WO2005052170A2 - Silençage genique - Google Patents

Silençage genique Download PDF

Info

Publication number
WO2005052170A2
WO2005052170A2 PCT/US2004/033453 US2004033453W WO2005052170A2 WO 2005052170 A2 WO2005052170 A2 WO 2005052170A2 US 2004033453 W US2004033453 W US 2004033453W WO 2005052170 A2 WO2005052170 A2 WO 2005052170A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
mirna
oligonucleotide
plant
precursor
Prior art date
Application number
PCT/US2004/033453
Other languages
English (en)
Other versions
WO2005052170A3 (fr
Inventor
Milo J. Aukerman
Original Assignee
E. I. Du Pont De Nemours And Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by E. I. Du Pont De Nemours And Company filed Critical E. I. Du Pont De Nemours And Company
Priority to CA002541970A priority Critical patent/CA2541970A1/fr
Publication of WO2005052170A2 publication Critical patent/WO2005052170A2/fr
Publication of WO2005052170A3 publication Critical patent/WO2005052170A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]

Definitions

  • the field of the present invention relates generally to plant molecular biology. More specifically it relates to constructs and methods to suppress the expression of targeted genes.
  • Figure 1 Predicted hairpin structure formed by the sequence surrounding miR172a-2. The mature microRNA is indicated by a grey box.
  • the EAT gene contains a miRNA that is complementary to APETALA2 (AP2).
  • AP2 AP2
  • a Location of the EAT gene on chromosome 5.
  • the T-DNA insertion and orientation of the 35S enhancers is indicated.
  • the 21-nt sequence corresponding to miR172a-2 is shown below the EAT gene (SEQ ID NO: 86).
  • b Putative 21-nt miR172a-2/AP2 RNA duplex is shown below the gene structure of AP2.
  • the GU wobble in the duplex is underlined
  • c Alignment of AP2 21-nt region (black bar) and surrounding sequence with three other Arabidopsis AP2 family members, and with two maize AP2 genes (IDS1 and GL15).
  • d Alignment of miR172a-2 miRNA (black bar) and surrounding sequence with miR172-like sequences from Arabidopsis, tomato, soybean, potato and rice.
  • a Location of the T-DNA insert in LAT-D, in between At2g28550 and At2g28560.
  • the 4X 35S enhancers are approximately 5 kb from At2g28550.
  • b RT-PCR analysis of At2g28550 expression in wild type versus LAT-D plants.
  • Figure 8. EAT-D is epistatic to LAT-D. Genetic cross between EAT-D and LAT-D plants, with the resultant F1 plants shown, along with their flowering time (measured as rosette leaf number).
  • a Temporal expression of miR172a-2 and its relatives may cause temporal downregulation of AP2 targets (e.g. At2g28550 and At5g60120), which may trigger flowering once the target proteins drop below a critical threshold (dotted line), b, Dicer cleavage at various positions may generate at least four distinct miRNAs from the miR172 family (indicated as a single hairpin with a miRNA consensus sequence). Sequences at the 5' and 3' ends of each miRNA are indicated, with the invariant middle 15 nt shown as ellipses. The putative targets recognized by the individual miRNAs are in parentheses below each.
  • the invention provides methods and compositions useful in target sequence suppression and target sequence validation.
  • the invention provides polynucleotide constructs useful for gene silencing, as well as cells, plants and seeds comprising the polynucleotides.
  • the invention also provides a method for using microRNA to silence a target sequence.
  • RNA interference components e.g., RNA interference components
  • invertebrate and vertebrate animal cells e.g., invertebrate and vertebrate animal cells.
  • the compositions and methods are based on an endogenous miRNA silencing process discovered in Arabidopsis, a similar strategy can be used to extend the number of compositions and the organisms in which the methods are used.
  • compositions and methods described herein can be used in individual cells, cells or tissue in culture, or in vivo in organisms, or in organs or other portions of organisms.
  • the compositions selectively suppress the target sequence by encoding a miRNA having substantial complementarity to a region of the target sequence.
  • the miRNA is provided in a nucleic acid construct which, when transcribed into RNA, is predicted to form a hairpin structure which is processed by the cell to generate the miRNA, which then suppresses expression of the target sequence.
  • a nucleic acid construct is provided to encode the miRNA for any specific target sequence.
  • Any miRNA can be inserted into the construct, such that the encoded miRNA selectively targets and suppresses the target sequence.
  • the construct is modeled on the EAT (mir-172a) miRNA precursor from Arabidopsis.
  • a method for suppressing a target sequence is provided. The method employs the constructs above, in which a miRNA is designed to a region of the target sequence, and inserted into the construct. Upon introduction into a cell, the miRNA produced suppresses expression of the targeted sequence.
  • the target sequence can be an endogenous plant sequence, or a heterologous transgene in the plant.
  • the target gene may also be a gene from a plant pathogen, such as a pathogenic virus, nematode, insect, or mold or fungus.
  • a plant, cell, and seed comprising the construct and/or the miRNA is provided.
  • the cell will be a cell from a plant, but other prokaryotic or eukaryotic cells are also contemplated, including but not limited to viral, bacterial, yeast, insect, nematode, or animal cells.
  • Plant cells include cells from monocots and dicots.
  • the invention also provides plants and seeds comprising the construct and/or the miRNA. Units, prefixes, and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively.
  • nucleic acid construct or “construct” refers to an isolated polynucleotide which is introduced into a host cell.
  • This construct may comprise any combination of deoxyribonucleotides, ribonucleotides, and/or modified nucleotides.
  • the construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure.
  • This construct may be expressed in the cell, or isolated or synthetically produced.
  • the construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.
  • suppression or “silencing” or “inhibition” are used interchangeably to denote the down-regulation of the expression of the product of a target sequence relative to its normal expression level in a wild type organism.
  • Suppression includes expression that is decreased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% relative to the wild type expression level.
  • encodes or "encoding” refers to a DNA sequence which can be processed to generate an RNA and/or polypeptide.
  • expression or “expressing” refers to the generation of an RNA transcript from an introduced construct, an endogenous DNA sequence, or a stably incorporated heterologous DNA sequence. The term may also refer to a polypeptide produced from an mRNA generated from any of the above DNA precursors.
  • heterologous in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or is synthetically designed, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
  • host cell is meant a cell which contains an introduced nucleic acid construct and supports the replication and/or expression of the construct. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as fungi, yeast, insect, amphibian, nematode, or mammalian cells.
  • the host cells are monocotyledonous or dicotyledonous plant cells.
  • An example of a monocotyledonous host cell is a maize host cell.
  • the term "introduced" means providing a nucleic acid or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing.
  • isolated refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components which normally accompany or interact with the material as found in its naturally occurring environment or (2) if the material is in its natural environment, the material has been altered by deliberate human intervention to a composition and/or placed at a locus in the cell other than the locus native to the material.
  • miRNA refers to an oligoribonucleic acid, which suppresses expression of a polynucleotide comprising the target sequence transcript.
  • a “miRNA precursor” refers to a larger polynucleotide which is processed to produce a mature miRNA, and includes a DNA which encodes an RNA precursor, and an RNA transcript comprising the miRNA.
  • a “mature miRNA” refers to the miRNA generated from the processing of a miRNA precursor.
  • a “miRNA template” is an oligonucleotide region, or regions, in a nucleic acid construct which encodes the miRNA.
  • the "backside” region of a miRNA is a portion of a polynucleotide construct which is substantially complementary to the miRNA template and is predicted to base pair with the miRNA template.
  • the miRNA template and backside may form a double-stranded polynucleotide, including a hairpin structure.
  • target sequence and “sequence of interest” are used interchangeably.
  • Target sequence is used to mean the nucleic acid sequence that is selected for suppression of expression, and is not limited to polynucleotides encoding polypeptides.
  • the target sequence comprises a sequence that is substantially or completely complementary to the miRNA.
  • the target sequence can be RNA or DNA, and may also refer to a polynucleotide comprising the target sequence.
  • nucleic acid means a polynucleotide and includes single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides.
  • nucleic acid library is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism or of a tissue from that organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol.
  • operably linked includes reference to a functional linkage of at least two sequences. Operably linked includes linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
  • plant includes plants and plant parts including but not limited to plant cells, plant tissue such as leaves, stems, roots, flowers, and seeds.
  • polypeptide means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences. The polypeptide can be glycosylated or not.
  • promoter includes reference to a region of DNA that is involved in recognition and binding of an RNA polymerase and other proteins to initiate transcription.
  • sequences include reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
  • Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
  • stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence. Stringent conditions are sequence-dependent and will be different in different circumstances.
  • target sequences can be identified which are 100% complementary to the probe (homologous probing).
  • stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
  • a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to 1X SSC at 55 to 60°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C.
  • T m 81.5 °C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
  • Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
  • transgenic includes reference to a plant or a cell which comprises a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
  • transgenic does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
  • vector includes reference to a nucleic acid used in introduction of a polynucleotide of the invention into a host cell. Expression vectors permit transcription of a nucleic acid inserted therein. Polynucleotide sequences may have substantial identity, substantial homology, or substantial complementarity to the selected region of the target gene.
  • substantially identical or substantially homologous will have about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity wherein the percent sequence identity is based on the entire sequence and is determined by GAP alignment using default parameters (GCG, GAP version 10, Accelrys, San Diego, CA). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of sequence gaps.
  • Substantial complementarity refers to sequences that are complementary to each other, and are able to base pair with each other. In describing complementary sequences, if all the nucleotides in the first sequence will base pair to the second sequence, these sequences are fully complementary.
  • Overexpression of miR172a-2 downregulates at least one member of this family.
  • overexpression of one of the AP2-like target genes, At2g28550 causes late flowering.
  • This result in conjunction with loss-of-function analyses of At2g28550 and another target gene, At5g60120, indicates that at least some of the AP2-like genes targeted by miR172a-2 normally function as floral repressors.
  • the EAT-D line overexpressing miR172-a2 has a wild-type response to photoperiod.
  • the genomic region encoding the miRNA was also identified (SEQ ID NO: 1) and used to produce a cassette into which other miRNAs to target sequences can be inserted (SEQ ID NO: 3), and to produce an expression vector (SEQ ID NO: 44) useful for cloning the cassettes and expressing the miRNA.
  • the expression vector comprises the 1.4kb region encoding the miRNA. Expression of this region is processed in the cell to produce the miRNA which suppresses expression of the target gene. Alternatively, the miRNA may be synthetically produced and introduced to the cell directly.
  • a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target.
  • the miRNA comprises about 10-200 nucleotides, about 10-15, 15- 20, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
  • the nucleic acid construct encodes the miRNA.
  • the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
  • nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1.
  • the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • the method comprises: A method of inhibiting expression of a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order: (i) at least about 20 contiguous nucleotides in the region of nucleotides 1-38 of SEQ ID NO: 3, (ii) a first oligonucleotide of 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, (iii) at least about 20 contiguous nucleotides in the region of nucleotides 60-106 of SEQ ID NO: 3, (iv) the second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonu
  • the method comprises: A method of inhibiting expression of a gene comprising a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order: (i) nucleotides 1-38 of SEQ ID NO: 3, (ii) a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, (i ' ii) nucleotides 60-106 of SEQ ID NO: 3, (iv) the second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and wherein the second oligonucleotide is substantially complementary to the target sequence, and (v) nucleotides 128-159 of SEQ ID
  • the method comprises selecting a target sequence of a gene, and designing a nucleic acid construct comprising polynucleotide encoding a miRNA substantially complementary to the target sequence.
  • the target sequence is selected from any region of the gene.
  • the target sequence is selected from an untranslated region.
  • the target sequence is selected from a coding region of the gene.
  • the target sequence is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
  • the target sequence and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like genes in Arabidopsis thaliana.
  • nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template (first oligonucleotide) and the miRNA template (second oligonucleotide) respectively.
  • this new sequence replaces the equivalent region of SEQ ID NO: 1.
  • this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • the miRNA template i.e.
  • the polynucleotide encoding the miRNA), and thereby the miRNA may comprise some mismatches relative to the target sequence.
  • the miRNA template has > 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence.
  • the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
  • the miRNA template i.e. the polynucleotide encoding the miRNA
  • the miRNA template may comprise some mismatches relative to the miRNA backside.
  • the miRNA template has > 1 nucleotide mismatch as compared to the miRNA backside, for example, the miRNA template can have 1 , 2, 3, 4, 5, or more mismatches as compared to the miRNA backside. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA backside.
  • the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA backside.
  • the target sequence is selected from a plant pathogen. Plants or cells comprising a miRNA directed to the target sequence of the pathogen are expected to have decreased sensitivity and/or increased resistance to the pathogen.
  • the miRNA is encoded by a nucleic acid construct further comprising an operably linked promoter.
  • the promoter is a pathogen-inducible promoter.
  • the method comprises replacing the miRNA encoding sequence in the polynucleotide of SEQ ID NO: 3 with a sequence encoding a miRNA substantially complementary to the target region of the target gene.
  • a method comprising a method of inhibiting expression of a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and (b) expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
  • a method comprising a method of inhibiting expression of a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miR172 miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and (b) expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
  • a method comprising a method of inhibiting expression of a target sequence in a cell comprising: (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified Arabidopsis miR172 miRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and (b) expressing the nucleic acid construct for a time sufficient to produce the miRNA, wherein the miRNA inhibits expression of the target sequence.
  • nucleic acid construct for suppressing a target sequence.
  • the nucleic acid construct encodes a miRNA substantially complementary to the target.
  • the nucleic acid construct further comprises a promoter operably linked to the polynucleotide encoding the miRNA.
  • the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome.
  • the nucleic acid construct is integrated using recombination, including site-specific recombination. See, for example, WO 99/25821 , herein incorporated by reference.
  • the nucleic acid construct is an RNA.
  • the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miR172a precursor is from Arabidopsis thaliana, tomato, soybean, rice, or corn.
  • the miRNA precursor is SEQ ID NO: 1 , SEQ ID NO: 3, or SEQ ID NO: 44.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miR172 miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified Arabidopsis miR172 miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the miRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100- 150, or about 150-200 nucleotides.
  • the nucleic acid construct encodes the miRNA.
  • the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
  • nucleotides 39-59 and/or 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1.
  • this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • the target region is selected from any region of the target sequence. In some embodiments, the target region is selected from a untranslated region. In some embodiments, the target region is selected from a coding region of the target sequence. In some embodiments, the target region is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
  • the target region and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like sequences in Arabidopsis thaliana.
  • the nucleic acid construct comprises an isolated polynucleotide comprising in the following order at least 20 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, at least about 20 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and
  • the nucleic acid construct comprises an isolated polynucleotide comprising in the following order nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin.
  • cells, plants, and seeds comprising the introduced polynucleotides, and/or produced by the methods of the invention.
  • the cells include prokaryotic and eukaryotic cells, including but not limited to bacteria, yeast, fungi, viral, invertebrate, vertebrate, and plant cells.
  • Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, for example, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
  • the cells, plants, and/or seeds comprise a nucleic acid construct comprising a modified plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miR172a precursor is from Arabidopsis thaliana.
  • the miRNA precursor is SEQ ID NO: 1 , SEQ ID NO: 3, or SEQ ID NO: 44.
  • the miRNA precursor is encoded by SEQ ID NO: 1 , SEQ ID NO: 3, or SEQ ID NO: 44.
  • the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • the present invention concerns methods and compositions useful in suppression of a target sequence and/or validation of function.
  • the invention also relates to a method for using microRNA (miRNA) mediated RNA interference (RNAi) to silence or suppress a target sequence to evaluate function, or to validate a target sequence for phenotypic effect and/or trait development.
  • miRNA microRNA
  • RNAi mediated RNA interference
  • RNA interference refers to the process of sequence-specific post- transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al, Nature 391:806 1998). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi.
  • siRNAs short interfering RNAs
  • dsRNAs double-stranded RNAs
  • dsRNAs ribonuclease III enzyme
  • Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al, Nature 409:363 2001).
  • Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir ef. al, Genes Dev. 15:188 2001).
  • Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al, 2001 , Science 293:834).
  • the RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single- stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al, Genes Dev. 15:188 2001).
  • RISC RNA-induced silencing complex
  • RNA interference can also involve small RNA (e.g., microRNA, or miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, Science 297:1818-18192002; Volpe et al, Science 297:1833-1837 2002; Jenuwein, Science 297:2215-2218 2002; and Hall et al, Science 297:2232-2237 2002).
  • miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post- transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al. (Nature 391 :806 1998) were the first to observe RNAi in C. elegans. Wianny and Goetz (Nature Cell Biol. 2:70 1999) describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. (Nature 404:293 2000) describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al, (Nature 411 :494 2001) describe RNAi induced by introduction of duplexes of synthetic 21 -nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant. Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
  • RNA cleavage helps to determine which mechanism, RNA cleavage or translational inhibition, is employed. It is believed that siRNAs, which are perfectly complementary with their targets, work by RNA cleavage. Some miRNAs have perfect or near-perfect complementarity with their targets, and RNA cleavage has been demonstrated for at least a few of these miRNAs. Other miRNAs have several mismatches with their targets, and apparently inhibit their targets at the translational level. Again, without being held to a particular theory on the mechanism of action, a general rule is emerging that perfect or near-perfect complementarity favors RNA cleavage, whereas translational inhibition is favored when the miRNA/target duplex contains many mismatches.
  • miRNA 172 in plants.
  • One of the targets of miR172 is APETALA2 (AP2), and although miR172 shares near-perfect complementarity with AP2 it appears to cause translational inhibition of AP2 rather than RNA cleavage.
  • MicroRNAs are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al, Science 294:853-858 2001 , Lagos-Quintana et al, Curr. Biol.
  • Dicer an RNAse Ill-like protein
  • DCL1 previously named CARPEL FACTORY/SHORT INTEGUMENTS1/ SUSPENSOR1
  • both miRNAs display a temporal expression pattern consistent with their roles in developmental timing.
  • Other animal miRNAs display developmentally regulated patterns of expression, both temporal and tissue-specific (Lagos-Quintana et al, Science 294:853-853 2001 , Lagos-Quintana et al, Curr. Biol.
  • MicroRNAs appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes.
  • the target sites are located in the 3' UTRs of the target mRNAs (Lee et al, Cell 75:843-854 1993; Wightman et al, Cell 75:855-862 1993; Reinhart et al, Nature 403:901-906 2000; Slack et al, Mol. Cell 5:659-669 2000), and there are several mismatches between the lin-4 and let-7 miRNAs and their target sites.
  • Binding of the lin-4 or let-7 miRNA appears to cause downregulation of steady- state levels of the protein encoded by the target mRNA without affecting the transcript itself (Olsen and Ambros, Dev. Biol. 216:671-680 1999).
  • miRNAs can, in some cases, cause specific RNA cleavage of the target transcript within the target site, and this cleavage step appears to require 100% complementarity between the miRNA and the target transcript (Hutvagner and Zamore, Science 297:2056-2060 2002; Llave et al, Plant Cell 14:1605-1619 2002).
  • miRNAs can enter at least two pathways of target gene regulation: Protein downregulation when target complementarity is ⁇ 100%, and RNA cleavage when target complementarity is 100%.
  • MicroRNAs entering the RNA cleavage pathway are analogous to the 21- 25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants (Hamilton and Baulcombe 1999; Hammond et al, 2000; Zamore et al, 2000; Elbashir et al, 2001), and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
  • siRNAs short interfering RNAs
  • PTGS posttranscriptional gene silencing
  • the methods provided can be practiced in any organism in which a method of transformation is available, and for which there is at least some sequence information for the target sequence, or for a region flanking the target sequence of interest. It is also understood that two or more sequences could be targeted by sequential transformation, co-transformation with more than one targeting vector, or the construction of a DNA construct comprising more than one miRNA sequence.
  • the methods of the invention may also be implemented by a combinatorial nucleic acid library construction in order to generate a library of miRNAs directed to random target sequences.
  • the library of miRNAs could be used for high-throughput screening for gene function validation.
  • sequences of interest include, for example, those genes involved in regulation or information, such as zinc fingers, transcription factors, homeotic genes, or cell cycle and cell death modulators, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
  • Target sequences further include coding regions and non-coding regions such as promoters, enhancers, terminators, introns and the like, which may be modified in order to alter the expression of a gene of interest.
  • an intron sequence can be added to the 5' region to increase the amount of mature message that accumulates (see for example Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); and Callis et al, Genes Dev. 1 :1183-1200 (1987)).
  • the target sequence may be an endogenous sequence, or may be an introduced heterologous sequence, or transgene.
  • the methods may be used to alter the regulation or expression of a transgene, or to remove a transgene or other introduced sequence such as an introduced site-specific recombination site.
  • the target sequence may also be a sequence from a pathogen, for example, the target sequence may be from a plant pathogen such as a virus, a mold or fungus, an insect, or a nematode.
  • a miRNA could be expressed in a plant which, upon infection or infestation, would target the pathogen and confer some degree of resistance to the plant.
  • target sequences include genes affecting agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest also included those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting, for example, kernel size, sucrose loading, and the like. The quality of grain is reflected in traits such as levels and types of oils, saturated and unsaturated, quality and quantity of essential amino acids, and levels of cellulose. For example, genes of the phytic acid biosynthetic pathway could be suppressed to generate a high available phosphorous phenotype.
  • phytic acid biosynthetic enzymes including inositol polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324, inositol 1 ,3,4-trisphosphate 5/6- kinase polynucleotides, disclosed in WO 03/027243, and myo-inositol 1-phosphate synthase and other phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all of which are herein incorporated by reference.
  • Genes in the lignification pathway could be suppressed to enhance digestibility or energy availability.
  • Genes affecting cell cycle or cell death could be suppressed to affect growth or stress response.
  • Genes affecting DNA repair and/or recombination could be suppressed to increase genetic variability. Genes affecting flowering time could be suppressed, as well as genes affecting fertility. Any target sequence could be suppressed in order to evaluate or confirm its role in a particular trait or phenotype, or to dissect a molecular, regulatory, biochemical, or proteomic pathway or network. A number of promoters can be used, these promoters can be selected based on the desired outcome. It is recognized that different applications will be enhanced by the use of different promoters in plant expression cassettes to modulate the timing, location and/or level of expression of the miRNA.
  • Such plant expression cassettes may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • a promoter regulatory region e.g., one conferring inducible, constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific/selective expression
  • a transcription initiation start site e.g., one conferring inducible, constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific/selective expression
  • a transcription initiation start site e.g., one conferring inducible, constitutive, environmentally- or developmentally- regulated, or cell- or tissue-specific/selective expression
  • RNA processing signal e.g., RNA processing
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'- promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Patent No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP1-8 promoter and other transcription initiation regions from various plant genes known to those of skill. If low level expression is desired, weak promoter(s) may be used.
  • CaMV cauliflower mosaic virus
  • 1'- or 2'- promoter derived from T-DNA of Agrobacterium tumefaciens the ubiquitin 1 promoter
  • the Smas promoter the cinnamyl alcohol dehydrogenase promoter
  • the Nos promoter the pEmu promoter
  • the rubisco promoter the GRP1
  • Weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Patent No. 6,072,050), the core 35S CaMV promoter, and the like.
  • Other constitutive promoters include, for example, U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121 ; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142. See also, U.S. Patent No. 6,177,611 , herein incorporated by reference.
  • inducible promoters examples include the Adh1 promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, the PPDK promoter and the pepcarboxylase promoter which are both inducible by light. Also useful are promoters which are chemically inducible, such as the ln2-2 promoter which is safener induced (U.S. patent 5,364,780), the ERE promoter which is estrogen induced, and the Axigl promoter which is auxin induced and tapetum specific but also active in callus (PCT US01/22169). Examples of promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
  • An exemplary promoter is the anther specific promoter 5126 (U.S. Patent Nos. 5,689,049 and 5,689,051).
  • seed-preferred promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter, Boronat, A. et al. (1986) Plant Sci. 47:95-102; Reina, M. et al. Nucl. Acids Res. 18(21):6426; and Kloesgen, R.B. et al. (1986) Mol. Gen. Genet. 203:237-244.
  • Promoters that express in the embryo, pericarp, and endosperm are disclosed in US patent 6,225,529 and PCT publication WO 00/12733. The disclosures each of these are incorporated herein by reference in their entirety.
  • Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1 ,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol.
  • a wound-inducible promoter may be used in the constructions of the polynucleotides.
  • Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters include, but are not limited to, the maize ln2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid.
  • promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Patent Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
  • Tissue-preferred promoters can be utilized to target enhanced expression of a sequence of interest within a particular plant tissue.
  • Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341 ; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol.
  • Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root- specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al.
  • MAS mannopine synthase
  • Suitable methods of introducing the DNA construct include microinjection (Crossway et al. (1986) Biotechniques 4:320-334; and U.S. Patent No. 6,300,543), sexual crossing, electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium- mediated transformation (Townsend et al, U.S. Pat No. 5,563,055; and U.S. Patent No. 5,981 ,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford et al, U.S.
  • nucleotide constructs may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that useful promoters encompass promoters utilized for transcription by viral RNA polymerases.
  • transient expression may be desired.
  • standard transient transformation techniques may be used. Such methods include, but are not limited to viral transformation methods, and microinjection of DNA or RNA, as well other methods well known in the art.
  • the cells from the plants that have stably incorporated the nucleotide sequence may be grown into plants in accordance with conventional ways.
  • Gene targeting can be performed without selection if there is a sensitive method for identifying recombinants, for example if the targeted gene modification can be easily detected by PCR analysis, or if it results in a certain phenotype. However, in most cases, identification of gene targeting events will be facilitated by the use of markers.
  • Useful markers include positive and negative selectable markers as well as markers that facilitate screening, such as visual markers.
  • Selectable markers include genes carrying resistance to an antibiotic such as spectinomycin (e.g. the aada gene, Svab et al. 1990 Plant Mol. Biol. 14:197), streptomycin (e.g., aada, or SPT, Svab et al. 1990 Plant Mol. Biol.
  • Negative selectable markers include cytosine deaminase (codA) (Stougaard 1993 Plant J. 3:755-761), tms2 (DePicker et al. 1988 Plant Cell Rep.
  • nitrate reductase Nussame et al. 1991 Plant J. 1:267-274
  • SU1 O'Keefe et al. 1994 Plant Physiol. 105:473-482
  • aux-2 from the Ti plasmid of Agrobacterium
  • Screenable markers include fluorescent proteins such as green fluorescent protein (GFP) (Chalfie et al, 1994 Science 263:802; US 6,146,826; US 5,491 ,084; and WO 97/41228), reporter enzymes such as ⁇ -glucuronidase (GUS) (Jefferson R.A. 1987 Plant Mol. Biol. Rep.
  • One or more markers may be used in order to select and screen for gene targeting events.
  • One common strategy for gene disruption involves using a target modifying polynucleotide in which the target is disrupted by a promoterless selectable marker. Since the selectable marker lacks a promoter, random integration events are unlikely to lead to transcription of the gene. Gene targeting events will put the selectable marker under control of the promoter for the target gene. Gene targeting events are identified by selection for expression of the selectable marker.
  • Another common strategy utilizes a positive-negative selection scheme. This scheme utilizes two selectable markers, one that confers resistance (R+) coupled with one that confers a sensitivity (S+), each with a promoter.
  • the resulting phenotype is R+/S+.
  • the two markers are uncoupled and the resulting phenotype is R+/S-. Examples of using positive-negative selection are found in Thykjasr et al. (1997) Plant Mol. Biol. 35:523-530; and WO 01/66717, which are herein incorporated by reference.
  • the example describes the identification of a microRNA
  • the following experiments were carried out on the Arabidopsis thaliana Col- 0 ecotype. Plants were grown in long days (16 h light, 8 h dark) under cool white light at 22°C. Arabidopsis plants were transformed by a modified version of the floral dip method, in which Agrobacterium cell suspension was applied to plants by direct watering from above.
  • the T-DNA vector used, pHSbarENDs contained four copies of the CAMV 35S enhancer adjacent to the right border, an arrangement similar to that described by Weigel et al. (Plant Physiol. 122:1003-1013, 2000).
  • Transformed plants were selected with glufosinate (BASTA) and screened for flowering time, which resulted in the identification of the early-flowering EAT-D mutant.
  • BASTA glufosinate
  • a single T-DNA cosegregating with early flowering was identified in EAT- D, and TAIL-PCR was performed to amplify sequences adjacent to the left and right borders of the T-DNA.
  • TAIL-PCR was performed to amplify sequences adjacent to the left and right borders of the T-DNA.
  • To identify transcripts upregulated in the EAT-D mutant we probed Northern blots containing RNA extracted from wild type (Col-0) and EAT-D plants.
  • At5g04270 and At5g04280 did not detect any difference between wild type and EAT-D, whereas a probe from the intergenic region identified an ⁇ 1.4 kb transcript that was expressed at significantly higher levels in EAT-D than in wild type.
  • a probe from the intergenic region identified an ⁇ 1.4 kb transcript that was expressed at significantly higher levels in EAT-D than in wild type.
  • Reverse transcription was carried out using an oligo-dT primer, and PCR utilized a gene-specific primer (SEQ ID NO: 45 5'-CTGTGCTCACGATCTTGTTGTTCTTGATC-3') paired with the 5' kit primer, or a second gene-specific primer (SEQ ID NO: 46 5'- GTCGGCGGATCCATGGAAGAAAGCTCATC-5') paired with the 3' kit primer.
  • the Arabidopsis EAT-D (Early Activation Tagged - Dominant) mutant was identified in an activation tagging population (Weigel et al, Plant Physiol. 122:1003-1013, 2000).
  • EAT-D mutant flowers extremely early.
  • This ap2-like phenotype is only observed in EAT-D homozygotes, whereas both EAT-D heterozygotes and homozygotes are early flowering, indicating that the flowering time phenotype is more sensitive to EAT-D dosage than the ap2-like floral phenotype.
  • the 35S::EAT transformants displayed the identical early-flowering and ap2-like phenotypes seen for EAT-D (Table 1). Many of the 35S::EAT transformants occasionally displayed additional defects, including stigmatic papillae on cauline leaf margins and the formation of a complete or partial flower rather than a secondary inflorescence in the axils of cauline leaves. Ectopic expression of the EAT gene in 35S::EAT plants, therefore, affects both flowering time and the specification of floral organ identity.
  • the EAT gene produces a 1417-nucleotide noncoding RNA that is predicted to be 5'-capped and polyadenylated, based on our RACE-PCR methodology.
  • the GU wobble in the duplex is underlined.
  • This particular region of the AP2 gene is poorly conserved at the nucleotide level among the AP2 family; nevertheless, the AP2 sequence (SEQ ID NO: 49) that is complementary to miR172a-2 is found in a similar location in three other Arabidopsis AP2 family members, At5g60120 (SEQ ID NO: 50), At2g28550 (SEQ ID NO: 51), At5g67180 (SEQ ID NO: 52).
  • the sequence can be found at the corresponding positions of the maize AP2 genes indeterminate spikeletl (Chuck et al, Genes. Dev.
  • miR172a-2 is highly similar to three other Arabidopsis loci. Like the miR172a-2 miRNA, all four reiterations of the sequence are in intergenic regions, i.e. in between the Arabidopsis genes currently annotated in GenBank. In addition, the sequence is found in ESTs from tomato, potato and soybean, and four copies were found in the genomic sequence of rice.
  • Example 2 This example describes the construction of expression vectors To overexpress the EAT gene, we designed primers containing Xhol sites
  • the Xhol-cut EAT gene was inserted into the binary vector pBE851 in between a CAMV 35S promoter and b-phaseolin terminator, and Col-0 was transformed by floral dip.
  • two oligonucleotides were synthesized (SEQ ID NO: 57 5' GATCCATGGAAGAAAGCTCATCTGTCGTTGTTTGTAGGCGCAGCACCATTAA GATTCACATGGAAATTGATAAATAC-3' and SEQ ID NO: 58 5'- CCTAAATTAGGGTTTTGATATGTATATTCAACAATCGACGGCTACAAATACCTA A-3') that completely recreated the BamHI/Hindlll fragment of the EAT cDNA except that it lacked the 21 nt miR172a-2 sequence located within the fragment.
  • These two oligos were annealed to their synthesized complementary strands (SEQ ID NO: 59 5'-
  • this hairpin is the substrate which is subsequently cleaved by a plant Dicer homolog to generate the mature miRNA.
  • the location of the miRNA within the hairpin, i.e. on the 3' side of the stem, is conserved amongst all the members of the miR172 family, and this may reflect a structural requirement for processing of this particular miRNA family.
  • the 21-nt miR172a-2 miRNA therefore, is predicted to be a member of a family of miRNAs that have the capacity to regulate a subset of AP2 genes by forming an RNA duplex with a 21-nt cognate sequence in these genes.
  • the oligos were 30-mers that corresponded to either the sense or antisense strands of the miR172a-2 miRNA, with 4-5 nt of flanking sequence on each side.
  • the filter was washed twice at 37°C, in buffer containing 2X SSC and 0.5% SDS.
  • probe was made by end-labeling an oligo (SEQ ID NO: 61) (5'- ATGCAGCATCATCAAGATTCTCATATACAT-3') with T4 polynucleotide kinase and 32P. Hybridization and processing of S1 reactions were carried out using standard protocols.
  • Oligos used to amplify the ACT11 (Actin) transcript were: (SEQ ID NO: 66) 5'-ATGGCAGATGGTGAAGACATTCAG- 3', and (SEQ ID NO: 67) 5'-GAAGCACTTCCTGTGGACTATTGATG-3'.
  • RT-PCR analysis of AP2 was performed on RNA from floral buds, and utilized the following oligos: (SEQ ID NO: 68) 5'-TTTCCGGGCAGCAGCAACATTGGTAG-3', and (SEQ ID NO: 69) 5'-GTTCGCCTAAGTTAACAAGAGGATTTAGG-3'.
  • Oligos used to amplify the ANT transcript were: (SEQ ID NO: 70) 5'- GATCAACTTCAATGACTAACTCTGGTTTTC-3', and (SEQ ID NO: 71) 5'- GTTATAGAGAGATTCATTCTGTTTCACATG-3'.
  • Immunoblot analysis of AP2 was performed on proteins extracted from floral buds. Following electrophoresis on a 10% SDS-PAGE gel, proteins were transferred to a Hybond-P membrane (Amersham) and incubated with an antibody specific for AP2 protein (aA-20, Santa Cruz Biotechnology). The blot was processed using an ECL-plus kit (Amersham).
  • the example describes the developmental pattern of EAT miRNA expression.
  • RT-PCR was used to specifically detect a fragment of the 1.4 kb EAT full-length precursor transcript containing miR172a-2.
  • EAT precursor transcript expression is temporally regulated, with little or no transcript detected two days after germination, and progressively more steady- state transcript accumulation seen as the plant approaches flowering.
  • the precursor transcript of miR172a-1 showed a similar temporal pattern of expression. Both miR172a-2 and miR172a-1 precursor transcripts continue to be ( expressed after flowering has occurred, and accumulate in both leaves and floral buds.
  • Example 5 We assessed the levels of miR172 in various flowering time mutants, in an attempt to position miR172 within the known flowering time pathways. The levels of miR172 were not altered in any of the mutants tested, and the levels of the EAT transcript were identical in plants grown in long days versus plants grown in short days.
  • Example 6 The example describes evaluation of protein expression Immunoblot analysis indicates that AP2 protein is reduced 3.5-fold in the EAT-D mutant relative to wild type, whereas the AP2 transcript is unaffected. This data suggests that the miR172a-2 miRNA negatively regulates AP2 by translational inhibition. The predicted near-perfect complementarity between the miR172a-2 miRNA and the AP2 target site would be predicted to trigger AP2 mRNA cleavage by the RNA interference (RNAi) pathway (Llave et al, Plant Cell 14:1605-1619 2002; Hutvagner and Zamore, Science 297:2056-2060 2002).
  • RNAi RNA interference
  • Example 7 In the same genetic screen that identified the early-flowering EAT-D mutant, we identified an activation-tagged late-flowering mutant, called LAT-D.
  • the LAT-D mutant displays no additional phenotypes besides late flowering (Table 1), and the late-flowering phenotype cosegregated with a single T-DNA insertion.
  • Sequence analysis of the T-DNA insert in LAT-D indicated that the 4X 35S enhancer was located approximately 5 kb upstream of At2g28550, which is one of the AP2-like target genes that are potentially regulated by miR172.
  • RT-PCR analysis using primers specific for At2g28550 indicates that the transcript corresponding to this gene is indeed expressed at higher levels in the LAT-D mutant relative to wild type.
  • Example 8 To assess the effects of reducing At2g28550 function, we identified plants containing a T-DNA insertion in the At2g28550 gene. In addition, we identified a T-DNA mutant for At2g60120, a closely related AP2-like gene that also contains the miR172 target sequence. Plants homozygous for either the At2g28550 insert or the At5g60120 insert were slightly early flowering relative to wild type (Table 1). The two mutants were crossed, and the double mutant was isolated by PCR genotyping. The At2g28550/At5g60120 double mutant was earlier flowering than either individual mutant (Table 1), suggesting that the genes have overlapping function.
  • the early flowering phenotype of the At2g28550/At5g60120 double mutant is consistent with the idea that the early flowering phenotype of miR172- overexpressing lines is due to downregulation of several AP2-like genes, including At2g28550 and At5g60120.
  • the At2g28550/At5g60120 double mutant is not as early as miR172-overexpressing lines (c.f. EAT-OX, Table 1), which suggests that other AP2-like targets of miR172, for example AP2 itself or At5g67180, also contribute to flowering time control. Because ap2 mutants are not early flowering, any potential negative regulation of flowering by AP2 must be normally masked by genetic redundancy.
  • This example describes a method of target selection and method to design DNA constructs to generate miRNAs using the constructs of SEQ ID NOS: 3 and 44.
  • Any sequence of interest can be selected for silencing by miRNA generated using the following method: 1.
  • the chosen region ends with a T or A, such that the complementary miRNA will start with an A or U.
  • the miRNA sequence starts with an A, and many other miRNAs start with a U.
  • SEQ ID NO: 3 create a 21 nucleotide sequence complementary to the 21 nt target region (miRNA).
  • miRNA 21 nt target region
  • change a C in the miRNA to a T which will generate a GU wobble with the target sequence, which mimics the GU wobble seen in EAT. 3.
  • backside sequence of the hairpin. This will be substantially complementary to the miRNA from step 2. Note, this backside sequence will also be substantially identical to the target sequence. Typically, introduce a few mismatches to make some bulges in the stem of the hairpin that are similar to the bulges in the original EAT hairpin. Optionally, introduce an A at the 3' end of the backside, to create mismatch at the 5' end of the miRNA. This last step may help ensure lower stability at the 5' end of the miRNA in its double- stranded Dicer product form (Schwartz, et al. 2003 Cell 115:199-208). 4.
  • Oligo 1 will have an unpaired BamHI site at the 5' end, and will end with the nucleotide at position 78 of SEQ ID NO: 3.
  • Oligo 2 will have the nucleotides of position 79-82 (CCTA) unpaired at the 5' end, and will terminate just before the Hindlll site (or positions 151-154 in SEQ ID NO: 3).
  • Oligo 3 will be essentially complementary to Oligo 1 , (nucleotides 5-78 of SEQ ID NO: 3), and will terminate with 4 nucleotides complementary to nucleotides 1-4 (CCTA) of Oligo, 2.
  • Oligo 4 will be essentially complementary to Oligo 2 beginning at the nucleotide of position 5, and will terminate with the Hindlll site at the 3' end. Anneal the oligonucleotides to generate two fragments to be used in a subsequence ligation reaction with the plasmid sequence.
  • Silencing of the target gene can be assessed using techniques well- known in the art, for example, Northern blot analysis, immunoblot analysis if the target gene of interest encodes a polypeptide, and any phenotypic screens relevant to the target gene, for example flowering time, or floral morphology.
  • Example 10 Described in this example are methods one may use for introduction of a polynucleotide or polypeptide into a plant cell.
  • a DNA construct can be introduced into maize cells capable of growth on suitable maize culture medium. Such competent cells can be from maize suspension culture, callus culture on solid medium, freshly isolated immature embryos or meristem cells. Immature embryos of the Hi-ll genotype can be used as the target cells. Ears are harvested at approximately 10 days post-pollination, and 1.2-1.5mm immature embryos are isolated from the kernels, and placed scutellum-side down on maize culture medium. The immature embryos are bombarded from 18-72 hours after being harvested from the ear.
  • the immature embryos are placed on medium with additional osmoticum (MS basal medium, Musashige and Skoog, 1962, Physiol. Plant 15:473-497, with 0.25 M sorbitol).
  • MS basal medium Musashige and Skoog, 1962, Physiol. Plant 15:473-497, with 0.25 M sorbitol.
  • the embryos on the high-osmotic medium are used as the bombardment target, and are left on this medium for an additional 18 hours after bombardment.
  • plasmid DNA (described above) is precipitated onto 1.8 mm tungsten particles using standard CaCI2- spermidine chemistry (see, for example, Klein etal, 1987, Nature 327:70-73).
  • N6-based culture medium containing 3 mg/l of the selective agent bialaphos. Embryos, and later callus, are transferred to fresh selection plates every 2 weeks. The calli developing from the immature embryos are screened for the desired phenotype. After 6-8 weeks, transformed calli are recovered.
  • Soybean transformation Soybean embryogenic suspension cultures are maintained in 35 ml liquid media SB196 or SB172 in 250 ml Erlenmeyer flasks on a rotary shaker, 150 rpm, 26C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid media. Alternatively, cultures are initiated and maintained in 6-well Costar plates.
  • SB 172 media is prepared as follows: (per liter), 1 bottle Murashige and Skoog Medium (Duchefa # M 0240), 1 ml B5 vitamins 1000X stock, 1 ml 2,4-D stock (Gibco 11215-019), 60 g sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL 11013-026), pH 5.7.
  • SB 196 media is prepared as follows: (per liter) 10ml MS FeEDTA, 10ml MS Sulfate, 10ml FN-Lite Halides, 10ml FN-Lite P,B,Mo, 1ml B5 vitamins 1000X stock, 1 ml 2,4-D, (Gibco 11215-019), 2.83g KN03 , 0.463g (NH4)2S04, 2g MES, 1g Asparagine Anhydrous, Powder (Gibco 11013-026), 10g Sucrose, pH 5.8. 2,4-D stock concentration 10 mg/ml is prepared as follows: 2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and stored at -20°C.
  • B5 vitamins 1000X stock is prepared as follows: (per 100 ml) - store aliquots at -20°C, 10 g myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCI, 1 g thiamin. Soybean embryogenic suspension cultures are transformed with various plasmids by the method of particle gun bombardment (Klein et al, 1987 Nature 327:70. To prepare tissue for bombardment, approximately two flasks of suspension culture tissue that has had approximately 1 to 2 weeks to recover since its most recent subculture is placed in a sterile 60 x 20 mm petri dish containing 1 sterile filter paper in the bottom to help absorb moisture. Tissue (i.e.
  • suspension clusters approximately 3-5 mm in size) is spread evenly across each petri plate. Residual liquid is removed from the tissue with a pipette, or allowed to evaporate to remove excess moisture prior to bombardment. Per experiment, 4 - 6 plates of tissue are bombarded. Each plate is made from two flasks. To prepare gold particles for bombardment, 30 mg gold is washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile water. For each plasmid combination (treatments) to be used for bombardment, a separate micro- centrifuge tube is prepared, starting with 50 ⁇ l of the gold particles prepared above.
  • each tube the following are also added; 5 ⁇ l of plasmid DNA (at 1 ⁇ g/ ⁇ l), 50 ⁇ l CaCI2, and 20 ⁇ l 0.1 M spermidine. This mixture is agitated on a vortex shaker for 3 minutes, and then centrifuged using a microcentrifuge set at 14,000 RPM for 10 seconds. The supernatant is decanted and the gold particles with attached, precipitated DNA are washed twice with 400 ⁇ l aliquots of ethanol (with a brief centrifugation as above between each washing). The final volume of 100% ethanol per each tube is adjusted to 40 ⁇ l, and this particle/DNA suspension is kept on ice until being used for bombardment.
  • the tube is briefly dipped into a sonicator bath to disperse the particles, and then 5 ⁇ L of DNA prep is pipetted onto each flying disk and allowed to dry.
  • the flying disk is then placed into the DuPont Biolistics PDS1000/HE.
  • the membrane rupture pressure is 1100 psi.
  • the chamber is evacuated to a vacuum of 27-28 inches of mercury.
  • the tissue is placed approximately 3.5 inches from the retaining/stopping screen (3rd shelf from the bottom). Each plate is bombarded twice, and the tissue clusters are rearranged using a sterile spatula between shots.
  • the tissue is re-suspended in liquid culture medium, each plate being divided between 2 flasks with fresh SB196 or SB172 media and cultured as described above.
  • the medium is replaced with fresh medium containing a selection agent.
  • the selection media is refreshed weekly for 4 weeks and once again at 6 weeks. Weekly replacement after 4 weeks may be necessary if cell density and media turbidity is high.
  • green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into 6-well microtiter plates with liquid medium to generate clonally-propagated, transformed embryogenic suspension cultures.
  • Each embryogenic cluster is placed into one well of a Costar 6-well plate with 5mls fresh SB196 media with selection agent. Cultures are maintained for 2- 6 weeks with fresh media changes every 2 weeks. When enough tissue is available, a portion of surviving transformed clones are subcultured to a second 6- well plate as a back-up to protect against contamination.
  • transformed embryogenic clusters are removed from liquid SB196 and placed on solid agar media, SB 166, for 2 weeks. Tissue clumps of 2 - 4 mm size are plated at a tissue density of 10 to 15 clusters per plate. Plates are incubated in diffuse, low light ( ⁇ 10 ⁇ E) at 26 +/- 1°C.
  • SB 166 is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/ BRL - Cat# 11117-017), 1 ml B5 vitamins 1000X stock, 60 g maltose, 750 mg MgCI2 hexahydrate, 5 g activated charcoal, pH 5.7, 2 g gelrite.
  • SB 103 media is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL - CaW 11117-017), 1 ml B5 vitamins 1000X stock, 60 g maltose, 750 mg MgCI2 hexahydrate, pH 5.7, 2 g gelrite.
  • individual embryos are desiccated by placing embryos into a 100 X 15 petri dish with a 1cm2 portion of the SB103 media to create a chamber with enough humidity to promote partial desiccation, but not death.
  • Approximately 25 embryos are desiccated per plate. Plates are sealed with several layers of parafilm and again are placed in a lower light condition.
  • the duration of the desiccation step is best determined empirically, and depends on size and quantity of embryos placed per plate. For example, small embryos or few embryos/plate require a shorter drying period, while large embryos or many embryos/plate require a longer drying period. It is best to check on the embryos after about 3 days, but proper desiccation will most likely take 5 to 7 days.
  • Embryos will decrease in size during this process. Desiccated embryos are planted in SB 71-1 or MSO medium where they are left to germinate under the same culture conditions described for the suspension cultures. When the plantlets have two fully-expanded trifoliate leaves, germinated and rooted embryos are transferred to sterile soil and watered with MS fertilizer. Plants are grown to maturity for seed collection and analysis. Healthy, fertile transgenic plants are grown in the greenhouse. SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts w/ sucrose
  • MSO media is prepared as follows: 1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins 1000X stock, 30 g sucrose, pH 5.8, 2g Gelrite.
  • Example 11 This example describes the design and synthesis of miRNA targets and hairpins directed to various gene targets found in maize, soy, and/or Arabidopsis, using the method described in Example 9.
  • the miRNA sequence of SEQ ID NO: 4 was selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 12-15, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the miRNA of SEQ ID NO: 4, 88% of the transformants exhibited a mutant AGAMOUS (ag) floral phenotype, characterized by the conversion of stamens to petals in whorl 3, and carpels to another ag flower in whorl 4 (Bowman, et al.
  • the mutant phenotype varied between transformants, with approximately 1/3 exhibiting a strong ag phenotype, 1/3 exhibiting an intermediate ag phenotype, and 1/3 exhibiting a weak ag phenotype.
  • Gel electrophoresis and Northern Blot analysis of small RNAs isolated from the transformants demonstrated that the degree of the mutant ag phenotype was directly related to the level of antiAG miRNA, with the strongest phenotype having the highest accumulation of the processed miRNA ( ⁇ 21 nt).
  • the miRNA sequence of SEQ ID NO: 5 was selected and designed.
  • the sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 16-19, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • the miRNA sequence of SEQ ID NO: 6 was selected and designed.
  • the sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the miRNA of SEQ ID NO: 5, the transformants had novel leaf and floral phenotypes, but did not exhibit any mutant AP3 phenotype. Gel electrophoresis and Northern analysis of RNA isolated from 2 week old rosette leaf tissue from the transformants demonstrated that the highest accumulation of the processed miRNA ( ⁇ 21 nt) corresponded to the "backside" strand of the precursor, which evidently silenced a different target sequence to produce the novel leaf and floral phenotypes. A new target sequence was selected, with the correct asymmetry in order for the miRNA target strand to be selected during incorporation into RISC (Schwartz, et al.
  • the miRNA sequence of SEQ ID NO: 6 was selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44. Greater than 90% of the transformants showed silencing for the AP3 gene, as demonstrated by floral phenotype and electrophoretic analysis. An approximately 21 nt miRNA (antiAP3b) was detected at high levels in the transgenic plants, and not in wild type control plants. RT-PCR analysis confirmed that the amount of AP3 transcript was reduced in the transformants, as compared to wild type control plants.
  • the sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 28-31 , and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • Inositol polyphosphate kinase-2 polynucleotides are disclosed in WO 02/059324, herein incorporated by reference.
  • Inositol 1 ,3,4-trisphosphate 5/6-kinase polynucleotides are disclosed in WO
  • IPPK2 Inositol polyphosphate kinase-2
  • Inositol 1 ,3,4-trisphosphate 5/6-kinase-5 The miRNA sequence of SEQ ID NO: 10 was selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 36-39, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • Myo-inositol 1-phosphate svnthase The miRNA sequence of SEQ ID NO: 11 was selected and designed. The sequence is put into the BamHI/Hindlll hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 40-43, and ligating them into the BamHI/Hindlll backbone fragment of SEQ ID NO: 44.
  • Arabidopsis transformation was used to transform soybean.
  • This construct has a miRNA template sequence which encodes the miRNA of SEQ ID NO: 48.
  • the construct was created using a PCR amplification of miR172a-2 precursor sequence from Arabidopsis, restriction digestion, and ligation as described in Example 2. Soybean tissue was transformed and grown essentially as described in Example 10. After transformation, 42% of the transformants exhibited a mutant phenotype, characterized by the conversion of sepals to leaves. Plants exhibiting the strongest phenotypes were sterile, and produced no seed. Both the homeotic conversion of the organs and the effects on fertility are similar to that seen for ap2 mutant alleles in Arabidopsis.
  • RNA gel electrophoresis and Northern analysis probed with an oligonucleotide probe antisense to miR172, showed accumulation of miR172 in the transgenic lines. A small amount of endogenous soy miR172 is also detected in the soy control line. The degree of the mutant phenotype was directly related to the level of miRNA, with the strongest phenotype having the highest accumulation of the processed miRNA ( ⁇ 21 nt).
  • Example 12 This example summarizes the target sequences and oligos used for miRNA silencing constructs as described in the examples. Table 4:

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne des procédés et des compositions utiles dans la suppression et la validation d'une séquence cible. Cette invention concerne des constructions polynucléotidiques utiles dans le silençage génique, ainsi que des cellules, des plantes et des semences comportant lesdits polynucléotides. Cette invention concerne enfin un procédé d'utilisation de micro-ARN dans le silençage d'une séquence cible.
PCT/US2004/033453 2003-10-09 2004-10-12 Silençage genique WO2005052170A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002541970A CA2541970A1 (fr) 2003-10-09 2004-10-12 Silencage genique

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50995803P 2003-10-09 2003-10-09
US60/509,958 2003-10-09

Publications (2)

Publication Number Publication Date
WO2005052170A2 true WO2005052170A2 (fr) 2005-06-09
WO2005052170A3 WO2005052170A3 (fr) 2005-10-06

Family

ID=34435040

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2004/033453 WO2005052170A2 (fr) 2003-10-09 2004-10-12 Silençage genique
PCT/US2004/033462 WO2005035769A2 (fr) 2003-10-09 2004-10-12 Extinction genique

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US2004/033462 WO2005035769A2 (fr) 2003-10-09 2004-10-12 Extinction genique

Country Status (5)

Country Link
US (4) US20050120415A1 (fr)
EP (2) EP1711613B1 (fr)
AU (1) AU2004280634A1 (fr)
CA (2) CA2541914C (fr)
WO (2) WO2005052170A2 (fr)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010145846A1 (fr) 2009-06-15 2010-12-23 Bayer Bioscience N.V. Plants de nicotinia benthamiana à activité xylosyltransférase déficiente
US8237017B2 (en) 2006-05-12 2012-08-07 Bayer Cropscience Nv Stress-related microRNA molecules and uses thereof
EP2551348A2 (fr) 2011-07-29 2013-01-30 Icon Genetics GmbH Production de N-glycanes galactosylatées dans des plantes
WO2013050155A1 (fr) 2011-10-04 2013-04-11 Icon Genetics Gmbh Plantes nicotiana benthamiana déficientes dans l'activité fucosyltransférase
WO2015000914A1 (fr) 2013-07-01 2015-01-08 Bayer Cropscience Nv Procédés et moyens pour moduler la durée de floraison de plantes monocotylédones
WO2016050512A1 (fr) 2014-10-03 2016-04-07 Bayer Cropscience Nv Procédés et moyens pour augmenter la tolérance au stress et la biomasse chez des plantes
WO2016113333A1 (fr) 2015-01-16 2016-07-21 Bayer Cropscience Nv Promoteurs préférentiels de gousses et leurs utilisations
WO2016128519A1 (fr) 2015-02-12 2016-08-18 Bayer Cropscience Nv Promoteurs préférentiels de l'apex de pousse et utilisations de ces promoteurs
WO2017178318A1 (fr) 2016-04-11 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'endosperme et leurs utilisations
WO2017178367A1 (fr) 2016-04-13 2017-10-19 Bayer Cropscience Nv Promoteurs préférentiels des graines et du funicule et leurs utilisations
WO2017178322A1 (fr) 2016-04-11 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'endosperme et leurs utilisations
WO2017178368A1 (fr) 2016-04-13 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'embryon et leurs utilisations
WO2018172181A1 (fr) 2017-03-23 2018-09-27 Bayer Cropscience Nv Promoteur spécifique de l'anthère et ses utilisations
US10093907B2 (en) 2013-09-24 2018-10-09 Basf Se Hetero-transglycosylase and uses thereof
WO2018217474A1 (fr) 2017-05-24 2018-11-29 Bayer Cropscience Lp Promoteur inductible par la rouille fongique
WO2019138083A1 (fr) 2018-01-12 2019-07-18 Basf Se Gène sous-jacent au nombre de qtl d'épillets par épi de blé sur le chromosome 7a
WO2020002152A2 (fr) 2018-06-27 2020-01-02 Basf Se Rubisco activase thermostable et utilisations associées
US10844390B2 (en) 2015-08-07 2020-11-24 Basf Agricultural Solutions Seed, Us Llc Root-preferential and stress inducible promoter and uses thereof
WO2021004838A2 (fr) 2019-07-05 2021-01-14 BASF Agricultural Solutions Seed US LLC Activase rubisco avec inhibition de l'adp réduite et utilisations correspondantes
WO2023052562A1 (fr) 2021-10-01 2023-04-06 Basf Se Plantes de blé avec un rendement accru
WO2023052561A1 (fr) 2021-10-01 2023-04-06 Basf Se Plantes présentant des propriétés améliorées
WO2024099765A2 (fr) 2022-11-10 2024-05-16 BASF Agricultural Solutions Seed US LLC Séquences nucléotidiques régulant la transcription et procédés d'utilisation

Families Citing this family (85)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001285078A1 (en) 2000-08-18 2002-03-04 Atritech, Inc. Expandable implant devices for filtering blood flow from atrial appendages
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
CN100383238C (zh) * 2003-05-09 2008-04-23 克鲁塞尔荷兰公司 E1-永生化的细胞培养物及培养所述细胞以提高从中获取的产物产量的方法
CA2541914C (fr) * 2003-10-09 2012-07-24 E.I. Du Pont De Nemours And Company Extinction genique au moyen de molecules de microarn
US20050137694A1 (en) 2003-12-23 2005-06-23 Haug Ulrich R. Methods and apparatus for endovascularly replacing a patient's heart valve
US8840663B2 (en) 2003-12-23 2014-09-23 Sadra Medical, Inc. Repositionable heart valve method
US8182528B2 (en) 2003-12-23 2012-05-22 Sadra Medical, Inc. Locking heart valve anchor
US8343213B2 (en) 2003-12-23 2013-01-01 Sadra Medical, Inc. Leaflet engagement elements and methods for use thereof
US7381219B2 (en) 2003-12-23 2008-06-03 Sadra Medical, Inc. Low profile heart valve and delivery system
US20120041550A1 (en) 2003-12-23 2012-02-16 Sadra Medical, Inc. Methods and Apparatus for Endovascular Heart Valve Replacement Comprising Tissue Grasping Elements
EP2529696B1 (fr) 2003-12-23 2014-01-29 Sadra Medical, Inc. Valvule cardiaque repositionnable
US7445631B2 (en) 2003-12-23 2008-11-04 Sadra Medical, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US11278398B2 (en) 2003-12-23 2022-03-22 Boston Scientific Scimed, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
US8052749B2 (en) 2003-12-23 2011-11-08 Sadra Medical, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
IL179285A (en) 2004-05-14 2011-04-28 Rosetta Genomics Ltd Micrornas and uses thereof
US7795419B2 (en) 2004-05-26 2010-09-14 Rosetta Genomics Ltd. Viral and viral associated miRNAs and uses thereof
WO2006044322A2 (fr) * 2004-10-12 2006-04-27 The Rockefeller University Micro-arn
CN101107362A (zh) 2004-10-21 2008-01-16 文甘扎公司 用于赋予对植物病害生物和植物病原体抗性的方法和材料
AU2005323166B2 (en) 2004-12-21 2011-11-10 Monsanto Technology, Llc Recombinant DNA constructs and methods for controlling gene expression
US20060200878A1 (en) 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US8314290B2 (en) 2004-12-21 2012-11-20 Monsanto Technology Llc Temporal regulation of gene expression by MicroRNAs
DE102005003632A1 (de) 2005-01-20 2006-08-17 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Katheter für die transvaskuläre Implantation von Herzklappenprothesen
BRPI0608829A2 (pt) * 2005-04-19 2011-03-15 Basf Plant Science Gmbh método para a expressão transgênica com especificidade intensificada em uma planta, uso de um construto de ácido nucleico quimérico, seqüência de ribonucleotìdeo quimérica, construto de expressão, vetor de expressão, organismo não-humano ou célula transformada, semente transformada, e, preparação farmacêutica
EP1907549A1 (fr) * 2005-06-17 2008-04-09 Pioneer-Hi-Bred International, Inc. Procédés et compositions pour le silençage génique
US7569071B2 (en) 2005-09-21 2009-08-04 Boston Scientific Scimed, Inc. Venous valve, system, and method with sinus pocket
US8334430B2 (en) * 2005-10-13 2012-12-18 Monsanto Technology Llc Methods for producing hybrid seed
WO2007070389A2 (fr) * 2005-12-12 2007-06-21 Syngenta Participations Ag Regulation des mauvaises herbes
US20070213813A1 (en) 2005-12-22 2007-09-13 Symetis Sa Stent-valves for valve replacement and associated methods and systems for surgery
WO2008063203A2 (fr) * 2006-01-27 2008-05-29 Whitehead Institute For Biomedical Research Compositions et méthodes de silençage efficace de gènes dans des végétaux
US8404928B2 (en) * 2006-08-31 2013-03-26 Monsanto Technology Llc Phased small RNAs
EP3378953A1 (fr) 2006-10-12 2018-09-26 Monsanto Technology LLC Micro-arn de plantes et leurs procédés d'utilisation
US7896915B2 (en) 2007-04-13 2011-03-01 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
WO2008143786A1 (fr) * 2007-05-14 2008-11-27 The Rockefeller University Production de microarns artificiels en utilisant des précurseurs de microarn synthétiques
US20100167948A1 (en) * 2007-05-22 2010-07-01 The Brigham And Women's Hospital, Inc. MicroRNA Expression Profiling of Cerebrospinal Fluid
US8937217B2 (en) * 2007-12-18 2015-01-20 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US8115055B2 (en) 2007-12-18 2012-02-14 E.I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
CN101952443B (zh) * 2007-12-21 2014-11-12 纳幕尔杜邦公司 涉及编码miR827的基因的耐旱植物、以及相关的构建体和方法
WO2011104269A1 (fr) 2008-02-26 2011-09-01 Jenavalve Technology Inc. Stent pour le positionnement et l'ancrage d'une prothèse valvulaire dans un site d'implantation dans le cœur d'un patient
US9044318B2 (en) 2008-02-26 2015-06-02 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis
US20110179525A1 (en) * 2008-07-11 2011-07-21 Rutgers, The State University Of New Jersey Compositions and methods for biofuel crops
EP2617388B2 (fr) 2008-10-10 2019-11-06 Boston Scientific Scimed, Inc. Dispositifs médicaux et systèmes de délivrance destinés à délivrer des dispositifs médicaux
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
WO2010123904A1 (fr) 2009-04-20 2010-10-28 Monsanto Technology Llc Résistance à de multiples virus dans des plantes
WO2010144058A1 (fr) 2009-06-10 2010-12-16 Temasek Life Sciences Laboratory Limited Silençage de gène induit par virus (vigs) pour l'analyse fonctionnelle de gènes dans le coton.
WO2011057333A1 (fr) * 2009-11-11 2011-05-19 La Trobe University Stérilité mâle de plante transgénique
US9744031B2 (en) 2010-05-25 2017-08-29 Jenavalve Technology, Inc. Prosthetic heart valve and endoprosthesis comprising a prosthetic heart valve and a stent
CN106073946B (zh) 2010-09-10 2022-01-04 西美蒂斯股份公司 瓣膜置换装置、用于瓣膜置换装置的递送装置以及瓣膜置换装置的生产方法
AR083029A1 (es) 2010-12-09 2013-01-23 Syngenta Participations Ag Metodos y composiciones que utilizan arn interferente pequeño (arnip) para el control de nematodos en plantas
EP2520251A1 (fr) 2011-05-05 2012-11-07 Symetis SA Procédé et appareil pour compresser des valvules d'endoprothèse
US9873765B2 (en) 2011-06-23 2018-01-23 Dsm Ip Assets, B.V. Biodegradable polyesteramide copolymers for drug delivery
RS61292B1 (sr) 2011-07-01 2021-02-26 Monsanto Technology Llc Postupci i jedinjenja za selektivnu regulaciju ekspresije belančevina
EP2744905B1 (fr) 2011-08-16 2016-08-03 Syngenta Participations AG Procédés et compositions pour introduire un arndb exogène dans des cellules végétales
BR112014006527A2 (pt) 2011-09-21 2017-03-28 Syngenta Participations Ag resistência patogênica
EP3190186B1 (fr) 2011-11-30 2023-12-13 Jörn Bullerdiek Expression des miarn dans le tissu placentaire
US20150089689A1 (en) 2012-01-23 2015-03-26 E I Du Pont Nemours And Company Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthetic genes
US9883941B2 (en) 2012-06-19 2018-02-06 Boston Scientific Scimed, Inc. Replacement heart valve
WO2013192256A1 (fr) 2012-06-22 2013-12-27 Syngenta Participations Ag Lutte biologique contre les coléoptères nuisibles
US20150307894A1 (en) 2012-11-28 2015-10-29 Monsanto Technology Llc Transgenic Plants With Enhanced Traits
PL226431B1 (pl) * 2013-08-23 2017-07-31 Inst Biochemii I Biofizyki Polskiej Akademii Nauk Cząsteczka miRNA do zastosowania do wytwarzania leku do zmniejszania reakcji zapalnej lub zapobiegania zwiększaniu się reakcji zapalnej organizmu
US9867694B2 (en) 2013-08-30 2018-01-16 Jenavalve Technology Inc. Radially collapsible frame for a prosthetic valve and method for manufacturing such a frame
CN107075500A (zh) * 2014-09-10 2017-08-18 新西兰植物和食品研究院有限公司 能改变果实大小的方法和材料
BR112017013528A2 (pt) 2014-12-23 2018-03-06 Syngenta Participations Ag controle biológico de pragas de coleópteros
WO2016126524A1 (fr) 2015-02-03 2016-08-11 Boston Scientific Scimed, Inc. Valve cardiaque prothétique à joint tubulaire
US10426617B2 (en) 2015-03-06 2019-10-01 Boston Scientific Scimed, Inc. Low profile valve locking mechanism and commissure assembly
EP3288495B1 (fr) 2015-05-01 2019-09-25 JenaValve Technology, Inc. Dispositif à débit réduit de stimulateur cardiaque lors d'un remplacement de valvules cardiaques
EP3454795B1 (fr) 2016-05-13 2023-01-11 JenaValve Technology, Inc. Système d'implantation de prothèse de valve cardiaque pour la pose d'une prothèse de valve cardiaque avec une gaine d'introduction et système de chargement
US10201416B2 (en) 2016-05-16 2019-02-12 Boston Scientific Scimed, Inc. Replacement heart valve implant with invertible leaflets
AR109206A1 (es) 2016-08-05 2018-11-07 Syngenta Participations Ag Control de plagas de coleópteros utilizando moléculas de arn
AR109205A1 (es) 2016-08-05 2018-11-07 Syngenta Participations Ag Control de plagas de coleópteros utilizando moléculas de arn
CN110072384B (zh) 2016-10-11 2024-03-12 科迪华农业科技有限责任公司 植物中转基因表达的调节
JP7094965B2 (ja) 2017-01-27 2022-07-04 イエナバルブ テクノロジー インク 心臓弁模倣
US10828154B2 (en) 2017-06-08 2020-11-10 Boston Scientific Scimed, Inc. Heart valve implant commissure support structure
WO2019028161A1 (fr) 2017-08-01 2019-02-07 Boston Scientific Scimed, Inc. Mécanisme de verrouillage d'implant médical
WO2019035966A1 (fr) 2017-08-16 2019-02-21 Boston Scientific Scimed, Inc. Ensemble commissure de valvule cardiaque de remplacement
AR113761A1 (es) 2017-10-18 2020-06-10 Syngenta Participations Ag Control de plagas de hemípteros utilizando moléculas de arn
WO2019144071A1 (fr) 2018-01-19 2019-07-25 Boston Scientific Scimed, Inc. Système de pose de dispositif médical à boucle de rétroaction
JP7055882B2 (ja) 2018-01-19 2022-04-18 ボストン サイエンティフィック サイムド，インコーポレイテッド トランスカテーテル弁システム用誘導モード留置センサ
US11147668B2 (en) 2018-02-07 2021-10-19 Boston Scientific Scimed, Inc. Medical device delivery system with alignment feature
WO2019165394A1 (fr) 2018-02-26 2019-08-29 Boston Scientific Scimed, Inc. Marqueur radio-opaque intégré dans un joint adaptatif
EP3793478A1 (fr) 2018-05-15 2021-03-24 Boston Scientific Scimed, Inc. Ensemble commissure de valvule cardiaque de remplacement
US11241310B2 (en) 2018-06-13 2022-02-08 Boston Scientific Scimed, Inc. Replacement heart valve delivery device
WO2020123486A1 (fr) 2018-12-10 2020-06-18 Boston Scientific Scimed, Inc. Système d'administration de dispositif médical comprenant un élément de résistance
US11439504B2 (en) 2019-05-10 2022-09-13 Boston Scientific Scimed, Inc. Replacement heart valve with improved cusp washout and reduced loading
MX2022009416A (es) 2020-01-31 2022-10-21 Regeneron Pharma Uso de cromatografía líquida y espectrometría de masas para caracterizar oligonucleótidos.
CN112094334A (zh) * 2020-10-20 2020-12-18 中国农业科学院作物科学研究所 GmDCL2a蛋白和GmDCL2b蛋白在调控大豆种皮颜色中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093441A2 (fr) * 2002-05-03 2003-11-13 Duke University Procede de regulation de l'expression genique

Family Cites Families (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5569597A (en) 1985-05-13 1996-10-29 Ciba Geigy Corp. Methods of inserting viral DNA into plant material
US5583024A (en) 1985-12-02 1996-12-10 The Regents Of The University Of California Recombinant expression of Coleoptera luciferase
US5268463A (en) 1986-11-11 1993-12-07 Jefferson Richard A Plant promoter α-glucuronidase gene construct
US5608142A (en) 1986-12-03 1997-03-04 Agracetus, Inc. Insecticidal cotton plants
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5990387A (en) 1988-06-10 1999-11-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US5023179A (en) 1988-11-14 1991-06-11 Eric Lam Promoter enhancer element for gene expression in plant roots
US5110732A (en) 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
KR920701453A (ko) 1989-03-17 1992-08-11 미리엄 디. 멕코나헤이 유전자발현의 외부조절
US5879918A (en) 1989-05-12 1999-03-09 Pioneer Hi-Bred International, Inc. Pretreatment of microprojectiles prior to using in a particle gun
US5240855A (en) 1989-05-12 1993-08-31 Pioneer Hi-Bred International, Inc. Particle gun
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
ATE225853T1 (de) 1990-04-12 2002-10-15 Syngenta Participations Ag Gewebe-spezifische promotoren
US5498830A (en) 1990-06-18 1996-03-12 Monsanto Company Decreased oil content in plant seeds
US5932782A (en) 1990-11-14 1999-08-03 Pioneer Hi-Bred International, Inc. Plant transformation method using agrobacterium species adhered to microprojectiles
US5459252A (en) 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5399680A (en) 1991-05-22 1995-03-21 The Salk Institute For Biological Studies Rice chitinase promoter
DE69230290T2 (de) 1991-08-27 2000-07-20 Novartis Ag Proteine mit insektiziden eigenschaften gegen homopteran insekten und ihre verwendung im pflanzenschutz
ZA927576B (en) 1991-10-04 1993-04-16 Univ North Carolina State Pathogen-resistant transgenic plants.
US5324646A (en) 1992-01-06 1994-06-28 Pioneer Hi-Bred International, Inc. Methods of regeneration of Medicago sativa and expressing foreign DNA in same
US5428148A (en) 1992-04-24 1995-06-27 Beckman Instruments, Inc. N4 - acylated cytidinyl compounds useful in oligonucleotide synthesis
US5401836A (en) 1992-07-16 1995-03-28 Pioneer Hi-Bre International, Inc. Brassica regulatory sequence for root-specific or root-abundant gene expression
CA2140910C (fr) 1992-07-27 1999-03-23 Jeffrey A. Townsend Methode amelioree de transformation via agrobacterium de cellules de soya en culture
IL108241A (en) 1992-12-30 2000-08-13 Biosource Genetics Corp Plant expression system comprising a defective tobamovirus replicon integrated into the plant chromosome and a helper virus
US5789156A (en) 1993-06-14 1998-08-04 Basf Ag Tetracycline-regulated transcriptional inhibitors
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5491084A (en) 1993-09-10 1996-02-13 The Trustees Of Columbia University In The City Of New York Uses of green-fluorescent protein
JP3810791B2 (ja) 1993-09-10 2006-08-16 ザ・トラスティーズ・オブ・コランビア・ユニバーシティー・イン・ザ・シティー・オブ・ニューヨーク 緑色蛍光タンパク質の使用
US5470353A (en) 1993-10-20 1995-11-28 Hollister Incorporated Post-operative thermal blanket
US5633363A (en) 1994-06-03 1997-05-27 Iowa State University, Research Foundation In Root preferential promoter
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5608144A (en) 1994-08-12 1997-03-04 Dna Plant Technology Corp. Plant group 2 promoters and uses thereof
US5750868A (en) 1994-12-08 1998-05-12 Pioneer Hi-Bred International, Inc. Reversible nuclear genetic system for male sterility in transgenic plants
US6143557A (en) 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
CA2226463A1 (fr) 1995-06-07 1996-12-19 Life Technologies, Inc. Clonage de recombinaison au moyen de sites recombinaison obtenus par genie genetique
US5837876A (en) 1995-07-28 1998-11-17 North Carolina State University Root cortex specific gene promoter
AR006928A1 (es) 1996-05-01 1999-09-29 Pioneer Hi Bred Int Una molecula de adn aislada que codifica una proteina fluorescente verde como marcador rastreable para la transformacion de plantas, un metodo para laproduccion de plantas transgenicas, un vector de expresion, una planta transgenica y celulas de dichas plantas.
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
WO1998001575A1 (fr) 1996-07-08 1998-01-15 Pioneer Hi-Bred International, Inc. Transformation de cellules de zygote, d'oeuf et de sperme et recuperation de plantes transformees dans des sacs embryonnaires isoles
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
WO1999005298A1 (fr) 1997-07-22 1999-02-04 Pioneer Hi-Bred International, Inc. Genes regulant un metabolisme de phytate dans des plantes et leurs utilisations
CN100342008C (zh) 1997-10-24 2007-10-10 茵维特罗根公司 利用具重组位点的核酸进行重组克隆
WO1999025854A1 (fr) 1997-11-18 1999-05-27 Pioneer Hi-Bred International, Inc. Procede de transformation stable et dirigee de cellules eucaryotes
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
CA2315546C (fr) 1998-02-26 2008-04-29 Pioneer Hi-Bred International, Inc. Promoteurs constitutifs du mais
EP1056862A1 (fr) 1998-02-26 2000-12-06 Pioneer Hi-Bred International, Inc. Famille de genes pr-1 et de promoteurs
US6271439B1 (en) * 1998-03-04 2001-08-07 Pioneer Hi-Bred International, Inc. Methods and compositions for regulating cell death and enhancing disease resistance to plant pathogens
NZ507093A (en) 1998-04-08 2003-08-29 Commw Scient Ind Res Org Methods and means for reducing the phenotypic expression of a nucleic acid of interest in a plant
AU5489099A (en) 1998-08-20 2000-03-14 Pioneer Hi-Bred International, Inc. Seed-preferred promoters
WO2000012733A1 (fr) 1998-08-28 2000-03-09 Pioneer Hi-Bred International, Inc. PROMOTEURS PREFERES DE SEMENCES PROVENANT DE GENES $i(END)
AU1086501A (en) 1999-10-15 2001-04-30 Carnegie Institution Of Washington Rna interference pathway genes as tools for targeted genetic interference
GB0002260D0 (en) 2000-02-02 2000-03-22 Laporte Performance Chemicals Lubricating oils
WO2003070918A2 (fr) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Inhibition mediee par interference arn d'une expression genique faisant appel a des acides nucleiques interferants courts chimiquement modifies (sina)
CA2401677A1 (fr) 2000-03-03 2001-09-13 University Of Utah Research Foundation Procede de ciblage genique
DK2796553T3 (da) * 2000-03-30 2019-09-30 Whitehead Inst Biomedical Res Rna-sekvensspecifikke formidlere af rna-interferens
ES2728168T3 (es) 2000-12-01 2019-10-22 Max Planck Gesellschaft Moléculas pequeñas de ARN que median en la interferencia de ARN
MXPA03006190A (es) 2001-01-12 2004-12-03 Pioneer Hi Bred Int Genes de quinasa polifosfato inositol novedosos y usos de los mismos.
IL159756A0 (en) 2001-07-12 2004-06-20 Univ Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
AU2002329667A1 (en) 2001-07-30 2003-02-17 Uta Griesenbach Specific inhibition of gene expression by small double stranded rnas
EP1961293A3 (fr) 2001-09-27 2009-01-28 Pioneer Hi-Bred International, Inc. Polynucléotides de phytate et procédés d'utilisation
BR0312580A (pt) 2002-07-10 2006-10-10 Univ Kansas State composições e métodos para controlar nematódeos parasitas
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
WO2004066183A2 (fr) 2003-01-22 2004-08-05 European Molecular Biology Laboratory Microarn
US8309704B2 (en) 2003-06-02 2012-11-13 University Of Massachusetts Methods and compositions for enhancing the efficacy and specificity of RNAi
EP1633767B1 (fr) 2003-06-02 2018-11-21 University of Massachusetts Procedes et compositions de commande de l'efficacite permettant de rendre silencieux un arn
CA2541914C (fr) * 2003-10-09 2012-07-24 E.I. Du Pont De Nemours And Company Extinction genique au moyen de molecules de microarn

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093441A2 (fr) * 2002-05-03 2003-11-13 Duke University Procede de regulation de l'expression genique

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AUKERMAN MILO J ET AL: "Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes." PLANT CELL, vol. 15, no. 11, November 2003 (2003-11), pages 2730-2741, XP002323691 ISSN: 1040-4651 *
DATABASE EMBL 16 January 1998 (1998-01-16), "T29B20TF TAMU Arabidopsis thaliana genomic clone T29B20, genomic survey sequence." XP002323692 retrieved from EBI Database accession no. B77795 *
PARK WONKEUN ET AL: "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" CURRENT BIOLOGY, vol. 12, no. 17, 3 September 2002 (2002-09-03), pages 1484-1495, XP002323690 ISSN: 0960-9822 cited in the application *
ZENG YAN ET AL: "Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells" MOLECULAR CELL, CELL PRESS, CAMBRIDGE, MA, US, vol. 9, no. 6, June 2002 (2002-06), pages 1327-1333, XP002296481 ISSN: 1097-2765 *

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8237017B2 (en) 2006-05-12 2012-08-07 Bayer Cropscience Nv Stress-related microRNA molecules and uses thereof
US8933297B2 (en) 2009-06-15 2015-01-13 Icon Genetics Gmbh Nicotiana benthamiana plants deficient in xylosyltransferase activity
WO2010145846A1 (fr) 2009-06-15 2010-12-23 Bayer Bioscience N.V. Plants de nicotinia benthamiana à activité xylosyltransférase déficiente
EP2551348A2 (fr) 2011-07-29 2013-01-30 Icon Genetics GmbH Production de N-glycanes galactosylatées dans des plantes
WO2013050155A1 (fr) 2011-10-04 2013-04-11 Icon Genetics Gmbh Plantes nicotiana benthamiana déficientes dans l'activité fucosyltransférase
WO2015000914A1 (fr) 2013-07-01 2015-01-08 Bayer Cropscience Nv Procédés et moyens pour moduler la durée de floraison de plantes monocotylédones
US11447791B2 (en) 2013-07-01 2022-09-20 Basf Se Methods and means for modulating flowering time in monocot plants
US10472645B2 (en) 2013-07-01 2019-11-12 Basf Se Methods and means for modulating flowering time in monocot plants
EP3431606A1 (fr) 2013-07-01 2019-01-23 Bayer CropScience NV Procédés et moyens pour moduler le temps de floraison dans des plantes monocotylédones
US10093907B2 (en) 2013-09-24 2018-10-09 Basf Se Hetero-transglycosylase and uses thereof
US10647965B2 (en) 2013-09-24 2020-05-12 Basf Se Hetero-transglycosylase and uses thereof
WO2016050512A1 (fr) 2014-10-03 2016-04-07 Bayer Cropscience Nv Procédés et moyens pour augmenter la tolérance au stress et la biomasse chez des plantes
WO2016113333A1 (fr) 2015-01-16 2016-07-21 Bayer Cropscience Nv Promoteurs préférentiels de gousses et leurs utilisations
WO2016128519A1 (fr) 2015-02-12 2016-08-18 Bayer Cropscience Nv Promoteurs préférentiels de l'apex de pousse et utilisations de ces promoteurs
US10844390B2 (en) 2015-08-07 2020-11-24 Basf Agricultural Solutions Seed, Us Llc Root-preferential and stress inducible promoter and uses thereof
US10975380B2 (en) 2016-04-11 2021-04-13 Basf Agricultural Solutions Seed, Us Llc Seed-specific and endosperm-preferental promoters and uses thereof
WO2017178322A1 (fr) 2016-04-11 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'endosperme et leurs utilisations
WO2017178318A1 (fr) 2016-04-11 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'endosperme et leurs utilisations
WO2017178368A1 (fr) 2016-04-13 2017-10-19 Bayer Cropscience Nv Promoteurs spécifiques des graines et préférentiels de l'embryon et leurs utilisations
US10900046B2 (en) 2016-04-13 2021-01-26 BASF Agricultural Solutions Seed US LLC Seed- and funiculus-preferential promoters and uses thereof
WO2017178367A1 (fr) 2016-04-13 2017-10-19 Bayer Cropscience Nv Promoteurs préférentiels des graines et du funicule et leurs utilisations
WO2018172181A1 (fr) 2017-03-23 2018-09-27 Bayer Cropscience Nv Promoteur spécifique de l'anthère et ses utilisations
US11542519B2 (en) 2017-03-23 2023-01-03 Basf Se Anther-specific promoter and uses thereof
WO2018217474A1 (fr) 2017-05-24 2018-11-29 Bayer Cropscience Lp Promoteur inductible par la rouille fongique
WO2019138083A1 (fr) 2018-01-12 2019-07-18 Basf Se Gène sous-jacent au nombre de qtl d'épillets par épi de blé sur le chromosome 7a
WO2020002152A2 (fr) 2018-06-27 2020-01-02 Basf Se Rubisco activase thermostable et utilisations associées
WO2021004838A2 (fr) 2019-07-05 2021-01-14 BASF Agricultural Solutions Seed US LLC Activase rubisco avec inhibition de l'adp réduite et utilisations correspondantes
WO2023052562A1 (fr) 2021-10-01 2023-04-06 Basf Se Plantes de blé avec un rendement accru
WO2023052561A1 (fr) 2021-10-01 2023-04-06 Basf Se Plantes présentant des propriétés améliorées
WO2024099765A2 (fr) 2022-11-10 2024-05-16 BASF Agricultural Solutions Seed US LLC Séquences nucléotidiques régulant la transcription et procédés d'utilisation

Also Published As

Publication number Publication date
CA2541970A1 (fr) 2005-06-09
WO2005052170A3 (fr) 2005-10-06
CA2541914C (fr) 2012-07-24
EP2361984A1 (fr) 2011-08-31
US20050138689A1 (en) 2005-06-23
WO2005035769A2 (fr) 2005-04-21
EP1711613B1 (fr) 2013-04-10
US20050120415A1 (en) 2005-06-02
WO2005035769A3 (fr) 2005-06-02
EP1711613A2 (fr) 2006-10-18
CA2541914A1 (fr) 2005-04-21
US20060218673A9 (en) 2006-09-28
US20140230088A1 (en) 2014-08-14
US20120144527A1 (en) 2012-06-07
AU2004280634A1 (en) 2005-04-21
US8729339B2 (en) 2014-05-20

Similar Documents

Publication Publication Date Title
EP1711613B1 (fr) Extinction genique au moyen de micro-molecules d'arn
EP1809748B1 (fr) Micro-arn
EP2222858B1 (fr) Régulation à la baisse de l'expression de gènes à l'aide de micro-ARN artificiels
US8981181B2 (en) Maize microrna sequences
US20160017349A1 (en) Maize microrna sequences and targets thereof for agronomic traits
US20080313773A1 (en) Production of artificial micrornas using synthetic microrna precursors
WO2014036048A1 (fr) Long arn non codant intergénique dans le maïs
ZA200703832B (en) Micrornas

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2541970

Country of ref document: CA

122 Ep: pct application non-entry in european phase