WO2005068664A2 - Cell-type-specific patterns of gene expression - Google Patents

Cell-type-specific patterns of gene expression Download PDF

Info

Publication number
WO2005068664A2
WO2005068664A2 PCT/US2005/000564 US2005000564W WO2005068664A2 WO 2005068664 A2 WO2005068664 A2 WO 2005068664A2 US 2005000564 W US2005000564 W US 2005000564W WO 2005068664 A2 WO2005068664 A2 WO 2005068664A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cell
genes
levels
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/000564
Other languages
English (en)
French (fr)
Other versions
WO2005068664A3 (en
Inventor
Elizabeth Duff Stuart
William Wachsman
Daniel Mercola
Michael Mcclelland
Jessica Wang-Rodriguez
David Tarin
Charles C. Berry
Karen Arden
Linda Wasserman
Steven Goodison
Igor Klacansky
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Sidney Kimmel Cancer Center
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Sidney Kimmel Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD, Sidney Kimmel Cancer Center filed Critical University of California Berkeley
Priority to JP2006549442A priority Critical patent/JP2008504803A/ja
Publication of WO2005068664A2 publication Critical patent/WO2005068664A2/en
Publication of WO2005068664A3 publication Critical patent/WO2005068664A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/30Detection of binding sites or motifs
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/50Mutagenesis
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • G16B25/10Gene or protein expression profiling; Expression-ratio estimation or normalisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

Definitions

  • This invention relates to methods for determining gene expression in cells.
  • the methods, compositions, combinations and kits provided herein employ a regression-based approach for identification of cell-type-specific patterns of gene expression in samples containing more than one type of cell.
  • the methods, compositions, combinations and kits provided herein employ a regression-based approach for identification of cell-type- specific patterns of gene expression in cancer.
  • These methods, compositions, combinations and kits provided herein can be used in the identification of genes that are differentially expressed in malignant versus non-malignant cells and further identify tumor- dependent changes in gene expression of non-malignant cells associated with malignant cells relative to non-malignant cells not associated with malignant cells.
  • the methods, compositions, combinations and kits provided herein also can be used in correlating a phenotype with gene expression in one or more cell types .
  • Such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type; measuring overall levels of one or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type and the measured overall levels; and calculating the level of each of the one or more analytes in each cell type according to the regression relationship, wherein gene expression levels correspond to the calculated levels of analytes.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type; measuring overall levels of two or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type and the measured overall levels; and calculating the level of each of the two or more analytes in each cell type according to the regression relationship, wherein gene expression levels correspond to the calculated levels of analytes.
  • Such methods can further include identifying genes differentially expressed in at least one cell type relative to at least one other cell type.
  • the analyte can be selected from a nucleic acid molecule and a protein.
  • Such a method can include determining the relative content of each cell type in two or more cell samples of the same tissue or organ, wherein the two or more cell samples include at least a first sample containing malignant cells and a second sample that does not contain the same relative content of each cell type as the first sample; measuring overall expression levels of one or more genes in each sample; determining the regression relationship between the relative content of each cell type and the measured overall levels; calculating the level of each of the one or more genes in each cell type according to the regression relationship; and identifying genes differentially expressed in malignant cells relative to non- malignant cells.
  • Such a method also can include determining the relative content of each cell type in two or more cell samples of the same tissue or organ, wherein the two or more cell samples include at least a first sample containing malignant cells and a second sample that does not contain the same relative content of each cell type as the first sample; measuring overall expression levels of two or more genes in each sample; determining the regression relationship between the relative content of each cell type and the measured overall levels; calculating the level of each of the two or more genes in each cell type according to the regression relationship; and identifying genes differentially expressed in malignant cells relative to non-malignant cells.
  • Also provided herein are methods, compositions, combinations and kits for characterizing one or more cell types in a subject.
  • such a method can include measuring expression levels of one or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to a plurality of reference expression levels of the one or more genes, wherein the plurality of reference levels are indicative of two or more cell types; and if the measured levels match reference levels indicative of a specific cell type in the sample, identifying a subject as having the specific cell type.
  • such a method can include measuring expression levels of two or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to a plurality of reference expression levels of the two or more genes, wherein the plurality of reference levels are indicative of two or more cell types; and if the measured levels match reference levels indicative of a specific cell type in the sample, identifying a subject as having the specific cell type.
  • provided herein are methods, compositions, combinations and kits for characterizing one or more cell types in a subject, by measuring expression levels of one or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the one or more genes, wherein the reference expression levels are determined according to the methods provided herein; and if the measured levels match reference levels indicative of a specific cell type in the sample, identifying a subject as having the specific cell type.
  • provided herein are methods, compositions, combinations and kits for characterizing one or more cell types in a subject, by measuring expression levels of two or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the two or more genes, wherein the reference expression levels are determined according to the methods provided herein; and if the measured levels match reference levels indicative of a specific cell type in the sample, identifying a subject as having the specific cell type.
  • the specific cell type can be selected from the group consisting of malignant cell and non-malignant cell adjacent to a malignant cell in a subject.
  • Also provided herein are methods for identifying a subject as having malignant cells by measuring expression levels of one or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to a plurality of reference expression levels of the one or more genes, wherein the plurality of reference levels are indicative of two or more cell types; and if the measured levels match reference levels indicative of in malignant cells in the sample or of non-malignant cells in the sample that had been adjacent to malignant cells in the subject, identifying a subject as having malignant cells.
  • Also provided herein are methods for identifying a subject as having malignant cells by measuring expression levels of two or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to a plurality of reference expression levels of the two or more genes, wherein the plurality of reference levels are indicative of two or more cell types; and if the measured levels match reference levels indicative of in malignant cells in the sample or of non-malignant cells in the sample that had been adjacent to malignant cells in the subject, identifying a subject as having malignant cells.
  • provided herein are methods of identifying a subject as having malignant cells, by measuring expression levels of one or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the one or more genes, wherein the reference expression levels are determined according to the methods provided herein; and if the measured levels match reference levels indicative of in malignant cells in the sample or of non-malignant cells in the sample that had been adjacent to malignant cells in the subject, identifying a subject as having malignant cells.
  • provided herein are methods of identifying a subject as having malignant cells, by measuring expression levels of two or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the two or more genes, wherein the reference expression levels are determined according to the methods provided herein; and if the measured levels match reference levels indicative of in malignant cells in the sample or of non-malignant cells in the sample that had been adjacent to malignant cells in the subject, identifying a subject as having malignant cells.
  • identifying a subject as having malignant cells by assaying a cell sample from a subject for non-malignant cells in the sample that had been adjacent to malignant cells in the subject; and if the malignant-cell-adjacent non-malignant cells are present in the sample, identifying a subject as having malignant cells.
  • the malignant-cell-adjacent non-malignant cells can be stromal cells.
  • Such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein at least two of the samples correspond to different phenotypes; measuring overall levels of one or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type for each phenotype and the measured overall levels; and calculating the level of each of the one or more analytes in each cell type for each phenotype according to the regression relationship, wherein gene expression levels in each cell type for each phenotype correspond to the calculated levels of analytes.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein at least two of the samples correspond to different phenotypes; measuring overall levels of two or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type for each phenotype and the measured overall levels; and calculating the level of each of the two or more analytes in each cell type for each phenotype according to the regression relationship, wherein gene expression levels in each cell type for each phenotype correspond to the calculated levels of analytes.
  • Such a method can include measuring expression levels of one or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the one or more genes, wherein the reference expression levels are determined according to methods provided herein; and if the measured levels match reference levels indicative of a specific phenotype, identifying a subject as having the specific phenotype.
  • such a method can include measuring expression levels of two or more genes in a cell sample from a subject; comparing the measured levels to reference expression levels of the two or more genes, wherein the reference expression levels are determined according to methods provided herein; and if the measured levels match reference levels indicative of a specific phenotype, identifying a subject as having the specific phenotype. Also provided are methods wherein the phenotype can be indicative of prognosis of a disease or disorder.
  • the method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein at least one sample is from a subject with a disease or disorder and at least one sample is from a subject without a disease or disorder; measuring overall levels of one or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type for both disease and non-disease and the measured overall levels; and calculating the level of each of the one or more analytes in each cell type for both disease and non-disease according to the regression relationship, wherein gene expression levels in each cell type for both disease and non- disease correspond to the calculated levels of analytes.
  • the method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein at least one sample is from a subject with a disease or disorder and at least one sample is from a subject without a disease or disorder; measuring overall levels of two or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell type for both disease and non-disease and the measured overall levels; and calculating the level of each of the two or more analytes in each cell type for both disease and non-disease according to the regression relationship, wherein gene expression levels in each cell type for both disease and non- disease correspond to the calculated levels of analytes.
  • the prognosis can be tumor relapse, aggressiveness of tumor, indolence of tumor, survival, or likelihood of successful treatment of tumor.
  • the sample is clinically classified as negative of a tumor, and presence in the sample of non-malignant cells adjacent to malignant cells can be indicative of tumor, tumor relapse, aggressiveness of tumor, indolence of tumor, survival, or likelihood of successful treatment of tumor.
  • Also provided herein are methods, compositions, combinations and kits for identifying environment-dependent changes in gene expression of a cell type.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein cells of the same type that are in different cell environments are separately classified; measuring overall levels of one or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell classification and the measured overall levels; calculating the level of each of the one or more analytes in each cell classification according to the regression relationship; and identifying genes differentially expressed in separately classified cells of the same type, thereby identifying environment-dependent changes in gene expression of a cell type.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein cells of the same type that are in different cell environments are separately classified; measuring overall levels of two or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell classification and the measured overall levels; calculating the level of each of the two or more analytes in each cell classification according to the regression relationship; and identifying genes differentially expressed in separately classified cells of the same type, thereby identifying environment-dependent changes in gene expression of a cell type.
  • Another method of identifying tumor-dependent changes in gene expression of a cell type includes determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein cells associated with tumor are classified separately from cells of the same type that are not associated with tumor; measuring overall levels of one or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell classification and the measured overall levels; calculating the level of each of the one or more analytes in each cell classification according to the regression relationship; and identifying genes differentially expressed in cells associated with tumor relative to cells of the same type that are not associated with tumor.
  • Another method of identifying tumor-dependent changes in gene expression of a cell type includes determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, and wherein cells associated with tumor are classified separately from cells of the same type that are not associated with tumor; measuring overall levels of two or more gene expression analytes in each sample; determining the regression relationship between the relative content of each cell classification and the measured overall levels; calculating the level of each of the two or more analytes in each cell classification according to the regression relationship; and identifying genes differentially expressed in cells associated with tumor relative to cells of the same type that are not associated with tumor.
  • a method can include measuring expression levels of one or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to reference expression levels of the one or more genes, wherein the plurality of reference levels are indicative of two or more phenotypes; and if the measured levels match reference levels indicative of a specific phenotype, identifying a subject as having the specific phenotype.
  • a method can include measuring expression levels of two or more genes in a heterogeneous cell sample from a subject; comparing the measured levels to reference expression levels of the two or more genes, wherein the plurality of reference levels are indicative of two or more phenotypes; and if the measured levels match reference levels indicative of a specific phenotype, identifying a subject as having the specific phenotype.
  • all steps can be performed without physically separating the cells in the sample.
  • the step of determining the regression relationship can include determining the regression of overall levels of each analyte on the cell proportions.
  • a method can include detecting the expression levels of genes relative to a reference, the genes comprising at least 2 different indicating genes, wherein each indicating gene comprises either: (a) a nucleotide sequence at least 90% identical to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof or (b) a nucleotide sequence that hybridizes under high stringency to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof.
  • provided herein are methods, compositions, combinations and kits for classifying a cell sample as indicative of prostate cancer or not indicative of prostate cancer.
  • a use of a combination for the preparation of a composition for classifying a sample as indicative of prostate cancer or not indicative of prostate cancer wherein the combination detects the expression levels of genes relative to a reference, the genes comprising at least 2 different indicating genes, wherein each indicating gene comprises either: (a) a nucleotide sequence at least 90% identical to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof or (b) a nucleotide sequence that hybridizes under high stringency to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof.
  • the nucleotide sequences selected from SEQ ID NO:l- 38,826 are selected from SEQ ID NO: 35, 580-38, 826.
  • the methods, compositions, combinations, uses and kits provided herein can be used to detect the expression levels of genes relative to a reference, the genes comprising at least 5, 10, 15, 20, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500, 750, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, or 2750 indicating genes.
  • microarrays wherein at least 50%, 70%, 80%, 90%, 95%, 97%, 98% or 99% of the loci of the array specifically detect the expression level of the 2 or more indicating genes of the methods, compositions, combinations, uses and kits provided herein.
  • a method can include modulating the activity of a gene product selected from the group consisting of: (a) a product of a gene comprising a nucleotide sequence at least 90% identical to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof or (b) a gene product complementary to a nucleotide sequence that hybridizes under high stringency to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • the compound can be selected from the group consisting of an antibody, an antisense compound, a ribozyme, a DNAzyme, an RNA interference compound, a small molecule, a heterologous nucleic acid molecule encoding the gene, the gene product, and any combination thereof.
  • the modulating compound can specifically bind to mRNA encoding the gene or the protein gene product and thereby inhibit expression of the gene.
  • the modulating step can further include administering to a subject with prostate cancer a compound that increases the activity of the gene product selected from the selected from the group consisting of heterologous nucleic acid molecule encoding the gene, the gene product, and a combination thereof.
  • the heterologous nucleic acid molecule can be an expression vector.
  • a method can include contacting with a test compound a cell expressing a gene selected from the group consisting of: (a) a gene comprising a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof; and (b) a gene comprising a nucleotide sequence that hybridizes under high stringency to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof, and measuring expression levels of the gene, wherein a change in expression levels relative to a reference identifies the compound as a compound that modulates a expression of the gene.
  • Another screening method includes contacting with a test compound a gene product selected from the group consisting of: a product of a gene comprising a nucleotide sequence at least 90% identical to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof or (b) a gene product complementary to a nucleotide sequence that hybridizes under high stringency to a nucleotide sequence selected from SEQ ID NO: 1-38, 826 or a complement thereof, and either: (i) identifying a test compound that specifically binds to the gene product, or (ii) identifying a test compound that inhibits binding of a compound known to bind the gene product.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO:35, 580-38, 826.
  • At least one of the gene products corresponds to a Probe or Identifer/LocusLink with a modified t statistic in tumor >2.5 or ⁇ -2.5.
  • at least one of the gene products corresponds to a Probe or Identifer/LocusLink with a modified t statistic in benign prostatic hypertrophy (BPH) >2.5 or ⁇ -2.5.
  • BPH benign prostatic hypertrophy
  • at least one of the gene products corresponds to a Probe or Identifer/LocusLink with a modified t statistic in stroma >2.5 or ⁇ -2.5.
  • the gene product can be selected from the group consisting of: (a) a product of a gene comprising a nucleotide sequence at least 90% identical to the nucleotide sequence of a Probe identified in Table 9 as having a modified t statistic in tumor >2.5 or ⁇ -2.5; (b) a product of a gene comprising a nucleotide sequence at least 90% identical to the nucleotide sequence of a gene encoded by an Identifier and LocusLink identified in Table 9 as having a modified t statistic in tumor >2.5 or ⁇ -2.5; (c) a product of a gene comprising a nucleotide sequence at least 90% identical to the nucleotide sequence of a Probe identified in Table 10 as having a modified t statistic in stroma >2.5 or ⁇ -2.5; and (d) a product of a gene comprising a nucleotide sequence at least 90% identical to the nucleotide sequence of a gene
  • the modified t statistic can be >3 or ⁇ -3, >3.5 or ⁇ -3.5, >4 or ⁇ -4, >4.5 or ⁇ - 4.5, or >5 or ⁇ -5.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • such a compound can be selected from the group consisting of an antibody, an antisense compound, a ribozyme, a DNAzyme, an RNA interference compound, a small molecule, a heterologous nucleic acid molecule encoding the gene, the gene product, and any combination thereof.
  • Some compounds provided herein are present in pharmaceutically acceptable form.
  • nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • such a compound can be selected from the group consisting of a nucleic acid molecule that specifically binds at least 10 nucleotides in the gene or a complement thereof or a fragment thereof, an antibody that specifically binds the gene or a complement thereof, and an antibody that specifically binds the gene product or a fragment thereof.
  • kits comprising nucleic acids, polypeptides and/or antibodies useful in detecting the markers set forth in SEQ ID NO: 1-38, 826 for detecting prostate cancer. Also provided herein are methods of treating or preventing prostate cancer comprising suppressing gene expression or inhibiting or neutralizing the gene product of the genes that are listed as tumor markers and that are differentially expressed in the Tables provided herein and SEQ ID NO: 1-38, 826.
  • antibodies, antisense, ribozyme, a DNAzyme, RNA interference, and/or small molecule therapy to neutralize the gene or gene products can be used.
  • prognostic markers for early relapse in prostate cancer as set forth in SEQ ID NO: 1-38, 826, complements thereof, fragments thereof, and polypeptides encoded thereby.
  • kits comprising nucleic acids, polypeptides and/or antibodies useful in detecting the markers set forth in SEQ ID NO: 1-38, 826, complements thereof, fragments thereof, and polypeptides encoded thereby for detecting early relapse of prostate cancer.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • methods of treating or preventing prostate cancer comprising suppressing gene expression or inhibiting or neutralizing the gene product of genes that are up-regulated in the tumor epithelial cells of early relapsed prostate cancer samples, wherein such genes have a T > 3 in Table 8, Table 9, Table 10, Table 12 or Table 13.
  • antibodies, antisense, ribozyme, a DNAzyme, RNA interference, and/or small molecule therapy to neutralize the gene or gene products can be used.
  • computer implemented methods are also provided herein.
  • FIG. 1 depicts graphs showing agreement analysis of pathologists' percent estimates by calculation of Pearson correlation coefficients.
  • the figure shows agreement among four pathologists, for the analysis of prostate cancer sections. A total of 363 rankings were analyzed.
  • the y- and x- axes give the percent of a given tissue section estimated to be tumor epithelial cells by rater whose initials occur in the diagonal panels found by moving horizontally and vertically respectively.
  • the histograms below the diagonal show few instances in which y 1: , lk - - y ⁇ :)2 - exceeds 20%, and usually it is ⁇ 5%.
  • the k statistics and the Pearson correlations coefficients are all high. Many of the ratings showed ⁇ 5% tumor cells (histograms on diagonal) , making this a good test for presence versus absence of tumor cells.
  • FIG. 2 shows a ternary graph of sample characteristics. Eighty-eight prostatectomy samples from 41 individuals comprising 50 nontumor and 38 tumor-containing specimens were scored for proportional content of tumor, BPH, stroma, and dilated cystic glands. Vertices represent pure tissue types. Epithelia of dilated cystic glands, nerves, and vessels are small components. Note the wide range of proportions of tumor and stromal cells. Estimated tumor percentages ranged from 0.3% through 100%. The proportions were used in the linear models (x k -, in Equation 1) for cell-associated gene expression.
  • FIG. 3A-C shows statistical modeling.
  • A Regression on cell type.
  • B Multiple regression on percentage stroma, BPH, and tumor allows direct identification of tumor-BPH differences beyond the effect of stroma. Posterior probabilities akin to those in Efron et al. (J. Am.
  • Inclusion of cross-product terms in the linear model identifies genes in which the contribution of a cell may be more or less than in another tissue environment; i.e., the contributions of individual cell types to the overall profile depend on the proportions of other types present.
  • Data show tumor-stroma cross- product modified t sta tistics versus probabilities (y axis) , which were calculated as in B by comparing actual with permuted modified t sta tistics .
  • the upper left portion of graph represents a large number of stroma-associated genes with a high likelihood deviation from a strictly linear model.
  • the right portion of the graph reveals a number of tumor-associated genes that deviate from linearity.
  • TCRy which is among the most discriminant tumor/no tumor genes even at low proportions of tumor; i.e., the expression of TCRy is greater than that predicted by proportion of tumor cells alone.
  • the stromal gene with the greatest deviation was TGF- ⁇ 2, a candidate paracrine signaling molecule in prostate cancer.
  • FIG. 4 Validation the GeneChip analysis with LCM/qPCR.
  • Six prostate specimens were used for isolation of each cell type by laser capture microdissection (LCM) .
  • Primer sets for 31 selected genes including house keeping genes, including several genes validated by IHC (e.g. Tubulin- ⁇ , PSA, Desmin, and Cytokeratin- 15) were used for assay of target gene expression by quantitative RT-PCR (qPCR) .
  • the qPCR data were subjected to quantile normalization.
  • Spearman Rank-Order correlation coefficients were evaluated for 20 genes with modified t-statistic > 2.4 for at least one cell type (i.e.
  • Differential expression refers to both quantitative as well as qualitative differences in the extend of the genes' expression depending on differential development and/or tumor growth.
  • Differentially expressed genes can represent marker genes, and/or target genes.
  • the expression pattern of a differentially expressed gene disclosed herein can be utilized as part of a prognostic or diagnostic evaluation of a subject.
  • the expression pattern of a differentially expressed gene can be used to identify the presence of a particular cell type in a sample.
  • a differentially expressed gene disclosed herein can be used in methods for identifying reagents and compounds and uses of these reagents and compounds for the treatment of a subject as well as methods of treatment.
  • Bioactivity or bioactivity or activity or biological function which are used interchangeably, herein mean an effector or antigenic function that is directly or indirectly performed by a polypeptide (whether in its native or denatured conformation) , or by any fragment thereof in vivo or in vitro.
  • Biological activities include but are not limited to binding to polypeptides, binding to other proteins or molecules, enzymatic activity, signal transduction, activity as a DNA binding protein, as a transcription regulator, ability to bind damaged DNA, etc.
  • a bioactivity can be modulated by directly affecting the subject polypeptide.
  • a bioactivity can be altered by modulating the level of the polypeptide, such as by modulating expression of the corresponding gene.
  • gene expression analyte refers a biological molecule, e.g., a nucleic acid, peptide, hormone, etc., whose presence or concentration can be detected and correlated with gene expression.
  • gene expression levels refers to the amount of biological macromolecule produced from a gene.
  • expression levels of a particular gene can refer to the amount of protein produced from that particular gene, or can refer to the amount of mRNA produced from that particular gene.
  • Gene expression levels can refer to an absolute (e.g., molar or gram-quantity) levels or relative (e.g., the amount relative to a standard, reference, calibration, or to another gene expression level) .
  • gene expression levels used herein are relative expression levels.
  • gene expression levels can be considered in terms of any manner of describing gene expression known in the art. For example, regression methods that consider gene expression levels can consider the measurement of the level of a gene expression analyte, or the level calculated or estimated according to the measurement of the level of a gene expression analyte.
  • Marker gene refers to a differentially expressed gene which expression pattern can serve as part of a phenotype-indicating method, such as a predictive method, prognostic or diagnostic method, or other cell-type distinguishing evaluation, or which, alternatively, can be used in methods for identifying compounds useful for the treatment or prevention of diseases or disorders, or for identifying compounds that modulate the activity of one or more gene products.
  • a phenotype indicated by methods provided herein can be a diagnostic indication, a prognostic indication, or an indication of the presence of a particular cell type in a subject.
  • Diagnostic indications include indication of a disease or a disorder in the subject, such as presence of tumor or neoplastic disease, inflammatory disease, autoimmune disease, and any other diseases known in the art that can be identified according to the presence or absence of particular cells or by the gene expression of cells.
  • prognostic indications refers to the likely or expected outcome of a disease or disorder, including, but not limited to, the likelihood of survival of the subject, likelihood of relapse, aggressiveness of the disease or disorder, indolence of the disease or disorder, and likelihood of success of a particular treatment regimen.
  • a gene expression analyte refers to a biological molecule that indicates the expression of a particular gene.
  • a gene expression analyte can be a mRNA of a particular gene, or a fragment thereof (including, e.g., byproducts of mRNA splicing and nucleolytic cleavage fragments), a protein of a particular gene or a fragment thereof (including, e.g., post-translationally modified proteins or by-products therefrom, and proteolytic fragments) , and other biological molecules such as a carbohydrate, lipid or small molecule, whose presence or absence corresponds to the expression of a particular gene.
  • gene expression levels that correspond to levels of gene expression analytes refers to the relationship between an analyte that indicates the expression of a gene, and the actual level of expression of the gene. Typically the level of a gene expression analyte is measured in experimental methods used to determine gene expression levels. As understood by one skilled in the art, the measured gene expression levels can represent gene expression at a variety of levels of detail (e.g., the absolute amount of a gene expressed, the relative amount of gene expressed, or an indication of increased or decreased levels of expression) .
  • the level of detail at which the levels of gene expression analytes can indicate levels of gene expression can be based on a variety of factors that include the number of controls used, the number of calibration experiments or reference levels determined, and other factors known in the art.
  • increase in the levels of a gene expression analyte can indicate increase in the levels of the gene expressed
  • a decrease in the levels of a gene expression analyte can indicate decrease in the levels of the gene expressed.
  • a regression relationship between relative content of a cell type and measured overall levels of a gene expression analyte refers to a quantitative relationship between cell type and level of gene expression analyte that is determined according to the methods provided herein based on the amount of cell type present in two or more samples and experimentally measured levels of gene expression analyte. In one embodiment, the regression relationship is determined by determining the regression of overall levels of each gene expression analyte on determined cell proportions.
  • the regression relationship is determined by linear regression, where the overall expression level or the expression analyte levle is treated as directly proportional to (e.g., linear in) cell percent either for each cell type in turn or all at once and the slopes of these linear relationships can be expressed as beta values.
  • a heterogeneous sample refers to a sample that contains more than one cell type.
  • a heterogeneous sample can contain stromal cells and tumor cells.
  • the different cell types present in a sample are present in greater than about 0.1%, 0.2%, 0.3%, 0.5%, 0.7%, 1%, 2%, 3%, 4% or 5% or greater than 0.1%, 0.2%, 0.3%, 0.5%, 0.7%, 1%, 2%, 3%, 4% or 5%.
  • cell samples such as tissue samples from a subject, can contain minute amounts of a variety of cell types (e.g., nerve, blood, vascular cells) .
  • related cell samples refers to samples that contain one or more cell types in common.
  • Related cell samples can be samples from the same tissue type or from the same organ.
  • Related cell samples can be from the same or different sources (e.g., same or different individuals or cell cultures, or a combination thereof) .
  • tumor cells refers to cells with cytological and adherence properties consisting of nuclear and cyoplasmic features and patterns of cell-to-cell association that are known to pathologists skilled in the art as sufficient for the diagnosis as cancers of various types.
  • tumor cells have abnormal growth properties, such as neoplastic growth properties .
  • cells associated with tumor refers to cells that, while not necessarily malignant, are present in tumorous tissues or organs or particular locations of tissues or organs, and are not present, or are present at insignificant levels, in normal tissues or organs, or in particular locations of tissues or organs.
  • benign prostatic hyperplastic (BPH) cells refers to the cells of the epithelial lining of hyperplastic prostate glands.
  • dilated cystic glands cells refers to the cells of the epithelial lining of dilated (atrophic) cystic prostate glands.
  • stromal cells refers to the combined connective tissue cells and smooth muscle cells forming the stroma of an organ.
  • Exemplary stromal cells are cells of the stroma of the prostate gland.
  • a reference refers to a value or set of related values for one or more variables.
  • a reference gene expression level refers to a gene expression level in a particular cell type. Reference expression levels can be determined according to the methods provided herein, or by determining gene expression levels of a cell type in a homogenous sample. Reference levels can be in absolute or relative amounts, as is known in the art. In certain embodiments, a reference expression level can be indicative of the presence of a particular cell type.
  • only one particular cell type may have high levels of expression of a particular gene, and, thus, observation of a cell type with high measured expression levels can match expression levels of that particular cell type, and thereby indicate the presence of that particular cell type in the sample.
  • a reference expression level can be indicative of the absence of a particular cell type.
  • two or more references can be considered in determining whether or not a particular cell type is present in a sample, and also can be considered in determining the relative amount of a particular cell type that is present in the sample.
  • a modified t statistic is a numerical representation of the ability of a particular gene product or indicator thereof to indicate the presence or absence of a particular cell type in a sample.
  • relative content of a cell type or cell proportion refers to the amount of a cell mixture that is populated by a particular cell type. Typically, heterogeneous cell mixtures contain two or more cell types, and, therefore, no single cell type makes up 100% of the mixture.
  • Relative content can be expressed in any of a variety of forms known in the art; For example, relative content can be expressed as a percentage of the total amount of cells in a mixture, or can be expressed relative to the amount of a particular cell type.
  • percent cell or percent cell composition is the percent of all cells that a particular cell type accounts for in a heterologous cell mixture, such as a microscopic section sampling a tissue.
  • array or matrix is meant an arrangement of addressable locations or addresses on a device.
  • the locations can be arranged in two dimensional arrays, three dimensional arrays, or other matrix formats.
  • the number of locations can range from several to at least hundreds of thousands. Most importantly, each location represents a totally independent reaction site.
  • Arrays include but are not limited to nucleic acid arrays, protein arrays and antibody arrays.
  • a nucleic acid array refers to an array containing nucleic acid probes, such as oligonucleotides, polynucleotides or larger portions of genes.
  • the nucleic acid on the array can be single stranded.
  • oligonucleotide arrays or oligonucleotide chips wherein the probes are oligonucleotides are referred to as oligonucleotide arrays or oligonucleotide chips.
  • a microarray herein also refers to a biochip or biological chip, an array of regions having a density of discrete regions of at least about 100/cm2, and can be at least about 1000/ cm2. The regions in a microarray have typical dimensions, e.g., diameters, in the range of between about 10-250 ⁇ m, and are separated from other regions in the array by about the same distance.
  • a protein array refers to an array containing polypeptide probes or protein probes which can be in native form or denatured.
  • An antibody array refers to an array containing antibodies which include but are not limited to monoclonal antibodies (e.g. from a mouse), chimeric antibodies, humanized antibodies or phage antibodies and single chain antibodies as well as fragments from antibodies.
  • agonist is meant to refer to an agent that mimics or upregulates (e.g., potentiates or supplements) the bioactivity of a protein.
  • An agonist can be a wild-type protein or derivative thereof having at least one bioactivity of the wild- type protein.
  • An agonist can also be a compound that upregulates expression of a gene or which increases at least one bioactivity of a protein.
  • An agonist can also be a compound which increases the interaction of a polypeptide with another molecule, e.g., a target peptide or nucleic acid.
  • a polynucleotide or nucleic acid molecule is a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides . This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA.
  • nucleotide modifications such as, for example, those with uncharged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example proteins (including e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), those containing nucleotide analogs (e.g., peptide nucleic acids), as well as unmodified forms of the polynucle
  • a polynucleotide derived from a designated sequence refers to a polynucleotide sequence which is comprised of a sequence of approximately at least about 6 nucleotides, at least about 8 nucleotides, at least about 10-12 nucleotides, or at least about 15-20 nucleotides corresponding to a region of the designated nucleotide sequence.
  • Corresponding polynucleotides are homologous to or complementary to a designated sequence.
  • the sequence of the region from which the polynucleotide is derived is homologous to or complementary to a sequence that is unique to a gene provided herein.
  • a recombinant protein is a protein made using recombinant techniques, i.e. through the expression of a recombinant nucleic acid as depicted above.
  • a recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics.
  • the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure.
  • an isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, constituting at least about 0.5%, or at least about 5% by weight of the total protein in a given sample.
  • a substantially pure protein comprises at least about 50-75% by weight of the total protein, at least about 80%, or at least about 90%.
  • the definition includes the production of a protein from one organism in a different organism or host cell.
  • the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels.
  • the protein may be in a form not normally found in nature, as in the addition of an epitope tag or amino acid substitutions, insertions and deletions, as discussed below.
  • disease or disorder refers to a pathological condition in an organism resulting from, e.g., infection or genetic defect, and characterized by identifiable symptoms .
  • nucleic acid molecules have nucleotide sequences that are at least, for example, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical can be determined using known computer algorithms such as the FAST A program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444 (other programs include the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al .
  • the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in the shorter of the two sequences.
  • Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res.
  • identity represents a comparison between a test and a reference polypeptide or polynucleotide.
  • the term at least 90% identical to refers to percent identities from 90 to 100 relative to the reference polypeptides. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polynucleotide length of 100 amino acids are compared. No more than 10% (i.e., 10 out of 100) amino acids in the test polypeptide differs from that of the reference polypeptides. Similar comparisons can be made between a test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g.
  • 10/100 amino acid difference (approximately 90% identity) . Differences are defined as nucleic acid or amino acid substitutions, or deletions. At the level of homologies or identities above about 85-90%, the result should be independent of the program and gap parameters set; such high levels of identity can be assessed readily, often without relying on software .
  • primer refers to an oligonucleotide containing two or more deoxyribonucleotides or ribonucleotides, typically more than three, from which synthesis of a primer extension product can be initiated.
  • Experimental conditions conducive to synthesis include the presence of nucleoside triphosphates and an agent for polymerization and extension, such as DNA polymerase, and a suitable buffer, temperature and pH.
  • animals include any animal, such as, but are not limited to, goats, cows, deer, sheep, rodents, pigs and humans. Non-human animals, exclude humans as the contemplated animal.
  • the SPs provided herein are from any source, animal, plant, prokaryotic and fungal.
  • genetic therapy involves the transfer of heterologous nucleic acid, such as DNA, into certain cells, target cells, of a mammal, particularly a human, with a disorder or conditions for which such therapy is sought.
  • the nucleic acid, such as DNA is introduced into the selected target cells in a manner such that the heterologous nucleic acid, such as DNA, is expressed and a therapeutic product encoded thereby is produced.
  • the heterologous nucleic acid, such as DNA can in some manner mediate expression of DNA that encodes the therapeutic product, or it can encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product.
  • Genetic therapy can also be used to deliver nucleic acid encoding a gene product that replaces a defective gene or supplements a gene product produced by the mammal or the cell in which it is introduced.
  • the introduced nucleic acid can encode a therapeutic compound, such as a growth factor inhibitor thereof, or a tumor necrosis factor or inhibitor thereof, such as a receptor therefor, that is not normally produced in the mammalian host or that is not produced in therapeutically effective amounts or at a therapeutically useful time.
  • the heterologous nucleic acid, such as DNA, encoding the therapeutic product can be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.
  • Genetic therapy can also involve delivery of an inhibitor or repressor or other modulator of gene expression.
  • heterologous nucleic acid is nucleic acid that encodes RNA or RNA and proteins that are not normally produced in vivo by the cell in which it is expressed or that mediates or encodes mediators that alter expression of endogenous nucleic acid, such as DNA, by affecting transcription, translation, or other regulatable biochemical processes.
  • Heterologous nucleic acid, such as DNA can also be referred to as foreign nucleic acid, such as DNA.
  • heterologous nucleic acid includes exogenously added nucleic acid that is also expressed endogenously .
  • heterologous nucleic acid include, but are not limited to, nucleic acid that encodes traceable marker proteins, such as a protein that confers drug resistance, nucleic acid that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and nucleic acid, such as DNA, that encodes other types of proteins, such as antibodies.
  • Antibodies that are encoded by heterologous nucleic acid can be secreted or expressed on the surface of the cell in which the heterologous nucleic acid has been introduced.
  • Heterologous nucleic acid is generally not endogenous to the cell into which it is introduced, but has been obtained from another cell or prepared synthetically. Generally, although not necessarily, such nucleic acid encodes RNA and proteins that are not normally produced by the cell in which it is now expressed.
  • a therapeutically effective product for gene therapy is a product that is encoded by heterologous nucleic acid, typically DNA, that, upon introduction of the nucleic acid into a host, a product is expressed that ameliorates or eliminates the symptoms, manifestations of an inherited or acquired disease or that cures the disease. Also included are biologically active nucleic acid molecules, such as RNAi and antisense.
  • disease or disorder treatment or compound refers to any therapeutic regimen and/or agent that, when used alone or in combination with other treatments or compounds, can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with the disease or disorder.
  • nucleic acids include DNA, RNA and analogs thereof, including peptide nucleic acids (PNA) and mixtures thereof. Nucleic acids can be single or double-stranded. When referring to probes or primers, optionally labeled, with a detectable label, such as a fluorescent or radiolabel, single-stranded molecules are contemplated. Such molecules are typically of a length such that their target is statistically unique or of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 14, 16 or 30 contiguous of sequence complementary to or identical a gene of interest. Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids long.
  • operative linkage of heterologous nucleic acids to regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences refers to the relationship between such nucleic acid, such as DNA, and such sequences of nucleotides.
  • operatively linked or operationally associated refers to the functional relationship of nucleic acid, such as DNA, with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • consensus ribosome binding sites see, e.g., Kozak J. Biol. Chem. 266:19867-19870 (1991)
  • the desirability of (or need for) such modification can be empirically determined.
  • a sequence complementary to at least a portion of an RNA means a sequence having sufficient complementarity to be able to hybridize with the RNA, generally under moderate or high stringency conditions, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA (or dsRNA) can thus be tested, or triplex formation can be assayed.
  • the ability to hybridize depends on the degree of complementarily and the length of the antisense nucleic acid.
  • antisense polynucleotides refer to synthetic sequences of nucleotide bases complementary to mRNA or the sense strand of double-stranded DNA. Admixture of sense and antisense polynucleotides under appropriate conditions leads to the binding of the two molecules, or hybridization.
  • Antisense nucleic acid molecules typically contain a sufficient number of nucleotides to specifically bind to a target nucleic acid, generally at least 5 contiguous nucleotides, often at least 14 or 16 or 30 contiguous nucleotides or modified nucleotides complementary to the coding portion of a nucleic acid molecule that encodes a gene of interest.
  • antibody refers to an immunoglobulin, whether natural or partially or wholly synthetically produced, including any derivative thereof that retains the specific binding ability the antibody.
  • antibody includes any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin binding domain.
  • Antibodies include members of any immunoglobulin groups, including, but not limited to, IgG, IgM, IgA, IgD, IgY and IgE.
  • antibody fragment refers to any derivative of an antibody that is less than full-length, retaining at least a portion of the full-length antibody's specific binding ability.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab) 2 , single-chain Fvs (scFV) , FV, dsFV diabody and Fd fragments.
  • the fragment can include multiple chains linked together, such as by disulfide bridges.
  • An antibody fragment generally contains at least about 50 amino acids and typically at least 200 amino acids.
  • an Fv antibody fragment is composed of one variable heavy domain (V H ) and one variable light domain linked by noncovalent interactions.
  • a dsFV refers to an Fv with an engineered intermolecular disulfide bond, which stabilizes the V H -V L pair.
  • an F(ab) 2 fragment is an antibody fragment that results from digestion of an immunoglobulin with pepsin at pH 4.0-4.5; it can be recombinantly expressed to produce the equivalent fragment.
  • Fab fragments are antibody fragments that result from digestion of an immunoglobulin with papain; they can be recombinantly expressed to produce the equivalent fragment.
  • scFVs refer to antibody fragments that contain a variable light chain (V L ) and variable heavy chain (V H ) covalently connected by a polypeptide linker in any order.
  • the linker is of a length such that the two variable domains are bridged without substantial interference. Included linkers are (Gly-Ser) n residues with some Glu or Lys residues dispersed throughout to increase solubility.
  • humanized antibodies refer to antibodies that are modified to include human sequences of amino acids so that administration to a human does not provoke an immune response.
  • Methods for preparation of such antibodies are known.
  • the encoding nucleic acid in the hybridoma or other prokaryotic or eukaryotic cell, such as an E. coli or a CHO cell, that expresses the monoclonal antibody is altered by recombinant nucleic acid techniques to express an antibody in which the amino acid composition of the non-variable region is based on human antibodies.
  • Computer programs have been designed to identify such non-variable regions.
  • diabodies are dimeric scFV; diabodies typically have shorter peptide linkers than scFvs, and they generally dimerize.
  • production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.
  • an effective amount of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such amount can be administered as a single dosage or can be administered according to a regimen, whereby it is effective. The amount can cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration can be required to achieve the desired amelioration of symptoms.
  • a compound that modulates the activity of a gene product either decreases or increases or otherwise alters the activity of the protein or, in some manner up- or down-regulates or otherwise alters expression of the nucleic acid in a cell.
  • pharmaceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that can be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that can be administered to animals or humans without substantial toxic effects and that either are pharmaceutically active or are prodrugs .
  • a drug or compound identified by the screening methods provided herein refers to any compound that is a candidate for use as a therapeutic or as a lead compound for the design of a therapeutic.
  • Such compounds can be small molecules, including small organic molecules, peptides, peptide mimetics, antisense molecules or dsRNA, such as RNAi, antibodies, fragments of antibodies, recombinant antibodies and other such compounds that can serve as drug candidates or lead compounds.
  • a non-malignant cell adjacent to a malignant cell in a subject refers to a cell that has a normal morphology (e.g., is not classified as neoplastic or malignant by a pathologist, cell sorter, or other cell classification method) , but, while the cell had been present in tact in the subject, the cell had been adjacent to a malignant cell or malignant cells.
  • cells of a particular type e.g., stroma
  • adjacent to a malignant cell or malignant cells can display an expression pattern that differs from cells of the same type that are not adjacent to a malignant cell or malignant cells.
  • cells that are adjacent to malignant cells can be distinguished from cells of the same type that are adjacent to non-malignant cells, according to their differential gene expression.
  • adjacent refers to a first cell and a second cell being sufficiently proximal such that the first cell influences the gene expression of the second cell.
  • adjacent cells can include cells that are in direct contact with each other, adjacent cell can include cells within 500 microns, 300 microns, 200 microns 100 microns or 50 microns, of each other.
  • tumor refers to a collection of malignant cells.
  • Malignant as applied to a cell refers to a cell that grows in an uncontrolled fashion.
  • a malignant cell can be anaplastic.
  • a malignant cell can be capable of metastasizing.
  • stringency of hybridization in determining percentage mismatch is as follows: 1) high stringency: O.lx SSPE, 0.1% SDS, 65A. 2) medium stringency: 0.2x SSPE, 0.1% SDS, 50 °C. 3) low stringency: l.Ox SSPE, 0.1% SDS, 50°C.
  • vector refers to discrete elements that are used to introduce heterologous nucleic acid into cells for either expression or replication thereof.
  • the vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome.
  • vectors that are artificial chromosomes such as yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vehicles are well known to those of skill in the art.
  • An expression vector includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA.
  • Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those that integrate into the host cell genome.
  • a disease prognosis refers to a forecast of the probable outcome of a disease or of a probable outcome resultant from a disease.
  • Non-limiting examples of disease prognosis include likely relapse of disease, likely aggressiveness of disease, likely indolence of disease, likelihood of survival of the subject, likelihood of success in treating a disease, condition in which a particular treatment regimen is likely to be more effective than another treatment regimen, and combinations thereof.
  • aggressiveness of a tumor or malignant cell refers to the capacity of one or more cells to attain a position in the body away from the tissue or organ of origin, attach to another portion of the body, and multiply. Experimentally, aggressiveness can be described in one or more manners, including, but not limited to, post-diagnosis survival of subject, relapse of tumor, and metastasis of tumor.
  • data indicative of time length of survival, relapse, non-relapse, time length for metastasis, or non-metastasis are indicative of the aggressiveness of a tumor or a malignant cell.
  • aggressiveness is inversely related to the length of time of survival of the subject.
  • time length for metastasis is considered, one skilled in the art will recognize that aggressiveness is directly related to the length of time of survival of a subject.
  • indolence refers to non- aggressiveness of a tumor or malignant cell; thus, the more aggressive a tumor or cell, the less indolent, and vice versa.
  • a malignant prostate cell can attain an extra-prostatic position, and thus have one characteristic of an aggressive malignant cell.
  • Attachment of cells can be, for example, on the lymph node or bone marrow of a subject, or other sites known in the art.
  • a combination refers to any association between two or among more items.
  • composition refers to any mixture. It can be a solution, a suspension, liquid, powder, a paste, aqueous, non- aqueous or any combination thereof.
  • fluid refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams and other such compositions.
  • Cell-type-associated patterns of gene expression [0093] Primary tissues are composed of many (e.g., 2 or more) types of cells. Identification of genes expressed in a specific cell type present within a tissue in other methods can require physical separation of that cell type and the cell type's subsequent assay. Although it is possible to physically separate cells according to type, by methods such as laser capture microdissection, centrifugation, FACS, and the like, this is time consuming and costly and in certain embodiments impractical to perform.
  • Known expression profiling assays either RNA or protein
  • primary tissues or other specimens containing multiple cell types either (1) do not take into account that multiple cell types are present or (2) physically separate the component cell types before performing the assay.
  • compositions and kits based on the development of a model, where the level of each gene product assayed can be correlated to a specific cell type.
  • This approach for determination of cell-type-specific gene expression obviates the need for physical separation of cells from tissues or other specimens with heterogeneous cell content. Furthermore, this method permits determination of the interaction between the different types of cells contained in such heterogeneous mixtures, which would otherwise have been difficult or impossible had the cells been first physically separated and then assayed.
  • biomarkers can be identified related to various diseases and disorders. Exemplified herein is the identification of biomarkers for prostate cancer and benign prostatic hypertophy. Such biomarkers can be used in diagnosis and prognosis and treatment decisions.
  • the methods, compositions, combinations and kits provided herein employ a regression-based approach for identification of cell-type-specific patterns of gene expression in samples containing more than one type of cell.
  • the methods, compositions, combinations and kits provided herein employ a regression-based approach for identification of cell-type- specific patterns of gene expression in cancer.
  • These methods, compositions, combinations and kits provided herein can be used in the identification of genes that are differentially expressed in malignant versus non-malignant cells and further identify tumor- dependent changes in gene expression of non-malignant cells associated with malignant cells relative to non-malignant cells not associated with malignant cells.
  • the methods, compositions, combinations and kits provided herein also can be used in correlating a phenotype with gene expression in one or more cell types.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, measuring overall levels of one or more gene expression analytes in each sample, determining the regression relationship between the relative content of each cell type and the measured overall levels, and calculating the level of each of the one or more analytes in each cell type according to the regression relationship, where gene expression levels correspond to the calculated levels of analytes.
  • such a method can include determining the relative content of each cell type in two or more related heterogeneous cell samples, wherein at least two of the samples do not contain the same relative content of each cell type, measuring overall levels of two or more gene expression analytes in each sample, determining the regression relationship between the relative content of each cell type and the measured overall levels, and calculating the level of each of the two or more analytes in each cell type according to the regression relationship, where gene expression levels correspond to the calculated levels of analytes.
  • Such methods can further include identifying genes differentially expressed in at least one cell type relative to at least one other cell type.
  • the analyte can be a nucleic acid molecule and a protein.
  • the methods provided herein can be used for determining cell-type-specific gene expression in any heterogeneous cell population.
  • the methods provided herein can find application in samples known to contain a variety of cell types, such as brain tissue samples and muscle tissue samples.
  • the methods provided herein also can find application in samples in which separation of cell type can represent a tedious or time consuming operation, which is no longer required under the methods provided herein.
  • Samples used in the present methods can be any of a variety of samples, including, but not limited to, blood, cells from blood (including, but not limited to, non-blood cells such as epithelial cells in blood) , plasma, serum, spinal fluid, lymph fluid, skin, sputum, alimentary and genitourinary samples (including, but not limited to, urine, semen, seminal fluid, prostate aspirate, prostatic fluid, and fluid from the seminal vesicles) , saliva, milk, tissue specimens (including, but not limited to, prostate tissue specimens) , tumors, organs, and also samples of in vitro cell culture constituents.
  • the methods provided herein can be used to differentiate true markers of tumor cells, hyperplastic cells, and stromal cells of cancer.
  • least squares regression using individual cell-type proportions can be used to produce clear predictions of cell-specific expression for a large number of genes.
  • many of these predictions are accepted on the basis of prior knowledge of prostate gene expression and biology, which provide confidence in the method. These are illustrated by numerous genes predicted to be preferentially expressed by stromal cells that are characteristic of connective tissue and only poorly expressed or absent in epithelial cells.
  • the methods provided herein allow segregation of molecular tumor and nontumor markers into more discrete and informative groups.
  • genes identified as tumor- associated can be further categorized into tumor versus stroma (epithelial versus mesenchymal) and tumor versus hyperplastic (perhaps reflecting true differences between the malignant cell and its hyperplastic counterpart) .
  • cancers classified by site such as cancer of the oral cavity and pharynx (lip, tongue, salivary gland, floor of mouth, gum and other mouth, nasopharynx, tonsil, oropharynx, hypopharynx, other oral/pharynx) ; cancers of the digestive system (esophagus; stomach; small intestine; colon and rectum; anus, anal canal, and anorectum; liver; intrahepatic bile duct; gallbladder; other biliary; pancreas; retroperitoneum; peritoneum, omentum, and mesentery; other digestive) ; cancers of the respiratory system (nasal cavity, middle ear, and sinuses; larynx; lung and bronchus; pleura; trachea, mediastinum, and other respiratory) ; cancers of the mesot
  • CK15 has previously received little attention in this context, but BPH markers play an important role in the diagnosis of ambiguous clinical cases.
  • the methods provided herein provide a straightforward approach using simple and multiple linear regression to identify genes whose expression in tissue is specifically correlated with a specific cell type (e.g., in prostate tissue with either tumor cells, BPH epithelial cells or stromal cells) . Context-dependent expression that is not readily attributable to single cell types is also recognized.
  • the investigative approach described here is also applicable to a wide variety of tumor marker discovery investigations in a variety of tissues and organs.
  • the exemplary prostate analysis results presented herein demonstrate the ability to identify a large number of gene candidates as specific products of various cells involved in prostate cancer pathogenesis .
  • a model for cell-specific gene expression is established by both (1) determination of the proportion of each constituent cell type (e.g., epithelium, stroma, tumor, or other discriminating entity) within a given type of tissue or specimen (e.g., prostate, breast, colon, marrow, and the like) and (2) assay of the expression profile (e.g., RNA or protein) of that same tissue or specimen.
  • tissue or specimen e.g., prostate, breast, colon, marrow, and the like
  • cell type specific expression of a gene can be determined by fitting this model to data from a collection of tissue samples.
  • the methods provided herein can include a step of determining the relative content of each cell type in a heterogeneous sample. Identification of a cell type in a sample can include identifying cell types that are present in a sample in amounts greater than about 1%, 2%, 3%, 4% or 5% or greater than 1%,
  • cell type can be determined by an individual skilled in the ability to identify cell types, such as a pathologist or a histologist.
  • cell types can be determined by cell sorting and/or flow cytometry methods known in the art.
  • the methods provided herein can be used to determine that the nucleotide or proteins are differentially expressed in at least one cell type relative to at least one other cell type.
  • genes include those that are up-regulated (i.e. expressed at a higher level), as well as those that are down-regulated (i.e. expressed at a lower level) .
  • genes also include sequences that have been altered (i.e., truncated sequences or sequences with substitutions, deletions or insertions, including point mutations) and show either the same expression profile or an altered profile.
  • the genes can be from humans; however, as will be appreciated by those in the art, genes from other organisms can be useful in animal models of disease and drug evaluation; thus, other genes are provided, from vertebrates, including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, and farm animals (including sheep, goats, pigs, cows, horses, etc) . In some cases, prokaryotic genes can be useful. Gene expression in any of a variety of organisms can be determined by methods provided herein or otherwise known in the art.
  • Gene products measured according to the methods provided herein can be nucleic acid molecules, including, but not limited to mRNA or an amplicate or complement thereof, polypeptides, or fragments thereof.
  • Methods and compositions for the detection of nucleic acid molecules and proteins are known in the art.
  • oligonucleotide probes and primers can be used in the detection of nucleic acid molecules
  • antibodies can be used in the detection of polypeptides.
  • one or more gene products can be detected. In some embodiments, two or more gene products are detected. In other embodiments, 3 or more, 4 or more, 5 or more, 7 or more, 10 or more 15 or more, 20 or more 25, or more, 35 or more, 50 or more, 75 or more, or 100 or more gene products can be detected in the methods provided herein.
  • the expression levels of the marker genes in a sample can be determined by any method or composition known in the art.
  • the expression level can be determined by isolating and determining the level (i.e., amount) of nucleic acid transcribed from each marker gene.
  • the level of specific proteins translated from mRNA transcribed from a marker gene can be determined.
  • Determining the level of expression of specific marker genes can be accomplished by determining the amount of mRNA, or polynucleotides derived therefrom, or protein present in a sample. Any method for determining protein or RNA levels can be used. For example, protein or RNA is isolated from a sample and separated by gel electrophoresis. The separated protein or RNA is then transferred to a solid support, such as a filter. Nucleic acid or protein (e.g., antibody) probes representing one or more markers are then hybridized to the filter by hybridization, and the amount of marker-derived protein or RNA is determined. Such determination can be visual, or machine-aided, for example, by use of a densitometer .
  • Another method of determining protein or RNA levels is by use of a dot-blot or a slot-blot.
  • protein, RNA, or nucleic acid derived therefrom, from a sample is labeled.
  • the protein, RNA or nucleic acid derived therefrom is then hybridized to a filter containing oligonucleotides or antibodies derived from one or more marker genes, wherein the oligonucleotides or antibodies are placed upon the filter at discrete, easily- identifiable locations. Binding, or lack thereof, of the labeled protein or RNA to the filter is determined visually or by densitometer.
  • Proteins or polynucleotides can be labeled using a radiolabel or a fluorescent (i.e., visible) label.
  • Methods provided herein can be used to detect mRNA or amplicates thereof, and any fragment thereof.
  • introns of mRNA or amplicate or fragment thereof can be detected.
  • Processing of mRNA can include splicing, in which introns are removed from the transcript.
  • Detection of introns can be used to detect the presence of the entire mRNA, and also can be used to detect processing of the mRNA, for example, when the intron region alone (e.g., intron not attached to any exons) is detected.
  • methods provided herein can be used to detect polypeptides and modifications thereof, where a modification of a polypeptide can be a post-translation modification such as lipidylation, glycosylation, activating proteolysis, and others known in the art, or can include degradational modification such as proteolytic fragments and ubiquitinated polypeptides.
  • a modification of a polypeptide can be a post-translation modification such as lipidylation, glycosylation, activating proteolysis, and others known in the art, or can include degradational modification such as proteolytic fragments and ubiquitinated polypeptides.
  • proteins can be separated by two-dimensional gel electrophoresis systems.
  • Two-dimensional gel electrophoresis is well-known in the art and can involve isoelectric focusing along a first dimension followed by SDS-PAGE electrophoresis along a second dimension. See, e.g., Hames et al, 1990, GEL ELECTROPHORESIS OF PROTEINS: A PRACTICAL APPROACH, IRL Press, New York; Shevchenko et al., Proc. Nat'l Acad. Sci. USA 93:1440-1445 (1996); Sagliocco et al., Yeast 12:1519-1533 (1996); Lander, Science 274:536-539 (1996).
  • marker-derived protein levels can be determined by constructing an antibody microarray in which binding sites comprise immobilized antibodies, such as monoclonal antibodies, specific to a plurality of protein species encoded by the cell genome. Antibodies can be present for a substantial fraction of the marker-derived proteins of interest. Methods for making monoclonal antibodies are well known (see, e.g., Harlow and Lane, 1988, ANTIBODIES: A LABORATORY MANUAL, Cold Spring Harbor, N.Y., which is incorporated in its entirety for all purposes).
  • monoclonal antibodies are raised against synthetic peptide fragments designed based on genomic sequence of the cell.
  • proteins from the cell are contacted to the array, and their binding is assayed with assays known in the art.
  • the expression, and the level of expression, of proteins of diagnostic or prognostic interest can be detected through immunohistochemical staining of tissue slices or sections.
  • expression of marker genes in a number of tissue specimens can be characterized using a tissue array (Kononen et al . , Nat. Med 4(7):844-7 (1998)).
  • a tissue array multiple tissue samples are assessed on the same microarray. The arrays allow in situ detection of RNA and protein levels; consecutive sections allow the analysis of multiple samples simultaneously.
  • polynucleotide microarrays are used to measure expression so that the expression status of each of the markers above is assessed simultaneously.
  • the microarrays provided herein are oligonucleotide or cDNA arrays comprising probes hybridizable to the genes corresponding to the marker genes described herein.
  • the microarrays provided herein can comprise probes hybridizable to the genes corresponding to markers able to distinguish cells, identify phenotypes, identify a disease or disorder, or provide a prognosis of a disease or disorder.
  • polynucleotide arrays comprising probes to a subset or subsets of at least 2, 5, 10, 15, 20, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500, 750, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2750, 3000, 3500, 4000, 4500, 5000, or more, genetic markers, up to the full set of markers listed in SEQ ID NO: 1-38, 826.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • the invention provides combinations such as arrays in which the markers described herein comprise at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 98% of the probes on the combination or array.
  • Microarrays can be prepared by selecting probes that comprise a polypeptide or polynucleotide sequence, and then immobilizing such probes to a solid support or surface.
  • the probes can comprise DNA sequences, RNA sequences, or antibodies.
  • the probes can also comprise amino acid, DNA and/or RNA analogues, or combinations thereof.
  • the probes can be prepared by any method known in the art.
  • the probe or probes used in the methods of the invention can be immobilized to a solid support which can be either porous or non-porous.
  • the probes of the can be attached to a nitrocellulose or nylon membrane or filter.
  • the solid support or surface can be a glass or plastic surface.
  • hybridization levels are measured to microarrays of probes consisting of a solid phase on the surface of which are immobilized a population of probes.
  • the solid phase can be a nonporous or, optionally, a porous material such as a gel.
  • the microarrays are addressable arrays, such as positionally addressable arrays.
  • each probe of the array can be located at a known, predetermined position on the solid support such that the identity (i.e., the sequence) of each probe can be determined from its position in the array (i.e., on the support or surface).
  • positive control probes e.g., probes known to be complementary and hybridizable to sequences in target polynucleotide molecules
  • negative control probes e.g., probes known to not be complementary and hybridizable to sequences in target polynucleotide molecules
  • positive controls can be synthesized along the perimeter of the array.
  • positive controls can be synthesized in diagonal stripes across the array.
  • Probes can be immobilized on the to solid surface by any of a variety of methods- known in the art .
  • this model can be further extended to include sample characteristics, such as cell or organism phenotypes, allowing cell type specific expression to be linked to observable indicia such as clinical indicators and prognosis (e.g., clinical disease progression, response to therapy, and the like) .
  • sample characteristics such as cell or organism phenotypes
  • prognosis e.g., clinical disease progression, response to therapy, and the like
  • a model for prostate tissue is provided, resulting in identification of cell-type-specific markers of cancer, epithelial hypertrophy, and disease progression.
  • a method for studying differential gene expression between subjects with cancers that relapse and those with cancers that do not relapse is disclosed.
  • the framework for studying mixed cell type samples and more flexible models allowing for cross-talk among genes in a sample are extensions to defining differences in expression between samples with different characteristics, such as samples from subjects who subsequently relapse versus those who do not.
  • the methods provided herein include determining the regression relationship between relative cell content and measured expression levels.
  • the regression relationship can be determined by determining the regression of measured expression levels on cell proportions.
  • Statistical methods for determining regression relationships between variables are known in the art. Such general statistical methods can be used in accordance with the teachings provided herein regarding regression of measured expression levels on cell proportions.
  • the methods provided herein also include calculating the level of analytes in each cell type based on the regression relationship between relative cell content and expression levels. The regression relationship can be determined according to methods provided herein, and, based on the regression relationship, the level of a particular analyte can be calculated for a particular cell type.
  • the methods provided herein can permit the calculation of any of a variety of analyte for particular cell types.
  • the methods provided herein can permit calculation of a single analyte for a single cell type, or can permit calculation of a plurality of analytes for a single cell type, or can permit calculation of a single analyte for a plurality of cell types, or can permit calculation of a plurality of analytes for a plurality of cell types.
  • the number of analytes whose level can be calculated for a particular cell type can range from a single analyte to the total number of analytes measured (e.g., the total number of analytes measured using a microarray) .
  • the total number of cell types for which analyte levels can be calculated can range from a single cell type, to all cell types present in a sample at sufficient levels.
  • the levels of analyte for a particular cell type can be used to estimate expression levels of the corresponding gene, as provided elsewhere herein.
  • the methods provided herein also can include identifying genes differentially expressed in a first cell type relative to a second cell type. Expression levels of one or more genes in a particular cell type can be compared to one or more additional cell types. Differences in expression levels can be represented in any of a variety of manners known in the art, including mathematical or statistical representations, as provided herein. For example, differences in expression level can be represented as a modified t statistic, as described elsewhere herein.
  • the methods provided herein also can serve as the basis for methods of indicating the presence of a particular cell type in a subject.
  • the methods provided herein can be used for identifying the expression levels in particular cell types.
  • classifier methods known in the art such as a naive Bayes classifier
  • gene expression levels in cells of a sample from a subject can be compared to reference expression levels to determine the presence of absence, and, optionally, the relative amount, of a particular cell type in the sample.
  • the markers provided herein as associated with prostate tumor, stroma or BPH can be selected in a prostate tumor classifier in accordance with the modified t statistic associated with each marker provided in the Tables herein.
  • Methods for using a modified t statistic in classifier methods are provided herein and also are known in the art.
  • the methods provided herein can be used in phenotype-indicating methods such as diagnostic or prognostic methods, in which the gene expression levels in a sample from a subject can be compared to references indicative of one or more particular phenotypes.
  • phenotype-indicating methods such as diagnostic or prognostic methods, in which the gene expression levels in a sample from a subject can be compared to references indicative of one or more particular phenotypes.
  • Vjk ⁇ Xki ⁇ ij + £jk
  • 'expression levels' as used in this exemplification of the method is used in a generic sense: 'expression levels' could be readings of mRNA levels, cRNA levels, protein levels, fluorescent intensity from a feature on an array, the logarithm of that reading, some highly post-processed reading, and the like.
  • differences in the coefficients can correspond to differences, log ratios, or some other functions of the underlying transcript abundance.
  • the columns of Z that result are the unit vector (all ones) , ⁇ k/BPH + Xk, Tumor, Xk,BP H - Xk, Tumor, and ⁇ k , stroma-
  • twice the coefficient of ⁇ k , B p H _ X k , Tum o r estimates the average difference in expression level of a tumor cell versus a BPH cell.
  • standard software can be used to provide an estimate and a tesmodified t statistic for the average difference of tumor and BPH cells. Further, this can simplify the specification of restricted models in which two or more of the tissue components have the same average expression level.
  • the data for a study can contain a large number of samples from a smaller number of different men. It is plausible that the samples from one man may tend to share a common level of expression for a given gene, differences among his cells according to their type notwithstanding. This will tend to lead to positive covariance among the measurements of expression level within men. Ordinary least squares (OLS) estimates are less than fully efficient in such circumstances.
  • OLS Ordinary least squares
  • One alternative to OLS is to use a weighted least squares approach that treats a collection of samples from a single subject as having a common (non-negative) covariance and identical variances.
  • the estimating equation for this setup can be solved via iterative methods using software such as the gee library from R (Ross Ihaka and Robert Gentleman.
  • That null model is obtained by regressing the expression level on all design terms except for the 'BPH - tumor' term using the exchangeable, non-negative correlation structure just mentioned.
  • the correlation structure in the residuals can be accounted for.
  • ⁇ x be the set of n x indexes of samples for subject 1.
  • the contribution of each type of cell does not depend on what other cell types are present in the sample. However, there can be instances in which contribution of each type of cell does depend on other cell types present in the sample. It may happen that putatively 'normal' cells exhibit genomic features that influence both their expression profiles and their potential to become malignant. Such cells would exhibit the same expression pattern when located in normal tissue, but are more likely to be found in samples that also have tumor cells in them. Another possible effect is that signals generated by tumor cells trigger expression changes in nearby cells that would not be seen if those same cells were located in wholly normal tissue. In either case, the contribution of a cell may be more or less than in another tissue environment leading to a setup in which the contributions of individual cell types to the overall profile depend on the proportions of all types present, viz. i as do the expected proportions
  • Xk ⁇ j R ⁇ Xk) Xk,BVBj + Xk,T ⁇ Tj + %k,S V Sj + Xk t S k t ⁇ fy + Xk,CVCj coefficients being multipliers of those terms.
  • the unknowns in this case are linear functions of the gene expression levels and can be determined using standard linear models as was done earlier. The only change here is the addition of the product of X k/S and X kr T .
  • Such a product when significant, is termed an "interaction" and refers to the product archiving a significance level owing to a correlation of X k , s with X k , ⁇ -
  • an interaction refers to the product archiving a significance level owing to a correlation of X k , s with X k , ⁇ -
  • dependence of gene expression refers to the dependence of gene expression in one cell type on the level of gene expression in another cell type. In another embodiment, dependence of gene expression refers to the dependence of gene expression in one cell type on the amount of another cell type.
  • each type of cell can depend on what other cell types are present in the sample, but also can depend on other characteristics of the sample, such as clinical characteristics of the subject who contributed it. For example, clinical characteristics such as disease symptoms, disease prognosis such as relapse and/or aggressiveness of disease, likelihood of success in treating a disease, likelihood of survival, condition in which a particular treatment regimen is likely to be more effective than another treatment regimen, can be correlated with cell expression. For example, cell type specific gene expression can differ between a subject with a cancer that does not relapse after treatment and a subject with a cancer that does relapse after treatment.
  • the contribution of a cell type may be more or less than in another subject leading to an instance in which the contributions of individual cell types to the overall profile depend on the characteristics of the subject or sample.
  • the model used earlier is extended to allow for dependence on a vector of sample specific covariates, Z k : _ j ⁇ kifzj z k ) i as do the expected proportions: ftgj #teE/y (y
  • ⁇ j is a 4 x m matrix of unknown coefficients and R (Z k ) is a column vector of m elements.
  • Z k is an indicator variable taking the value zero for samples of subjects who do not relapse and one for those who do.
  • the v coefficients give the average expression of the different cell types in subjects who do not relapse, while the ⁇ coefficients give the difference between the average expression of the different cell types in subjects who do relapse and those who do not.
  • ⁇ ⁇ would indicate that in tumor cells, the average expression level differs for subjects who relapse and those who do not.
  • the above equation is linear in its coefficients, so standard statistical methods can be applied to estimation and inference on the coefficients. Extensions that allow ⁇ to depend on both cell proportions and on sample covariates can be determined according to the teachings provided herein or other methods known in the art.
  • nucleic acid molecules that contain one or more nucleotide sequences provided in SEQ ID NO: 1-38, 826 or a complement thereof.
  • reference to one or more nucleotide sequences in SEQ ID NO: 1-38,826 also is intended to refer to the nucleotide sequence complementary thereto, as will be understood by one skilled in the art.
  • a nucleic acid molecule that contains one or more nucleotide sequences provided in SEQ ID NO: 1-38, 826 is a gene that encodes RNA and/or a polypeptide.
  • nucleic acid molecules encoding genes containing the nucleotide sequences listed in SEQ ID NO: 35, 580-38, 826 from animals, including splice variants thereof are provided.
  • the encoded proteins are also provided.
  • functional domains thereof For each of the nucleic acid molecules provided, the nucleic acid can be DNA or RNA or PNA or other nucleic acid analogs or can include non-natural nucleotide bases.
  • isolated nucleic acid molecules that include a sequence of nucleotides complementary to a nucleotide sequence provided in SEQ ID NO: 1-38, 826.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO:35, 580-38, 826.
  • tables listing probe sets; nucleotide sequences of the probes in the probe sets; genes associated with the probe set, including, for some tables, genbank accession number, locus ID, nucleotide sequence of the genes, splice regions for the genes, start and stop translation sites for the genes; modified t statistics for each probe set, and additional information described with reference to the individual table.
  • nucleotide sequence information associated with particular probe sets in a first table can thereby be associated with other features such as modified t statistics by virtue of one or more additional tables that associate probe sets with those features such as modified t statistics.
  • Table 15 lists Probe ID, Probe SEQ ID NOs and Gene SEQ ID NOs to identify the nucleotide sequences of the enclosed sequence listing correspond to each Probe set (Probe ID); subsequent tables (e.g., Table 2 or Table 8) that describe information (e.g., modified t statistics) relating to a particular Probe ID, are therefore contemplated herein to also describe information relating to each nucleotide sequence identified with that Probe ID.
  • Table 2 provides modified t statistics for an Affymetrix U95Av2 microarray, including Bstat (modified t statistic for BPH) , Sstat (modified t statistic for stroma) , Tstat (modified t statistic for tumor) .
  • the Probe IDs for the U95Av2 microarray that map to a Probe ID for the U133a microarray, and the mapping itself, is provided in Table 17, where the mapping represents Probe IDs of microarrays that can hybridize to the same gene. Probe IDs with identical names for the two arrays are identical. Accordingly, by virtue of the mapping of Table 17, Table 2 Probe IDs can be associated with nucleotide sequences via Table 15.
  • Table 8 provides Probe IDs for Affymetrix U133a microarray, and associated t statistics for BPH, tumor, stroma and cystic atrophy. Table 8 also identifies cell type for which the modified t statistic is greater than 2.5.
  • Table 8 also identifies cell type for which the calculated expression for the associated gene is greater than twofold more than in other cell types; such information can be used in selection of probes for a classifier, as described elsewhere herein.
  • Table 9 provides the top genes identified as up- and down- regulated in prostate tumor cells of relapse patients, calculated by linear regression including all samples with prostate cancer; in Table 9, "1" is the top up-regulated gene, and "-1" is the top down-regulated gene.
  • the gene(s) referred to in Table 9 (which lists Probe ID) can be determined by way of Table 15. Other tables describing genes in terms of Probe ID also can be interpreted according to Table 15.
  • Tables 9-13 also contains a column that indicates with a "D" those genes that have a greater than 1.5 fold ratio of predicted expression between relapse and non-relapse tissue, as well as an absolute difference in expression that exceeds the expression level reported for most genes queried by the array.
  • Table 10 provides top genes identified as up- and down- regulated in prostate stroma of relapse patients, calculated by linear regression including all samples with prostate cancer, with numbering as in Table 9.
  • Table 11 identifies exemplary genes whose expression can be examined in methods for identifying or characterizing a sample; and also identifies Probe IDs that can be used for such gene expression identification.
  • Table 12 provides top 144 genes identified as down- regulated in prostate stroma cells of relapse patients, calculated by linear regression including only samples that did not have detectable tumor cells, with ranking as with Table 9.
  • Table 13 provides top 100 genes identified as up- regulated in prostate stroma of relapse patients when only samples free of tumor were examined from cases of prostate cancer.
  • Tables 12 and 13 demonstrate that genes in stroma can be used to determine a prognosis such as relapse, aggressiveness, and indolence of prostate tumor.
  • Table 15 provides splice variants of the genes provided herein. Each row identifies one or more pairs of numbers that identify the first and last residues of an exon in the gene, where the numbers in the pair are separated by a comma, and different pairs are separated by semicolons. Table 15 also provides the start and stop site of translation of the gene into a polypeptide. As will be understood in the art, multiple splicing combinations are provided for some genes. One skilled in the art can apply the splicing taught in Table 15 and nucleotide sequences listed herein to generate the nucleotide sequence of a spliced mRNA transcript.
  • One skilled in the art also can apply the splicing taught in Table 15 and nucleotide sequences listed herein to generate the amino acid sequence of a polypeptide translated from the spliced transcript.
  • Reference herein to one or more genes (including reference to products of genes) by referring to the SEQ ID NO of the gene or the SEQ ID NO of a nucleotide contained in the gene also contemplates reference to spliced gene sequences for the corresponding SEQ ID NO in accordance with Table 15.
  • reference herein to one or more protein gene products also contemplates proteins translated from the splice variants identified in Table 15.
  • Table 14 provides a list of 35 (nonunique) genes that have been associated with differential expression in aggressive prostate cancer.
  • the cell-specific genes identified here see, e.g., Tables 8-10) , those not previously known to be indicator of aggressive prostate cancer are contemplated herein.
  • Table 14 lists genes associated with aggressive prostate cancer that are also found among the genes identified here (see, e.g., Table 9-10) .
  • contemplated herein all genes of Tables 1-13 and 15-17 that are not present in Table 14 represent genes identified herein as genes whose differential expression can be indicative of prostate cancer (in accordance with the corresponding table) .
  • cell-specific genes statistically significantly differentially expressed in early relapse prostate cancer by tumor cells (Table 9) or stroma cells (Table 10) of early relapse prostate cancer are biomarkers when used individually or in combination to form panels or profiles of genes for use in the examination of gene expression of prostate tissue by the methods described herein in order to determine whether the examined prostate tissue is similar in gene expression to the pattern of, for example, early relapsed or aggressive disease or indolent disease.
  • the methods, compositions and kits provided herein exclude those genes identified in Table 14.
  • genes identified in Table 14 also can be used in the methods, combinations, compositions and kits provided herein, with the exception of use of PSA and PMSA in a combination of only those two genes.
  • genes whose products can be detected in the methods provided herein include, IGF-1, microsimino protein, and MTA-1. In one embodiment detection of the expression of one or more of these genes can be performed in combination with detection of expression of one or more additional genes containing a sequence provided in SEQ ID NO: 1-38, 826.
  • Uses of Probes and detection of genes identified in the tables are described herein and exemplified below. It is contemplated herein that uses and methods similar to those exemplified below can be applied to the probe and gene nucleotide sequences in accordance with the teachings provided herein.
  • nucleic acid molecules that have at least 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with a nucleotide of SEQ ID NO: 1-38, 826, or that hybridizes along their full-length or along at least about 70%, 80% or 90% of the full-length nucleic acid to a nucleic acids under conditions of moderate, or high, stringency.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • the isolated nucleic acids can contain least 10 nucleotides, 25 nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides or more, contiguous nucleotides of a sequence provided in SEQ ID NO: 1-38, 826. in another embodiment, the nucleic acids are smaller than 35, 200 or 500 nucleotides in length. In some embodiments, the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • probes or primers are also provided.
  • fragments of the above nucleic acids that can be used as probes or primers and that contain at least about 10 nucleotides, at least about 14 nucleotides, at least about 16 nucleotides, or at least about 30 nucleotides.
  • the length of the probe or primer is a function of the size of the genome probed; the larger the genome, the longer the probe or primer required for specific hybridization to a single site.
  • Probes and primers as described can be single-stranded. Double stranded probes and primers also can be used, if they are denatured when used. Probes and primers derived from the nucleic acid molecules are provided.
  • probes and primers contain at least 8, 14, 16, 30, 100 or more contiguous nucleotides.
  • the probes and primers are optionally labeled with a detectable label, such as a radiolabel or a fluorescent tag, or can be mass differentiated for detection by mass spectrometry or other means.
  • a detectable label such as a radiolabel or a fluorescent tag
  • an isolated nucleic acid molecule that includes the sequence of molecules that is complementary to the nucleotides provided in SEQ ID NO: 1-38, 826.
  • Double-stranded RNA (dsRNA) such as RNAi is also provided.
  • the nucleotide sequences selected from SEQ ID NO:l-38,826 are selected from SEQ ID NO: 35, 580-38 , 826.
  • Plasmids and vectors containing the nucleic acid molecules are also provided.
  • Cells containing the vectors, including cells that express the encoded proteins are provided.
  • the cell can be a bacterial cell, a yeast cell, a fungal cell, a plant cell, an insect cell or an animal cell.
  • the nucleic acid containing all or a portion of the nucleotide sequence encoding the genes can be inserted into an appropriate expression vector, i.e., a vector that contains the elements for the transcription and translation of the inserted protein coding sequence.
  • the nucleotide sequences selected from SEQ ID NO: 1-38, 826 are selected from SEQ ID NO: 35, 580-38, 826.
  • the transcriptional and translational signals can also be supplied by the native promoter for the genes, and/or their flanking regions .
  • vectors that contain nucleic acid encoding a gene containing a sequence provided in SEQ ID NO:l- 38,826
  • the nucleotide sequences selected from SEQ ID NO:l-38,826 are selected from SEQ ID NO: 35, 580-38, 826.
  • Cells containing the vectors are also provided. The cells include eukaryotic and prokaryotic cells, and the vectors are any suitable for use therein.
  • Prokaryotic and eukaryotic cells containing the vectors are provided. Such cells include bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells. The cells can be used to produce an oligonucleotide or polypeptide gene products by (a) growing the above-described cells under conditions whereby the encoded gene is expressed by the cell, and then (b) recovering the expressed compound.
  • a variety of host-vector systems can be used to express the protein coding sequence. These include but are not limited to mammalian cell systems infected with virus (e.g. vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g. baculovirus) ; microorganisms such as yeast containing yeast vectors; or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA.
  • virus e.g. vaccinia virus, adenovirus, etc.
  • insect cell systems infected with virus e.g. baculovirus
  • microorganisms such as yeast containing yeast vectors
  • bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA.
  • the expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system used, any one of a number of suitable transcription and translation elements can be used.
  • nucleic acid fragments into a vector can be used to construct expression vectors containing a chimeric gene containing appropriate transcriptional/translational control signals and protein coding sequences. These methods can include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination) . Expression of nucleic acid sequences encoding polypeptide can be regulated by a second nucleic acid sequence so that the genes or fragments thereof are expressed in a host transformed with the recombinant DNA molecule (s). For example, expression of the proteins can be controlled by any promoter/enhancer known in the art. [00161] Proteins
  • Protein products of the genes provided in SEQ ID NO: 35, 580- 38,826 , derivatives and analogs can be produced by various methods known in the art. For example, once a recombinant cell expressing such a polypeptide, or a domain, fragment or derivative thereof, is identified, the individual gene product can be isolated and analyzed. This is achieved by assays based on the physical and/or functional properties of the protein, including, but not limited to, radioactive labeling of the product followed by analysis by gel electrophoresis, immunoassay, cross-linking to marker-labeled product, and assays of protein activity or antibody binding.
  • polypeptides can be isolated and purified by standard methods known in the art (either from natural sources or recombinant host cells expressing the complexes or proteins) , including but not restricted to column chromatography (e.g., ion exchange, affinity, gel exclusion, reversed-phase high pressure and fast protein liquid) , differential centrifugation, differential solubility, or by any other standard technique used for the purification of proteins.
  • column chromatography e.g., ion exchange, affinity, gel exclusion, reversed-phase high pressure and fast protein liquid
  • differential centrifugation e.g., differential centrifugation, differential solubility
  • Functional properties can be evaluated using any suitable assay known in the art.
  • polypeptide sequences can be made at the protein level.
  • polypeptide proteins, domains thereof, derivatives or analogs or fragments thereof which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand.
  • any of numerous chemical modifications can be carried out by known techniques, including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4, acetylation, formulation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin and other such agents.
  • domains, analogs and derivatives of a polypeptide provided herein can be chemically synthesized.
  • a peptide corresponding to a portion of a polypeptide provided herein, which includes the desired domain or which mediates the desired activity in vitro can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence.
  • Non- classical amino acids include but are not limited to the D-isomers of the common amino acids, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, . epsilon.
  • the oligonucleotide or polypeptide gene products provided herein can be used in a variety of methods to identify compounds that modulate the activity thereof.
  • the nucleotide sequences and genes identified in SEQ ID NO: 35, 580- 38,826 can be identified in different cell types and in the same cell type in which subject have different phenotypes.
  • Methods are provided herein for screening compounds can include contacting cells with a compound and measuring gene expression levels, wherein a change in expression levels relative to a reference identifies the compound as a compound that modulates a gene expression.
  • agents such as compounds that bind to products of genes identified in SEQ ID NO: 35, 580-38, 826 .
  • the assays are designed to identify agents that bind to the RNA or polypeptide gene product.
  • the identified compounds are candidates or leads for identification of compounds for treatments of tumors and other disorders and diseases.
  • a variety of methods can be used, as known in the art. These methods can be performed in solution or in solid phase reactions .
  • Methods for identifying an agent, such as a compound, that specifically binds to an oligonucleotide or polypeptide encoded by a gene identified in SEQ ID NO: 35, 580-38, 826 are provided herein.
  • the method can be practiced by (a) contacting the gene product with one or a plurality of test agents under conditions conducive to binding between the gene product and an agent; and (b) identifying one or more agents within the one or plurality that specifically binds to the gene product.
  • Compounds or agents to be identified can originate from biological samples or from libraries, including, but are not limited to, combinatorial libraries .
  • Exemplary libraries can be fusion-protein-displayed peptide libraries in which random peptides or proteins are presented on the surface of phage particles or proteins expressed from plasmids; support-bound synthetic chemical libraries in which individual compounds or mixtures of compounds are presented on insoluble matrices, such as resin beads, or other libraries known in the art.
  • Modulators of the Activity of Gene products [00172] Provided herein are compounds that modulate the activity of a gene product from SEQ ID NO: 35, 580-38, 826. These compounds act by directly interacting with the polypeptide or by altering transcription or translation thereof.
  • Such molecules include, but are not limited to, antibodies that specifically bind the polypeptide, antisense nucleic acids or double-stranded RNA (dsRNA) such as RNAi, that alter expression of the polypeptide, antibodies, peptide mimetics and other such compounds.
  • dsRNA double-stranded RNA
  • Antibodies including polyclonal and monoclonal antibodies, that specifically bind to a polypeptide gene product provided herein are provided.
  • the antibody can be a monoclonal antibody, and the antibody can specifically bind to the polypeptide.
  • the polypeptide and domains, fragments, homologs and derivatives thereof can be used as immunogens to generate antibodies that specifically bind such immunogens.
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.
  • antibodies to human polypeptides are produced. Methods for monoclonal and polyclonal antibody production are known in the art.
  • Antibody fragments that specifically bind to the polyeptide or epitopes thereof can be generated by techniques known in the art.
  • such fragments include but are not limited to: the F(ab')2 fragment, which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragment, the Fab fragments that can be generated by treating the antibody molecular with papain and a reducing agent, and Fv fragments.
  • Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide.
  • Products of genes in SEQ ID NO: 35, 580-38 , 826 can be detected in diagnostic methods, such as diagnosis of tumors and other diseases or disorders. Such methods can be used to detect, prognose, diagnose, or monitor various conditions, diseases, and disorders.
  • Exemplary compounds that can be used in such detection methods include polypeptides such as antibodies or fragments thereof that specifically bind polypeptides encoded by the genes of SEQ ID NO: 35, 580-38, 826, and oligonucleotides such as DNA probes or primers that specifically bind oligonucleotides such as RNA encoded by the genes of SEQ ID NO: 35, 580-38, 826.
  • a set of one or more, or two or more compounds for detection of markers containing a nucleotide sequence provided in SEQ ID NO: 1-38, 826, complements thereof, fragments thereof, or polypeptides encoded thereby, can be selected for any of a variety of assay methods provided herein.
  • one or more, or two or more such compounds can be selected as diagnostic or prognostic indicators. Methods for selecting such compounds and using such compounds in assay methods such as diagnostic and prognostic indicator applications are known in the art.
  • the Tables provided herein list a modified t statistic associated with each marker, where the modified t statistic indicate the ability of the associated marker to indicate (by presence or absence of the marker, according to the modified t statistic) the presence or absence of a particular cell type in a prostate sample.
  • marker selection can be performed by considering both modified t statistics and expected intensity of the signal for a particular marker. For example, markers can be selected that have a strong signal in a cell type whose presence or absence is to be determined, and also have a sufficiently large modified t statistic for gene expression in that cell type. Also, markers can be selected that have little or no signal in a cell type whose presence or absence is to be determined, and also have a sufficiently large negative modified t statistic for gene expression in that cell type.
  • Exemplary assays include immunoassays such as competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay) , sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays and protein A immunoassays.
  • immunoassays such as competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay) , sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassay
  • kits for diagnostic use contain in one or more containers an anti-polypeptide antibody, and, optionally, a labeled binding partner to the antibody.
  • a kit is also provided that includes in one or more containers a nucleic acid probe capable of hybridizing to the gene-encoding nucleic acid.
  • a kit can include in one or more containers a pair of primers (e.g., each in the size range of 6-30 nucleotides) that are capable of priming amplification.
  • a kit can optionally further include in a container a predetermined amount of a purified control polypeptide or nucleic acid.
  • kits can contain packaging material that is one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like.
  • the packaging material is constructed by well known methods, and can provide a sterile, contaminant-free environment.
  • the packaging material has a label which indicates that the compounds can be used for detecting a particular oligonucleotide or polypeptide.
  • the packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid or protein- based diagnostic systems.
  • a package is to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.
  • the kits also can include instructions for use, which can include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
  • compositions and Modes of Administration [00183] Pharmaceutical compositions containing the identified compounds that modulate expression of a gene in SEQ ID NO: 35, 580- 38,826 or bind to a gene product are provided herein. Also provided are combinations of such a compound and another treatment or compound for treatment of a disease or disorder, such as a chemotherapeutic compound. [00184] Expression modulator or binding compound and other compounds can be packaged as separate compositions for administration together or sequentially or intermittently. Alternatively, they can provided as a single composition for administration or as two compositions for administration as a single composition. The combinations can be packaged as kits. [00185] Compounds and compositions provided herein can be formulated as pharmaceutical compositions, for example, for single dosage administration.
  • compositions are effective for delivery of an amount, upon administration, that is effective for the intended treatment.
  • the compositions are formulated for single dosage administration.
  • the weight fraction of a compound or mixture thereof is dissolved, suspended, dispersed or otherwise mixed in a selected vehicle at an effective concentration such that the treated condition is relieved or ameliorated.
  • Pharmaceutical carriers or vehicles suitable for administration of the compounds provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
  • the compounds can be formulated as the sole pharmaceutically active ingredient in the composition or can be combined with other active ingredients.
  • the active compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the subject treated.
  • the therapeutically effective concentration can be determined empirically by testing the compounds in known in vitro and in vivo systems. The concentration of active compound in the drug composition depends on absorption, inactivation and excretion rates of the active compound, the physicochemical characteristics of the compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
  • Pharmaceutically acceptable derivatives include acids, salts, esters, hydrates, solvates and prodrug forms. The derivative can be selected such that its pharmacokinetic properties are superior to the corresponding neutral compound.
  • Compounds are included in an amount effective for ameliorating or treating the disorder for which treatment is contemplated.
  • Formulations suitable for a variety of administrations such as perenteral, intramuscular, subcutaneous, alimentary, transdermal, inhaling and other known methods of administration, are known in the art.
  • the pharmaceutical compositions can also be administered by controlled release means and/or delivery devices as known in the art.
  • Kits containing the compositions and/or the combinations with instructions for administration thereof are provided.
  • the kit can further include a needle or syringe, which can be packaged in sterile form, for injecting the complex, and/or a packaged alcohol pad. Instructions are optionally included for administration of the active agent by a clinician or by the patient .
  • the compounds can be packaged as articles of manufacture containing packaging material, a compound or suitable derivative thereof provided herein, which is effective for treatment of a diseases or disorders contemplated herein, within the packaging material, and a label that indicates that the compound or a suitable derivative thereof is for treating the diseases or disorders contemplated herein.
  • the label can optionally include the disorders for which the therapy is warranted.
  • the compounds provided herein can be used for treating or preventing diseases or disorders in an animal, such as a mammal, including a human.
  • the method includes administering to a mammal an effective amount of a compound that modulates the expression of a gene provided in SEQ ID NO: 35, 580- 38,826 or a compound that binds to a product of a gene provided in SEQ ID NO: 35, 580-38, 826, whereby the disease or disorder is treated or prevented.
  • Exemplary inhibitors provided herein are those identified by the screening assays.
  • antibodies and antisense nucleic acids or double-stranded RNA (dsRNA) such as RNAi, are contemplated.
  • gene expression can be inhibited by antisense nucleic acids.
  • the therapeutic or prophylactic use of nucleic acids of at least six nucleotides, up to about 150 nucleotides, that are antisense to a gene or cDNA is provided.
  • the antisense molecule can be complementary to all or a portion of the gene.
  • the oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 125 nucleotides.
  • the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • RNA interference (RNAi) (see, e.g. Chuang et al . (2000) Proc. Natl. Acad. Sci. U.S.A. 97:4985) can be employed to inhibit the expression of a gene provided in SEQ ID NO: 35, 580-38, 826.
  • Interfering RNA (RNAi) fragments such as double-stranded (ds) RNAi
  • ds double-stranded
  • Methods relating to the use of RNAi to silence genes in organisms including, mammals, C. elegans, Drosophila and plants, and humans are known.
  • Double-stranded RNA (dsRNA) -expressing constructs are introduced into a host, such as an animal or plant using, a replicable vector that remains episomal or integrates into the genome. By selecting appropriate sequences, expression of dsRNA can interfere with accumulation of endogenous mRNA.
  • RNAi also can be used to inhibit expression in vitro. Regions include at least about 21 (or 21) nucleotides that are selective (i.e.
  • RNAi smaller fragments of about 21 nucleotides can be transformed directly (i.e., in vitro or in vivo) into cells; larger RNAi dsRNA molecules can be introduced using vectors that encode them. dsRNA molecules are at least about 21 bp long or longer, such as 50, 100, 150, 200 and longer. Methods, reagents and protocols for introducing nucleic acid molecules in to cells in vitro and in vivo are known to those of skill in the art.
  • nucleic acids that include a sequence of nucleotides encoding a polypeptide of a gene provided in SEQ ID NO: 35, 580-38, 826, are administered to promote polypeptide function, by way of gene therapy.
  • Gene therapy refers to therapy performed by the administration of a nucleic acid to a subject.
  • the nucleic acid produces its encoded protein that mediates a therapeutic effect by promoting polypeptide function.
  • Any of the methods for gene therapy available in the art can be used (see, Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, An. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926- 932 (1993); and Morgan and Anderson, An. Rev. Biochem. 62:191-217 (1993); TIBTECH 11 (5):155-215 (1993).
  • vaccines based on the genes and polypeptides provided herein can be developed.
  • genes can be administered as DNA vaccines, either single genes or combinations of genes.
  • Naked DNA vaccines are generally known in the art.
  • Methods for the use of genes as DNA vaccines are well known to one of ordinary skill in the art, and include placing a gene or portion of a gene under the control of a promoter for expression in a patient with cancer.
  • the gene used for DNA vaccines can encode full-length proteins, but can encode portions of the proteins including peptides derived from the protein.
  • a patient can be immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a particular gene.
  • DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine.
  • adjuvant molecules include cytokines that increase the immunogenic response to the polypeptide encoded by the DNA vaccine. Additional or alternative adjuvants are known to those of ordinary skill in the art and find use in the invention.
  • the nucleotide the genes, nucleotide molecules and polypeptides disclosed herein find use in generating animal models of cancers, such as lymphomas and carcinomas.
  • gene therapy technology wherein antisense RNA directed to the gene will also diminish or repress expression of the gene.
  • An animal generated as such serves as an animal model that finds use in screening bioactive drug candidates.
  • gene knockout technology for example as a result of homologous recombination with an appropriate gene targeting vector, will result in the absence of the protein.
  • tissue-specific expression or knockout of the protein can be accomplished using known methods.
  • transgenic animals can be generated that overexpress the protein.
  • promoters of various strengths can be employed to express the transgene.
  • the number of copies of the integrated transgene can be determined and compared for a determination of the expression level of the transgene. Animals generated by such methods find use as animal models and are additionally useful in screening for bioactive molecules to treat cancer.
  • a processor-based system can include a main memory, such as random access memory (RAM) , and can also include a secondary memory.
  • the secondary memory can include, for example, a hard disk drive and/or a removable storage drive, representing a floppy disk drive, a magnetic tape drive, an optical disk drive, etc.
  • the removable storage drive reads from and/or writes to a removable storage medium.
  • Removable storage medium refers to a floppy disk, magnetic tape, optical disk, and the like, which is read by and written to by a removable storage drive.
  • the removable storage medium can comprise computer software and/or data.
  • the secondary memory may include other similar means for allowing computer programs or other instructions to be loaded into a computer system.
  • Such means can include, for example, a removable storage unit and an interface. Examples of such can include a program cartridge and cartridge interface (such as the found in video game devices) , a movable memory chip (such as an EPROM or PROM) and associated socket, and other removable storage units and interfaces, which allow software and data to be transferred from the removable storage unit to the computer system.
  • the computer system can also include a communications interface.
  • Communications interfaces allow software and data to be transferred between computer system and external devices.
  • Examples of communications interfaces can include a modem, a network interface (such as, for example, an Ethernet card) , a communications port, a PCMCIA slot and card, and the like.
  • Software and data transferred via a communications interface are in the form of signals, which can be electronic, electromagnetic, optical or other signals capable of being received by a communications interface. These signals are provided to communications interface via a channel capable of carrying signals and can be implemented using a wireless medium, wire or cable, fiber optics or other communications medium.
  • Some examples of a channel can include a phone line, a cellular phone link, an RF link, a network interface, and other communications channels.
  • computer program medium and computer usable medium are used to refer generally to media such as a removable storage device, a disk capable of installation in a disk drive, and signals on a channel. These computer program products are means for providing software or program instructions to a computer system.
  • Computer programs also called computer control logic
  • Computer programs are stored in main memory and/or secondary memory. Computer programs can also be received via a communications interface. Such computer programs, when executed, permit the computer system to perform the features of the invention as discussed herein. In particular, the computer programs, when executed, permit the processor to perform the features of the invention. Accordingly, such computer programs represent controllers of the computer system.
  • the software may be stored in, or transmitted via, a computer program product and loaded into a computer system using a removable storage drive, hard drive or communications interface.
  • the control logic when executed by the processor, causes the processor to perform the functions of the invention as described herein.
  • the elements are implemented in hardware using, for example, hardware components such as PALs, application specific integrated circuits (ASICs) or other hardware components .
  • ASICs application specific integrated circuits
  • Implementation of a hardware state machine so as to perform the functions described herein will be apparent to person skilled in the relevant art(s).
  • elements are implanted using a combination of both hardware and software.
  • the computer-based methods can be accessed or implemented over the World Wide Web by providing access via a Web Page to the methods of the invention.
  • the Web Page is identified by a Universal Resource Locator (URL) .
  • the URL denotes both the server machine and the particular file or page on that machine.
  • a consumer or client computer system interacts with a browser to select a particular URL, which in turn causes the browser to send a request for that URL or page to the server identified in the URL.
  • the server can respond to the request by retrieving the requested page and transmitting the data for that page back to the requesting client computer system (the client/server interaction can be performed in accordance with the hypertext transport protocol (HTTP) ) .
  • HTTP hypertext transport protocol
  • the selected page is then displayed to the user on the client's display screen.
  • the client may then cause the server containing a computer program of the invention to launch an application to, for example, perform an analysis according to the methods provided herein.
  • probe and gene sequences that can be indicative of the presence and/or absence of prostate cancer in a subject. Also provided herein are probe and gene sequences that can be indicative of presence and/or absence of benign prostatic hyperplasia (BPH) in a subject. Also provided herein are probe and gene sequences that can be indicative of a prognosis of prostate cancer, where such a prognosis can include likely relapse of prostate cancer, likely aggressiveness of prostate cancer, likely indolence of prostate cancer, likelihood of survival of the subject, likelihood of success in treating prostate cancer, condition in which a particular treatment regimen is likely to be more effective than another treatment regimen, and combinations thereof. In one embodiment, the probe and gene sequences can be indicative of the likely aggressiveness or indolence of prostate cancer.
  • probes have been identified that hybridize to one or more nucleic acids of a prostate sample at different levels according to the presence or absence of prostate tumor, BPH and stroma in the sample.
  • the probes provided herein are listed in conjunction with modified t statistics that represent the ability of that particular probe to indicate the presence or absence of a particular cell type in a prostate sample. Use of modified t statistics for such a determination is described elsewhere herein, and general use of modified t statistics is known in the art. Accordingly, provided herein are nucleotide sequences of probes that can be indicative of the presence or absence of prostate tumor and/or BPH cells, and also can be indicative of the likelihood of prostate tumor relapse in a subject.
  • nucleotide and predicted amino acid sequences of genes and gene products associated with the probes are also provided in the methods and Tables herein. Accordingly, as provided herein, detection of gene products (e.g., mRNA or protein) or other indicators of gene expression, can be indicative of the presence or absence of prostate tumor and/or BPH cells, and also can be indicative of the likelihood of prostate tumor relapse in a subject. As with the probe sequences, the nucleotide and amino acid sequences of these gene products are listed in conjunction with modified t statistics that represent the ability of that particular gene product or indicator thereof to indicate the presence or absence of a particular cell type in a prostate sample.
  • gene products e.g., mRNA or protein
  • modified t statistics that represent the ability of that particular gene product or indicator thereof to indicate the presence or absence of a particular cell type in a prostate sample.
  • Methods for determining the presence of prostate tumor and/or BPH cells, the likelihood of prostate tumor relapse in a subject, the likelihood of survival of prostate cancer, the aggressiveness of prostate tumor, the indolence of prostate tumor, survival, and other prognoses of prostate tumor can be performed in accordance with the teachings and examples provided herein.
  • a set of probes or gene products can be selected according to their modified t statistic for use in combination (e.g., for use in a microarray) in methods of determining the presence of prostate tumor and/or BPH cells, and/or the likelihood of prostate tumor relapse in a subject.
  • the gene products identified as present at increased levels in prostate cancer or in subjects with likely relapse of cancer can serve as targets for therapeutic compounds and methods.
  • an antibody or siRNA targeted to a gene product present at increased levels in prostate cancer can be administered to a subject to decrease the levels of that gene product and to thereby decrease the malignancy of tumor cells, the aggressiveness of a tumor, indolence of a tumor, survival, or the likelihood of tumor relapse.
  • Methods for providing molecules such as antibodies or siRNA to a subject to decrease the level of gene product in a subject are provided herein or are otherwise known in the art.
  • the gene products identified as present at decreased levels in prostate cancer or in subjects with likely relapse of cancer can serve as subjects for therapeutic compounds and methods.
  • a nucleic acid molecule such as a gene expression vector encoding a particular gene
  • a nucleic acid molecule can be administered to a individual with decreased levels of the particular gene product to increase the levels of that gene product and to thereby decrease the malignancy of tumor cells, the aggressiveness of a tumor, indolence of a tumor, likelihood of survival, or the likelihood of tumor relapse.
  • Methods for providing gene expression vectors to a subject to increase the level of gene product in a subject are provided herein or are otherwise known in the art.
  • Tissue Samples Prostate samples were obtained from patients that were preoperatively staged as having organ-confined prostate cancer. Institutional Review Board-approved informed consent for participation in this project was obtained from all patients. Tissue samples were collected in the operating room, and specimens were immediately transported to institutional pathologists who provided fresh portions of grossly identifiable or suspected tumor tissue and separate portions of uninvolved tissues. All tissue was snap frozen upon receipt and maintained in liquid nitrogen until used for frozen section preparation at -22°C. Thirty-eight of the contributed cases contained carcinomas. An additional 50 additional samples, consisting of paired adjacent nontumor tissue and separate nontumor bearing cases, also were used, making a total of 88 specimens for analysis. Tissue for expression analysis was provided as 20- ⁇ m-thick serial cryosections sections .
  • Tissue samples for expression analysis were prepared as 10- to 400-mm 3 pieces, an amount that was found to be sufficient to yield 10 ⁇ g or more of total RNA.
  • 5- ⁇ m frozen sections were prepared at -22°C. The first section and a section every 200 ⁇ m thereafter were stained with hematoxylin and eosin for histopathological assessment, and all other intervening sections were prepared at 20- ⁇ m thickness for RNA extraction. Typically four to eight thin sections were examined per specimen by four pathologists. Preparative (20- ⁇ m) sections were lysed in RNA extraction buffer (RNeasy, Qiagen, Valencia, CA) and stored at - 80°C. Thin sections were examined by four pathologists in a single session using a multihead microscope.
  • RNA extraction buffer RNeasy, Qiagen, Valencia, CA
  • Each pathologist assessed each specimen and completed, a standardized form indicating the fraction of total area of the section occupied by the aggregate of all prostate carcinoma cells, benign prostatic hypertrophy (BPH) epithelial cells, dilated gland (dilated cystic atrophy) epithelial cells, and stromal cells. Clear spaces of glandular lumina, edema, defects, etc., were not considered, and minor proportions of neural, vascular, or other components were marked as other (median value, 3.1%). Average percentages of estimates from the four pathologists were calculated for epithelial cells of tumor, BPH, and cystic glands and total stromal cells for each sample. [00220] Data Collection.
  • RNA polymerase promoter sequence was synthesized from total RNA by using a reverse transcriptase with a purified oligo(dT) primer containing a RNA polymerase promoter sequence at it's 5' -end.
  • the second cDNA strand was synthesized using DNA polymerase I, RNase H and DNA ligase.
  • the double-stranded cDNA was placed in RNase-free buffer.
  • Labeled cRNA was generated from cDNA by in vitro transcription and incorporating biotinylated nucleotides. Fifteen micrograms of the resulting biotinylated cRNA was fragmented and hybridized to U95Av2 GeneChip® arrays Affymetrix according to the manufacturer's instructions .
  • the antibodies were obtained and used as follows: directed against desmin and prostate-specific membrane antigen (PSMA) (DAKO, Carpinteria, CA) , keratin 15 and tubulin ⁇ 4 (NeoMarkers, Lab Vision Corporation, Fremont, CA) , prostaglandin-D2 synthase (Cayman Chemical, Ann Arbor, MI), and prostate-specific antigen (PSA) (Biodesign International, Saco, Maine) .
  • PSMA prostate-specific membrane antigen
  • LCM Laser Capture Microdissection
  • Microdissection of freshly prepared frozen sections was performed by using an Arcturus (Mountain View, CA) Mark PixCell II LCM apparatus to isolate prostate cancer epithelium, stroma, and hypertrophic benign epithelial prostate cells.
  • Total RNA was prepared from these samples and used in quantitative RT-PCR (qPCR) to validate cell- specific expression analysis as described in detail together with the gene list, primers, graphical relationships of Affymetrix (modified t statistic) to LCM (LCM/qPCR endpoint) . From each flash-frozen tissue, 5- ⁇ m-thick frozen sections were prepared.
  • the 88 tissue samples from 41 subjects undergoing prostatectomy for clinically early stage localized prostate carcinoma were independently scored by a panel of four pathologists for fractional composition of the four cell types. Agreement analysis on the continuous measures of fractional cell type as estimated by four pathologists were assessed as interobserver Pearson correlation coefficients.
  • the average coefficients for tumor, stroma, BPH, and dilated gland cells were 0.92, 0.77, 0.73, and 0.49, respectively, indicating reproducibility of scoring for the predominant cell types.
  • the samples were found to contain a wide range of relative tumor cell numbers ranging, in the case of tumor cells, from a low of 0.3% to a high of 100% tumor cells (Fig. 2) .
  • tumor markers identified through standard microarray studies may have little significance with respect to tumor-cell biology, being more reflective of fundamental differences between cells of epithelial versus mesenchymal lineage.
  • Equation 1 the expected cell type expression level is given as the regression coefficient, ⁇ , in the linear model (Equation 1) .
  • Equation 2 Modified t statistics incorporating goodness of fit and effect size were calculated according to Tusher (Proc. Natl. Acad. Sci. USA 98, 5116-5121, 2001), where ⁇ is the standard error of the coefficient, and k is a small constant. t - 0/ ⁇ k + ⁇ ) (Equation 2)
  • a modified t sta tistic of 2.4 sets thresholds corresponding >4-fold expected differences in expression between the respective cell types (p ⁇ 0.02). By these criteria, many transcripts were found to have strong association with a particular cell type (Fig. 3) .
  • a global view of predicted cell-specific gene expression was obtained by hierarchical clustering of the modified t sta tistics from the linear model.
  • a total of 3,384 transcripts displayed cell-type-associated gene expression patterns according to the criteria. The procedure revealed that tumor- and nontumor- associated transcripts could be interpreted in terms of cell type specificity.
  • 1,096 genes have strong tumor association, yet the majority (683) of these represent primarily differences in tumor-stroma gene expression (tumor > stroma) .
  • stroma and stroma > tumor a large number of transcripts are predicted to be stroma associated (stroma and stroma > tumor) .
  • stroma and stroma > tumor a number of genes are strongly associated with BPH cell content (492) .
  • a subset of these (196) also showed a strong negative association with tumor cell content, indicating potential clinically useful markers of BPH.
  • this analysis predicts 413 genes to be tumor specific, being strongly associated with tumor and displaying negative associations with both BPH and stroma.
  • the transcript groups were characterized by distinct personalities in terms of gene function.
  • the BPH cell-associated groups (B > S, B > T) included a number of previously identified nonmalignant prostate epithelial markers including 15-lipoxygenase- II, CD38, and p63.
  • This group contained a number of neuroendocrine markers such as cystatin-A, chromogranin-A, cholecystokinin, and cholecystokinin receptor.
  • the BPH group of genes included IL-1 convertase.
  • IL-1 is a putative neuroendocrine morphogen in prostate.
  • the stroma cell compartment was dominated by archetypal smooth muscle and connective tissue-associated genes: vimentin, myosins, actin, and dystrophin. Other strong stroma associations included participants in transforming growth factor (TGF)- ⁇ and fibroblast growth factor signaling pathways.
  • TGF transforming growth factor
  • Cytokeratin-15 (CK15) expression was predicted with high confidence to be associated with the BPH cell type.
  • Other putative BPH epithelial cell markers included the intermediate filament protein NF-H, histone H2A1B, CD38, and 15-lipoxygenase .
  • Transcripts predicted to be specifically expressed in tumor as opposed to BPH cells included ⁇ -tubulin, UDP N-acetyl glucosamine pyrophosphorylase 1, and SGP-28, among others.
  • High cross-product tumor-associated genes were also identified and included the T cell receptor y (TCRy) transcript (Affymetrix probe set 41468_at) .
  • TCRy T cell receptor y
  • Affymetrix probe set 41468_at the high cross-product is the result of TCRy transcript being a very highly discriminant tumor marker. That is, even relatively low percentage tumor samples display high expression, an exception to the linear model consistent with stromal modulation of tumor TCR expression.
  • Immunohistochemical Validation Selected predicted cell- type-specific gene expression patterns were tested by examining the distribution of gene expression on the protein level by using immunohistochemistry. At least five cases of tumor-bearing tissue with adjacent BPH, stroma, and dilated glands were examined with each antibody.
  • ⁇ -Tubulin is predicted to be a strongly tumor- associated gene. Immunohistochemical staining revealed uniform expression in tumor cells of crowded gland-like structures of the tumor but negative in stroma or epithelial cells of adjacent BPH and dilated glands. Prostaglandin-D2 synthase (PD2S) is predicted to be a moderately tumor-associated gene. Apical surfaces of the epithelial cells of tumor-gland structures were highly immunoreactive, whereas BPH glands displayed little or no immunoreactivity . Prostate-specific membrane antigen (PSMA) is predicted to be strongly tumor associated.
  • P2S Prostaglandin-D2 synthase
  • PSMA Prostate-specific membrane antigen
  • Desmin is predicted to be a stromal gene with high likelihood of tumor-stroma cell interaction. Numerous desmin-positive spindle shaped cells forming files and parallel clusters fill the stroma tissue component, whereas all epithelial cells are negative. The stroma within zones of tumor is distinct from adjacent normal stroma in that the desmin-positive spindle cell population is sparse, suggesting a distinct remodeling of cells in the tumor-associated stroma.
  • CK15 is predicted to be strongly associated with BPH.
  • CK15 cytokeratin-15
  • Reverse Transcriptase was added after two minutes of incubation at 42 °C, then incubate for 50 minutes at 42 °C The reaction was inactivated at 70 °C for 15 min. 20 ⁇ l cDNA reaction was diluted to 400 ⁇ l and 6 ⁇ l was used for analysis of each gene.
  • Real-time quantitative PCR (ABI Prism 7900 Sequence Detection System, Applied Biosystems, Foster City, CA) was carried out for the analysis of gene expression by the use of SybrGreen.
  • Real-time PCR reaction contained IX HotStartTaq PCR Buffer (with 1.5 mM MgC12), 1:25,000 dilution of SybrGreen I (Molecular Probes), 0.35 ⁇ M 6-ROX (Molecular Probes), 0.2 mM dNTPs, 4 mM MgC12, 0.025 unit/ ⁇ l HotStartTaq DNA polymerase (Qiagen) and 0.8 ⁇ M each primer.
  • Real-time PCR was done in 95°C for 15 minutes; 50 cycles of 95 °C for 15 seconds, 60 °C for 15 seconds and 72 °C for 30 seconds; followed by a dissociation stage (95 °C 15 seconds, 60 °C 15 seconds, 95°C 15 seconds, 2% ramping rate from 60 °C to 95 °C) .
  • Relative standard curves representing decreasing dilutions of stock cDNA were used for monitoring efficiency of target amplification of each gene. Thirty-one genes were amplified. The primer pair sequences for each of the specific RNA transcripts assayed are listed in Table 1.
  • Table 8 Selected Cell-type specific Expressed Genes.
  • the table provides a modified t-statistic calculated as described herein (Equation 2) for each cell type (tumor (T) , BPH, (B) , and stroma (S) ) defined and selected differences (T-B) for each gene with t > 2.4.
  • 3384 transcripts displayed cell-type associated gene expression patterns according to the threshold and are listed here.
  • BSTAT Columns B, C, and D labeled BSTAT, SSTAT, and TSTAT respectively are the corresponding modified t-statistic values for simple regression using percent composition for each tissue type alone ( cf. equation 1), i.e. BPH epithelial cells content, stroma cell content, or tumor epithelial cell content respectively.
  • the modified t-statistic value are color coded Red for modified t-statistic > 2.0; Tan for 2.0 > modified t-statistic > 1.0, Green for t-static ⁇ -2.0, and Blue for -2.0 ⁇ modified t-statistic ⁇ -1.0.
  • the modified t statistics calculated from two-cell-type linear models embody the direction and magnitude as well as goodness of fit of the coefficients.
  • the modified t statistics were filtered to include genes with >4-fold predicted changes in between pure and 0% specific cell type sample composition and an absolute correlation coefficient of >0.25.
  • Example 2 Identification of differences in expression between cell-types and between relapse and non-relapse patients .
  • Methods have been developed which have promise to distinguish cell-specific and relapse-specific differential gene expression which will be assessed on available clinical cases in a prospective observational trial design.
  • Sample Evaluation Percent sample composi tion determina tion . All samples used in microarray analysis were evaluated by four pathologists, who independently estimated percentage of tumor-, stroma-, BPH- and Cystic-Atrophy-cells in every sample using serial frozen sections as described in Example 1. Tissue between these analytical sections was utilized for RNA preparation and expression analysis.
  • Affymetrix Microarray Suite 5.0 (Affymetrix (2000). Microarray Suite 5.0 - User Guide. Affymetrix, Inc. (www. affymetrix. com) ) .
  • the background estimation and gene expression evaluation was carried out using BioConductor ' s Affymetrix package (Rafael A. Irizarry, Laurent Gautier, Benjamin Milo Bolstad, Crispin Miller, with contributions from Magnus Astr, , Leslie M. Cope, Robert Gentleman Jeff Gentry Wolfgang Huber James MacDonald Benjamin I. P. Rubinstein Christopher Workman and John Zhang (2004) .
  • Affymetrix Methods for Affymetrix Oligonucleotide Arrays. R package version 1.5.8.).
  • tumor-bearing prostate tissue In accord with the common histology of prostate, we assume (1) that the vast majority of cell types of tumor-bearing prostate tissue is accounted for by four cell types: Tumor epithelial cells, BPH epithelial cells, stromal cells (combined smooth muscle and connective tissue cells, and the flattened epithelial lining of dilated cystic glands) .
  • Tumor epithelial cells BPH epithelial cells
  • stromal cells combined smooth muscle and connective tissue cells, and the flattened epithelial lining of dilated cystic glands
  • ⁇ 13 is the observed gene expression intensity of a gene j in a sample i
  • Xx ⁇ is a percentage of cell-type X in sample i
  • ⁇ x 3 is a regression coefficient for gene j and cell-type X, defining the contribution of the proportion of the cell-type X to the overall gene expression intensity of the gene j , obtained fitting the model.
  • the ⁇ coefficients are the change in gene expression per unit cell ( i . e . the slope of plots of gene intensity vs. percent composition) and therefore are cell specific gene intensity coefficients.
  • Equation 3 The coefficients of the model, equation 3, may be obtained by regression analysis (Draper N and Smith H. Applied Regression Analysis. John Wiley and Sons, New York 1981). Because there are multiple samples for some patients and samples for one patient generally have a different correlation structure then other patients, we fitted the model with Generalized Estimation Equation (GEE) by means of the package gee in R (Diggle, P. J., P. Heagerty, et al. (2002). Analysis of Longitudinal Data. Oxford University Press 2nd edition, Oxford, England) . The procedure minimizes the residual by an iterative process.
  • GEE Generalized Estimation Equation
  • transcripts are predicted to be stroma associated (groups stroma and stroma > tumor) .
  • 492 are strongly associated with BPH cell content.
  • a subset of these (196) also showed a strong negative association with tumor cell content indicating potential clinically useful markers of BPH.
  • 413 are predicted to be tumor specific, being strongly associated with tumor and displaying negative associations with both BPH and stroma.
  • FDR False Discovery Rate
  • the distribution of the modified t-statistic considering the 20 repetitions for every cell-type gave the null-distribution of the modified t-statistics, which was compared to the actual data.
  • the resulting FDR values are in parentheses in Table 6. ⁇ 1100 probe sets of the ⁇ 22,000 probe sets on the Affymetrix U133A GeneChip are significantly differentially expressed between nonrelapsed and early relapse Prostate Cancer. Of these, approximately 13% are false positives.
  • Table 9 contains a list of the most significantly different genes discovered tumor that are changed in patient that have a higher risk of relapse.
  • Table 10 contains genes that are different in stroma in relapse versus non-relapse patients.
  • FDR is determined as the as the ratio of areas of interest of the null distribution to the original distribution of modified t-statistics.
  • SVM Support Vector Machine
  • NM_000424 Hs.433845 CACAGAGATGAACCGGATGATC TTGGCGCACTGTTTCTTGAC 69 prostaglandin D2 synthase (21 kD, brain)
  • N _000954 Hs.8272 GGGCTTCACAGAGGATACCATT AGTCCTATTGTTCCGTCATGCA 68
  • CD44 antigen (homing function and Indian blood I group system) NM_000610 Hs.169610 CCTCTGCAAGGCTTTCAATAGC CGATGCTCAGAGCTTTCTCCAT 65 tropomyosin 2 (beta) NM_003289 Hs.300772 CGAGAGCCGAGCCAGACA CTCTGAGGCCATCAGGGACTT 76
  • Table 5 Agreement Analysis of Cell-type Specific Gene Expression as determined using U95A GeneChip expression data (Example 1) and additional samples and by U113A GeneChip Expression data

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Evolutionary Biology (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • General Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2005/000564 2004-01-09 2005-01-07 Cell-type-specific patterns of gene expression Ceased WO2005068664A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2006549442A JP2008504803A (ja) 2004-01-09 2005-01-07 遺伝子発現の細胞型特異的パターン

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US53538204P 2004-01-09 2004-01-09
US60/535,382 2004-01-09
US53616304P 2004-01-12 2004-01-12
US60/536,163 2004-01-12

Publications (2)

Publication Number Publication Date
WO2005068664A2 true WO2005068664A2 (en) 2005-07-28
WO2005068664A3 WO2005068664A3 (en) 2006-04-27

Family

ID=34798852

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/000564 Ceased WO2005068664A2 (en) 2004-01-09 2005-01-07 Cell-type-specific patterns of gene expression

Country Status (4)

Country Link
US (1) US8781750B2 (cg-RX-API-DMAC7.html)
JP (2) JP2008504803A (cg-RX-API-DMAC7.html)
KR (1) KR20070052694A (cg-RX-API-DMAC7.html)
WO (1) WO2005068664A2 (cg-RX-API-DMAC7.html)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2370813A4 (en) * 2008-12-04 2012-05-23 Univ California MATERIALS AND METHODS FOR DIAGNOSIS AND PRESENTATION OF PROSTATE CANCER
WO2013054200A3 (en) * 2011-10-10 2013-08-22 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
RU2511408C2 (ru) * 2007-09-17 2014-04-10 Конинклейке Филипс Электроникс Н.В. Способ анализа нарушений, связанных с раком яичников
CN103757028A (zh) * 2014-01-23 2014-04-30 南京医科大学 Osbpl2突变型基因、其鉴定方法和检测试剂盒
US8781750B2 (en) 2004-01-09 2014-07-15 The Regents Of The University Of California Cell-type-specific patterns of gene expression
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US10059997B2 (en) 2010-08-02 2018-08-28 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US10210306B2 (en) 2006-05-03 2019-02-19 Population Bio, Inc. Evaluating genetic disorders
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
JP2020513549A (ja) * 2016-11-24 2020-05-14 ザ カウンシル オブ ザ クイーンズランド インスティテュート オブ メディカル リサーチ 癌予後の決定法
WO2020093574A1 (zh) * 2018-11-08 2020-05-14 浙江大学 一种肿瘤相关序列、长链非编码rna及其应用
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
WO2023076895A3 (en) * 2021-10-25 2023-09-14 University Of Cincinnati Molecular therapeutics for the treatment of hypertrophic cardiomyopathy and heart failure associated with mybpc3 gene mutations

Families Citing this family (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120258442A1 (en) 2011-04-09 2012-10-11 bio Theranostics, Inc. Determining tumor origin
ES2548514T3 (es) 2004-06-04 2015-10-19 Biotheranostics, Inc. Identificación de tumores
DK1899484T3 (da) 2005-06-03 2015-11-23 Biotheranostics Inc Identifikation af tumorer og væv
JP2007295822A (ja) * 2006-04-28 2007-11-15 Kusakabe Bio-Medical Research Laboratory Inc 卵巣腫瘍のシスプラチン耐性マーカー
KR100740582B1 (ko) * 2006-09-27 2007-07-19 한국과학기술연구원 가스크로마토그래피-질량분석기를 이용한 두 생체시료군 간대사체 차별성 분석 방법
WO2009002193A1 (en) * 2007-06-27 2008-12-31 Auckland Uniservices Limited Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof
JP2012508013A (ja) * 2008-11-04 2012-04-05 イデラ ファーマシューティカルズ インコーポレイテッド アンチセンスオリゴヌクレオチドによるToll様受容体5発現の調節
US20110229471A1 (en) 2008-11-26 2011-09-22 Cedars-Sinai Medical Center Methods of determining responsiveness to anti-tnf alpha therapy in inflammatory bowel disease
GB0903026D0 (en) * 2009-02-23 2009-04-08 Glaxosmithkline Biolog Sa Novel method
WO2011116244A2 (en) * 2010-03-17 2011-09-22 Cedars-Sinai Medical Center Methods of diagnosing and treating conditions associated with metabolic clearance rate of insulin
CA2793877A1 (en) * 2010-03-22 2011-09-29 Esoterix Genetic Laboratories, Llc Mutations associated with cystic fibrosis
IL243203A (en) 2010-07-27 2017-04-30 Genomic Health Inc Method for using gene expression to determine prognosis of prostate cancer
KR20140006898A (ko) 2011-01-25 2014-01-16 알막 다이아그노스틱스 리미티드 결장암 유전자 발현 시그니처 및 이용 방법
US9589099B2 (en) 2011-07-21 2017-03-07 The Chinese University Of Hong Kong Determination of gene expression levels of a cell type
US8632827B2 (en) 2011-12-13 2014-01-21 Avon Products, Inc Modulation of thymosin beta-4 in skin
US20140024546A1 (en) * 2012-05-01 2014-01-23 Synapdx Corporation Systems and methods for normalizing gene expression profiles of biological samples having a mixed cell population
JP6097388B2 (ja) * 2012-07-10 2017-03-15 ネピアン ブルー マウンテンズ ローカル ヘルス ディストリクト インフルエンザにおけるリスクの階層化
WO2014093053A1 (en) * 2012-12-11 2014-06-19 Avon Products, Inc. Modulation of thymosin beta-4 in skin
KR20230109779A (ko) 2013-03-27 2023-07-20 세다르스-신나이 메디칼 센터 Tl1a 기능 및 관련된 신호전달 경로의 저해에 의한섬유증 및 염증의 완화 및 반전
CA2917348A1 (en) 2013-07-11 2015-01-15 Moderna Therapeutics, Inc. Compositions comprising synthetic polynucleotides encoding crispr related proteins and synthetic sgrnas and methods of use
EP3022295A4 (en) 2013-07-19 2017-03-01 Cedars-Sinai Medical Center Signature of tl1a (tnfsf15) signaling pathway
WO2015120482A2 (en) * 2014-02-10 2015-08-13 Baylor College Of Medicine Recurrent fusion genes identified in high-grade serous ovarian carcinoma
JP6403260B2 (ja) * 2014-11-21 2018-10-10 学校法人日本大学 前立腺癌の判定、治療選択方法、予防又は治療剤
CN104611430A (zh) * 2015-01-26 2015-05-13 钱学庆 一种人类尿液中tmprss2-erg基因检测方法和引物
US10041079B2 (en) 2015-11-30 2018-08-07 Synthetic Genomics, Inc. Compositions and methods for expressing genes in algae
KR20240095481A (ko) 2016-03-17 2024-06-25 세다르스-신나이 메디칼 센터 Rnaset2를 통한 염증성 장 질환의 진단 방법
EP3717505A4 (en) 2017-12-01 2021-12-01 Encoded Therapeutics, Inc. GENENICALLY MODIFIED DNA-BINDING PROTEINS
CN112534070B (zh) * 2018-06-29 2024-07-30 杰克逊实验室 乳腺癌剪接变体
GB2582665B (en) * 2019-03-29 2021-12-29 Advanced Risc Mach Ltd Feature dataset classification
PL3976798T3 (pl) 2019-05-29 2026-04-07 Encoded Therapeutics, Inc. Kompozycje i sposoby selektywnej regulacji genów
US12188060B2 (en) 2020-05-15 2025-01-07 Crispr Therapeutics Ag Messenger RNA encoding Cas9 for use in genome-editing systems
US20240279654A1 (en) * 2021-05-21 2024-08-22 Ionis Pharmaceuticals, Inc. Compounds for reducing ptbp1 expression
US20250340883A1 (en) * 2021-11-18 2025-11-06 Resonance Health Analysis Services Pty Ltd Method For Treating Cyclophilin B Associated Diseases
WO2025054611A1 (en) * 2023-09-08 2025-03-13 The Trustees Of Princeton University Systems and methods for predicting high resolution cell-type-specific gene transcription and applications thereof
CN119296651B (zh) * 2024-09-19 2025-09-19 新疆维吾尔自治区人民医院 胸主动脉夹层关键细胞类型及亚型的分类方法及装置

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2432991A1 (en) * 2001-01-23 2002-08-01 Irm, Llc Genes overexpressed in prostate disorders as diagnostic and therapeutic targets
CA2436448A1 (en) * 2001-02-02 2002-08-15 Dana-Farber Cancer Institute, Inc. Rare event detection system
DE10159404A1 (de) * 2001-12-04 2003-06-26 Arevia Gmbh Verfahren zur Analyse von Gewebeproben
AU2002953327A0 (en) * 2002-12-12 2003-01-09 Monash University Methods of diagnosing prognosing and treating activin associated diseases and conditions
US20050048463A1 (en) * 2003-05-07 2005-03-03 Deng David Xing-Fei Systems and methods for determining cell type composition of mixed cell populations using gene expression signatures
KR20070052694A (ko) 2004-01-09 2007-05-22 더 리젠트스 오브 더 유니이버시티 오브 캘리포니아 유전자 발현을 위한 세포-유형-특이적 패턴

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8781750B2 (en) 2004-01-09 2014-07-15 The Regents Of The University Of California Cell-type-specific patterns of gene expression
US10210306B2 (en) 2006-05-03 2019-02-19 Population Bio, Inc. Evaluating genetic disorders
US10529441B2 (en) 2006-05-03 2020-01-07 Population Bio, Inc. Evaluating genetic disorders
US10522240B2 (en) 2006-05-03 2019-12-31 Population Bio, Inc. Evaluating genetic disorders
RU2511408C2 (ru) * 2007-09-17 2014-04-10 Конинклейке Филипс Электроникс Н.В. Способ анализа нарушений, связанных с раком яичников
EP2370813A4 (en) * 2008-12-04 2012-05-23 Univ California MATERIALS AND METHODS FOR DIAGNOSIS AND PRESENTATION OF PROSTATE CANCER
US10059997B2 (en) 2010-08-02 2018-08-28 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
US11788142B2 (en) 2010-08-02 2023-10-17 Population Bio, Inc. Compositions and methods for discovery of causative mutations in genetic disorders
WO2013054200A3 (en) * 2011-10-10 2013-08-22 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10221454B2 (en) 2011-10-10 2019-03-05 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11339439B2 (en) 2011-10-10 2022-05-24 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11180807B2 (en) 2011-11-04 2021-11-23 Population Bio, Inc. Methods for detecting a genetic variation in attractin-like 1 (ATRNL1) gene in subject with Parkinson's disease
US11174516B2 (en) 2012-02-09 2021-11-16 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10407724B2 (en) 2012-02-09 2019-09-10 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US11008614B2 (en) 2012-09-14 2021-05-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinsonism
US12012634B2 (en) 2012-09-14 2024-06-18 Population Bio, Inc. Methods for diagnosing, prognosing, and treating parkinson's disease or parkinsonism
US9976180B2 (en) 2012-09-14 2018-05-22 Population Bio, Inc. Methods for detecting a genetic variation in subjects with parkinsonism
US10233495B2 (en) 2012-09-27 2019-03-19 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
US10597721B2 (en) 2012-09-27 2020-03-24 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
US11618925B2 (en) 2012-09-27 2023-04-04 Population Bio, Inc. Methods and compositions for screening and treating developmental disorders
CN103757028B (zh) * 2014-01-23 2015-09-09 南京医科大学 Osbpl2突变型基因、其鉴定方法和检测试剂盒
CN103757028A (zh) * 2014-01-23 2014-04-30 南京医科大学 Osbpl2突变型基因、其鉴定方法和检测试剂盒
US10724096B2 (en) 2014-09-05 2020-07-28 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
US11549145B2 (en) 2014-09-05 2023-01-10 Population Bio, Inc. Methods and compositions for inhibiting and treating neurological conditions
JP2020513549A (ja) * 2016-11-24 2020-05-14 ザ カウンシル オブ ザ クイーンズランド インスティテュート オブ メディカル リサーチ 癌予後の決定法
EP3545313A4 (en) * 2016-11-24 2020-07-29 The Council of the Queensland Institute of Medical Research DETERMINATION OF A PROGNOSIS OF CANCER
US10544463B2 (en) 2017-02-03 2020-01-28 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US11913073B2 (en) 2017-02-03 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10941448B1 (en) 2017-02-03 2021-03-09 The Universite Paris-Saclay Methods for assessing risk of developing a viral disease using a genetic test
US10563264B2 (en) 2017-02-03 2020-02-18 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12331357B2 (en) 2017-02-03 2025-06-17 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10240205B2 (en) 2017-02-03 2019-03-26 Population Bio, Inc. Methods for assessing risk of developing a viral disease using a genetic test
US12227807B2 (en) 2018-08-08 2025-02-18 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US11913074B2 (en) 2018-08-08 2024-02-27 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US10961585B2 (en) 2018-08-08 2021-03-30 Pml Screening, Llc Methods for assessing risk of developing a viral of disease using a genetic test
US12054778B2 (en) 2018-08-08 2024-08-06 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12234513B2 (en) 2018-08-08 2025-02-25 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
US12241125B2 (en) 2018-08-08 2025-03-04 Pml Screening, Llc Methods for assessing risk of developing a viral disease using a genetic test
WO2020093574A1 (zh) * 2018-11-08 2020-05-14 浙江大学 一种肿瘤相关序列、长链非编码rna及其应用
WO2023076895A3 (en) * 2021-10-25 2023-09-14 University Of Cincinnati Molecular therapeutics for the treatment of hypertrophic cardiomyopathy and heart failure associated with mybpc3 gene mutations

Also Published As

Publication number Publication date
JP2008504803A (ja) 2008-02-21
KR20070052694A (ko) 2007-05-22
JP2011229522A (ja) 2011-11-17
US20060292572A1 (en) 2006-12-28
WO2005068664A3 (en) 2006-04-27
US8781750B2 (en) 2014-07-15

Similar Documents

Publication Publication Date Title
US8781750B2 (en) Cell-type-specific patterns of gene expression
LaTulippe et al. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease
Risinger et al. Microarray analysis reveals distinct gene expression profiles among different histologic types of endometrial cancer
US8349555B2 (en) Methods and compositions for predicting death from cancer and prostate cancer survival using gene expression signatures
JP4938672B2 (ja) p53の状態と遺伝子発現プロファイルとの関連性に基づき、癌を分類し、予後を予測し、そして診断する方法、システム、およびアレイ
US20060265138A1 (en) Expression profiling of tumours
JP6404304B2 (ja) メラノーマ癌の予後予測
CA2745961A1 (en) Materials and methods for determining diagnosis and prognosis of prostate cancer
Rahbari et al. Identification of differentially expressed microRNA in parathyroid tumors
US20050266420A1 (en) Multigene predictors of response to chemotherapy
WO2007035676A2 (en) Methods and materials for identifying the origin of a carcinoma of unknown primary origin
EP2648762A2 (en) Post-treatment breast cancer prognosis
EP2307570B1 (en) Molecular signature of liver tumor grade and use to evaluate prognosis and therapeutic regimen
Bao et al. Transcriptomic analysis identifies a tumor subtype mRNA classifier for invasive non-functioning pituitary neuroendocrine tumor diagnostics
KR101847815B1 (ko) 삼중음성유방암의 아형 분류 방법
CA2588253A1 (en) Methods and systems for prognosis and treatment of solid tumors
US20170074880A1 (en) Prognosis of oesophageal and gastro-oesophageal junctional cancer
KR20070115891A (ko) 충실성 종양의 예후전망을 위한 약물유전학 마커
US20060134622A1 (en) Amplified cancer target genes useful in diagnosis and thereapeutic screening
KR102731352B1 (ko) 위암의 예후 예측 방법
Sinnappah-Kang et al. Heparanase expression and TrkC/p75NTR ratios in human medulloblastoma
AU2004219989B2 (en) Expression profiling of tumours
Mehta Gene expression analysis in breast cancer
KR20200038045A (ko) 방광암 수술치료법 결정을 위한 유전자 세트

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006549442

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

WWE Wipo information: entry into national phase

Ref document number: 1020067015965

Country of ref document: KR

122 Ep: pct application non-entry in european phase