WO2005083093A2 - Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen - Google Patents
Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen Download PDFInfo
- Publication number
- WO2005083093A2 WO2005083093A2 PCT/EP2005/001863 EP2005001863W WO2005083093A2 WO 2005083093 A2 WO2005083093 A2 WO 2005083093A2 EP 2005001863 W EP2005001863 W EP 2005001863W WO 2005083093 A2 WO2005083093 A2 WO 2005083093A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- desaturase
- fatty acids
- acid
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23D—EDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS, COOKING OILS
- A23D9/00—Other edible oils or fats, e.g. shortenings, cooking oils
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
- A61K31/202—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids having three or more double bonds, e.g. linolenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/92—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof
- A61K8/922—Oils, fats or waxes; Derivatives thereof, e.g. hydrogenation products thereof of vegetable origin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/02—Nutrients, e.g. vitamins, minerals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0083—Miscellaneous (1.14.99)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
- A61K2800/86—Products or compounds obtained by genetic engineering
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/19—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
Definitions
- the present invention relates to a process for the production of polyunsaturated fatty acids in the seed of transgenic plants by introducing nucleic acids into the organism which are suitable for polypeptides having ⁇ -3-desaturase, ⁇ -12-desaturase, ⁇ -6-desaturase , ⁇ 6-elongase, ⁇ 5-desaturase, ⁇ 5-elongase and / or ⁇ 4-desaturase activity are preferred for polypeptides having ⁇ 6-desaturase, ⁇ 6-elongase and ⁇ - Encoding 5-desaturase activity.
- nucleic acid sequences are the sequences shown in SEQ ID NO: 11, SEQ ID NO: 27, SEQ ID NO: 193, SEQ ID NO: 197, SEQ ID NO: 199 and SEQ ID NO: 201.
- a further nucleic acid sequence which codes for a polypeptide having a ⁇ 12-desaturase activity is preferably introduced into the plant and likewise expressed simultaneously. These are particularly preferably the nucleic acid sequence shown in SEQ ID NO: 195.
- these nucleic acid sequences may optionally be expressed in the organism along with other nucleic acid sequences encoding polypeptides of biosynthesis of the fatty acid or lipid metabolism.
- Nucleic acid sequences which are particularly advantageous for . encode a ⁇ 6-desaturase, ⁇ 5-desaturase, ⁇ 4-desaturase, ⁇ 12-desaturase and / or ⁇ 6-elongase activity.
- These desaturases and elongases are advantageously derived from Thalassiosira, Euglena or Ostreococcus.
- the invention relates to a process for the preparation of oils and / or triacylglycerides having an increased content of long-chain polyunsaturated fatty acids.
- the invention also relates, in a preferred embodiment, to a process for the preparation of arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid and a process for the preparation of triglycerides having an increased content of unsaturated fatty acids, in particular arachidonic acid, eicosapentaenoic acid and / or docosahexaenoic acid, in transgenic plants advantageously in the seed of the transgenic plants Plant.
- the invention relates to the production of a transgenic plant with an increased content of polyunsaturated fatty acids, in particular arachidonic acid, eicosapentaenoic acid and / or docosahexaenoic acid, based on the expression of the elongases and desaturases used in the method according to the invention.
- polyunsaturated fatty acids in particular arachidonic acid, eicosapentaenoic acid and / or docosahexaenoic acid
- the invention further relates to recombinant Nukleinsauremolekule, the nucleic acid sequences encoding the polypeptides with ⁇ -6-desaturase, ⁇ -6-elongase, ⁇ -5-desaturase and ⁇ -5-Elongaseeducationtician, together or individually, and Transgenic plants containing the aforementioned recombinant Nukleinsauremolekule.
- Another part of the invention relates to oils, lipids and / or fatty acids prepared by the process according to the invention and their use.
- the invention relates to unsaturated fatty acids and triglycerides having an increased content of unsaturated fatty acids and their use.
- the lipid synthesis can be divided into two sections: the synthesis of fatty acids and their attachment to sn-glycerol-3-phosphate and the addition or modification of a polar head group.
- Common lipids used in membranes include phospholipids, glycolipids, sphingolipids and phosphoglycerides.
- Fatty acid synthesis begins with the conversion of acetyl-CoA into malonyl-CoA by the acetyl-CoA carboxylase or into acetyl-ACP by the acetyl transacylase.
- fatty acids must then be transported to various M ⁇ dischensorte and incorporated into the triacylglycerol storage lipid.
- Another important step in lipid synthesis is the transfer of fatty acids to the polar head groups, for example by glycerol-fatty acid acyltransferase (see Frentzen, 1998, Lipid, 100 (4-5): 161-166).
- polyunsaturated fatty acids are referred to as PUFA, PUFAs, LCPUFA or LCPUFAs (poly unsaturated fatty acids, PUFA, polyunsaturated fatty acids, long chain polyunsaturated fatty acids, LCPUFA, long-chain polyunsaturated fatty acids).
- Fatty acids and triacylglycerides have a variety of uses in the food, animal nutrition, cosmetics and pharmaceutical industries. Depending on whether they are free saturated and unsaturated fatty acids or triacylglycerides with an increased content of saturated or unsaturated fatty acids, they are suitable for a wide variety of applications.
- Polyunsaturated fatty acids such as linoleic and linolenic acids are essential for mammals because they can not be produced by them. Therefore, polyunsaturated ⁇ -3 fatty acids and ⁇ -6 fatty acids are an important component of animal and human food. in the human diet lipids with unsaturated fatty acids, especially polyunsaturated fatty acids are preferred.
- the polyunsaturated ⁇ -3 fatty acids thereby a positive effect on the cholesterol level in the blood and thus on the prevention of heart disease is attributed.
- the risk of heart disease, stroke, or hypertension can be significantly reduced (Shimikawa 2001, World Rev. Nutr., Diet, 88, 100-108).
- inflammatory, especially chronic inflammatory, processes in the context of immunological diseases can be positively influenced by ⁇ -3 fatty acids (Calder 2002, Proc Nutr Soc 61, 345-358, Cleland and James 2000, J. Rheumatql. 27, 2305-2307). They are therefore added to foods, especially dietary foods, or are used in medicines, omega-6 fatty acids such as arachidonic acid have a rather negative effect in these rheumatic diseases.
- ⁇ -3 and ⁇ -6 fatty acids are precursors of tissue hormones called eicosanoids such as the prostaglandins derived from dihomo- ⁇ -linolenic acid, arachidonic acid and eicosapentaenoic acid and the thromboxanes and leukotrienes derived from arachidonic acid and the eicosapentaenoic acid.
- Eicosanoids (so-called PG 2 series), which are formed from ⁇ -6 fatty acids, usually promote inflammatory reactions, while eicosanoids (so-called PG 3 series) of ⁇ -3 fatty acids have little or no proinflammatory effect.
- polyunsaturated long-chain fatty acids Due to the customary composition of human food today, addition of polyunsaturated ⁇ -3 fatty acids, which are preferred in fish oils, is particularly important for food.
- the unsaturated fatty acid DHA is thereby attributed a positive effect on the development and maintenance of brain functions.
- polyunsaturated long-chain fatty acids Due to the customary composition of human food today, addition of polyunsaturated ⁇ -3 fatty acids, which are preferred in fish oils, is particularly important for food.
- the free fatty acids are advantageously prepared by saponification.
- fish such as herring, salmon, sardine, goldfish, eel, carp, trout, halibut , Mackerel, zander or tuna or algae.
- oils with saturated or unsaturated fatty acids are preferred.
- lipids with unsaturated fatty acids especially polyunsaturated fatty acids
- the polyunsaturated ⁇ -3 fatty acids thereby a positive effect on the cholesterol level in the blood and thus the possibility of preventing heart disease is attributed.
- ⁇ -3 fatty acids By adding these ⁇ -3 fatty acids to the diet, the risk of heart disease, stroke or hypertension can be significantly reduced.
- inflammatory especially chronic inflammatory processes in the context of immunological diseases such as rheumatoid arthritis can be positively influenced by ⁇ -3 fatty acids. They are therefore added to foods especially dietary foods or found in medicines application.
- ⁇ -6 fatty acids such as arachidonic acid tend to have a negative effect on these diseases in these rheumatic diseases due to our usual food composition. Due to their positive properties, there has been no lack of approaches in the past, genes involved in the synthesis of fatty acids or triglycerides, for to make available the production of oils in various organisms with modified unsaturated fatty acid content. Thus, WO 91/13972 and its US equivalent describe a ⁇ -9-desaturase. In WO 93/11245 a ⁇ -15-desaturase is claimed in WO 94/11516 a ⁇ -12-desaturase.
- Plant Cell 11 825-838
- C22: 1 monounsaturated long-chain fatty acids
- microorganisms for the production of PUFAs are microorganisms such as microalgae such as Phaeodactylum tricornutum, Porphiridium species, Thraustochytrien species, Schizochytria species or Crypthecodinium species, ciliates such as Stylonychia or Colpidium, fungi such as Mortierella, Entomophthora or Mucor and / or mosses such as Physcomitrella, Ceratodon and Marchantia (R. Vazhappilly & F. Chen (1998) Botanica Marina 41: 553-558; K. Totani & K. Oba (1987) Lipids 22: 1060-1062; Akimoto, M.
- microalgae such as Phaeodactylum tricornutum, Porphiridium species, Thraustochytrien species, Schizochytria species or Crypthecodinium species, ciliates such as Stylonychia or Colpidium
- Higher plants contain polyunsaturated fatty acids such as linoleic acid (C18: 2) and linolenic acid (C18: 3).
- ERA, EPA and DHA are absent or only found in the seed oil of higher plants (E. Ucciani: Wunsch Dictionnaire des Huiles Ve- tales, Technique & Documentation - Lavoisier, 1995. ISBN: 2-7430-0009-0).
- oilseeds such as oilseed rape, linseed, sunflower and soybeans, as this will enable large quantities of high quality LCPUFAs to be obtained inexpensively for the food, animal and pharmaceutical industries.
- genes which code for enzymes of the biosynthesis of LCPUFAs are advantageously introduced into oilseeds and expressed via genetic engineering methods, advantageously expressed in the seed.
- These genes can be advantageously isolated from microorganisms and lower plants that produce LCPUFAs and incorporate them into the membranes or triacylglycerides.
- ⁇ 6-desaturase genes from the moss Physcomitrella patens and ⁇ 6 elongase genes from P. patens and the nematode C. elegans have already been isolated.
- the polyunsaturated fatty acids may be classified according to their desaturation pattern into two broad classes, ⁇ -6 or ⁇ -3 fatty acids, which have metabolically and functionally different activities (Figure 1).
- the starting material for the ⁇ -6 pathway is the fatty acid linoleic acid (18: 2 ⁇ 9 '12 ), while the ⁇ -3 pathway is via linolenic acid (18: 3 ⁇ S 2,15 ).
- Linolenic acid is formed by the activity of an ⁇ -3-desaturase (Tocher et al., 1998, Prog. Lipid Res., 37, 73-117, Domergue et al., 2002, Eur. J. Biochem., 269, 4105-4113).
- DHA docosahexaenoic acid
- the application of ⁇ -3 fatty acids shows the therapeutic effect as described above in the treatment of cardiovascular diseases (Shimikawa 2001, World Rev. Nutr., Diet, 88, 100-108), inflammations (Calder 2002, Proc. Soc., 61, 345-358) and Arthridis (Cleland and James 2000, J. Rheumatol., 27, 2305-2307).
- the elongation of fatty acids by elongases of 2 and 4 C atoms, respectively, is of crucial importance for the production of C 20 and C 22 PUFAs, respectively.
- This process runs over 4 stages.
- the first step is the condensation of malonyl-CoA on the fatty acyl-CoA by ketoacyl-CoA synthase (KCS, hereinafter referred to as elongase).
- KCS ketoacyl-CoA synthase
- KCR ketoacyl-CoA reductase
- dehydratase dehydratase
- enoyl-CoA reductase enoyl-CoA reductase
- DHA apparently can not be detected in the seed in the disclosed process.
- soy is less suitable due to the low oil content of about 20 wt .-% less.
- Soy is a beneficial source of protein and is therefore grown on a large scale.
- the oil content of soy is rather low.
- HGLA is barely detectable.
- a further disadvantage is that the plants disclosed in WO 2004/071467 were produced by cotransformation, this leads to the splitting of the properties in the following generations and thus to an increased selection effort.
- the object of the invention was to develop a process for producing large amounts of polyunsaturated fatty acids, especially ERA, EPA and DHA, in the seed of a transgenic plant. This object has been achieved by the process according to the invention for the preparation of compounds of the general formula I
- R 1 _ hydroxyl, coenzymeA (thioester), lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lysophosphatidylinositol, sphingobase, or a residue of the general Formula II
- R 2 hydrogen, lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine. Lyso-phosphatidylinositol or saturated or unsaturated C 2 -C 2 -alkylcarbonyl-,
- R 3 hydrogen, saturated or unsaturated C 2 -C 2 -alkylcarbonyl-, or R 2 or R 3 independently of one another a radical of the general formula Ia:
- R in the general formula I hydroxyl, CoenzymA- (thioester), lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol, sphingobase, or a radical of the general formula II
- R 2 in the general formula II denotes hydrogen, lyso-phosphatidylcholine, lyso-phosphatidylethanolamine, lyso-phosphatidylglycerol, lyso-diphosphatidylglycerol, lyso-phosphatidylserine, lyso-phosphatidylinositol or saturated or unsaturated C 2 -C 24 - alkylcarbonyl,
- Suitable alkyl radicals are substituted or unsubstituted, saturated or unsaturated C 2 -C 2 -alkylcarbonyl chains, such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta-decylcarbonyl , n-octadecylcarbonyl, n-nonadec
- C 1 -C 22 -alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta decylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl.
- C 10 -C 22 are particularly preferred alkylcarbonyl radicals such as C ⁇ 0 alkylcarbonyl, Cn-alkylcarbonyl, C 12 alkylcarbonyl, C 13 alkylcarbonyl, C 14 alkylcarbonyl, C 6 alkylcarbonyl , C 18 - alkylcarbonyl, C 20 alkylcarbonyl or C 22 alkylcarbonyl radicals which contain one or more double bonds.
- saturated or unsaturated C 16 -C 22 -alkylcarbonyl radicals such as C 16 -alkylcarbonyl, cis-alkylcarbonyl, C 20 -alkylcarbonyl or C 22 -alkylcarbonyl radicals, which contain one or more double bonds.
- These advantageous radicals may contain two, three, four, five or six double bonds.
- the particularly advantageous radicals having 20 or 22 carbon atoms in the fatty acid chain contain up to six double bonds, advantageously three, four, five or six double bonds, more preferably four, five or six double bonds, very particularly preferably five or six. All these radicals are derived from the corresponding fatty acids.
- R 3 in the general formula II is hydrogen, saturated or unsaturated C 2 -C 24 -alkylcarbonyl.
- Suitable alkyl radicals are substituted or unsubstituted, saturated or unsaturated C 2 -C 24 -alkylcarbonyl chains, such as ethylcarbonyl, n-propylcarbonyl, n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta-decylcarbonyl , n-octadecylcarbonyl, n-nonadec
- C 1 -C 22 -alkylcarbonyl radicals such as n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta decylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl containing one or more double bonds are preferred.
- Saturated and / or unsaturated C 10 -C 22 are particularly preferred alkylcarbonyl radicals such as C10-alkylcarbonyl, Cn-alkylcarbonyl, C 2 alkylcarbonyl, C ⁇ 3 alkylcarbonyl, C 14 -Alkylcarbonyi-, C ⁇ 6 -alkylcarbonyl , C- ⁇ 8 - alkylcarbonyl, C 20 -alkylcarbonyl or C 22 -AIkylcarbonylreste, which contain one or more double bonds.
- alkylcarbonyl radicals such as C10-alkylcarbonyl, Cn-alkylcarbonyl, C 2 alkylcarbonyl, C ⁇ 3 alkylcarbonyl, C 14 -Alkylcarbonyi-, C ⁇ 6 -alkylcarbonyl , C- ⁇ 8 - alkylcarbonyl, C 20 -alkylcarbonyl or C 22 -AIkylcarbonylreste, which
- C 16 -C 22 -alkylcarbonyl radicals such as C 16 -alkylcarbonyl, C 8 -alkylcarbonyl, C 20 -alkylcarbonyl or C 22 -alkylcarbonyl radicals, which contain one or more double bonds.
- These advantageous radicals may contain two, three, four, five or six double bonds.
- the particularly advantageous radicals having 20 or 22 carbon atoms in the fatty acid chain contain up to six double bonds, advantageously three, four, five or six double bonds, particularly preferably four, five or six double bonds, very particularly preferably five or six. All of the radicals mentioned are derived from the corresponding fatty acids.
- the abovementioned radicals of R 1 , R 2 and R 3 may be substituted by hydroxyl and / or epoxy groups and / or may contain triple bonds.
- the polyunsaturated fatty acids prepared in the process according to the invention contain at least two, advantageously three, four, five or six double bonds. Particularly advantageously, the fatty acids contain four five or six double bonds.
- the fatty acids produced in the process advantageously have 18, 20 or 22 carbon atoms in the fatty acid chain; the fatty acids preferably contain 20 or 22 carbon atoms in the fatty acid chain.
- saturated fatty acids are little or not reacted with the nucleic acids used in the process.
- the saturated fatty acids have less than 5% of the activity, advantageously less than 3%, more preferably less than 2%, most preferably less than 1; 0.5; 0.25 or 0.125% are implemented.
- These produced fatty acids can be produced as the only product in the process or present in a fatty acid mixture.
- the nucleic acid sequences used in the method according to the invention are isolated nucleic acid sequences which are suitable for polypeptides having ⁇ 9 -elongase, ⁇ 6-desaturase, ⁇ 8-desaturase, ⁇ 6-elongase, ⁇ -5.
- nucleic acid sequences which are advantageous for polypeptides having ⁇ -9-elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6 elongase, ⁇ -5-desaturase, ⁇ -5 are advantageous.
- Encode elongase or ⁇ -4 desaturase activity selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO : 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41 , SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67,
- the substituents R 2 or R 3 in the general formulas I and II independently of one another denote saturated or unsaturated C 18 -C 22 -alkylcarbonyl, particularly advantageously they independently of one another denote unsaturated C 18 , C 20 or C 22 -alkylcarbonyl. with at least two double bonds, advantageously with at least three, four, five or six double bonds, particularly advantageously with at least four, five or six double bonds.
- a preferred embodiment of the method is characterized in that a nucleic acid sequence is additionally introduced into the transgenic plant which codes for polypeptides having ⁇ -3-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO : 87 or SEQ ID NO: 105 or b) nucleic acid sequences which can be derived as a result of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO: 106, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105, which code for polypeptides having at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and have a ⁇ 3-desaturase activity.
- the method is characterized in that a nucleic acid sequence is additionally introduced into the transgenic plant which codes for polypeptides having ⁇ 12-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO : 107, SEQ ID NO: 109 or SEQ ID NO: 195, or b) Nucleic acid sequences which differ from those shown in SEQ ID NO: 108, SEQ ID NO: 110 or SEQ ID NO: 196 as a result of the degenerate genetic code or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107, SEQ ID NO: 109 or SEQ ID NO: 195, which for polypeptides having at least 60% identity at the amino acid level with SEQ ID NO: 108, SEQ ID NO: 110 or SEQ ID NO: 196 and have ⁇ -12 desaturase activity.
- a nucleic acid sequence is additionally introduced into the transgenic plant which codes for polypeptides having ⁇
- ⁇ -12-desaturase sequences can be used alone or in combination with the ⁇ 3-desaturase sequences with the nucleic acid sequences used in the method, which are suitable for ⁇ -9 elongases, ⁇ -6-desaturases, ⁇ -8-desaturases, ⁇ -6.
- Elongases, ⁇ -5-desaturases, ⁇ -5-elongases and / or ⁇ -4-desaturases can be used.
- Table 1 represents the nucleic acid sequences, the organism of origin and the sequence ID number.
- a process for producing large quantities of polyunsaturated fatty acids, especially ERA and EPA, in a transgenic plant has been developed. This method is also suitable for the production of DHA.
- ERA, EPA, DHA or mixtures thereof can be produced.
- a further embodiment of the invention is thus a process for the preparation of compounds of general formula I.
- the method comprising: a) introducing at least one nucleic acid sequence into a plant which codes for a polypeptide having the activity of a ⁇ 6-desaturase activity, and is selected from the group consisting of: i) a nucleic acid sequence with the sequence shown in SEQ ID NO: 193 or SEQ ID NO: 201, ii) nucleic acid sequences which code for the amino acid sequence given in SEQ ID NO: 194 or SEQ ID NO: 202, iii) nucleic acid sequences which are linked to the complementary strand of the hybridize the nucleic acid sequence given in SEQ ID NO: 193 or SEQ ID NO: 201 under stringent conditions, and iv) nucleic acid sequences which are at least 60% identical to the sequence given in SEQ ID NO: 193 or SEQ ID NO: 201, and b ) Introducing at least one nucleic acid sequence into a plant which encodes a polypeptide having ⁇ 6-elongase activity and
- nucleic acid sequences which can be used in the method according to the invention are described in WO 02/26946 ( ⁇ -5-desaturase from Thraustochytrium ssp., SEQ ID NO: 11 and ⁇ -6-desaturase from phytium irregular, SEQ ID NO: 193) and in WO 01 / 59128 ( ⁇ 6-elongase from Physcomitrella patens, SEQ ID NO: 27), which is incorporated herein by reference.
- ERA and EPA were examined either not in transgenic plants but only in microorganisms, or no increase in the ERA and EPA synthesis could be detected in the transgenic plants; Moreover, in these applications, the nucleic acids of the invention were not combined with nucleic acids encoding other enzymes of the fatty acid synthesis pathway.
- oils and / or triglycerides with an advantageously increased compared to oils and / or triglycerides from the wild-type plants content of polyunsaturated fatty acids, especially of ERA, EPA or DHA or mixtures thereof, it may be advantageous to increase the amount of starting material for fatty acid synthesis.
- This can be accomplished, for example, by introducing a nucleic acid encoding a polypeptide having the activity of a ⁇ 12-desaturase and co-expressing it in the organism.
- a nucleic acid sequence is additionally introduced into the transgenic plant which codes for a polypeptide having ⁇ 12-desaturase activity.
- This nucleic acid sequence is particularly preferably selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 195, b) nucleic acid sequences which encode the amino acid sequence shown in SEQ ID NO: 196, c) nucleic acid sequences, which hybridize to the complementary strand of the nucleic acid sequence set forth in SEQ ID NO: 195 under stringent conditions, and d) nucleic acid sequences which are at least 60% identical to the sequence given in SEQ ID NO: 195.
- SEQ ID NO: 195 The nucleic acid sequence of SEQ ID NO: 195 is derived from Calendula officinalis and is described in WO 01/85968, the disclosure of which is also incorporated by reference into the present application.
- ⁇ -12 desaturases oleic acid (C18: 1 ⁇ 9) into linoleic acid (C18: 2 ⁇ 9 - 12) 9 '12 (gamma-linolenic acid GLA) or C18: 2 ⁇ 6' 3 ⁇ 6 9 to C18 ' , the starting materials for the synthesis of ERA, EPA and DHA.
- the ⁇ -12-desaturases used bind fatty acids bound to phospholipids or CoA fatty acid esters, advantageously bound to CoA fatty acid esters. This, if an elongation step has previously taken place, advantageously leads to higher yields of synthesis products, since the elongation in the
- ⁇ 12-desaturase in the transgenic plants leads to a further increase in the ARA content to more than 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%. , 18%, 19% or 20%, more preferably more than 21%, 22%, 23%, 24% or 25%, based on the total lipid content of the plant (cf. Table 3 and 4 and Figure 32).
- the above percentages are by weight.
- nucleic acid sequences may advantageously be introduced into the plants which code for a polypeptide having a ⁇ 5 -ongonase activity.
- nucleic acid sequences coding for ⁇ -5 elongase activity are preferably selected from the group consisting of: a) a nucleic acid sequence having the sequence shown in SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO : 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77 , SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 197, b) Nucleic acid sequences corresponding to those shown in SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID
- the ⁇ -5 elongase genes are expressed under the control of a seed-specific promoter.
- nucleic acid sequences will be introduced into the plants on a common recombinant nucleic acid molecule, each nucleic acid sequence being controlled by a own promoter can be and this promoter can be a seed-specific promoter.
- nucleic acids indicated in the sequence listing are nucleic acids which have a certain degree of identity or homology to the sequences specified in the sequence listing.
- substantially identical enzymatic activity is to be understood as meaning proteins which are at least 20%, 30%, 40%, 50% or 60%, advantageously at least 70%, 80%, 90% or 95%, particularly advantageously at least 96%, 97%, 98% or 99% of the enzymatic activity of the wild-type enzymes.
- the sequences are written to one another (eg gaps can be inserted into the sequence of a protein or a nucleic acid for optimal alignment with the other protein or the other nucleic acid) to create).
- the amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are then compared. If a position in one sequence is occupied by the same amino acid residue or nucleotide as the corresponding site in the other sequence, then the molecules are homologous at that position (ie, amino acid or nucleic acid 'homology' as used herein corresponds to amino acid or nucleic acid "entity").
- the terms homology and identity are to be regarded as synonymous.
- the homology was calculated over the entire amino acid or nucleic acid sequence range.
- a number of programs based on different algorithms are available to the person skilled in the art.
- the algorithms of Needleman and Wunsch or Smith and Waterman provide particularly reliable results.
- the program PileUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math.
- Elongase gene All and all of these nucleotide variations and resulting amino acid polymorphisms in ⁇ 12-desaturase, ⁇ 6-desaturase, ⁇ 5-desaturase, ⁇ 5-elongase and / or ⁇ 6-elongase, which are the result of natural variation and which do not substantially alter the enzymatic activity should be included within the scope of the invention.
- Substantial enzymatic activity of the ⁇ -12-desaturase, ⁇ -6-desaturase, ⁇ -5 elongase, ⁇ -6 elongase or ⁇ -5-desaturase used in the process according to the invention is to be understood as meaning that they are different from those given by the sequence and their derivatives coded proteins / enzymes in comparison nor an enzymatic activity of at least 10%, preferably of at least 20%, more preferably of at least 30%, 40%, 50% or at least 60% and most preferably of at least 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99%, and thus - in the metabolism of compounds required for the construction of fatty acids, fatty acid esters such as diacylglycerides and / or triacylglycerides in a plant or plant cell or participate in the transport of molecules across membranes, where C 18 , C 20 or C 22 carbon chains in the fatty acid molecule with double bonds at least two, preferably three, four or five positions are meant.
- nucleic acid molecules which bind under stringent conditions to the complementary strand of ⁇ -12-desaturase, ⁇ -6-desaturase, ⁇ -5-desaturase, ⁇ -5 elongase and / or ⁇ -4-desaturase Hybridize ⁇ 6-elongase nucleic acids.
- hybridized under stringent conditions is intended to describe hybridization and washing conditions under which nucleotide sequences that are at least 60% homologous to one another usually remain hybridized to one another.
- the conditions are preferably such that sequences that are at least about 65%, 70%, 80% or 90%, preferably at least about 91%, 92%, 93%, 94% or 95%, and most preferably at least about 96%, 97 %, 98%, 99% or more are homologous to each other, usually remaining hybridized to each other.
- stringent conditions are known to those skilled in the art and e.g. in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
- a preferred, non-limiting example of stringent hybridization conditions are hybridizations in 6x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by one or more washes in 0.2x SSC, 0.1 % SDS at 50 to 65 ° C. It is known to the person skilled in the art that these hybridization conditions differ depending on the type of nucleic acid and, for example, if organic solvents are present, with regard to the temperature and the concentration of the buffer.
- the hybridization temperature is for example, under "standard hybridization conditions" depending on the type of nucleic acid between 42 ° C and 58 ° C in aqueous buffer at a concentration of 0.1 to 5 x SSC (pH 7.2). If organic solvent, for example 50% formamide, is present in the abovementioned buffer, the temperature under standard conditions is about 42 ° C.
- the hybridization conditions are for example, under “standard hybridization conditions" depending on the type of nucleic acid between 42 ° C and 58 ° C in aque
- DNA hybrids for example 0.1 x SSC and 20 ° C to 45 ° C, preferably 30 ° C to 45 ° C.
- the hybridization conditions for DNA: RNA hybrids are, for example, 0.1 x SSC and 30 ° C to 55 ° C, preferably 45 ° C to 55 ° C.
- nucleotide substitutions, additions or deletions into a nucleotide sequence, it is possible to produce an isolated nucleic acid molecule which is responsible for a ⁇ 12-desaturase, ⁇ 6-desaturase, ⁇ 5-desaturase, ⁇ 5-elongase and / or or ⁇ 6-elongase encoded with one or more amino acid substitutions, additions or deletions.
- Mutations can be introduced into one of the sequences by standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis.
- conservative amino acid substitutions are made on one or more of the predicted nonessential amino acid residues.
- amino acid residue is replaced with an amino acid residue having a similar side chain.
- families of amino acid residues have been defined with similar side chains. These families include amino acids with basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), uncharged polar side chains (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (eg Alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg, threonine, valine, isoleucine) and aromatic side chains (eg, tyrosine, phenylalanine, tryptophan, histidine).
- Desaturase, ⁇ -6-desaturase, ⁇ -5-desaturase, ⁇ -5 elongase or ⁇ -6 elongase is thus preferably exchanged for another amino acid residue from the same side chain family.
- the mutations may be introduced randomly over all or part of the ⁇ 12-desaturase, ⁇ 6-desaturase, ⁇ 5-desaturase, ⁇ 5-elongase or ⁇ 6-elongase encoding sequence
- saturation mutagenesis and the resulting mutants can be prepared by recombinant expression according to the here described ⁇ -12-desaturase, ⁇ -6-desaturase, ⁇ -5-desaturase, ⁇ -5-elongase or ⁇ -6.
- Elongase activity can be screened to identify mutants that have retained ⁇ 12-desaturase, ⁇ 6-desaturase, ⁇ 5-desaturase, ⁇ 5-elongase or ⁇ 6-elongase activity.
- the polyunsaturated fatty acids prepared in the process according to the invention contain at least two, preferably three, four, five or six double bonds. Most preferably, the fatty acids contain four, five or six double bonds. Fatty acids produced in the process preferably have a length of 20C or 22C atoms.
- saturated fatty acids are little or not reacted with the nucleic acids used in the process. Little is understood to mean that, compared to polyunsaturated fatty acids, the saturated fatty acids are less than 5%, preferably less than 3%, more preferably less than 2%, most preferably less than 1%; 0.5; 0.25 or 0.125% of the activity are reacted.
- the fatty acids produced may be the sole product of the process or may be present in a fatty acid mixture.
- the polyunsaturated fatty acids produced in the process are advantageously bound in membrane lipids and / or triacylglycerides, but may also be present as free fatty acids or bound in the form of other fatty acid esters in the organisms.
- the different fatty acids bound in the triacylglycerides can thereby be derived from short-chain fatty acids having 4 to 6 C atoms, medium-chain fatty acids having 8 to 12 C atoms or long-chain fatty acids having 14 to 24 C atoms, preferably the long-chain fatty acids are particularly preferred the long-chain fatty acids LCPUFAs of C 18 , C 20 and / or C 12 fatty acids, very particularly preferably the long-chain fatty acids LCPUFAs of C 20 and / or C 22 fatty acids such as ERA, EPA, DHA or their combination ,
- fatty acid esters with polyunsaturated C 18 , C 20 and / or C 22 fatty acid molecules having at least two double bonds in the fatty acid ester, advantageously having at least three, four, five or six double bonds in the fatty acid ester, particularly advantageously at least four, five or six double bonds in the fatty acid ester, most preferably made of at least five or six double bonds in the fatty acid ester.
- the fatty acid esters with polyunsaturated C 18 , C 2 o and / or C 22 fatty acid molecules advantageously with polyunsaturated C 20 and / or C 22 fatty acid molecules can be prepared from the plants used for the preparation of the fatty acid esters, in the form of an oil or lipid, for example in the form of compounds such as sphingolipids, phosphoglycerides, lipids, glycolipids such as glycosphingolipids, phospholipids such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol, monoacylglycerides, diacylglycerides, triacylglycerides or other fatty acid esters such as the acetyl
- CoenzymeA esters which contain the polyunsaturated fatty acids containing at least two, three, four, five or six, preferably four, five or six, more preferably five or six double bonds.
- they are isolated in the form of their diacylglycerides, triacylglycerols and / or in the form of phosphatidylcholine, more preferably isolated in the form of triacylglycerols.
- the polyunsaturated fatty acids are also included as free fatty acids or bound to other compounds in the plants.
- the various compounds mentioned above are present in the organisms in an approximate distribution of 80 to 90% by weight of triglycerides, 2 to 5% by weight of diglycerides, 5 to 10% by weight of monoglycerides, 1 to 5 wt .-% of free fatty acids, 2 to 8 wt .-% phospholipids ago, wherein the sum of the various compounds to 100 wt .-% complements.
- the LCPUFAs produced have a content of at least 3, 5, 6, 7 or 8% by weight. , preferably of at least 9, 10, 11, 12, 13, 14 or 15 wt .-%, preferably of at least 16, 17, 18, 19 or 20 wt .-%, particularly preferably of at least 21, 22, 23, 24 or 25% by weight, very particularly preferably at least 26, 27, 28, 29 or 30% by weight, based on the total fatty acids in the transgenic organisms, advantageously in the seed of the transgenic organisms
- C 18 and / or C 20 fatty acids present in the host organisms become at least 10%, advantageously at least 20%, particularly advantageously at least 30%, very particularly advantageously at least 40% in the corresponding products such as ERA, EPA, DPA or DHA, to name but a few.
- the fatty acids are prepared in bound form.
- Advantageously at least 21, 22, are advantageous , 23, 24 or 25 wt .-%, particularly advantageously made of at least 26, 27, 28, 29 or 30 wt .-% based on the total fatty acids in the seeds of the transgenic plants.
- polyunsaturated C 20 and / or C 22 fatty acids having four, five or six double bonds in the molecule with a content of all such fatty acids of at least 15, 16, 17, 18, 19 or 20% by weight are advantageously used.
- % advantageously at least 21, 22, 23, 24 or 25 wt .-%, particularly advantageously at least 26, 27, 28, 29 or 30 wt .-%, most particularly of at least 31, 32, 33, 34 or 35 wt .-% based on the total fatty acids produced in the seeds of the transgenic plant.
- ERA is used with a content of at least 3, 5, 6, 7, 8, 9 or 10% by weight, advantageously of at least 11, 12, 13, 14 or 15% by weight, preferably of at least 16, 17, 18, 19 or 20% by weight, more preferably at least 21, 22, 23, 24 or 25% by weight, most preferably at least 26% by weight, based on the total lipid content in the seeds transgenic plants.
- EPA is used in the process according to the invention with a content of at least 0.2; 0.3; 0.4; 0.5; 0.6; 0.7; 0.8; 0.9 or 1 wt .-%, advantageously of at least 2, 3, 4 or 5 wt .-%, preferably of at least 6, 7, 8, 9 or 10 wt .-%, particularly preferably of at least 11, 12, 13, 14 or 15 wt .-% and most preferably of at least 16 wt .-%, based on the total lipid content in the seeds of the transgenic plants prepared.
- DHA is used in the process according to the invention with a content of at least 0.01 or 0.02% by weight, advantageously of at least 0.03 or 0.05% by weight, preferably of at least 0.09 or 0.1% by weight. %, more preferably at least 0.2 or 0.3% by weight and most preferably at least 0.35% by weight, based on the total lipid content in the seeds of the transgenic plants.
- these unsaturated fatty acids can be brought to the sn1, sn2 and / or sn3 position of the advantageously prepared triglycerides.
- ERA arachidonic acid
- EPA eicosapentaenoic acid
- DHA .omega.-6-docosapentaenoic acid
- a DHA-containing lipid and / or oil should be less than 15, 14, 13, 12 or 11 wt .-%, advantageously less than 10, 9, 8, 7, 6 or 5 wt .-%, more preferably less than 4 , 3, 2 or 1 wt .-% EPA and / or ERA. Therefore, in an EPA-containing lipid and / or oil should be less than 15, 14, 13, 12 or 11 wt .-%, advantageously less than 10, 9, 8, 7, 6 or 5 wt .-%, more preferably less than 4 , 3, 2 or 1 wt .-% ERA contained.
- ARA-containing lipid and / or oil should therefore less than 15, 14, 13, 12 or 11 wt .-%, advantageously less than 10, 9, 8, 7, 6 or 5 wt .-%, particularly advantageously less than 4, 3, 2 or 1 wt .-% EPA and / or DHA contained.
- mixtures of various polyunsaturated C 20 and / or C 22 fatty acids in one product may also be desirable.
- DHA-containing lipids and / or oils at least 1, 2, 3, 4 or 5 wt .-% ERA and / or EPA, preferably at least 6, 7 or 8 wt .-%, particularly preferably at least 9, 10, 11, 12, 13, 14 or 15 wt .-%, most preferably at least 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 wt .-% based on the total lipid content in the Contain seeds of transgenic plants.
- the precursors should advantageously not more than 20 wt .-%, preferably not more than 15 wt .-%, more preferably not more than 10 wt .-%, most preferably not more than 5 wt .-% based on the amount of the respective Final product.
- a transgenic plant only ERA, EPA or only DHA are advantageously bound in the process according to the invention or prepared as free acids. If the compounds ERA, EPA and DHA are produced simultaneously, they are advantageously used in a ratio of at least 1: 1: 2 (EPA: ARA: DHA), more preferably at least 1: 1: 3, preferably 1: 1: 4 preferably prepared from 1: 1: 5. If the compounds ERA and EPA are produced simultaneously, they are advantageously used in a ratio of at least 1: 6 (EPA: ARA), preferably at least 1: 8, preferably at least 1:10, more preferably at least 1:12 in the plant produced.
- Fatty acid esters or fatty acid mixtures which have been prepared by the process according to the invention advantageously contain 6 to 15% palmitic acid, 1 to 6% stearic acid; 7 - 85% of oleic acid; 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachidic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids in each case based on 100% and on the total fatty acid content of the organisms.
- the fatty acid esters or fatty acid mixtures prepared by the process according to the invention advantageously contain fatty acids selected from the group of the fatty acids erucic acid (13-docosaic acid), sterculic acid (9,10-methylene octadec-9-enoic acid), malvalic acid (8,9 Methylene heptadec-8-enoic acid), chaulmo-gruoic acid (cyclopentene-dodecanoic acid), furan fatty acid (9,12-epoxy-octadeca-9, 11-dienoic acid), vernonic acid (9,10-epoxyoctadec-12-enoic acid), taric acid ( 6-octadecynoic acid), 6-nonadecynoic acid, santalbinic acid (t11-octadecen-9-ynoic acid), 6,9-octadecenynoic acid, pyrulic acid (t10-hepta
- Octadecatrienoic acid catalpinic acid (9t11t13c-octadecatrienoic acid), elecetic acid (9c11t13t octadecatrienoic acid), jacric acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c-octadecatrienoic acid), parinaric acid (9c11t13t15c octadecatetraenoic acid), pinolenic acid (all-cis-5,9,12-octadecatrienoic acid), labialic acid (5, 6-octadecadienenoic acid), ricinoleic acid (12-hydroxyoleic acid) and / or coriolinic acid (13-hydroxy-9c, 11t-octadecadienoic acid).
- the abovementioned fatty acids are generally advantageously present only in traces in the fatty acid esters or fatty acid mixtures prepared by the process according to the invention, that is to say they are less than 30%, preferably less than 25%, 24%, 23%, based on the total fatty acids. , 22% or 21%, more preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, most preferably less than 4%, 3%, 2% or 1% ago.
- these abovementioned fatty acids come to less than 0.9%, based on the total fatty acids; 0.8%; 0.7%; 0.6%; or 0.5%, more preferably less than 0.4%; 0.3%; 0.2%; 0.1% before.
- the nucleic acid sequences according to the invention or the nucleic acid sequences used in the method according to the invention can increase the yield of polyunsaturated fatty acids, especially of ERA and EPA but also DHA, by at least 50, 80 or 100%, advantageously at least 150, 200 or 250%, more preferably at least 300, 400, 500, 600, 700, 800 or 900%, most preferably at least 1000, 1100, 1200, 1300, 1400 or 1500% relative to the non-transgenic parent plant of, for example, a plant such as Brassica juncea, Brassica napus See Camelina sativa, Arabidopsis thanliana or Linum usitatissimum for comparison in the GC analysis see Examples.
- the polyunsaturated C 20 - and / or C 2 -fatty acids having four, five or six double bonds in the molecule in the seed of plants which produce no or only very small amounts of C 12 : 0 or C14: 0 fatty acids.
- Even shorter saturated fatty acids such as the fatty acids C4: 0, C6: 0, C8: 0 or C10: 0 should not or only in small amounts in the lipid and / or oil be present. Under only very small amounts are to be understood advantageously amounts which in the GC analysis advantageously under 5, 4, 3, 2 or 1%.
- the fatty acid C16: 0 should advantageously be in the range of 1 to 28% GC area units.
- the fatty acid C16: 0 in GC unit area should be less than 25%, 20%, 15% or 10%, advantageously less than 9%, 8%, 7%, 6% or 5%, more preferably less than 4%, 3%, 2% or 1% or not at all in the lipids, oils and / or free fatty acids.
- the fatty acid C16: 1 should advantageously be less than 1; 0.5; 0.4; 0.3; 0.2 or 0.1%, more preferably 0.09; 0.08; 0.07; 0.06; 0.05; 0.04; 0.03; 0.02 or 0.01 area units in the GC. Most preferably, the fatty acid C16: 1 should not be present in the oils and / or lipids produced by the process. The same applies to the fatty acids C15: 0, C17: 0, C16: 1 ⁇ 3 trans, c16; 4 ⁇ 4 , 7 , ⁇ o , i3 and C18 .
- the isomers (C18: 1 ⁇ 7 , C18: 1 ⁇ 11 ) may also be present in the lipids, oils or free fatty acids. Advantageous in amounts, measured as GC area units, of less than 5%, 4%, 3%, 2% or 1%.
- the fatty acids C20: 0, C20: 1, C24: 0 and C24: 1 should each be in a range of 0 to 1%, 0 to 3% and 0 to 5% area units in the GC, respectively.
- DGLA dihomo- ⁇ -linolenic acid
- DGLA and ERA should be present in a ratio of from 1: 1 to 1: 100, preferably from 1: 2 to 1:80, more preferably from 1: 3 to 1:70, most preferably from 1: 5 up to 1:60 arise.
- DGLA and EPA should be present in a ratio of from 1: 1 up to 1: 100, advantageously from 1: 2 up to 1:80, more preferably from 1: 3 up to 1:70, most preferably from 1: 5 up to 1:60.
- the lipids and / or oils produced in the process according to the invention should advantageously have a high proportion of unsaturated fatty acids of polyunsaturated fatty acids of at least 30, 40 or 50% by weight, advantageously of at least 60, 70 or 80% by weight, based on the Total fatty acid content in the seeds of the transgenic plants amount.
- All saturated fatty acids together should advantageously account for only a small proportion in the plants preferably used for the process according to the invention.
- a small proportion in this context is a proportion in GC area units of less than 15%, 14%, 13%, 12%, 11% or 10%, preferably less than 9%, 8%, 7% or 6% understand.
- the advantageous in the process as host plants containing the introduced via different methods used in the process genes for the synthesis of polyunsaturated fatty acids advantageously have a higher oil content than protein content in the seed, advantageous plants have a ⁇ I- / protein content ratio of 5 to 1, 4 to 1, 3 to 1, 2 to 1 or 1 to 1.
- Advantageous host plants used in the process should on the triglyceride in sn1, sn2 and sn3 position a distribution of the unsaturated fatty acids such as oleic acid, linoleic acid and linolenic acid, which are the starting compounds in the process according to the invention for the synthesis of polyunsaturated fatty acids, as shown in the following Table 5, wherein lines Nos. 1-7 represent various advantageous alternatives of such distributions.
- the name nv does not exist.
- Row 1 Arachis hypogaea
- Row 2 Brassica napus
- Row 3 Glycine max
- Row 4 Linum usitatissimum
- Row 5 Zea mays
- Row 6 Olea europaea
- Row 7 Theobroma cacao.
- Host plants which are advantageous for the method are those which have a high proportion of oleic acid, ie of at least 40, 50, 60 or 70% by weight, based on the total fatty acid content of the plant, in comparison to linoleic acid and / or linolenic acid in the lipids and / or oils particularly in the triglyceride such as Anarcardium occidentale, Argania spinosa, Bombax malabaricum, Brassica napus, Butyrospermum parkii, Highly oil thistle (Carthamus tinctorius), Citrullus colocythis, Corylus avellana, Curcurbita foetidissima, Curcurbita pepo, Guizotia abyssinica, high oleic acid Sunflower (Helianthus annus), Macadamia intergrifolia, Nigella sativa, Olea europaea, Papaver somniferium, Passiflor
- Advantageous plants such as Actinidia chinensis, Aleurites moluccana, Arnebia griffithii, Brassica alba, Brassica hirta, Brassica nigra, Brassica juncea, Brassica carinata, Camelina sativa, Cannabis sativa, Echium rubrum, Echium vulgaris, Humulus lupulus, Juglans regia, Linum usitatissimum, Ocimum spp ., Perilla frutescens, Portulaç ⁇ o oleracea, Prunus cerasus, Salicornia bigelovii, Salvia hispanica are also those which have a high proportion of ⁇ -linolenic acid in the lipid and / or oil of the plant, that is, a proportion of ⁇ -linolenic acid of at least 10 , 15 or 20 wt .-%, advantageously of at least 25, 30, 35, 40, 45 or 50 wt
- Very particularly advantageous plants also show, for the arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid produced in the process, a preference for the sn2 position in the triglyceride in relation to positions sn1 and sn3 of advantageously 1: 1.1: 1; 1: 1.5: 1 to 1: 3: 1.
- Plants used for the method should advantageously have an erucic acid content of less than 2% by weight based on the total fatty acid content of the plant.
- the content of saturated fatty acids C16: 0 and / or C18: 0 should advantageously be less than 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10% by weight, advantageously less than 9.8 , 7, 6 or 5 wt .-% based on the total fatty acid content of the plant.
- longer fatty acids such as C20: 0 or C22: 1 should not at all or in only small amounts advantageously less than 4, 3, 2 or 1 wt .-%, advantageously less than 0.9; 0.8; 0.7; 0.6; 0.5; 0.4; 0.3; 0.2 or 0.1% by weight, based on the total fatty acid content of the plant, in the plants used in the process.
- no or only small amounts of C16: 1 are present as fatty acid in the plants used for the method according to the invention.
- Small amounts are to be understood as meaning contents of fatty acids which are less than 4, 3, 2 or 1% by weight, advantageously less than 0.9; 0.8; 0.7; 0.6; 0.5; 0.4; 0.3; 0.2 or 0, 1 wt .-% based on the total fatty acid content of the plant.
- soybean oilseed rape mustard, camelina, flax, sunflower, oil palm, cotton, sesame, corn, olive oilseed rape, camelina, linseed Sunflower is gladly taken in the procedure as a host plant.
- chemically pure polyunsaturated fatty acids or fatty acid compositions can be prepared by the methods described above.
- the fatty acids or the fatty acid compositions from the plants are advantageously isolated the plant seeds in a known manner, for example by breaking the seeds such as grinding and subsequent extraction, distillation, crystallization, chromatography or combinations of these methods.
- These chemically pure fatty acids or Fatty acid compositions are advantageous for applications in the food, cosmetics and especially pharmaceutical industry.
- plants which are capable of synthesizing fatty acids are suitable as plants for the process according to the invention.
- Advantageous plants are selected from the group of the plant families Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Compositae, Convolvulaceae, Cruciferae, Cucurbitaceae, Eleaganaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gramineae , Juglandaceae, Lauraceae, Leguminosae, Linaceae, Malvaceae, Moringaceae, Marchantiaceae, Onagraceae, Olacaceae, Oleaceae, Papaveraceae, Piperaceae,
- the following plants may be selected from the group: Anacardiaceae such as the genera Pistacia, Mangifera, Anacardium e.g. the genus and species Pistacia vera [pistachio], Mangifer indica [Mango] or Anacardium occidentale [cashew], Asteraceae such as the genera Artemisia, Calendula, Carthage, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta, Tagetes, Valeriana e.g. the genus and species Artemisia sphaerocephala, Calendula officinalis [gardening marigold], Carthamus tinctorius [safflower], Centaurea cyanus
- Anacardiaceae such as the genera Pistacia, Mangifera, Anacardium e.g. the genus and species Pistacia vera [pistachio], Mangifer indica [Mango] or Anacardium occidentale [cashew
- Ricinus communis such as the genera Pisum, Albizia, Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa, Medicago, Glycine, Dolichos, Phaseolus, Soy eg the genera and species Pisum sativum, Pisum atvense, Pisum humile [Pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Alb
- Marchantiaceae such as the genus Marchantia e.g. the genera and species Marchantia berteroana, Marchantia foliacea, Marchantia macropora, Musaceae such as the genus Musa e.g. the genera and species Musa nana, Musa acuminata, Musa paradisiaca, Musa spp.
- Onagraceae such as the genera Camissonia, Oenothera e.g. the genera and species Oenothera biennis, Oenothera grandiflora or Camissonia brevipes [evening primrose], Palmae such as the genus Elacis e.g.
- Papaveraceae such as the genus Papaver e.g. the genera and species Papaver oriental, Papaver rhoeas, Papaver dubium [poppy], Pedaliaceae such as the genus Sesamum e.g. the genus and species Sesamum indicum [sesame], piperaceae such as the genera Piper, Artanthe, Peperomia, Steffensia e.g.
- Hordeum vulgare the genera and species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon Hordeum aegiceras, Hordeum hexastichonum, Hordeum hexastichum, Hordeum irregular, Hordeum sativum, Hordeum secalinum [Barley], Seeale cereale [Rye], Avena sativa , Avena fatua, Avena byzantina, Avena fatua var.
- transgenic plants such as germinate or monocotyledonous plants are used in the process according to the invention.
- Transgenic plants are particularly advantageously used in the process according to the invention which belong to the oil-producing plants, that is to say those which are used for the production of oils, preferably oil-crop plants which contain large amounts of lipid compounds, such as peanut, rapeseed, canola, sunflower, Safflower (Carthamus tinctoria), poppy, mustard, hemp, castor, olive, sesame, calendula, punica, evening primrose, mullein, safflower, wild roses, hazelnut, almond, macadamia, avocado, bay leaf, pumpkin, flax, soybean, pistachios, borage, Trees (oil palm, coconut or walnut) or crops such as corn, wheat, rye, oats, triticale, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species
- oilseed or oil crop plants such as peanut, oilseed rape, canola, sunflower, safflower, poppy seed, saptase f. Mustard, hemp, castor, olive, calendula, punica, evening primrose, pumpkin, flax, soy, borage, trees (oil palm, coconut).
- Particularly preferred are C18: 2 and / or C18: 3 fatty acid rich plants such as sunflower, safflower, tobacco, mullein, sesame, cotton, pumpkin, poppy, evening primrose, walnut, flax, hemp, thistle or safflower.
- plants such as safflower, sunflower, poppy, evening primrose, walnut, flax, Sareptasenf, Camelina or hemp.
- nucleic acids introduced under process steps (a) to (e) or (a) to (c) and the optionally introduced Nukleinsauresequenzen for the ⁇ -3 Desaturases and / or encode for the ⁇ -12-desaturases in addition to introduce additional nucleic acids encoding enzymes of the fatty acid or lipid metabolism.
- genes selected from the group of ⁇ -4-desaturases, ⁇ -5-desaturases, ⁇ -6-desaturases, ⁇ -8-desatuases, ⁇ -9-desaturases, ⁇ -12-desaturases, ⁇ -6-elongases or ⁇ -9 elongases are used in combination with the abovementioned genes for the ⁇ -5-EIongase, ⁇ -6-EIongase and / or ⁇ -3-desaturase, whereby individual genes or several genes can be used in combination.
- the aforementioned geni are used in combination with the ⁇ -6 elongase, ⁇ -5 elongase, ⁇ -5-desaturase, ⁇ -6-desaturase and / or ⁇ -12-desaturase according to the invention
- genes selected from the group of ⁇ -8-desaturases, ⁇ -9-desaturases, ⁇ -5 elongases or ⁇ -9 elongases in combination with the abovementioned genes.
- nucleic acids used in the method according to the invention which code for polypeptides with ⁇ 6-elongase, ⁇ 6-desaturase, ⁇ 5-desaturase and / or ⁇ 12-desaturase activity, advantageously in combination with nucleic acid sequences, which code for polypeptides of the fatty acid or lipid metabolism such as polypeptides with ⁇ -8-desaturase or ⁇ -5 or ⁇ -9 elongase activity, in the process according to the invention a wide variety of polyunsaturated fatty acids can be prepared.
- mixtures of the various polyunsaturated fatty acids or individual polyunsaturated fatty acids such as EPA or ERA can be prepared in free or bound form.
- fatty acids derived from C18: 2 fatty acids such as GLA, DGLA or ERA, or fatty acids, which differ from C18: 3 Derived fatty acids, such as SDA, ETA or EPA.
- linoleic acid LA, C18: 2 ⁇ 9,12
- GLA, DGLA and ERA can arise as products of the process which may be present as free fatty acids or bound.
- ⁇ -linolenic acid ALA, C18: 3 ⁇ 9,12,15
- the products of the process can only be SDA, ETA or EPA which, like may be present as free fatty acids or bound.
- ⁇ -6-desaturase and ⁇ -6 elongase Due to the activity of ⁇ -6-desaturase and ⁇ -6 elongase, for example, GLA and DGLA or SDA and ETA are formed, depending on the starting plant and the unsaturated fatty acid contained therein. Preference is given to DGLA or ETA or mixtures thereof. If, in addition, ⁇ 5-desaturase is introduced into the plant, ERA and / or EPA are also formed. If, in addition, genes are also introduced which code for a ⁇ 5-elongase and / or ⁇ 4-desaturase activity, the fatty acids DPA and / or DHA can be prepared in the process according to the invention.
- ERA, EPA and / or DHA or a mixture thereof are synthesized, depending on the fatty acid present in the plant which serves as the starting substance for the synthesis. Since these are biosynthetic chains, the respective end products are not present as pure substances in the organisms. There are always small amounts of precursor compounds in the final product. These minor amounts are less than 20% by weight, preferably less than 15% by weight, more preferably less than 10% by weight, most preferably less than 5, 4, 3, 2 or 1% by weight. based on the end products DGLA, ETA or mixtures thereof or ERA, EPA or mixtures thereof or ERA, EPA, DHA or mixtures thereof.
- the fatty acids can also be fed from the outside.
- Preferred substrates for the production of ERA are linoleic acid (C18: 2 ⁇ 9,12 ), ⁇ -linolenic acid
- Preferred substrates for the production of EPA are the linolenic acid (C18: 3 ⁇ 9,12,15 ), the stearidonic acid (C18: 4 ⁇ 6,9, i2, ⁇ 5) and the eicosatetraenoic acid (C20: 4 ⁇ 8 ' 11 ' 14 '17 ).
- Preferred substrates for the production of DHA are the linoleic acid (C18: 3 ⁇ 9,12,15), stearidonic acid (C18: 4 ⁇ 6 '9-12' 15) eicosatetraenoic acid (C20: 4 ⁇ 8 '11' 14 '17) , EPA and DPA.
- the ⁇ -5 elongases according to the invention have the advantageous property that they do not elongate C 22 -fatty acids to the corresponding C 24 -fatty acids compared to the human elongases or elongases from non-human animals such as those from Oncorhynchus, Xenopus or Ciona. Furthermore, they advantageously do not convert fatty acids having a double bond in the ⁇ -6 position as reacted by the human elongases or the elongases from non-human animals. Particularly advantageous ⁇ -5 elongases preferably convert only unsaturated C 20 -fatty acids. These advantageous ⁇ -5 elongases have some putative transmembrane helixes (5-7).
- C 20 fatty acids are reacted with a double bond in ⁇ 5-position, with ⁇ -3-C 20 fatty acids being preferred (EPA).
- EPA ⁇ -3-C 20 fatty acids
- they have the property that in addition to the ⁇ -5 elongation activity, they advantageously have no or only a relatively low ⁇ -6-EIongase activity respectively.
- the human elongases or non-human animal elongases have approximately equal activity to fatty acids having a ⁇ -6 or ⁇ -5 double bond. These advantageous elongases are referred to as so-called monofunctional elongases.
- the human elongases or the non-human animal will be referred to the opposite multifunkti ⁇ nelle as elongases, in addition to the above-mentioned substrates, monounsaturated C 16 - and C 18 fatty acids, for example, with ⁇ -9 or ⁇ -11 implement double bond.
- GLA is not reacted.
- FIGS. 27 and 28 show the measured substrate specificities of the different elongated gases.
- FIG. 27 shows the specificities of the multifunctional elongases of Xenopus laevis (FIG. 27A), Ciona intestinalis (FIG. 27B) and Oncorhynchus mykiss (FIG. 27C). All of these elongated gases convert a broad spectrum of substrates. This can lead to by-products in the process according to the invention, which have to be converted by further enzymatic activities. These enzymes are therefore less preferred in the process of the invention.
- the preferred monofunctional elongases and their substrate specificity are shown in FIG. Figure 28A shows the specificity of the Ostreococcus tauri ⁇ -5 elongase.
- Advantageous ⁇ -6-EIongases according to the invention are likewise distinguished by a high specificity, that is to say preferably C 18 -fatty acids are elongated.
- they convert fatty acids with a double bond in ⁇ -6 position.
- Particularly advantageous ⁇ -6 elongases advantageously convert C 18 -fatty acids with three or four double bonds in the molecule, these having to contain a double bond in the ⁇ -6 position.
- they have the property that in addition to the ⁇ 6-elongase activity they advantageously have no or only a relatively small ⁇ 5-elongase activity.
- the human elongases or non-human animal elongases have approximately equal activity towards fatty acids having a ⁇ -6 or ⁇ -5 double bond. These advantageous elongases are referred to as so-called monofunctional elongases.
- C18: 4 ⁇ 6, 9, 12, 15 ( stearidonic acid) is also particularly advantageously elongated. SDA is thereby reacted to at least 40% by weight, advantageously to at least 50% by weight, particularly advantageously to at least 60% by weight, very particularly advantageously to at least 70% by weight.
- Particularly advantageous ⁇ -6 elongases show no activity or only a very low activity (less than 0.1% by weight conversion) over the following substrates: C18: 1 ⁇ 6 , C18: 1 ⁇ 9 , C18: 1 ⁇ 11 , C20: 2 ⁇ 11 '14, C20: 3 ⁇ 11' 14-17, C20: 3 ⁇ 8 '11' 14, C20: 4 ⁇ 5 '8' 11 '14, C20: 5 ⁇ 5' 8 '11-14' or ⁇ 17. .1 ⁇ 7,10,13,16
- Figures 29 and 30 and Table 21 represent the measured substrate specificities of the various elongated gases.
- the ⁇ -3-desaturase used in the method according to the invention has the advantageous property that it can desaturate a wide range of ⁇ -6 fatty acids compared to the known ⁇ -3-desaturase, preferably C 20 - and C 22 -fatty acids such as C 20 : 2 -, C 20: 3 -, C 20: -, C 22: 4 - or C 22: 5 fatty acids desaturated. But even the shorter C 18 fatty acids such as C 18: 2 or C 18: 3 fatty acids are advantageously desaturated.
- omega-3-desaturase By virtue of these properties of the omega-3-desaturase, it is advantageously possible to shift the fatty acid spectrum within an organism, advantageously within a plant or a fungus, from the omega-6 fatty acids to the omega-3 fatty acids.
- C 20 -fatty acids are preferably desaturated by the ⁇ -3-desaturase according to the invention. Within the organism, these fatty acids are converted from the existing fatty acid pool to at least 10%, 15%, 20%, 25% or 30% to the corresponding ⁇ -3 fatty acids.
- the ⁇ -3-desaturase has a factor of 10 lower activity, that is, only about 1.5 to 3% of the fatty acids present in the fatty acid pool to the corresponding ⁇ -3 fatty acids implemented.
- Preferred substrate of the ⁇ -3-desaturase according to the invention are the ⁇ -6-fatty acids bound in phospholipids.
- FIG. 19 clearly shows, using the example of the desaturation of dihomo- ⁇ -linoenoic acid [C 20: ⁇ 8,11,14 ], that the ⁇ -3-desaturase advantageously does not differentiate between fatty acids bound to sn 1 or sn 2 position during desaturation. Both at sn1 or sn2 position in the phospholipids bound fatty acids are desaturated.
- PC phosphatidylcholine
- PIS phosphatidylinositol
- PE phosphatidylethanolamine
- ⁇ -4-Desatu lawns used in the erfingungshacken method ⁇ -5-desaturases and ⁇ -6-desaturases have the advantage over the known ⁇ -4-desaturases, ⁇ -5-desaturases and ⁇ -6-desaturases that they fatty acids bonded to phospholipids or CoA fatty acid esters, can advantageously convert CoA fatty acid esters.
- the ⁇ -12-desaturases used bind fatty acids bound to phospholipids or CoA fatty acid esters, advantageously bound to CoA fatty acid esters.
- nucleic acids used in the method according to the invention which code for polypeptides with ⁇ -5-elongase, ⁇ -6-elongase and / or ⁇ -3 desaturase activity, advantageously in combination with nucleic acid sequences coding for polypeptides of the fatty acid or lipid metabolism such as other polypeptides encode with ⁇ -4, ⁇ -5, ⁇ -6, ⁇ -8, ⁇ -12-desaturase or ⁇ -5, ⁇ -6 or ⁇ -9 elongase activity, a wide variety of polyunsaturated fatty acids can be prepared in the process according to the invention.
- mixtures of the various polyunsaturated fatty acids or individual polyunsaturated fatty acids can be prepared in free or bound form.
- fatty acids derived from C18: 2 fatty acids such as GLA, DGLA or ERA, or those derived from C18: 3 fatty acids derive, such as SDA, ETA, EPA or DHA.
- GLA, DGLA and ERA can arise as products of the process which may be present as free fatty acids or bound.
- the fatty acid spectrum can also be shifted towards ⁇ -linolenic acid, DPA and DHA.
- this shift in the fatty acid spectrum is possible only to a limited extent. Such a shift is more advantageous in plants which, as described below, already contain a high proportion of ⁇ -linolenic acid.
- ⁇ -5 elongase By modifying the activity of the enzyme involved in the synthesis ⁇ -5 elongase advantageously in combination with the ⁇ -4, ⁇ -5, ⁇ -6, ⁇ -12-desaturase and / or ⁇ -6 elongase, or the ⁇ -4-, ⁇ -5-, ⁇ -8, ⁇ -12-desaturase, and / or ⁇ -9 elongase can be selectively produced in the aforementioned plants only individual products. Due to the activity of ⁇ -6-desaturase and ⁇ -6 elongase arise For example, GLA and DGLA or SDA and ETA, depending on the starting plant and unsaturated fatty acid. Preference is given to DGLA or ETA or mixtures thereof.
- ⁇ -5-desaturase, the ⁇ -5 elongase and the ⁇ -4-desaturase are additionally advantageously introduced into the organisms in the organisms, then ERA, EPA and / or DHA are additionally produced. This also applies to organisms in which previously the ⁇ -8-desaturase and ⁇ -9 elongase was introduced.
- ERA, EPA or DHA or their mixtures are synthesized, depending on the fatty acid present in the plant, which serves as the starting substance for the synthesis. Since these are biosynthetic chains, the respective end products are not present as pure substances in the organisms. There are always small amounts of precursor compounds in the final product.
- small amounts are less than 20 wt .-%, advantageously less than 15 wt .-%, more preferably less than 10 wt .-%, most preferably less than 5, 4, 3, 2 or 1 wt .-% based to the end product DGLA, ETA or mixtures thereof or ERA, EPA, DHA or mixtures thereof advantageously EPA or DHA or mixtures thereof.
- the trout-derived nucleic acid of SEQ ID NO: 53 used in the method of the invention encodes a protein having high specificity for the two C18: 4 ⁇ 6 ' 9 ' 12 '15 - and C20: 5 ⁇ 5 ⁇ 11
- 17- fatty acids shows, these are precursors for the synthesis of DHA (precursors and synthesis of DHA see Figure 1).
- other fatty acids are elongated by the enzyme.
- the protein encoded by SEQ ID: 53 thus has a specificity for ⁇ 6 and ⁇ 5 fatty acids in addition to a ⁇ 3 double bond (FIG. 2).
- the ⁇ -5 elongase has a keto-acyl-CoA synthase activity, which advantageously extends fatty acid residues of acyl-CoA esters by 2 carbon atoms.
- the fatty acids can also be fed from the outside. For cost reasons, production in the organism is preferred.
- Preferred substrates of ⁇ -3-desaturase are linoleic acid (C18: 2 ⁇ 9,12 ), ⁇ -linolenic acid (C18: 3 ⁇ 6 ' 9,12 ), eicosadienoic acid (C20: 2 ⁇ 11 ' 14 ), dihomo- ⁇ linolenic acid (C20: 3 ⁇ 8 '14 ), the arachidonic acid
- Nucleic acids used in the method according to the invention are advantageously derived from plants such as algae, for example algae of the family Prasinophyceae as from the genera Heteromastix, Mammella, Mantoniella, Micromonas, Nephroselmis, Ostreococcus, Prasinocladus, Prasinococcus, Pseudoscourfielda, Pycnococcus, Pyramimonas, Scherffelia or Tetraselmis such as the genera and Heteromastix longifillis, Mamiella gilva, Mantoniella squamata, Micromonas pusilla, Nephroselmis olivacea, Nephroselmis pyriformis, Nephroselmis rotunda, Ostreococcus tauri, Ostreococcus sp.
- algae for example algae of the family Prasinophyceae as from the genera Heteromastix,
- nucleic acids used are derived from algae of the genera Euglena, Mantoniella or Ostreococcus.
- plants as sources for the nucleic acid sequences used in the method according to the invention are algae such as Isochrysis or Crypthecodinium, algae / diatoms such as Thalassiosira or Phaeodactylum, mosses such as Physcomitrella or Ceratodon.
- algae such as Isochrysis or Crypthecodinium
- algae / diatoms such as Thalassiosira or Phaeodactylum
- mosses such as Physcomitrella or Ceratodon.
- the nucleic acid sequences used in the method according to the invention are derived from an animal of the vertebrate order.
- the nucleic acid sequences are of the vertebrate class; Euteleostomi, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus or Vertebrata, Amphibia, Anura, Pipidae, Xenopus or Evertebrata such as Protochordata, Tunicata, Holothuroidea, Cionidae such as Amaroucium constellatum, Botryllus scheri, Ciona intestinalis, Molgula citrina, Molgula manhattensis, Perophora viridis or Styela partita.
- the nucleic acids originate particularly advantageously from fungi, animals or from plants such as algae or mosses, preferably from the order of the Salmoniformes such as the family Salmonidae such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario, from algae such as the genera Mantoniella or Ostreococcus or from the diatoms such as the genera Thalassiosira or Phaeodactylum or from algae such as Crypthecodinium.
- Salmoniformes such as the family Salmonidae such as the genus Salmo
- Oncorhynchus mykiss Trutta trutta or Salmo trutta fario
- algae such as the genera Mantoniella or Ostreococcus
- diatoms such as the genera Thalassiosira or Phaeodact
- microorganisms such as fungi such as the genus Mortierella, Phytium, e.g. of the genus and species Mortierella alpina, Mortierella elongata, phytium irregular, Phytium ultimum or bacteria
- fungi such as the genus Mortierella, Phytium, e.g. of the genus and species Mortierella alpina, Mortierella elongata, phytium irregular, Phytium ultimum or bacteria
- fungi such as the genus Mortierella, Phytium, e.g. of the genus and species Mortierella alpina, Mortierella elongata, phytium irregular, Phytium ultimum or bacteria
- the genus Shewanella e.g. of the genus and Art Shewanella hanedai can be advantageous in the novel nucleic acid used.
- nucleic acid sequences or their derivative or homologs which code for polypeptides which still possess the enzymatic activity of the proteins encoded by nucleic acid sequences.
- These sequences are used alone or in combination with those for ⁇ 12-desaturase, ⁇ 4-desaturase, ⁇ 5-desaturase, ⁇ 6-desaturase, ⁇ 5-elongase, ⁇ 6-elongase and / or ⁇ 3-desaturase-encoding nucleic acid sequences are cloned into expression constructs and used for introduction and for expression in organisms. By their construction, these expression constructs enable a favorable optimal synthesis of the polyunsaturated fatty acids produced in the process according to the invention.
- the method further comprises the step of obtaining a transgenic plant containing the nucleic acid sequences used in the method, the plant comprising a nucleic acid sequence according to the invention which is responsible for the ⁇ -12 desaturase, ⁇ -4-desaturase, ⁇ 5-desaturase, ⁇ -6
- this method further comprises the step of recovering the oils, lipids or free fatty acids from the seed of the plant as from the seed of one Oil plant such as peanut, canola, canola, flax, hemp, peanut, soybean, safflower, hemp, sunflower or borage.
- Oil plant such as peanut, canola, canola, flax, hemp, peanut, soybean, safflower, hemp, sunflower or borage.
- Cultivation is, for example, culturing in the case of plant cells, tissue or organs on or in a nutrient medium or the whole plant on or in a substrate, for example in hydroponics, potting soil or on arable land.
- a further subject of the invention are gene constructs which contain the nucleic acid sequences according to the invention which code for a ⁇ 5-desaturase, ⁇ 6-desaturase, ⁇ 5-elongase or ⁇ 6-elongase, the nucleic acid being functional with one or more regulatory signals connected is.
- There may be more than one nucleic acid sequence of an enzymatic activity e.g. a ⁇ -12-desaturase, ⁇ -5-desaturase, ⁇ -6-desaturase, ⁇ -5-EIongase and / or ⁇ -6 elongase.
- the nucleic acids used in the method are advantageously subjected to amplification and ligation in a known manner.
- the procedure is based on the protocol of the Pfu DNA polymerase or of a Pfu / Taq DNA polymerase mixture.
- the primers are selected taking into account the sequence to be amplified. Conveniently, the primers should be chosen so that the amplificate comprises the entire codogenic sequence from the start to the stop codon.
- the amplificate is conveniently analyzed. For example, a quantitative and qualitative analysis can be carried out after gel electrophoresis separation.
- the amplificate can be purified according to a standard protocol (eg Qiagen). An aliquot of the purified amplificate is then available for subsequent cloning.
- Suitable cloning vectors are well known to those skilled in the art. These include, in particular, vectors which can be replicated in microbial systems, ie in particular vectors which ensure efficient cloning in yeasts or fungi, and which enable the stable transformation of plants. Particular mention should be made of various binary and co-integrated vector systems suitable for T-DNA-mediated transformation. Such vector systems are usually characterized in that they contain at least the vir genes required for the Agrobacterium-mediated transformation as well as the T-DNA limiting sequences (T-DNA border).
- these vector systems also include other cis-regulatory regions such as promoters and terminator sequences and / or selection markers, with which correspondingly transformed organisms can be identified.
- vir genes and T-DNA sequences are located on the same vector
- binary systems are based on at least two vectors, one of which is vir, but no T-DNA and a second T-DNA, but no carries vir gene.
- the latter vectors are relatively small, easy to manipulate and replicate in both E. coli and Agrobacterium.
- These binary vectors include vectors of the series pBIB-HYG, pPZP, pBecks, pGreen.
- Bin19, pBI101, pBinAR, pGP and pCAMBIA are preferably used according to the invention.
- binary vectors and their use see Hellens et al, Trends in Plant Science (2000) 5, 446-451.
- the vectors can first be linearized with restriction endonuclease (s) and then suitably enzymatically modified. The vector is then purified and an aliquot used for cloning. In cloning, the enzymatically cut and, if necessary, purified amplicon is linked to similarly prepared vector fragments using ligase.
- a particular nucleic acid construct or vector or plasmid construct can have one or more codogenic gene segments.
- the codogenic gene segments in these constructs are functionally linked to regulatory sequences.
- the regulatory sequences include in particular plant sequences such as promoters and terminator sequences.
- the constructs can advantageously be stably propagated in microorganisms, in particular in E. coli and Agrobacterium tumefaciens, under selection conditions and enable a transfer of heterologous DNA into plants or microorganisms.
- nucleic acids used in the method can be introduced into plants and thus used in the transformation of plants, such as those published and cited therein: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida). , Chapter 6/7, pp. 71-119 (1993); F. F. White, Vectors for Gene Transfer to Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds .: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene
- nucleic acids used in the method and / or vectors can thus be used for the genetic modification of a broad spectrum of plants, so that they become better and / or more efficient producers of PUFAs.
- Desaturase protein is possible, so that the yield, production and / or efficiency of the production of polyunsaturated fatty acids in a plant, preferably in an oilseed or oilseed plant, due to this altered protein can be directly influenced.
- the number or activity of ⁇ -12-desaturase, ⁇ -6-desaturase, ⁇ -5 elongase, ⁇ -6 elongase or ⁇ -5-desaturase proteins or genes can be increased so that larger Amounts of gene products and thus ultimately larger amounts of the compounds of general formula I are produced.
- a de novo synthesis in a plant lacking the activity and ability to biosynthesize the compounds prior to introduction of the corresponding gene (s) is possible.
- the number or activity of other genes necessary for the import of nutrients necessary for the biosynthesis of one or more fatty acids, oils, polar and / or neutral lipids may be increased, such that the concentration of these precursors, cofactors or intermediates within the cells or within the storage compartment, thereby further increasing the ability of the cells to produce PUFAs.
- the nucleic acid sequences used in the method are advantageously introduced into an expression cassette which enables expression of the nucleic acids in plants.
- the nucleic acid sequences used for the ⁇ -12-desaturase, ⁇ -6 are
- Desaturase, ⁇ -5 elongase, ⁇ -6 elongase or ⁇ -5-desaturase encode with a or multiple regulatory signals advantageously functionally linked to increase gene expression.
- These regulatory sequences are intended to allow the targeted expression of genes and proteins. Depending on the host organism, this may mean, for example, that the gene is expressed and / or overexpressed only after induction, or that it is expressed and / or overexpressed immediately.
- these regulatory sequences are sequences to which inducers or repressors bind and thereby regulate the expression of the nucleic acid.
- the natural regulatory elements of these sequences may still be present before the actual structural genes and may have been genetically engineered to eliminate their natural regulation and increase expression of the genes.
- the gene construct may also contain one or more so-called “enhancer sequences" operably linked to the promoter which allow for increased expression of the nucleic acid sequence. Additional advantageous sequences may also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminator sequences.
- gene construct gene construct
- only one copy of the genes is present in the expression cassette.
- This gene construct or gene constructs can be expressed together in the host plant.
- the gene construct or the gene constructs can be inserted in one or more vectors and be present freely in the cell or else be inserted in the genome. It is advantageous for the insertion of additional genes in the host genome when the genes to be expressed are present together in a gene construct.
- the regulatory sequences or factors can, as described above, preferably positively influence the gene expression of the introduced genes and thereby increase them.
- enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
- an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
- a further embodiment of the invention is one or more gene constructs which contain one or more sequences represented by SEQ ID NO: 11, SEQ ID NO: 27, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201 or derivatives thereof and for polypeptides according to SEQ ID NO: 12, SEQ ID NO: 28, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202 encode.
- ⁇ -12-desaturase, ⁇ -6-desaturase, ⁇ -5-EIongase, ⁇ -6-elongase or ⁇ -5-desaturase proteins advantageously lead to this a desaturation or elongation of fatty acids, wherein the substrate advantageously has one, two, three or four double bonds and advantageously 18, 20 or 22 carbon atoms in the fatty acid molecule.
- the substrate advantageously has one, two, three or four double bonds and advantageously 18, 20 or 22 carbon atoms in the fatty acid molecule.
- the PUFA biosynthesis genes should advantageously be seed-specifically expressed in oilseeds.
- seed-specific promoters can be used, or such promoters that are active in the embryo and / or in the endosperm.
- Bce4 [WO 91/13980], legumes B4 (LegB4 promoter) [Bäumlein et al., Plant J., 2,2, 1992], Lpt2 and lpt1 (barley) [WO 95/15389 and US Pat , WO95 / 23230], seed-specific promoters from rice, maize and the like.
- Plant gene expression can also be facilitated by a chemically inducible promoter (see review in Gatz 1997, Annu Rev. Plant Physiol Plant Mol. Biol., 48: 89-108).
- Chemically inducible promoters are particularly useful when it is desired that gene expression be in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
- each of the nucleic acids used in the process should be tested for ⁇ -12 desaturase, ⁇ -6-desaturase, ⁇ -5-EIongase, ⁇ -6 elongase and / or ⁇ -5-desaturase are expressed under the control of a separate, preferably a promoter different from the other promoters, since repetitive sequence motifs can lead to instability of the T-DNA or to recombination events.
- the expression cassette is advantageous such that a promoter has a suitable interface, advantageously in a polylinker, for insertion of the nucleic acid to be expressed, and optionally a terminator sequence is behind the polylinker.
- each nucleic acid sequence has its own promoter and optionally its own terminator sequence.
- Such advantageous constructs are disclosed for example in DE 101 02 337 or DE 101 02 338.
- the insertion site or the sequence of the inserted nucleic acids in the expression cassette is not of crucial importance, that is, a nucleic acid sequence may be inserted at the first or last position in the cassette, without thereby significantly affecting its expression.
- different promoters such as the USP, LegB4 or DC3 promoter and different terminator sequences can be used in the expression cassette.
- the transcription of the introduced genes should advantageously be stopped by suitable terminator sequences at the 3 'end of the introduced biosynthesis genes (behind the stop codon). It can be used here e.g. the OCS1 terminator sequence. As with the promoters, different terminator sequences should be used for each gene.
- the gene construct can, as described above, also comprise other genes which are to be introduced into the plants. It is possible and advantageous to introduce into the host plants regulatory genes, such as genes for inducers, repressors or enzymes which interfere by their enzyme activity in the regulation of one or more genes of a biosynthetic pathway, and express. These genes may be of heterologous or homologous origin.
- biosynthesis genes of the fatty acid or lipid metabolism can advantageously be contained in the nucleic acid construct or gene construct, but these genes can also be located on one or more further nucleic acid constructs.
- a gene selected from the group consisting of acyl-CoA dehydrogenase (s), acyl-ACP [ acyl carrier protein] desaturase (s), acyl-ACP thioesterase (s), as biosynthesis gene of the fatty acid or lipid metabolism, Fatty acid acyltransferase (s), acyl-CoA: lysophospholipid acyltransferase (s), fatty acid synthase (s), fatty acid hydroxylase (s), acetyl coenzyme A carboxylase (s), acyl coenzyme A oxidase (n), fatty acid desaturase (s), fatty acid acetylenase (s), Lipoxygenase (s), triacylgly, acyl
- nucleic acid sequences are biosynthesis genes of the fatty acid or lipid metabolism selected from the group of the acyl-CoA: lysophospholipid acyltransferase, ⁇ -3-desaturase, ⁇ -8-desaturase, ⁇ -4-desaturase, ⁇ -9-desaturase, ⁇ -5 elongase and / or ⁇ -9 elongase.
- nucleic acids or genes can be cloned in combination with other elongases and desaturases in expression cassettes, such as those mentioned above, and used for the transformation of plants with the aid of Agrobacterium.
- the regulatory sequences or factors can, as described above, preferably positively influence the gene expression of the introduced genes and thereby increase them.
- enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
- an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
- the expression cassettes can be used in principle directly for introduction into the plant or else be introduced into a vector.
- These advantageous vectors contain the nucleic acids used in the method, which encode the ⁇ -12-desaturases, ⁇ -6-desaturases, ⁇ -5-elongases, ⁇ -6-elongases or ⁇ -5-desaturases , or a nucleic acid construct containing the nucleic acid used alone or in combination with other fatty acid or lipid metabolism biosynthesis genes such as the acyl-CoA: lysophospholipid acyltransferases, ⁇ -3-desaturases, ⁇ -8-desaturases, ⁇ -9-desaturases, ⁇ 3 Desaturases, ⁇ -4-Desatu lawns, ⁇ -5-elongases and / or ⁇ -9-elongases.
- acyl-CoA lysophospholipid acyltransferases
- ⁇ -3-desaturases ⁇ -8-desaturases
- ⁇ -9-desaturases ⁇ 3 Desaturases
- ⁇ -4-Desatu lawns ⁇ -5-elongases and
- vector refers to a nucleic acid molecule that can transport another nucleic acid that is bound to it.
- plasmid a circular double-stranded DNA loop into which additional DNA segments can be ligated.
- viral vector a viral vector, where additional DNA segments can be ligated into the viral genome.
- Certain vectors may autonomously replicate in a host cell into which they have been introduced (eg bacterial vectors of bacterial origin of replication). Other vectors are advantageously integrated into the genome of a host cell upon introduction into the host cell and thereby replicated together with the host genome.
- certain vectors may direct the expression of genes to which they are operably linked. These vectors are referred to herein as "expression vectors”.
- expression vectors suitable for recombinant DNA techniques are in the form of plasmids.
- plasmid and “vector” can be used interchangeably because the plasmid is the most commonly used vector form.
- the invention is intended also other expression vector forms, such as viral vectors that perform similar functions.
- vector is intended to include other vectors known to those skilled in the art, such as phages, viruses such as SV40, CMV, TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA.
- the recombinant expression vectors advantageously used in the method comprise the nucleic acids or the gene construct according to the invention in a form suitable for expression of the nucleic acids used in a host cell, which means that the recombinant expression vectors have one or more regulatory sequences selected on the basis of the Expression used host cells, which is operably linked to the nucleic acid sequence to be expressed include.
- operatively linked means that the nucleotide sequence of interest is bound to the regulatory sequence (s) such that the expression of the nucleotide sequence is possible and they are linked together such that both sequences fulfill the predicted function ascribed to the sequence (eg in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).
- regulatory sequence is intended to include promoters, enhancers, and other expression control elements (eg, polyadenylation signals). These regulatory sequences are described, for example, in Goeddel: Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), or see: Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnolgy, CRC Press, Boca Raton, Florida, Ed .: Glick and Thompson, chapter 7, 89-108, including references therein. Regulatory sequences include those which direct the constitutive expression of a nucleotide sequence in many types of host cells and those which direct the direct expression of the nucleotide sequence only in certain host cells under certain conditions.
- ⁇ -12-desaturases, ⁇ -6-desaturases, ⁇ -5 elongases, ⁇ -6 elongases and / or ⁇ -5-desaturases can be found in unicellular plant cells (such as algae), see Falciatore et al , 1999, Marine Biotechnology 1 (3): 239-251 and references cited therein, and plant cells from higher plants (eg, spermatophytes, such as crops) are expressed.
- plant expression vectors include those described in detail in: Becker, D., Kemper, E., Schell, J., and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left Border ", Plant Mol. Biol. 20: 1195-1197; and Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12: 8711-8721; Vectors for Gene Transfer to Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds .: Kung and R. Wu, Academic Press, 1993, pp. 15-38.
- a plant expression cassette preferably contains regulatory sequences that can direct gene expression in plant cells and that are operatively linked so that each sequence can fulfill its function, such as termination of transcription, for example, polyadenylation signals.
- Preferred polyadenylation signals are those derived from Agrobacterium tumefaciens TD A, such as the gene 3 of the Ti plasmid pTiACH ⁇ known as octopine synthase (Gielen et al., EMBO J. 3 (1984) 835ff.) Or functional equivalents thereof, but all other terminator sequences functionally active in plants are also suitable.
- a plant expression cassette preferably contains other operably linked sequences, such as translation enhancers, for example the overdrive sequence containing the 5'-untranslated tobacco mosaic virus leader sequence encoding the protein / RNA Ratio increased (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).
- the gene to be expressed, as described above, must be operably linked to a suitable promoter that will trigger gene expression in a timely, cell or tissue-specific manner.
- Useful promoters are constitutive promoters (Benfey et al., EMBO J.
- Plant gene expression can also be achieved as described above via a chemically inducible promoter (see an overview in Gatz 1997, Annu Rev. Plant Physiol Plant Mol. Biol., 48: 89-108).
- Chemically inducible promoters are particularly useful when it is desired that gene expression be in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter. Promoters which respond to biotic or abiotic stress conditions are also suitable, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant Mol.
- Suitable noteworthy promoters are the lpt2 'or lpt1-gene promoter from barley or the promoters (WO 95/15389 and WO 95/23230) described in WO 99/16890 from the barley hordein gene, the rice glutelin gene , the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum casirin gene, the rye secalin gene.
- promoters which induce plastid-specific expression since plastids are the compartment in which the precursors as well as some end products of lipid biosynthesis are synthesized.
- Suitable promoters are the viral RNA polymerase promoter described in WO 95/16783 and WO 97/06250, and the Arabidopsis clpP promoter described in WO 99/46394.
- the multiparallel expression of the ⁇ -12-desaturases, ⁇ -6-desaturases, ⁇ -5-elongases, ⁇ -6-elongases and / or ⁇ -5-desaturases used in the method may be desired.
- the introduction of such expression cassettes can be carried out via a simultaneous transformation of a plurality of individual expression constructs or preferably by combining a plurality of expression cassettes on a construct. It is also possible to transform a plurality of vectors each having a plurality of expression cassettes and to transfer them to the host cell.
- Other preferred sequences for use in the functional compound in plant gene expression cassettes are targeting sequences used to direct the gene product into its corresponding cell compartment, for example into the vacuole, the nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, the extracellular space, mitochondria, endoplasmic reticulum, oil bodies, peroxisomes, and other compartments of plant cells are necessary (see review in Kermode, Grit. Rev. Plant Sci. 15, 4 (1996) 285-423 and references cited therein ).
- SEQ ID NO: 11 SEQ ID NO: 27, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201 or their derivatives or homologues coding for polypeptides still possessing the enzymatic activity of the proteins encoded by nucleic acid sequences.
- the method further comprises the step of obtaining a cell or whole plant containing the nucleic acid sequences used in the method, the cell and / or plant having a nucleic acid sequence corresponding to a polypeptide having a ⁇ 12-desaturase , ⁇ 5-desaturase, ⁇ 6-desaturase, ⁇ 5-elongase and / or ⁇ 6-elongase activity, a gene construct or a vector as described above, alone or in combination with other nucleic acid sequences which code for proteins of the fatty acid or lipid metabolism is transformed.
- the cell thus produced is advantageously a cell of an oil-producing organism such as an oil crop such as peanut, rape, canola, flax, hemp, peanut, soy, dyeing safflower, hemp, mustard, sunflower or borage.
- Natural genetic environment means the natural genomic or chromosomal locus in the source organism or presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably at least partially conserved.
- the environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, more preferably at least 1000 bp, most preferably at least 5000 bp.
- a naturally occurring expression cassette for example, the naturally occurring combination of the natural promoter of the nucleic acid sequences used in the method according to the invention with the corresponding ⁇ -12-desaturase, ⁇ -4-desaturase, ⁇ -5-desaturase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -3-desaturase, ⁇ -9 elongase, ⁇ -6-EIongase and / or ⁇ -5 elongase genes - becomes a transgenic expression cassette when expressed by non-natural, synthetic ("artificial") methods such as mutagenization is changed.
- transgenic plants are therefore to be understood as meaning that the nucleic acids used in the process are not in their natural position in the genome of the plant, it being possible for the nucleic acids to be expressed homologously or heterologously.
- transgene also means that the nucleic acids of the invention are in their natural place in the genome of the plant, but that the sequence has been altered from the natural sequence and / or that the regulatory sequences of the natural sequence have been altered.
- Transgenic is preferably understood to mean the expression of the nucleic acids according to the invention or of the nucleic acid sequences used in the method according to the invention at a non-natural site in the genome, ie a homologous or preferably heterologous expression of the nucleic acids is present.
- Preferred transgenic plants are oil seed or oil crop plants.
- plants which are able to synthesize fatty acids, especially unsaturated fatty acids, such as ERA, EPA and / or DHA, and which are suitable for the expression of recombinant genes, are suitable in principle as plants for use in the method according to the invention.
- examples include plants such as Arabidopsis, Asteraceae such as calendula or crops such as soybean, peanut, castor, sunflower, corn, cotton, flax, oilseed rape, coconut, oil palm, dyer safflower (Carthamus tinctorius) or cocoa bean.
- Other useful host cells for the cloning of the nucleic acid sequences used in the method of the invention are further mentioned in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- Plant is derived and / or can be used to produce the transgenic plant.
- Transgenic plants or advantageously their seeds which contain the polyunsaturated fatty acids synthesized in the process according to the invention, in particular ERA, EPA and / or DHA, can advantageously be marketed directly without the synthesized oils, lipids or fatty acids having to be isolated.
- plants in the inventive methods are whole plants and all plant parts, plant organs or plant parts such as leaf, stalk, seeds, root, tubers, anthers, fibers, root hair, stems, embryos, calli, kotelydons, petioles, crop, plant tissue, reproductive tissue, cell cultures, the be derived from the transgenic plant and / or used to produce the transgenic plant.
- the seed includes all seed parts such as the seed shells, epidermis and sperm cells, endosperm or embryonic tissue.
- the process according to the invention is also suitable for the production of polyunsaturated fatty acids, in particular of ERA, EPA and / or DHA in plant cell cultures and subsequent recovery of the fatty acids from the cultures.
- polyunsaturated fatty acids in particular of ERA, EPA and / or DHA
- ERA polyunsaturated fatty acids
- EPA EPA
- DHA dihydroxyacetyl fatty acids
- These may in particular be suspension or callus cultures.
- the compounds prepared in the process according to the invention can also be advantageously isolated from the plants from the plant seeds in the form of their oils, fat, lipids and / or free fatty acids.
- Polyunsaturated fatty acids produced by this process especially ERA, EPA and / or DHA, can be harvested by harvesting the plants or plant seeds either from the culture in which they grow or from the field.
- this method further comprises the step of recovering the oils, lipids or free fatty acids from the plant or from the culture.
- the culture may be, for example, a greenhouse or field crop of a plant.
- the isolation of the oils, lipids or free fatty acids can be carried out by pressing or extraction of the plant parts, preferably the plant seeds.
- the oils, fats, lipids and / or free fatty acids by so-called cold beat or cold pressing can be obtained without supplying heat by pressing.
- the plant parts, especially the seeds, to be easier to digest they are first crushed, steamed or roasted. The thus pretreated seeds can then be pressed or extracted with solvents such as warm hexane. Subsequently, the solvent is removed again.
- the products thus obtained which contain the polyunsaturated fatty acids, further processed, that is refined.
- the mucilages and turbid matter are removed.
- the so-called degumming can be carried out enzymatically or, for example, chemically / physically by adding acid, such as phosphoric acid.
- the free fatty acids are removed by treatment with a base, for example sodium hydroxide solution.
- the product obtained is thoroughly washed with water to remove the lye remaining in the product and dried.
- the products are subjected to bleaching with, for example, bleaching earth or activated carbon.
- the product is deodorized, for example with steam.
- the PUFAs or LCPUFAs C 8 -, C 20 - or C 22 -fatty acid molecules produced by this process are preferably C 20 - or C 22 -fatty acid molecules having at least two double bonds in the fatty acid molecule, preferably three, four, five or six double bonds, especially preferably with four, five or six double bonds.
- These C 18 , C 20 or C 22 fatty acid molecules can be isolated from the plant in the form of an oil, lipid or free fatty acid. Suitable plants are, for example, those mentioned above. Preferred organisms are transgenic plants.
- One embodiment of the invention is therefore oils, lipids or fatty acids or fractions thereof which have been prepared by the method described above, more preferably oil, lipid or fatty acid composition comprising PUFAs derived from transgenic plants.
- the fatty acids obtained in the process are also suitable as starting material for the chemical synthesis of further products of value. They may be used, for example, in combination with each other or solely for the manufacture of pharmaceuticals, foods, animal feed or cosmetics.
- oils, lipids or fatty acids advantageously contain 6 to 15% palmitic acid, 1 to 6% stearic acid as described above; 7 - 85% of oleic acid; 0.5 to 8% of vaccenic acid, 0.1 to 1% of arachidic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids in each case based on 100% and on the total fatty acid content of the organisms.
- polyunsaturated fatty acid in the fatty acid esters or fatty acid mixtures are preferably at least 0.1; 0.2; 0.3; 0.4; 0.5; 0.6; 0.7; 0.8; 0.9 or 1% based on the total fatty acid content of arachidonic acid.
- the fatty acid esters or fatty acid mixtures prepared by the process according to the invention advantageously contain fatty acids selected from the group of the fatty acids erucic acid (13-docosaic acid), sterculic acid (9,10-methylene octadec-9-enoic acid), malvalic acid (8,9 Methylene heptadec-8-enoic acid), chaulmo-gruoic acid (cyclopentene-dodecanoic acid), furan fatty acid (9,12-epoxy-octadeca-9,11-dienoic acid), vernonic acid (9, 10-epoxyoctadec-12-enoic acid), taric acid ( 6- octadecynoic acid), 6-nonadecynoic acid, santalbic acid (t11-octadecen-9-ynoic acid), 6,9-octadecenynoic acid, pyrulic acid (t10-heptade
- the abovementioned fatty acids come in the fatty acid esters or fatty acid mixtures prepared by the process according to the invention usually advantageously only in traces, that is to say they come to less than 30%, preferably less than 30%, preferably less than 25%, 24%, 23%, 22% or 21%, particularly preferably less than 20%, of the total fatty acids, 15%, 10%, 9%, 8%, 7%, 6% or 5%, most preferably less than 4%, 3%, 2% or 1%.
- these aforementioned fatty acids come to less than 0.9% based on the total fatty acids; 0.8%; 0.7%; 0.6%; or 0.5%, more preferably less than 0.4%; 0.3%; 0.2%; 0.1% before.
- fatty acids are generally advantageously present only in traces in the fatty acid esters or fatty acid mixtures prepared by the process according to the invention, that is to say they are less than 30%, preferably less than 25%, 24%, 23%, based on the total fatty acids. , 22% or 21%, more preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, most preferably less than 4%, 3%, 2% or 1% of In another preferred form of the invention, these aforementioned fatty acids are less than 0.9% of the total fatty acids; 0.8%; 0.7%; 0.6%; or 0.5%, more preferably less than 0.4%; 0.3%; 0.2%; 0.1% before.
- the oils, lipids or fatty acids according to the invention comprise at least 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, advantageously at least 11%, 12%, 13%, 14%, 15%, 16% or 17%, most preferably at least 18%, 19%, 20%, 21%, 22%, 23%, 24% or 25% ERA or at least 0.5 %, 1%, 2%, 3%, 4%, 5% or 6%, advantageously at least 7%, 8%, 9%, 10% or 11% especially advantageous at least 12%, 13%, 14%, 15% , 16%, 17%, 18%, 19% or 20% EPA or at least 0.01%, 0.02%, 0.03%, 0.04% or 0.05% or 0.06%, advantageously at least 0.07%, 0.08%, 0.09 or 0.1%, particularly advantageously at least 0.2%, 0.3% or 0.4% of DHA, based on the total fatty acid content of the production organism advantageously
- the nucleic acid sequences according to the invention or the nucleic acid sequences used in the method according to the invention can increase the yield of polyunsaturated fatty acids, especially of ERA and EPA but also DHA, by at least 50, 80 or 100%, advantageously at least 150, 200 or 250%, more preferably at least 300, 400, 500, 600, 700, 800 or 900%, most preferably at least 1000, 1100, 1200, 1300, 1400 or 1500% relative to the non-transgenic parent plant of, for example, a plant such as Brassica juncea, Brassica napus See Camelina sativa, Arabidopsis thanliana or Linum usitatissimum for comparison in the GC analysis see Examples.
- the lipids and / or oils produced in the process according to the invention have a higher proportion of the unsaturated fatty acids oleic acid, linoleic acid and ⁇ -linolenic acid in sn2 position in comparison with the other positions sn1 and sn3. Under higher proportion are ratios of (sn1: sn2: sn3) 1: 1.1: 1; 1: 1.5: 1 to 1: 3: 1.
- arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid produced in the process also show a preference in the lipids and / or oils for the sn2 position in the triglyceride in relation to positions sn1 and sn3 of advantageously 1: 1.1: 1; 1: 1.5: 1 to 1: 3: 1.
- the polyunsaturated C 20 - and / or C 22 -fatty acids having four, five or six double bonds in the molecule in the seed of plants which produce no or only very small amounts of C 12 : 0 or C14: 0 fatty acids.
- Even shorter saturated fatty acids such as the fatty acids C4: 0, C6: 0, C8: 0 or C10: 0 should not or only in small amounts in the lipid and / or oil be present.
- fatty acid C16: 0 should advantageously be in the range of 1 to 28% GC area units.
- the fatty acid C16: 0 in GC unit area should be less than 25%, 20%, 15% or 10%, advantageously less than 9%, 8%, 7%, 6% or 5%, more preferably less than 4%, 3%, 2% or 1% or not at all in the lipids, oils and / or free fatty acids.
- the fatty acid C16: 1 should advantageously be less than 1; 0.5; 0.4; 0.3; 0.2 or 0.1%, more preferably 0.09; 0.08; 0.07; 0.06; 0.05; 0.04; 0.03; 0.02 or 0.01 area units in the GC. Most preferably, the fatty acid C16: 1 should not be present in the oils and / or lipids produced by the process.
- C18: 1 ⁇ 7 , C18: 1 ⁇ 11 may be present in the lipids, oils or free fatty acids.
- the fatty acids C20: 0, C20: 1, C24: 0 and C24: 1 should each be in one range from 0 to 1%, 0 to 3% and 0 to 5% area units in the GC, respectively.
- DGLA and ERA should be present in a ratio of from 1: 1 to 1: 100, advantageously from 1: 2 to 1:80, more preferably from 1: 3 to 1:70, most preferably from 1: 5 up to 1: 60 arise.
- DGLA and EPA should be present in a ratio of from 1: 1 to 1: 100, advantageously from 1: 2 to 1:80, more preferably from 1: 3 to 1:70, most preferably from 1: 5 up to 1:60 arise.
- the lipids, oils and / or free fatty acids produced in the process according to the invention should have a high proportion of unsaturated fatty acids advantageously polyunsaturated fatty acids of at least 30, 40 or 50 wt .-%, advantageously of at least 60, 70 or 80 wt .-% based on the total fatty acid content in the seeds of the transgenic plants.
- All saturated fatty acids together should advantageously only make up a small proportion in the lipids, oils and / or free fatty acids preferably used plants.
- a small proportion in this context is a proportion in GC area units of less than 15%, 14%, 13%, 12%, 11% or 10%, preferably less than 9%, 8%, 7% or 6% understand.
- Lipids, oils and / or free fatty acids produced in the process should advantageously have an erucic acid content of less than 2% by weight, based on the total fatty acid content of the plant.
- no erucic acid should be present in the lipids and / or oils.
- the content of saturated fatty acids C16: 0 and / or C18: 0 should advantageously be less than 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10% by weight, advantageously less than 9.8 , 7, 6 or 5 wt .-% based on the total fatty acid content of the lipids and / or oils.
- longer fatty acids such as C20: 0 or C22: 1 should not at all or, in only small amounts, advantageously less than 4, 3, 2 or 1% by weight, advantageously less than 0.9; 0.8; 0.7; 0.6; 0.5; 0.4; 0.3; 0.2 or 0.1 wt .-% based on the total fatty acid content of the lipids and / or oils.
- little or no C16: 1 is present as the fatty acid.
- fatty acids which are less than 4, 3, 2 or 1% by weight, advantageously less than 0.9; 0.8; 0.7; 0.6; 0.5; 0.4; 0.3; 0.2 or 0.1% by weight, based on the total fatty acid content of the lipids and / or oils.
- oils, lipids, fatty acids or fatty acid mixtures obtained after pressing according to the invention are referred to as so-called crude oils. These still contain all the oil and / or lipid components, as well as compounds that are soluble in these.
- Such compounds are the various tocopherols such as ⁇ -tocopherol, ⁇ -tocopherol, ⁇ -tocopherol and / or ⁇ -tocopherol or phytosterols such as brassicasterol, campesterol, stigmasterol, ⁇ -sitosterol, sitostanol, ⁇ 5 -avenasterol, ⁇ 5 , 24-stigmastadienol , ⁇ 7 -stigmastenol or ⁇ 7 -avenasterol.
- Triterpenes such as germaniol, amyrin, cycloartanol and others may also be included in these lipids and oils.
- lipids and / or oils contain in the process polyunsaturated fatty acids such as ERA, EPA and / or DHA bound in polar and nonpolar lipids such as phospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine, phosphatidylglycerol, galactolipids, monoglycerides, diglycerides or triglycerides only to name a few. Lysophospholipids may also be present in the lipids and / or oils. These components of the lipids and / or oils can be separated by suitable methods. Not included in these crude oils is cholesterol.
- oils, lipids, fatty acids and / or fatty acid composition in feed, food, cosmetics or pharmaceuticals.
- the oils, lipids, fatty acids or fatty acid mixtures according to the invention may be mixed with other oils, lipids, fatty acids or fatty acid mixtures of animal origin, such as those described in the art, for example.
- Fish oils are used. Typical of such fish oils short-chain fatty acids such as C12: 0, C14: 0, C14: 1, branched chain C15: 0, C15: 0, C16: 0 or C16: 1.
- polyunsaturated C16 fatty acids such as C16: 2, C16: 3 or C16: 4, branched chain C17: 0, C17: 1, branched chain C18: 0 and C19: 0 and C19: 0 and C19: 1 are found in fish oil.
- Such fatty acids are typical of fish oils and are rarely or not found in vegetable oils.
- Economically relevant fish oils are e.g. Anchovy oil, menhadne oil, tuna oil, sardine oil, herring oil, marjoram oil, whale oil and salmon oil.
- lipids and / or oils of animal origin may be used for blending with the oils of the invention in the form of crude oils, that is in the form of lipids and / or oils that have not yet been purified, or differentially purified fractions may be used for blending ,
- Another embodiment of the invention is the use of the oil, lipid, fatty acids and / or fatty acid composition in feed, food, cosmetics or pharmaceuticals.
- oils, lipids, fatty acids or fatty acid mixtures according to the invention may be mixed with other oils, lipids, fatty acids or fatty acid mixtures of animal origin, such as those described in the art, for example. Fish oils are used. These oils, lipids, fatty acids or fatty acid mixtures, which consist of vegetable and animal constituents, can also be used for the production of feed, foodstuffs, cosmetics or pharmaceuticals.
- oil is understood as meaning a fatty acid mixture which contains unsaturated, saturated, preferably esterified fatty acid (s). It is preferred that the oil, lipid or fat contain a high proportion of polyunsaturated free or advantageously esterified fatty acid (s), in particular linoleic acid, ⁇ -linolenic acid, dihomo-Y-linolenic acid, arachidonic acid, ⁇ -linolenic acid, stearidonic acid, eicosatetraenoic acid, Eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid has.
- s polyunsaturated free or advantageously esterified fatty acid
- the proportion of unsaturated esterified fatty acids is about 30%, more preferred is a proportion of 50%, even more preferred is a proportion of 60%, 70%, 80%, 85% or more.
- the proportion of fatty acid after conversion of the fatty acids into the methyl esters can be determined by transesterification by gas chromatography.
- the oil, lipid or fat may contain various other saturated or unsaturated fatty acids, eg calendulic acid, palmitic, palmitoleic, stearic, oleic acid, etc. In particular, depending on the starting plant, the proportion of the various fatty acids in the oil or fat may vary.
- the polyunsaturated fatty acids having advantageously at least two double bonds which are produced in the process are, as described above, for example sphingolipids, phosphoglycerides, lipids, glycolipids, phospholipids, monoacylglycerol, diacylglycerol, triacylglycerol or other fatty acid esters.
- the polyunsaturated fatty acids containing, for example, an alkali treatment such as aqueous KOH or NaOH or acid hydrolysis advantageously in the presence of an alcohol such as methanol or ethanol or via an enzymatic cleavage liberate and isolate via, for example, phase separation and subsequent acidification via, for example, H 2 SO 4 .
- an alkali treatment such as aqueous KOH or NaOH or acid hydrolysis
- an alcohol such as methanol or ethanol or via an enzymatic cleavage
- the release of the fatty acids can also be carried out directly without the workup described above.
- Moose and algae are the only known plant systems that produce significant amounts of polyunsaturated fatty acids, such as arachidonic acid (ERA) and / or eicosapentaenoic acid (EPA) and / or docosahexaenoic acid (DHA).
- ERA arachidonic acid
- EPA eicosapentaenoic acid
- DHA docosahexaenoic acid
- Moose contain PUFAs in membrane lipids, while algae, algae-related organisms and some fungi also accumulate significant levels of PUFAs in the triacylglycerol fraction.
- nucleic acid molecules isolated from strains which also accumulate PUFAs in the triacylglycerol fraction are particularly advantageous for the process of the invention and thus for modification of the lipid and PUFA production system in a host, in particular plants such as oilseed crops, for example oilseed rape. Canola, flax, hemp, soy, sunflower, borage. They are therefore advantageous for use in the process according to the invention.
- the nucleic acids used in the process can either be on a separate plasmid after introduction into a plant cell or plant or advantageously integrated into the genome of the host cell.
- integration may be at random or by such recombination as to replace the native gene with the incorporated copy, thereby modulating the production of the desired compound by the cell, or by using a gene in trans such that A gene having a functional expression unit which ensures at least one sequence ensuring the expression of a gene and at least one polyadenylation of a functionally transcribed gene. containing a functional sequence is functionally connected.
- the nucleic acids are brought into the plants via multi-expression cassettes or constructs for multiparallel expression in the organisms, advantageously for multiparallel seed-specific expression of genes.
- co-expression of several genes can not be accomplished merely by introducing the genes onto a common recombinant nucleic acid construct. Rather, individual genes can also be introduced separately - simultaneously or sequentially - on different constructs.
- the use of different selection markers ensures the simultaneous presence in the plant co-expressing all genes.
- This plant may be the product of one or more transformational processes, or else a crossbred product of plants containing one or more of the genes.
- the fatty acids reacted as substrates in the process are preferably reacted in the form of their acyl-CoA esters and / or their phospholipid esters.
- Desaturases which have a specificity for the acyl-CoA esters are advantageously used in the process. This has the advantage that no exchange must take place between the phospholipid esters, which are usually the substrate of desaturation, and the acyl-CoA esters. This eliminates a further enzyme step, which has been shown to be a limiting step in some cases.
- the polyunsaturated C 16 - or C 18 -fatty acids must first be desaturated by the enzymatic activity of a desaturase and then extended by at least two carbon atoms via an elongase. After a round of elongation, this enzyme activity leads to C 18 or C 20 fatty acids and, after two rounds of elongation, to C 20 or C 22 fatty acids.
- the activity of the desaturases and elongases used in the process according to the invention preferably leads to C 18 , C 20 and / or C 2 fatty acids advantageously having at least two double bonds in the fatty acid molecule, preferably having three, four, five or six double bonds, more preferably C.
- 20 - or C 22 - fatty acids having at least two double bonds in the fatty acid molecule, preferably having three, four, five or six double bonds, most preferably four, five or six double bonds in the molecule.
- Particularly preferred products of the method according to the invention are arachidonic acid, eicosapentaenoic acid and / or docosahexaenoic acid.
- the C 18 fatty acids having at least two double bonds in the fatty acid can be extended by the enzymatic activity according to the invention in the form of the free fatty acid or in the form of the esters, such as phospholipids, glycolipids, sphingolipids, phosphoglycerides, monoacylglycerol, diacylglycerol or triacylglycerol.
- esters such as phospholipids, glycolipids, sphingolipids, phosphoglycerides, monoacylglycerol, diacylglycerol or triacylglycerol.
- the preferred biosynthesis site of fatty acids, oils, lipids or fats in the advantageously used plants is, for example, generally the seeds or cell layers of the seed, so that a seed-specific expression of the nucleic acids used in the method is useful.
- the biosynthesis of fatty acids, oils or lipids need not be limited to the seed tissue, but may also be tissue-specific in all other parts of the plant - for example in epidermal cells or in the tubers.
- the polyunsaturated fatty acids prepared in the process can be at least 5%, preferably at least 10%, more preferably at least 20%, very particularly preferably at least 50%. be increased compared to the wild type of organisms that do not contain the nucleic acids recombinantly.
- the polyunsaturated fatty acids produced in the plants used in the process can in principle be increased in two ways. Either the pool of free polyunsaturated fatty acids and / or the proportion of the esterified polyunsaturated fatty acids produced by the process can be increased.
- the process according to the invention increases the pool of esterified polyunsaturated fatty acids in the transgenic organisms.
- Nukleinsauresequenzen that code for polypeptides with ⁇ -5 elongase, wherein the ⁇ 5-Elongasen encoded by the nucleic acid sequences C 20 fatty acids having at least four double bonds in the fatty acid molecule implement; which are advantageously incorporated ultimately in diacylglycerols and / or triacylglycerols.
- Another subject of the invention is thus an isolated nucleic acid sequence which codes for polypeptides with ⁇ -5-EIongase and has the sequence shown in SEQ ID NO: 197.
- Another subject of the invention is an isolated nucleic acid sequence which encodes polypeptides having ⁇ 6-elongase activity and has the sequence shown in SEQ ID NO: 199.
- Yet another subject of the invention is an isolated nucleic acid sequence encoding polypeptides having ⁇ -6 desaturase activity and having the sequence shown in SEQ ID NO: 201.
- the invention also includes a recombinant nucleic acid molecule comprising: a) one or more copies of an active promoter in plant cells, preferably in sperm cells, b) at least one nucleic acid sequence having the sequence shown in SEQ ID NO: 193 or SEQ ID NO: 201 C) at least one nucleic acid sequence with the sequence shown in SEQ ID NO: 11, which codes for a ⁇ -5-desaturase activity, d) at least one nucleic acid sequence with the in SEQ ID NO: 27 or SEQ ID NO: 199, which encodes a ⁇ 6-elongase activity, and e) one or more copies of a terminator sequence.
- aforementioned nucleic acid molecule additionally a nucleic acid sequence with the sequence shown in SEQ ID NO: 195, which encodes a ⁇ -12-desaturase, be included.
- nucleic acid molecule it is additionally possible in the recombinant nucleic acid molecule to additionally contain a nucleic acid sequence with the sequence shown in SEQ ID NO: 197 which codes for a ⁇ 5-elongase.
- Synthase fatty acid hydroxylase (s), acetyl coenzyme A carboxylase (s), acyl coenzyme A oxidase (s), fatty acid desaturase (s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases , Allene oxide synthases, hydroperoxide lyases and fatty acid elongase (s).
- These are preferably genes of the fatty acid or lipid metabolism selected from the group consisting of ⁇ -4-desaturase, ⁇ -8-desaturase, ⁇ -9-desaturase or ⁇ -9 elongase.
- a further subject of the invention are gene constructs which comprise the inventive nucleic acid sequences SEQ ID NO: 11, SEQ ID NO: 27, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199 or SEQ ID NO: 201, wherein the nucleic acid is operably linked to one or more regulatory signals.
- all the nucleic acid sequences used in the method according to the invention are derived from a eukaryotic organism such as a plant, a microorganism such as an alga or an animal.
- the nucleic acid sequences are preferably derived from the order Salmoniformes, Xenopus or Ciona, algae such as Mantoniella, Crypthecodinium, Euglena or Ostreococcus, fungi such as the genus Phytophtora or diatoms such as the genera Thalassiosira or Phaeodactylum.
- an expression cassette may be more than one nucleic acid sequence of an enzymatic activity, e.g.
- ⁇ -12-desaturase ⁇ -4-desaturase, ⁇ -5-desaturase, ⁇ -6-desaturase, ⁇ -5-elongase, ⁇ -6-EIongase and / or ⁇ -3-desaturase.
- the nucleic acids used in the method are advantageously subjected to amplification and ligation in a known manner as described above.
- a modification of the ⁇ -12-desaturase, ⁇ -5-elongase, ⁇ -6 elongase, ⁇ -5-desaturase, ⁇ -4-desaturase, ⁇ -6 Desaturase and / or ⁇ -3-desaturase protein and the other proteins used in the process such as the ⁇ -12-desaturase, ⁇ -9-EIongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ 6-elongase, ⁇ 5-desaturase or ⁇ 4-desaturase proteins is possible, so that the yield, production and / or efficiency of the production of the advantageously polyunsaturated fatty acids in a plant preferably in an oil crop plant due to this modified protein can be directly influenced.
- the number or activity of ⁇ -12-desaturase, ⁇ -3-desaturase, ⁇ -9 elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6 elongase, ⁇ -5 -Desaturase, ⁇ -5-elongase or ⁇ -4-desaturase proteins or genes can be increased so that larger amounts of the gene products and thus ultimately larger amounts of the compounds of general formula I are produced. Also, a de novo synthesis in a plant lacking the activity and ability to biosynthesize the compounds prior to introduction of the corresponding gene (s) is possible. The same applies to the combination with other desaturases or elongases or other enzymes from the fatty acid and lipid metabolism.
- ⁇ -12-desaturase, ⁇ -3-desaturase, ⁇ -9-elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6-elongase, ⁇ -5 Desaturase, ⁇ -5-elongase and / or ⁇ -4-desaturase gene in a plant alone or in combination with other genes in a cell can not only increase the biosynthetic flux to the final product, but also increases the corresponding triacylglycerol composition or be created de novo.
- the number or activity of other genes necessary for the import of nutrients necessary for the biosynthesis of one or more fatty acids, oils, polar and / or neutral lipids may be increased, such that the concentration of these precursors, cofactors or intermediates within the cells or within the storage compartment, thereby further increasing the ability of the cells to produce PUFAs, as described below.
- the isolated nucleic acid molecules used in the method of the invention encode proteins or portions thereof, wherein the proteins or the individual protein or portions thereof contain an amino acid sequence sufficiently homologous to an amino acid sequence represented in the sequences SEQ ID NO: 2, SEQ ID NO 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 , SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO : 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO:
- the proteins or parts thereof encoded by the nucleic acid molecule still have their essential enzymatic activity and the ability to metabolically metabolize compounds necessary for building cell membranes or lipid bodies in organisms in organisms to participate in the transport of molecules through these membranes.
- the proteins encoded by the nucleic acid molecules are at least about 50%, preferably at least about 60%, and more preferably at least about 70%, 80% or 90%, and most preferably at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to those shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26; SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO:
- the homology was calculated over the entire amino acid or nucleic acid sequence range.
- the expert has at his disposal a series of programs based on different algorithms.
- the algorithms of Needleman and Wunsch or Smith and Waterman provide particularly reliable results.
- the program PileUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math.
- Desaturase, ⁇ -5 elongase or ⁇ -4-desaturase is understood to be superior to that represented by the sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45,
- Nucleic acids useful in the method are derived from bacteria, fungi, diatoms, animals such as Caenorhabditis or Oncorhynchus or plants such as algae or mosses such as the genera Shewanella, Physcomitrella, Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Mantoniella, Ostreococcus, Isochrysis, Aleurita, Muscarioides, Mortierella , Borago, Phaeodactylum, Crypthecodinium, especially of the genera and species Oncorhynchus mykiss, Xenopus laevis, Ciona intestinalis, Thalassiosira pseudonona, Mantoniella squamata, Ostreococcus sp., Ostreococcus tauri, Euglena gracilis, Physcomitrella patens, Phytophthora infestans, Fusa
- nucleotide sequences can be used which are suitable for a ⁇ -12-desaturase, ⁇ -3-desaturase, ⁇ -9 elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6 elongase, ⁇ - 5-desaturase, ⁇ -5 elongase or ⁇ -4-desaturase which encode a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO:
- the nucleic acid sequences are used for the ⁇ -12 desaturase, ⁇ -3 desaturase, ⁇ -9-elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6-elongase, ⁇ -5 desaturase , ⁇ -5 elongase or ⁇ -4-desaturase, with one or more regulatory signals advantageously operably linked to increase gene expression.
- These regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host plant, this may mean, for example, that the gene is expressed and / or overexpressed only after induction, or that it is expressed and / or overexpressed immediately.
- these regulatory sequences are sequences that bind to the inducers or repressors and thus regulate the expression of the nucleic acid.
- the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically altered so that natural regulation is eliminated and gene expression increased.
- the gene construct may also advantageously contain one or more so-called “enhancer sequences” functionally linked to the promoter, which allow for increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
- gene construct a gene construct.
- This gene construct or gene constructs can be expressed together in the host organism.
- the gene construct or the gene constructs can be inserted in one or more vectors and be present freely in the cell or else be inserted in the genome.
- the regulatory sequences or factors can, as described above, preferably positively influence the gene expression of the introduced genes and thereby increase them.
- enhancement of the regulatory elements can advantageously be done at the transcriptional level by using strong transcription signals such as Promoters and / or "enhancers" are used.
- an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
- promoters such as the plant promoters CaMV / 35S [Franck et al., Cell 21 (1980) 285-294], PRP1 [Ward et al., Plant. Biol. 22 (1993)], SSU, OCS, Iib4, usp, STLS1, B33, nos or in the ubiquitin or phaseolin promoter.
- inducible promoters such as those described in EP-A-0388186 (benzylsulfonamide-inducible), Plant J.
- Suitable plant promoters are the promoter of cytosolic FBPase or the potato ST LSI promoter (Stockhaus et al., EMBO J. 8, 1989, 2445), the glycine max phosphoribosyl pyrophosphatamidotransferase promoter (Genbank Accession No. U87999) or the nodule-specific promoter described in EP-A-0249676.
- promoters which allow expression in tissues involved in fatty acid biosynthesis.
- seed-specific promoters such as the USP promoter according to the invention but also other promoters such as the LeB4, DC3, phaseolin or napin promoter.
- promoters are seed-specific promoters which can be used for monocots or dicots and US 5,608,152 (napin promoter from rapeseed), WO 98/45461 (oleosin promoter 'Arabidopsis), US 5,504,200 (phaseolin promoter from Phaseolus vulgaris), WO 91/13980 (Bce4 promoter from Brassica), von Baeumlein et al., Plant J., 2, 2, 1992: 233-239 (LeB4 promoter from a legume), these promoters being described for Dicotyledons are suitable.
- the following promoters are suitable, for example, for barley monocotylone lpt-2 or lpt-1 promoter (WO 95/15389 and WO 95/23230), barley hordein promoter and other suitable promoters described in WO 99/16890. It is possible in principle to use all natural promoters with their regulatory sequences, such as those mentioned above, for the new method. It is also possible and advantageous to use synthetic promoters in addition or alone, especially if they mediate seed-specific expression, as described for example in WO 99/16890. In order to achieve a particularly high content of PUFAs, especially in transgenic plants, the PUFA biosynthesis genes should advantageously be seed-specifically expressed in oilseeds.
- seed-specific promoters can be used, or such promoters that are active in the embryo and / or in the endosperm.
- seed-specific promoters can be isolated from both dicotolydone and monocotolydonous plants.
- advantageous promoters are listed above, for example the USP, Vicilin, Napin, Oleosin, Phaseolin, Bce4, LegB4, Lpt2, lpt1, Amy32b, Amy 6-6, Aleurain or Bce4 promoter.
- chemically inducible promoter can be used advantageously in the method according to the invention.
- promoters which are advantageously suitable for expression in soybean are the promoters of the ⁇ -conglycinin ⁇ -heme unit, the ⁇ -conglyinin ⁇ subunit, the Kunitz trypsin inhibitor, the annexin, the glysinin, the albumin 2S, the Legumin A1, Legumin A2 and BD30.
- promoters are the USP, LegB4, Fad3, SBP, DC-3 or Cruciferin820 promoter.
- Advantageous regulatory sequences which are used for the expression of the nucleic acid sequences used in the method according to the invention are terminators for the expression advantageous in soya are the Leg2A3 ', Kti3', Phas3 ', BD30 3' or the AIS3 '.
- terminators are the A7T, OCS, LeB3T or cat terminator.
- each of the nucleic acids used in the method which is responsible for the ⁇ -12-desaturase, ⁇ -3-desaturase ⁇ -9 elongase, ⁇ - 6-desaturase, ⁇ -8-desaturase, ⁇ -6 elongase, ⁇ -5-desaturase, ⁇ -5 elongase and / or ⁇ -4-desaturase are expressed under the control of its own preferably a different promoter, since Repetitive sequence motifs can lead to instability of the T-DNA or to recombination events.
- the gene construct can, as described above, also comprise other genes which are to be introduced into the plant.
- the regulatory sequences or factors used to express the nucleic acids used in the method according to the invention can, as described above, preferably have a positive influence on the gene expression of the introduced genes and thereby increase it.
- These advantageous vectors contain the nucleic acids used in the method which are useful for the ⁇ -12-desaturases, ⁇ -3-desaturases, ⁇ -9-elongases, ⁇ -6-desaturases, ⁇ -8-desaturases, ⁇ -6 Or a nucleic acid construct containing the nucleic acid used alone or in combination with other fatty acid or lipid metabolism biosynthesis genes such as the acyl-CoA: lysophospholipid- Acyltransferases, ⁇ -3-desaturases, ⁇ -4-desaturases, ⁇ -5-desaturases, ⁇ -6-desaturases, ⁇ -8-desatuases, ⁇ -9-desaturases, ⁇ -12-desaturases, ⁇ 3-desaturases, ⁇ -5-elongases, ⁇ -6-elongases and / or ⁇ -9-elongases.
- acyl-CoA lysophospholipid- Acyltransferases
- ⁇ -3-desaturases ⁇ -4-desatura
- the term "vector” refers to a nucleic acid molecule that can transport another nucleic acid to which it is attached.
- the recombinant expression vectors used can be used for the expression of ⁇ -12-desaturases, ⁇ -3-desaturases, ⁇ -9 elongases, ⁇ -6-desaturases, ⁇ -8-desaturases, ⁇ -6 elongases, ⁇ -5-desaturases, ⁇ -5 elongases and / or ⁇ -4 desaturases in prokaryotic or eukaryotic cells. This is advantageous because intermediate steps of the vector construction are often carried out in microorganisms for the sake of simplicity.
- Suitable host cells are further discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- the recombinant expression vector may alternatively be transcribed and translated in vitro using, for example, T7 promoter regulatory sequences and T7 polymerase.
- fusion expression vectors include i.a. pGEX (Pharmacia Biotech Inc., Smith, DB, and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA), and pRIT5 (Pharmacia, Piscataway, NJ), in which glutathione-S Transferase (GST),
- Maltose E-binding protein or protein A is fused to the recombinant target protein.
- suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al. (1988) Gene 69: 301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60 -89).
- Target gene expression from the pTrc vector is based on transcription by host RNA polymerase from a hybrid trp-lac fusion promoter.
- Target gene expression from the pET 11d vector is based on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1).
- This viral polymerase is provided by the host strains BL21 (DE3) or HMS174 (DE3) from a resident ⁇ prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.
- vectors in prokaryotic organisms are known to the person skilled in the art, these vectors are, for example, in E. coli pLG338, pACYC184, the pBR series, such as pBR322, the pUC series, such as pUC18 or pUC19, the M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-ilH 13-B1, ⁇ gtl 1 or pBdCl, in Streptomyces plJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667.
- the expression vector is a yeast expression vector.
- yeast expression vectors for expression in the yeast S. cerevisiae include pYeDesaturased (Baldari et al. (1987) Embo J. 6: 229-234), pMFa (Kurjan and
- Vectors and methods for constructing vectors suitable for use in other fungi, such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, JF Peberdy et al., Eds., Pp.
- yeast vectors are, for example, pAG-1, YEp6, YEp13 or pEMBLYe23.
- the ⁇ -12-desaturases, ⁇ -3-desaturases, ⁇ -9-elongases, ⁇ -6-desaturases, ⁇ -8-desaturases, ⁇ -6-elongases, ⁇ -5-desaturases, ⁇ -5-elongases and / or ⁇ -4 desaturases are expressed in insect cells using baculovirus expression vectors.
- Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series. Series (Lucklow and Summers (1989) Virology 170: 31-39).
- plant expression vectors include those described in detail in: Becker, D., Kemper, E., Schell, J., and Masterson, R.
- a plant expression cassette preferably contains regulatory sequences which can direct gene expression in plant cells and are operably linked so that each sequence can fulfill its function, such as termination of transcription, for example, polyadenylation signals.
- Preferred polyadenylation signals are those derived from Agrobacterium tumefaciens T-DNA, such as the gene 3 of the Ti plasmid pTiACH ⁇ known as octopine synthase (Gielen et al., EMBO J. 3 (1984) 835ff.) Or functional equivalents thereof, as well all other terminators functionally active in plants are suitable.
- a plant expression cassette preferably contains other operably linked sequences, such as translation enhancers, for example the overdrive sequence containing the 5'-untranslated tobacco mosaic virus leader sequence, which is the protein / RNA ratio increases (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).
- translation enhancers for example the overdrive sequence containing the 5'-untranslated tobacco mosaic virus leader sequence, which is the protein / RNA ratio increases (Gallie et al., 1987, Nucl. Acids Research 15: 8693-8711).
- Plant gene expression must be operably linked to a suitable promoter that performs gene expression in a timely, cell or tissue-specific manner.
- useful promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those derived from plant viruses, such as 35S CEMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also US 5352605 and WO 84/02913) or plant promoters, such as the Rubisco small subunit described in US 4,962,028.
- telomeres are preferred sequences necessary to direct the gene product into its corresponding cell compartment (see review in Kermode, Crit., Plant, 15, 4 (1996) 285) -423 and quoted therein References), for example to the vacuole, the nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, extracellular space, mitochondria, endoplasmic reticulum, oily bodies, peroxisomes and other compartments of plant cells. Plant gene expression can also be facilitated by a chemically inducible promoter as described above (see review in Gatz 1997, Annu Rev. Plant Physiol Plant Mol. Biol., 48: 89-108).
- Chemically inducible promoters are particularly useful when it is desired that gene expression be in a time-specific manner.
- Examples of such promoters are a salicylic acid-inducible promoter (WO 95/19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter.
- Promoters which react to biotic or abiotic stress conditions are also suitable promoters, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant Mol. Biol. 22 (1993) 361-366), the heat-inducible hsp80 promoter Tomato (US 5,187,267), the potato alpha-amylase-inducible promoter (WO 96/12814) or the wound-inducible pinll promoter (EP-A-0 375 091).
- the pathogen-induced PRP1 gene promoter Ward et al., Plant Mol. Biol. 22 (1993) 361-366
- the heat-inducible hsp80 promoter Tomato US 5,187,267
- the potato alpha-amylase-inducible promoter WO 96/1281
- the wound-inducible pinll promoter EP-A-0 375 091
- promoters which induce gene expression in tissues and organs in which the fatty acid, lipid and oil biosynthesis take place are preferred in sperm cells such as the cells of the endosperm and the developing embryo.
- Suitable promoters are the rapeseed napin promoter (US Pat. No. 5,608,152), the Vicia faba USP promoter (Baeumlein et al., Mol Gen Genet.
- promoters which induce seed specific expression in monocotyledonous plants such as maize, barley, wheat, rye, rice, etc.
- Suitable noteworthy promoters are the lpt2 or Ipt1 gene promoter from barley (WO 95/15389 and WO 95/23230) or those described in WO 99/16890 (promoters from the barley hordein gene, the rice glutelin gene , the rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, the wheat glutelin gene, the maize zein gene, the oat glutelin gene, the sorghum kasirin gene, the rye secalin gene).
- the multiparallel expression of the ⁇ -12-desaturases used in the process may be desired.
- the introduction of such expression cassettes can be carried out via a simultaneous transformation of a plurality of individual expression constructs or preferably by combining a plurality of expression cassettes on a construct. It is also possible to transform a plurality of vectors each having a plurality of expression cassettes and to transfer them to the host cell.
- promoters which induce plastid-specific expression are particularly suitable.
- Suitable promoters such as the viral RNA polymerase promoter, are described in WO 95/16783 and WO 97/06250, and the Arabidopsis clpP promoter described in WO 99/46394.
- Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
- transformation and “transfection”, conjugation and transduction are intended to encompass a variety of methods known in the art for introducing foreign nucleic acid (eg DNA) into a host cell, including calcium phosphate or calcium chloride coprecipitation, DEAE- Dextran-mediated transfection, lipofection, natural competence, chemically mediated transfer, electroporation or particle bombardment.
- Suitable methods for transforming or transfecting host cells, including plant cells can be found in Sambrook et al.
- the host organisms advantageously used are plant cells, preferably plants or parts thereof.
- plants such as oil seed or oil crop plants containing large amounts of lipid compounds such as oilseed rape, evening primrose, hemp, Diestel, peanut, canola, flax, soybean, safflower, sareptasef, sunflower, borage, or plants such as corn, wheat , Rye, oats, triticale, rice, barley, cotton, cassava, pepper, tagetes, solanaceae plants, such as potato, tobacco, eggplant and tomato, vicia species, pea, alfalfa, bush plants (coffee, cocoa, tea), salix Species, trees (oil plan, coconut) as well as perennial grasses and forage crops.
- Particularly preferred plants according to the invention are oil crop plants, such as soybean, peanut, rapeseed, canola, flax, hemp, evening primrose, sunflower, safflower, trees (oil palm, coconut).
- Another object of the invention is an isolated nucleic acid sequence encoding ⁇ 5-elongase activity polypeptides having the sequence shown in SEQ ID NO: 197, wherein the elongase encoded by the nucleic acid sequence is C 16 - and C 8 fatty acids with one double bond are not elongated. Also, polyunsaturated C 18 fatty acids having a ⁇ 6 double bond or C 22 fatty acids are not reacted. Due to the enzymatic activity, only polyunsaturated C 20 -fatty acids having a ⁇ 5 double bond are advantageously elongated.
- nucleic acid (molecule) additionally comprises, in an advantageous embodiment, those at the 3 'and at the 5' end of the coding gene region untranslated sequence: at least 500, preferably 200, more preferably 100 nucleotides of the sequence upstream of the 5 'end of the coding region and at least 100, preferably 50, more preferably 20 nucleotides of the sequence downstream of the 3' end of the coding gene region.
- An "isolated" nucleic acid molecule is separated from other nucleic acid molecules present in the natural source of the nucleic acid.
- nucleic acid preferably does not have sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (eg, sequences located at the 5 'and 3' ends of the nucleic acid).
- the isolated ⁇ -12-desaturase, ⁇ -3-desaturase, ⁇ -9 elongase, ⁇ -6-desaturase, ⁇ -8-desaturase, ⁇ -6 elongase For example, ⁇ 5-desaturase, ⁇ 5-elongase, or ⁇ 4-desaturase molecules less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb nucleotide sequences naturally, flanking the nucleic acid molecule in the genomic DNA of the cell from which the nucleic acid is derived.
- the nucleic acid molecule used in the method for example a nucleic acid molecule having a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45 , SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ
- a homologous sequence or homologous, conserved sequence regions at the DNA or amino acid level can be identified. These may be used as a hybridization probe as well as standard hybridization techniques (such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) Isolation of other nucleic acid sequences useful in the method can be used.
- nucleic acid molecule comprising a complete sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29 , SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO:
- mRNA can be isolated from cells (eg, by the guanidinium thiocyanate extraction method of Chirgwin et al. (1979) Biochemistry 18: 5294-5299) and cDNA by reverse transcriptase (eg, Moloney MLV reverse transcriptase, available from Gibco / BRL, Bethesda, MD, or AMV Reverse Transcriptase, available from Seikagaku America, Inc., St. Russia, FL).
- reverse transcriptase eg, Moloney MLV reverse transcriptase, available from Gibco / BRL, Bethesda, MD, or AMV Reverse Transcriptase, available from Seikagaku America, Inc., St. Russia, FL.
- Synthetic oligonucleotide primers for polymerase chain reaction amplification can be prepared on the basis of one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69
- One of the aforementioned nucleic acids can under Use of cDNA or alternatively genomic DNA as a template and suitable oligonucleotide primers according to standard PCR amplification techniques amplified.
- the thus amplified nucleic acid can be cloned into a suitable vector and characterized by DNA sequence analysis.
- Oligonucleotides corresponding to a desaturase nucleotide sequence can be prepared by standard synthetic methods, for example, with an automated DNA synthesizer.
- nukleinsauremolekule a nucleotide sequence corresponding to one of in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71,
- Allelic variants comprise, in particular, functional variants which are obtained by deletion, insertion or substitution of nucleotides from / in which is shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO:
- Desaturase, ⁇ -5 elongase or ⁇ -4-desaturase, ie their activity is substantially not reduced means proteins with at least 10%, preferably 20%, more preferably 30%, most preferably 40% of the original enzyme activity, as compared to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ
- the homology was calculated over the entire amino acid or nucleic acid sequence range.
- a number of programs that are based on different algorithms are available to the person skilled in the art.
- the algorithms of Needleman and Wunsch or Smith and Waterman provide particularly reliable results.
- the program PileUp was used (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970) and Smith and Waterman (Adv. Appl. Math.
- Homologs of the abovementioned nucleic acid sequences also include, for example, bacterial, fungal and plant homologs, truncated sequences, single-stranded DNA or RNA of the coding and non-coding DNA sequence or else derivatives such as, for example, promoter variants.
- the promoters upstream of the indicated nucleotide sequences may be modified by one or more nucleotide exchanges, insertions, and / or deletions, without, however, interfering with the functionality or activity of the promoters. It is also possible that the activity of the promoters is increased by modification of their sequence or that they are completely replaced by more active promoters, even from heterologous organisms.
- nucleic acids and protein molecules having ⁇ 12-desaturase, ⁇ -3-desaturase, ⁇ 9-elongase, ⁇ 6-desaturase, ⁇ 8-desaturase, ⁇ 6-elongase, ⁇ - 5-desaturase, ⁇ -5-elongase and / or ⁇ -4-desaturase activity which are involved in the metabolism of lipids and fatty acids, PUFA cofactors and enzymes or in the transport of lipophilic compounds via membranes are in the inventive method for Modulation of the production of PUFAs in transgenic plants such as maize, wheat, rye, oats, triticale, rice, barley, soybean, peanut, cotton, linum species such as oil or fiber kidney, Brassica species such as rapeseed, canola, sareptasef and turnip rape , Pepper, sunflower, borage, evening primrose and Tagetes, Solanacaen plants, such as
- PUFAs preferably of arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid
- Brassicaceae preferably of arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid
- sareptases are particularly suitable for the production of PUFAs with the nucleic acid sequences according to the invention, advantageously as described, in combination with other desaturases and elongases.
- PUFAs polyunsaturated fatty acids
- PUFAs for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid
- Brasicaceae for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid
- stearidonic acid for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid
- Brasicaceae for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid
- Linseed Longum usitatissimum
- Brassica juncea and Camelina sativa are particularly advantageously suitable for the production of PUFAS with the nucleic acid sequences according to the invention, as described, in combination with further desaturases and elongases.
- the lipid synthesis can be divided into two parts: the synthesis of fatty acids and their binding to sn-glycerol-3-phosphate and the addition or modification of a polar head group.
- Common lipids used in membranes include phospholipids, glycolipids, sphingolipids and phosphoglycerides.
- Fatty acid synthesis begins with the conversion of acetyl-CoA into malonyl-CoA by the acetyl-CoA carboxylase or into acetyl-ACP by the acetyl transacylase. After a condensation reaction, these two product molecules together form acetoacetyl-ACP, which is converted via a series of condensation, reduction and dehydration reactions, so that a saturated fatty acid molecule with the desired chain length is obtained.
- the production of unsaturated fatty acids from these molecules is catalyzed by specific desaturases, either aerobically by molecular oxygen or anaerobically (for fatty acid synthesis in microorganisms, see FC Neidhardt et al., (1996) E.
- Precursors for PUFA biosynthesis are, for example, oleic acid, linoleic acid and linolenic acid. These C 8 fatty acids must be extended to C 20 and C 22 in order to obtain fatty acids of the eicosa and docosa chain type.
- desaturases used in the process such as the ⁇ -12, ⁇ 3, ⁇ -4-, ⁇ -5, ⁇ -6 and ⁇ -8-desaturases and / or the ⁇ -5, ⁇ -6, ⁇ -9 elongases, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid, can advantageously be prepared eicosapentaenoic acid and / or docosahexaenoic acid and subsequently used for various purposes in food, feed, cosmetic or pharmaceutical applications.
- C 20 - and / or C 22 -fatty acids having at least two, preferably at least three, four, five or six double bonds in the fatty acid molecule, preferably C 2 o- or C 22 -fatty acids with advantageously four, five or six double bonds in the formula Fatty acid molecule can be produced.
- the desaturation can be carried out before or after elongation of the corresponding fatty acid.
- the products of desaturase activities and possible further desaturation and elongation result in preferred PUFAs having a higher degree of desaturation, including further elongation of C 20 to C 22 fatty acids.
- fatty acids such as ⁇ -linolenic acid, dihomo- ⁇ -oleolenic acid, arachidonic acid, stearidonic acid , Eicosatetraenoic acid or eicosapentaenoic acid.
- Substrates of the desaturases and elongases used in the process according to the invention are C 16 , C 8 - or C 20 -fatty acids, for example linoleic acid, ⁇ -linolenic acid, ⁇ -linolenic acid, dihomo- ⁇ -lino-acid, eicosatetraenoic acid or stearidonic acid.
- Preferred substrains are linoleic acid, ⁇ -linolenic acid and / or ⁇ -linolenic acid, dihomo- ⁇ -linolenic acid or arachidonic acid, eicosatetraenoic acid or eicosapentaenoic acid.
- the synthesized C 20 - or C 22 -fatty acids having at least two, three, four, five or six, advantageously having at least four, five or six double bonds in the fatty acid fall in the process according to the invention in the form of the free fatty acid or in the form of their esters, for example in Form their glycerides.
- glycolide is understood to mean a glycerol esterified with one, two or three carboxylic acid residues (mono-, di- or triglyceride).
- glycolide is also meant a mixture of different glycerides.
- the glyceride or glyceride mixture may contain other additives, e.g. contain free fatty acids, antioxidants, proteins, carbohydrates, vitamins and / or other substances.
- a "glyceride” in the sense of the method according to the invention is also understood to mean derivatives derived from glycerol.
- fatty acid glycerides also include glycerophospholipids and glyceroglycolipids.
- the glycerophospholipids such as lecithin (phosphatidylcholine), cardiolipin, phosphatidylglycerol, phosphatidylserine and alkylacylglycerophospholipids, may be mentioned by way of example here.
- fatty acids must then be transported to various modification sites and incorporated into the triacylglycerol storage lipid.
- lipid synthesis Another important step in lipid synthesis is the transfer of fatty acids to the polar head groups, for example by glycerol-fatty acid acyltransferase (see Frentzen, 1998, Lipid, 100 (4-5): 161-166). Publications on plant fatty acid biosynthesis, desaturation, the
- the PUFAs produced in the process comprise a group of molecules that are no longer able to synthesize, and therefore need to take up, higher animals, or that can no longer sufficiently produce higher animals themselves, and thus have to additionally take up, even though they are readily synthesized by other organisms, such as bacteria For example, cats can no longer synthesize arachidonic acid.
- phospholipids are to be understood as meaning phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol and / or phosphatidylinositol, advantageously phosphatidylcholine.
- production or “productivity” are known in the art and include the concentration of the fermentation product (compounds of formula I) formed in a given period of time and fermentation volume (eg, kg of product per hour per liter). They also include the productivity within a plant cell or plant, that is the content of the desired fatty acids produced in the process based on the content of all fatty acids in that cell or plant.
- efficiency of production includes the time required to reach a certain amount of production (eg, how long the cell needs to set up a specific throughput rate of a fine chemical).
- yield or “product / carbon yield” is understood in the art and includes the efficiency of converting the carbon source into the product (ie, the fine chemical). This is usually expressed, for example, as kg of product per kg of carbon source.
- biosynthesis or “biosynthetic pathway” are known in the art and involve the synthesis of a compound, preferably an organic compound, by a cell from intermediates, for example in a multi-step and highly regulated process.
- degradation or “degradation pathway” are known in the art and involve the cleavage of a compound, preferably an organic compound, by a cell into degradation products (more generally, smaller or less complex molecules), for example in a multi-step and highly regulated process.
- metabolism is known in the art and encompasses the entirety of the biochemical reactions that take place in an organism. The metabolism of a particular compound (e.g., the metabolism of a fatty acid) then comprises all of the biosynthetic, modification, and degradation pathways of that compound in the cell that affect that compound.
- This invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references cited in this patent application, patent applications, patents, and published patent applications are incorporated herein by reference.
- the cloning methods e.g. Restriction cleavage, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of Escherichia coli cells, culture of bacteria and sequence analysis of recombinant DNA were performed as described in Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).
- RNA of Oncoryhnehus mykiss was isolated using the RNAeasy kit from Qiagen (Valencia, CA, US). From the total RNA, poly-A + RNA (mRNA) was isolated using oligo-dT-cellulose (Sambrook et al., 1989). The RNA was reverse-transcribed with Promega's Reverse Transcription System Kit and the synthesized cDNA cloned into the lambda ZAP vector (lambda ZAP Gold, Stratagene). According to the manufacturer's instructions, the cDNA was unpacked to the plasmid DNA. The cDNA plasmid library was then used for PCR for cloning expression plasmids.
- Example 4 Cloning of Expression Plasmids for Heterologous Expression in Yeasts for the cloning of the two sequences for heterologous expression in yeast, the following oligonucleotides were used for the PCR reaction:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was incubated for 2 h at 37 ° C with the restriction enzymes Hindi II and BamHI.
- the yeast expression vector pYES3 (Invitrogen) was incubated in the same way. Subsequently, the 812 bp or 905 bp PCR product and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. Purify the DNA using Qiagen Gel purification Kit according to the manufacturer's instructions. Subsequently, vector and elongase cDNA were ligated. The rapid ligation kit from Roche was used for this purpose.
- pYES3-OmELO2 and pYES3-OmELO3 were verified by sequencing and transformed into the Saceharomyces strain INVSd (Invitrogen) by electroporation (1500 V).
- pYES3 was transformed in parallel.
- the yeasts were plated out on complete minimal medium without tryptophan with 2% glucose. Cells which were able to grow without tryptophan in the medium thus contain the corresponding plasmids pYES3, pYES3-OmELO2 (SEQ ID NO: 51) and pYES3-OmELO3 (SEQ ID NO: 53). After selection, two transformants were selected for further functional expression.
- Notl interfaces were inserted at the 5 'and 3' ends of the coding sequence with the following primer pair:
- PSUN-OMELO3 Forward 5'-GCGGCCGCataatggagacttttaat (SEQ ID NO: 177)
- composition of the PCR mixture (50 ⁇ L): 5.00 ⁇ L template cDNA 5.00 ⁇ L 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 ⁇ L 2 mM dNTP 1, 25 ⁇ L per primer (10 pmol / ⁇ L) 0, 50 ⁇ L Advantage Polymerase
- the Advantage polymerase from Clontech was used. Reaction conditions of the PCR:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products were incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. Purify the DNA using Qiagen Gel purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-OmELO2 and pSUN-OmELO3 were verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the octopine synthase gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers. M., Van Montagu. M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet.
- the USP promoter corresponds to nucleotides 1 -684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was made by commercial T7 standard primer (Stratagene) and by means of a synthesized primer via a PCR reaction amplified according to standard methods (primer sequence: 5 -GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3 ', SEQ ID NO: 174)
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator to give the plasmid designated pSU N-USP.
- the construct was used to transform Arabidopsis thaliana, rape, tobacco and linseed.
- the effect of genetic modification in plants, fungi, algae, ciliates or on the production of a desired compound may be determined by cultivating the modified microorganism or modified plant under suitable conditions (such as those described above), and Medium and / or the cellular components on the increased production of the desired product (ie of lipids or a fatty acid) is examined.
- suitable conditions such as those described above
- These analytical techniques are known to those skilled in the art and include spectroscopy, thin layer chromatography, staining methods of various types, enzymatic and microbiological methods and analytical chromatography such as high performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, Vol. A2, pp. 89-90 and pp. 443-613, VCH: Weinheim (1985); Fallon, A., et al .,
- the analytical methods include measurements of nutrient levels in the medium (e.g., sugars, hydrocarbons, nitrogen sources, phosphate and other ions), measurements of biomass composition and growth, analysis of production of common biosynthetic pathway metabolites, and measurements of gases produced during fermentation. Standard methods for these measurements are in Applied Microbial Physiology; A Practical Approach, P.M. Rhodes and P.F. Stanbury, Eds., IRL Press, pp. 103-129; 131-163 and 165-192 (ISBN: 0199635773) and references cited therein.
- FAME fatty acid methyl ester
- GC-MS gas-liquid chromatography-mass spectrometry
- TAG triacylglycerol
- TLC thin-layer chromatography
- the unambiguous evidence for the presence of fatty acid products can be obtained by analysis of recombinant organisms by standard analytical methods: GC, GC-MS or TLC as variously described by Christie and the references therein (1997, in: Advances on Lipid Methodology, Fourth Edition. : Christie, Oily Press, Dundee, 119-169; 1998, gas chromatography-mass spectrometry method, Lipids 33: 343-353).
- the material to be analyzed may be broken up by sonication, milling in the glass mill, liquid nitrogen and milling or other applicable methods.
- the material must be centrifuged after rupture.
- the sediment is distilled in aqua. re-suspended, heated at 100 ° C for 10 min, cooled on ice and recentrifuged, followed by extraction into 0.5 M sulfuric acid in methanol with 2% dimethoxypropane for 1 h at 90 ° C resulting in hydrolyzed oil and lipid compounds. which give transmethylated lipids.
- fatty acid methyl esters are extracted into petroleum ether and finally subjected to GC analysis using a capillary column (Chrompack, WCOT Fused silica, CP-Wax-52 CB, 25 microm, 0.32 mm) at a temperature gradient between 170 ° C and 240 ° C for 20 min and 5 min at 240 ° C subjected.
- Chropack Chrompack, WCOT Fused silica, CP-Wax-52 CB, 25 microm, 0.32 mm
- the identity of the resulting fatty acid methyl esters must be defined using standards available from commercial sources (i.e., Sigma).
- Plant material is first mechanically homogenized by mortars to make it more accessible to extraction.
- the mixture is then heated for 10 min at 100 ° C and sedimented again after cooling on ice.
- the cell sediment is hydrolyzed with 1 M methanolic sulfuric acid and 2% dimethoxypropane at 90 ° C. for 1 h and the lipids are transmethylated.
- the resulting fatty acid methyl esters (FAME) are extracted into petroleum ether.
- the extracted FAME are purified by gas chromatography using a capillary column (Chrompack, WCOT Fused silica, CP-Wax-52CB, 25 m, 0.32 mm) and a temperature gradient from 170 ° C to 240 ° C in 20 min and 5 min at 240 ° C analyzed.
- the identity of the fatty acid methyl esters is confirmed by comparison with corresponding FAME standards (Sigma).
- the identity and position of the double bond can be determined by suitable chemical derivatization of the FAME mixtures e.g. to 4,4-dimethoxy-oxazoline derivatives (Christie, 1998) are further analyzed by GC-MS.
- Yeasts transformed with plasmids pYES3, pYES3-OmELO2 and pYES3-OmELO3 as in Example 4 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 10 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methionic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were washed once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were run on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 Gas chromatograph with flame ionization detector disconnected.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
- OmELO2 does not show any elongase activity, whereas OmELO2 showed distinct activity with various substrates.
- the substrate specificity of OmElo3 could be determined after expression and feeding of different fatty acids ( Figure 2).
- the lined substrates can be detected in large quantities in all transgenic yeasts. All transgenic yeasts show the synthesis of new fatty acids, the products of the OmElo3 reaction. This means that the gene OmElo3 could be expressed functionally. .
- FIG. 2 shows that the OmElo3 has a substrate specificity that leads with high specificity to the extension of ⁇ 5 and ⁇ 6 fatty acids with a ⁇ 3 double bond. It was also possible to elongate ⁇ 6 fatty acids (C18 and C20) to a lesser extent. Stearidonic acid (C18: 4 ⁇ 3) and eicosapentaenoic acid (C20: 5 ⁇ 3) are the best substrates for OmElo3 (up to 66% elongation).
- the reconstitution of the biosynthesis of DHA was based on EPA (20: 5 ⁇ 3) or stearidonic acid (18: 4 ⁇ 3) by coexpression of the OmElo3 with the ⁇ -4-desaturase from Euglena gracilis or the ⁇ 5-desaturase from Phaeodactylum tricornutum and the ⁇ -4-desaturase from Euglena gracilis performed.
- the expression vectors pYes2-EgD4 and pESCLeu-PtD5 were further constructed. The o.g.
- Yeast strain already transformed with the pYes3-OmElo3 was further transformed with the pYes2-EgD4 or simultaneously with pYes2-EgD4 and pESCLeu-PtD5.
- the selection of the transformed yeasts was carried out on complete minimal medium agar plates with 2% glucose, but without tryptophan and uracil in the case of the pYes3-OmELO / pYes2-EgD4 strain and without tryptophan, uracil and leucine in the case of pYes3-OmELO / pYes2- EgD4 + pESCLeu-PtD5 tribe.
- Expression was induced as above by the addition of 2% (w / v) galactose. The cultures were incubated for an additional 120 h at 15 ° C.
- Figure 3 shows the fatty acid profiles of transgenic yeasts fed with 20: 5 ⁇ 3.
- the fatty acid composition of the transgenic yeasts is shown in FIG. After co-expression of OmElo3 and EgD4 up to 3% DHA could be detected in yeasts.
- OmElo3, EgD4 and a ⁇ 5-desaturase from P. tricornutum (PtD5) were expressed together.
- the transgenic yeasts were fed with stearidonic acid (18: 4 ⁇ 3) and analyzed ( Figure 4).
- the fatty acid composition of these yeasts is shown in FIG.
- OmElo3 elongated the fed fatty acid 18: 4 ⁇ 3 to 20: 4 ⁇ 3 (60% elongation).
- the latter was desaturated by the PtD5 to 20: 5 ⁇ 3.
- the activity of PtD5 was 15%. 20: 5 ⁇ 3 could still be elongated by the OmElo3 to 22: 5 ⁇ 3.
- Binary vectors in Agrobacterium tumefaciens C58C1: pGV2260 or Escherichia coli can be used to generate transgenic rape plants (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777-4788).
- rape plants Var Drakkar, NPZ Nor Weg für Maizucht, Hohenlieth, Germany
- a 1:50 dilution of an overnight culture of a positive transformed Agrobacterium colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant., 15, 473). used with 3% sucrose (3MS medium).
- Petioles or hypocotyls of freshly germinated sterile rape plants are incubated in a Petri dish with a 1:50 agrobacterial dilution for 5-10 minutes. This is followed by a 3-day colncubation in darkness at 25 ° C on 3MS medium with 0.8% Bacto agar.
- Cultivation is continued after 3 days at 16 hours light / 8 hours darkness and at weekly intervals on MS medium containing 500 mg / l claforan (cefotoxime sodium), 50 mg / l kanamycin, 20 microM benzylaminopurine (BAP) and 1 , 6 g / l glucose continued.
- MS medium containing 500 mg / l claforan (cefotoxime sodium), 50 mg / l kanamycin, 20 microM benzylaminopurine (BAP) and 1 , 6 g / l glucose continued.
- Growing shoots are transferred to MS medium with 2% sucrose, 250 mg / L claforan and 0.8% Bacto agar. If roots do not form after three weeks, then 2-indolebutyric acid was added to the medium as growth hormone for rooting.
- Regenerated shoots are obtained on 2MS medium with kanamycin and claforan, transferred into soil after rooting and grown in a climatic chamber or greenhouse after culturing for two weeks, flowered, mature seeds and examined for elongase expression such as ⁇ -5 elongase or ⁇ -6 elongase activity or ⁇ -3-desaturase activity by means of lipid analyzes. Lines polyunsaturated with increased contents of C20 and C22 fatty e can be identified * acids. b) Production of transgenic flax plants The production of transgenic flax plants can be carried out, for example, by the method of Bell et al., 1999, In Vitro Cell. Dev. Biol. Plant.
- Example 10 Cloning of ⁇ 5 elongase genes from Thraustochytrium aureum ATCC34304 and Thraustochytrium ssp. By comparing the different elongase protein sequences found in this application, conserved nucleic acid regions could be defined (histidine box: His-Val-X-His-His, tyrosine box: Met-Tyr-X-Tyr-Tyr). Using these sequences, an EST database of T. aureum ATCC34304 and Thraustochytrium ssp. searched for additional ⁇ -5 elongases. The following new sequences could be found:
- RNA of T. aureum ATCC34304 and Thraustochytrium ssp. was isolated using the RNAeasy kit from Qiagen (Valencia, CA, US). From the total RNA, mRNA was isolated using the PolyATract isolation system (Promega). The mRNA was reverse transcribed with the Marathon cDNA Arhplification Kit (BD Biosciences) and ligated according to the manufacturer's specifications adapters. The cDNA library was then used for PCR for cloning expression plasmids using 5 'and 3' rapid amplification of cDNA ends (RACE).
- RACE rapid amplification of cDNA ends
- composition of the PCR approach (50 ⁇ L): 5.00 ⁇ L template cDNA
- PCR product is ligated by a T-overhang and activity of a topoisomerase (Invitrogen) in the vector.
- yeasts were plated on complete minimal medium without uracil at 2%.
- composition of the PCR approach (50 ⁇ L): 5.00 ⁇ L template cDNA
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products were incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA is carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-BioTaurELO1 and pSUN-TL16y2 were verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP originated from pSUN300, by inserting in pSUN300 a USP promoter as EcoRI fragment.
- the polyadenylation signal is that of the octopine synthase gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers. M., Van Montagu. M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet.
- the USP promoter corresponds to nucleotides 1 -684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was obtained by commercial T7 standard primer (Stratagene) and by means of a synthesized primer via a PCR reaction amplified according to standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3 ', SEQ ID NO: 165)
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator the name p SUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Lipid extraction from yeasts and seeds was identical to Example 6.
- 200 ⁇ M ⁇ -linolenic acid and eicosapentaenoic acid were added to the yeast incubation medium and incubated for 24 hours. After extraction of the fatty acids from the yeasts they were transmethylated and separated by gas chromatography. The elongation products produced from the two fed fatty acids are marked by arrows.
- the lined substrates can be detected in large quantities in all transgenic yeasts. All transgenic yeasts show the synthesis of new fatty acids, the products of the BioTaurELOI reaction. This means that the gene BioTaurELOI could be functionally expressed.
- FIG. 6 shows that the BioTaurELOI has a substrate specificity that leads with high specificity to the elongation of ⁇ 5 and ⁇ 6 fatty acids with a ⁇ 3 double bond. Furthermore, ⁇ 6 fatty acids (C18 and C20) could also be elongated. There are reacted ⁇ -linolenic acid (C18: 3 ⁇ 6) with 65.28%, stearidonic acid (C18: 4 ⁇ 3) with 65.66% and eicosapentaenoic acid (C20: 5 ⁇ 3) with 22.01% conversion. The substrate specificities of the different feeding experiments are shown in Table 6 (see end of the description).
- TL16y2 shows ⁇ 5, ⁇ 6 and ⁇ 8 elongase activity. The activity is highest for C18 fatty acids with a ⁇ 6 double bond. Depending on the concentration of fed fatty acids, C20 fatty acids are then extended with a ⁇ 5 or ⁇ 8 double bond.
- Example 14 Cloning of genes from Ostreococcus tauri
- two sequences with corresponding motifs could be prepared in an Ostreococcus tauri sequence database (genomic sequences) can be identified. These are the following sequences:
- Otelol has the highest similarity to an elongase from Danio rerio (GenBank AAN77156, approximately 26% identity), while OtElo2 bears the greatest similarity to the Physcomitrella Elo (PSE) [ca. Aliquots were performed with the tBLASTn algorithm (Altschul et al., J. Mol. Biol., 1990, 215: 403-410) The cloning was performed as follows: 40 ml of an Ostreococcus tauri culture in the stationary phase were spun down and resuspended in 100 ⁇ l of bidistilled water and stored at -20 ° C.
- CMdum liquid medium For the expression of the Ot elongases, first precultures each of 5 ml of CMdum liquid medium with 2% (w / v) raffinose but without uracil with the selected transformants were inoculated and incubated for 2 days at 30 ° C., 200 rpm. 5 ml of CMdum liquid medium (without uracil) with 2% raffinose and 300 ⁇ M of different fatty acids were then inoculated with the precultures to an OD 6 oovon 0,05. Expression was induced by the addition of 2% (w / v) galactose. The cultures were incubated for a further 96 h at 20 ° C.
- the PCR products were incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA was carried out using Qiagen Gel Purification Kit according to the manufacturer. Subsequently, vector and PCR products were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-OtELO1 and pSUN-OtELO2 were verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the Ostreococcus gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol.
- the USP promoter corresponds nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was amplified by means of commercially available T7 standard primer (Stratagene) and with the aid of a synthesized primer. Reaction amplified by standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3 ', SEQ ID NO: 164),
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator.
- the resulting plasmid was named pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Yeasts transformed with plasmids pYES3, pYES3-OtELO1 and pYES3-OtELO2 as in Example 15 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were washed once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ⁇ C / min and finally 10 min at 250 ° C (hold).
- OtELOI and OtELO2 The substrate specificity of OtElol could be determined after expression and feeding of various fatty acids (Table 8). The lined substrates can be detected in large quantities in all transgenic yeasts. The transgenic yeasts showed the synthesis of new fatty acids, the products of the OtElol reaction. This means that the gene OtElol could be functionally expressed. Table 7 shows that the OtElol has a narrow substrate specificity.
- the oleol could only elongate the C20 fatty acids eicosapentaenoic acid (Figure 7) and arachidonic acid (Figure 8), but preferred the ⁇ -3-desaturated eicosapentaenoic acid.
- Table 8 shows the substrate specificity of the elongase OtElol for C20 polyunsaturated fatty acids with a double bond in ⁇ 5 position towards different fatty acids.
- the yeasts transformed with the vector pOTE1 were cultured in minimal medium in the presence of the indicated fatty acids.
- the substrate specificity of OtElo2 was determined after expression and feeding of various fatty acids (Table 9).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the OtElo2 reaction. This means that the gene OtElo2 could be expressed functionally.
- Table 9 shows the substrate specificity of the elongase OtElo2 towards various fatty acids.
- Yeasts transformed with vector pOTE2 were cultured in minimal medium in the presence of the indicated fatty acids.
- the enzymatic activity reported in Table 9 clearly shows that OTELO2 is a ⁇ 6 elongase.
- Example 20 Cloning of Expression Plasmids for Heterologous Expression in Yeasts
- the appropriate primer pairs were chosen to be the yeast consensus sequence for high efficiency translation (Kozak, Cell 1986, 44: 283-292). wore next to the start codon.
- the amplification of the TpElo DNAs was carried out in each case with 1 .mu.l cDNA, 200 .mu.M dNTPs, 2.5 U> 4 ⁇ Vatrfagre polymerase and 100 pmol of each primer in a total volume of 50 .mu.l.
- the conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes, followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes and a final extension step at 72 ° C for 10 minutes.
- first denaturation at 95 ° C for 5 minutes
- 30 cycles at 94 ° C for 30 seconds
- 55 ° C for 1 minute and 72 ° C for 2 minutes 55 ° C for 1 minute
- 72 ° C for 2 minutes a final extension step at 72 ° C for 10 minutes.
- yeasts were plated on complete minimal medium without uracil with 2% glucose. Cells which were able to grow in the medium without uracil thus contain the corresponding plasmids pYES2.1, pYES2.1-TpELOI, pYES2.1-TpELO2 and pYES2.1-TpELO3. After selection, two transformants were selected for further functional expression.
- Example 21 Cloning of expression plasmids for seed-specific expression in plants
- PSUN-TPELO2 'Forward: 5'-GCGGCCGCACCATGTGCTCATCACCGCCGTC (SEQ ID NO: 154) Reverse: 3'-GCGGCCGCCTACATGGCACCAGTAAC (SEQ ID NO: 155)
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products are incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP is incubated in the same way.
- the PCR products and the 7624 bp vector are separated by agarose gel electrophoresis and the corresponding DNA fragments are excised.
- the DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products are ligated.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. Genet.
- the USP promoter corresponds to the Nucleotides 1-684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is included in the promoter
- the 684 base pair promoter fragment was obtained by commercially available T7 standard primer (Stratagene) and by a synthesized primer via a PCR reaction amplified according to standard methods.
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator.
- the resulting plasmid was named pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Lipid extraction from yeasts and seeds was identical to Example 6.
- Example 22 Expression of TpELOI, TpELO2 and TpELO3 in Yeasts
- Yeasts which were transformed with the plasmids pYES2, pYES2-TpELO1, pYES2-TpELO2 and pYES2-TpELO3 as in Example 4 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were washed once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold). The identification of the signals was carried out by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- the substrate specificity of TpElol could be determined after expression and feeding of various fatty acids (FIG. 9).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the TpElol reaction. This means that the gene TpElol could be functionally expressed.
- TpElol has a narrow substrate specificity.
- the TpElol was only able to elongate the C20 fatty acids eicosapentaenoic acid and arachidonic acid, but preferred the ⁇ -3-desaturated eicosapentaenoic acid.
- the yeasts transformed with the vector pYES2-TpELO1 were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- Table 10 Expression of TpELOI in yeast. Columns 1 and 3 show the control reactions for columns 2 (fed 250 ⁇ M 20: 4 ⁇ 5,8,11, 14) and 4 (fed 250 ⁇ M 20: 5 ⁇ 5,8,11,14, 17) ,
- the substrate specificity of TpElo3 could be determined after expression and feeding of various fatty acids (FIG. 10).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the TpElo3 reaction. This means that the gene TpElo3 could be expressed functionally.
- TpElo3 has a narrow substrate specificity.
- the TpElo3 was able to elongate only the C18 fatty acids ⁇ -linolenic acid and stearidonic acid, but preferred the ⁇ -3-desaturated stearidonic acid.
- Yeasts transformed with the vector pYES2-TpELO3 were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- Table 11 Expression of TpELO3 in yeast.
- Column 1 shows the fatty acid profile of yeast without feeding.
- Column 2 shows the control reaction.
- the pi-omega3D clone was cloned into the yeast expression vector pYES3 for heterologous expression in yeasts via PCR with appropriate pi-omega3D specific primers. Only the open reading frame of the gene coding for the pi-omega3Des protein was amplified and provided with two cloning sites for the pYES3 expression vector:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was incubated for 2 h at 37 ° C with the restriction enzymes Hindi II and BamHI.
- the yeast expression vector pYES3 (Invitrogen) was incubated in the same way. Subsequently, the 1104 bp PCR product and the vector was separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. Purify the DNA using Qiagen Gel purification Kit according to the manufacturer's instructions. Subsequently, vector and desaturase cDNA were ligated. The rapid ligation kit from Roche was used for this purpose.
- the resulting plasmid pYES3-Pi-omega3Des was checked by sequencing and transformed into the Saceharomyces strain INVSd (Invitrogen) by electroporation (1500 V). As a control, pYES3 was transformed in parallel. Subsequently, the yeasts were plated on complete minimal medium without tryptophan with 2% glucose. Cells which were able to grow without tryptophan in the medium thus contain the corresponding plasmids pYES3, pYES3-Pi-omega3Des. After selection, two transformants were selected for further functional expression.
- Example 25 Cloning of expression plasmids for seed-specific expression in plants
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products were incubated for 4 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. Purify the DNA using Qiagen Gel purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmid pSUN-piomega3Des was verified by sequencing.
- Yeasts transformed with the plasmid pYES3 or pYES3-pi-omega3Des as in Example 24 were analyzed as follows: The yeast cells from the main cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and 100 mM NaHCO 3 , pH 8.0, to remove residual medium and fatty acids. From the yeast cell sediments, fatty acid methyl ester (FAMEs) produced by acid methanolysis. For this purpose, the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- FAMEs fatty acid methyl ester
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- PE petroleum ether
- the organic phases were each determined once with 2 ml of 100 mM NaHCO 3, pH 8.0 and 2 ml of distilled water. washed.
- the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold). The signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
- the methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- the substrate specificity of Pi omega3Des could be determined after expression and feeding of various fatty acids (Figure 12 to 18).
- the fed substrates are present in large quantities in all transgenic yeasts, demonstrating the uptake of these fatty acids into the yeasts.
- the transgenic yeasts show the synthesis of new fatty acids, the products of the pi omega3Des reaction. This means that the gene Pi omega3Des could be expressed functionally.
- FIG. 12 shows the desaturation of linoleic acid (18: 2 ⁇ -6 fatty acid) into ⁇ -linolenic acid (18: 3 ⁇ -3 fatty acid) by the pi omega3Ds.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 12A) or the vector pYes3-Pi-omega3Des (FIG. 12B).
- the yeasts were cultured in minimal medium in the presence of C18: 2 'fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- Figure 13 shows the desaturation of ⁇ -linolenic acid (18: 3 ⁇ -6 fatty acid) to stearidonic acid (18: 4 ⁇ -3 fatty acid) by pi-omega3Des.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 13A) or the vector pYes3-P ⁇ ega3Des (FIG. 13B).
- the yeasts were cultured in minimal medium in the presence of ⁇ -C18: 3 A6,9 '12 fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- Figure 14 gives the desaturation of C20: 2- ⁇ -6 fatty acid to C20: 3- ⁇ -3 fatty acid by Pi-omega3Des.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 14A) or the vector pYes3-Pi-omega3Des (FIG. 14B).
- the yeasts were cultured in minimal medium in the presence of C20: 2 ⁇ 11,14 fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- Figure 15 gives the desaturation of C20: 3- ⁇ -6 fatty acid to C20: 4- ⁇ -3 fatty acid by Pi-omega3Des.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 15A) or the vector pYes3-Pi-omega3Des (FIG. 15B).
- the yeasts were cultured in minimal medium in the presence of C20: 3 ⁇ 8,11,14 fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- Figure 16 shows the desaturation of arachidonic acid (C20: 4- ⁇ -6 fatty acid) into eicosapentaenoic acid (C20: 5- ⁇ -3 fatty acid) by the pi omega3Des.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 16A) or the vector pYes3-P ⁇ ega3Des (FIG. 16B).
- the yeasts were cultured in minimal medium in the presence of C20: 4 ⁇ 5,8 '11, 14 fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- FIG. 17 shows the desaturation of docosatetraenoic acid (C22: 4-omega-6 fatty acid) into docosapentaenoic acid (C22: 5-omega-3 fatty acid) by Pi-omega3Des.
- the synthesis of the fatty acid methyl esters was carried out by acidic methanolysis of intact cells which had been transformed with the empty vector pYES2 (FIG. 17A) or the vector pYes3-Pi-omega3Des (FIG. 17B).
- the yeasts were cultured in minimal medium in the presence of C22: 4 ⁇ 7,10 ' 13 ' 1 ⁇ fatty acid (300 ⁇ M). Subsequently, the FAMEs were analyzed by GLC.
- the substrate specificity of Pi omega3Des against various fatty acids is shown in FIG.
- the yeasts transformed with the vector pYes3-Pi-omega3Des were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells.
- the FAMEs were analyzed by GLC. Each value represents an average of three measurements.
- the conversion rates (% desaturation) were calculated with the formula: [product] / [product] + [substrate] * 100.
- the pi-omega3Des can also be used to generate transgenic plants.
- the lipids can then be extracted from the seeds of these plants as described under Example 6.
- Example 28 Cloning of desaturase genes from Ostreococcus tauri
- the cloning was as follows:
- the conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes, followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes and a final extension step at 72 ° C for 10 minutes.
- Saceharomyces cere 's / ae strain 334 was transformed by electroporation (1500 V) with the vector pYES2.1-OtDes6.1.
- a yeast was used, which was transformed with the empty vector pYES2.
- the selection of the transformed yeasts was carried out on complete minimal medium (CMdum) agar plates with 2% glucose, but without uracil. After selection, three transformants each were selected for further functional expression.
- CMdum liquid medium containing 2% (w / v) raffinose but no uracil precultures from 5 ml of CMdum liquid medium containing 2% (w / v) raffinose but no uracil were initially inoculated with the selected transformants and incubated for 2 days at 30 ° C., 200 rpm.
- 5 ml of CMdum liquid medium (without uracil) with 2% raffinose and 300 ⁇ M of different fatty acids were then inoculated with the precultures to an OD 60 o on 0.05.
- Expression was induced by the addition of 2% (w / v) galactose. The cultures were incubated for a further 96 h at 20 ° C.
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products are incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP is incubated in the same way.
- the PCR products and the vector are subsequently separated by agarose gel electrophoresis and the corresponding DNA fragments are excised.
- the DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR products are ligated.
- the rapid ligation kit from Roche was used for this purpose.
- the resulting plasmids are verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz, P., Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation., Plant Mol Biol. 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the Ostreococcus gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol.
- the USP promoter corresponds nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was transfected via commercially available T7 standard primer (Stratagene) and with the aid of a synthesized primer PCR reaction amplified by standard methods (primer sequence: 5'-
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator.
- the resulting plasmid was named pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Yeasts transformed with plasmids pYES2 and pYES2-OtDes6.2 as in Example 4 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- FAMEs fatty acid methyl ester
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were each determined once with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
- the methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- the substrate specificity of desaturases can be determined after expression in yeast (see examples cloning of desaturase genes, yeast expression) by feeding using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for ⁇ 15 desaturases, WO 94/11516 for ⁇ 12 desaturases, WO 93/06712, US 5,614,393, US 5614393, WO 96/21022, WO0021557 and WO 99/27111 for ⁇ 6- Desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for ⁇ 4-desaturases, Hong et al. 2002, Lipids 37,863-868 for ⁇ 5-desaturases.
- Table 12 shows the substrate specificity of the desaturase OtDes6.1 versus various fatty acids.
- the substrate specificity of OtDes6.1 could be determined after expression and feeding of different fatty acids.
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the OtDes6.2 reaction ( Figure 20). This means that the gene OtDes6.1 could be expressed functionally.
- Yeasts transformed with the vector pYES2-OtDes6.1 were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells.
- the activity corresponds to the conversion rate calculated according to [substrate / (substrate + product) * 100].
- Table 12 shows that the OtDes6.1 has a substrate specificity for linoleic and linolenic acid (18: 2 and 18: 3), since these fatty acids achieve the highest activity.
- Figure 20 shows the conversion of linoleic acid by OtDes6.1.
- the analysis of the FAMEs was done by gas chromatography.
- the lined substrate (C18: 2) is converted to ⁇ -C18: 3. Both starting material and the resulting product are marked by arrows.
- sequences By searching for conserved regions in the protein sequences using conserved motifs (His-boxes, see motifs), six sequences with corresponding motifs could be identified in a Thalassiosira pseudonana sequence database (genomic sequences). These are the following sequences:
- the cloning was as follows:
- the conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes, followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes and a final extension step at 72 ° C for 10 minutes.
- CMdum liquid medium with 2% (w / v) raffinose but without uracil are inoculated with the selected transformants and incubated for 2 days at 30 ° C, 200 rpm.
- 5 ml of CMdum liquid medium (without uracil) with 2% raffinose and 300 ⁇ M of different fatty acids are then inoculated with the precultures to an OD 600 of 0.05.
- Expression is induced by the addition of 2% (w / v) galactose.
- the cultures are incubated for a further 96 h at 20 ° C.
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products are incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP is incubated in the same way. Subsequently, the PCR products and the vector are separated by agarose gel electrophoresis and the corresponding DNA fragments are excised. The DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products are ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmids are verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the OCS gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers.
- the USP promoter corresponds to Nukieotiden 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter.
- the 684 base pair promoter fragment was by means of commercially available T7 standard primer (Stratagene) and using a synthesized primer via PCR Reaction amplified by standard methods (primer sequencing: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCC GGATCTGCTGGCTATGAA-3 '; SEQ ID NO: 143)
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. The result was the plasmid with the designation pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Yeasts which are transformed with the plasmids pYES2 and pYES2-Tp-desaturases as in example 4 are analyzed as follows:
- the yeast cells from the major cultures are harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters (FAMEs) are produced by acid methanolysis.
- the cell sediments are incubated with 2 ml of 1N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases are distilled once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases are dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE. The samples are separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis are as follows: The oven temperature is programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals are identified by comparison of the retention times with corresponding fatty acid standards (Sigma).
- the methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- the substrate specificity of desaturases can be determined after expression in yeast (see examples cloning of desaturase genes, yeast expression) by feeding using various yeasts. Descriptions for the determination of the individual activities can be found in WO 93/11245 for ⁇ 15 desaturases, WO 94/11516 for ⁇ 12 desaturases, WO 93/06712, US 5,614,393, US 5614393, WO 96/21022, WO0021557 and WO 99/27111 for ⁇ 6- Desaturases, Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566 for ⁇ 4-desaturases, Hong et al. 2002, Lipids 37,863-868 for ⁇ 5-desaturases.
- the activity of the individual desaturases is calculated from the conversion rate according to the formula [substrate / (substrate + product) * 100].
- Tables 11 and 12 below give an overview of the cloned Thalassiosira pseudonana desaturases.
- Table 14 Length and characteristic features of the cloned Thalassiosira desaturases.
- Table 15 Length, exons, homology and identities of the cloned desaturases.
- the ⁇ -12-desaturase genes from Ostreococcus and Thalassiosira can also be cloned.
- Example 38 Cloning of Elongase Genes from Xenopus laevis and Ciona intestinalis By searching for conserved regions (see consensus sequences, SEQ ID NO: 115 and SEQ ID NO: 116) in the protein sequences in gene databases (Genbank) using the methods listed in the application Elongase genes with ⁇ -5 elongase activity or ⁇ -6 elongase activity were able to identify and isolate further elongase sequences from other organisms. From X. laevis or from C. intestinalis additional sequences could be identified with respective motifs. These are the following sequences:
- the cDNA clone of X. laevis was obtained from the NIH (National Institute of Health) [Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative, Dev. Dyn. 225 (4), 384-391 (2002)].
- the cDNA clone of C. inetstinalis was obtained from the University of Kyto [Satou.Y., Yamada.L, Mochizuki.Y., Takatori.N., Kawashima.T., Sasaki.A., Hamaguchi.M.
- Example 39 Cloning of Expression Plasmids for Heterologous Expression in Yeasts The amplification of the elongase DNAs was carried out in each case with 1 ⁇ L cDNA, 200 ⁇ M dNTPs, 2.5 U y4cVatrfage polymerase and 100 pmol of each primer in a total volume of 50 ⁇ l.
- the conditions for the PCR were as follows: first denaturation at 95 C for 5 minutes, followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes, and a final extension step 72 ° C for 10 minutes.
- the PCR products were incubated for 30 min at 21 ° C with the yeast expression vector - pYES2.1-TOPO (Invitrogen) according to manufacturer's instructions.
- the PCR product is ligated by a T-overhang and activity of a topoisomerase (Invitrogen) according to the manufacturer's instructions in the vector.
- transformation of E. coli DH5 ⁇ cells was then carried out.
- Corresponding clones were identified by PCR, the plasmid DNA was isolated using Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into Saceharomyces strain INVSd (Invitrogen) by electroporation (1500V).
- the empty vector pYES2.1 was transformed in parallel.
- Example 40 Cloning of expression plasmids for seed-specific expression in plants For the transformation of plants, another transformation vector based on pSUN-USP is generated.
- notl interfaces are inserted at the 5 'and 3' end of the coding sequence with the following primer pair: pSUN-ELO (XI) Forward: 5'-GCGGCCGCACCATGGCCTTCAAGGAGCTCACATC (SEQ ID NO: 125) Reverse: 3'-GCGGCCGCCTTCAATGGTTTTTGCTTTTCAATGCACCG (SEQ ID NO: 126) pSUN-ELO (Ci)
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products were incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP was incubated in the same way. Subsequently, the PCR products and the 7624 bp vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmids pSUN-ELO (XI) and pSUN-ELO (Ci) were verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP [Hajdükiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors forplant transformation. Plant Mol Biol 25: 989-994].
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the octopine synthase gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck, J., Lemmers.M., Van Montagu M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol.
- the USP promoter corresponds to the Nucleotides 1-684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is included in the promoter
- the 684 base pair promoter fragment was obtained by commercially available T7 standard primer (Stratagene) and by a synthesized primer via a PCR reaction amplified according to standard methods.
- Primer sequence 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3 '(SEQ ID NO: 129).
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. The result was the plasmid with the designation pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rape, tobacco and linseed.
- Lipid extraction from yeasts and seeds was identical to Example 6.
- Example 41 Expression of ELO (XI) and ELO (Ci) in Yeasts Yeasts which were transformed as in example 4 with the plasmids pYES2, pYES2-ELO (XI) and pYES2-ELO (Ci) were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMEs was carried out by extracting twice with "petroleum ether (PE).
- the organic phases were once each 8.0 and 2 ml of distilled water with 2 ml of 100 mM NaHCO 3, pH. Washed. Then, the PE Dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE The samples were run on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 The conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
- the methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- the substrate specificity of the ELO (XI) could be determined after expression and feeding of various fatty acids (FIG. 22).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the ELO (XI) reaction. This means that the gene ELO (XI) could be expressed functionally.
- Table 16 shows that the ELO (XI) has a broad substrate specificity. Both C18 and C20 fatty acids are extended, with a preference for ⁇ 5 and ⁇ 6-desaturated fatty acids.
- Yeasts transformed with the vector pYES2-ELO (XI) were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of Fatty acid methyl ester was made by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- Table 16 Expression of ELO (XI) in yeast. Described is the conversion rate (conversion rate) of various educts (fed in each case 250 uM).
- the substrate specificity of the ELO (Ci) could be determined after expression and feeding of different fatty acids (FIG. 23).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the Synthesis of new fatty acids, the products of the ELO (Ci) reaction. This means that the gene ELO (Ci) could be expressed functionally.
- Table 17 Expression of ELO (Ci) in yeast. Described is the conversion rate (conversion rate) of various educts (fed in each case 250 uM).
- Table 17 shows that the ELO (Ci) has a broad substrate specificity. Both C18 and C20 fatty acids are extended, with a preference for ⁇ 5 and ⁇ 6-desaturated fatty acids.
- the yeasts transformed with the vector pYES2-ELO (Ci) were cultured in minimal medium in the presence of the indicated fatty acids. The synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- EXAMPLE 43 Cloning Genes from Ostreococcus tauri
- two sequences each with corresponding motifs could be isolated in an Ostreococcus tauri sequence database ( genomic sequences). These are the following sequences:
- OtElol and OtElol .2 show the highest similarity to an elongase from Danio rerio (GenBank AAN77156, approximately 26% identity), while OtElo2 and OtElo2.1 are most similar to the Physcomitrella Elo (PSE) [ca. Alignments were performed with the tBLASTn algorithm (Altschul et al., J. Mol. Biol., 1990, 215: 403-410) The cloning of the elongases was performed as follows:
- the Saceharomyces cerews / ae strain 334 was transformed by electroporation (1500 V) with the vector pOTE1, pOTE1.2, pOTE2 and pOTE2.1, respectively.
- a yeast was used, which was transformed with the empty vector pYES2.
- the selection of the transformed yeasts was carried out on complete minimal medium (CMdum) agar plates with 2% glucose, but without uracil. After selection, three transformants each were selected for further functional expression.
- the Advantage polymerase from Clontech was used. Reaction conditions of the PCR: annealing temperature: 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products are incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP is incubated in the same way. Subsequently, the PCR products and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were cut out. The DNA was purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR products were ligated.
- pSUN300 is a derivative of the plasmid pPZP [Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989-994].
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as an EcoRI fragment.
- the polyadenylation signal is that of the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol.
- the USP promoter corresponds nucleotides 1 to 684 (Genbank Accession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was amplified by means of commercially available T7 standard primer (Stratagene) and with the aid of a synthesized primer. Reaction amplified by standard methods.
- Yeasts which were transformed with the plasmids pYES3, pYES3-OtELO1, pYES3-OtELO1.2, pYES3-OtELO2 and pYES3-OtELO2.2 as in Example 15 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- the yeast cell sediments became fatty acid methyl esters (FAMEs). produced by acid methanolysis.
- FAMEs fatty acid methyl esters
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with Petroleum ether (PE).
- the organic phases were washed once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma). The methodology is described for
- the substrate specificity of OtElol was determined after expression and feeding of various fatty acids (Table 18).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the OtElol reaction. This means that the gene OtElol could be functionally expressed.
- Table 18 shows that OtElol and OtElol.2, respectively, have a narrow substrate specificity. Otolol and Otolol.2, respectively, were able to elongate only the C20 fatty acids eicosapentaenoic acid (FIGS. 24A, 24B) and arachidonic acid (FIGS. 25A, 25B), but preferred the co-3-desaturated eicosapentaenoic acid.
- Table '18 shows the substrate specificity of elongase and OtElol OtElol.2 for C20 polyunsaturated fatty acids having a double bond at ⁇ 5 position against various fatty acids.
- the yeasts which had been transformed with the vector pOTE1 or pOTE1.2, were cultured in minimal medium in the presence of the specified fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- OtElo2 SEQ ID NO: 81
- OtElo2.1 SEQ ID NO: 111
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the OtElo2 reaction. This means that the genes OtElo2 and OtElo2.1 could be functionally expressed.
- Table 19 shows the substrate specificity of the elongase OtElo2 and OtElo2.1 towards different fatty acids.
- OtElo2.1 shows a significantly higher activity.
- the yeasts, which had been transformed with the vector pOTE2 or pOTE2.1, were cultured in minimal medium in the presence of the specified fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells. Subsequently, the FAMEs were analyzed by GLC.
- Figure 24 A-D shows the elongation of eicosapentaenoic acid by OtElol (B) and OtElol.2 (D), respectively. Controls (A, C) do not show the product of elongation (22: 5 ⁇ 3).
- Figure 25 A-D shows the elongation of arachidonic acid by OtElol (B) and OtElol.2 (D). Controls (A, C) do not show the product of elongation (22: 4 ⁇ 6).
- Example 48 Cloning of elongase genes from Euglena gracilis and Arabidopsis thaliana
- sequences from Arabidopsis thaliana or Euglena gracilis with corresponding motifs in sequence databases (Genbank, Euglena EST Bank ) be identified. These are the following sequences: Euglena gracilis elongases were cloned as follows: Euglena gracilis strain 1224-5 / 25 was obtained from the Algae Culture Collection Göttingen (SAG).
- RNA from a four-day Euglena culture was isolated using the RNAeasy kit from Qiagen (Valencia, CA, US). From the total RNA, poly-A + RNA (mRNA) was isolated using oligo-dT-cellulose (Sambrook et al., 1989).
- RNA was reverse-transcribed with Promega's Reverse Transcription System Kit and the synthesized cDNA cloned into the lambda ZAP vector (lambda ZAP Gold, Stratagene). According to the manufacturer's instructions, the cDNA was decompressed to plasmid DNA and clones were sequenced for random sequencing. From the total RNA mRNA was isolated using the PolyATract isolation system (Promega). The mRNA was reverse transcribed using the Marathon cDNA Amplification Kit (BD Biosciences) and the adapters were ligated according to the manufacturer's instructions.
- the cDNA library was then used for PCR for cloning expression plasmids by means of 5'- and 3'-RACE (rapid amplification of cDNA ends).
- the cloning of the elongases from Arabidopsis thaliana was carried out as follows:
- primers were derived for the two genes corresponding to the 5 'and 3' end of the open reading frame.
- RNA precipitated with 2.5 M LiCl For the isolation of total RNA from A thaliana was according to Chrigwin et al., (1979) method. Leaves of 21-day-old plants were minced in liquid nitrogen, mixed with digestion buffer and incubated for 15 min at 37 ° C. After centrifugation (10 min, 4 oC, 12000xg) the RNA in the supernatant was precipitated with 0.02 volume 3M sodium acetate pH 5.0 and 0.75 volume ethanol at -20 oC for 5 h. The RNA was then taken up in 1 ml of TES per g of starting material after a further centrifugation step, extracted once with one volume of phenol-chloroform and once with one volume of chloroform, and the RNA precipitated with 2.5 M LiCl.
- RNA was resuspended in water. According to Sambrook et al. In 1989, the cDNA was synthesized and RT-PCR performed with the derived primers. The PCR products were cloned according to the manufacturer's instructions in the vector pYES2.1-TOPO (Invitrogen).
- pYES2.1-TOPO Invitrogen
- Saceharomyces cerews / ae strain 334 was transformed by electroporation (1500 V) with the vector pAt60 and pAt70, respectively.
- a yeast was used, which was transformed with the empty vector pYES2.1.
- the selection of the transformed yeasts was carried out on complete minimal medium (CMdum) agar plates with 2% glucose but without uracil. After selection, three transformants each were selected for further functional expression.
- At-elongases For the expression of the At-elongases, first precultures each of 5 ml of CMdum liquid medium with 2% (w / v) raffinose but without uracil were inoculated with the selected transformants and incubated for 2 days at 30 ° C., 200 rpm.
- Yeasts which were transformed with the plasmids pYES2.1, pAt ⁇ 0 or pAt70 as in Example 5 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were each determined once with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the lined substrates must be detected in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of genes At3g06460 and At3g06470, respectively. This means that these genes could be expressed functionally.
- Table 20 Elongation of EPA by the elongases At3g06460 and At3g06470, respectively. Measurement of yeast extracts after feeding with 250 ⁇ M EPA.
- FIG. 26 shows the elongation of 20: 5n-3 by the elongases At3g06470.
- Example 52 Cloning of an Elongase from Phaeodactylum tricornutum Starting from conserved regions in the protein sequences with the aid of the elongase genes with ⁇ 6-EIongase activity listed in the application, degenerate primers were prepared and used to screen a Phaeodactylum cDNA Bank by PCR. The following primer sequences were used:
- Nucleotide bases in parenthesis mean that there is a mixture of oligonucleotides each with one or the other nucleotide base.
- Frozen cells were ground to a fine powder after centrifugation in the presence of liquid nitrogen and mixed with 2 mL homogenization buffer (0.33 M sorbitol, 0.3 M NaCl, 10 mM EDTA, 10 mM EGTA, 2% SDS, 2% mercaptoethanol in 0.2 M Tris-Cl ph 8.5). After addition of 4 ml of phenol and 2 ml of chloroform, shaking vigorously at 40-50 ° C. for 15 min. It was then centrifuged (10 min ⁇ 10000 g) and the aqueous phase was extracted stepwise with chloroform. Nucleic acids were then precipitated by addition of 1/20 volume of 4M sodium bicarbonate solution and centrifuged.
- RNA was isolated with Dynabeads (Dynal, Oslo, Norway) according to the manufacturer's instructions and the first-strand cDNA synthesis was carried out with MLV-Rtase from Roche (Mannheim). Second strand synthesis was then performed using DNA polymerase I and Klenow fragment, followed by RnaseH digestion.
- the cDNA was treated with T4 DNA polymerase and then EcoRI / Xhol adapters (Pharmacia, Freiburg) attached by T4 ligase. After Xhol digestion, phosphorylation and gel separation, fragments greater than 300 bp were ligated into lambda ZAP Express phage according to the manufacturer's instructions (Stratagene, Amsterdam, Netherlands). After mass excision of the cDNA library and plasmid recovery, the plasmid library was transformed into E. coli DH10B cells and used for PCR screening.
- the PCR fragment with the sequence number SEQ ID NO: 187 could be generated. This fragment was labeled with digoxigenin (Roche, Mannheim) and used as a probe for phage library screening.
- the gene sequence SEQ ID NO: 183 could be obtained, which represents the full-length RNA molecule of the ⁇ 6 elongase of Phaeodactylum:
- Example 53 Cloning of expression plasmids for heterologous expression in - yeasts
- the corresponding primer pairs were selected to carry the yeast high-efficiency translation consensus sequence (Kozak, Cell 1986, 44: 283-292) adjacent to the start codon.
- the amplification of the PtELO6 DNA was performed with 1 ⁇ L cDNA, 200 ⁇ M dNTPs, 2.5 U Advantage polymerase and 100 pmol of each primer in a total volume of 50 ⁇ l.
- the conditions for the PCR were as follows: first denaturation at 95 ° C for 5 minutes followed by 30 cycles at 94 ° C for 30 seconds, 55 ° C for 1 minute and 72 ° C for 2 minutes, and a last extension step 72 ° C for 10 minutes.
- the following oligonucleotides were used for the PCR reaction:
- the PCR products were incubated for 30 min at 21 ° C with the yeast expression vector - pYES2.1-TOPO (Invitrogen) according to the manufacturer's instructions.
- the PCR product (see SEQ ID NO: 192) was ligated into the vector by a T overhang and topoisomerase activity (Invitrogen). After incubation, transformation of E. coli DH5 ⁇ cells was then carried out.
- Corresponding clones were identified by PCR, the plasmid DNA was isolated using the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into Saceharomyces strain INVSd (Invitrogen) by electroporation (1500V). As a control, the empty vector pYES2.1 was transformed in parallel.
- Example 54 Cloning of expression plasmids for seed-specific expression in plants For the transformation of plants, another transformation vector based on pSUN-USP is generated.
- Notl interfaces are inserted at the 5 'and 3' end of the coding sequence with the following primer pair: PSUN-PtELO6 Forward: 5'-GCGGCCGCACCATGATGGTACCTTCAAGTTA (SEQ ID NO: 190) Reverse: 3'-GAAGACAGCTTAATAGGCGGCCGC (SEQ ID NO: 191) Composition of the PCR approach (50 ⁇ L):
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR products are incubated for 16 h at 37 ° C with the restriction enzyme Notl.
- the plant expression vector pSUN300-USP is incubated in the same way.
- the PCR products and the 7624 bp vector are separated by agarose gel electrophoresis and the corresponding DNA fragments are excised.
- the DNA is purified using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR products are ligated. The rapid ligation kit from Roche is used for this purpose.
- the resulting plasmid pSUN-PtELO is verified by sequencing.
- pSUN300 is a derivative of the plasmid pPZP (Hajdukiewicz P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation, Plant Mol Biol 25: 989-994).
- pSUN-USP was generated from pSUN300 by inserting into pSUN300 a USP promoter as EcoRI fragment.
- the polyadenylation signal is that of the octopine synthase gene from the A.
- tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve.H., Dhaese.P., Seurinck J., Lemmers, M., Van Montagu M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol.
- the USP promoter corresponds nucleotides 1-684 (Genbank AeCession X56240), wherein part of the non-coding region of the USP gene is contained in the promoter
- the 684 base pair promoter fragment was amplified using commercially available T7 standard primer (Stratagene) and using a synthesized primer via a PCR Reaction amplified by standard methods.
- the PCR fragment was rescored with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. The result was the plasmid with the designation pSUN-USP.
- the construct was used to transform Arabidopsis thaliana, rapeseed, tobacco and linseed.
- Lipid extraction from yeasts and seeds was identical to Example 6.
- Example 55 Expression of PtElo in Yeasts Yeasts transformed with the plasmids pYES2 and pYES2-PtELO6 as in Example 4 were analyzed as follows:
- the yeast cells from the major cultures were harvested by centrifugation (100 xg, 5 min, 20 ° C) and washed with 100 mM NaHCO 3 , pH 8.0 to remove residual medium and fatty acids.
- fatty acid methyl esters FAMEs
- the cell sediments were incubated with 2 ml of 1 N methanolic sulfuric acid and 2% (v / v) dimethoxypropane for 1 h at 80 ° C.
- the extraction of the FAMES was carried out by extraction twice with petroleum ether (PE).
- the organic phases were washed once each with 2 ml of 100 mM NaHCO 3 , pH 8.0 and 2 ml of distilled water. washed. Subsequently, the PE phases were dried with Na 2 SO 4 , evaporated under argon and taken up in 100 ⁇ l of PE.
- the samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 ⁇ m, Agilent) in a Hewlett-Packard 6850 gas chromatograph with flame ionization detector.
- the conditions for the GLC analysis were as follows: The oven temperature was programmed from 50 ° C to 250 ° C at a rate of 5 ° C / min and finally 10 min at 250 ° C (hold).
- the signals were identified by comparing the retention times with corresponding fatty acid standards (Sigma).
- the methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36 (8): 761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52 (360): 1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388 (2): 293-298 and Michaelson et al., 1998, FEBS Letters. 439 (3): 215-218.
- FIG. 29 is the conversion of C18: 3 ⁇ 6 '9' 12, and C18: reproduced ⁇ 6,9 4 '12' 15 °.
- the substrates are each elongated by two carbon atoms.
- the respective fatty acids C20: 3 ⁇ 8 ' 11 ' 14 and C20: 4 ⁇ 8 ' 11 ' 14 '17 are formed .
- the substrate specificity of PtELO6 could be determined after expression and feeding of various fatty acids (FIG. 30).
- the lined substrates can be detected in large quantities in all transgenic yeasts.
- the transgenic yeasts showed the synthesis of new fatty acids, the products of the PtElo ⁇ reaction. This means that the gene PtELO6 could be expressed functionally.
- Table 21 shows that the PtElo ⁇ has a narrow substrate specificity.
- PtELO6 was able to elongate only the C18 fatty acids linoleic acid, linolenic acid, ⁇ -linolenic acid and stearidonic acid, but preferred ⁇ -3-desaturated stearidonic acid (see also Figure 30).
- Feeding experiment fatty acids (fat) were added at 250 ⁇ M each time. The underlined fatty acids were newly formed.
- the yeasts transformed with the vector pYES2-PtELO6 were cultured in minimal medium in the presence of the indicated fatty acids.
- the synthesis of fatty acid methyl esters was carried out by acidic methanolysis of intact cells.
- the FAMEs were analyzed by GLC. Thus, the results shown in Figures 29 and 30 and Table 19 were determined.
- Bin19, pBI101, pBinAR, pGPTV and pCAMBIA are preferably used according to the invention for the following examples.
- binary vectors and their use see Hellens et al, Trends in Plant Science (2000) 5, 446-451. used was a pGPTV derivative as described in DE10205607. This vector differs from pGP by an additional inserted ⁇ scl restriction site.
- the starting point of the cloning was the cloning vector pUC19 (Maniatis et al.).
- the conlinin promoter fragment was amplified with the following primers:
- composition of the PCR mixture (50 ⁇ l):
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme EcoRI and then for 12 h at 25 ° C with the restriction enzyme SmaI.
- the cloning vector pUC19 was incubated in the same way. Subsequently, the PCR product and the 2668 bp cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and PCR product were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmid pUC19-Cnl1-C was verified by sequencing.
- the OCS terminator (Genbank Accession V00088, De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl Genet 1 (6), 499-511 (1982)) from the vector pGPVT-USP / OCS (DE 102 05607) with the following primers:
- OCS_C 5 ' aggcctccatggcctgctttaatgagatatgcgagacgcc
- OCS_C 3' cccgggccggacaatcagtaaattgaacggag Composition of the PCR mixture (50 ⁇ l):
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme Stul and then for 12 h at 25 ° C with the restriction enzyme SmaI.
- the vector pUC19-Cnl1-C was incubated for 12 h at 25 ° C with the restriction enzyme SmaI.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR product were ligated. The rapid ligation kit from Roche was used for this purpose.
- the resulting plasmid pUC19-Cnl1C_OCS was verified by sequencing.
- the Cnl1-B promoter was amplified by PCR using the following primers:
- OCS2 5 ' aggcctcctgctttaatgagatatgcgagac
- OCS23' cccgggcggacaatcagtaaattgaacggag
- the Cnl1-A promoter was amplified by PCR using the following primers:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was incubated for 2 h at 37 ° C with the restriction enzyme Stu ⁇ .
- the vector pUC19-Cnl1-C was incubated for 12 h at 25 ° C with the restriction enzyme SmaI.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR product were ligated. The rapid ligation kit from Roche was used for this purpose.
- the resulting plasmid pUC19-Cnl1C_Cnl1B_Cnl1A_OCS2 was verified by sequencing.
- the OCS terminator for CnllA was inserted.
- the PCR was carried out with the following primers:
- OCS2 5 ' ggcctcctgctttaatgagatatgcga
- OCS2 3 ' aagcttggcgcgccgagctcgtcgacggacaatcagtaaattgaacggaga
- the plasmid pUC19-Cnl1C_Cnl1B_Cnl1A_OCS3 was used in the next step to clone the ⁇ , ⁇ 5-desaturase and ⁇ 6-elongase.
- the ⁇ 6-desaturase was amplified from phytium irregular (WO02 / 26946) with the following PCR primers:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme BglW and then for 2 h at 37 ° C with the restriction enzyme ⁇ / col.
- the vector pUC19-Cnl1C_Cnl1B__Cnl1A_OCS3 was incubated for 2 h at 37 ° C with the restriction enzyme BglW and for 2 h at 37 ° C with the restriction enzyme ⁇ / col.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR product were ligated. This was the Rapid . Ligation kit used by Roche.
- the resulting plasmid pUC19-Cnl1_d6Des (Pir) was verified by sequencing.
- the plasmid p.UC19-Cnl1_d6Des (Pir) was used in the next step to clone the ⁇ 5-desaturase from Thraustochytrium ssp. (WO02 / 26946).
- the ⁇ 5-desaturase from Thraustochytrium ssp. amplified with the following PCR primers: D5Des (Tc) 5 ': gggatccatgggcaagggcagcgagggccg D5Des (Tc) 3': ggcgccgacaccaagaagcaggactgagatatc
- composition of the PCR mixture (50 ⁇ l):
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme BamHI and then for 2 h at 37 ° C with the restriction enzyme EcoRV.
- the vector pUC19-Cnl1_d6Des (Pir) was incubated for 2 h at 37 ° C with the restriction enzyme BamHI and for 2 h at 37 ° C with the restriction enzyme EcoRV.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- the plasmid pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) was used in the next step for cloning the ⁇ elongase from Physcomitrella patens (WO01 / 59128), for which purpose it was amplified with the following PCR primers:
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme ⁇ / ofl and then for 2 h at 37 ° C with the restriction enzyme Xba ⁇ .
- the vector pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) was incubated for 2 h at 37 ° C with the restriction enzyme Not ⁇ and for 2 h at 37 ° C with the restriction enzyme XbaI.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- the binary vector for plant transfusion was prepared.
- pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) was incubated for 2 h at 37 ° C with the restriction enzyme Asc ⁇ .
- the vector pGPTV was treated in the same way.
- the fragment from pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) and the cut pGP vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR product were ligated. The rapid ligation kit from Roche was used for this purpose.
- the resulting plasmid pGPTV-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) was verified by sequencing.
- composition of the PCR mixture (50 ⁇ l):
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was incubated for 2 h at 37 ° C with the restriction enzyme Sa / I.
- the vector pUC19 was incubated for 2 h at 37 ° C with the restriction enzyme Sa / I. Subsequently, the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out by means of Qiagen Gel Purification Kit according to
- ⁇ 12-desaturase gene from Calendula officinalis (WO01 / 85968) was cloned into pUC19-Cn17_OCS.
- d12Des (Co) was amplified with the following primers:
- the plasmid pUC19-Cnl1_D12Des (Co), as well as the plasmid pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) were incubated for 2 h at 37 ° C with the restriction enzyme Sa / I. Subsequently, the vector fragment and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised. The purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions. Subsequently, vector and vector fragment were ligated. The rapid ligation kit from Roche was used for this purpose. The resulting plasmid pUC19-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp D12Des (Co) was verified by sequencing.
- pSUN2 Another vector suitable for plant transformation is pSUN2.
- this vector was used in combination with the Gateway system (Invitrogen, Düsseldorf).
- the gateway cassette A was inserted into the vector pSUN2 according to the manufacturer's instructions as follows:
- the pSUN2 vector (1 ⁇ g) was incubated for 1 h with the restriction enzyme EcoRV at 37 °. Subsequently, the Gateway cassette A (Invitrogen, Düsseldorf) was ligated into the cut vector by means of the Rapid Ligation Kit of Roche, Mannheim. The resulting plasmid was transformed into E. coli DB3.1 cells (Invitrogen). The isolated plasmid pSUN-GW was subsequently verified by sequencing.
- the expression cassette from pUC19-Cn11_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) _D12Des (Co) was excised by Ascl and ligated into the similarly treated vector pSUN-GW.
- the resulting plasmid pSUN-4G was used for further gene constructs.
- a pENTR clone was first modified according to the manufacturer's instructions (Invitrogen).
- the plasmid pENTRIA (Invitrogen) was incubated for 1 h at 37 ° with the restriction enzyme Ecorl, then for 30 min with Klenow enzyme, and a 1 ⁇ M dNTP mix and then the Ascl adapter (5'-ggcgcgcc; phosphorylated at the 5'-end, double-stranded) into the pENTRIA vector.
- Ascl adapter 5'-ggcgcgcc; phosphorylated at the 5'-end, double-stranded
- the plasmid pUC19-CnI1C_Cnl1B_Cnl1A_OCS3 was used in the next step to clone the ⁇ elongase TL16y2.
- the ⁇ 5-elongase from Thraustochytrium ssp. amplified with the following PCR primers: TL16y25 ': agatct atggacgtcgtcgagcagca
- composition of the PCR mixture (50 ⁇ l):
- Annealing temperature 1 min 55 ° C denaturation temperature: 1 min 94 ° C elongation temperature: 2 min 72 ° C number of cycles: 35
- the PCR product was first incubated for 2 h at 37 ° C with the restriction enzyme BglW and then for 2 h at 37 ° C with the restriction enzyme ⁇ / col.
- the vector pUC19-Cnl1 C_Cnl1 B_Cnl1 A_OCS3 was incubated for 2 h at 37 ° C with the restriction enzyme BglW and for 2 h at 37 ° C with the restriction enzyme ⁇ / col.
- the PCR product and the cut vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were excised.
- the purification of the DNA was carried out using the Qiagen Gel Purification Kit according to the manufacturer's instructions.
- vector and PCR product were ligated.
- the rapid ligation kit from Roche was used for this purpose.
- the resulting plasmid pUC19-Cnl1_TL16y2 was verified by sequencing.
- the cassette was excised with Ascl and ligated into an Ascl pretreated pENTR vector.
- the resulting plasmid pENTR-Cnl1_TL16y2 was then incubated according to the manufacturer's instructions (Invitrogen) in a recombination reaction with the vector pSUN-4G.
- the product yielded the vector pSUN-5G, which was used for plant transformation.
- the construct pSUN-8G was created using the same described methodology.
- Example 58 Generation of Transgenic Plants a) Generation of transgenic sareptase plants. The protocol for the transformation of oilseed rape plants was used (modified according to Moloney et al., 1992, Plant Cell Reports, 8: 238-242)
- the binary vectors generated were pGPTV-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) _D12Des (Co), pSUN-5G and pSUN-8G in
- Agrobacterium tumefaciens C58C1: pGV2260 (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777-4788).
- a 1:50 dilution of an overnight culture of a positively transformed agrobacterial colony was used in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant., 15, 473) with 3% sucrose (3MS medium).
- Peti oils or hypocotyls of freshly germinated sterile plants (about 1 cm 2 each) were incubated in a Petri dish with a 1:50 agrobacterial dilution for 5-10 minutes.
- Regenerated shoots were obtained on 2MS medium with kanamycin and claforan, transferred to soil after rooting and grown in a climatic chamber or greenhouse after cultivation for two weeks, flowered, harvested mature seeds and for elongase expression such as ⁇ -6 EIongase activity or ⁇ -5 or ⁇ -6 desaturase activity by lipid analysis. Lines with elevated levels of C20 and C22 polyunsaturated fatty acids were identified.
- transgenic flax plants can, for example, according to the method of Bell et al., 1999, In Vitro Cell. Dev. Biol. Plant. 35 (6): 456-465 by means of particle bombartment.
- Agrobacteria-mediated transformations can be carried out, for example, according to Mlynarova et al. (1994), Plant Cell Report 13: 282-285.
- the effect of genetic modification in plants on the production of a desired compound may be determined by cultivating the modified plant under appropriate conditions (such as those described above) and loading the medium and / or cellular components onto the plant increased production of the desired product (ie the lipids or a fatty acid) are investigated.
- appropriate conditions such as those described above
- the desired product ie the lipids or a fatty acid
- analytical techniques include spectroscopy, thin-layer chromatography, staining methods of various types, enzymatic and microbiological methods and analytical chromatography, such as high performance liquid chromatography (see for example
- fatty acids abbreviations: FAME, fatty acid methyl ester, GC-MS, gas-liquid chromatography-mass spectrometry, TAG, triacylglycerol, TLC, thin-layer chromatography.
- FAME fatty acid methyl ester
- GC-MS gas-liquid chromatography-mass spectrometry
- TAG triacylglycerol
- TLC thin-layer chromatography
- the material to be analyzed may be broken up by sonication, milling in the glass mill, liquid nitrogen and milling or other applicable methods.
- the material must be centrifuged after rupture.
- the sediment is distilled in aqua. re-suspended, heated at 100 ° C for 10 min, cooled on ice and recentrifuged, followed by extraction into 0.5 M sulfuric acid in methanol with 2% dimethoxypropane for 1 h at 90 ° C resulting in hydrolyzed oil and lipid compounds. which give transmethylated lipids.
- fatty acid methyl ester are extracted in petroleum ether and finally subjected to GC analysis using a capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 mikrom, 0.32 mm) at a temperature gradient between 170 C and 240 C C C for 20 min and 5 min at 240 ° C subjected.
- Chropack Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 mikrom, 0.32 mm
- the identity of the resulting fatty acid methyl esters must be defined using standards available from commercial sources (ie Sigma).
- Plant material is first mechanically homogenized by mortars to make it more accessible to extraction.
- the mixture is then heated for 10 min at 100 ° C and sedimented again after cooling on ice.
- the cell sediment is hydrolyzed with 1 M methanolic sulfuric acid and 2% dimethoxypropane for 1 h at 90 ° C and transmethylated the lipids.
- the resulting fatty acid methyl esters (FAME) are extracted into petroleum ether.
- the extracted FAME are purified by gas chromatography using a capillary column (Chrompack, WCOT Fused silica, CP-Wax-52CB, 25 m, 0.32 mm) and a temperature gradient from 170 ° C to 240 ° C in 20 min and 5 min at 240 ° C analyzed.
- Example 60 Analysis of the Seeds from the Generated Transgenic Plants According to Example 59, the seeds of the plants treated with the constructs pGPTV-Cnl1_d6Des (Pir) _d5Des (Tc) _D6Elo (Pp) _D12Des (Co), pSUN-5G and pSUN- 8G transformed.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Diabetes (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Plant Pathology (AREA)
- Epidemiology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Biophysics (AREA)
- Rheumatology (AREA)
- Nutrition Science (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Child & Adolescent Psychology (AREA)
- Neurology (AREA)
- Endocrinology (AREA)
Abstract
Description
Claims
Priority Applications (15)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP22209519.2A EP4219670A3 (de) | 2004-02-27 | 2005-02-23 | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen |
CN2005800074288A CN1930277B (zh) | 2004-02-27 | 2005-02-23 | 在转基因植物中产生多不饱和脂肪酸的方法 |
US10/590,457 US9458436B2 (en) | 2004-02-27 | 2005-02-23 | Method for producing polyunsaturated fatty acids in transgenic plants |
RU2006134267/10A RU2449007C2 (ru) | 2004-02-27 | 2005-02-23 | Способ получения полиненасыщенных жирных кислот в трансгенных растениях |
PL05715462T PL1723220T3 (pl) | 2004-02-27 | 2005-02-23 | Sposób wytwarzania wielokrotnie nienasyconych kwasów tłuszczowych w roślinach transgenicznych |
EP13162907.3A EP2623584B1 (de) | 2004-02-27 | 2005-02-23 | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Pflanzen |
EP19155597.8A EP3543324B1 (de) | 2004-02-27 | 2005-02-23 | Verfahren zur herstellung mehrfach ungesättigten fettsäuren in transgenen pflanzen |
CA002559360A CA2559360A1 (en) | 2004-02-27 | 2005-02-23 | Method for producing c18, c20 and c22 polyunsaturated fatty acids in transgenic plants |
ES05715462T ES2421440T3 (es) | 2004-02-27 | 2005-02-23 | Método para preparar ácidos grasos poliinsaturados en plantas transgénicas |
JP2007500134A JP4567047B2 (ja) | 2004-02-27 | 2005-02-23 | トランスジェニック植物における多価不飽和脂肪酸の製造方法 |
EP05715462.7A EP1723220B1 (de) | 2004-02-27 | 2005-02-23 | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen |
AU2005217079A AU2005217079C1 (en) | 2004-02-27 | 2005-02-23 | Method for producing polyunsaturated fatty acids in transgenic plants |
MXPA06009572A MXPA06009572A (es) | 2004-02-27 | 2005-02-23 | Metodo para la produccion de acidos grasos poliinsaturados en plantas transgenicas. |
IL177231A IL177231A (en) | 2004-02-27 | 2006-08-02 | A method of producing unsaturated fatty acid poly in transgenic plants |
US14/823,253 US10035989B2 (en) | 2004-02-27 | 2015-08-11 | Method for producing polyunsaturated fatty acids in transgenic plants |
Applications Claiming Priority (12)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE102004009457 | 2004-02-27 | ||
DE102004009457.8 | 2004-02-27 | ||
DE102004012370.5 | 2004-03-13 | ||
DE102004012370 | 2004-03-13 | ||
DE102004017518A DE102004017518A1 (de) | 2004-04-08 | 2004-04-08 | Verfahren zur Herstellung von mehrfach ungesättigten Fettsäuren |
DE102004017518.7 | 2004-04-08 | ||
DE102004024014.0 | 2004-05-14 | ||
DE102004024014 | 2004-05-14 | ||
EPPCT/EP/04/07957 | 2004-07-16 | ||
PCT/EP2004/007957 WO2005012316A2 (de) | 2003-08-01 | 2004-07-16 | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen |
DE200410062543 DE102004062543A1 (de) | 2004-12-24 | 2004-12-24 | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Pflanzen |
DE102004062543.3 | 2004-12-24 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/590,457 A-371-Of-International US9458436B2 (en) | 2004-02-27 | 2005-02-23 | Method for producing polyunsaturated fatty acids in transgenic plants |
US14/823,253 Continuation US10035989B2 (en) | 2004-02-27 | 2015-08-11 | Method for producing polyunsaturated fatty acids in transgenic plants |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2005083093A2 true WO2005083093A2 (de) | 2005-09-09 |
WO2005083093A3 WO2005083093A3 (de) | 2006-02-16 |
Family
ID=34916613
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2005/001863 WO2005083093A2 (de) | 2004-02-27 | 2005-02-23 | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen |
Country Status (6)
Country | Link |
---|---|
EP (2) | EP1723220B1 (de) |
AU (1) | AU2005217079C1 (de) |
CA (2) | CA3045858C (de) |
PL (1) | PL1723220T3 (de) |
RU (1) | RU2449007C2 (de) |
WO (1) | WO2005083093A2 (de) |
Cited By (56)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006012326A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
WO2006069710A1 (de) * | 2004-12-23 | 2006-07-06 | Basf Plant Science Gmbh | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen organismen |
EP1756280A1 (de) * | 2004-04-22 | 2007-02-28 | Commonwealth Scientific And Industrial Research Organisation | Synthese langkettiger mehrfach ungesättigter fettsäuren durch rekombinante zellen |
WO2007017419A3 (de) * | 2005-08-09 | 2007-05-10 | Basf Plant Science Gmbh | Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in transgenen nutzpflanzen |
WO2007096387A1 (de) * | 2006-02-21 | 2007-08-30 | Basf Plant Science Gmbh | Verfahren zur herstellung von mehrfach ungesättigten fettsäuren |
WO2008009600A1 (de) * | 2006-07-21 | 2008-01-24 | Basf Plant Science Gmbh | Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in pflanzen |
WO2007123999A3 (en) * | 2006-04-20 | 2008-04-24 | Du Pont | Δ17 desaturases and their use in making polyunsaturated fatty acids |
WO2008054565A1 (en) * | 2006-10-30 | 2008-05-08 | E. I. Du Pont De Nemours And Company | Δ17 desaturase and its use in making polyunsaturated fatty acids |
WO2008085840A2 (en) | 2007-01-03 | 2008-07-17 | Monsanto Technology, Llc | Food compositions incorporating additional long chain fatty acids |
CN100410376C (zh) * | 2006-03-06 | 2008-08-13 | 中国科学院遗传与发育生物学研究所 | 与油脂代谢调控相关的转录因子GmDofC及其编码基因与应用 |
WO2008104559A1 (de) * | 2007-02-27 | 2008-09-04 | Norddeutsche Pflanzenzucht | Verfahren zur herstellung von mehrfach ungesättigten fettsäuren in transgenen organismen |
WO2008128240A1 (en) * | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
US7645604B2 (en) | 2005-11-23 | 2010-01-12 | E.I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
US7709239B2 (en) | 2006-12-07 | 2010-05-04 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
EP2166069A3 (de) * | 2003-08-01 | 2010-06-02 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
WO2010023202A3 (en) * | 2008-08-26 | 2010-06-24 | Basf Plant Science Gmbh | Nucleic acids encoding desaturases and modified plant oil |
US7807849B2 (en) | 2004-04-22 | 2010-10-05 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
DE112009001385T5 (de) | 2008-06-03 | 2011-04-14 | Basf Plant Science Gmbh | Fettsäure-Dehydratasen und Anwendungen davon |
WO2011054801A1 (en) | 2009-11-03 | 2011-05-12 | Dsm Ip Assets B.V. | Vegatable oil comprising a polyunsaturaded fatty acid having at least 20 carbon atoms |
WO2011054800A1 (en) | 2009-11-03 | 2011-05-12 | Dsm Ip Assets B.V. | Composition comprising cells and a polyunsaturated fatty acid having at least 20 carbon atoms (lc-pufa) |
WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
US8017838B2 (en) | 2006-12-07 | 2011-09-13 | E.I. Du Pont De Nemours And Company | Mutant delta-8 desaturase genes engineered by targeted mutagensis and their use in making polyunsaturated fatty acids |
EP2380984A3 (de) * | 2006-02-16 | 2011-11-30 | BASF Plant Science GmbH | Nukleinsäure |
WO2012027689A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Recombinant microbial host cells for high eicosapentaenoic acid production |
WO2012027676A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Mutant delta-9 elongases and their use in making polyunsaturated fatty acids |
WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
CN102725405A (zh) * | 2009-09-24 | 2012-10-10 | 国立大学法人九州大学 | 原生藻菌的转化方法 |
WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
AU2008216707B2 (en) * | 2007-02-12 | 2014-06-19 | E. I. Du Pont De Nemours And Company | Production of arachidonic acid in oilseed plants |
US8765422B2 (en) | 2007-07-13 | 2014-07-01 | Dsm Nutritional Products Ag | D4 desaturases and D5 elongases |
US8816111B2 (en) | 2012-06-15 | 2014-08-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US8916361B2 (en) | 2006-11-17 | 2014-12-23 | Abbott Laboratories | Elongase gene and uses thereof |
WO2015001505A2 (en) | 2013-07-05 | 2015-01-08 | Basf Plant Science Company Gmbh | Gene expression or activity enhancing elements |
US9057083B2 (en) | 2006-05-01 | 2015-06-16 | E I Du Pont De Nemours And Company | Fungal Δ-12 desaturase and Δ-15 desaturase motifs |
WO2015092709A1 (en) | 2013-12-17 | 2015-06-25 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
AU2013204296B2 (en) * | 2004-04-22 | 2015-07-23 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
AU2013273704B2 (en) * | 2006-10-06 | 2016-05-19 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
WO2016075327A2 (en) | 2014-11-14 | 2016-05-19 | Basf Plant Science Company Gmbh | Production of pufas in plants |
US9458436B2 (en) | 2004-02-27 | 2016-10-04 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids in transgenic plants |
US9624477B2 (en) | 2004-02-27 | 2017-04-18 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3-fatty acids in transgenic organisms |
US9718759B2 (en) | 2013-12-18 | 2017-08-01 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US9938486B2 (en) | 2008-11-18 | 2018-04-10 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
WO2018109059A1 (en) | 2016-12-15 | 2018-06-21 | Dsm Ip Assets B.V. | Blend formulation comprising silicate and microbial and / or plant cells comprising a polyunsaturated fatty acid having at least 20 carbon atoms (lc-pufa) |
US10005713B2 (en) | 2014-06-27 | 2018-06-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position |
US10513717B2 (en) | 2006-08-29 | 2019-12-24 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of fatty acids |
WO2020168277A1 (en) | 2019-02-14 | 2020-08-20 | Cargill, Incorporated | Brassica plants producing elevated levels of polyunsaturated fatty acids |
US11053511B2 (en) | 2010-05-17 | 2021-07-06 | Dow Agrosciences Llc | Production of DHA and other LC PUFAs in plants |
US11236351B2 (en) | 2010-05-17 | 2022-02-01 | Dow Agrosciences Llc | Production of DHA and other LC PUFAs in plants |
WO2022098631A1 (en) | 2020-11-04 | 2022-05-12 | Cargill, Incorporated | Harvest management |
WO2022204454A1 (en) | 2021-03-25 | 2022-09-29 | Cargill, Incorporated | Fertilizer management |
US11746363B2 (en) | 2013-12-20 | 2023-09-05 | MARA Renewables Corporation | Methods of recovering oil from microorganisms |
US11952581B2 (en) | 2003-08-01 | 2024-04-09 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
US11959120B2 (en) | 2016-06-10 | 2024-04-16 | MARA Renewables Corporation | Method of making lipids with improved cold flow properties |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2005235627B2 (en) * | 2004-04-22 | 2011-07-07 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US7678560B2 (en) * | 2006-05-17 | 2010-03-16 | E.I. Du Pont De Nemours And Company | Δ 5 desaturase and its use in making polyunsaturated fatty acids |
AU2013202498B2 (en) * | 2006-08-24 | 2015-04-30 | Basf Plant Science Gmbh | Isolation and characterization of a novel Pythium omega 3 desaturase with specificity to all omega 6 fatty acids longer than 18 carbon chains |
EP2271223A2 (de) * | 2008-04-25 | 2011-01-12 | BASF Plant Science GmbH | Pflanzensamenöl |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE10219203A1 (de) * | 2002-04-29 | 2003-11-13 | Basf Plant Science Gmbh | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in Pflanzen |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6677145B2 (en) * | 1998-09-02 | 2004-01-13 | Abbott Laboratories | Elongase genes and uses thereof |
DE19941609A1 (de) * | 1999-09-01 | 2001-03-08 | Inst Pflanzenbiochemie Ipb | Fettsäure-Desaturase-Gen aus Pflanzen |
EP2166069B2 (de) * | 2003-08-01 | 2024-01-24 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
-
2005
- 2005-02-23 CA CA3045858A patent/CA3045858C/en active Active
- 2005-02-23 EP EP05715462.7A patent/EP1723220B1/de not_active Revoked
- 2005-02-23 CA CA002559360A patent/CA2559360A1/en active Pending
- 2005-02-23 WO PCT/EP2005/001863 patent/WO2005083093A2/de active Application Filing
- 2005-02-23 RU RU2006134267/10A patent/RU2449007C2/ru not_active IP Right Cessation
- 2005-02-23 AU AU2005217079A patent/AU2005217079C1/en active Active
- 2005-02-23 EP EP22209519.2A patent/EP4219670A3/de active Pending
- 2005-02-23 PL PL05715462T patent/PL1723220T3/pl unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE10219203A1 (de) * | 2002-04-29 | 2003-11-13 | Basf Plant Science Gmbh | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in Pflanzen |
Non-Patent Citations (5)
Title |
---|
BEAUDOIN FREDERIC ET AL: "Heterologous reconstitution in yeast of the polyunsaturated fatty acid biosynthetic pathway" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE. WASHINGTON, US, Bd. 97, Nr. 12, 6. Juni 2000 (2000-06-06), Seiten 6421-6426, XP002200201 ISSN: 0027-8424 * |
DOMERGUE F ET AL: "Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis" EUROPEAN JOURNAL OF BIOCHEMISTRY, BERLIN, DE, Bd. 269, Nr. 16, August 2002 (2002-08), Seiten 4105-4113, XP002228745 ISSN: 0014-2956 * |
DREXLER H ET AL: "Metabolic engineering of fatty acids for breeding of new oilseed crops: Strategies, problems and first results" JOURNAL OF PLANT PHYSIOLOGY, FISCHER, STUTTGART, DE, Bd. 160, Nr. 7, Juli 2003 (2003-07), Seiten 779-802, XP002266491 ISSN: 0176-1617 * |
MEYER ASTRID ET AL: "Novel fatty acid elongases and their use for the reconstitution of docosahexaenoic acid biosynthesis." JOURNAL OF LIPID RESEARCH. OCT 2004, Bd. 45, Nr. 10, Oktober 2004 (2004-10), Seiten 1899-1909, XP009046591 ISSN: 0022-2275 * |
ZANK T K ET AL: "Cloning and functional expression of the first plant fatty acid elongase specific for DELTA6-polyunsaturated fatty acids" BIOCHEMICAL SOCIETY TRANSACTIONS, COLCHESTER, ESSEX, GB, Bd. 28, Nr. 6, Dezember 2000 (2000-12), Seiten 654-658, XP002174836 ISSN: 0300-5127 * |
Cited By (153)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2169052B1 (de) | 2003-08-01 | 2016-01-06 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
JP2011087578A (ja) * | 2003-08-01 | 2011-05-06 | Basf Plant Science Gmbh | トランスジェニック生物における多不飽和脂肪酸の製造方法 |
EP2166069B1 (de) | 2003-08-01 | 2016-06-08 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
US9433228B2 (en) | 2003-08-01 | 2016-09-06 | Basf Plant Science Gmbh | Method for the production of multiple-unsaturated fatty acids in transgenic organisms |
US11952581B2 (en) | 2003-08-01 | 2024-04-09 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
EP2166069B2 (de) † | 2003-08-01 | 2024-01-24 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
EP2166069A3 (de) * | 2003-08-01 | 2010-06-02 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen |
US11180769B2 (en) | 2003-08-01 | 2021-11-23 | Basf Plant Science Gmbh | Method for the production of multiple-unsaturated fatty acids in transgenic organisms |
EP2623584B1 (de) | 2004-02-27 | 2019-04-10 | BASF Plant Science GmbH | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Pflanzen |
US9458436B2 (en) | 2004-02-27 | 2016-10-04 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids in transgenic plants |
US9624477B2 (en) | 2004-02-27 | 2017-04-18 | Basf Plant Science Gmbh | Method for producing unsaturated omega-3-fatty acids in transgenic organisms |
US10035989B2 (en) | 2004-02-27 | 2018-07-31 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids in transgenic plants |
US11220698B2 (en) | 2004-04-22 | 2022-01-11 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US7834250B2 (en) | 2004-04-22 | 2010-11-16 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US10443079B2 (en) | 2004-04-22 | 2019-10-15 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
US10781463B2 (en) | 2004-04-22 | 2020-09-22 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US8106226B2 (en) | 2004-04-22 | 2012-01-31 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US8071341B2 (en) | 2004-04-22 | 2011-12-06 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US9994880B2 (en) | 2004-04-22 | 2018-06-12 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
US9970033B2 (en) | 2004-04-22 | 2018-05-15 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
US9963723B2 (en) | 2004-04-22 | 2018-05-08 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
EP2357243A3 (de) * | 2004-04-22 | 2011-11-23 | Commonwealth Scientific and Industrial Research Organisation | Synthese von langkettigen polyungesättigten Fettsäuren durch rekombinante Zellen |
US9951357B2 (en) | 2004-04-22 | 2018-04-24 | Commonweatlh Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
EP1756280A4 (de) * | 2004-04-22 | 2008-04-30 | Commw Scient Ind Res Org | Synthese langkettiger mehrfach ungesättigter fettsäuren durch rekombinante zellen |
US9926579B2 (en) | 2004-04-22 | 2018-03-27 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cell |
US11597953B2 (en) | 2004-04-22 | 2023-03-07 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
US7807849B2 (en) | 2004-04-22 | 2010-10-05 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
EP2357244A3 (de) * | 2004-04-22 | 2011-11-23 | Commonwealth Scientific and Industrial Research Organisation | Synthese von langkettigen polyungesättigten Fettsäuren durch rekombinante Zellen |
EP2363492A3 (de) * | 2004-04-22 | 2012-03-14 | Commonwealth Scientific and Industrial Research Organisation | Synthese von langkettigen polyungesättigten Fettsäuren durch rekombinante Zellen |
US8158392B1 (en) | 2004-04-22 | 2012-04-17 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
EP1756280A1 (de) * | 2004-04-22 | 2007-02-28 | Commonwealth Scientific And Industrial Research Organisation | Synthese langkettiger mehrfach ungesättigter fettsäuren durch rekombinante zellen |
US7932438B2 (en) | 2004-04-22 | 2011-04-26 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
AU2013204296B2 (en) * | 2004-04-22 | 2015-07-23 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of long-chain polyunsaturated fatty acids by recombinant cells |
WO2006012325A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
US7256033B2 (en) | 2004-06-25 | 2007-08-14 | E. I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
WO2006012326A1 (en) * | 2004-06-25 | 2006-02-02 | E.I. Dupont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
US7550651B2 (en) | 2004-06-25 | 2009-06-23 | E.I. Du Pont De Nemours And Company | Delta-8 desaturase and its use in making polyunsaturated fatty acids |
WO2006069710A1 (de) * | 2004-12-23 | 2006-07-06 | Basf Plant Science Gmbh | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen organismen |
WO2007017419A3 (de) * | 2005-08-09 | 2007-05-10 | Basf Plant Science Gmbh | Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in transgenen nutzpflanzen |
US8134046B2 (en) | 2005-08-09 | 2012-03-13 | Basf Plant Science Gmbh | Method for producing arachidonic acid and/or eicosapentaenoic acid in useful transgenic plants |
US8048653B2 (en) | 2005-11-23 | 2011-11-01 | E.I. Du Pont De Nemours And Company | Microbial oils produced in transformed host cells comprising delta-9 elongases |
US7645604B2 (en) | 2005-11-23 | 2010-01-12 | E.I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
EP2380984A3 (de) * | 2006-02-16 | 2011-11-30 | BASF Plant Science GmbH | Nukleinsäure |
US10533183B2 (en) | 2006-02-21 | 2020-01-14 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic Brassica plant |
US10533182B2 (en) | 2006-02-21 | 2020-01-14 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic brassica plant |
US10301638B2 (en) | 2006-02-21 | 2019-05-28 | Basf Plant Science Gmbh | Oils, lipids and fatty acids produced in transgenic Brassica plant |
US10190131B2 (en) | 2006-02-21 | 2019-01-29 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids |
WO2007096387A1 (de) * | 2006-02-21 | 2007-08-30 | Basf Plant Science Gmbh | Verfahren zur herstellung von mehrfach ungesättigten fettsäuren |
AU2013260698B2 (en) * | 2006-02-21 | 2016-05-19 | Basf Plant Science Gmbh | Method for producing polyunsaturated fatty acids |
CN100410376C (zh) * | 2006-03-06 | 2008-08-13 | 中国科学院遗传与发育生物学研究所 | 与油脂代谢调控相关的转录因子GmDofC及其编码基因与应用 |
JP2009534032A (ja) * | 2006-04-20 | 2009-09-24 | イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニー | Δ17デサチュラーゼおよび多価不飽和脂肪酸の製造におけるそれらの使用 |
US7465793B2 (en) | 2006-04-20 | 2008-12-16 | E.I. Du Pont De Nemours And Company | Synthetic Δ17 desaturase derived from Phytophthora ramourum and its use in making polyunsaturated fatty acids |
WO2007123999A3 (en) * | 2006-04-20 | 2008-04-24 | Du Pont | Δ17 desaturases and their use in making polyunsaturated fatty acids |
US9057083B2 (en) | 2006-05-01 | 2015-06-16 | E I Du Pont De Nemours And Company | Fungal Δ-12 desaturase and Δ-15 desaturase motifs |
WO2008009600A1 (de) * | 2006-07-21 | 2008-01-24 | Basf Plant Science Gmbh | Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in pflanzen |
US10513717B2 (en) | 2006-08-29 | 2019-12-24 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of fatty acids |
AU2013273704B2 (en) * | 2006-10-06 | 2016-05-19 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
AU2013273704C1 (en) * | 2006-10-06 | 2023-03-16 | Basf Plant Science Gmbh | Process for the production of polyunsaturated fatty acids in transgenic organisms |
US8241884B2 (en) | 2006-10-30 | 2012-08-14 | E I Du Pont De Nemours And Company | Δ17 desaturase and its use in making polyunsaturated fatty acids |
WO2008054565A1 (en) * | 2006-10-30 | 2008-05-08 | E. I. Du Pont De Nemours And Company | Δ17 desaturase and its use in making polyunsaturated fatty acids |
AU2007314481B2 (en) * | 2006-10-30 | 2012-11-29 | E. I. Du Pont De Nemours And Company | Delta17 desaturase and its use in making polyunsaturated fatty acids |
US7556949B2 (en) | 2006-10-30 | 2009-07-07 | E.I. Du Pont De Nemours And Company | Δ17 desaturase and its use in making polyunsaturated fatty acids |
US8916361B2 (en) | 2006-11-17 | 2014-12-23 | Abbott Laboratories | Elongase gene and uses thereof |
US8017838B2 (en) | 2006-12-07 | 2011-09-13 | E.I. Du Pont De Nemours And Company | Mutant delta-8 desaturase genes engineered by targeted mutagensis and their use in making polyunsaturated fatty acids |
US7709239B2 (en) | 2006-12-07 | 2010-05-04 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
EP2117334A2 (de) * | 2007-01-03 | 2009-11-18 | Monsanto Technology, LLC | Nahrungsmittelzusammensetzungen mit zusätzlichen langkettigen fettsäuren |
EP2117334A4 (de) * | 2007-01-03 | 2014-08-13 | Monsanto Technology Llc | Nahrungsmittelzusammensetzungen mit zusätzlichen langkettigen fettsäuren |
WO2008085840A2 (en) | 2007-01-03 | 2008-07-17 | Monsanto Technology, Llc | Food compositions incorporating additional long chain fatty acids |
AU2008216707B2 (en) * | 2007-02-12 | 2014-06-19 | E. I. Du Pont De Nemours And Company | Production of arachidonic acid in oilseed plants |
WO2008104559A1 (de) * | 2007-02-27 | 2008-09-04 | Norddeutsche Pflanzenzucht | Verfahren zur herstellung von mehrfach ungesättigten fettsäuren in transgenen organismen |
WO2008128240A1 (en) * | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
WO2008128241A1 (en) | 2007-04-16 | 2008-10-23 | E. I. Du Pont De Nemours And Company | Delta 9 elongases and their use in making polyunsaturated fatty acids |
US8377673B2 (en) | 2007-04-16 | 2013-02-19 | E.I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
AU2008240028B2 (en) * | 2007-04-16 | 2014-03-06 | Corteva Agriscience Llc | Delta 9 elongases and their use in making polyunsaturated fatty acids |
US7794701B2 (en) | 2007-04-16 | 2010-09-14 | E.I. Du Pont De Nemours And Company | Δ-9 elongases and their use in making polyunsaturated fatty acids |
US8298797B2 (en) | 2007-04-16 | 2012-10-30 | E I Du Pont De Nemours And Company | Δ-9 elongases and their use in making polyunsaturated fatty acids |
US8119860B2 (en) | 2007-04-16 | 2012-02-21 | E. I. Du Pont De Nemours And Company | Delta-9 elongases and their use in making polyunsaturated fatty acids |
US8765422B2 (en) | 2007-07-13 | 2014-07-01 | Dsm Nutritional Products Ag | D4 desaturases and D5 elongases |
US9441212B2 (en) | 2007-07-13 | 2016-09-13 | Dsm Nutritional Products Ag | Nucleic acids encoding D4 desaturases and D5 elongases |
US8901374B2 (en) | 2008-06-03 | 2014-12-02 | Basf Plant Science Gmbh | Fatty acid dehydratases and uses thereof |
DE112009001385T5 (de) | 2008-06-03 | 2011-04-14 | Basf Plant Science Gmbh | Fettsäure-Dehydratasen und Anwendungen davon |
DE112009002048T5 (de) | 2008-08-26 | 2012-01-26 | Basf Plant Science Gmbh | Nukleinsäure, die Desaturasen kodieren, und modifiziertes Planzenöl |
US9090902B2 (en) | 2008-08-26 | 2015-07-28 | Basf Plant Science Gmbh | Nucleic acids encoding desaturases and modified plant oil |
WO2010023202A3 (en) * | 2008-08-26 | 2010-06-24 | Basf Plant Science Gmbh | Nucleic acids encoding desaturases and modified plant oil |
US9938486B2 (en) | 2008-11-18 | 2018-04-10 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US11976287B2 (en) | 2008-11-18 | 2024-05-07 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing ω-3 fatty acids |
US9994792B2 (en) | 2008-11-18 | 2018-06-12 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US10648046B2 (en) | 2008-11-18 | 2020-05-12 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing omega-3 fatty acids |
US9976107B2 (en) | 2008-11-18 | 2018-05-22 | Commonwealth Scientific And Industrial Research Organisation | Enzymes and methods for producing ω-3 fatty acids |
WO2010142522A2 (en) | 2009-06-08 | 2010-12-16 | Basf Plant Science Company Gmbh | Novel fatty acid elongation components and uses thereof |
DE112010002353T5 (de) | 2009-06-08 | 2012-08-09 | Basf Plant Science Company Gmbh | Neue fettsäure-elongations-komponenten und anwenduingen davon |
US8993841B2 (en) | 2009-06-08 | 2015-03-31 | Basf Plant Science Company Gmbh | Fatty acid elongation components and uses thereof |
US11913007B2 (en) | 2009-07-17 | 2024-02-27 | Basf Plant Science Company Gmbh | Uses of novel fatty acid desaturases and elongases and products thereof |
DE112010002967T5 (de) | 2009-07-17 | 2012-10-11 | Basf Plant Science Company Gmbh | Neue Fettsäuredesaturasen und -elongasen und Anwendungen davon |
WO2011006948A1 (en) | 2009-07-17 | 2011-01-20 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases and elongases and uses thereof |
CN102725405A (zh) * | 2009-09-24 | 2012-10-10 | 国立大学法人九州大学 | 原生藻菌的转化方法 |
CN102725405B (zh) * | 2009-09-24 | 2015-08-19 | 国立大学法人九州大学 | 原生藻菌的转化方法 |
WO2011054801A1 (en) | 2009-11-03 | 2011-05-12 | Dsm Ip Assets B.V. | Vegatable oil comprising a polyunsaturaded fatty acid having at least 20 carbon atoms |
WO2011054800A1 (en) | 2009-11-03 | 2011-05-12 | Dsm Ip Assets B.V. | Composition comprising cells and a polyunsaturated fatty acid having at least 20 carbon atoms (lc-pufa) |
WO2011064181A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid desaturase and uses thereof |
WO2011064183A1 (en) | 2009-11-24 | 2011-06-03 | Basf Plant Science Company Gmbh | Novel fatty acid elongase and uses thereof |
US11236351B2 (en) | 2010-05-17 | 2022-02-01 | Dow Agrosciences Llc | Production of DHA and other LC PUFAs in plants |
US11053511B2 (en) | 2010-05-17 | 2021-07-06 | Dow Agrosciences Llc | Production of DHA and other LC PUFAs in plants |
US8980589B2 (en) | 2010-08-26 | 2015-03-17 | E I Du Pont De Nemours And Company | Mutant delta-9 elongases and their use in making polyunsaturated fatty acids |
WO2012027689A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Recombinant microbial host cells for high eicosapentaenoic acid production |
WO2012027676A1 (en) | 2010-08-26 | 2012-03-01 | E. I. Du Pont De Nemours And Company | Mutant delta-9 elongases and their use in making polyunsaturated fatty acids |
DE112011103527T5 (de) | 2010-10-21 | 2013-10-17 | Basf Plant Science Company Gmbh | Neue Fettsäure-Desaturasen, -Elongasen, -Elongations-Komponenten und Anwendungen davon |
EP2695936A1 (de) | 2010-10-21 | 2014-02-12 | BASF Plant Science Company GmbH | Neue Fettsäuredesaturasen und Verwendungen davon |
WO2012052468A2 (en) | 2010-10-21 | 2012-04-26 | Basf Plant Science Company Gmbh | Novel fatty acid desaturases, elongases, elongation components and uses therof |
US9458477B2 (en) | 2010-10-21 | 2016-10-04 | Basf Plant Science Company Gmbh | Fatty acid desaturases, elongases, elongation components and uses thereof |
US11834621B2 (en) | 2012-06-15 | 2023-12-05 | Nuseed Global Innovation Ltd. | Lipid comprising polyunsaturated fatty acids |
US8816111B2 (en) | 2012-06-15 | 2014-08-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US10335386B2 (en) | 2012-06-15 | 2019-07-02 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US9932289B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Ogranisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US9932290B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Organisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US9932541B2 (en) | 2012-06-15 | 2018-04-03 | Commonwealth Scientific And Industrial Research Organisation | Process for producing ethyl esters of polyunsaturated fatty acids |
US10899992B2 (en) | 2012-06-15 | 2021-01-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
US9969954B2 (en) | 2012-06-15 | 2018-05-15 | Commonwealth Scientific And Industrial Research Organisation | Oil comprising polyunsaturated fatty acids |
US10655082B2 (en) | 2012-06-15 | 2020-05-19 | Commonwealth Scientific And Industrial Research Organisation | Oil comprising polyunsaturated fatty acids |
US8946460B2 (en) | 2012-06-15 | 2015-02-03 | Commonwealth Scientific And Industrial Research Organisation | Process for producing polyunsaturated fatty acids in an esterified form |
US11306271B2 (en) | 2012-06-15 | 2022-04-19 | Commonwealth Scientific And Industrial Research Organisation | Process for producing extracted lipid comprising docosahexaenoic acid |
US9999607B2 (en) | 2012-06-15 | 2018-06-19 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising polyunsaturated fatty acids |
WO2014020533A2 (en) | 2012-08-03 | 2014-02-06 | Basf Plant Science Company Gmbh | Novel enzymes, enzyme components and uses thereof |
WO2015001505A2 (en) | 2013-07-05 | 2015-01-08 | Basf Plant Science Company Gmbh | Gene expression or activity enhancing elements |
US10731169B2 (en) | 2013-07-05 | 2020-08-04 | Basf Plant Science Company Gmbh | Gene expression or activity enhancing elements |
EP3795686A2 (de) | 2013-07-05 | 2021-03-24 | Basf Plant Science Company GmbH | Genexpressions- oder aktivitätsverstärkende elemente |
US10329541B2 (en) | 2013-12-17 | 2019-06-25 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
US11046937B2 (en) | 2013-12-17 | 2021-06-29 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
WO2015092709A1 (en) | 2013-12-17 | 2015-06-25 | Basf Plant Science Company Gmbh | Methods for conversion of the substrate specificity of desaturases |
US9718759B2 (en) | 2013-12-18 | 2017-08-01 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US11623911B2 (en) | 2013-12-18 | 2023-04-11 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US10125084B2 (en) | 2013-12-18 | 2018-11-13 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising docosapentaenoic acid |
US10800729B2 (en) | 2013-12-18 | 2020-10-13 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US10190073B2 (en) | 2013-12-18 | 2019-01-29 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US9725399B2 (en) | 2013-12-18 | 2017-08-08 | Commonwealth Scientific And Industrial Research Organisation | Lipid comprising long chain polyunsaturated fatty acids |
US11746363B2 (en) | 2013-12-20 | 2023-09-05 | MARA Renewables Corporation | Methods of recovering oil from microorganisms |
US10793507B2 (en) | 2014-06-27 | 2020-10-06 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the SN-2 position |
US10005713B2 (en) | 2014-06-27 | 2018-06-26 | Commonwealth Scientific And Industrial Research Organisation | Lipid compositions comprising triacylglycerol with long-chain polyunsaturated fatty acids at the sn-2 position |
US11771728B2 (en) | 2014-11-14 | 2023-10-03 | Basf Plant Science Company Gmbh | Materials and methods for increasing the tocopherol content in seed oil |
US11033593B2 (en) | 2014-11-14 | 2021-06-15 | Basf Plant Science Company Gmbh | Brassica events LBFLFK and LBFDAU and methods for detection thereof |
US10829775B2 (en) | 2014-11-14 | 2020-11-10 | Basf Plant Science Company Gmbh | Materials and methods for increasing the tocopherol content in seed oil |
EP4151733A1 (de) | 2014-11-14 | 2023-03-22 | BASF Plant Science Company GmbH | Modifizierung von pflanzlichen lipiden mit mehrfach ungesättigten fettsäuren |
US11613761B1 (en) | 2014-11-14 | 2023-03-28 | Bioriginal Food & Science Corporation | Materials and methods for PUFA production, and PUFA-containing compositions |
US11484560B2 (en) | 2014-11-14 | 2022-11-01 | Basf Plant Science Company Gmbh | Stabilising fatty acid compositions |
US11260095B2 (en) | 2014-11-14 | 2022-03-01 | Basf Plant Science Company Gmbh | Modification of plant lipids containing PUFAs |
US10760089B2 (en) | 2014-11-14 | 2020-09-01 | Basf Plant Science Company Gmbh | Materials and methods for increasing the tocopherol content in seed oil |
US11813302B2 (en) | 2014-11-14 | 2023-11-14 | Basf Plant Science Company Gmbh | Brassica events LBFLFK and LBFDAU and methods for detection thereof |
WO2016075327A2 (en) | 2014-11-14 | 2016-05-19 | Basf Plant Science Company Gmbh | Production of pufas in plants |
US11959120B2 (en) | 2016-06-10 | 2024-04-16 | MARA Renewables Corporation | Method of making lipids with improved cold flow properties |
WO2018109059A1 (en) | 2016-12-15 | 2018-06-21 | Dsm Ip Assets B.V. | Blend formulation comprising silicate and microbial and / or plant cells comprising a polyunsaturated fatty acid having at least 20 carbon atoms (lc-pufa) |
WO2020168277A1 (en) | 2019-02-14 | 2020-08-20 | Cargill, Incorporated | Brassica plants producing elevated levels of polyunsaturated fatty acids |
WO2022098631A1 (en) | 2020-11-04 | 2022-05-12 | Cargill, Incorporated | Harvest management |
WO2022204454A1 (en) | 2021-03-25 | 2022-09-29 | Cargill, Incorporated | Fertilizer management |
Also Published As
Publication number | Publication date |
---|---|
AU2005217079B2 (en) | 2012-02-02 |
CA3045858C (en) | 2023-02-21 |
RU2006134267A (ru) | 2008-04-10 |
PL1723220T3 (pl) | 2013-09-30 |
CA3045858A1 (en) | 2005-09-09 |
WO2005083093A3 (de) | 2006-02-16 |
AU2005217079C1 (en) | 2016-02-04 |
EP4219670A3 (de) | 2023-08-09 |
EP1723220B1 (de) | 2013-04-10 |
CA2559360A1 (en) | 2005-09-09 |
AU2005217079A1 (en) | 2005-09-09 |
EP4219670A2 (de) | 2023-08-02 |
EP1723220A2 (de) | 2006-11-22 |
RU2449007C2 (ru) | 2012-04-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP2623584B1 (de) | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Pflanzen | |
EP1723220B1 (de) | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen pflanzen | |
EP1769074B1 (de) | Verfahren zur erhöhung des gehalts an mehrfach ungesättigten langkettigen fettsäuren in transgenen organismen | |
EP1866417B1 (de) | Verfahren zur herstellung von mehrfach ungesättigten c20- und c22-fettsäuren mit mindestens vier doppelbindungen in transgenen pflanzen | |
EP1991684B1 (de) | Verfahren zur herstellung von mehrfach ungesättigten fettsäuren | |
EP2169052B1 (de) | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Organismen | |
EP1915451B1 (de) | Verfahren zur herstellung von arachidonsäure und/oder eicosapentaensäure in transgenen nutzpflanzen | |
EP1831377A1 (de) | Verfahren zur herstellung mehrfach ungesättigter fettsäuren in transgenen organismen | |
DE102006008030A1 (de) | Verfahren zur Herstellung von mehrfach ungesättigten Fettsäuren | |
DE102004062543A1 (de) | Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenen Pflanzen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 177231 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2559360 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/009572 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005715462 Country of ref document: EP Ref document number: 2007500134 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10590457 Country of ref document: US Ref document number: 2005217079 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 200580007428.8 Country of ref document: CN |
|
ENP | Entry into the national phase |
Ref document number: 2005217079 Country of ref document: AU Date of ref document: 20050223 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2005217079 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2006134267 Country of ref document: RU Ref document number: 3564/CHENP/2006 Country of ref document: IN |
|
WWP | Wipo information: published in national office |
Ref document number: 2005715462 Country of ref document: EP |