentration (MHK) ist die minimale Konzentration eines Antibiotikums , mit der ein Testkeim in seinem Wachstum über 18-24 h inhibiert wird. Die Hemmstoff- konzentration kann dabei nach mikrobiologischen Standardverfahren bestimmt werden (siehe z.B. The National Committee for Clinical Laboratory Standards. Methods for dilution anti- microbial susceptibility tests for bacteria that grow aerobi- cally; approved standard-fifth edition. NCCLS document M7-A5 [ISBN 1-56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000). Die MHK der erfindungsgemäßen Verbindungen wird im Flüssigdilutionstest im 96er- Mikrotiter-Platten-Maßstab bestimmt. Die Bakterienkeime werden in einem Minimalmedium (18.5 mM Na2HPO4, 5.7 mM KH2PO4, 9.3 mM NH4Cl, 2.8 mM MgSO4, 17.1 mM NaCl, 0.033 μg/ml Thiamin- hydrochlorid, 1.2 μg/ml Nicotinsäure, 0.003 μg/ml Biotin, 1% Glucose, 25 μg/ml von jeder proteinogenen Aminosäure mit Ausnahme von Phenylalanin; [H. -P. Kroll; unveröffentlicht]) unter Zusatz von 0.4% BH-Bouillon kultiviert (Testmedium). Im Fall von Enterococcus faecium L4001 wird dem Testmedium hitzeinaktiviertes fötales Kälberserum (FCS; GibcoBRL, Deutschland) in einer Endkonzentration von 10% zugesetzt. Übernachtkulturen der Testkeime werden auf eine OD578 von 0.001 (im Falle der Entero- kokken auf 0.01) in frisches Testmedium verdünnt und 1:1 mit Verdünnungen der Testsubstanzen (Verdünnungsstufen 1:2) in Testmedium inkubiert (200 μl Endvolumen). Die Kulturen werden bei 370C für 18-24 Stunden inkubiert; Enterokokken in Gegenwart von 5% CO2.
Die jeweils niedrigste Substanzkonzentration, bei der kein sichtbares Bakterienwachstum mehr auftritt, wird als MHK definiert.
Alternative Bestimmunqsmethode der Minimalen Hemmkonzentration (MHK)
Die minimale Hemmkonzentration (MHK) ist die minimale Konzentration eines Antibiotikums , mit der ein Testkeim in seinem Wachstum über 18-24 h inhibiert wird. Die Hemmstoffkonzentration kann dabei nach mikrobiologischen Standardverfahren mit modifiziertem Medium im Rahmen eines Agardiluti- onstests bestimmt werden (siehe z.B. The National Committee for Clinical Laboratory Standards. Methods for dilution antimicro- bial susceptibility tests for bacteria that grow aerobically; approved standard-fifth edition. NCCLS document M7-A5 [ISBN 1- 56238-394-9]. NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2000). Die Bakterienkeime werden auf 1.5%igen Agarplatten kultiviert, die 20% defibriniertes Pferdeblut enthalten. Die Testkeime, die über Nacht auf Colum- bia-Blutagarplatten (Becton-Dickinson) inkubiert werden, werden in PBS verdünnt, auf eine Keimzahl von ca. 5x105 Keime/ml eingestellt und auf Testplatten getropft (1-3 μl). Die Testsubstanzen enthalten unterschiedliche Verdünnungen der Testsubstanzen (Verdünnungsstufen 1:2). Die Kulturen werden bei 370C für 18-24 Stunden in Gegenwart von 5% CO2 inkubiert.
Die jeweils niedrigste Substanzkonzentration, bei der kein sichtbares Bakterienwachstum mehr auftritt, wird als MHK definiert und in μg/ml angegeben.
Tabelle A (mit Vergleichsbeispiel Biphenomycin B)
Figure imgf000106_0001
Konzentrationsangaben: MHK in μg/ml; IC50 in μM. Systemische Infektion mit S. aureus 133
Die Eignung der erfindungsgemäßen Verbindungen zur Behandlung von bakteriellen Infektionen kann in verschiedenen Tiermodellen gezeigt werden. Dazu werden die Tiere im allgemeinen mit einem geeigneten virulenten Keim infiziert und anschließend mit der zu testenden Verbindung, die in einer an das jeweilige Therapiemodell angepassten Formulierung vorliegt, behandelt. Speziell kann die Eignung der erfindungsgemäßen Verbindungen zur Behandlung von bakteriellen Infektionen in einem Sepsismodell an Mäusen nach Infektion mit S. aureus demonstriert werden.
Dazu werden S. aureus 133 Zellen über Nacht in BH-Bouillon (Oxoid, Deutschland) angezüchtet. Die Übernachtkultur wurde 1:100 in frische BH-Bouillon verdünnt und für 3 Stunden hochgedreht. Die in der logarithmischen Wachstumsphase befindlichen Bakterien werden abzentrifugiert und zweimal mit gepufferter, physiologischer Kochsalzlösung gewaschen. Danach wird am Photometer (Dr. Lange LP 2W) eine Zellsuspension in Kochsalzlösung mit einer Extinktion von 50 Einheiten eingestellt. Nach einem Verdünnungsschritt (1:15) wird diese Suspension 1:1 mit einer 10%-igen Mucinsuspension gemischt. Von dieser Infektionslösung wird 0.2 ml/20 g Maus i.p. appliziert. Dies entspricht einer Zellzahl von etwa 1-2 x 106 Keimen/Maus. Die i.v. -Therapie erfolgt 30 Minuten nach der Infektion. Für den Infektionsversuch werden weibliche CFWl-Mäuse verwendet. Das überleben der Tiere wird über 6 Tage protokolliert. Das Tiermodell ist so eingestellt, daß unbehandelte Tiere innerhalb von 24 h nach der Infektion versterben. Für die Beispielverbindung 2 konnte in diesem Modell eine therapeutische Wirkung von ED100 = 1.25 mg/kg demonstriert werden. Bestimmung der Spontanresistenzfrequenzen gegen S. aureus
Die Spontanresistenzraten der erfindungsgemäßen Verbindungen werden wie folgt bestimmt: die Bakterienkeime werden in 30 ml eines Minimalmediums (18.5 inM Na2HPO4, 5.7 mM KH2PO4, 9.3 mM NH4Cl, 2.8 mM MgSO4, 17.1 mM NaCl, 0.033 μg/ml Thiaminhydrochlo- rid, 1.2 μg/ml Nicotinsäure, 0.003 μg/ml Biotin, 1% Glucose, 25 μg/ml von jeder proteinogenen Aminosäure unter Zusatz von 0,4% BH Bouillon) bei 37°C über Nacht kultiviert, 10 min bei β.OOOxg abzentrifugiert und in 2 ml phosphat-gepufferter physiologischer NaCl-Lösung resuspendiert (ca. 2xlO9 Keime/ml). 100 μl dieser Zellsuspension bzw. 1:10 und 1:100 Verdünnungen werden auf vorgetrockneten Agarplatten (1.5% Agar, 20% defibriniertes Pferdeblut bzw. 1.5% Agar, 20% Rinderserum in 1/10 Müller- Hinton-Medium verdünnt mit PBS ) , welche die zu testende erfindungsgemäße Verbindung in einer Konzentration entsprechend 5xMHK bzw. 1OxMHK enthalten, ausplattiert und 48 h bei 370C bebrütet. Die entstehenden Kolonien (cfu) werden ausgezählt.
Isolierung der Biphenomycin-resistenten S. aureus Stämme RN4220BiR und T17
Der S. aureus Stamm RN4220BiR wird in vitro isoliert. Dazu werden jeweils 100 μl einer S. aureus RN4220 Zellsuspension (ca. 1.2xlO8 cfu/ml) auf einer antibiotikafreien Agarplatte (18.5 mM Na2HPO4, 5.7 mM KH2PO4, 9.3 mM NH4Cl, 2.8 mM MgSO4, 17.1 mM NaCl, 0.033 μg/ml Thiaminhydrochlorid, 1.2 μg/ml Nicotinsäure, 0.003 μg/ml Biotin, 1% Glucose, 25 μg/ml von jeder proteinogenen Aminosäure unter Zusatz von 0.4% BH-Bouillon und 1% Agarose) und einer Agarplatte, die 2 μg/ml Biphenomycin B (lOxMHK) enthält, ausplattiert und über Nacht bei 37°C bebrütet. Während auf der antibiotikafreien Platte ca. 1x1O7 Zeilen wachsen, wachsen auf der antibiotikahaltigen Platte ca. 100 Kolonien, entsprechend einer Resistenzfrequenz von IxIO"5. Einige der auf der antibiotikahaltigen Platte gewachsenen Kolonien werden auf MHK gegen Biphenomycin B getestet. Eine Kolonie mit einer MHK > 50 μM wird zur weiteren Verwendung ausgewählt und der Stamm mit RN4220BiR bezeichnet.
Der S. aureus Stamm T17 wird in vivo isoliert. CFWl-Mäuse werden mit 4x10^ S. aureus 133 - Zellen pro Maus intraperitoneal infiziert. 0.5 Std. nach der Infektion werden die Tiere mit 50 mg/kg Biphenomycin B intravenös behandelt. Den überlebenden Tieren werden am Tag 3 nach der Infektion die Nieren entnommen. Nach dem Homogenisieren der Organe werden die Homogenate, wie bei RN4220BiR beschrieben, auf antibiotikafreien und antibiotikahaltigen Agarplatten, ausplattiert und über Nacht bei 370C bebrütet. Etwa die Hälfte der aus der Niere isolierten Kolonien zeigen ein Wachstum auf den antibiotikahaltigen Platten (2.2xlO6 Kolonien), was die Anreicherung von Biphenomycin B resistenten S. aureus Zellen in der Niere der behandelten Tiere belegt. Ca. 20 dieser Kolonien werden auf MHK gegen Biphenomycin B getestet und eine Kolonie mit einer MHK > 50 μM wird zur Weiterkultivierung ausgewählt und der Stamm mit T17 bezeichnet.
Ausführungsbeispiele für pharmazeutische Zusammensetzungen
Die erfindungsgemäßen Verbindungen können folgendermaßen in pharmazeutische Zubereitungen überführt werden:
Intravenös applizierbare Lösung;
Zusammensetzung;
1 mg der Verbindung von Beispiel 1, 15 g Polyethylenglykol 400 und 250 g Wasser für Injektionszwecke.
Herstellung:
Die erfindungsgemäße Verbindung wird zusammen mit Polyethylenglykol 400 in dem Wasser unter Rühren gelöst. Die Lösung wird sterilfiltriert (Porendurchmesser 0.22 μm) und unter aseptischen Bedingungen in hitzesterilisierte Infusionsflaschen abgefüllt. Diese werden mit Infusionsstopfen und Bördelkappen verschlossen.

Claims

Patentansprüche
1. Verbindung der Formel
Figure imgf000111_0001
in welcher
,26 gleich Wasserstoff, Halogen, Hydroxy oder Methyl ist,
R7 gleich eine Gruppe der Formel
''//. ,NH, '''', ^NH
Figure imgf000111_0002
ist,
wobei
R1 gleich Wasserstoff oder Hydroxy ist,
* die Anknüpfstelle an das Kohlenstoffatom ist, R2 gleich Wasserstoff oder Methyl ist,
R3 gleich eine Gruppe der Formel
Figure imgf000112_0001
ist,
wobei
* die Anknüpfstelle an das Stickstoffatom ist,
A gleich eine Bindung oder Phenyl ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000112_0002
ist, worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-(CH2Jn-OH oder *- (CH2J0-NH2 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
n und o unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
m eine Zahl 0 oder 1 ist,
R12 unabhängig voneinander eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R14 und R15 unabhängig voneinander eine Gruppe der Formel
sind,
worin
* die Anknüpf stelle an das Stickstoffatom ist,
R4a gleich Wasserstoff, Amino oder Hydro- xy ist,
R5a gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6a gleich Wasserstoff oder Aminoethyl ist,
oder
R5a und R6a bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Piperazin-Ring, R8a und R12a unabhängig voneinander
*-(CH2)zla-OH, *-(CH2)Z2a-NHR13a, *-CONHR14a oder * -CH2CONHR150 sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa und Z2a unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
R13a gleich Wasserstoff oder Methyl ist
und
R14a und R15a unabhängig voneinander eine Gruppe der Formel
Figure imgf000115_0001
sind ,
worin
* die Anknüpfstelle an das Stickstoffatom ist, R4c gleich Wasserstoff, Amino oder Hydroxy ist,
R5c gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6c gleich Wasserstoff oder Aminoethyl ist,
kc eine Zahl 0 oder 1 ist
und
Ic eine Zahl 1, 2, 3 oder 4 ist,
R9a und Rlla unabhängig voneinander Wasserstoff oder Methyl sind,
R1Oa gleich Amino oder Hydroxy ist,
R16a eine Gruppe der Formel
Figure imgf000116_0001
ist,
worin * die Anknüpfstelle an das Stickstoffatom ist,
R4d gleich Wasserstoff, Amino oder Hydroxy ist,
R5d gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6d gleich Wasserstoff oder Aminoethyl ist,
kd eine Zahl 0 oder 1 ist
und
Id eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist
und
Ia, wa, xa und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
gleich Wasserstoff, Methyl, *-C(NH2)=NH oder eine Gruppe der Formel
Figure imgf000118_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R20 gleich Wasserstoff oder *-(CH2 J1-NHR' 22 ist,
worin
I gleich Wasserstoff oder Methyl ist
und
eine Zahl 1, 2 oder 3 ist,
R gleich Wasserstoff oder Methyl ist,
eine Zahl 0, 1, 2 oder 3 ist,
g eine Zahl 1, 2 oder 3 ist
und h eine Zahl 1, 2, 3 oder 4 ist,
d R17 unabhängig voneinander eine Gruppe der Formel
Figure imgf000119_0001
kbttϊb
Figure imgf000119_0002
sind,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4b gleich Wasserstoff, Amino oder Hydroxy ist,
R5b gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6b gleich Wasserstoff oder Aminoethyl ist,
oder R5b und R6b bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Pipe- razin-Ring,
R8b und R12bunabhängig voneinander *—(CH2)Zlb-OH, *-(CH2)22b-NHR13b, *-CONHR14b oder *-CH2CONHR15" sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R13b gleich Wasserstoff oder Methyl ist
und
ZIb und Z2b unabhängig voneinander eine Zahl 1, 2 oder 3 sind,
und
R14b und R15b unabhängig voneinander eine Gruppe der Formel
Figure imgf000120_0001
sind, worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4g gleich Wasserstoff, Amino oder Hydroxy ist,
R5g gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6g gleich Wasserstoff oder Aminoethyl ist,
kg eine Zahl 0 oder 1 ist
und
Ig eine Zahl 1, 2, 3 oder 4 ist,
R9b und Rllb unabhängig voneinander Wasserstoff oder Methyl sind,
R10b gleich Amino oder Hydroxy ist,
kb eine Zahl 0 oder 1 ist,
Ib, wb, xb und yb unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
gleich Wasserstoff, Amino oder Hydroxy ist, gleich Wasserstoff , Methyl oder eine Gruppe der Formel
Figure imgf000122_0001
ist ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R25 gleich Wasserstoff oder *-(CH2)u-NHR29 ist,
worin
R29 gleich Wasserstoff oder Methyl ist
und
u eine Zahl 1, 2 oder 3 ist,
R28 gleich Wasserstoff oder Methyl ist,
s eine Zahl 0, 1, 2 oder 3 ist
und
t eine Zahl 1, 2 oder 3 ist, R24 gleich Wasserstoff oder Aminoethyl ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind,
1, r, w und y unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
r~Jw rodery unabhängig voneinander bei w, r oder y gleich 3 eine Hydroxy-Gruppe tragen kann,
oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
2. Verbindung nach Anspruch 1, dadurch gekennzeichnet, dass sie der Formel
Figure imgf000123_0001
entspricht, in welcher R26 gleich Wasserstoff, Halogen, Hydroxy oder Methyl ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff oder Methyl ist,
R3 wie in Anspruch 1 definiert ist,
oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
3. Verbindung nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass
R26 gleich Wasserstoff, Chlor, Hydroxy oder Methyl ist.
4. Verbindung nach Anspruch 2, dadurch gekennzeichnet, dass
R26 gleich Wasserstoff oder Hydroxy ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff ist,
R3 gleich eine Gruppe der Formel
Figure imgf000125_0001
ist,
wobei
* die Anknüpfstelle an das Stickstoffatom ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000125_0002
ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-(CH2)n-OH oder *-(CH2)o-NH2 ist, worin
* die Anknüpfstelle an das Kohlenstoff- atom ist,
n und o unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
m eine Zahl 0 oder 1 ist,
eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R14 und R15 unabhängig voneinander eine Gruppe der Formel
,4a ,5a 8a
Ra ,10a
R1
HIsBf %•■ ■ - *r ■ v— H-fe NH x a
Figure imgf000126_0001
sind ,
worin * die Anknüpfstelle an das Stickstoffatom ist,
R4a gleich Wasserstoff, Amino oder Hydro- xy ist,
R5a gleich Wasserstoff, Methyl oder Ami- noethyl ist,
R6a gleich Wasserstoff oder Aminoethyl ist,
oder
R5a und R6a bilden zusammen mit dem Stickstof fatom an das sie gebunden sind einen Piperazin-Ring ,
R8a und R12a unabhängig voneinander
*-( CH2 ) zla-OH , *- ( CH2 ) z2a-NHR13a,
*-CONHR14a oder * -CH2CONHR1511 sind ,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa und Z2a unabhängig voneinander eine Zahl 1, 2 oder 3 sind, R13a gleich Wasserstoff oder Methyl ist
und
R14a und R15a unabhängig voneinander eine Gruppe der Formel
Figure imgf000128_0001
sind,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4c gleich Wasserstoff, Amino oder Hydroxy ist,
R5c gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6c gleich Wasserstoff oder Aminoethyl ist,
kc eine Zahl 0 oder 1 ist
und Ic eine Zahl 1, 2, 3 oder 4 ist,
R9a und RUa unabhängig voneinander Wasserstoff oder Methyl sind,
R1Oa gleich Amino oder Hydroxy ist,
R16a eine Gruppe der Formel
Figure imgf000129_0001
ist,
worin
* die Anknüpfstelle an das Stick- stoffatom ist,
R4d gleich Wasserstoff, Amino oder Hydroxy ist,
R5d gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6d gleich Wasserstoff oder Aminoethyl ist,
kd eine Zahl 0 oder 1 ist und
Id eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist
und
Ia, wa, xa und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R9 gleich Wasserstoff, Methyl, *-C(NH2)=NH oder eine Gruppe der Formel
Figure imgf000130_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R20 gleich Wasserstoff oder *—(CH2 J1-NHR22 ist,
worin R22 gleich Wasserstoff oder Methyl ist
und
i eine Zahl 1, 2 oder 3 ist,
R21 gleich Wasserstoff oder Methyl ist,
f eine Zahl 0, 1, 2 oder 3 ist,
g eine Zahl 1, 2 oder 3 ist
und
h eine Zahl 1, 2, 3 oder 4 ist,
eine Gruppe der Formel
Figure imgf000131_0001
ist ,
worin * die Anknüpfstelle an das Stickstoffatom ist,
R4b gleich Wasserstoff, Amino oder Hydroxy ist,
R5b gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6b gleich Wasserstoff oder Aminoethyl ist,
oder
R5b und R6b bilden zusammen mit dem Stickstoffatom an das sie gebunden sind einen Pipe- razin-Ring,
R8b und R12b unabhängig voneinander *-(CH2)zlb-OH, * *--((CCHH2)z2b-NHR13b, *-CONHR14b oder *-CH2CONHR15b sind,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R13b gleich Wasserstoff oder Methyl ist
und
ZIb und Z2b unabhängig voneinander eine Zahl 1, 2 oder 3 sind, und
R14b und R15b unabhängig voneinander eine Gruppe der Formel
Figure imgf000133_0001
sind ,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4g gleich Wasserstoff, Amino oder Hydroxy ist,
R5g gleich Wasserstoff, Methyl oder Aminoethyl ist,
R6g gleich Wasserstoff oder Aminoethyl ist,
kg eine Zahl 0 oder 1 ist
und
Ig eine Zahl 1, 2, 3 oder 4 ist, R9b und Rllb unabhängig voneinander Wasserstoff oder Methyl sind,
R10b gleich Amino oder Hydroxy ist,
kb eine Zahl 0 oder 1 ist,
Ib, wb, xb und yb unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R18 gleich Wasserstoff, Amino oder Hydroxy ist,
R19 gleich Wasserstoff, Methyl oder eine Gruppe der Formel
Figure imgf000134_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R25 gleich Wasserstoff oder *-(CH2)u-NHR29 ist,
worin
R29 gleich Wasserstoff oder Methyl ist und
u eine Zahl 1, 2 oder 3 ist,
R28 gleich Wasserstoff oder Methyl ist,
s eine Zahl 0, 1, 2 oder 3 ist
und
t eine Zahl 1, 2 oder 3 ist,
R24 gleich Wasserstoff oder Aminoethyl ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind,
1, r und w unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
L Jw oder r unabhängig voneinander bei w oder r gleich 3 eine HydroxyGruppe tragen kann,
oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
5. Verbindung nach einem der Ansprüche 2 oder 3, dadurch gekennzeichnet, dass
R26 gleich Wasserstoff oder Hydroxy ist,
R1 gleich Wasserstoff oder Hydroxy ist,
R2 gleich Wasserstoff ist,
R3 gleich eine Gruppe der Formel
Figure imgf000136_0001
ist ,
wobei
* die Anknüpfstelle an das Stickstoffatom ist,
R4 gleich Wasserstoff, Amino oder Hydroxy ist,
R5 eine Gruppe der Formel
Figure imgf000137_0001
ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
R23 Wasserstoff oder eine Gruppe der Formel *-(CH2)n-OH oder *-(CH2)o-NH2 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
n und o unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
m eine Zahl 0 oder 1 ist,
eine Gruppe der Formel *-CONHR14 oder *-CH2CONHR15 ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist, R14 und R15 unabhängig voneinander eine Gruppe der Formel
Figure imgf000138_0001
sind,
worin
* die Anknüpfstelle an das Stickstoff- atom ist,
R4a gleich Wasserstoff, Amino oder Hydro- xy ist,
R5a gleich Wasserstoff ist,
R6a gleich Wasserstoff ist,
R12a gleich *-(CH2)zla-OH oder *-CH2CONHR15a ist,
worin
* die Anknüpfstelle an das Kohlenstoffatom ist,
ZIa eine Zahl 1, 2 oder 3 ist, und
R15a eine Gruppe der Formel
Figure imgf000139_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4c gleich Wasserstoff, Amino oder Hydroxy ist,
R5c gleich Wasserstoff ist,
R6c gleich Wasserstoff ist,
kc eine Zahl 0 oder 1 ist
und
Ic eine Zahl 1, 2, 3 oder 4 ist,
ka eine Zahl 0 oder 1 ist
und Ia und ya unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
R9 gleich Wasserstoff ist,
R17 eine Gruppe der Formel
Figure imgf000140_0001
ist,
worin
* die Anknüpfstelle an das Stickstoffatom ist,
R4b gleich Wasserstoff, Amino oder Hydroxy ist,
R5b gleich Wasserstoff ist,
R6b gleich Wasserstoff ist,
kb eine Zahl 0 oder 1 ist,
Ib eine Zahl 1, 2, 3 oder 4 ist,
R18 gleich Wasserstoff, Amino oder Hydroxy ist, R19 gleich Wasserstoff ist,
R24 gleich Wasserstoff ist,
d eine Zahl 1, 2 oder 3 ist,
k und q unabhängig voneinander eine Zahl 0 oder 1 sind,
1, r und w unabhängig voneinander eine Zahl 1, 2, 3 oder 4 sind,
r*~Jw oder r unabhängig voneinander bei w oder r gleich 3 eine Hydroxy-Gruppe tragen kann,
oder eines ihrer Salze, ihrer Solvate oder der Solvate ihrer Salze.
6. Verfahren zur Herstellung einer Verbindung der Formel (I) nach Anspruch 1 oder eines ihrer Salze, Solvate oder der Solvate ihrer Salze, dadurch gekennzeichnet, dass
[A] eine Verbindung der Formel
Figure imgf000142_0001
worin R2, R7 und R26 die in Anspruch 1 angegebene Bedeutung haben und boc gleich tert-Butoxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit einer Verbindung der Formel
H2NR3 (IH) ,
worin R3 die in Anspruch 1 angegebene Bedeutung hat,
und anschließend mit einer Säure und/oder durch Hydrogeno- lyse umgesetzt wird,
oder
[B] eine Verbindung der Formel
Figure imgf000143_0001
worin R2, R7 und R26 die in Anspruch 1 angegebene Bedeutung haben und Z gleich Benzyloxycarbonyl ist,
in einem zweistufigen Verfahren zunächst in Gegenwart von einem oder mehreren Dehydratisierungsreagenzien mit einer Verbindung der Formel
H2NR3 (HI),
worin R3 die in Anspruch 1 angegebene Bedeutung hat,
und anschließend mit einer Säure oder durch Hydrogenolyse umgesetzt wird.
7. Verfahren zur Herstellung einer Verbindung der Formel ( I ) nach Anspruch 1 oder eines ihrer Solvate, dadurch gekennzeichnet, dass ein Salz der Verbindung oder ein Solvat eines Salzes der Verbindung durch Chromatographie unter Zusatz einer Base in die Verbindung überführt wird.
8. Verbindung nach einem der Ansprüche 1 bis 5 zur Behandlung und/oder Prophylaxe von Krankheiten.
9. Verwendung einer Verbindung nach einem der Ansprüche 1 bis 5 zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von Krankheiten.
10. Verwendung einer Verbindung nach einem der Ansprüche 1 bis 5 zur Herstellung eines Arzneimittels zur Behandlung und/oder Prophylaxe von bakteriellen Erkrankungen.
11. Arzneimittel enthaltend mindestens eine Verbindung nach einem der Ansprüche 1 bis 5 in Kombination mit mindestens einem inerten, nichttoxischen, pharmazeutisch geeigneten Hilfsstoff.
12. Arzneimittel nach Anspruch 11 zur Behandlung und/oder Prophylaxe von bakteriellen Infektionen.
13. Verfahren zur Bekämpfung von bakteriellen Infektionen in Menschen und Tieren durch Verabreichung einer antibakteriell wirksamen Menge mindestens einer Verbindung nach einem der Ansprüche 1 bis 5 oder eines Arzneimittels nach Anspruch 11 oder 12.
PCT/EP2006/006770 2005-07-14 2006-07-11 Antibakterielle amid-makrozyklen vii WO2007006548A2 (de)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP06762521A EP1907413A2 (de) 2005-07-14 2006-07-11 Antibakterielle amid-makrozyklen vii
JP2008520778A JP2009501173A (ja) 2005-07-14 2006-07-11 抗菌性アミドマクロサイクルｖｉｉ
US12/008,662 US20080306040A1 (en) 2005-07-14 2008-01-11 Antibacterial amide macrocycles VII

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005032781.8 2005-07-14
DE102005032781A DE102005032781A1 (de) 2005-07-14 2005-07-14 Antibakterielle Amid-Markozyklen VII

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/008,662 Continuation US20080306040A1 (en) 2005-07-14 2008-01-11 Antibacterial amide macrocycles VII

Publications (2)

Publication Number Publication Date
WO2007006548A2 true WO2007006548A2 (de) 2007-01-18
WO2007006548A3 WO2007006548A3 (de) 2007-03-22

Family

ID=37507564

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/006770 WO2007006548A2 (de) 2005-07-14 2006-07-11 Antibakterielle amid-makrozyklen vii

Country Status (5)

Country Link
US (1) US20080306040A1 (de)
EP (1) EP1907413A2 (de)
JP (1) JP2009501173A (de)
DE (1) DE102005032781A1 (de)
WO (1) WO2007006548A2 (de)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003106480A1 (de) * 2002-06-17 2003-12-24 Bayer Healthcare Ag Antibakterielle amid-makrozyklen
WO2004012816A1 (de) * 2002-07-29 2004-02-12 Bayer Healthcare Ag Antibakterielle ester-makrozyklen
WO2005033129A1 (de) * 2003-10-01 2005-04-14 Bayer Healthcare Ag Antibakterielle amid-makrozyklen
WO2005058943A1 (de) * 2003-12-16 2005-06-30 Aicuris Gmbh & Co. Kg Antibakterielle makrozyklen mit substituiertem biphenyl
WO2005100380A1 (de) * 2004-04-16 2005-10-27 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen ii
WO2005118613A2 (de) * 2004-05-26 2005-12-15 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen
WO2006034786A1 (de) * 2004-09-24 2006-04-06 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen iv
WO2006103009A1 (de) * 2005-03-30 2006-10-05 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen vi
WO2006103015A1 (de) * 2005-03-30 2006-10-05 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen v

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2720066B1 (fr) * 1994-05-20 1996-06-28 Rhone Poulenc Rorer Sa Peptides antagonistes de la neurotensine.

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003106480A1 (de) * 2002-06-17 2003-12-24 Bayer Healthcare Ag Antibakterielle amid-makrozyklen
WO2004012816A1 (de) * 2002-07-29 2004-02-12 Bayer Healthcare Ag Antibakterielle ester-makrozyklen
WO2005033129A1 (de) * 2003-10-01 2005-04-14 Bayer Healthcare Ag Antibakterielle amid-makrozyklen
WO2005058943A1 (de) * 2003-12-16 2005-06-30 Aicuris Gmbh & Co. Kg Antibakterielle makrozyklen mit substituiertem biphenyl
WO2005100380A1 (de) * 2004-04-16 2005-10-27 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen ii
WO2005118613A2 (de) * 2004-05-26 2005-12-15 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen
WO2006034786A1 (de) * 2004-09-24 2006-04-06 Aicuris Gmbh & Co.Kg Antibakterielle amid-makrozyklen iv
WO2006103009A1 (de) * 2005-03-30 2006-10-05 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen vi
WO2006103015A1 (de) * 2005-03-30 2006-10-05 Aicuris Gmbh & Co. Kg Antibakterielle amid-makrozyklen v

Also Published As

Publication number Publication date
DE102005032781A8 (de) 2008-06-26
WO2007006548A3 (de) 2007-03-22
EP1907413A2 (de) 2008-04-09
DE102005032781A1 (de) 2007-01-18
US20080306040A1 (en) 2008-12-11
JP2009501173A (ja) 2009-01-15

Similar Documents

Publication Publication Date Title
EP1869068A1 (de) Antibakterielle amid-makrozyklen v
EP1515983B1 (de) Antibakterielle amid-makrozyklen
EP1866291B1 (de) Antibakterielle amid-makrozyklen vi
WO2006048156A1 (de) Cyclische nonapeptidamide
EP1797110B1 (de) Antibakterielle amid-makrozyklen iv
EP1697400B1 (de) Antibakterielle makrozyklen mit substituiertem biphenyl
WO2005118613A2 (de) Antibakterielle amid-makrozyklen
WO2005033129A1 (de) Antibakterielle amid-makrozyklen
DE10234422A1 (de) Antibakterielle Ester-Makrozyklen
EP1981903A1 (de) Asparagin-10-substituierte nonadepsipeptide
EP1809653B1 (de) Substituierte nonadepsipeptide
DE102004051023A1 (de) Desoxo-Nonadepsipeptide
WO2005100380A1 (de) Antibakterielle amid-makrozyklen ii
WO2007006548A2 (de) Antibakterielle amid-makrozyklen vii
WO2007059908A1 (de) Neue cyclische iminopeptid-derivate und ein verfahren zur herstellung von cyclischen iminopeptid-derivaten
EP1866312A1 (de) Cyclische iminopeptid-derivate

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008520778

Country of ref document: JP

WWW Wipo information: withdrawn in national office

Country of ref document: DE

WWE Wipo information: entry into national phase

Ref document number: 2006762521

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2006762521

Country of ref document: EP