US20050138689A1 - Gene silencing - Google Patents

Gene silencing Download PDF


Publication number
US20050138689A1 US10963394 US96339404A US2005138689A1 US 20050138689 A1 US20050138689 A1 US 20050138689A1 US 10963394 US10963394 US 10963394 US 96339404 A US96339404 A US 96339404A US 2005138689 A1 US2005138689 A1 US 2005138689A1
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Application number
Other versions
US20060218673A9 (en )
Milo Aukerman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
E I du Pont de Nemours and Co
Original Assignee
E I du Pont de Nemours and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date




    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827Flower development or morphology, e.g. flowering promoting factor [FPF]


The invention provides methods and compositions useful in target sequence suppression and target sequence validation. The invention provides polynucleotide constructs useful for gene silencing, as well as cells, plants and seeds comprising the polynucleotides. The invention also provides a method for using microRNA to silence a target sequence.


  • This application claims the benefit of U.S. Provisional Application No. 60/509,958, filed Oct. 9, 2003. The entire contents of the above application is herein incorporated by reference.
  • The field of the present invention relates generally to plant molecular biology. More specifically it relates to constructs and methods to suppress the expression of targeted genes.
  • Reduction of the activity of specific genes (also known as gene silencing, or gene suppression) is desirable for several aspects of genetic engineering in plants. There is still a need for methods and constructs that induce gene suppression against a wide selection of target genes, and that result in effective silencing of the target gene at high efficiency.
  • FIG. 1. Predicted hairpin structure formed by the sequence surrounding miR172a-2. The mature microRNA is indicated by a grey box.
  • FIG. 2. miR172a-2 overexpression phenotype. a, Wild type (Columbia ecotype) plant, 3.5 weeks old. b, EAT-D plant, 3.5 weeks old. c, Wild type flower. d, EAT-D flower. Note absence of second whorl organs (petals). Arrow indicates sepal with ovules along the margins and stigmatic papillae at the tip. e, Cauline leaf margin from a 35S-EAT plant. Arrows indicate bundles of stigmatic papillae projecting from the margin. f, Solitary gynoecium (arrow) emerging from the axil of a cauline leaf of a 35S-EAT plant.
  • FIG. 3. The EAT gene contains a mRNA that is complementary to APETALA2 (AP2). a, Location of the EAT gene on chromosome 5. The T-DNA insertion and orientation of the 35S enhancers is indicated. The 21-nt sequence corresponding to miR172a-2 is shown below the EAT gene (SEQ ID NO: 86). b, Putative 21-nt miR172a-2/AP2 RNA duplex is shown below the gene structure of AP2. The GU wobble in the duplex is underlined. c, Alignment of AP221-nt region (black bar) and surrounding sequence with three other Arabidopsis AP2 family members, and with two maize AP2 genes (IDS1 and GL15). d, Alignment of miR172a-2 mRNA (black bar) and surrounding sequence with miR172-like sequences from Arabidopsis, tomato, soybean, potato and rice.
  • FIG. 4. miR172a-2 mRNA expression. a, Northern blot of total RNA from wild type (lanes 3 and 7) and EAT-D (lanes 4 and 8). Blots were probed with sense (lanes 1-4) or antisense (lanes 5-8) oligo to miR172a-2 mRNA. 100 pg of sense oligo (lanes 2 and 6) and antisense oligo (lanes 1 and 5) were loaded as hybridization controls. Nucleotide size markers are indicated on the left. b, S1 nuclease mapping of miR172a-2 mRNA. A 5′-end-labeled probe undigested (lane 1) or digested after hybridization to total RNA from wild-type (lane 2), EAT-D (lane 3), or tRNA (lane 4).
  • FIG. 5. Developmental expression pattern of miR172 family members. a, RT-PCR of total RNA from wild type seedlings harvested at 2, 5, 12, and 21 days after germination (lanes 1-4, respectively), or from mature leaves (lane 5) and floral buds (lane 6). Primers for PCR are indicated on the left. b, Northern analysis of mirR172 expression in the indicated mutants, relative to wild type (Col). Blot was probed with an oligo to miR172a-2; however, all miR172 members should cross hybridize.
  • FIG. 6. Expression analysis of putative EAT target genes. a, Northern blot analysis of polyA+ RNA isolated from wild type (Col) or EAT-D floral buds. Probes for hybridization are indicated on the right. b, Western blot of proteins from wild type or EAT-D floral buds, probed with AP2 antibody. RbcL, large subunit of ribulose 1,5-bisphosphate carboxylase as loading control.
  • FIG. 7. Identification of LAT-D. a, Location of the T-DNA insert in LAT-D, in between At2g28550 and At2g28560. The 4×35S enhancers are approximately 5 kb from At2g28550. b, RT-PCR analysis of At2g28550 expression in wild type versus LAT-D plants.
  • FIG. 8. EAT-D is epistatic to LAT-D. Genetic cross between EAT-D and LAT-D plants, with the resultant F1 plants shown, along with their flowering time (measured as rosette leaf number).
  • FIG. 9. Loss-of-function At2g28550 (2-28550) and At5g60120 (6-60120) mutants. Location of T-DNA in each line is indicated, along with intron/exon structure.
  • FIG. 10. Potential function of the miR172 mRNA family. a, Temporal expression of miR172a-2 and its relatives may cause temporal downregulation of AP2 targets (e.g. At2g28550 and At5g60120), which may trigger flowering once the target proteins drop below a critical threshold (dotted line). b, Dicer cleavage at various positions may generate at least four distinct mRNAs from the miR172 family (indicated as a single hairpin with a mRNA consensus sequence). Sequences at the 5′ and 3′ ends of each mRNA are indicated, with the invariant middle 15 nt shown as ellipses. The putative targets recognized by the individual mRNAs are in parentheses below each.
  • The invention provides methods and compositions useful in target sequence suppression and target sequence validation. The invention provides polynucleotide constructs useful for gene silencing, as well as cells, plants and seeds comprising the polynucleotides. The invention also provides a method for using microRNA to silence a target sequence.
  • Recently discovered small RNAs play an important role in controlling gene expression. Regulation of many developmental processes including flowering is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
  • The invention provides methods and compositions useful for suppressing targeted sequences. The compositions can be employed in any type of plant cell, and in other cells which comprise the appropriate processing components (e.g., RNA interference components), including invertebrate and vertebrate animal cells. The compositions and methods are based on an endogenous mRNA silencing process discovered in Arabidopsis, a similar strategy can be used to extend the number of compositions and the organisms in which the methods are used. The methods can be adapted to work in any eukaryotic cell system. Additionally, the compositions and methods described herein can be used in individual cells, cells or tissue in culture, or in vivo in organisms, or in organs or other portions of organisms.
  • The compositions selectively suppress the target sequence by encoding a mRNA having substantial complementarity to a region of the target sequence. The mRNA is provided in a nucleic acid construct which, when transcribed into RNA, is predicted to form a hairpin structure which is processed by the cell to generate the mRNA, which then suppresses expression of the target sequence.
  • A nucleic acid construct is provided to encode the mRNA for any specific target sequence. Any mRNA can be inserted into the construct, such that the encoded mRNA selectively targets and suppresses the target sequence. The construct is modeled on the EAT (mir-172a) mRNA precursor from Arabidopsis.
  • A method for suppressing a target sequence is provided. The method employs the constructs above, in which a mRNA is designed to a region of the target sequence, and inserted into the construct. Upon introduction into a cell, the mRNA produced suppresses expression of the targeted sequence. The target sequence can be an endogenous plant sequence, or a heterologous transgene in the plant. The target gene may also be a gene from a plant pathogen, such as a pathogenic virus, nematode, insect, or mold or fungus.
  • A plant, cell, and seed comprising the construct and/or the mRNA is provided. Typically, the cell will be a cell from a plant, but other prokaryotic or eukaryotic cells are also contemplated, including but not limited to viral, bacterial, yeast, insect, nematode, or animal cells. Plant cells include cells from monocots and dicots. The invention also provides plants and seeds comprising the construct and/or the mRNA.
  • Units, prefixes, and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively. Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range. Amino acids may be referred to herein by either commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. Unless otherwise provided for, software, electrical, and electronics terms as used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Terms (5th edition, 1993). The terms defined below are more fully defined by reference to the specification as a whole.
  • As used herein, “nucleic acid construct” or “construct” refers to an isolated polynucleotide which is introduced into a host cell. This construct may comprise any combination of deoxyribonucleotides, ribonucleotides, and/or modified nucleotides. The construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure. This construct may be expressed in the cell, or isolated or synthetically produced. The construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.
  • As used here “suppression” or “silencing” or “inhibition” are used interchangeably to denote the down-regulation of the expression of the product of a target sequence relative to its normal expression level in a wild type organism. Suppression includes expression that is decreased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% relative to the wild type expression level.
  • As used herein, “encodes” or “encoding” refers to a DNA sequence which can be processed to generate an RNA and/or polypeptide.
  • As used herein, “expression” or “expressing” refers to the generation of an RNA transcript from an introduced construct, an endogenous DNA sequence, or a stably incorporated heterologous DNA sequence. The term may also refer to a polypeptide produced from an mRNA generated from any of the above DNA precursors.
  • As used herein, “heterologous” in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or is synthetically designed, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. A heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
  • By “host cell” is meant a cell which contains an introduced nucleic acid construct and supports the replication and/or expression of the construct. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as fungi, yeast, insect, amphibian, nematode, or mammalian cells. Alternatively, the host cells are monocotyledonous or dicotyledonous plant cells. An example of a monocotyledonous host cell is a maize host cell.
  • The term “introduced” means providing a nucleic acid or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing.
  • The term “isolated” refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components which normally accompany or interact with the material as found in its naturally occurring environment or (2) if the material is in its natural environment, the material has been altered by deliberate human intervention to a composition and/or placed at a locus in the cell other than the locus native to the material.
  • As used herein, “mRNA” refers to an oligoribonucleic acid, which suppresses expression of a polynucleotide comprising the target sequence transcript. A “mRNA precursor” refers to a larger polynucleotide which is processed to produce a mature mRNA, and includes a DNA which encodes an RNA precursor, and an RNA transcript comprising the mRNA. A “mature mRNA” refers to the mRNA generated from the processing of a mRNA precursor. A “mRNA template” is an oligonucleotide region, or regions, in a nucleic acid construct which encodes the mRNA. The “backside” region of a mRNA is a portion of a polynucleotide construct which is substantially complementary to the mRNA template and is predicted to base pair with the mRNA template. The mRNA template and backside may form a double-stranded polynucleotide, including a hairpin structure.
  • As used herein, the phrases “target sequence” and “sequence of interest” are used interchangeably. Target sequence is used to mean the nucleic acid sequence that is selected for suppression of expression, and is not limited to polynucleotides encoding polypeptides. The target sequence comprises a sequence that is substantially or completely complementary to the mRNA. The target sequence can be RNA or DNA, and may also refer to a polynucleotide comprising the target sequence.
  • As used herein, “nucleic acid” means a polynucleotide and includes single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides.
  • By “nucleic acid library” is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism or of a tissue from that organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et al., Molecular Cloning—A Laboratory Manual, 2nd ed., Vol. 1-3 (1989); and Current Protocols in Molecular Biology, F. M. Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994).
  • As used herein “operably linked” includes reference to a functional linkage of at least two sequences. Operably linked includes linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
  • As used herein, “plant” includes plants and plant parts including but not limited to plant cells, plant tissue such as leaves, stems, roots, flowers, and seeds.
  • As used herein, “polypeptide” means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences. The polypeptide can be glycosylated or not.
  • As used herein, “promoter” includes reference to a region of DNA that is involved in recognition and binding of an RNA polymerase and other proteins to initiate transcription.
  • The term “selectively hybridizes” includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
  • The term “stringent conditions” or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
  • Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C., and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
  • Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 138:267-284 (1984): Tm=81.5° C.+16.6 (log M)+0.41 (% GC)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ≧90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays”, Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995). Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
  • As used herein, “transgenic” includes reference to a plant or a cell which comprises a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term “transgenic” as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
  • As used herein, “vector” includes reference to a nucleic acid used in introduction of a polynucleotide of the invention into a host cell. Expression vectors permit transcription of a nucleic acid inserted therein.
  • Polynucleotide sequences may have substantial identity, substantial homology, or substantial complementarity to the selected region of the target gene. As used herein “substantial identity”, and “substantial homology” indicate sequences that have sequence identity or homology to each other. Generally, sequences that are substantially identical or substantially homologous will have about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity wherein the percent sequence identity is based on the entire sequence and is determined by GAP alignment using default parameters (GCG, GAP version 10, Accelrys, San Diego, Calif.). GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of sequence gaps. Sequences which have 100% identity are identical. “Substantial complementarity” refers to sequences that are complementary to each other, and are able to base pair with each other. In describing complementary sequences, if all the nucleotides in the first sequence will base pair to the second sequence, these sequences are fully complementary.
  • Through a forward genetics approach, a microRNA that confers a developmental phenotype in Arabidopsis was identified. This mRNA, miR172a-2 (Park et al., Curr. Biol. 12:1484-1495 2002), causes early flowering and defects in floral organ identity when overexpressed. The predicted target of miR172a-2 is a small subfamily of APETALA2-like transcription factors (Okamuro et al. 1997). Overexpression of miR172a-2 downregulates at least one member of this family. In addition, overexpression of one of the AP2-like target genes, At2g28550, causes late flowering. This result, in conjunction with loss-of-function analyses of At2g28550 and another target gene, At5g60120, indicates that at least some of the AP2-like genes targeted by miR172a-2 normally function as floral repressors. The EAT-D line overexpressing miR172-a2 has a wild-type response to photoperiod. The genomic region encoding the mRNA was also identified (SEQ ID NO: 1) and used to produce a cassette into which other mRNAs to target sequences can be inserted (SEQ ID NO: 3), and to produce an expression vector (SEQ ID NO: 44) useful for cloning the cassettes and expressing the mRNA. The expression vector comprises the 1.4 kb region encoding the mRNA. Expression of this region is processed in the cell to produce the mRNA which suppresses expression of the target gene. Alternatively, the mRNA may be synthetically produced and introduced to the cell directly.
  • In one embodiment, there is provided a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a mRNA substantially complementary to the target. In some embodiments the mRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides. In some embodiments the nucleic acid construct encodes the mRNA. In some embodiments the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the mRNA. In some embodiments, nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the mRNA template and the mRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • In some embodiments, the nucleic acid construct comprises a modified endogenous plant mRNA precursor, wherein the precursor has been modified to replace the endogenous mRNA encoding regions with sequences designed to produce a mRNA directed to the target sequence. In some embodiments the mRNA precursor template is a miR172a mRNA precursor. In some embodiments, the miR172a precursor is from a dicot or a monocot. In some embodiments the mRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • In another embodiment the method comprises:
  • A method of inhibiting expression of a target sequence in a cell comprising:
      • (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order:
        • (i) at least about 20 contiguous nucleotides in the region of nucleotides 1-38 of SEQ ID NO: 3,
        • (ii) a first oligonucleotide of 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide,
        • (iii) at least about 20 contiguous nucleotides in the region of nucleotides 60-106 of SEQ ID NO: 3,
        • (iv) the second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and the second oligonucleotide is substantially complementary to the target sequence, and
        • (v) at least about 20 contiguous nucleotides in the region of nucleotides 128-159 of SEQ ID NO:3;
          wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin, and
      • (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  • In another embodiment the method comprises:
  • A method of inhibiting expression of a gene comprising a target sequence in a cell comprising:
      • (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order:
        • (i) nucleotides 1-38 of SEQ ID NO: 3,
        • (ii) a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide,
        • (iii) nucleotides 60-106 of SEQ ID NO: 3,
        • (iv) the second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and wherein the second oligonucleotide is substantially complementary to the target sequence, and
        • (v) nucleotides 128-159 of SEQ ID NO:3;
          wherein polynucleotide encodes an RNA precursor capable of forming a hairpin, and
      • (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  • In another embodiment, the method comprises selecting a target sequence of a gene, and designing a nucleic acid construct comprising polynucleotide encoding a mRNA substantially complementary to the target sequence. In some embodiments, the target sequence is selected from any region of the gene. In some embodiments, the target sequence is selected from an untranslated region. In some embodiments, the target sequence is selected from a coding region of the gene. In some embodiments, the target sequence is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon. In further embodiments, the target sequence and/or the mRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like genes in Arabidopsis thaliana. In some embodiments, nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the mRNA template (first oligonucleotide) and the mRNA template (second oligonucleotide) respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • In some embodiments, the mRNA template, (i.e. the polynucleotide encoding the mRNA), and thereby the mRNA, may comprise some mismatches relative to the target sequence. In some embodiments the mRNA template has ≧1 nucleotide mismatch as compared to the target sequence, for example, the mRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the mRNA template to the complement of the target sequence. For example, the mRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
  • In some embodiments, the mRNA template, (i.e. the polynucleotide encoding the mRNA) and thereby the mRNA, may comprise some mismatches relative to the mRNA backside. In some embodiments the mRNA template has ≧1 nucleotide mismatch as compared to the mRNA backside, for example, the mRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the mRNA backside. This degree of mismatch may also be described by determining the percent identity of the mRNA template to the complement of the mRNA backside. For example, the mRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the mRNA backside.
  • In some embodiments, the target sequence is selected from a plant pathogen. Plants or cells comprising a mRNA directed to the target sequence of the pathogen are expected to have decreased sensitivity and/or increased resistance to the pathogen. In some embodiments, the mRNA is encoded by a nucleic acid construct further comprising an operably linked promoter. In some embodiments, the promoter is a pathogen-inducible promoter.
  • In another embodiment, the method comprises replacing the mRNA encoding sequence in the polynucleotide of SEQ ID NO: 3 with a sequence encoding a mRNA substantially complementary to the target region of the target gene.
  • In another embodiment a method is provided comprising a method of inhibiting expression of a target sequence in a cell comprising:
      • (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
      • (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  • In another embodiment a method is provided comprising a method of inhibiting expression of a target sequence in a cell comprising:
      • (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miR172 mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
      • (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  • In another embodiment a method is provided comprising a method of inhibiting expression of a target sequence in a cell comprising:
      • (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified Arabidopsis miR172 mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
      • (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  • In another embodiment, there is provided a nucleic acid construct for suppressing a target sequence. The nucleic acid construct encodes a mRNA substantially complementary to the target. In some embodiments, the nucleic acid construct further comprises a promoter operably linked to the polynucleotide encoding the mRNA. In some embodiments, the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome. In some embodiments, the nucleic acid construct is integrated using recombination, including site-specific recombination. See, for example, WO 99/25821, herein incorporated by reference. In some embodiments, the nucleic acid construct is an RNA. In some embodiments, the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • In some embodiments, the nucleic acid construct comprises a modified endogenous plant mRNA precursor, wherein the precursor has been modified to replace the mRNA encoding region with a sequence designed to produce a mRNA directed to the target sequence. In some embodiments the mRNA precursor template is a miR172a mRNA precursor. In some embodiments, the miR172a precursor is from a dicot or a monocot. In some embodiments the miR172a precursor is from Arabidopsis thaliana, tomato, soybean, rice, or corn. In some embodiments the mRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • In another embodiment, the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • In another embodiment, the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miR172 mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • In another embodiment, the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified Arabidopsis miR172 mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • In some embodiments the mRNA comprises about 10-200 nucleotides, about 10-15,15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides. In some embodiments the nucleic acid construct encodes the mRNA. In some embodiments the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the mRNA. In some embodiments, nucleotides 39-59 and/or 107-127 of SEQ ID NO: 3 are replaced by the backside of the mRNA template and the mRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 44. In some embodiments, the target region is selected from any region of the target sequence. In some embodiments, the target region is selected from a untranslated region. In some embodiments, the target region is selected from a coding region of the target sequence. In some embodiments, the target region is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon. In further embodiments, the target region and/or the mRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like sequences in Arabidopsis thaliana.
  • In another embodiment the nucleic acid construct comprises an isolated polynucleotide comprising in the following order at least 20 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, at least about 20 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and the second oligonucleotide is substantially complementary to the target sequence, and at least about 20 contiguous nucleotides in the region from nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin structure.
  • In another embodiment the nucleic acid construct comprises an isolated polynucleotide comprising in the following order nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and the second oligonucleotide is substantially complementary to the target sequence, and nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin.
  • In some embodiments there are provided cells, plants, and seeds comprising the introduced polynucleotides, and/or produced by the methods of the invention. The cells include prokaryotic and eukaryotic cells, including but not limited to bacteria, yeast, fungi, viral, invertebrate, vertebrate, and plant cells. Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, for example, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis, and tobacco.
  • In some embodiments, the cells, plants, and/or seeds comprise a nucleic acid construct comprising a modified plant mRNA precursor, wherein the precursor has been modified to replace the endogenous mRNA encoding regions with sequences designed to produce a mRNA directed to the target sequence. In some embodiments the mRNA precursor template is a miR172a mRNA precursor. In some embodiments, the miR172a precursor is from a dicot or a monocot. In some embodiments the miR172a precursor is from Arabidopsis thaliana. In some embodiments the mRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44. In some embodiments the mRNA precursor is encoded by SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44. In some embodiments, the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • The present invention concerns methods and compositions useful in suppression of a target sequence and/or validation of function. The invention also relates to a method for using microRNA (mRNA) mediated RNA interference (RNAi) to silence or suppress a target sequence to evaluate function, or to validate a target sequence for phenotypic effect and/or trait development. Specifically, the invention relates to constructs comprising small nucleic acid molecules, mRNAs, capable of inducing silencing, and methods of using these mRNAs to selectively silence target sequences.
  • RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., Nature 391:806 1998). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 1999). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
  • The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., Nature 409:363 2001). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al., Genes Dev. 15:188 2001). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science 293:834). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al., Genes Dev. 15:188 2001). In addition, RNA interference can also involve small RNA (e.g., microRNA, or mRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, Science 297:1818-1819 2002; Volpe et al., Science 297:1833-1837 2002; Jenuwein, Science 297:2215-2218 2002; and Hall et al., Science 297:2232-2237 2002). As such, mRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al. (Nature 391:806 1998) were the first to observe RNAi in C. elegans. Wianny and Goetz (Nature Cell Biol. 2:70 1999) describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. (Nature 404:293 2000) describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., (Nature 411:494 2001) describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
  • Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
  • It is thought that sequence complementarity between small RNAs and their RNA targets helps to determine which mechanism, RNA cleavage or translational inhibition, is employed. It is believed that siRNAs, which are perfectly complementary with their targets, work by RNA cleavage. Some mRNAs have perfect or near-perfect complementarity with their targets, and RNA cleavage has been demonstrated for at least a few of these mRNAs. Other mRNAs have several mismatches with their targets, and apparently inhibit their targets at the translational level. Again, without being held to a particular theory on the mechanism of action, a general rule is emerging that perfect or near-perfect complementarity favors RNA cleavage, whereas translational inhibition is favored when the mRNA/target duplex contains many mismatches. The apparent exception to this is microRNA 172 (miR172) in plants. One of the targets of miR172 is APETALA2 (AP2), and although miR172 shares near-perfect complementarity with AP2 it appears to cause translational inhibition of AP2 rather than RNA cleavage.
  • MicroRNAs (mRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 2001, Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et al., Science 294:858-862 2001; Lee and Ambros, Science 294:862-864 2001; Llave et al., Plant Cell 14:1605-1619 2002; Mourelatos et al., Genes. Dev. 16:720-728 2002; Park et al., Curr. Biol. 12:1484-1495 2002; Reinhart et al., Genes. Dev. 16:1616-1626 2002). They are processed from longer precursor transcripts that range in size from approximately 70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures. In animals, the enzyme involved in processing mRNA precursors is called Dicer, an RNAse III-like protein (Grishok et al., Cell 106:23-34 2001; Hutvagner et al., Science 293:834-838 2001; Ketting et al., Genes. Dev. 15:2654-2659 2001). Plants also have a Dicer-like enzyme, DCL1 (previously named CARPEL FACTORY/SHORT INTEGUMENTS1/SUSPENSOR1), and recent evidence indicates that it, like Dicer, is involved in processing the hairpin precursors to generate mature mRNAs (Park et al., Curr. Biol. 12:1484-1495 2002; Reinhart et al., Genes. Dev. 16:1616-1626 2002). Furthermore, it is becoming clear from recent work that at least some mRNA hairpin precursors originate as longer polyadenylated transcripts, and several different mRNAs and associated hairpins can be present in a single transcript (Lagos-Quintana et al., Science 294:853-858 2001; Lee et al., EMBO J. 21:4663-4670 2002).
  • In animals, there is direct evidence indicating a role for specific mRNAs in development. The lin-4 and let-7 mRNAs in C. elegans have been found to control temporal development, based on the phenotypes generated when the genes producing the lin-4 and let-7 mRNAs are mutated (Lee et al., Cell 75:843-854 1993; Reinhart et al., Nature 403-901-906 2000). In addition, both mRNAs display a temporal expression pattern consistent with their roles in developmental timing. Other animal mRNAs display developmentally regulated patterns of expression, both temporal and tissue-specific (Lagos-Quintana et al., Science 294:853-853 2001, Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et al., Science 294:858-862 2001; Lee and Ambros, Science 294:862-864 2001), leading to the hypothesis that mRNAs may, in many cases, be involved in the regulation of important developmental processes. Likewise, in plants, the differential expression patterns of many mRNAs suggests a role in development (Llave et al., Plant Cell 14:1605-1619 2002; Park et al., Curr. Biol. 12:1484-1495 2002; Reinhart et al., Genes. Dev. 16:1616-1626 2002). However, a developmental role for mRNAs has not been directly proven in plants, because to date there has been no report of a developmental phenotype associated with a specific plant mRNA.
  • MicroRNAs appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. In the case of lin-4 and let-7, the target sites are located in the 3′ UTRs of the target mRNAs (Lee et al., Cell 75:843-854 1993; Wightman et al., Cell 75:855-862 1993; Reinhart et al., Nature 403:901-906 2000; Slack et al., Mol. Cell 5:659-669 2000), and there are several mismatches between the lin-4 and let-7 mRNAs and their target sites. Binding of the lin-4 or let-7 mRNA appears to cause downregulation of steady-state levels of the protein encoded by the target mRNA without affecting the transcript itself (Olsen and Ambros, Dev. Biol. 216:671-680 1999). On the other hand, recent evidence suggests that mRNAs can, in some cases, cause specific RNA cleavage of the target transcript within the target site, and this cleavage step appears to require 100% complementarity between the mRNA and the target transcript (Hutvagner and Zamore, Science 297:2056-2060 2002; Llave et al., Plant Cell 14:1605-1619 2002). It seems likely that mRNAs can enter at least two pathways of target gene regulation: Protein downregulation when target complementarity is <100%, and RNA cleavage when target complementarity is 100%. MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants (Hamilton and Baulcombe 1999; Hammond et al., 2000; Zamore et al., 2000; Elbashir et al., 2001), and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
  • Identifying the targets of mRNAs with bioinformatics has not been successful in animals, and this is probably due to the fact that animal mRNAs have a low degree of complementarity with their targets. On the other hand, bioinformatic approaches have been successfully used to predict targets for plant mRNAs (Llave et al., Plant Cell 14:1605-1619 2002; Park et al., Curr. Biol. 12:1484-1495 2002; Rhoades et al., Cell 110:513-520 2002), and thus it appears that plant mRNAs have higher overall complementarity with their putative targets than do animal mRNAs. Most of these predicted target transcripts of plant mRNAs encode members of transcription factor families implicated in plant developmental patterning or cell differentiation. Nonetheless, biological function has not been directly demonstrated for any plant mRNA. Although Llave et al. (Science 297:2053-2056 2002) have shown that a transcript for a SCARECROW-like transcription factor is a target of the Arabidopsis mRNA mir171, these studies were performed in a heterologous species and no plant phenotype associated with mir171 was reported.
  • The methods provided can be practiced in any organism in which a method of transformation is available, and for which there is at least some sequence information for the target sequence, or for a region flanking the target sequence of interest. It is also understood that two or more sequences could be targeted by sequential transformation, co-transformation with more than one targeting vector, or the construction of a DNA construct comprising more than one mRNA sequence. The methods of the invention may also be implemented by a combinatorial nucleic acid library construction in order to generate a library of mRNAs directed to random target sequences. The library of mRNAs could be used for high-throughput screening for gene function validation.
  • General categories of sequences of interest include, for example, those genes involved in regulation or information, such as zinc fingers, transcription factors, homeotic genes, or cell cycle and cell death modulators, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
  • Target sequences further include coding regions and non-coding regions such as promoters, enhancers, terminators, introns and the like, which may be modified in order to alter the expression of a gene of interest. For example, an intron sequence can be added to the 5′ region to increase the amount of mature message that accumulates (see for example Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); and Callis et al., Genes Dev. 1:1183-1200 (1987)).
  • The target sequence may be an endogenous sequence, or may be an introduced heterologous sequence, or transgene. For example, the methods may be used to alter the regulation or expression of a transgene, or to remove a transgene or other introduced sequence such as an introduced site-specific recombination site. The target sequence may also be a sequence from a pathogen, for example, the target sequence may be from a plant pathogen such as a virus, a mold or fungus, an insect, or a nematode. A mRNA could be expressed in a plant which, upon infection or infestation, would target the pathogen and confer some degree of resistance to the plant.
  • In plants, other categories of target sequences include genes affecting agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest also included those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting, for example, kernel size, sucrose loading, and the like. The quality of grain is reflected in traits such as levels and types of oils, saturated and unsaturated, quality and quantity of essential amino acids, and levels of cellulose. For example, genes of the phytic acid biosynthetic pathway could be suppressed to generate a high available phosphorous phenotype. See, for example, phytic acid biosynthetic enzymes including inositol polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324, inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides, disclosed in WO 03/027243, and myo-inositol 1-phosphate synthase and other phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all of which are herein incorporated by reference. Genes in the lignification pathway could be suppressed to enhance digestibility or energy availability. Genes affecting cell cycle or cell death could be suppressed to affect growth or stress response. Genes affecting DNA repair and/or recombination could be suppressed to increase genetic variability. Genes affecting flowering time could be suppressed, as well as genes affecting fertility. Any target sequence could be suppressed in order to evaluate or confirm its role in a particular trait or phenotype, or to dissect a molecular, regulatory, biochemical, or proteomic pathway or network.
  • A number of promoters can be used, these promoters can be selected based on the desired outcome. It is recognized that different applications will be enhanced by the use of different promoters in plant expression cassettes to modulate the timing, location and/or level of expression of the mRNA. Such plant expression cassettes may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • Constitutive, tissue-preferred or inducible promoters can be employed. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1′- or 2′-promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP1-8 promoter and other transcription initiation regions from various plant genes known to those of skill. If low level expression is desired, weak promoter(s) may be used. Weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142. See also, U.S. Pat. No. 6,177,611, herein incorporated by reference.
  • Examples of inducible promoters are the Adh1 promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, the PPDK promoter and the pepcarboxylase promoter which are both inducible by light. Also useful are promoters which are chemically inducible, such as the In2-2 promoter which is safener induced (U.S. Pat. No. 5,364,780), the ERE promoter which is estrogen induced, and the Axig1 promoter which is auxin induced and tapetum specific but also active in callus (PCT US01/22169).
  • Examples of promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers. An exemplary promoter is the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051). Examples of seed-preferred promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter, Boronat, A. et al. (1986) Plant Sci. 47:95-102; Reina, M. et al. Nucl. Acids Res. 18(21):6426; and Kloesgen, R. B. et al. (1986) Mol. Gen. Genet. 203:237-244. Promoters that express in the embryo, pericarp, and endosperm are disclosed in U.S. Pat. No. 6,225,529 and PCT publication WO 00/12733. The disclosures each of these are incorporated herein by reference in their entirety.
  • In some embodiments it will be beneficial to express the gene from an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.
  • Of interest are promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et al. (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol. Plant Path. 41:189-200).
  • Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the constructions of the polynucleotides. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotech. 14:494498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Lett. 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like, herein incorporated by reference.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
  • Tissue-preferred promoters can be utilized to target enhanced expression of a sequence of interest within a particular plant tissue. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.
  • Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590. In addition, the promoters of cab and ribisco can also be used. See, for example, Simpson et al. (1958) EMBO J 4:2723-2729 and Timko et al. (1988) Nature 318:57-58.
  • Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al. (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a β-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed roIC and roID root-inducing genes of Agrobacterium rhizogenes (see Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teeri et al. (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2′ gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The TR1′ gene, fused to nptII (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol. Biol. 29(4):759-772); and roIB promoter (Capana et al. (1994) Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179. The phaseolin gene (Murai et al. (1983) Science 23:476-482 and Sengopta-Gopalen et al. (1988) PNAS 82:3320-3324.
  • Transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing the DNA construct include microinjection (Crossway et al. (1986) Biotechniques 4:320-334; and U.S. Pat. No. 6,300,543), sexual crossing, electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al., U.S. Pat. No. 5,563,055; and U.S. Pat. No. 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford et al., U.S. Pat. No. 4,945,050; Tomes et al., U.S. Pat. No. 5,879,918; Tomes et al., U.S. Pat. No. 5,886,244; Bidney et al., U.S. Pat. No. 5,932,782; Tomes et al. (1995) “Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment,” in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6:923-926). Also see Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); Tomes, U.S. Pat. No. 5,240,855; Buising et al., U.S. Pat. Nos. 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; Bowen et al., U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); and U.S. Pat. No. 5,736,369 (meristem transformation), all of which are herein incorporated by reference.
  • The nucleotide constructs may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that useful promoters encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing nucleotide constructs into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931; herein incorporated by reference.
  • In some embodiments, transient expression may be desired. In those cases, standard transient transformation techniques may be used. Such methods include, but are not limited to viral transformation methods, and microinjection of DNA or RNA, as well other methods well known in the art.
  • The cells from the plants that have stably incorporated the nucleotide sequence may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic imparted by the nucleotide sequence of interest and/or the genetic markers contained within the target site or transfer cassette. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved.
  • Initial identification and selection of cells and/or plants comprising the DNA constructs may be facilitated by the use of marker genes. Gene targeting can be performed without selection if there is a sensitive method for identifying recombinants, for example if the targeted gene modification can be easily detected by PCR analysis, or if it results in a certain phenotype. However, in most cases, identification of gene targeting events will be facilitated by the use of markers. Useful markers include positive and negative selectable markers as well as markers that facilitate screening, such as visual markers. Selectable markers include genes carrying resistance to an antibiotic such as spectinomycin (e.g. the aada gene, Svab et al. 1990 Plant Mol. Biol. 14:197), streptomycin (e.g., aada, or SPT, Svab et al. 1990 Plant Mol. Biol. 14:197; Jones et al. 1987 Mol. Gen. Genet. 210:86), kanamycin (e.g., nptII, Fraley et al. 1983 PNAS 80:4803), hygromycin (e.g., HPT, Vanden Elzen et al. 1985 Plant Mol. Biol. 5:299), gentamycin (Hayford et al. 1988 Plant Physiol. 86:1216), phleomycin, zeocin, or bleomycin (Hille et al. 1986 Plant Mol. Biol. 7:171), or resistance to a herbicide such as phosphinothricin (bar gene), or sulfonylurea (acetolactate synthase (ALS)) (Charest et al. (1990) Plant Cell Rep. 8:643), genes that fulfill a growth requirement on an incomplete media such as HIS3, LEU2, URA3, LYS2, and TRP1 genes in yeast, and other such genes known in the art. Negative selectable markers include cytosine deaminase (codA) (Stougaard 1993 Plant J. 3:755-761), tms2 (DePicker et al. 1988 Plant Cell Rep. 7:63-66), nitrate reductase (Nussame et al. 1991 Plant J. 1:267-274), SU1 (O'Keefe et al. 1994 Plant Physiol. 105:473-482), aux-2 from the Ti plasmid of Agrobacterium, and thymidine kinase. Screenable markers include fluorescent proteins such as green fluorescent protein (GFP) (Chalfie et al., 1994 Science 263:802; U.S. Pat. No. 6,146,826; U.S. Pat. No. 5,491,084; and WO 97/41228), reporter enzymes such as β-glucuronidase (GUS) (Jefferson R. A. 1987 Plant Mol. Biol. Rep. 5:387; U.S. Pat. No. 5,599,670; and U.S. Pat. No. 5,432,081), β-galactosidase (lacZ), alkaline phosphatase (AP), glutathione S-transferase (GST) and luciferase (U.S. Pat. No. 5,674,713; and Ow et al. 1986 Science 234(4778):856-859), visual markers like anthocyanins such as CRC (Ludwig et al. (1990) Science 247(4841):449-450) R gene family (e.g. Lc, P, S), A, C, R-nj, body and/or eye color genes in Drosophila, coat color genes in mammalian systems, and others known in the art.
  • One or more markers may be used in order to select and screen for gene targeting events. One common strategy for gene disruption involves using a target modifying polynucleotide in which the target is disrupted by a promoterless selectable marker. Since the selectable marker lacks a promoter, random integration events are unlikely to lead to transcription of the gene. Gene targeting events will put the selectable marker under control of the promoter for the target gene. Gene targeting events are identified by selection for expression of the selectable marker. Another common strategy utilizes a positive-negative selection scheme. This scheme utilizes two selectable markers, one that confers resistance (R+) coupled with one that confers a sensitivity (S+), each with a promoter. When this polynucleotide is randomly inserted, the resulting phenotype is R+/S+. When a gene targeting event is generated, the two markers are uncoupled and the resulting phenotype is R+/S−. Examples of using positive-negative selection are found in Thykjaer et al. (1997) Plant Mol. Biol. 35:523-530; and WO 01/66717, which are herein incorporated by reference.
  • The following are non-limiting examples intended to illustrate the invention. Although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
  • Example 1
  • The Example Describes the Identification of a microRNA
  • The following experiments were carried out on the Arabidopsis thaliana Col-0 ecotype. Plants were grown in long days (16 h light, 8 h dark) under cool white light at 22° C.
  • Arabidopsis plants were transformed by a modified version of the floral dip method, in which Agrobacterium cell suspension was applied to plants by direct watering from above. The T-DNA vector used, pHSbarENDs, contained four copies of the CAMV 35S enhancer adjacent to the right border, an arrangement similar to that described by Weigel et al. (Plant Physiol. 122:1003-1013, 2000). Transformed plants were selected with glufosinate (BASTA) and screened for flowering time, which resulted in the identification of the early-flowering EAT-D mutant. A single T-DNA cosegregating with early flowering was identified in EAT-D, and TAIL-PCR was performed to amplify sequences adjacent to the left and right borders of the T-DNA. To identify transcripts upregulated in the EAT-D mutant, we probed Northern blots containing RNA extracted from wild type (Col-0) and EAT-D plants. Probes for the genes At5g04270 and At5g04280 (GenBank NC003076) did not detect any difference between wild type and EAT-D, whereas a probe from the intergenic region identified an ˜1.4 kb transcript that was expressed at significantly higher levels in EAT-D than in wild type.
  • To isolate the full-length EAT cDNA, we performed 5′- and 3′-RACE-PCR with a GeneRacer kit (Invitrogen) that selects for 5′-capped mRNAs. Reverse transcription was carried out using an oligo-dt primer, and PCR utilized a gene-specific primer (SEQ ID NO: 45 5′-CTGTGCTCACGATCTTGTTGTTCTTGATC-3′) paired with the 5′ kit primer, or a second gene-specific primer (SEQ ID NO: 46 5′-GTCGGCGGATCCATGGMGAAAGCTCATC-5′) paired with the 3′ kit primer.
  • The Arabidopsis EAT-D (Early Activation Tagged-Dominant) mutant was identified in an activation tagging population (Weigel et al., Plant Physiol. 122:1003-1013, 2000). As evidenced by visual inspection and by measuring rosette leaf number (Table 1), the EAT-D mutant flowers extremely early. In addition, EAT-D displays floral defects that are virtually identical to those observed for strong apetala2 (ap2) mutant alleles (Bowman et al., Development 112:1-20, 1991), including the complete absence of petals and the transformation of sepals to carpels. This ap2-like phenotype is only observed in EAT-D homozygotes, whereas both EAT-D heterozygotes and homozygotes are early flowering, indicating that the flowering time phenotype is more sensitive to EAT-D dosage than the ap2-like floral phenotype.
    TABLE 1
    Rosette leaf numbers for Arabidopsis lines
    Genotype rosette leaf no. floral phenotype
    Col-0 11.4 +/− 1.2 wild type
    EAT-D  3.1 +/− 0.8 ap2
    EAT-OX  2.0 +/− 0.2 ap2 + additional
    eatdel 11.1 +/− 1.1 wild type
    miR172a1-OX  2.1 +/− 0.3 ap2 + additional
    LAT-D 22.5 +/− 2.1 wild type
    At2g28550-OX 28.6 +/− 3.6 wild type
    5-60120 10.2 +/− 1.4 wild type
    2-28550  8.7 +/− 0.6 wild type
    5-60120; 2-28550  6.0 +/− 0.8 wild type
  • We mapped the activation-tagged T-DNA insert in EAT-D to chromosome 5, in between the annotated genes At5g04270 and At5g04280. We then used 5′- and 3′-RACE PCR with primers located within this region to identify a 1.4 kb transcript (SEQ ID NO: 1), which we named EAT, that is upregulated in EAT-D. When the 1.4 kb EAT cDNA was fused to the constitutive CAMV 35S promoter and the resultant 35S::EAT construct was introduced into wild type (Col-0) plants by Agrobacterium-mediated transformation (Clough and Bent, Plant J. 16:735-743 1998), the 35S::EAT transformants displayed the identical early-flowering and ap2-like phenotypes seen for EAT-D (Table 1). Many of the 35S::EAT transformants occasionally displayed additional defects, including stigmatic papillae on cauline leaf margins and the formation of a complete or partial flower rather than a secondary inflorescence in the axils of cauline leaves. Ectopic expression of the EAT gene in 35S::EAT plants, therefore, affects both flowering time and the specification of floral organ identity.
  • The EAT gene produces a 1417-nucleotide noncoding RNA that is predicted to be 5′-capped and polyadenylated, based on our RACE-PCR methodology. BLASTN and BLASTX searches of several databases with the EAT cDNA did not reveal extensive nucleotide or predicted amino acid sequence identity between EAT and any other gene. We did, however, identify a 21-nucleotide (nt) (SEQ ID NO: 4) stretch in the middle of the EAT transcript that is identical to miR172a-2, a recently identified mRNA (Park et al., Curr. Biol. 12:1484-1495, 2002). To confirm the functional importance of the miR172a-2 sequence within the EAT cDNA, we generated a mutant form of EAT in which the miR172a-2 sequence was deleted, and made a construct consisting of this mutant EAT cDNA, eatdel, driven by the 35S promoter. Transgenic plants carrying this 35S::eatdel construct flowered with the same number of leaves as wild-type and had normal flowers (Table 1), indicating that the miR172a-2 sequence is necessary to confer both the flowering time and floral organ identity phenotypes seen in EAT-overexpressing lines.
  • As noted by Park et al. (Curr. Biol. 12:1484-1495, 2002), the 21-nt miR172a-2 mRNA has the potential to form an RNA duplex with a sequence near the 3′ end of the coding region of AP2 (Table 2).
    TABLE 2
    Putative 21-nt miR172a-2/AP2 RNA duplex
    Sequence Duplex SEQ ID NO:

    The GU wobble in the duplex is underlined.
  • This particular region of the AP2 gene is poorly conserved at the nucleotide level among the AP2 family; nevertheless, the AP2 sequence (SEQ ID NO: 49) that is complementary to miR172a-2 is found in a similar location in three other Arabidopsis AP2 family members, At5g60120 (SEQ ID NO: 50), At2g28550 (SEQ ID NO: 51), At5g67180 (SEQ ID NO: 52). In addition, the sequence can be found at the corresponding positions of the maize AP2 genes indeterminate spikelet1 (Chuck et al., Genes. Dev. 12:1145-1154 1998) (IDS1 (SEQ ID NO: 53)) and glossy15 (Moose and Sisco, Genes. Dev. 10:3018-3027 1996) (GL15 (SEQ ID NO: 54)), and in AP2 family members from many other plant species, including soybean, rice, wheat, tomato and pea (not shown). The alignment of three Arabidopsis and two maize AP2 family members is shown in Table 3 below.
    TABLE 3
    Alignment of AP2 21-nt region (black bar) and
    surrounding sequence
  • There is an additional copy of the miR172a-2 mRNA in the Arabidopsis genome on chromosome 2 (miR172a-1, FIG. 2 d), and miR172a-2 is highly similar to three other Arabidopsis loci. Like the miR172a-2 mRNA, all four reiterations of the sequence are in intergenic regions, i.e. in between the Arabidopsis genes currently annotated in GenBank. In addition, the sequence is found in ESTs from tomato, potato and soybean, and four copies were found in the genomic sequence of rice.
  • Example 2
  • This Example Describes the Construction of Expression Vectors
  • To overexpress the EAT gene, we designed primers containing XhoI sites (SEQ ID NO: 55 5′-GACTACTCGAGCACCTCTCACTCCCTTTCTCTAAC-3′ and SEQ ID NO: 56 5′-GACTACTCGAGGTTCTCAAGTTGAGCACTTGAAAAC-3′) to amplify the entire EAT gene from Col-0 DNA. The PCR product was digested with XhoI and inserted into a modified pBluescriptSK+ vector (Stratagene, La Jolla, Calif.) that lacked BamHI and HindIII sites, to generate EATX4 (SEQ ID NO: 44). To generate the 35S::EAT transformants, the XhoI-cut EAT gene was inserted into the binary vector pBE851 in between a CAMV 35S promoter and b-phaseolin terminator, and Col-0 was transformed by floral dip. To generate the eatdel construct, two oligonucleotides were synthesized (SEQ ID NO: 57 5′ GATCCATGGAAGAAAGCTCATCTGTCGTTGTTTGTAGGCGCAGCACCATTAAGA TTCACATGGAAATTGATAAATAC-3′ and SEQ ID NO: 58 5′-CCTAAATTAGGGTTTTGATATGTATATTCAACAATCGACGGCTACAAATACCTAA-3′) that completely recreated the BamHI/HindIII fragment of the EAT cDNA except that it lacked the 21 nt miR172a-2 sequence located within the fragment. These two oligos were annealed to their synthesized complementary strands (SEQ ID NO: 59 5′-TAGGGTATTTATCAATTTCCATGTGAATCTTAATGGTGCTGCGCCTACAAACAAC GACAGATGAGCTTTCTTCCATG-3′ and SEQ ID NO: 60 5′-AGCTTTAGGTATTTGTAGCCGTCGATTGTTGAATATACATATCAAAACCCTAATT-3′) and ligated to EATX4 that had been digested with BamHI and HindIII, in a trimolecular ligation reaction. This resulted in the replacement of 159 bp of wild-type EAT sequence with the 138 bp mutant sequence. The eatdel cDNA was then subcloned into pBE851 and transformed as described above. BASTA was used to select in plants for both the EAT and eatdel overexpression constructs.
  • To test whether another member of the miR172 family, miR172a-1, would confer a phenotype similar to that of miR172a-2, we generated a construct containing the 35S promoter fused to the genomic region surrounding miR172a-1. Plants containing the 35S::miR172a-1 construct flowered early and displayed an ap2 phenotype (Table 1), indicating that miR172a-1 behaves in an identical manner to miR172a-2 when overexpressed.
  • All of the miR172 mRNA family members are located within a sequence context that allows an RNA hairpin to form (FIG. 1). Presumably this hairpin is the substrate which is subsequently cleaved by a plant Dicer homolog to generate the mature mRNA. The location of the mRNA within the hairpin, i.e. on the 3′ side of the stem, is conserved amongst all the members of the miR172 family, and this may reflect a structural requirement for processing of this particular mRNA family. The 21-nt miR172a-2 mRNA, therefore, is predicted to be a member of a family of mRNAs that have the capacity to regulate a subset of AP2 genes by forming an RNA duplex with a 21-nt cognate sequence in these genes.
  • Example 3
  • The Example Describes the Analysis of microRNA Expression and AP2 Expression
  • Total RNA was isolated from wild type and EAT-D whole plants that had already flowered, using TRIZOL reagent (Sigma). 50 mg of each RNA was subjected to electrophoresis on a 15% TBE-Urea Criterion gel (BioRad), electroblotted onto Hybond-N+ filter paper (Amersham) using a TransBlot-SD apparatus (BioRad). The filter was then hybridized at 37° C. overnight in UltraHyb-Oligo buffer (Ambion) with 32P-labeled oligos. The oligos were 30-mers that corresponded to either the sense or antisense strands of the miR172a-2 mRNA, with 4-5 nt of flanking sequence on each side. The filter was washed twice at 37° C., in buffer containing 2×SSC and 0.5% SDS. For S1 analysis, probe was made by end-labeling an oligo (SEQ ID NO: 61) (5′-ATGCAGCATCATCMGATTCTCATATACAT-3′) with T4 polynucleotide kinase and 32P. Hybridization and processing of S1 reactions were carried out using standard protocols. For developmental analysis of miR172a-2 and miR172a-1, total RNA was isolated from plants at the various stages and tissues indicated in Example 4, using an Rneasy kit (Qiagen). RT-PCR was carried out using standard protocols, and utilized oligos specific for sequences adjacent to miR172a-2 (SEQ ID NO: 62) (5′-GTCGGCGGATCCATGGAAGAAAGCTCATC-3′ and (SEQ ID NO: 63) 5′-CAAAGATCGATCCAGACTTCAATCAATATC-3′) or sequences adjacent to miR172a-1 (SEQ ID NO: 64) (5′-TAATTTCCGGAGCCACGGTCGTTGTTG-3′ and (SEQ ID NO: 65) 5′-AATAGTCGTTGATTGCCGATGCAGCATC-3′). Oligos used to amplify the ACT11 (Actin) transcript were: (SEQ ID NO: 66) 5′-ATGGCAGATGGTGAAGACATTCAG-3′, and (SEQ ID NO: 67) 5′-GAAGCACTTCCTGTGGACTATTGATG-3′. RT-PCR analysis of AP2 was performed on RNA from floral buds, and utilized the following oligos: (SEQ ID NO: 68) 5′-TTTCCGGGCAGCAGCAACATTGGTAG-3′, and (SEQ ID NO: 69) 5′-GTTCGCCTAAGTTAACAAGAGGATTTAGG-3′. Oligos used to amplify the ANT transcript were: (SEQ ID NO: 70) 5′-GATCAACTTCAATGACTAACTCTGGTTTTC-3′, and (SEQ ID NO: 71) 5′-GTTATAGAGAGATTCATTCTGTTTCACATG-3′.
  • Immunoblot analysis of AP2 was performed on proteins extracted from floral buds. Following electrophoresis on a 10% SDS-PAGE gel, proteins were transferred to a Hybond-P membrane (Amersham) and incubated with an antibody specific for AP2 protein (aA-20, Santa Cruz Biotechnology). The blot was processed using an ECL-plus kit (Amersham).
  • Northern analysis using probes both sense and antisense to the miR172a-2 mRNA identified a small single-stranded RNA of 21-25 nucleotides accumulating too much higher levels in EAT-D mutant plants relative to wild type. The small amount of transcript seen in wild type presumably represents endogenous levels of not only the miR172a-2 mRNA but also its family members, which are similar enough to cross-hybridize with the probe. The predicted miR172a-2 hairpin is 117 nt in length (FIG. 1), a small amount of an ˜100 nt transcript accumulating is detected in EAT-D, this likely represents partially processed miR172a-2 hairpin precursor. S1 nuclease mapping of the miR172a-2 mRNA provides independent confirmation of the 5′ end of miR172a-2 reported by Park et al. (Curr. Biol. 12:1484-1495, 2002).
  • Example 4
  • The Example Describes the Developmental Pattern of EAT mRNA Expression.
  • To address the wild-type expression pattern of miR172a-2 separate from its other Arabidopsis family members, RT-PCR was used to specifically detect a fragment of the 1.4 kb EAT full-length precursor transcript containing miR172a-2. EAT precursor transcript expression is temporally regulated, with little or no transcript detected two days after germination, and progressively more steady-state transcript accumulation seen as the plant approaches flowering. The precursor transcript of miR172a-1 showed a similar temporal pattern of expression. Both miR172a-2 and miR172a-1 precursor transcripts continue to be expressed after flowering has occurred, and accumulate in both leaves and floral buds. We were unable to detect expression of the precursors for the other miR172 family members, perhaps due to their exclusive expression in tissue types not included in this analysis, or because their precursor transcripts are too transient to detect. The temporal expression pattern seen for miR172a-2 and miR172a-1 is reminiscent of that observed for let-7 and lin-4, two mRNAs that control developmental timing in C. elegans (Feinbaum and Ambros, Dev. Biol. 210:87-95 1999; Reinhart et al., Nature 403:901-906 2000).
  • Example 5
  • We assessed the levels of miR172 in various flowering time mutants, in an attempt to position miR172 within the known flowering time pathways. The levels of miR172 were not altered in any of the mutants tested, and the levels of the EAT transcript were identical in plants grown in long days versus plants grown in short days.
  • Example 6
  • The Example Describes Evaluation of Protein Expression
  • Immunoblot analysis indicates that AP2 protein is reduced 3.5-fold in the EAT-D mutant relative to wild type, whereas the AP2 transcript is unaffected. This data suggests that the miR172a-2 mRNA negatively regulates AP2 by translational inhibition. The predicted near-perfect complementarity between the miR172a-2 mRNA and the AP2 target site would be predicted to trigger AP2 mRNA cleavage by the RNA interference (RNAi) pathway (Llave et al., Plant Cell 14:1605-1619 2002; Hutvagner and Zamore, Science 297:2056-2060 2002). Indeed, others have proposed that many plant mRNAs enter the RNAi pathway exclusively due to their near-perfect complementarity to putative targets (Rhoades et al., Cell 110:513-520 2002). While there is no evidence regarding the GU wobble base pair in the predicted miR172a-2/AP2 RNA duplex, it is conserved in all predicted duplexes between miR172 family members and their AP2 targets. Regardless of the mechanism, it is apparent from the AP2 expression data and the observed phenotype of EAT-D that AP2 is a target of negative regulation by miR172a-2, at least when miR172a-2 is overexpressed.
  • Example 7
  • In the same genetic screen that identified the early-flowering EAT-D mutant, we identified an activation-tagged late-flowering mutant, called LAT-D. The LAT-D mutant displays no additional phenotypes besides late flowering (Table 1), and the late-flowering phenotype cosegregated with a single T-DNA insertion. Sequence analysis of the T-DNA insert in LAT-D indicated that the 4×35S enhancer was located approximately 5 kb upstream of At2g28550, which is one of the AP2-like target genes that are potentially regulated by miR172. RT-PCR analysis using primers specific for At2g28550 indicates that the transcript corresponding to this gene is indeed expressed at higher levels in the LAT-D mutant relative to wild type. To confirm that overexpression of At2g28550 causes late flowering, we fused a genomic region containing the entire At2g28550 coding region (from start to stop codon) to the 35S promoter, and created transgenic plants containing this construct. Transgenic 35S::At2g28550 plants flowered later than wild type plants, and were slightly later than the LAT-D mutant (Table 1). This late flowering phenotype was observed in multiple independent transformants.
  • The fact that overexpression of At2g28550 causes late flowering suggests that miR172 promotes flowering in part by downregulating At2g28550. However, because miR172 appears to affect protein rather than transcript accumulation of its target genes, and because we do not have an antibody to the At2g28550 gene product, we decided to test this regulation indirectly via a genetic cross. A plant heterozygous for LAT-D was crossed to a plant homozygous for EAT-D, such that all F1 progeny would contain one copy of EAT-D and 50% of the F1 progeny would also have one copy of LAT-D. F1 progeny were scored for the presence or absence of the LAT-D allele by PCR, and also were scored for flowering time. All of the F1 plants were early flowering, regardless of whether or not they contained a copy of the LAT-D allele, indicating that EAT-D is epistatic to LAT-D. This result is consistent with the idea that miR172a-2, which is overexpressed in EAT-D, directly downregulates At2g28550, which is overexpressed in LAT-D.
  • Example 8
  • To assess the effects of reducing At2g28550 function, we identified plants containing a T-DNA insertion in the At2g28550 gene. In addition, we identified a T-DNA mutant for At2g60120, a closely related AP2-like gene that also contains the miR172 target sequence. Plants homozygous for either the At2g28550 insert or the At5g60120 insert were slightly early flowering relative to wild type (Table 1). The two mutants were crossed, and the double mutant was isolated by PCR genotyping. The At2g28550/At5g60120 double mutant was earlier flowering than either individual mutant (Table 1), suggesting that the genes have overlapping function. The early flowering phenotype of the At2g28550/At5g60120 double mutant is consistent with the idea that the early flowering phenotype of miR172-overexpressing lines is due to downregulation of several AP2-like genes, including At2g28550 and At5g60120. Interestingly, the At2g28550/At5g60120 double mutant is not as early as miR172-overexpressing lines (c.f. EAT-OX, Table 1), which suggests that other AP2-like targets of miR172, for example AP2 itself or At5g67180, also contribute to flowering time control. Because ap2 mutants are not early flowering, any potential negative regulation of flowering by AP2 must be normally masked by genetic redundancy.
  • Example 9
  • This Example Describes a Method of Target Selection and Method to Design DNA Constructs to Generate mRNAs Using the Constructs of SEQ ID NOS: 3 and 44. Any Sequence of Interest can be Selected for Silencing by mRNA Generated Using the Following Method:
  • 1. Choose a region from the coding strand in a gene of interest to be the target sequence. Typically, choose a region of about 10-50 nucleotides found in a similar location to the region targeted by EAT in AP2-like genes, which are regions about 100 nt upstream of the stop codon. The exact location of the target, however, does not appear to be critical. It is recommended to choose a region that has ˜50% GC and is of high sequence complexity, i.e. no repeats or long polynucleotide tracts. It is also recommended that the chosen region ends with a T or A, such that the complementary mRNA will start with an A or U. This is to help ensure a lower stability at the 5′ end of the mRNA in its double-stranded Dicer product form (Schwartz, et al. 2003 Cell 115:199-208). For example, in the miR172a-2 precursor, the mRNA sequence starts with an A, and many other mRNAs start with a U.
  • 2. To use the construct of SEQ ID NO: 3, create a 21 nucleotide sequence complementary to the 21 nt target region (mRNA). Optionally, change a C in the mRNA to a T, which will generate a GU wobble with the target sequence, which mimics the GU wobble seen in EAT.
  • 3. Create the 21 nucleotide “backside” sequence of the hairpin. This will be substantially complementary to the mRNA from step 2. Note, this backside sequence will also be substantially identical to the target sequence. Typically, introduce a few mismatches to make some bulges in the stem of the hairpin that are similar to the bulges in the original EAT hairpin. Optionally, introduce an A at the 3′ end of the backside, to create mismatch at the 5′ end of the mRNA. This last step may help ensure lower stability at the 5′ end of the mRNA in its double-stranded Dicer product form (Schwartz, et al. 2003 Cell 115:199-208).
  • 4. Replace the 21 nucleotide mRNA sequence and the 21 nucleotide “backside” sequence in the EAT BamHI/HindIII DNA construct (SEQ ID NO: 3) with the new mRNA and “backside” sequences from steps 2 and 3.
  • 5. Use MFOLD (GCG, Accelrys, San Diego, Calif.), or an equivalent program, to compare the new hairpin from Step 4 with the original hairpin. Generally, the sequence substantially replicate the structure of the original hairpin (FIG. 1). It is predicted that the introduced bulges need not be exactly identical in length, sequence or position to the original. Examine the mRNA sequence in the hairpin for the relative stability of the 5′ and 3′ ends of the predicted dsRNA product of Dicer.
  • 6. Generate four synthetic oligonucleotides of 76-77 nucleotides in length to produce two double-stranded fragments which comprise the BamHI and HindIII restriction sites, and a 4 nucleotide overhang to facilitate directional ligation which will recreate the BamHI/HindIII fragment. Design of the overhang can be done by one of skill in the art, the current example uses the 4 nucleotide region of positions 79-82 (CCTA) of SEQ ID NO: 3. Hence, for example:
  • Oligo 1 will have an unpaired BamHI site at the 5′ end, and will end with the nucleotide at position 78 of SEQ ID NO: 3.
  • Oligo 2 will have the nucleotides of position 79-82 (CCTA) unpaired at the 5′ end, and will terminate just before the HindIII site (or positions 151-154 in SEQ ID NO: 3).
  • Oligo 3 will be essentially complementary to Oligo 1, (nucleotides 5-78 of SEQ ID NO: 3), and will terminate with 4 nucleotides complementary to nucleotides 1-4 (CCTA) of Oligo 2.
  • Oligo 4 will be essentially complementary to Oligo 2 beginning at the nucleotide of position 5, and will terminate with the HindIII site at the 3′ end.
  • Anneal the oligonucleotides to generate two fragments to be used in a subsequence ligation reaction with the plasmid sequence.
  • 7. Ligate the two DNA fragments from Step 6 in a trimolecular ligation reaction with a plasmid cut with BamHI/HindIII. The current example uses the modified pBluescript SK+ plasmid of SEQ ID NO: 44, which comprises the 1.4 kb EAT sequence of SEQ ID NO: 1, digested with BamHI/HindIII and gel purified away from the small fragment using standard molecular biological techniques. The new designed mRNA to the gene of interest has replaced the previous mRNA.
  • 8. The plasmid from Step 7, subject to any other preparations or modifications as needed, is used to transform the target organism using techniques appropriate for the target.
  • 9. Silencing of the target gene can be assessed using techniques well-known in the art, for example, Northern blot analysis, immunoblot analysis if the target gene of interest encodes a polypeptide, and any phenotypic screens relevant to the target gene, for example flowering time, or floral morphology.
  • Example 10
  • Described in this example are methods one may use for introduction of a polynucleotide or polypeptide into a plant cell.
  • A. Maize Particle-Mediated DNA Delivery
  • A DNA construct can be introduced into maize cells capable of growth on suitable maize culture medium. Such competent cells can be from maize suspension culture, callus culture on solid medium, freshly isolated immature embryos or meristem cells. Immature embryos of the Hi-II genotype can be used as the target cells. Ears are harvested at approximately 10 days post-pollination, and 1.2-1.5 mm immature embryos are isolated from the kernels, and placed scutellum-side down on maize culture medium.
  • The immature embryos are bombarded from 18-72 hours after being harvested from the ear. Between 6 and 18 hours prior to bombardment, the immature embryos are placed on medium with additional osmoticum (MS basal medium, Musashige and Skoog, 1962, Physiol. Plant 15:473-497, with 0.25 M sorbitol). The embryos on the high-osmotic medium are used as the bombardment target, and are left on this medium for an additional 18 hours after bombardment.
  • For particle bombardment, plasmid DNA (described above) is precipitated onto 1.8 mm tungsten particles using standard CaCl2-spermidine chemistry (see, for example, Klein et al., 1987, Nature 327:70-73). Each plate is bombarded once at 600 PSI, using a DuPont Helium Gun (Lowe et al., 1995, Bio/Technol 13:677-682). For typical media formulations used for maize immature embryo isolation, callus initiation, callus proliferation and regeneration of plants, see Armstrong, C., 1994, In “The Maize Handbook”, M. Freeling and V. Walbot, eds. Springer Verlag, NY, pp 663-671.
  • Within 1-7 days after particle bombardment, the embryos are moved onto N6-based culture medium containing 3 mg/l of the selective agent bialaphos. Embryos, and later callus, are transferred to fresh selection plates every 2 weeks. The calli developing from the immature embryos are screened for the desired phenotype. After 6-8 weeks, transformed calli are recovered.
  • B. Soybean Transformation
  • Soybean embryogenic suspension cultures are maintained in 35 ml liquid media SB196 or SB172 in 250 ml Erlenmeyer flasks on a rotary shaker, 150 rpm, 26C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid media. Alternatively, cultures are initiated and maintained in 6-well Costar plates.
  • SB 172 media is prepared as follows: (per liter), 1 bottle Murashige and Skoog Medium (Duchefa # M 0240), 1 ml B5 vitamins 1000× stock, 1 ml 2,4-D stock (Gibco 11215-019), 60 g sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL 11013-026), pH 5.7. SB 196 media is prepared as follows: (per liter) 1 0 ml MS FeEDTA, 10 ml MS Sulfate, 10 ml FN-Lite Halides, 10 ml FN-Lite P, B, Mo, 1 ml B5 vitamins 1000× stock, 1 ml 2,4-D, (Gibco 11215-019), 2.83g KNO3, 0.463 g (NH4)2SO4, 2g MES, 1 g Asparagine Anhydrous, Powder (Gibco 11013-026), 10 g Sucrose, pH 5.8. 2,4-D stock concentration 10 mg/ml is prepared as follows: 2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and stored at −20° C. B5 vitamins 1000× stock is prepared as follows: (per 100 ml)-store aliquots at −20° C., 10 g myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g thiamin.
  • Soybean embryogenic suspension cultures are transformed with various plasmids by the method of particle gun bombardment (Klein et al., 1987 Nature 327:70. To prepare tissue for bombardment, approximately two flasks of suspension culture tissue that has had approximately 1 to 2 weeks to recover since its most recent subculture is placed in a sterile 60×20 mm petri dish containing 1 sterile filter paper in the bottom to help absorb moisture. Tissue (i.e. suspension clusters approximately 3-5 mm in size) is spread evenly across each petri plate. Residual liquid is removed from the tissue with a pipette, or allowed to evaporate to remove excess moisture prior to bombardment. Per experiment, 4-6 plates of tissue are bombarded. Each plate is made from two flasks.
  • To prepare gold particles for bombardment, 30 mg gold is washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile water. For each plasmid combination (treatments) to be used for bombardment, a separate micro-centrifuge tube is prepared, starting with 50 μl of the gold particles prepared above. Into each tube, the following are also added; 5 μl of plasmid DNA (at 1 μg/μl), 50 μl CaCl2, and 20 μl 0.1 M spermidine. This mixture is agitated on a vortex shaker for 3 minutes, and then centrifuged using a microcentrifuge set at 14,000 RPM for 10 seconds. The supernatant is decanted and the gold particles with attached, precipitated DNA are washed twice with 400 μl aliquots of ethanol (with a brief centrifugation as above between each washing). The final volume of 100% ethanol per each tube is adjusted to 40 μl, and this particle/DNA suspension is kept on ice until being used for bombardment.
  • Immediately before applying the particle/DNA suspension, the tube is briefly dipped into a sonicator bath to disperse the particles, and then 5 μL of DNA prep is pipetted onto each flying disk and allowed to dry. The flying disk is then placed into the DuPont Biolistics PDS1000/HE. Using the DuPont Biolistic PDS1000/HE instrument for particle-mediated DNA delivery into soybean suspension clusters, the following settings are used. The membrane rupture pressure is 1100 psi. The chamber is evacuated to a vacuum of 27-28 inches of mercury. The tissue is placed approximately 3.5 inches from the retaining/stopping screen (3rd shelf from the bottom). Each plate is bombarded twice, and the tissue clusters are rearranged using a sterile spatula between shots.
  • Following bombardment, the tissue is re-suspended in liquid culture medium, each plate being divided between 2 flasks with fresh SB196 or SB172 media and cultured as described above. Four to seven days post-bombardment, the medium is replaced with fresh medium containing a selection agent. The selection media is refreshed weekly for 4 weeks and once again at 6 weeks. Weekly replacement after 4 weeks may be necessary if cell density and media turbidity is high.
  • Four to eight weeks post-bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into 6-well microtiter plates with liquid medium to generate clonally-propagated, transformed embryogenic suspension cultures.
  • Each embryogenic cluster is placed into one well of a Costar 6-well plate with 5 mls fresh SB196 media with selection agent. Cultures are maintained for 2-6 weeks with fresh media changes every 2 weeks. When enough tissue is available, a portion of surviving transformed clones are subcultured to a second 6-well plate as a back-up to protect against contamination.
  • To promote in vitro maturation, transformed embryogenic clusters are removed from liquid SB196 and placed on solid agar media, SB 166, for 2 weeks. Tissue clumps of 2-4 mm size are plated at a tissue density of 10 to 15 clusters per plate. Plates are incubated in diffuse, low light (<10 μE) at 26+/−1° C. After two weeks, clusters are subcultured to SB 103 media for 3-4 weeks.
  • SB 166 is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL-Cat# 111117-017), 1 ml B5 vitamins 1000× stock, 60 g maltose, 750 mg MgCl2 hexahydrate, 5 g activated charcoal, pH 5.7, 2 g gelrite. SB 103 media is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL-Cat# 11117-017), 1 ml B5 vitamins 1000× stock, 60 g maltose, 750 mg MgCl2 hexahydrate, pH 5.7, 2 g gelrite. After 5-6 week maturation, individual embryos are desiccated by placing embryos into a 100×15 petri dish with a 1 cm2 portion of the SB103 media to create a chamber with enough humidity to promote partial desiccation, but not death.
  • Approximately 25 embryos are desiccated per plate. Plates are sealed with several layers of parafilm and again are placed in a lower light condition. The duration of the desiccation step is best determined empirically, and depends on size and quantity of embryos placed per plate. For example, small embryos or few embryos/plate require a shorter drying period, while large embryos or many embryos/plate require a longer drying period. It is best to check on the embryos after about 3 days, but proper desiccation will most likely take 5 to 7 days. Embryos will decrease in size during this process.
  • Desiccated embryos are planted in SB 71-1 or MSO medium where they are left to germinate under the same culture conditions described for the suspension cultures. When the plantlets have two fully-expanded trifoliate leaves, germinated and rooted embryos are transferred to sterile soil and watered with MS fertilizer. Plants are grown to maturity for seed collection and analysis. Healthy, fertile transgenic plants are grown in the greenhouse.
  • SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRL-Cat# 21153-036), 10 g sucrose, 750 mg MgCl2 hexahydrate, pH 5.7, 2 g gelrite. MSO media is prepared as follows: 1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins 1000× stock, 30 g sucrose, pH 5.8, 2g Gelrite.
  • Example 11
  • This example describes the design and synthesis of mRNA targets and hairpins directed to various gene targets found in maize, soy, and/or Arabidopsis, using the method described in Example 9.
  • A. Targeting Arabidopsis AGAMOUS, At4g18960
  • The mRNA sequence of SEQ ID NO: 4 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 12-15, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the mRNA of SEQ ID NO: 4, 88% of the transformants exhibited a mutant AGAMOUS (ag) floral phenotype, characterized by the conversion of stamens to petals in whorl 3, and carpels to another ag flower in whorl 4 (Bowman, et al. (1991) The Plant Cell 3:749-758). The mutant phenotype varied between transformants, with approximately {fraction (1/3)} exhibiting a strong ag phenotype, ⅓ exhibiting an intermediate ag phenotype, and ⅓ exhibiting a weak ag phenotype. Gel electrophoresis and Northern Blot analysis of small RNAs isolated from the transformants demonstrated that the degree of the mutant ag phenotype was directly related to the level of antiAG mRNA, with the strongest phenotype having the highest accumulation of the processed mRNA (˜21 nt).
  • B. Targeting Arabidopsis Apetela3 (AP3), At3g54340
  • Two mRNA Targets from AP3 were Selected and Oligonucleotides Designed.
  • The mRNA sequence of SEQ ID NO: 5 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 16-19, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • The mRNA sequence of SEQ ID NO: 6 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the mRNA of SEQ ID NO: 5, the transformants had novel leaf and floral phenotypes, but did not exhibit any mutant AP3 phenotype. Gel electrophoresis and Northern analysis of RNA isolated from 2 week old rosette leaf tissue from the transformants demonstrated that the highest accumulation of the processed mRNA (˜21 nt) corresponded to the “backside” strand of the precursor, which evidently silenced a different target sequence to produce the novel leaf and floral phenotypes.
  • A new target sequence was selected, with the correct asymmetry in order for the mRNA target strand to be selected during incorporation into RISC (Schwartz et al., 2003, Cell 115:199-208). The mRNA sequence of SEQ ID NO: 6 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44. Greater than 90% of the transformants showed silencing for the AP3 gene, as demonstrated by floral phenotype and electrophoretic analysis. An approximately 21 nt mRNA (antiAP3b) was detected at high levels in the transgenic plants, and not in wild type control plants. RT-PCR analysis confirmed that the amount of AP3 transcript was reduced in the transformants, as compared to wild type control plants.
  • C. Targeting Maize Phytoene Desaturase
  • Two mRNA Targets from Phytoene Desaturase (PDS) were Selected and Oligonucleotides Designed.
  • The mRNA sequence of SEQ ID NO: 7 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 24-27, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • The mRNA sequence of SEQ ID NO: 8 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 28-31, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • D. Targeting Maize Phytic Acid Biosynthetic Enzymes
  • Three maize phytic acid biosynthetic enzyme gene targets were selected and mRNA and oligonucleotides designed. Inositol polyphosphate kinase-2 polynucleotides are disclosed in WO 02/059324, herein incorporated by reference. Inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides are disclosed in WO 03/027243, herein incorporated by reference. Myo-inositol 1-phosphate synthase polynucleotides are disclosed in WO 99/05298, herein incorporated by reference.
  • Inositol Polyphosphate Kinase-2 (IPPK2)
  • The mRNA sequence of SEQ ID NO: 9 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 32-35, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Inositol 1,3,4-trisphosphate 5/6-kinase-5 (ITPK5)
  • The mRNA sequence of SEQ ID NO: 10 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 36-39, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Myo-Inositol 1-Phosphate Synthase (mi1 ps)
  • The mRNA sequence of SEQ ID NO: 11 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 40-43, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • E. Targeting Soy Apetela2-Like Sequences (AP2)
  • The same EAT (miR172a-2) construct, comprising SEQ ID NO: 1, used for Arabidopsis transformation was used to transform soybean. This construct has a mRNA template sequence which encodes the mRNA of SEQ ID NO: 48. The construct was created using a PCR amplification of miR172a-2 precursor sequence from Arabidopsis, restriction digestion, and ligation as described in Example 2.
  • Soybean tissue was transformed and grown essentially as described in Example 10. After transformation, 42% of the transformants exhibited a mutant phenotype, characterized by the conversion of sepals to leaves. Plants exhibiting the strongest phenotypes were sterile, and produced no seed. Both the homeotic conversion of the organs and the effects on fertility are similar to that seen for ap2 mutant alleles in Arabidopsis. Small RNA gel electrophoresis and Northern analysis, probed with an oligonucleotide probe antisense to miR172, showed accumulation of miR172 in the transgenic lines. A small amount of endogenous soy miR172 is also detected in the soy control line. The degree of the mutant phenotype was directly related to the level of mRNA, with the strongest phenotype having the highest accumulation of the processed mRNA (˜21 nt).
  • Example 12
  • This example summarizes the target sequences and oligos used for mRNA silencing constructs as described in the examples.
    TABLE 4
    Target miRNA miRNA/ SEQ ID
    Organism gene name template NOS
    Arabidopsis AP2-like miR172-a2 SEQ ID NO: 47 55-56
    none EATdel none 57-60
    AGAMOUS antiAG SEQ ID NO: 4 12-15
    APETELA3 antiAP3a SEQ ID NO: 5 16-19
    APETELA3 antiAP3b SEQ ID NO: 6 20-23
    Corn PDS1 antiPDS1 SEQ ID NO: 7 24-27
    PDS2 antiPDS1 SEQ ID NO: 8 28-31
    IPPK2 antiIPPK2 SEQ ID NO: 9 32-35
    ITPK5 antiITPK5 SEQ ID NO: 10 36-39
    MI1PS antiMI1PS SEQ ID NO: 11 40-43
    Soybean AP2-like miR172a-2 SEQ ID NO: 47 55-56
  • The above examples are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims. All publications, patents, patent applications, and computer programs cited herein are hereby incorporated by reference.

Claims (76)

  1. 1. A method of inhibiting expression of a target sequence in a cell comprising:
    (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, the polynucleotide comprising in the following order:
    (i) at least about 20 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO: 3,
    (ii) a first oligonucleotide of 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide,
    (iii) at least about 20 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO: 3,
    (iv) the second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and wherein the second oligonucleotide is substantially complementary to the target sequence, and
    (v) at least about 20 contiguous nucleotides in the region from nucleotides 128-159 of SEQ ID NO:3;
    wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin, and
    (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  2. 2. The method of claim 1, wherein the nucleic acid construct further comprises a promoter operably linked to the polynucleotide
  3. 3. The method of claim 1, wherein the cell is a plant cell.
  4. 4. A cell comprising the nucleic acid construct of claim 1.
  5. 5. The cell of claim 4, wherein the cell is a plant cell.
  6. 6. The method of claim 1, wherein target sequence expression is inhibited by at least 10%.
  7. 7. The method of claim 1, wherein inhibition of the target sequence generates a loss-of-function phenotype.
  8. 8. The method of claim 2, wherein the promoter is a pathogen-inducible promoter and inhibition of the target sequence confers resistance to a pathogen.
  9. 9. An isolated polynucleotide comprising in the following order at least 20 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, at least about 20 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and the second oligonucleotide is substantially complementary to the target sequence, and at least about 20 contiguous nucleotides in the region from nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin.
  10. 10. The isolated polynucleotide of claim 9, further comprising an operably linked promoter.
  11. 11. A cell comprising the isolated polynucleotide of claim 9.
  12. 12. The cell of claim 11, wherein the cell is a plant cell.
  13. 13. A transgenic plant comprising the isolated polynucleotide of claim 9.
  14. 14. A transgenic seed comprising the isolated polynucleotide of claim 9.
  15. 15. The isolated polynucleotide of claim 10, wherein the promoter is a pathogen-inducible promoter.
  16. 16. The isolated polynucleotide of claim 9, wherein the polynucleotide suppresses expression of a target sequence.
  17. 17. A method of inhibiting expression of a target sequence in a cell comprising:
    (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide comprises in the following order:
    (i) nucleotides 1-38 of SEQ ID NO: 3,
    (ii) a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide,
    (iii) nucleotides 60-106 of SEQ ID NO: 3,
    (iv) a second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and wherein the second oligonucleotide is substantially complementary to the target sequence, and
    (v) nucleotides 128-159 of SEQ ID NO:3;
    wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin, and
    (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  18. 18. An isolated polynucleotide comprising in the following order nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a mRNA, and the second oligonucleotide is substantially complementary to the target sequence, and nucleotides 128-159 of SEQ ID NO:3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin.
  19. 19. A method of inhibiting expression of a target sequence in a cell comprising:
    (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
    (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  20. 20. A method of inhibiting expression of a target sequence in a cell comprising:
    (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified plant miR172 mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
    (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  21. 21. The method of claim 20, wherein the plant miR172 mRNA precursor is from a dicot or a monocot.
  22. 22. The method of claim 20, wherein the plant miR172 mRNA precursor is from Arabidopsis.
  23. 23. The method of claim 20, wherein the plant miR172 mRNA precursor comprises SEQ ID NO: 3.
  24. 24. A method of inhibiting expression of a target sequence in a cell comprising:
    (a) introducing into the cell a nucleic acid construct comprising a promoter operably linked to a polynucleotide encoding a modified Arabidopsis miR172 mRNA precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide encodes a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin; and
    (b) expressing the nucleic acid construct for a time sufficient to produce the mRNA, wherein the mRNA inhibits expression of the target sequence.
  25. 25. The method of claim 24, wherein the Arabidopsis miR172 mRNA precursor comprises SEQ ID NO: 3.
  26. 26. A cell produced by the method of claim 1.
  27. 27. The cell of claim 26, wherein the cell is a plant cell.
  28. 28. The cell of claim 27, wherein the plant cell is from a monocot or a dicot.
  29. 29. The cell of claim 28, wherein the cell is selected from the group consisting of corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
  30. 30. The cell of claim 29, wherein the cell is from Arabidopsis.
  31. 31. The cell of claim 29, wherein the cell is from corn.
  32. 32. A cell produced by the method of claim 19.
  33. 33. The cell of claim 32, wherein the cell is a plant cell.
  34. 34. The cell of claim 33, wherein the plant cell is from a monocot or a dicot.
  35. 35. The cell of claim 34, wherein the cell is selected from the group consisting of corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
  36. 36. The cell of claim 35, wherein the cell is from Arabidopsis.
  37. 37. The cell of claim 35, wherein the cell is from corn.
  38. 38. A cell produced by the method of claim 20.
  39. 39. The cell of claim 38, wherein the cell is a plant cell.
  40. 40. The cell of claim 39, wherein the plant cell is from a monocot or a dicot.
  41. 41. The cell of claim 40, wherein the cell is selected from the group consisting of corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
  42. 42. The cell of claim 41, wherein the cell is from Arabidopsis.
  43. 43. The cell of claim 41, wherein the cell is from corn.
  44. 44. A cell produced by the method of claim 24.
  45. 45. The cell of claim 44, wherein the cell is a plant cell.
  46. 46. The cell of claim 45, wherein the plant cell is from a monocot or a dicot.
  47. 47. The cell of claim 46, wherein the cell is selected from the group consisting of corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
  48. 48. The cell of claim 47, wherein the cell is from Arabidopsis.
  49. 49. The cell of claim 47, wherein the cell is from corn.
  50. 50. The method of claim 3, the method further comprising producing a transformed plant, wherein the plant comprises the nucleic acid construct which encodes the mRNA.
  51. 51. A plant produced by the method of claim 50.
  52. 52. The method of claim 19, wherein the cell is a plant cell, the method further comprising producing a transformed plant, wherein the plant comprises the nucleic acid construct which encodes the mRNA.
  53. 53. A plant produced by the method of claim 52.
  54. 54. The method of claim 20, wherein the cell is a plant cell, the method further comprising producing a transformed plant, wherein the plant comprises the nucleic acid construct which encodes the mRNA.
  55. 55. A plant produced by the method of claim 50.
  56. 56. The method of claim 24, wherein the cell is a plant cell, the method further comprising producing a transformed plant, wherein the plant comprises the nucleic acid construct which encodes the mRNA.
  57. 57. A plant produced by the method of claim 56.
  58. 58. The plant of claim 57, wherein the plant is a monocot or a dicot.
  59. 59. The plant of claim 58, wherein the plant is selected from the group consisting of corn, wheat, rice, barley, oats, sorghum, millet, sunflower, safflower, cotton, soy, canola, alfalfa, Arabidopsis, and tobacco.
  60. 60. The plant of claim 59, wherein the plant is Arabidopsis.
  61. 61. The plant of claim 59, wherein the plant is corn.
  62. 62. An isolated polynucleotide comprising a polynucleotide which encodes a modified plant mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  63. 63. A cell comprising the isolated polynucleotide of claim 62.
  64. 64. The cell of claim 63, wherein the cell is a plant cell.
  65. 65. An isolated polynucleotide comprising a polynucleotide encoding a modified plant miR172 mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  66. 66. A cell comprising the isolated polynucleotide of claim 65.
  67. 67. The cell of claim 66, wherein the cell is a plant cell.
  68. 68. An isolated polynucleotide comprising polynucleotide encoding a modified Arabidopsis miR172 mRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a mRNA which is substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  69. 69. A cell comprising the isolated polynucleotide of claim 68.
  70. 70. The cell of claim 69, wherein the cell is a plant cell.
  71. 71. The cell of claim 70, wherein the plant cell is from a dicot or a monocot.
  72. 72. The cell of claim 71, wherein the cell is from Arabidopsis.
  73. 73. The cell of claim 71, wherein the cell is from corn.
  74. 74. The isolated polynucleotide of claim 62, wherein the first and the second oligonucleotides are heterologous to the precursor.
  75. 75. The isolated polynucleotide of claim 65, wherein the first and the second oligonucleotides are heterologous to the precursor.
  76. 76. The isolated polynucleotide of claim 68, wherein the first and the second oligonucleotides are heterologous to the precursor.
US10963394 2003-10-09 2004-10-12 Gene silencing Abandoned US20060218673A9 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US50995803 true 2003-10-09 2003-10-09
US10963394 US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10963394 US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing

Publications (2)

Publication Number Publication Date
US20050138689A1 true true US20050138689A1 (en) 2005-06-23
US20060218673A9 true US20060218673A9 (en) 2006-09-28



Family Applications (4)

Application Number Title Priority Date Filing Date
US10963394 Abandoned US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing
US10963238 Abandoned US20050120415A1 (en) 2003-10-09 2004-10-12 Gene silencing
US11958423 Active 2028-10-28 US8729339B2 (en) 2003-10-09 2007-12-18 Gene silencing
US14264275 Abandoned US20140230088A1 (en) 2003-10-09 2014-04-29 Gene silencing

Family Applications After (3)

Application Number Title Priority Date Filing Date
US10963238 Abandoned US20050120415A1 (en) 2003-10-09 2004-10-12 Gene silencing
US11958423 Active 2028-10-28 US8729339B2 (en) 2003-10-09 2007-12-18 Gene silencing
US14264275 Abandoned US20140230088A1 (en) 2003-10-09 2014-04-29 Gene silencing

Country Status (4)

Country Link
US (4) US20060218673A9 (en)
EP (2) EP1711613B1 (en)
CA (2) CA2541914C (en)
WO (2) WO2005035769A3 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US20060130176A1 (en) * 2004-10-12 2006-06-15 The Rockefeller University MicroRNAs
US20060200878A1 (en) * 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US20070031932A1 (en) * 2003-05-09 2007-02-08 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
WO2007070389A2 (en) * 2005-12-12 2007-06-21 Syngenta Participations Ag Control of parasitic weeds
WO2008063203A2 (en) * 2006-01-27 2008-05-29 Whitehead Institute For Biomedical Research Compositions and methods for efficient gene silencing in plants
US20080313773A1 (en) * 2007-05-14 2008-12-18 The Rockefeller University Production of artificial micrornas using synthetic microrna precursors
US20090155909A1 (en) * 2007-12-18 2009-06-18 E.I.Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US20090155910A1 (en) * 2007-12-18 2009-06-18 E.I.Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
US8148604B2 (en) 2004-10-21 2012-04-03 Venganza Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US8182528B2 (en) 2003-12-23 2012-05-22 Sadra Medical, Inc. Locking heart valve anchor
US8231670B2 (en) 2003-12-23 2012-07-31 Sadra Medical, Inc. Repositionable heart valve and method
US8246678B2 (en) 2003-12-23 2012-08-21 Sadra Medicl, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US8328868B2 (en) 2004-11-05 2012-12-11 Sadra Medical, Inc. Medical devices and delivery systems for delivering medical devices
US8343213B2 (en) 2003-12-23 2013-01-01 Sadra Medical, Inc. Leaflet engagement elements and methods for use thereof
WO2013112523A2 (en) 2012-01-23 2013-08-01 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthestic genes
US8828078B2 (en) 2003-12-23 2014-09-09 Sadra Medical, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
US9585750B2 (en) 2003-12-23 2017-03-07 Boston Scientific Scimed, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US9873765B2 (en) 2011-06-23 2018-01-23 Dsm Ip Assets, B.V. Biodegradable polyesteramide copolymers for drug delivery

Families Citing this family (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7795419B2 (en) 2004-05-26 2010-09-14 Rosetta Genomics Ltd. Viral and viral associated miRNAs and uses thereof
EP1784501B1 (en) 2004-05-14 2015-11-18 Rosetta Genomics Ltd VIRAL AND VIRUS ASSOCIATED MicroRNAS AND USES THEREOF
WO2005035769A3 (en) * 2003-10-09 2005-06-02 Du Pont Gene silencing by using micro-rna molecules
US8314290B2 (en) 2004-12-21 2012-11-20 Monsanto Technology Llc Temporal regulation of gene expression by MicroRNAs
WO2006073727A3 (en) 2004-12-21 2007-06-28 Monsanto Technology Llc Recombinant dna constructs and methods for controlling gene expression
EP1874936B1 (en) * 2005-04-19 2013-10-30 BASF Plant Science GmbH Improved methods controlling gene expression
EP1907549A1 (en) * 2005-06-17 2008-04-09 Pioneer-Hi-Bred International, Inc. Methods and compositions for gene silencing
CA2625031C (en) * 2005-10-13 2016-07-19 Monsanto Technology Llc Methods for producing hybrid seed
US8237017B2 (en) 2006-05-12 2012-08-07 Bayer Cropscience Nv Stress-related microRNA molecules and uses thereof
EP3287524A1 (en) * 2006-08-31 2018-02-28 Monsanto Technology LLC Phased small rnas
WO2008133643A8 (en) 2006-10-12 2011-10-06 Monsanto Technology, Llc Plant micrornas and methods of use thereof
WO2008153692A3 (en) * 2007-05-22 2009-02-26 Brigham & Womens Hospital Microrna expression profiling of cerebrospinal fluid
CA2710221A1 (en) * 2007-12-21 2009-07-09 E. I. Du Pont De Nemours And Company Drought tolerant plants and related constructs and methods involving genes encoding mir827
WO2010006338A9 (en) * 2008-07-11 2010-09-16 Rutgers University Compositions and methods for biofuel crops
ES2651909T3 (en) 2009-04-20 2018-01-30 Monsanto Technology Llc Multiple virus resistance in plants
CN102803496A (en) 2009-06-10 2012-11-28 淡马锡生命科学研究院有限公司 Virus induced gene silencing (VIGS) for functional analysis of genes in cotton
EP2443234A1 (en) 2009-06-15 2012-04-25 Icon Genetics GmbH Nicotiana benthamiana plants deficient in xylosyltransferase activity
WO2011057333A1 (en) * 2009-11-11 2011-05-19 La Trobe University Transgenic plant male sterility
CA2818997A1 (en) 2010-12-09 2012-06-14 Xiang Huang Methods and compositions using small interfering rna (sirna) for nematode control in plants
EP2726493A4 (en) 2011-07-01 2015-03-18 Monsanto Technology Llc Methods and compositions for selective regulation of protein expression
US9181532B2 (en) 2011-07-29 2015-11-10 Icon Genetics Gmbh Production of galactosylated N-glycans in plants
CA2842709A1 (en) 2011-08-16 2013-02-21 Syngenta Participations Ag Methods and compositions for introduction of exogenous dsrna into plant cells
US20140259222A1 (en) 2011-09-21 2014-09-11 Syngenta Participation Ag Pathogen resistance
EP2764105B1 (en) 2011-10-04 2017-03-15 Icon Genetics GmbH Nicotiana benthamiana plants deficient in fucosyltransferase activity
US20140294840A1 (en) 2011-11-30 2014-10-02 University Of Bremen Expression of mirnas in placental tissue
WO2013192256A1 (en) 2012-06-22 2013-12-27 Syngenta Participations Ag Biological control of coleopteran pests
CA2917105A1 (en) 2013-07-01 2015-01-08 Bayer Cropscience Nv Methods and means for modulating flowering time in monocot plants
EP3035941A1 (en) * 2013-08-23 2016-06-29 Instytut Biochemii i Biofizyki PAN Use of a mir172 molecule for decreasing inflammation
WO2016050512A1 (en) 2014-10-03 2016-04-07 Bayer Cropscience Nv Methods and means for increasing stress tolerance and biomass in plants
CA2969105A1 (en) 2014-12-23 2016-06-30 Syngenta Participations Ag Biological control of coleopteran pests
WO2016113333A1 (en) 2015-01-16 2016-07-21 Bayer Cropscience Nv Leaf-preferential promoters and uses thereof
WO2016128519A1 (en) 2015-02-12 2016-08-18 Bayer Cropscience Nv Shoot apex-preferential promoters and uses thereof
WO2017178318A1 (en) 2016-04-11 2017-10-19 Bayer Cropscience Nv Seed-specific and endosperm-preferential promoters and uses thereof
WO2017178322A1 (en) 2016-04-11 2017-10-19 Bayer Cropscience Nv Seed-specific and endosperm-preferential promoters and uses thereof
WO2017178368A1 (en) 2016-04-13 2017-10-19 Bayer Cropscience Nv Seed-specific and embryo-preferential promoters and uses thereof
WO2017178367A1 (en) 2016-04-13 2017-10-19 Bayer Cropscience Nv Seed- and funiculus-preferential promoters and uses thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6271439B1 (en) * 1998-03-04 2001-08-07 Pioneer Hi-Bred International, Inc. Methods and compositions for regulating cell death and enhancing disease resistance to plant pathogens
US20020086356A1 (en) * 2000-03-30 2002-07-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants

Family Cites Families (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5569597A (en) 1985-05-13 1996-10-29 Ciba Geigy Corp. Methods of inserting viral DNA into plant material
US5583024A (en) 1985-12-02 1996-12-10 The Regents Of The University Of California Recombinant expression of Coleoptera luciferase
US5268463A (en) 1986-11-11 1993-12-07 Jefferson Richard A Plant promoter α-glucuronidase gene construct
US5608142A (en) 1986-12-03 1997-03-04 Agracetus, Inc. Insecticidal cotton plants
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5990387A (en) 1988-06-10 1999-11-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US5023179A (en) 1988-11-14 1991-06-11 Eric Lam Promoter enhancer element for gene expression in plant roots
US5110732A (en) 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
EP0463056A1 (en) 1989-03-17 1992-01-02 E.I. Du Pont De Nemours And Company External regulation of gene expression
US5879918A (en) 1989-05-12 1999-03-09 Pioneer Hi-Bred International, Inc. Pretreatment of microprojectiles prior to using in a particle gun
US5240855A (en) 1989-05-12 1993-08-31 Pioneer Hi-Bred International, Inc. Particle gun
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
ES2187497T3 (en) 1990-04-12 2003-06-16 Syngenta Participations Ag Promoters preferably in tissues.
US5498830A (en) 1990-06-18 1996-03-12 Monsanto Company Decreased oil content in plant seeds
US5932782A (en) 1990-11-14 1999-08-03 Pioneer Hi-Bred International, Inc. Plant transformation method using agrobacterium species adhered to microprojectiles
US5459252A (en) 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5399680A (en) 1991-05-22 1995-03-21 The Salk Institute For Biological Studies Rice chitinase promoter
DE69230290T2 (en) 1991-08-27 2000-07-20 Novartis Ag Proteins with insecticidal properties against homoptera insects and their use in plant protection
EP0612208B1 (en) 1991-10-04 2004-09-15 North Carolina State University Pathogen-resistant transgenic plants
US5324646A (en) 1992-01-06 1994-06-28 Pioneer Hi-Bred International, Inc. Methods of regeneration of Medicago sativa and expressing foreign DNA in same
US5428148A (en) 1992-04-24 1995-06-27 Beckman Instruments, Inc. N4 - acylated cytidinyl compounds useful in oligonucleotide synthesis
US5401836A (en) 1992-07-16 1995-03-28 Pioneer Hi-Bre International, Inc. Brassica regulatory sequence for root-specific or root-abundant gene expression
CA2140910C (en) 1992-07-27 1999-03-23 Jeffrey A. Townsend An improved method of agrobacterium-mediated transformation of cultured soybean cells
US5889191A (en) 1992-12-30 1999-03-30 Biosource Technologies, Inc. Viral amplification of recombinant messenger RNA in transgenic plants
US5789156A (en) 1993-06-14 1998-08-04 Basf Ag Tetracycline-regulated transcriptional inhibitors
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5491084A (en) 1993-09-10 1996-02-13 The Trustees Of Columbia University In The City Of New York Uses of green-fluorescent protein
EP0759170B1 (en) 1993-09-10 2008-07-09 The Trustees Of Columbia University In The City Of New York Uses of green fluorescent protein
US5470353A (en) 1993-10-20 1995-11-28 Hollister Incorporated Post-operative thermal blanket
US5633363A (en) 1994-06-03 1997-05-27 Iowa State University, Research Foundation In Root preferential promoter
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5608144A (en) 1994-08-12 1997-03-04 Dna Plant Technology Corp. Plant group 2 promoters and uses thereof
US5750868A (en) 1994-12-08 1998-05-12 Pioneer Hi-Bred International, Inc. Reversible nuclear genetic system for male sterility in transgenic plants
US6143557A (en) 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
DE69623057D1 (en) 1995-06-07 2002-09-19 Invitrogen Corp Recombinational cloning in vitro using genetically engineered recombination sites
US5837876A (en) 1995-07-28 1998-11-17 North Carolina State University Root cortex specific gene promoter
DE69730830T2 (en) 1996-05-01 2005-09-22 Pioneer Hi-Bred International, Inc. Use of the "green-fluorescent-protein" as screenung-marker for plant transformation
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
WO1998001575A1 (en) 1996-07-08 1998-01-15 Pioneer Hi-Bred International, Inc. Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
WO1999005298A1 (en) 1997-07-22 1999-02-04 Pioneer Hi-Bred International, Inc. Genes controlling phytate metabolism in plants and uses thereof
DE69836092T2 (en) 1997-10-24 2007-05-10 Invitrogen Corp., Carlsbad Recombinational cloning using of nukleinsaüren with recombination
US6331661B1 (en) 1997-11-18 2001-12-18 Pioneer Hi-Bred International, Inc. Method for directional stable transformation of eukaryotic cells
WO1999043797A3 (en) 1998-02-26 2000-02-24 Pioneer Hi Bred Int Constitutive maize promoters
CA2315549A1 (en) 1998-02-26 1999-09-02 Pioneer Hi-Bred International, Inc. Family of maize pr-1 genes and promoters
EP3214177A3 (en) 1998-04-08 2017-11-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
DE69928264T2 (en) 1998-08-20 2006-07-13 Pioneer Hi-Bred International, Inc. Seed Preferable promoters
WO2000012733A1 (en) 1998-08-28 2000-03-09 Pioneer Hi-Bred International, Inc. Seed-preferred promoters from end genes
JP2003516124A (en) 1999-10-15 2003-05-13 カーネギー インスティテューション オブ ワシントン rna interference pathway genes as a means of genetic interference targeting
GB0002260D0 (en) 2000-02-02 2000-03-22 Laporte Performance Chemicals Lubricating oils
WO2001066717A9 (en) 2000-03-03 2003-01-16 Univ Utah Gene targeting method
ES2215494T5 (en) 2000-12-01 2017-12-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Small RNA molecules that mediate RNA interference
US7067720B2 (en) 2001-01-12 2006-06-27 Pioneer Hi-Bred International, Inc. Inositol polyphosphate kinase genes and uses thereof
CA2453183C (en) 2001-07-12 2016-05-10 University Of Massachusetts In vivo production of small interfering rnas that mediate gene silencing
WO2003012052A3 (en) 2001-07-30 2005-03-31 Eric Wfw Alton Specific inhibition of gene expression by small double stranded rnas
EP1961293A3 (en) 2001-09-27 2009-01-28 Pioneer Hi-Bred International, Inc. Phytate polynucleotides and methods of use
WO2003070918A3 (en) 2002-02-20 2004-07-08 Leonid Beigelman Rna interference by modified short interfering nucleic acid
WO2004005485A3 (en) 2002-07-10 2006-03-23 Michael A Herman Compositions and methods for controlling parasitic nematodes
WO2004066183A3 (en) 2003-01-22 2004-12-02 European Molecular Biology Lab Embl Microrna
EP1633890B1 (en) 2003-06-02 2010-10-20 University of Massachusetts METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF FNAi
US7459547B2 (en) 2003-06-02 2008-12-02 University Of Massachusetts Methods and compositions for controlling efficacy of RNA silencing
WO2005035769A3 (en) * 2003-10-09 2005-06-02 Du Pont Gene silencing by using micro-rna molecules

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030051263A1 (en) * 1997-12-23 2003-03-13 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030055020A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US6271439B1 (en) * 1998-03-04 2001-08-07 Pioneer Hi-Bred International, Inc. Methods and compositions for regulating cell death and enhancing disease resistance to plant pathogens
US20020086356A1 (en) * 2000-03-30 2002-07-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20030108923A1 (en) * 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants

Cited By (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US9822376B2 (en) 2002-07-19 2017-11-21 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US20070031932A1 (en) * 2003-05-09 2007-02-08 Crucell Holland B.V. Cultures of E1-immortalized cells and processes for culturing the same to increase product yields therefrom
US8182528B2 (en) 2003-12-23 2012-05-22 Sadra Medical, Inc. Locking heart valve anchor
US8828078B2 (en) 2003-12-23 2014-09-09 Sadra Medical, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
US8343213B2 (en) 2003-12-23 2013-01-01 Sadra Medical, Inc. Leaflet engagement elements and methods for use thereof
US9585750B2 (en) 2003-12-23 2017-03-07 Boston Scientific Scimed, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US8231670B2 (en) 2003-12-23 2012-07-31 Sadra Medical, Inc. Repositionable heart valve and method
US8246678B2 (en) 2003-12-23 2012-08-21 Sadra Medicl, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US8975471B2 (en) 2004-10-12 2015-03-10 The Rockefeller University MicroRNAs
US20060130176A1 (en) * 2004-10-12 2006-06-15 The Rockefeller University MicroRNAs
US9121034B2 (en) 2004-10-21 2015-09-01 Venganza Inc Methods and materials for conferring resistance to pests and pathogens of corn
US8581039B2 (en) 2004-10-21 2013-11-12 Venganza, Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US8461416B2 (en) 2004-10-21 2013-06-11 Venganza, Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US8148604B2 (en) 2004-10-21 2012-04-03 Venganza Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US8328868B2 (en) 2004-11-05 2012-12-11 Sadra Medical, Inc. Medical devices and delivery systems for delivering medical devices
US20070113302A1 (en) * 2004-12-21 2007-05-17 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20070089188A1 (en) * 2004-12-21 2007-04-19 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20070089194A1 (en) * 2004-12-21 2007-04-19 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20070089190A1 (en) * 2004-12-21 2007-04-19 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US9212370B2 (en) 2004-12-21 2015-12-15 Monsanto Technology Llc Recombinant DNA constructs and methods for controlling gene expression
US7723568B2 (en) 2004-12-21 2010-05-25 Monsanto Technology Llc Engineered miRNA precursors for suppressing target gene expression in plants
US7786350B2 (en) 2004-12-21 2010-08-31 Monsanto Technology, Llc Recombinant DNA constructs compressing engineered plant microRNAs and methods for controlling gene expression
US20070094748A1 (en) * 2004-12-21 2007-04-26 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20070089196A1 (en) * 2004-12-21 2007-04-19 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US9000264B2 (en) 2004-12-21 2015-04-07 Monsanto Technology Llc Recombinant DNA constructs and methods for controlling gene expression
US20110035838A1 (en) * 2004-12-21 2011-02-10 Linda Lutfiyya Recombinant DNA Constructs and Methods for Controlling Gene Expression
US20070083949A1 (en) * 2004-12-21 2007-04-12 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20070083950A1 (en) * 2004-12-21 2007-04-12 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US20060200878A1 (en) * 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US20070089195A1 (en) * 2004-12-21 2007-04-19 Shihshieh Huang Recombinant DNA constructs and methods for controlling gene expression
US9708620B2 (en) 2004-12-21 2017-07-18 Monsanto Technology Llc Recombinant DNA constructs and methods for controlling gene expression
US8395023B2 (en) 2004-12-21 2013-03-12 Monsanto Technology Llc Recombinant DNA constructs and methods for controlling gene expression
WO2007070389A3 (en) * 2005-12-12 2008-06-05 Syngenta Participations Ag Control of parasitic weeds
WO2007070389A2 (en) * 2005-12-12 2007-06-21 Syngenta Participations Ag Control of parasitic weeds
WO2008063203A2 (en) * 2006-01-27 2008-05-29 Whitehead Institute For Biomedical Research Compositions and methods for efficient gene silencing in plants
WO2008063203A3 (en) * 2006-01-27 2009-02-19 Whitehead Biomedical Inst Compositions and methods for efficient gene silencing in plants
US8143480B2 (en) 2006-01-27 2012-03-27 Whitehead Institute For Biomedical Research Compositions and methods for efficient gene silencing in plants
US20080313773A1 (en) * 2007-05-14 2008-12-18 The Rockefeller University Production of artificial micrornas using synthetic microrna precursors
US20090155909A1 (en) * 2007-12-18 2009-06-18 E.I.Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
EP2573181A2 (en) 2007-12-18 2013-03-27 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial microRNAs
EP2573180A2 (en) 2007-12-18 2013-03-27 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial microRNAs
EP2573182A2 (en) 2007-12-18 2013-03-27 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial microRNAs
US8415526B2 (en) 2007-12-18 2013-04-09 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
EP2458010A1 (en) 2007-12-18 2012-05-30 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial microRNAs
US8273951B2 (en) 2007-12-18 2012-09-25 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US8536405B2 (en) 2007-12-18 2013-09-17 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial MicroRNAs
US8115055B2 (en) 2007-12-18 2012-02-14 E.I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US20110091975A1 (en) * 2007-12-18 2011-04-21 E.I.Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US8937217B2 (en) 2007-12-18 2015-01-20 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US20110033937A1 (en) * 2007-12-18 2011-02-10 E.I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
EP2270183A2 (en) 2007-12-18 2011-01-05 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial microRNAs
EP2261363A2 (en) 2007-12-18 2010-12-15 E. I. du Pont de Nemours and Company Down-regulation of gene expression using artificial mircoRNAa
WO2009079548A2 (en) 2007-12-18 2009-06-25 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US9546374B2 (en) 2007-12-18 2017-01-17 E I Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US20090155910A1 (en) * 2007-12-18 2009-06-18 E.I.Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
US9873765B2 (en) 2011-06-23 2018-01-23 Dsm Ip Assets, B.V. Biodegradable polyesteramide copolymers for drug delivery
US9598701B2 (en) 2012-01-23 2017-03-21 E I Du Pont De Nemours And Company Down-regulation of gene expression using artificial MicroRNAs for silencing fatty acid biosynthetic genes
WO2013112523A2 (en) 2012-01-23 2013-08-01 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial micrornas for silencing fatty acid biosynthestic genes

Also Published As

Publication number Publication date Type
CA2541914A1 (en) 2005-04-21 application
CA2541970A1 (en) 2005-06-09 application
WO2005052170A3 (en) 2005-10-06 application
US20140230088A1 (en) 2014-08-14 application
US20050120415A1 (en) 2005-06-02 application
US20120144527A1 (en) 2012-06-07 application
EP1711613B1 (en) 2013-04-10 grant
WO2005035769A3 (en) 2005-06-02 application
WO2005035769A2 (en) 2005-04-21 application
US8729339B2 (en) 2014-05-20 grant
EP1711613A2 (en) 2006-10-18 application
WO2005052170A2 (en) 2005-06-09 application
EP2361984A1 (en) 2011-08-31 application
CA2541914C (en) 2012-07-24 grant
US20060218673A9 (en) 2006-09-28 application

Similar Documents

Publication Publication Date Title
Preston et al. AtMYB32 is required for normal pollen development in Arabidopsis thaliana
Steindler et al. Shade avoidance responses are mediated by the ATHB-2 HD-zip protein, a negative regulator of gene expression
Aukerman et al. Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes
Papp et al. Evidence for nuclear processing of plant micro RNA and short interfering RNA precursors
Guo et al. A chemical‐regulated inducible RNAi system in plants
Liu et al. The ARGONAUTE10 gene modulates shoot apical meristem maintenance and establishment of leaf polarity by repressing miR165/166 in Arabidopsis
Guo et al. MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development
Zhu et al. Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa)
US20050155117A1 (en) Transcriptional regulation of plant disease tolerance
US20060008874A1 (en) Plant transcriptional regulators of abiotic stress
Li et al. PERSISTENT TAPETAL CELL 1 (PTC1) encodes a PHD-finger protein that is required for tapetal cell death and pollen development in rice
Chen et al. Viral virulence protein suppresses RNA silencing–mediated defense but upregulates the role of microRNA in host gene expression
US20060162018A1 (en) Plant transcriptional regulators of disease resistance
US20050097638A1 (en) Transcriptional regulation of plant biomass and abiotic stress tolerance
US20070220628A1 (en) Methods and compositions for in planta production of inverted repeats
US20090205063A1 (en) Plant polynucleotides for improved yield and quality
US20090293148A1 (en) Improved Methods Controlling Gene Expression
Mallory et al. MicroRNA-directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes
US20090265813A1 (en) Stress tolerance in plants
US20060021088A1 (en) Identification of novel e2f target genes and use thereof
Lee et al. Genome-wide expression profiling of ARABIDOPSIS RESPONSE REGULATOR 7 (ARR7) overexpression in cytokinin response
Kidner et al. The role of ARGONAUTE1 (AGO1) in meristem formation and identity
US6395962B1 (en) Enhancing expression of a silenced target sequence in plants using plant viral enhancers and amplicons
US20040268441A1 (en) Compositions and methods for the modulation of gene expression in plants
US20110167516A1 (en) Methods and compositions for the introduction and regulated expression of genes in plants