WO2008027592A2 - Phased small rnas - Google Patents

Phased small rnas


Publication number
WO2008027592A2 PCT/US2007/019283 US2007019283W WO2008027592A2 WO 2008027592 A2 WO2008027592 A2 WO 2008027592A2 US 2007019283 W US2007019283 W US 2007019283W WO 2008027592 A2 WO2008027592 A2 WO 2008027592A2
Grant status
Patent type
Prior art keywords
Prior art date
Application number
Other languages
French (fr)
Other versions
WO2008027592A3 (en )
WO2008027592A9 (en )
Edwards Allen
Liang Guo
Sara E. Heisel
Sergey I. Ivashuta
Yuanji I. Zhang
Original Assignee
Monsanto Technology, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date



    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8251Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
    • C12N15/8254Tryptophan or lysine
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8266Abscission; Dehiscence; Senescence
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827Flower development or morphology, e.g. flowering promoting factor [FPF]


This invention discloses recombinant DNA constructs encoding phased small RNAs useful in regulating expression of one or more genes of interest. Also disclosed by this invention are transgenic plant cells, plants, and seeds containing a recombinant DNA construct of this invention.




[0001] This application claims the benefit of priority of U. S. Provisional Patent Application 60/841,608, which was filed on 31 August 2006 and is incorporated by reference in its entirety herein. The sequence listing contained in the fileΛ'38-21(54702)A.ST25.txt" (file size of 21 KB in operating system MS-Windows, recorded on 31 August 2006, and filed with U. S. Provisional Patent Application 60/841,608 on 31 August 2006) is incorporated by reference in its entirety herein. The sequence listing contained in the file named "38- 21(55702)B.txt", which is 54 kilobytes (measured in operating system MS-Windows), recorded on 29 August 2007, and located in computer readable form on a compact disk (CD- R), is filed herewith and incorporated herein by reference.


[0002] This invention discloses recombinant DNA constructs and phased small RNAs useful in regulating expression of one or more genes of interest. Also disclosed by this invention are non-natural transgenic plant cells, plants, and seeds containing a recombinant DNA construct of this invention.


[0003] Methods of gene suppression include use of anti-sense, co-suppression, and RNA interference. Anti-sense gene suppression in plants is described by Shewmaker et al. in United States Patents 5,107,065, 5453,566, and 5,759,829. Gene suppression in bacteria using DNA which is complementary to mRNA encoding the gene to be suppressed is disclosed by Inouye et al. in United States Patents 5,190,931, 5,208,149, and 5,272,065. RNA interference or RNA-mediated gene suppression has been described by, e. g., Redenbaugh et al. in "Safety Assessment of Genetically Engineered Fruits and Vegetables", CRC Press, 1992; Chuang et al. (2000) PNAS, 97:4985-4990; and Wesley et al. (2001) Plant J., 27:581-590.

[0004] Several cellular pathways involved in RNA-mediated gene suppression have been described, each distinguished by a characteristic pathway and specific components. See, for example, the reviews by Brodersen and Voinnet (2006), Trends Genetics, 22:268-280, and Tomari and Zamore (2005) Genes & Dev., 19:517-529. The siRNA pathway involves the non- phased cleavage of a double-stranded RNA to small interfering RNAs ("siRNAs"). The microRNA pathway involves microRNAs ("miRNAs"), non-protein coding RNAs generally of between about 19 to about 25 nucleotides (commonly about 20 - 24 nucleotides in plants) that guide cleavage in trans of target transcripts, negatively regulating the expression of genes involved in various regulation and development pathways; see Ambros et al. (2003) RNA, 9:277-279. Plant miRNAs have been defined by a set of characteristics including a paired stem-loop precursor that is processed by DCLl to a single specific -21 -nucleotide miRNA, expression of a single pair of miRNA and miRNA* species from the double-stranded RNA precursor with two-nucleotide 3' overhangs, and silencing of specific targets in trans. See Bartel (2004) Cell, 116:281-297; Kim (2005) Nature Rev. MoI. Cell Biol, 6:376-385; Jones- Rhoades et al. (2006) Anna. Rev. Plant Biol, 57:19-53; Ambros et al. (2003) RNA, 9:277-279. In the trans-acting siRNA ("ta-siRNA") pathway, miRNAs serve to guide in-phase processing of siRNA primary transcripts in a process that requires an RNA-dependent RNA polymerase for production of a double-stranded RNA precursor; trans-acting siRNAs are defined by lack of secondary structure, a miRNA target site that initiates production of double-stranded RNA, requirements of DCL4 and an RNA-dependent RNA polymerase (RDR6), and production of multiple perfectly phased ~21-nt small RNAs with perfectly matched duplexes with 2- nucleotide 3' overhangs (see Allen et al. (2005) Cell, YIYWM-IIX).

[0005] This invention discloses a novel pathway for RNA-mediated gene suppression, based on an endogenous locus termed a "phased small RNA locus", which transcribes to an RNA transcript forming a single foldback structure that is cleaved in phase in vivo into multiple small double-stranded RNAs (termed "phased small RNAs") capable of suppressing a target gene. In contrast to siRNAs, a phased small RNA transcript is cleaved in phase. In contrast to miRNAs, a phased small RNA transcript is cleaved by DCL4 or a DCL4- like orthologous ribonuclease (not DCLl) to multiple abundant small RNAs capable of silencing a target gene. In contrast to the ta-siRNA pathway, the phased small RNA locus transcribes to an RNA transcript that forms hybridized RNA independently of an RNA- dependent RNA polymerase and without a miRNA target site that initiates production of double-stranded RNA. Novel recombinant DNA constructs that are designed based on a phased small RNA locus are useful for suppression of one or multiple target genes, without the use of miRNAs, ta-siRNAs, or expression vectors designed to form a hairpin structure for processing to siRNAs. Furthermore, the recognition sites corresponding to a phased small RNA are useful for suppression of a target sequence in a cell or tissue where the appropriate phased small RNA is expressed endogenously or as a transgene. SUMMARY OF THE INVENTION

[0006] In one aspect, this invention provides a recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression, preferably wherein the hybridized RNA is produced independently of an RNA-dependent RNA polymerase and is cleaved in phase in vivo by DCL4 or a DCL4-like ribonuclease (such as a DCL4 orthologue from any monocot or dicot plant).

[0007] Another aspect of this invention provides a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression.

[0008] In a further aspect, this invention provides a recombinant DNA construct including a promoter operably linked to DNA that transcribes to RNA including: (a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and (b) target RNA to be suppressed in the specific cell, wherein the target RNA is to be expressed in cells of the multicellular eukaryote other than the specific cell.

[0009] Other aspects of this invention are methods of use of the recombinant DNA constructs of this invention for providing protection to plants from pests or pathogens, as well as non-natural transgenic plant cells, plants, and seeds containing in their genome a recombinant DNA construct of this invention. Other specific embodiments of the invention are disclosed in the following detailed description.


[0010] Figure 1 depicts a non-limiting hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") of this invention, as described in Example 1.

[0011] Figure 2 depicts a non-limiting example of a genomic DNA sequence (SEQ ID NO. 9) including the cDNA sequence, intronic sequence, and foldback arms which transcribe to hybridized RNA of this invention, as described in Example 1. [0012] Figure 3 depicts results of gene silencing in maize embryos using a recombinant DNA construct including DNA that transcribes to RNA containing a recognition site corresponding to at least one phased small RNA of this invention, as described in Example 2.

[0013] Figure 4 depicts the results of northern blot analysis of tissue from developing maize kernels using a single oligonucleotide probe with sequence complementary to an endogenous phased small RNA, as described in Example 2.

[0014] Figure 5 depicts the predicted secondary structure of a phased small RNA template sequence (SEQ ID NO. 17) based on an endogenous phased small RNA locus, and of an engineered gene suppression construct (SEQ ID NO. 32) that is designed to suppress multiple target genes, as described in Example 3.

[0015] Figure 6 depicts the RNA transcript (SEQ ID NO. 34) containing hybridized RNA in a single foldback structure predicted from an endogenous phased small RNA locus (LOC_Osl2g42380.1|11982.m08017) having the sequence of SEQ ID NO. 33, as described in Example 4. This locus was identified from rice mature grain and seedling, and contained the phased small RNAs listed in Table 4. The transcript (SEQ ID NO.34) includes 5' flanking sequence (SEQ ID NO. 66) and 3' flanking sequence (SEQ ID NO. 67), and a spacer sequence (SEQ ID NO. 68), located between the 5' and 3' arms of the foldback structure. The 5' and 3' termini of the transcript are indicated at the top of the figure; at the bottom of the figure, the transcript is shown to have a compact turn or loop of only 3 nucleotides.

[0016] Figure 7A depicts the small RNA abundance in transcripts per quarter million sequences ("tpq") along about 2 kilobases of the phased small RNA locus having the sequence of SEQ ID NO. 33, as described in Example 4. Figure 7B depicts an expanded view of this small RNA region and the 21-nucleotide phasing of the small RNA abundance.

[0017] Figure 8 depicts results of studies further characterizing the Os06g21900 phased small RNA locus, as described in Example 5. Figure 8A depicts the transcript corresponding to a precursor cloned from the Os06g21900 phased sRNA locus. This precursor contained the phased small RNAs distributed between two regions along the transcript. Figure 8B depicts the two exons (Exons 2 and 3, indicated by the shaded regions) contained within this locus and that form a long, imperfect foldback structure containing eight 21-nucleotide phased small RNAs, separated by an ~1.2 kB intron. Figure 8C depicts results of Southern blot analysis confirming that expression of the phased small RNA from the Os06g21900 phased sRNA locus is found in rice grain but not rice seedlings or in other plant species tested. Figure 8D depicts results of Southern blot analysis of transformed Arabidopsis thaliana Columbia (Col-0) ecotype and mutants dcll-7 and dcl4-l; the blot was analyzed with probes corresponding to phased small RNAs "P7" (SEQ ID NO. 6), and "P5" (SEQ ID NO. 4), a canonical miRNA (miR173) and a trans-acting siRNA (ta-siR255). These results demonstrate that the Os06g21900 phased small RNA locus was efficiently processed in a dicot plant and required DCL4, not DCLl, to be cleaved in phase.

[0018] Figure 9 depicts the hybridized RNA structures predicted from transcripts of a naturally occurring phased small RNA locus and a synthetic phased small RNA locus, as described in Example 7. Figure 9A depicts the foldback structure of the transcript of the endogenous Os06g21900 phased small RNA locus (SEQ ID NO. 69); Figure 9B depicts the foldback structure of the synthetic phased small RNA precursor encoded by SEQ ID NO. 77.


[0019] Unless defined otherwise, all technical and scientific terms used have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used and the manufacture or laboratory procedures described below are well known and commonly employed in the art. Conventional methods are used for these procedures, such as those provided in the art and various general references. Unless otherwise stated, nucleic acid sequences in the text of this specification are given, when read from left to right, in the 5' to 3' direction. Nucleic acid sequences may be provided as DNA or as RNA, as specified; disclosure of one necessarily defines the other, as is known to one of ordinary skill in the art. Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term. The nomenclature used and the laboratory procedures described below are those well known and commonly employed in the art. Where there are discrepancies in terms and definitions used in references that are incorporated by reference, the terms used in this application shall have the definitions given. Other technical terms used have their ordinary meaning in the art that they are used, as exemplified by a variety of technical dictionaries. The inventors do not intend to be limited to a mechanism or mode of action. Reference thereto is provided for illustrative purposes only.


[0020] This invention provides a recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double- stranded RNAs for gene suppression. By "hybridized RNA" is meant RNA that has undergone Watson-Crick base-pairing between strands of RNA that are substantially complementary, thus forming RNA that is substantially, but preferably not completely, base-paired or annealed between strands; this is in contrast to conventional siRNA production from two perfectly or near-perfectly base-paired strands that form fully double-stranded RNA. In one preferred embodiment, "hybridized RNA" includes two single strands of RNA that are part of a single molecule, where the two single strands are substantially complementary and arranged anti- parallel to each other, thus allowing the two single strands to base-pair to each other; formation of the hybridized RNA occurs by intramolecular base-pairing. In an alternative embodiment, "hybridized RNA" includes two single strands of RNA that each are part of a separate molecule; formation of the hybridized RNA occurs by intermolecular base-pairing. In a particularly preferred embodiment, the recombinant DNA encodes an RNA transcript that forms a foldback structure including two anti-parallel single-stranded arms, wherein one arm is substantially but not perfectly complementary with the other arm, and base-pairing between the two arms of the foldback structure results in substantially but not perfectly double-stranded RNA that includes mismatches; preferably the mismatches are distributed along the length of the hybridized RNA (such as at least one mismatch within a given segment of 21 contiguous nucleotides), such as is depicted in Figure 1, Figure 6, and Figure 8B. Thus, in one preferred embodiment of this invention, the hybridized RNA includes a structure derived from a transcript of a naturally occurring phased small RNA locus, such as a structure selected from the structures depicted in Figure 1, Figure 5, Figure 6, and Figure 8B.

[0021] The hybridized RNA is produced independently of an RNA-dependent RNA polymerase; this is in contrast to irα/w-siRNA production wherein double-stranded RNA is formed through the action of an RNA-dependent RNA polymerase that synthesizes a complementary strand using the original RNA transcript as a template. Preferably, the nucleotides that form the hybridized RNA are nucleotides of the original RNA transcript (the "plus" strand) transcribed from the recombinant DNA construct, and not nucleotides on a second RNA molecule such as one (the "minus" strand) formed by the action of an RNA- dependent RNA polymerase on the original RNA transcript.

[0022] By "cleaved in phase" in vivo is meant that the hybridized RNA is enzymatically processed or "cut" in vivo into shorter segments wherein the site of cleavage is not randomly distributed along the hybridized RNA. The hybridized RNA is processed in vivo by a ribonuclease into multiple, shorter, substantially (but preferably not perfectly) double- stranded segments, that is to say, multiple small substantially double-stranded RNAs, which are arranged in a contiguous fashion, such as is depicted in Figure 1, Figure 6, and Figure 8B; this is in contrast to canonical microRNAs, wherein there is substantial accumulation of only a single mature microRNA from the precursor transcript. The ribonucleotide cleaves the hybridized RNA non-randomly, resulting in a frequency distribution of the multiple small double-stranded RNAs that is phased; this is in contrast to conventional siRNA production wherein the site of cleavage does not result in a phased frequency distribution of siRNAs. Preferably the phasing of this frequency distribution is about 21 nucleotides, such as is depicted in Figure 7. Thus, the multiple small double-stranded RNAs produced from a recombinant construct of this invention are termed "phased small RNAs". The term "phased small RNAs" is also applied to a single strand of the pair of strands that forms a given small double-stranded RNA produced from a recombinant construct of this invention; in a preferred embodiment, one strand of the pair accumulates to a greater level than the other.

[0023] In a preferred embodiment, the hybridized RNA is cleaved in phase in vivo by a ribonuclease other than a DCLl ribonuclease. IrI a most preferred embodiment, the hybridized RNA is cleaved in phase in vivo by DCL4 or a DCL4-like ribonuclease (such as a DCL4 orthologue from any monocot or dicot plant, such as, but not limited to, plants of commercial or agricultural interest, such as crop plants (especially crop plants used for human food or animal feed), wood-, fiber-, pulp-, or cellulose-producing trees and plants, vegetable plants, fruit plants, and ornamental plants, such as those listed below under the heading "Making and Using Transgenic Plant Cells and Transgenic Plants") into multiple small double- stranded RNAs ("phased small RNAs") for gene suppression.

[0024] In a preferred embodiment hybridized RNA is cleaved in phase in vivo to at least three small double-stranded RNAs ("phased small RNA"). Various embodiments encompassed by this invention include recombinant DNA constructs that give rise to 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or even more phased small RNAs, respectively.

[0025] Each phased small RNA is contiguous to the next; non-limiting examples of this arrangement are depicted in Figure 1, Figure 6, and Figure 8B. Each phased small RNA includes two anti-parallel RNA segments, each of which contains from about 20 to about 27 nucleotides (e. g., 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides). The base-pairing between the two anti-parallel RNA segments is sufficient for them to form a substantially double-stranded RNA. In a preferred embodiment, each small double-stranded RNA or phased small RNA includes at least one mismatch. A mismatch generally includes one or more non-base-paired nucleotides (on either or on both segments), forming a "bump" or "bulge" or "loop" within the otherwise base-paired double-stranded RNA. In a preferred embodiment, each phased small RNA includes one or more unpaired bases forming an overhang at one or at both ends; most preferably the overhang is a 2-nucleotide overhang such as is depicted in Figure 1, Figure 6, and Figure 8B. [0026] Each phased small RNA preferably is capable of suppressing a target gene. In one embodiment, the gene suppression by the phased small RNAs is of one target gene; for example, each phased small RNA suppresses the same segment of a single target gene or different segments of a single target gene. In another embodiment, the gene suppression by the phased small RNAs is of multiple target genes. While the inventors do not limit themselves to any single mechanism of action, it is most preferred that one of the two anti-parallel strands that makes up each phased small RNA is substantially complementary, or near perfectly complementary, or even perfectly complementary, to a target gene or sequence, as described below under the heading "Target Genes", which also provides a detailed discussion of suitable target genes.

[0027] In a preferred embodiment of this invention, the recombinant DNA construct includes a nucleotide sequence derived from a phased small RNA template sequence selected from the group consisting of SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 17, SEQ ID NO. 33, the DNA sequence encoding SEQ ID NO. 34, and SEQ ID NO. 69, wherein at least one segment of 21 contiguous nucleotides in the phased small RNA template sequence is modified to suppress a target gene (that is, modified to suppress a gene other than the native target of the native phased small RNA). In a preferred embodiment of this invention, the recombinant DNA construct includes a nucleotide sequence derived from a phased small RNA template sequence selected from the group consisting of SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 17, SEQ ID NO. 33, the DNA sequence encoding SEQ ID NO. 34, and SEQ ID NO. 69, wherein multiple segments of about 20 to about 28 (e. g., 20, 21, 22, 23, 24, 25, 26, 27, or 28) contiguous nucleotides are modified such that the transcript is cleaved in phase in vivo to multiple synthetic phased small RNAs that suppress a target gene.

[0028] In another preferred embodiment of this invention, the recombinant DNA construct includes at least one nucleotide sequence selected from the group consisting of SEQ ID NO. 18, SEQ ID NO. 23, SEQ ID NO. 27, the DNA sequence encoding SEQ ID NO. 66, the DNA sequence encoding SEQ ID NO.67, and the DNA sequence encoding SEQ ID NO. 68.


[0029] Another aspect of this invention provides a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA . segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression. This recombinant DNA construct can include a naturally occurring phased small RNA locus, such as is described in this disclosure, or can include a non-naturally occurring, synthetic sequence. Most preferably, the hybridized RNA is cleaved in phase by DCL4 or a DCL4-like ribonuclease (such as a DCL4 orthologue from any monocot or dicot plant, such those listed below under the heading "Making and Using Transgenic Plant Cells and Transgenic Plants").

[0030] In preferred embodiments of the recombinant DNA construct, each of the RNA segments consists of between 20 to 27 nucleotides. In a particularly preferred embodiment, the first and second series include RNA segments of 21 nucleotides. Each pair of small RNAs that make up a given small double-stranded RNA ("phased small RNA") can be of the same length, or can be of different lengths, such as illustrated in Figure 8B and Table 4. In a preferred embodiment, the pair of small RNAs that make up a given small double-stranded RNA ("phased small RNA") is a pair of 21-nucleotide small RNAs. In one embodiment, the contiguous RNA segments are all of the same size. In a preferred embodiment, the RNA segments all consist of 21 nucleotides. In another embodiment, the RNA segments vary in size; preferably they are sized such that when the first series and second series of contiguous RNA segments hybridize, the individual segments are aligned in a manner permitting cleavage in phase to the intended small double-stranded RNAs. In a preferred embodiment, the first and second series of contiguous RNA segments contain an equal number of RNA segments which are arranged such that when the first series and second series of contiguous RNA segments hybridize and form an RNA duplex (hybridized RNA), a RNA segment of a given size in the first series is hybridized to a corresponding RNA segment in the second series of equivalent size.

[0031] In a preferred embodiment of the recombinant DNA construct, strands of the hybridized RNA are located on a single molecule and the construct further includes DNA that transcribes to a spacer that links the first and second series of contiguous RNA segments. The spacer generally includes DNA that does not correspond to the target gene (although in some embodiments can include sense or anti-sense sequence of the target gene). The spacer includes at least about 4 nucleotides; in various embodiments, the spacer contains at least about 4, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 80, at least about 100, at least about 120, or at least about 150 nucleotides. In one embodiment, the spacer is a contiguous nucleotide sequence derived from the spacer of a transcript of a naturally occurring phased small RNA locus. Non-limiting examples of spacers are provided by SEQ ID NO. 23 and SEQ ID NO. 68 as well as spacers having at least 90% sequence identity with either of SEQ ID NO. 23 and SEQ ID NO. 68.

[0032] In one embodiment, the spacer is designed to transcribed to single-stranded RNA or to at least partially double-stranded RNA (such as in a "kissing stem-loop" arrangement), or to an RNA that assumes a secondary structure or three-dimensional configuration (e. g., a large loop of anti-sense sequence of the target gene or an aptamer) that confers on the transcript an additional desired characteristic, such as increased stability, increased half-life in vivo, or cell or tissue specificity. In one example, the spacer is transcribed to a stabilizing loop that links the first and second series of contiguous RNA segments (see, for example, Di Giusto and King (2004) J. Biol. Chem., 279:46483-46489). In another example, the spacer transcribes to RNA including an RNA aptamer (e. g., an aptamer that binds to a cell-specific ligand) that allows cell- or tissue-specific targetting of the phased small RNAs.

[0033] In many embodiments, the recombinant DNA construct further includes DNA encoding 5' flanking sequence (e. g., SEQ ID NO. 18 and SEQ ID NO.66) and/or 3' flanking sequence (e. g., SEQ ID NO.27 and SEQ ID NO. 67) that are adjacent to the portion of the transcript that is the hybridized RNA. Li other embodiments of the recombinant DNA construct, the strands of the hybridized RNA are located on separate molecules. Preferred embodiments of the invention include a recombinant DNA construct including at least one nucleotide sequence derived from a transcript of a naturally occurring phased small RNA locus selected from the group consisting of 5' flanking sequence, 3' flanking sequence, and spacer sequence. Non-limiting embodiments include a recombinant DNA construct including at least one nucleotide sequence selected from the group consisting of SEQ ID NO. 18, SEQ ID NO. 23, SEQ ID NO. 27, the DNA sequence encoding SEQ ID NO. 66, the DNA sequence encoding SEQ ID NO. 67, and the DNA sequence encoding SEQ ID NO. 68. Additional embodiments of the invention include a recombinant DNA construct including at least one nucleotide sequence having at least 90% sequence identity with any of SEQ ID NO. 18, SEQ ID NO. 23, SEQ ID NO.27, the DNA sequence encoding SEQ ID NO. 66, the DNA sequence encoding SEQ ID NO. 67, and the DNA sequence encoding SEQ ID NO. 68.

[0034] Recombinant DNA constructs of this invention are designed to suppress one or more target genes as described below under the heading "Target Genes". The construct is designed so that each RNA segment of the first series hybridizes to an RNA segment of the second series; the transcript transcribed from the construct is cleaved in phase in vivo, resulting in multiple small double-stranded RNAs ("phased small RNAs") which correspond to the paired hybridized RNA segments. Preferably, each of the phased small RNAs contains at least one mismatch. A mismatch generally includes one or more non-base-paired nucleotides (on either or on both segments), forming a "bump" or "bulge" or "loop" within the otherwise base- paired double-stranded RNA. In a preferred embodiment, each phased small RNA includes one or more unpaired bases forming an overhang at one or at both ends; most preferably the overhang is a 2-nucleotide overhang such as is depicted in Figure 1, Figure 6, and Figure 8B. In a preferred embodiment, at least one of the phased small RNAs is designed to suppress one or more target genes; that is, one of the two anti-parallel strands that makes up the phased small RNA is substantially complementary to a target gene.

[0035] The first and second series of contiguous RNA segments are designed so that when the first series and second series of contiguous RNA segments hybridize and form an RNA duplex (hybridized RNA), the small double-stranded RNAs resulting from cleavage in- phase of the hybridized RNA silence the target gene or genes. Most preferably, the secondary structure of the transcript is maintained so as to be substantially similar to that of a naturally occurring phased small RNA locus (e. g., as depicted in Figure 1, Figure 6, and Figure 8B).

[0036] A general method for designing RNA segments corresponding to phased small RNAs for silencing a target gene, useful in making a recombinant DNA construct of this invention, includes the steps:

(a) Selecting a unique target sequence of at least 18 nucleotides specific to the target gene, e. g. by using sequence alignment tools such as BLAST (see, for example, Altschul et al. (1990) J. MoI. Biol., 215:403-410; Altschul et al. (1997) Nucleic Acids Res., 25:3389-3402), for example, of both maize cDNA and genomic DNA databases, to identify target transcript orthologues and any potential matches to unrelated genes, thereby avoiding unintentional silencing of non-target sequences.

(b) Analyzing the target gene for undesirable sequences (e. g., matches to sequences from non-target species, especially animals), and score each potential 19-mer segment for GC content, Reynolds score (see Reynolds et al. (2004) Nature BiotechnoL, 22:326-330), and functional asymmetry characterized by a negative difference in free energy ("MG") (see Khvorova et al. (2003) Cell, 115:209-216). Preferably 19-mers are selected that have all or most of the following characteristics: (1) a Reynolds score >4, (2) a GC content between about 40% to about 60%, (3) a negative ΔΔG, (4) a terminal adenosine, (5) lack of a consecutive run of 4 or more of the same nucleotide; (6) a location near the 3' terminus of the target gene; (7) minimal differences from the engineered phased siRNA precursor transcript. Preferably multiple (3 or more) 19-mers are selected for testing. (c) Determining the reverse complement of the selected 19-mers to use in making a synthetic 21-mer phased small RNAs\; the additional nucleotide at position

20 is preferably matched to the selected target sequence, and the nucleotide at position

21 is preferably chosen to be unpaired to prevent spreading of silencing on the target transcript;

(d) Testing the synthetic phased small RNAs, for example, in an Agrobacterium-mediaΛed transient Nicotiαnα benthαmiαnα assay for siRNA expression and target repression. and (e) Cloning the most effective phased small RNAs into a construct for stable transformation of maize (see the sections under the headings "Making and Using Recombinant DNA Constructs" and "Making and Using Transgenic Plant Cells and Transgenic Plants").

[0037] The recombinant DNA construct is made by commonly used techniques, such as those described under the heading "Making and Using Recombinant DNA Constructs" and illustrated in the working Examples. The recombinant DNA construct is particularly useful for making transgenic plant cells, transgenic plants, and transgenic seeds as discussed below under 'Transgenic Plant Cells and Transgenic Plants".


[0038] Another aspect of this invention includes a recombinant DNA construct including a promoter operably linked to DNA that transcribes to RNA including: (a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and (b) target RNA to be suppressed in the specific cell, wherein the target RNA is to be expressed in cells of the multicellular eukaryote other than the specific cell. The exogenous recognition site includes an RNA sequence that is substantially complementary, or near perfectly complementary, or even perfectly complementary, to a phased small RNA; the exogenous recognition site hybridizes to the phased small RNA, leading to suppression or silencing of the target RNA. The phased small RNA can be transcribed from a native or endogenous phased small RNA locus, or from a synthetic phased small RNA locus that is transgenically expressed. In various embodiments of the recombinant DNA construct, the at least one exogenous recognition site is located within at least one of: (a) the 5' untranslated region of the target RNA; (b) the 3' untranslated region of the target RNA; and (c) the target RNA. [0039] In non-limiting embodiments, the exogenous recognition site is recognized by and silenced by a phased small RNA having a nucleotide sequence selected from the group consisting of SEQ ID NOS. I1 2, 3, 4, 5, 6, 7, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, and 65. In preferred embodiments, the exogenous recognition site is recognized by and silenced by a phased small RNA having a nucleotide sequence selected from the group consisting of SEQ ID NOS. 1, 2, 3, 4, 5, 6, 7, 35, 37, 38, 39, 40, 41, 42, 43, 45, 46, 49, 51, 52, 53, 54, 55, 56, 60, 61, 62, 63, 64, and 65. In a particularly preferred embodiment, the exogenous recognition site is recognized by and silenced by a phased small RNA having a nucleotide sequence selected from the group consisting of SEQ ID NOS. 1, 2, 3, 4, 5, 6, 7, 37, 38, 40, 41, 46, 61, 62, 63, 64, and 65.


[0040] A further aspect of this invention provides a non-natural transgenic plant cell having in its genome any of the recombinant DNA constructs of this invention. Thus, the inventors claim a non-natural transgenic plant cell having in its genome a recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression. The inventors also claim a non-natural transgenic plant cell having in its genome a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression. The inventors further claim a non-natural transgenic plant cell having in its genome a recombinant DNA construct including a promoter operably linked to DNA that transcribes to RNA including: (a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and (b) target RNA to be suppressed in the specific cell, wherein the target RNA is to be expressed in cells of the multicellular eukaryote other than the specific cell.

[0041] Also provided are a non-natural transgenic plant containing the non-natural transgenic plant cell of this invention, a non-natural transgenic plant grown from the non- natural transgenic plant cell of this invention, and non-natural transgenic seed produced by the non-natural transgenic plants. The non-natural transgenic plant of this invention includes plants of any developmental stage, and includes a non-natural transgenic regenerated plant prepared from the non-natural transgenic plant cells disclosed herein, or a non-natural transgenic progeny plant (which can be an inbred or hybrid progeny plant) of the regenerated plant, or non-natural transgenic seed of such a non-natural transgenic plant. Also provided and claimed is a non-natural transgenic seed having in its genome a recombinant DNA construct of this invention. The non-natural transgenic plant cells, non-natural transgenic plants, and non- natural transgenic seeds of this invention are made by methods well-known in the art, as described below under the heading "Making and Using Transgenic Plant Cells and Transgenic Plants".

[0042] The non-natural transgenic plant cell can include an isolated plant cell (e. g., individual plant cells or cells grown in or on an artificial culture medium), or can include a plant cell in undifferentiated tissue (e. g., callus or any aggregation of plant cells). The non- natural transgenic plant cell can include a plant cell in at least one differentiated tissue selected from the group consisting of leaf (e. g., petiole and blade), root, stem (e. g., tuber, rhizome, stolon, bulb, and corm) stalk (e. g., xylem, phloem), wood, seed, fruit (e. g., nut, grain, fleshy fruits), and flower (e. g., stamen, filament, anther, pollen, carpel, pistil, ovary, ovules).

[0043] The non-natural transgenic plant cell or non-natural transgenic plant of the invention can be any suitable plant cell or plant of interest. Both transiently transformed and stably transformed plant cells are encompassed by this invention. Stably transformed transgenic plants are particularly preferred. In many preferred embodiments, the non-natural transgenic plant is a fertile transgenic plant from which seed can be harvested, and the invention further claims non-natural transgenic seed of such transgenic plants, wherein the seed preferably also contains the recombinant construct of this invention.

[0044] In some embodiments of this invention, the non-natural plant is a non-natural transgenic plant, and all cells (with the possible exception of haploid cells) and tissues of the plant contain the recombinant DNA construct of this invention. In other embodiments, the non-natural plant is not completely transgenic, but includes both non-natural transgenic cells or tissues and non-transgenic cells or tissues (for example, transgenic tissue grafted onto non- transgenic tissue). In a non-limiting embodiment, the plant includes a non-transgenic scion and a transgenic rootstock including the transgenic plant cell, wherein the non-transgenic scion and transgenic rootstock are grafted together. Such embodiments are particularly useful where the plant is one that is commonly vegetatively grown as a scion grafted onto a rootstock (wherein scion and rootstock can be of the same species or variety or of different species or variety); non-limiting examples include grapes (e. g., wine grapes and table grapes), apples, pears, quince, avocados, citrus, stone fruits (e. g., peaches, plums, nectarines, apricots, cherries), kiwifruit, roses, and other plants of agricultural or ornamental importance.

[0045] Also encompassed by this invention are non-natural plants that are not transgenic in the sense of having had recombinant DNA introduced into their genome, but are non-natural plants having a genome that has been artificially modified by means other than recombinant DNA technology. Such artificial modifications of the native genomic sequence include insertions, deletions, substitutions, frame shifts, transpositions, duplications, and inversions. Artificial modification of a native genomic sequence is achieved by any means, including mutagenesis by chemicals (such as methane sulfonate, methyl methane sulfonate, diethylsulfate), nitrosoguanidine, and other alkylating agents, base analogues such as 5-bromo- deoxyuridine, interchelating agents such as ethidium bromide, crosslinking agents such as platinum, and oxidating agents such as nitrous acid or reactive oxygen species) or mutagenesis by physical treatments (such as exposure to ultraviolet light, radioactive isotopes, or ionizing radiation). Such mutagenesis can be random or non-random (e. g., site-directed mutagenesis). Mutagenesis can be carried out with intact plants, plant tissues, or plant cells. One non- limiting example of mutagenesis is treatment of maize pollen with an alkylating agent. Mutagenesis is generally carried out on a population, following screening of that population to allow selection of individuals having the desired property. These non-natural plants are useful in ways similar to those described below for transgenic plants; for example, they can be grown for production of seed or other harvestable parts, or used to grow progeny generations (including hybrid generations).

Target Genes

[0046] Phased small RNAs of this invention and the recombinant DNA constructs encoding such can be designed to suppress any target gene or genes. The target gene can be translatable (coding) sequence, or can be non-coding sequence (such as non-coding regulatory sequence), or both, and can include at least one gene selected from the group consisting of a eukaryotic target gene, a non-eukaryotic target gene, a microRNA precursor DNA sequence, and a microRNA promoter. The target gene can be native or endogenous to the cell (e. g., a cell of a plant or animal) in which the recombinant DNA construct is transcribed, or can be native to a pest or pathogen of the plant or animal in which the recombinant DNA construct is transcribed. The target gene can be an exogenous gene, such as a transgene in a plant. A target gene can be a native gene targetted for suppression, with or without concurrent expression of an exogenous transgene, for example, by including a gene expression element in the recombinant DNA construct from which the phased small RNAs are transcribed, or in a separate recombinant DNA construct. For example, it can be desirable to replace a native gene with an exogenous transgene homologue.

[0047] The target gene can include a single gene or part of a single gene that is targetted for suppression, or can include, for example, multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species. A target gene can include any sequence from any species (including, but not limited to, non-eukaryotes such as bacteria, and viruses; fungi; plants, including monocots and dicots, such as crop plants, ornamental plants, and non-domesticated or wild plants; invertebrates such as arthropods, annelids, nematodes, and molluscs; and vertebrates such as amphibians, fish, birds, domestic or wild mammals, and even humans.

[0048] In one embodiment, the target gene is exogenous to the plant in which the recombinant DNA construct is to be transcribed, but endogenous to a pest or pathogen (e. g., viruses, bacteria, fungi, oomycetes, and invertebrates such as insects, nematodes, and molluscs) of the plant. The target gene can include multiple target genes, or multiple segments of one or more genes. In one preferred embodiment, the target gene or genes is a gene or genes of an invertebrate pest or pathogen of the plant. These embodiments are particularly useful in providing transgenic plants having resistance to one or more plant pests or pathogens, for example, resistance to a nematode such as soybean cyst nematode or root knot nematode, or to a pest insect, or to at least one pathogenic virus, bacterium, or fungus.

[0049] The target gene can be translatable (coding) sequence, or can be non-coding sequence (such as non-coding regulatory sequence), or both. Non-limiting examples of a target gene include non-translatable (non-coding) sequence, such as, but not limited to, 5' untranslated regions, promoters, enhancers, or other non-coding transcriptional regions, 3' untranslated regions, terminators, and introns. Target genes include genes encoding microRNAs, small interfering RNAs, RNA components of ribosomes or ribozymes, small nucleolar RNAs, and other non-coding RNAs (see, for example, non-coding RNA sequences provided publicly at rfam.wustl.edu; Erdmann et al. (2001) Nucleic Acids Res., 29: 189-193; Gottesman (2005) Trends Genet., 21:399-404; Griffiths- Jones et al. (2005) Nucleic Acids Res., 33: 121-124). One specific example of a target gene includes a microRNA recognition site (that is, the site on an RNA strand to which a mature miRNA binds and induces cleavage). Another specific example of a target gene includes a microRNA precursor sequence native to a pest or pathogen of the transgenic plant, that is, the primary transcript encoding a microRNA, or the RNA intermediates processed from this primary transcript (e. g., a nuclear-limited pri- miRNA or a pre-miRNA which can be exported from the nucleus into the cytoplasm). See, for example, Lee et al (2002) EMBO Journal, 21:4663-4670; Reinhart et al. (2002) Genes & Dev., 16:161611626; Lund et al. (2004) Science, 303:95-98; and Millar and Waterhouse (2005) Funct. Integr Genomics, 5:129-135. Target genes can also include translatable (coding) sequence for genes encoding transcription factors and genes encoding enzymes involved in the biosynthesis or catabolism of molecules of interest (such as, but not limited to, amino acids, fatty acids and other lipids, sugars and other carbohydrates, biological polymers, and secondary metabolites including alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin).

[0050] In many preferred embodiments, the target gene is an essential gene of a plant pest or pathogen. Essential genes include genes that are required for development of the pest or pathogen to a fertile reproductive adult. Essential genes include genes that, when silenced or suppressed, result in the death of the organism (as an adult or at any developmental stage, including gametes) or in the organism's inability to successfully reproduce (e. g., sterility in a male or female parent or lethality to the zygote, embryo, or larva). A description of nematode essential genes is found, e. g., in Kemphues, K. "Essential Genes" (December 24, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.57.1, available on line at www.wormbook.org. Non-limiting examples of nematode essential genes include major sperm protein, RNA polymerase π, and chitin synthase (see, e. g., U. S. Patent Application Publication US20040098761 Al); additional soybean cyst nematode essential genes are provided in U. S. Patent Application 11/360,355, filed 23 February 2006, incorporated by reference herein. A description of insect genes is publicly available at the Drosophila genome database (available on line at flybase.bio.indiana.edu/). The majority of predicted Drosophila genes have been analyzed for function by a cell culture-based RNA interference screen, resulting in 438 essential genes being identified; see Boutros et al. (2004) Science, 303:832-835, and supporting material available on line at www.sciencemag.org/cgi/content/full/303/5659/832/DCl. A description of bacterial and fungal essential genes is provided in the Database of Essential Genes ("DEG", available on line at tubic.tju.edu.cn/deg/); see Zhang et al. (2004) Nucleic Acids Res., 32:D271- D272.

[0051] Plant pest invertebrates include, but are not limited to, pest nematodes, pest molluscs (slugs and snails), and pest insects. Plant pathogens of interest include fungi, oomycetes, bacteria (e. g., the bacteria that cause leaf spotting, fireblight, crown gall, and bacterial wilt), mollicutes, and viruses (e. g., the viruses that cause mosaics, vein banding, flecking, spotting, or abnormal growth). See also G. N. Agrios, "Plant Pathology" (Fourth Edition), Academic Press, San Diego, 1997, 635 pp., for descriptions of fungi, bacteria, mollicutes (including mycoplasmas and spiroplasmas), viruses, nematodes, parasitic higher plants, and flagellate protozoans, all of which are plant pests or pathogens of interest. See also the continually updated compilation of plant pests and pathogens and the diseases caused by such on the American Phytopathological Society's "Common Names of Plant Diseases", compiled by the Committee on Standardization of Common Names for Plant Diseases of The American Phytopathological Society, 1978-2005, available online at www.apsnet.org/online/common/top.asp.

[0052] Non-limiting examples of fungal plant pathogens of particular interest include, e. g., the fungi that cause powdery mildew, rust, leaf spot and blight, damping-off, root rot, crown rot, cotton boll rot, stem canker, twig canker, vascular wilt, smut, or mold, including, but not limited to, Fusarium spp., Phakospora spp., Rhizoctonia spp., Aspergillus spp., Gibberella spp., Pyricularia spp., and Alternaria spp.. Specific examples of fungal plant pathogens include Phakospora pachirhizi (Asian soy rust), Puccinia sorghi (corn common rust), Puccinia polysora (corn Southern rust), Fusarium oxysporum and other Fusarium spp., Alternaria spp., Penicillium spp., Rhizoctonia solani, Exserohilum turcicum (Northern corn leaf blight), Bipolaris maydis (Southern corn leaf blight), Ustilago maydis (corn smut), Fusarium graminearum (Gibberella zeae), Fusarium verticilliodes (Gibberella moniliformis), F. proliferatum (G. fujikuroi var. intermedia), F. subglutinans (G. subglutinans), Diplodia maydis, Sporisorium holci-sorghi, Colletotrichum graminicola, Setosphaeria turcica, Aureobasidium zeae, Sclerotinia sclerotiorum, and the numerous fungal species provided in Tables 4 and 5 of U. S. Patent 6,194,636, which is incorporated in its entirety by reference herein. Non-limiting examples of plant pathogens include pathogens previously classified as fungi but more recently classified as oomycetes. Specific examples of oomycete plant pathogens of particular interest include members of the genus Pythium (e. g., Pythium aphanidermatum) and Phytophthora (e. g., Phytophthora infestans, Phytophthora sojae,) and organisms that cause downy mildew (e. g., Peronospora farinosa).

[0053] Non-limiting examples of bacterial pathogens include the mycoplasmas that cause yellows disease and spiroplasmas such as Spiroplasma kunkelii, which causes corn stunt, eubacteria such as Pseudomonas avenae, Pseudomonas andropogonis, Erwinia stewartii, Pseudomonas syringae pv. syringae, Xylella fastidiosa, and the numerous bacterial species listed in Table 3 of U. S. Patent 6,194,636, which is incorporated in its entirety by reference herein.

[0054] Non-limiting examples of viral plant pathogens of particular interest include maize dwarf mosaic virus (MDMV), sugarcane mosaic virus (SCMV, formerly MDMV strain B), wheat streak mosaic virus (WSMV), maize chlorotic dwarf virus (MCDV), barley yellow dwarf virus (BYDV), banana bunchy top virus (BBTV), and the numerous viruses listed in Example 7 below and in Table 2 of U. S. Patent 6,194,636, which is incorporated in its entirety by reference herein. [0055] Non-limiting examples of invertebrate pests include cyst nematodes Heterodera spp. especially soybean cyst nematode Heterodera glycines, root knot nematodes Meloidogyne spp., lance nematodes Hoplolaimus spp., stunt nematodes Tylenchorhynchus spp., spiral nematodes Helicotylenchus spp., lesion nematodes Pratylenchus spp., ring nematodes Criconema spp., foliar nematodes Aphelenchus spp. or Aphelenchoides spp., corn rootworms, Lygus spp., aphids and similar sap-sucking insects such as phylloxera (Daktulosphaira vitifoliae), corn borers, cutworms, armyworms, leafhoppers, Japanese beetles, grasshoppers, and other pest coleopterans, dipterans, and lepidopterans. Specific examples of invertebrate pests include pests capable of infesting the root systems of crop plants, e. g., northern corn rootworm (Diabrotica barberi), southern corn rootworm (Diabrotica undecimpunctatά), Western corn rootworm (Diabrotica virgifera), corn root aphid (Anuraphis maidiradicis), black cutworm (Agrotis ipsiloή), glassy cutworm (Crymodes devastator), dingy cutworm (Feltia ducens), claybacked cutworm {Agrotis gladiariά), wireworm (Melanotus spp., Aeolus mellillus), wheat wireworm {Aeolus mancus), sand wireworm (Horistonotus uhleriϊ), maize billbug (Sphenophorus maidis), timothy billbug (Sphenophorus zeae), bluegrass billbug (Sphenophorus parvulus), southern corn billbug (Sphenophorus callosus), white grubs (Phyllophaga spp.), seedcorn maggot (Delia platura), grape colaspis (Colaspis brunnea), seedcorn beetle (Stenolophus leconteϊ), and slender seedcorn beetle (Clivinia impressifrons), as well as the parasitic nematodes listed in Table 6 of U. S. Patent 6,194,636, which is incorporated in its entirety by reference herein.

[0056] Invertebrate pests of particular interest, especially in but not limited to southern hemisphere regions (including South and Central America) include aphids, corn rootworms, spodoptera, noctuideae, potato beetle, Lygus spp., any hemipteran, homopteran, or heteropteran, any lepidopteran, any coleopteran, nematodes, cutworms, earworms, armyworms, borers, leaf rollers, and others. Arthropod pests specifically encompassed by this invention include various cutworm species including cutworm (Agrotis repletά), black cutworm (Agrotis ipsiloή), cutworm (Anicla ignicans), granulate cutworm (Feltia subterraneά), "gusano άspero" (Agrotis malefida); Mediterranean flour moth (Anagasta kuehniella), square-necked grain beetle (Cathartus quadricollis), flea beetle (Chaetocnema spp), rice moth (Corey ra cephalonica), corn rootworm or "vaquita de San Antonio" (Diabotica speciosa), sugarcane borer (Diatraea saccharalis), lesser cornstalk borer (Elasmopalpus lignosellus), brown stink bug (Euschistus spp.), corn earworm (Helicoverpa zed), flat grain beetle (Laemophloeus minutus), grass looper moth (Mods latipes), sawtoothed grain beetle (Oryzaephilus surinamensis), meal moth (Pyralis farinalis), Indian meal moth (Plodia interpunctella), corn leaf aphid (Rhopalosiphum maidis), brown burrowing bug or "chinche subterrάnea" (Scaptocoris castaneά), greenbug (Schizaphis graminum), grain weevil (βitophilus zeamais), Angoumois grain moth (Sitotroga cerealellά), fall armyworm (Spodoptera frugiperda), cadelle beetle (Tenebroides mauritanicus), two-spotted spider mite (Tetranychus urticae), red flour beetle (Triboleum castaneum), cotton leafworm (Alabama argillacea), boll weevil (Anthonomus grandis), cotton aphid (Aphis gossypiϊ), sweet potato whitefly (Bemisia tabaci), various thrips species (Frankliniella spp.), cotton earworm (Helicoverpa zeά), "oruga bolillera" (e. g., Helicoverpa geletopoeoή), tobacco budworm (Heliothis virescens), stinkbug (Nezara viridulά), pink bollworm (Pectinophora gossypiella), beet armyworm (Spodoptera exigua), spider mites (Tetranychus spp.), onion thrips (Thrips tabaci), greenhouse whitefly (Trialeurodes vaporarium), velvetbean caterpillar (Anticarsia gemmatalis), spotted maize beetle or "astilo moteado" (Astylus atromaculatus), "ontga de Ia alfalfa' (Colias lesbid), "chinche marrόή" or "chinche de los cuernos" (Dichelops furcatus), "alquiche chico" (Edessa miditabundd), blister beetles (Epicauta spp.)» "barrenador del brote" (Epinotia aporema), "oruga verde del yuyo Colorado" (Loxostege bifidalis), rootknot nematodes (Meloidogyne spp.), "oruga cuarteadora" (Mods repanda), southern green stink bug (Nezara viridula), "chinche de Ia alfalfa" (Piezodorus guildinii), green cloverworm (Plathypena scabrά), soybean looper (Pseudoplusia includens), looper moth "isoca medidora del girasol" (Rachiplusia nu), yellow woolybear (Spilosoma virginicά), yellowstriped armyworm (Spodoptera ornithogalli),vaήous root weevils (family Curculionidae), various wireworms (family Elateridae), and various white grubs (family Scarabaeidae). Nematode pests specifically encompassed by this invention include nematode pests of maize (Belonolαimus spp., Trichodorus spp., Longidorus spp., Dolichodorus spp., Anguinα spp., Prαtylenchus spp., Meloidogyne spp., Heteroderα spp.), soybean (Heteroderα glycines, Meloidogyne spp., Belonolαimus spp.), bananas (Rαdopholus similis, Meloidogyne spp., Helicotylenchus spp.), sugarcane (Heteroderα sαcchαri, Prαtylenchus spp., Meloidogyne spp.), oranges (Tylenchulus spp., Rαdopholus spp., Belonolαimus spp., Prαtylenchus spp., Xiphinemα spp.), coffee (Meloidogyne spp., Prαtylenchus spp.), coconut palm (Bursαphelenchus spp.), tomatoes (Meloidogyne spp., Belonolαimus spp., Nαcobbus spp.), grapes (Meloidogyne spp., Xiphinemα spp., Tylenchulus spp., Criconemellα spp.), lemon and lime (Tylenchulus spp., Rαdopholus spp., Belonolαimus spp., Prαtylenchus spp., Xiphinemα spp.), cacao (Meloidogyne spp., Rotylenchulus reniformis), pineapple (Meloidogyne spp., Prαtylenchus spp., Rotylenchulus reniformis), papaya (Meloidogyne spp., Rotylenchulus reniformis), grapefruit (Tylenchulus spp., Rαdopholus spp. Belonolαimus spp., Prαtylenchus spp., Xiphinemα spp., and broad beans (Meloidogyne spp.). [0057] Target genes from pests can include invertebrate genes for major sperm protein, alpha tubulin, beta tubulin, vacuolar ATPase, glyceraldehyde-3-phosphate dehydrogenase, RNA polymerase π, chitin synthase, cytochromes, miRNAs, miRNA precursor molecules, miRNA promoters, as well as other genes such as those disclosed in U. S. Patent Application Publication 2006/0021087 Al, PCT Patent Application PCT/US05/11816, and in Table π of U. S. Patent Application Publication 2004/0098761 Al, which are incorporated by reference herein. Target genes from pathogens can include genes for viral translation initiation factors, viral replicases, miRNAs, miRNA precursor molecules, fungal tubulin, fungal vacuolar ATPase, fungal chitin synthase, fungal MAP kinases, fungal Pacl Tyr/Thr phosphatase, enzymes involved in nutrient transport (e. g., amino acid transporters or sugar transporters), enzymes involved in fungal cell" wall biosynthesis, cutinases, melanin biosynthetic enzymes, polygalacturonases, pectinases, pectin lyases, cellulases, proteases, genes that interact with plant avirulence genes, and other genes involved in invasion and replication of the pathogen in the infected plant. Thus, a target gene need not be endogenous to the plant in which the recombinant DNA construct is transcribed. A recombinant DNA construct encoding phased small RNAs of the invention can be transcribed in a plant and used to suppress a gene of a pathogen or pest that may infest the plant.

[0058] Specific, non-limiting examples of suitable target genes also include amino acid catabolic genes (such as, but not limited to, the maize LKR/SDH gene encoding lysine- ketoglutarate reductase (LKR) and saccharopine dehydrogenase (SDH), and its homologues), maize zein genes, genes involved in fatty acid synthesis (e. g., plant microsomal fatty acid desaturases and plant acyl-ACP thioesterases, such as, but not limited to, those disclosed in U. S. Patent Numbers 6,426,448, 6,372,965, and 6,872,872), genes involved in multi-step biosynthesis pathways, where it may be of interest to regulate the level of one or more intermediates, such as genes encoding enzymes for polyhydroxyalkanoate biosynthesis (see, for example, U. S. Patent No. 5,750,848); and genes encoding cell-cycle control proteins, such as proteins with cyclin-dependent kinase (CDK) inhibitor-like activity (see, for example, genes disclosed in International Patent Application Publication Number WO 05007829A2). Target genes can include genes encoding undesirable proteins (e. g., allergens or toxins) or the enzymes for the biosynthesis of undesirable compounds (e. g., undesirable flavor or odor components). Thus, one embodiment of the invention is a transgenic plant or tissue of such a plant that is improved by the suppression of allergenic proteins or toxins, e. g., a peanut, soybean, or wheat kernel with decreased allergenicity. Target genes can include genes involved in fruit ripening, such as polygalacturonase. Target genes can include genes where expression is preferably limited to a particular cell or tissue or developmental stage, or where expression is preferably transient, that is to say, where constitutive or general suppression, or suppression that spreads through many tissues, is not necessarily desired. Thus, other examples of suitable target genes include genes encoding proteins that, when expressed in transgenic plants, make the transgenic plants resistant to pests or pathogens (see, for example, genes for cholesterol oxidase as disclosed in U. S. Patent No. 5,763,245); genes where expression is pest- or pathogen-induced; and genes which can induce or restore fertility (see, for example, the barstar/barnase genes described in U. S. Patent No. 6,759,575); all the publications and patents cited in this paragraph are incorporated by reference in their entirety herein.

[0059] The phased small RNAs can be designed to be more specifically suppress the target gene, by designing the phased small RNAs to include regions substantially non-identical to a non-target gene sequence. Non-target genes can include any gene not intended to be silenced or suppressed, either in a plant containing the recombinant DNA construct encoding the phased small RNAs or in organisms that may come into contact with the phased small RNAs. A non-target gene sequence can include any sequence from any species (including, but not limited to, non-eukaryotes such as bacteria, and viruses; fungi; plants, including monocots and dicots, such as crop plants, ornamental plants, and non-domesticated or wild plants; invertebrates such as arthropods, annelids, nematodes, and molluscs; and vertebrates such as amphibians, fish, birds, domestic or wild mammals, and even humans).

[0060] In one embodiment, the target gene is a gene endogenous to a given species, such as a given plant (such as, but not limited to, agriculturally or commercially important plants, including monocots and dicots), and the non-target gene can be, e. g., a gene of a non- target species, such as another plant species or a gene of a virus, fungus, bacterium, invertebrate, or vertebrate, even a human. One non-limiting example is where the phased small RNAs are designed to suppress a target gene that is a gene endogenous to a single species (e. g., Western corn rootworm, Diabrotica virgifera virgifera LeConte) but to not suppress a non-target gene such as genes from related, even closely related, species (e. g., Northern corn rootworm, Diabrotica barberi Smith and Lawrence, or Southern corn rootworm, Diabrotica undecimpunctatά).

[0061] In other embodiments (e. g., where it is desirable to suppress a target gene across multiple species), it may be desirable to design the phased small RNAs to suppress a target gene sequence common to the multiple species in which the target gene is to be silenced. Thus, a recombinant DNA construct encoding phased small RNAs can be designed to be specific for one taxon (for example, specific to a genus, family, or even a larger taxon such as a phylum, e. g., viruses or arthropoda) but not for other taxa (e. g., plants or vertebrates or mammals). In one non-limiting example of this embodiment, a recombinant DNA construct encoding phased small RNAs can be selected so as to target pathogenic fungi (e. g., a Fusarium spp.) but not target any gene sequence from beneficial fungi.

[0062] In another non-limiting example of this embodiment, phased small RNAs for gene silencing in corn rootworm can be selected to be specific to all members of the genus Diabrotica. In a further example of this embodiment, such Diabrotica-targβtted phased small RNAs can be selected so as to not target any gene sequence from beneficial coleopterans (for example, predatory coccinellid beetles, commonly known as ladybugs or ladybirds) or other beneficial insect species.

[0063] The required degree of specificity of an RNA for silencing a target gene depends on various factors. Factors can include the size of the phased small RNAs that are expected to be produced by the action of a ribonuclease (preferably DCL4 or a DCL4 orthologue) on the hybridized RNA, and the relative importance of decreasing the phased small RNAs' potential to suppress non-target genes. In a non-limiting example, where the phased small RNAs are expected to be 21 base pairs in size, one particularly preferred embodiment includes RNA for silencing a target gene that encodes regions substantially non-identical to a non-target gene sequence, such as regions within which every contiguous fragment including at least 21 nucleotides matches fewer than 21 (e. g., fewer than 21, or fewer than 20, or fewer than 19, or fewer than 18, or fewer than 17) out of 21 contiguous nucleotides of a non-target gene sequence. In another embodiment, regions substantially non-identical to a non-target gene sequence include regions within which every contiguous fragment including at least 19 nucleotides matches fewer than 19 (e. g., fewer than 19, or fewer than 18, or fewer than 17, or fewer than 16) out of 19 contiguous nucleotides of a non-target gene sequence.

[0064] In some embodiments, it may be desirable to design phased small RNAs for silencing a target gene to include regions predicted to not generate undesirable polypeptides, for example, by screening the recombinant DNA construct encoding the phased small RNAs or each component phased small RNA for sequences that may encode known undesirable polypeptides or close homologues of these. Undesirable polypeptides include, but are not limited to, polypeptides homologous to known allergenic polypeptides and polypeptides homologous to known polypeptide toxins. Publicly available sequences encoding such undesirable potentially allergenic peptides are available, for example, the Food Allergy Research and Resource Program (FARRP) allergen database (available at allergenonline.com) or the Biotechnology Information for Food Safety Databases (available at www.iit.edu/~sgendel/fa.htm) (see also, for example, Gendel (1998) Adv. FoodNutr. Res., 42:63-92). Undesirable sequences can also include, for example, those polypeptide sequences annotated as known toxins or as potential or known allergens and contained in publicly available databases such as GenBank, EMBL, SwissProt, and others, which are searchable by the Entrez system (www.ncbi.nih.govΛEntrez). Non-limiting examples of undesirable, potentially allergenic peptide sequences include glycinin from soybean, oleosin and agglutinin from peanut, glutenins from wheat, casein, lactalbumin, and lactoglobulin from bovine milk, and tropomyosin from various shellfish (allergenonline.com). Non-limiting examples of undesirable, potentially toxic peptides include tetanus toxin tetA from Clostridium tetani, diarrheal toxins from Staphylococcus aureus, and venoms such as conotoxins from Conus spp. and neurotoxins from arthropods and reptiles (www.ncbi.nih.gov/Entrez).

[0065] In one non-limiting example, the recombinant DNA construct encoding the phased small RNAs or each component phased small RNA is screened to eliminate those transcribable sequences encoding polypeptides with perfect homology to a known allergen or toxin over 8 contiguous amino acids, or with at least 35% identity over at least 80 amino acids; such screens can be performed on any and all possible reading frames in both directions, on potential open reading frames that begin with AUG (ATG in the corresponding DNA), or on all possible reading frames, regardless of whether they start with an AUG (or ATG) or not. When a "hit" or match is made, that is, when a sequence that encodes a potential polypeptide with perfect homology to a known allergen or toxin over 8 contiguous amino acids (or at least about 35% identity over at least about 80 amino acids), is identified, the nucleic acid sequences corresponding to the hit can be avoided, eliminated, or modified when selecting sequences to be used in an RNA for silencing a target gene. In one embodiment the recombinant DNA construct encoding the phased small RNAs or each component phased small RNA is designed so no potential open reading frames that begin with AUG (ATG in the corresponding DNA) is included.

[0066] Avoiding, elimination of, or modification of, an undesired sequence can be achieved by any of a number of methods known to those skilled in the art. In some cases, the result can be novel sequences that are believed to not exist naturally. For example, avoiding certain sequences can be accomplished by joining together "clean" sequences into novel chimeric sequences to be used in the recombinant DNA construct encoding the phased small RNAs.

[0067] Applicants recognize that in some dsRNA-mediated gene silencing, it is possible for imperfectly matching dsRNA sequences to be effective at gene silencing. For example, it has been shown that mismatches near the center of a miRNA complementary site has stronger effects on the miRNA's gene silencing than do more distally located mismatches. See, for example, Figure 4 in Mallory et al. (2004) EMBO J., 23:3356-3364. In another example, it has been reported that, both the position of a mismatched base pair and the identity of the nucleotides forming the mismatch influence the ability of a given siRNA to silence a target gene, and that adenine-cytosine mismatches, in addition to the G:U wobble base pair, were well tolerated (see Du et al. (2005) Nucleic Acids Res., 33:1671-1677). Thus, each phased small RNA need not always have 100% sequence complementarity with the intended target gene, but generally would preferably have substantial complementarity with the intended target gene, such as about 95%, about 90%, about 85%, or about 80% complementarity with the intended target gene. One strand of the hybridized RNA (or each component phased small RNA or RNA segment) is preferably designed to have substantial complementarity to the intended target (e. g., a target messenger RNA or target non-coding RNA), such as about 95%, about 90%, about 85%, or about 80% complementarity to the intended target. In a non- limiting example, in the case of a component phased small RNA consisting of two 21- nucleotide strands, one of the two 21-nucleotide strands is substantially but not perfectly complementary to 21 contiguous nucleotides of a target RNA; preferably the nucleotide at position 21 is unpaired with the corresponding position in the target RNA to prevent transitivity.

[0068] One skilled in the art would be capable of judging the importance given to screening for regions predicted to be more highly specific to the target gene or predicted to not generate undesirable polypeptides, relative to the importance given to other criteria, such as, but not limited to, the percent sequence identity with the intended target gene or the predicted gene silencing efficiency of a given sequence. For example, it may be desirable for the phased small RNAs to be active across several species, and therefore one skilled in the art can determine that it is more important to include in the recombinant DNA construct encoding the phased small RNAs regions specific to the several species of interest, but less important to screen for regions predicted to have higher gene silencing efficiency or for regions predicted to generate undesirable polypeptides.

Combinations of Phased Small RNAs with Pesticidal Compositions

[0069] Phased small RNAs of this invention and the recombinant DNA constructs encoding such phased small RNAs are useful in controlling pests and pathogens of plants, and thus this invention further claims methods of controlling pests and pathogens of plant wherein a phased small RNA of this invention is provided to at least one cell of the plant to be protected from the pest or pathogen. The phased small RNA is generally provided by in vivo transcription of a recombinant DNA construct of this invention in a cell of the plant. [0070] Methods of controlling pests and pathogens of plant with a phased small RNA of this invention can be used in combination with other methods or compositions for controlling pests and pathogens of plants. Thus, this invention also provides combinations of methods and combinations of compositions for controlling pests and pathogens of plants. In a preferred embodiment, the methods to be combined operate by different mechanisms to provide protection to the plant from the pest or pathogen. For example, invertebrate pests can be controlled by providing an alternative gene suppression element (such as an engineered microRNA or an engineered siRNA produced by a conventional double-stranded RNA transcript transgenically expressed in the plant) designed to silence a gene of the invertebrate pest; see, for example, the various recombinant DNA constructs and methods for gene suppression disclosed in U. S. Patent Application Publication 2006/0200878, which are incorporated herein by reference.

[0071] One non-limiting example is a method for controlling insect pests of plants, including providing at least one phased small RNA designed to silence an insect pest gene and an insecticidal agent (e. g., a Bacillus thuringiensis or "Bt" insecticidal protein) to which the insect pest is susceptible. When Bt proteins are provided in the diet of insect pests (e. g., via topical application to the plant or by transgenic expression in the plant) a mode of action for controlling the insect pest is exhibited that is dramatically different from the mode of action of the methods and compositions using phased small RNAs. In preferred embodiments, the combination results in synergies that were not known previously in the art for controlling insect infestation. Transgenic plants that produce one or more phased small RNA molecules that inhibit some essential biological function in a target pest along with one or more Bt insecticidal proteins that are toxic to the target pest provide surprising synergies. One synergy is the reduction in the level of expression required for either the phased small RNA(s) or the Bt insecticidal protein(s). When combined together, a lower effective dose of each pest control agent is required.

[0072] Another non-limiting example is a method for controlling viral pests of plants, including providing at least one phased small RNA designed to silence an viral pathogen gene and a composition to induce viral coat protein-mediated resistance to the plant (e. g., by transgenic expression of the viral coat protein in a plant cell). In preferred embodiments, the combination results in a synergy between the two protective components, so that a lower effective dose of each pathogen control agent is achieved. Making and Using Recombinant DNA Constructs

[0073] The recombinant DNA constructs of this invention are made by any method suitable to the intended application, taking into account, for example, the type of expression desired and convenience of use in the plant in which the construct is to be transcribed. General methods for making and using DNA constructs and vectors are well known in the art and described in detail in, for example, handbooks and laboratory manuals including Sambrook and Russell, "Molecular Cloning: A Laboratory Manual" (third edition), Cold Spring Harbor Laboratory Press, NY, 2001. An example of useful technology for building DNA constructs and vectors for transformation is disclosed in U. S. Patent Application Publication 2004/0115642 Al, incorporated herein by reference. DNA constructs can also be built using the GATEWAY™ cloning technology (available from Invitrogen Life Technologies, Carlsbad, CA), which uses the site-specific recombinase LR cloning reaction of the Integrase/αtf system from bacteriophage lambda vector construction, instead of restriction endonucleases and ligases. The LR cloning reaction is disclosed in U. S. Patents 5,888,732 and 6,277,608, and in U. S. Patent Application Publications 2001/283529, 2001/282319 and 2002/0007051, all of which are incorporated herein by reference. The GATEWAY™ Cloning Technology Instruction Manual, which is also supplied by Invitrogen, provides concise directions for routine cloning of any desired DNA into a vector comprising operable plant expression elements. Another alternative vector fabrication method employs ligation-independent cloning as disclosed by Aslandis et al. (1990) Nucleic Acids Res., 18:6069-6074 and Rashtchian et al. (1992) Biochem., 206:91-97, where a DNA fragment with single-stranded 5' and 3' ends is annealed to complementary 5' and 3' single-stranded ends of at least one other DNA fragment to produce a desired vector which can then be ligated and amplified in vivo.

[0074] In certain embodiments, the DNA sequence of the recombinant DNA construct includes sequence that has been codon-optimized for the plant in which the recombinant DNA construct is to be expressed. For example, a recombinant DNA construct to be expressed in a plant can have all or parts of its sequence (e. g., the first gene suppression element or the gene expression element) codon-optimized for expression in a plant by methods known in the art. See, e. g., U. S. Patent 5,500,365, incorporated by reference, for a description of codon-optimization for plants; see also De Amicis and Marchetti (2000) Nucleic Acid Res., 28:3339-3346.

Making and Using Transgenic Plant Cells and Transgenic Plants

[0075] Where a recombinant DNA construct of this invention is used to produce a non-natural transgenic plant cell, non-natural transgenic plant, or non-natural transgenic seed of this invention, transformation can include any of the well-known and demonstrated methods and compositions. Suitable methods for plant transformation include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA (e. g., by PEG- mediated transformation of protoplasts, by electroporation, by agitation with silicon carbide fibers, and by acceleration of DNA coated particles), by Agrobacterium-mediated transformation, by viral or other vectors, etc. One preferred method of plant transformation is microprojectile bombardment, for example, as illustrated in U.S. Patents 5,015,580 (soy), 5,550,318 (maize), 5,538,880 (maize), 6,153,812 (wheat), 6,160,208 (maize), 6,288,312 (rice) and 6,399,861 (maize), and 6,403,865 (maize) , all of which are incorporated by reference.

[0076] Another preferred method of plant transformation is Agrobacterium-mediated transformation. In one preferred embodiment, the non-natural transgenic plant cell of this invention is obtained by transformation by means of Agrobαcterium containing a binary Ti plasmid system, wherein the Agrobαcterium carries a first Ti plasmid and a second, chimeric plasmid containing at least one T-DNA border of a wild-type Ti plasmid, a promoter functional in the transformed plant cell and operably linked to a gene suppression construct of the invention. See, for example, the binary system described in U. S. Patent 5,159,135, incorporated by reference. Also see De Framond (1983) Biotechnology, 1:262-269; and Hoekema et αl., (1983) Nature, 303: 179. In such a binary system, the smaller plasmid, containing the T-DNA border or borders, can be conveniently constructed and manipulated in a suitable alternative host, such as E. coli, and then transferred into Agrobacterium.

[0077] Detailed procedures for Agrobacterium-mediated transformation of plants, especially crop plants, include, for example, procedures disclosed in U. S. Patents 5,004,863, 5,159,135, 5,518,908, 5,846,797, and 6,624,344 (cotton); 5,416,011, 5,569,834, 5,824,877, 5,914,451 6,384,301, and 7,002,058 (soy); 5,591,616 5,981,840, and 7,060,876 (maize); 5,463,174 and 5,750,871 (brassicas, including rapeseed and canola), and in U. S. Patent Application Publications 2004/0244075 (maize), 2004/0087030 (cotton) and 2005/0005321 (soy), all of which are incorporated by reference. Additional procedures for Agrobacterium- mediated transformation are disclosed in WO9506722 (maize). Similar methods have been reported for many plant species, both dicots and monocots, including, among others, peanut (Cheng et αl. (1996) Plant Cell Rep., 15: 653); asparagus (Bytebier et al. (1987) Proc. Natl. Acad. Sci. U.S.A., 84:5345); barley (Wan and Lemaux (1994) Plant Physiol., 104:37); rice (Toriyama et al. (1988) Bio/Technology, 6: 10; Zhang et al. (1988) Plant Cell Rep., 7:379; wheat (Vasil et al. (1992) Bio/Technology, 10:667; Becker et al. (1994) Plant J. , 5:299), alfalfa (Masoud et al. (1996) Transgen. Res., 5:313); brassicas (Radke et al. (1992) Plant Cell Rep., 11:499-505); and tomato (Sun et al. (2006) Plant Cell Physiol, 47:426-431). See also a description of vectors, transformation methods, and production of transformed Arabidopsis thaliana plants where transcription factors are constitutively expressed by a CaMV35S promoter, in U. S. Patent Application Publication 2003/0167537 Al, incorporated by reference. Non-natural transgenic plant cells and transgenic plants can also be obtained by transformation with other vectors, such as, but not limited to, viral vectors (e. g., tobacco etch potyvirus (TEV), barley stripe mosaic virus (BSMV), and the viruses referenced in Edwardson and Christie, "The Potyvirus Group: Monograph No. 16, 1991, Agric. Exp. Station, Univ. of Florida), plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning vector, when used with an appropriate transformation protocol, e. g., bacterial infection (e.g., with Agrobacterium as described above), binary bacterial artificial chromosome constructs, direct delivery of DNA (e. g., via PEG-mediated transformation, desiccation/inhibition-mediated DNA uptake, electroporation, agitation with silicon carbide fibers, and microprojectile bombardment). It would be clear to one of ordinary skill in the art that various transformation methodologies can be used and modified for production of stable transgenic plants from any number of plant species of interest.

[0078] Transformation methods to provide non-natural transgenic plant cells and non- natural transgenic plants containing stably integrated recombinant DNA are preferably practiced in tissue culture on media and in a controlled environment. "Media" refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. Recipient cell targets include, but are not limited to, meristem cells, callus, immature embryos or parts of embryos, and gametic cells such as microspores, pollen, sperm, and egg cells. Any cell from which a fertile plant can be regenerated is contemplated as a useful recipient cell for practice of the invention. Callus can be initiated from various tissue sources, including, but not limited to, immature embryos or parts of embryos, seedling apical meristems, microspores, and the like. Those cells which are capable of proliferating as callus can serve as recipient cells for genetic transformation. Practical transformation methods and materials for making transgenic plants of this invention (e. g., various media and recipient target cells, transformation of immature embryos, and subsequent regeneration of fertile transgenic plants) are disclosed, for example, in U. S. Patents 6,194,636 and 6,232,526 and U. S. Patent Application Publication 2004/0216189, which are incorporated by reference.

[0079] In general transformation practice, DNA is introduced into only a small percentage of target cells in any one transformation experiment. Marker genes are generally used to provide an efficient system for identification of those cells that are stably transformed by receiving and integrating a transgenic DNA construct into their genomes. Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or herbicide. Any of the antibiotics or herbicides to which a plant cell may be resistant can be a useful agent for selection. Potentially transformed cells are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance-conferring gene is integrated and expressed at sufficient levels to permit cell survival. Cells can be tested further to confirm stable integration of the recombinant DNA. Commonly used selective marker genes include those conferring resistance to antibiotics such as kanamycin or paromomycin (nptll), hygromycin B (aph IV) and gentamycin (aac3 and aacCA) or resistance to herbicides such as glufosinate (.bar or pat), glyphosate (EPSPS), and dicamba. Examples of useful selective marker genes and selection agents are illustrated in U. S. Patents 5,550,318, 5,633,435^ 5,780,708, and 6,118,047, all of which are incorporated by reference. A particularly preferred herbicide resistance gene is a glyphosate acetyl transferase, disclosed as SEQ ID NO. 68 in U. S. Patent Application Publication 2007/0079393 Al, which is specifically incorporated by reference. Screenable markers or reporters, such as markers that provide an ability to visually identify transformants can also be employed. Non-limiting examples of useful screenable markers include, for example, a gene expressing a protein that produces a detectable color by acting on a chromogenic substrate (e. g., />e/α-glucuronidase (GUS) (uidA) or luciferase (luc)) or that itself is detectable, such as green fluorescent protein (GFP) (gfp) or an immunogenic molecule. Those of skill in the art will recognize that many other useful markers or reporters are available for use.

[0080] Detecting or measuring transcription of the recombinant DNA construct in the non-natural transgenic plant cell of the invention can be achieved by any suitable method, including protein detection methods (e. g., western blots, ELISAs, and other immunochemical methods), measurements of enzymatic activity, or nucleic acid detection methods (e. g., Southern blots, northern blots, PCR, RT-PCR, fluorescent in situ hybridization). Such methods are well known to those of ordinary skill in the art as evidenced by- the numerous handbooks available; see, for example, Joseph Sambrook and David W. Russell, "Molecular Cloning: A Laboratory Manual" (third edition), Cold Spring Harbor Laboratory Press, NY, 2001; Frederick M. Ausubel etal. (editors) "Short Protocols in Molecular Biology" (fifth edition), John Wiley and Sons, 2002; John M. Walker (editor) "Protein Protocols Handbook" (second edition), Humana Press, 2002; and Leandro Pena (editor) 'Transgenic Plants: Methods and Protocols", Humana Press, 2004.

[0081] Other suitable methods for detecting or measuring transcription of the recombinant DNA construct in the non-natural transgenic plant cell of the invention include measurement of any other trait that is a direct or proxy indication of suppression of the target gene in the transgenic plant cell in which the recombinant DNA construct is transcribed, relative to one in which the recombinant DNA is not transcribed, e. g., gross or microscopic morphological traits, growth rates, yield, reproductive or recruitment rates, resistance to pests or pathogens, or resistance to biotic or abiotic stress (e. g., water deficit stress, salt stress, nutrient stress, heat or cold stress). Such methods can use direct measurements of a phenotypic trait or proxy assays (e. g., in plants, these assays include plant part assays such as leaf or root assays to determine tolerance of abiotic stress). Non-limiting methods include direct measurements of resistance to the invertebrate pest (e. g., damage to plant tissues) or proxy assays (e. g., plant yield assays, or bioassays such as the Western corn rootworm (Diabrotica virgifera virgifera LeConte) larval bioassay described in International Patent Application Publication WO2005/110068 A2 and U. S. Patent Application Publication US 2006/0021087 Al, incorporated by reference, or the soybean cyst nematode bioassay described by Steeves et al. (2006) Funct. Plant Biol., 33:991-999, wherein cysts per plant, cysts per gram root, eggs per plant, eggs per gram root, and eggs per cyst are measured.

[0082] The recombinant DNA constructs of the invention can be stacked with other recombinant DNA for imparting additional traits (e. g., in the case of transformed plants, traits including herbicide resistance, pest resistance, cold germination tolerance, water deficit tolerance, and the like) for example, by expressing or suppressing other genes. Constructs for coordinated decrease and increase of gene expression are disclosed in U.S. Patent Application Publication 2004/0126845 Al, incorporated by reference.

[0083] Seeds of transgenic, fertile plants can be harvested and used to grow progeny generations, including hybrid generations, of non-natural transgenic plants of this invention that include the recombinant DNA construct in their genome. Thus, in addition to direct transformation of a plant with a recombinant DNA construct of this invention, non-natural transgenic plants of the invention can be prepared by crossing a first plant having the recombinant DNA with a second plant lacking the construct. For example, the recombinant DNA can be introduced into a plant line that is amenable to transformation to produce a transgenic plant, which can be crossed with a second plant line to introgress the recombinant DNA into the resulting progeny. A transgenic plant of the invention can be crossed with a plant line having other recombinant DNA that confers one or more additional trait(s) (such as, but not limited to, herbicide resistance, pest or disease resistance, environmental stress resistance, modified nutrient content, and yield improvement) to produce progeny plants having recombinant DNA that confers both the desired target sequence expression behavior and the additional trait(s). [0084] Typically, in such breeding for combining traits the transgenic plant donating the additional trait is a male line and the transgenic plant carrying the base traits is the female line. The progeny of this cross segregate such that some of the plant will carry the DNA for both parental traits and some will carry DNA for one parental trait; such plants can be identified by markers associated with parental recombinant DNA Progeny plants carrying DNA for both parental traits can be crossed back into the female parent line multiple times, e. g., usually 6 to 8 generations, to produce a progeny plant with substantially the same genotype as one original transgenic parental line but for the recombinant DNA of the other transgenic parental line.

[0085] Yet another aspect of the invention is a non-natural transgenic plant grown from the non-natural transgenic seed of the invention. This invention contemplates transgenic plants grown directly from transgenic seed containing the recombinant DNA as well as progeny generations of plants, including inbred or hybrid plant lines, made by crossing a transgenic plant grown directly from transgenic seed to a second plant not grown from the same transgenic seed.

[0086] Crossing can include, for example, the following steps:

(a) plant seeds of the first parent plant (e. g., non-transgenic or a transgenic) and a second parent plant that is transgenic according to the invention;

(b) grow the seeds of the first and second parent plants into plants that bear flowers;

(c) pollinate a flower from the first parent with pollen from the second parent; and

(d) harvest seeds produced on the parent plant bearing the fertilized flower.

[0087] It is often desirable to introgress recombinant DNA into elite varieties, e. g., by backcrossing, to transfer a specific desirable trait from one source to an inbred or other plant that lacks that trait. This can be accomplished, for example, by first crossing a superior inbred ("A") (recurrent parent) to a donor inbred ("B") (non-recurrent parent), which carries the appropriate gene(s) for the trait in question, for example, a construct prepared in accordance with the current invention. The progeny of this cross first are selected in the resultant progeny for the desired trait to be transferred from the non-recurrent parent "B", and then the selected progeny are mated back to the superior recurrent parent "A". After five or more backcross generations with selection for the desired trait, the progeny are hemizygous for loci controlling the characteristic being transferred, but are like the superior parent for most or almost all other genes. The last backcross generation would be selfed to give progeny which are pure breeding for the gene(s) being transferred, i. e., one or more transformation events.

[0088] Through a series of breeding manipulations, a selected DNA construct can be moved from one line into an entirely different line without the need for-further recombinant manipulation. One can thus produce inbred plants which are true breeding for one or more DNA constructs. By crossing different inbred plants, one can produce a large number of different hybrids with different combinations of DNA constructs. In this way, plants can be produced which have the desirable agronomic properties frequently associated with hybrids ("hybrid vigor"), as well as the desirable characteristics imparted by one or more DNA constructs.

[0089] Genetic markers can be used to assist in the introgression of one or more DNA constructs of the invention from one genetic background into another. Marker assisted selection offers advantages relative to conventional breeding in that it can be used to avoid errors caused by phenotypic variations. Further, genetic markers can provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait which otherwise has a non-agronomically desirable genetic background is crossed to an elite parent, genetic markers can be used to select progeny which not only possess the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits into a particular genetic background is minimized. The usefulness of marker assisted selection in breeding non-natural transgenic plants of the current invention, as well as types of useful molecular markers, such as but not limited to SSRs and SNPs, are discussed in PCT Application Publication WO 02/062129 and U. S. Patent Application Publications Numbers 2002/0133852, 2003/0049612, and 2003/0005491, each of which is incorporated by reference in their entirety.

[0090] In certain non-natural transgenic plant cells and non-natural transgenic plants of the invention, it may be desirable to concurrently express (or suppress) a gene of interest while also regulating expression of a target gene. Thus, in some embodiments, the transgenic plant contains recombinant DNA including both a transgene transcription unit for expressing at least one gene of interest and a gene suppression element for suppressing a target gene.

[0091] Thus, as described herein, the non-natural transgenic plant cells or non-natural transgenic plants of the invention can be obtained by use of any appropriate transient or stable, integrative or non-integrative transformation method known in the art or presently disclosed. The recombinant DNA constructs can be transcribed in any plant cell or tissue or in a whole plant of any developmental stage. Transgenic plants can be derived from any monocot or dicot plant, such as, but not limited to, plants of commercial or agricultural interest, such as crop plants (especially crop plants used for human food or animal feed), wood-, fiber-, pulp-, or cellulose-producing trees and plants, vegetable plants, fruit plants, and ornamental plants. Non-limiting examples of plants of interest include grain crop plants (such as wheat, oat, barley, maize, rye, triticale, rice, millet, sorghum, quinoa, amaranth, and buckwheat); forage crop plants (such as forage grasses and forage dicots including alfalfa, vetch, clover, and the like); oilseed crop plants (such as cotton, safflower, sunflower, soybean, canola, rapeseed, flax, peanuts, and oil palm); tree nuts (such as walnut, cashew, hazelnut, pecan, almond, macadamia, and the like); sugarcane, coconut, date palm, olive, sugarbeet, tea, and coffee; wood-, fiber-, pulp-, or cellulose-producing trees and plants (for example, cotton, flax, jute, ramie, sisal, kenaf, switchgrass, and bamboo); vegetable crop plants such as legumes (for example, beans, peas, lentils, alfalfa, peanut), lettuce, asparagus, artichoke, celery, carrot, radish, cassava, sweet potato, yam, cocoa, coffee, tea, the brassicas (for example, cabbages, kales, mustards, and other leafy brassicas, broccoli, cauliflower, Brussels sprouts, turnip, kohlrabi), edible cucurbits (for example, cucumbers, melons, summer squashes, winter squashes), edible alliums (for example, onions, garlic, leeks, shallots, chives), edible members of the Solanaceae (for example, tomatoes, eggplants, potatoes, peppers, groundcherries), and edible members of the Chenopodiaceae (for example, beet, chard, spinach, quinoa, amaranth); fruit crop plants such as apple, pear, citrus fruits (for example, orange, lime, lemon, grapefruit, and others), stone fruits (for example, apricot, peach, plum, nectarine), banana, pineapple, grape, kiwifruit, papaya, avocado, fig, mango, and berries; and ornamental plants including ornamental flowering plants, ornamental trees and shrubs, ornamental groundcovers, and ornamental grasses. Preferred dicot plants include, but are not limited to, canola, broccoli, cabbage, carrot, cauliflower, Chinese cabbage, cucumber, dry beans, eggplant, fennel, garden beans, gourds, lettuces, melons, okra, peas, peppers, pumpkin, radishes, spinach, squash, watermelon, cotton, potato, quinoa, amaranth, buckwheat, safflower, soybean, sugarbeet, and sunflower. Preferred monocots include, but are not limited to, wheat, oat, barley, maize (including sweet corn and other varieties), rye, triticale, rice, ornamental and forage grasses, sorghum, millet, onions, leeks, and sugarcane, more preferably maize, wheat, and rice.

[0092] The ultimate goal in plant transformation is to produce plants which are useful to man. In this respect, non-natural transgenic plants of the invention can be used for virtually any purpose deemed of value to the grower or to the consumer. For example, one may wish to harvest the transgenic plant itself, or harvest transgenic seed of the transgenic plant for planting purposes, or products can be made from the transgenic plant or its seed such as oil, starch, ethanol or other fermentation products, animal feed or human food, pharmaceuticals, and various industrial products. For example, maize is used extensively in the food and feed industries, as well as in industrial applications. Further discussion of the uses of maize can be found, for example, in U. S. Patent Numbers 6,194,636, 6,207,879, 6,232,526, 6,426,446, 6,429,357, 6,433,252, 6,437,217, and 6,583,338, incorporated by reference, and PCT Publications WO 95/06128 and WO 02/057471. Thus, this invention also provides commodity products produced from a non-natural transgenic plant cell, plant, or seed of this invention, including, but not limited to, harvested leaves, roots, shoots, tubers, stems, fruits, seeds, or other parts of a plant, meals, oils, extracts, fermentation or digestion products, crushed or whole grains or seeds of a plant, or any food or non-food product including such commodity products produced from a transgenic plant cell, plant, or seed of this invention. The detection of one or more of nucleic acid sequences of the recombinant DNA constructs of this invention in one or more commodity or commodity products contemplated herein is de facto evidence that the commodity or commodity product contains or is derived from a transgenic plant cell, plant, or seed of this invention. fj0O93] In preferred embodiments, the non-natural transgenic plant prepared from the non-natural transgenic plant cell of this invention, i. e., a transgenic plant having in its genome a recombinant DNA construct of this invention has at least one additional altered trait, relative to a plant lacking the recombinant DNA construct, selected from the group of traits consisting of:

(a) improved abiotic stress tolerance;

(b) improved biotic stress tolerance;

(c) modified primary metabolite composition;

(d) modified secondary metabolite composition;

(e) modified trace element, carotenoid, or vitamin composition;

(f) improved yield;

(g) improved ability to use nitrogen or other nutrients; (h) modified agronomic characteristics;

(i) modified growth or reproductive characteristics; and

(j) improved harvest, storage, or processing quality.

[0094] In particularly preferred embodiments, the non-natural transgenic plant is characterized by: improved tolerance of abiotic stress (e. g., tolerance of water deficit or drought, heat, cold, non-optimal nutrient or salt levels, non-optimal light levels) or of biotic stress (e. g., crowding, allelopathy, or wounding); by a modified primary metabolite (e. g., fatty acid, oil, amino acid, protein, sugar, or carbohydrate) composition; a modified secondary metabolite (e. g., alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin) composition; a modified trace element (e. g., iron, zinc), carotenoid (e. g., fce/α-carotene, lycopene, lutein, zeaxanthin, or other carotenoids and xanthophylls), or vitamin (e. g., tocopherols) composition; improved yield (e. g., improved yield under non-stress conditions or improved yield under biotic or abiotic stress); improved ability to use nitrogen or other nutrients; modified agronomic characteristics (e. g., delayed ripening; delayed senescence; earlier or later maturity; improved shade tolerance; improved resistance to root or stalk lodging; improved resistance to "green snap" of stems; modified photoperiod response); modified growth or reproductive characteristics (e. g., intentional dwarfing; intentional male sterility, useful, e. g., in improved hybridization procedures; improved vegetative growth rate; improved germination; improved male or female fertility); improved harvest, storage, or processing quality (e. g., improved resistance to pests during storage, improved resistance to breakage, improved appeal to consumers); or any combination of these traits.

[0095] In one preferred embodiment, non-natural transgenic seed, or seed produced by the non-natural transgenic plant, has modified primary metabolite (e. g., fatty acid, oil, amino acid, protein, sugar, or carbohydrate) composition, a modified secondary metabolite (e. g., alkaloids, terpenoids, polyketides, non-ribosomal peptides, and secondary metabolites of mixed biosynthetic origin) composition, a modified trace element (e. g., iron, zinc, sulfur), organic phosphate (e. g, phytic acid), carotenoid (e. g., førα-carotene, lycopene, lutein, zeaxanthin, or other carotenoids and xanthophylls), or vitamin (e. g., tocopherols, ) composition, an improved harvest, storage, or processing quality, or a combination of these. For example, it can be desirable to modify the amino acid (e. g., lysine, methionine, tryptophan, or total protein), oil (e. g., fatty acid composition or total oil), carbohydrate (e. g., simple sugars or starches), trace element, carotenoid, or vitamin content of seeds of crop plants (e. g., canola, cotton, safflower, soybean, sugarbeet, sunflower, wheat, maize, or rice), preferably in combination with improved seed harvest, storage, or processing quality, and thus provide improved seed for use in animal feeds or human foods. In another example, it can be desirable to modify the quantity or quality of polysaccharides (e. g., starch, cellulose, or hemicellulose) in plant tissues for use in animal feeds or human foods or for fermentation or biofuel production. In another instance, it can be desirable to change levels of native components of the transgenic plant or seed of a transgenic plant, for example, to decrease levels of proteins with low levels of lysine, methionine, or tryptophan, or to increase the levels of a desired amino acid or fatty acid, or to decrease levels of an allergenic protein or glycoprotein (e. g., peanut allergens including ara h 1, wheat allergens including gliadins and glutenins, soy allergens including P34 allergen, globulins, glycinins, and conglycinins) or of a toxic metabolite (e. g., cyanogenic glycosides in cassava, solanum alkaloids in members of the Solanaceae). EXAMPLES

Example 1

[0096] This example describes a non-limiting embodiment of DNA encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression. More specifically, this example provides nucleic acid sequences, obtained from monocot crop plants, that are useful in making a single recombinant DNA molecule encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression, independently of an RNA-dependent RNA polymerase.

[0097] Several RNA libraries were cloned from mature rice (Oryza sativά) grain and from various maize (Zea mays) tissues by high-throughput sequencing (Margulies et al. (2005) Nature, 437:376-380). Among the most abundant sequences cloned from mature rice grain and maize root, 32 DAP (days after pollinations) and 39 DAP kernels were seven 21-mer RNAs (SEQ ID NO. 1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO. 6, and SEQ ID NO.7), listed in Table 1.

Table 1

*DAP, days after pollination

[0098] These seven 21-mer RNAs, when aligned to the rice genome at locus Os6g21900, were located in two adjacent regions containing seven and six 21-nt siRNAs aligned end to end, respectively, and forming a single foldback structure depicted in Figure 1. No siRNAs from this gene were present in other libraries, and only a very small number were sequenced from the putative loop region between arms of the foldback structure. Additional sequencing results indicated that this foldback structure contained at least three other potential 21-mer RNAs (in phase with and distal to the first seven 21 -mers and loop), although small RNAs predicted to result from in vivo cleavage of these additional phased small double- stranded RNAs were cloned only at low abundances.

[0099] Although many variants of small RNAs were identified, only a single unique 21 -nucleotide (21-nt) phase from the plus strand was supported by sequence information (Table 2). "Phase fullness" indicates how many 21-nt phases are occupied by sequenced small RNAs in both strands; for example, a fullness of 0.5 for frame 7.0 with a phase length of 8 indicates that all eight 21-nt frames are occupied in the plus strand, but none are occupied in the hypothetical minus strand. "Phase uniqueness" represents a probability score for phased small RNAs, which takes into account phase occupancy and abundance of small RNAs in each phase. Frame 16.1 and Frame 7.0 represent each side of the foldback structure (depicted in Figure 1, with the first seven phased small RNAs shown) and its abundant phased small RNAs; phasing is highly supported (uniqueness >0.97) for this structure, whereas all other potential small RNA phases were poorly supported by sequence data (uniqueness <0.005).

Table 2

[00100] The genomic sequence and putative precursors for the Oryza sativa foldback structure are given in SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11.

One genomic DNA sequence (SEQ ID NO. 9) was predicted to include the cDNA sequence, intronic sequence, and foldback arms as shown in Figure 2, and several alternatively spliced versions of this transcript were found in cDNA databases. One abundant alternatively spliced transcript (SEQ ID NO. 10) indicates removal of one half of the foldback structure, probably preventing small RNA production. An expressed sequence tag (SEQ ID NO. 11) was identified as representing the complementary sequence to SEQ ID NO. 10. A canonical TATA box (indicated by the boxed nucleotides in Figure 2) is located 34 bases upstream of the predicted transcription start site in SEQ ID NO. 8, evidence that this is the bonafide 5' end of the transcript. A single foldback structure is thus transcribed from one promoter and forms, independently of an RNA-dependent RNA polymerase, the hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression. Alternatively, two (or more) splicing variants transcribed from the same promoter each contains one of each of the arms of the foldback structure, and come together in trans, independently of an RNA- dependent RNA polymerase, to form the hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs.

[00101] The evidence collected supports this locus as a novel type of RNA-mediated regulatory (suppression) element. Unlike trans-acting siRNAs, all of the multiple small double-stranded RNAs derive from the original RNA transcript or plus strand of the precursor, independently of an RNA-dependent RNA polymerase and without a miRNA target site that initiates production of double-stranded RNA. Unlike microRNAs, the locus is cleaved in vivo to multiple abundant phased small RNAs, and (as described below in Example 5), this process requires DCL4 (or a DCL4 orthologue) and not DCLl. The inventors therefore term this novel locus a "phased small RNA" locus.

[00102] Expression of this particular phased small RNA locus appears to be restricted primarily to mature grain in both maize and rice, indicating an endogenous function related to repression of genes involved in maturation or maintenance of the embryogenic state in mature grain. Putative targets were predicted for each of the seven phased small RNAs (SEQ ED NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7), following target prediction guidelines described in Allen et al. (2005) Cell, 121:207-221. Non-limiting examples of these targets, which include members of the HAK2 high affinity potassium transporter family, are given in Table 3; the corresponding maize loci from the public database, Maize Assembled Genomic Island (available on line at magi.plantgenomics.iastate.edu, see Fu et al. (2005) Proc. Natl. Acad. ScL USA, 102:12282- 12287) are also provided.

Table 3

*publicly available at magi.plantgenomics.iastate.edu

Example 2

[00103] This example describes a non-limiting embodiment of a recombinant DNA construct including a promoter operably linked to DNA that transcribes to RNA including: (a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and (b) target RNA to be suppressed in the specific cell, wherein the target RNA is to be expressed in cells of the multicellular eukaryote other than the specific cell. More specifically, this example describes a recombinant DNA construct including DNA that transcribes to RNA containing an exogenous recognition site corresponding to at least one phased small RNA derived from an endogenous phased small RNA locus.

[00104] Recombinant DNA constructs were designed to include a gene expression element for expression of a gene of interest (in this non-limiting example, the reporter gene, 6eto-glucoronidase, "GUS"), and a recognition site (target site) corresponding to at least one phased small RNA of this invention (e. g., any one or more of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7 as described in Example 1). Similar recombinant DNA constructs can be designed, wherein a recognition site (target site) corresponding to at least one phased small RNA of this invention is included to regulate the expression of a gene expression element for the expression of a gene of interest (which can be translatable or coding sequence or non-coding sequence, including regulatory sequence), e. g., those described under the heading "Target Genes", or alternatively to regulate the expression of a gene suppression element (e. g., sense, anti-sense, combinations of sense and anti-sense, tandem repeats of sense or of anti-sense, microRNAs, siRNAs, and any other construct designed to reduce the expression of a target gene).

[00105] A control construct (pMON94320) with a 35S promoter driving expression of GUS and an Hspl7 terminator included the partial sequence SEQ ID NO. 12, with an insertion site (indicated in bold font in Figure 3B) located between the GUS coding sequence and the Hspl7 terminator. Three additional constructs based on this control construct were designed, each containing at least one recognition site corresponding to a phased small RNA of this invention. The first construct (pMON 100574) included the partial sequence SEQ ID NO. 13, which contained one of the 21-mer phased small RNAs (SEQ ID NO. 6) described in Example 1, incorporated in the sense orientation at the insertion site (Figure 3C). The second construct (pMON100575) included the partial sequence SEQ ID NO. 14, which contained one of the 21-mer phased small RNAs (SEQ ID NO. 6) described in Example 1, incorporated in the anti-sense orientation (i. e., as a recognition site corresponding to SEQ ID NO. 6 in the sense orientation) at the insertion site (Figure 3D). The third construct (pMONl 00576) included the partial sequence SEQ ID NO. 15, which contained two of the 21-mer phased small RNAs (SEQ ID NO.5 and SEQ ID NO.6) described in Example 1, both incorporated in the anti-sense orientation (i. e., as recognition sites corresponding to SEQ ID NO. 5 and SEQ ID NO. 6 in the sense orientation) at the insertion site (Figure 3E).

[00106] Maize tissue from developing kernels was analyzed by northern blot using a single probe with the sequence CGGCGTTCTCTTGGTGGGGCA (SEQ ID NO. 16, i. e., the anti-sense sequence of SEQ ID NO. 6). The results, depicted in Figure 4, indicated transcription of the endogenous maize phased small RNA locus, especially in developing embryo and to a lower extent in developing endosperm, further corroborating the cloning results given in Table 1.

[00107] Maize zygotic embryos (21 - 22 days after pollination) were transformed with the recombinant DNA constructs by particle bombardment, using about 0.5 micrograms DNA delivered with one shot of a helium particle gun. Bombarded tissue was incubated for 24 or 48 hours in a dark reach-in growth chamber at 26 degrees Celsius. The embryos were stained in 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid solution (24 hours at 37 degrees Celsius) followed by clearing of the stained tissue in 70% ethanol. Expression of the gene of interest (GUS) encoded by the gene expression element was indicated by the level of staining in the embryos; GUS expression was predicted to be silenced by the endogenous maize phased small RNA locus. As predicted, GUS expression was silenced in the embryos transformed with the constructs (pMON100575 and pMON100576) containing at least one recognition site corresponding to a phased small RNA of this invention (Figure 3A). The silencing observed in the embryos transformed with pMON100574 was presumably due to endogenous anti-sense transcript present in low abundance as was observed in the cloned rice RNA libraries (see Table 2 for abundances of cloned small RNAs).

[00108] Recognition sites corresponding to phased small RNAs of this invention are useful for regulating expression of a transgene in a construct including at least one such recognition site. Thus, this invention provides a recombinant DNA construct including a promoter operably linked to DNA that transcribes to RNA including: (a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and (b) target RNA to be suppressed in the specific cell, wherein the target RNA is to be expressed in cells of the multicellular eukaryote other than the specific cell. The invention includes a recombinant DNA construct including a transgene and at least one recognition site that corresponds to one or more phased small RNAs of this invention, useful for expression of that transgene in tissues other than those in which the phased small RNAs are expressed, and suppression of the transgene in tissues where the phased small RNAs are expressed. For example, SEQ ID NO. 6 has been shown to be expressed in rice kernel (Example 1) and in corn kernel (this example); a construct containing a transgene (e. g., an herbicide tolerance gene such as 5-enolpyruvylshikimate-3-phosphate synthase) and at least one recognition site corresponding to SEQ ID NO.6 is useful for suppression of the transgene in at least rice or corn kernel.

Example 3

[00109] This example describes a non-limiting embodiment of a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression. Preferably the hybridized RNA is produced independently of an RNA-dependent RNA polymerase. The recombinant DNA construct of this invention can include a synthetic phased small RNA locus (which can transcribe to a longer or shorter transcript than that transcribed from a naturally occurring phased small RNA locus), designed to be cleaved in vivo and in phase into any number of phased small RNAs for suppression of one or more target genes. [00110] This example provides an embodiment of a recombinant DNA construct including nucleic acid sequences derived from monocot crop plants, that transcribes to an RNA containing a single foldback structure cleavable in vivo and in phase to multiple small double- stranded RNAs for gene suppression, independently of an RNA-dependent RNA polymerase. A phased small RNA locus from monocot crops was found to have the single foldback structure depicted in Figure 1 (see Example 1). This locus includes at least seven 21-mer RNAs (SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ DD NO. 7), each and any of which can be engineered to suppress expression of one target gene or of multiple target genes in trans. In this non-limiting example, a recombinant DNA construct based on this locus was designed to transcribe to a single transcript including an imperfect foldback structure for suppressing multiple endogenous genes in maize: (1) the messenger RNA encoding the LKR region of the lysine ketoglutarate reductase/saccharopine dehydrogenase gene, LKR/SDH, and (2) the messenger RNA encoding the dominant Waxy gene, which encodes an enzyme for starch synthesis; a "waxy" (non- starchy) mutant phenotype characterized by decreased amylose and increased amylopectin (branched starch) is typically seen in plants homozygous for the naturally occurring, recessive allele (wx/wx) and is useful as a visual marker of inheritance in maize breeding.

[00111] The recombinant DNA sequence was designed based on a 939-nucleotide starting sequence (SEQ ID NO. 17), which included, in order:

(1) a 5' leader sequence (SEQ ID NO. 18);

(2) the 5' arm of the foldback structure, including a first series of contiguous RNA segments, i. e., seven contiguous 21-mers (SEQ ID NO. 1, SEQ DD NO. 2, SEQ DD NO. 19, SEQ DD NO.20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ DD NO. 7) in the order listed (5' to 3');

(3) spacer sequence (SEQ DD NO. 23) forming a loop joining the 5' and 3' arms of the foldback structure;

(4) the 3' arm of the foldback structure, including a second series of contiguous RNA segments, i. e., seven contiguous 21-mers (SEQ ID NO.24, SEQ DD NO. 6, SEQ ID NO. 5, SEQ ID NO.4, SEQ ID NO. 3, SEQ DD NO. 25, and SEQ ID NO.26) in the order listed (5' to 3'); and

(5) a 3' untranslated region and terminator (SEQ DD NO. 27)

[00112] This starting sequence (SEQ DD NO. 17) is useful as a phased small RNA template on which a gene suppression construct is based; any one or more of the contiguous 21-mers (or the contiguous RNA segments in the corresponding RNA transcript) that form the foldback structure can be modified or engineered to silence a target gene, as described above under the heading "A Recombinant DNA Construct Transcribing to a First and Second Series of Contiguous RNA Segments that Form Hybridized RNA that is Cleaved in Phase in vivo". In this non-limiting embodiment, the 21-mers engineered to silence one or more target genes are preferably selected from SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO. 6, and SEQ ID NO.7. Preferably, a spacer sequence (such as SEQ ID NO. 23) forming a loop joining the 5' and 3' arms of the foldback structure is maintained in the engineered gene suppression construct.

[00113] In one specific example, selected 21-mer sequences (synthetic phased small RNAs) were designed to target LKR (SEQ ID NO.28, and SEQ ID NO. 29) or Waxy (SEQ ID NO.30, and SEQ ID NO. 31), respectively. These are cloned into expressed phase locations of the template sequence to yield the gene suppression construct having the sequence aatcttattctacatatttctatcttatatagaacaactagcatagctctcgttgcccagccaggttgcccagccaggttgcctggtgcacaat gagagctggctagggcggactcattctgctgttggtgcccaacgatgctagctgctactcatactagtgaagcctgccatggttctgagaa atttttggatactccgctgcgtagatatgcactaaaagcttgtatgtttcgctgactacatactatggatatcacctgtttgacaagagaaggat tacataccacgateaagatgaattggaacatgATGCAAGTGATGTAGCGCCCCATATAGGAGTCACTC AGGAAAGCGCaGCTCGCCAccGAGATGcGCCcAAGATGCAGGTGcATGCTGAcgctaTT GGcGGCCtCGCATAGATCcCTTGATaTCACTTTGTgGATGCAGAaAGCGGTGcccacgg cgacgccaaaaaatgcaaagttggccaacacatagctcactgcatcgtcaagtagagctgcttaatcactgagggtatatacatttagttc gccttcttcagcgttgccatggacaCCGCTcTCTGCATCaACAAAGTGAcATCAAGtGATCTATGC GtGGCCaCCAAcaacaTCAGCATaCACCTGCATCTTtGGCaCATCTCctTGGCGAGCg GCGCttTCCGTAGTGATTCCTATACGGGGTGCTACTTCACTTGGATCAtgttacaatttatcttc atcgtgatatatgctccttctgttctcacataggtgatatcttaaaatgtatgaggcatatatactttctacctaatattataaagtatatgcctctat atagatcaaataaagcagaaaagtcattgttattaccaatcgtgtacttttgttctaaacatctcaactagtttaaagtatttgtctctcttga (SEQ ID NO. 32); the 5' and 3' arms of the foldback structure are indicated by underlined text, engineered 21-mers are shown in bold font, and intentionally mismatched nucleotides are indicated by lower case font. Additional sequence on each foldback arm was also modified in order to preserve the original secondary structure (including the location of mismatched bases) of the template sequence (SEQ ID NO. 17). Figure 5 depicts the predicted secondary structure of the RNA transcribed respectively from the template sequence (SEQ ID NO. 17) and from the engineered gene suppression construct (SEQ ID NO. 32). Expression of the engineered gene suppression construct is driven by an appropriate endosperm specific promoter, such as a maize zein or B32 promoter (nucleotides 848 through 1259 of GenBank accession number X70153, see also Hartings et al. (1990) Plant MoI. Biol, 14:1031-1040, which is incorporated herein by reference). Additional synthetic phased small RNA constructs are designed in a similar manner to silence multiple target genes, such as combinations of endogenous genes (e. g., LKR/SDH, GLABRAl, DWARF4, and CLAVATA) or transgenes (e. g., reporter genes such as GUS or GFP, or selectable markers such as a gene imparting antibiotic or herbicide tolerance).

Example 4

[00114] This example describes a non-limiting embodiment of an RNA transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression, wherein the hybridized RNA is produced independently of an RNA-dependent RNA polymerase. More specifically, this example provides nucleic acid sequences, obtained from monocot crop plants, that are useful in making a recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression, independently of an RNA- dependent RNA polymerase.


























AAAA (SEQ ID NO. 33), and a phase uniqueness score of 0.959, highly supportive of the predicted RNA transcript having the sequence












GACCGAGGAUGAUGGUCACUAUGAUGUGCUGAAA (SEQ ID NO. 34) and containing the sequence and single foldback structure as shown in Figure 6. Figure 7A depicts the siRNA abundance in transcripts per quarter million sequences ("tpq") along the entire sequence (about

2 kilobases), and Figure TB depicts an expanded view of the siRNA region and the 21- nucleotide phasing of the small RNA abundance from this locus.

[00116] As with the phased small RNA locus described in Example 1, the locus having SEQ ID NO. 33 was predicted to transcribe to RNA (SEQ ID NO. 34) forming hybridized RNA independently of an RNA-dependent RNA polymerase and to be cleavable in vivo in phase into multiple small double-stranded RNAs. Unlike frα«.s-acting siRNAs, all of the multiple small double-stranded RNAs derive from the original RNA transcript or plus strand of the precursor, independently of an RNA-dependent RNA polymerase and without a miRNA target site that initiates production of double-stranded RNA. Unlike microRNAs, the locus is cleaved in vivo to multiple abundant phased small RNAs, and (as described below in Example 5), this process requires DCL4 or a DCL4 orthologue and not DCLl.

[00117] Data on the phased small RNAs from this locus (SEQ ID NO.33) are provided in Table 4. The majority of these phased small RNAs were cloned from the rice small RNA libraries, and several were also identified in maize (Zea mays) RNA libraries prepared from kernels (32 days after pollination and 39 days after pollination) and root (V9 stage), indicating that a similar phased small RNA locus exists in maize. The transcript (SEQ ID NO. 34) predicted from this locus (SEQ ID NO.33) also includes 5' flanking sequence AGUCCAGCAAGUUUUGAAGAUGAUAGAAAAUUUGAGCGCGUCGUAGUAACUGU CGUCCACGA (SEQ ID NO. 66) and 3' flanking sequence

GAGGAUGAUGGUCACUAUGAUGUGCUGAAA (SEQ ID NO. 67) as well as a spacer sequence UUUAUUUUCGCUUGGUUUCCGGCAAAAAGGG (SEQ ID NO. 68) located between the 5' and 3' arms of the foldback structure, that includes a 3-nucleotide turn. Figure 6 depicts the relative position of each small RNA along the 5' and 3' arms of the hybridized RNA (foldback) structure (SEQ ID NO. 34) predicted from the rice locus (SEQ ID NO. 33). Most, but not all, of these small RNAs are 21-mers. The small RNA predicted to be encoded by SEQ ID NO. 59 contains 27 nucleotides, including a large bulge of 8 unpaired nucleotides; modification of this sequence so that this small RNA is closer to two helical turns (about 21 nucleotides) is predicted to result in processing of this small RNA.

Table 4

* "tpq", transcripts per quarter million sequence reads (given as averages of three sequencing runs)

♦♦small RNA also cloned from maize

♦♦♦predicted from the phased sRNA locus sequence (SEQ ID NO.33) but not cloned

Example 5

[00118] This example describes a non-limiting embodiment of DNA encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression, wherein the hybridized RNA is produced independently of an RNA-dependent RNA polymerase. The Os06g21900 phased sRNA locus (described in Example 1 and with the partial structure depicted in Figure 1) is processed in vivo to multiple phased small RNAs; all of the multiple small double- stranded RNAs derive from the plus strand of the precursor, which distinguishes them from frαns-acting siRNAs. And, unlike microRNAs, the locus contains multiple abundant phased small RNAs. This example provides further characterization of a phased small RNA locus as clearly distinct from canonical microRNAs and trans-acting siRNAs.

[00119] The Qs06g21900 phased sRNA locus, located on rice Chromosome 6, was further characterized. A 898-nucleotide precursor that mapped to this locus was sequenced from library clone LIB4833-001-R1-N1-G10 and found to have the DNA sequence















ATAAAGCAGAAAAGTCATTGTTATT ACAAAAAAAAAAAAAAAAAA (SEQ ID NO. 69); the corresponding transcript contained the phased small RNAs (see Example 1) distributed between two regions along the transcript (Figure 8A). This locus contains two exons (Exons 2 and 3, indicated by the shaded regions) that form a long, imperfect foldback structure containing eight 21-nucleotide phased small double-stranded RNAs, separated by an -1.2 kB intron (Figure 8B). No small RNAs were found that match Exon 1, nor was any miRNA target sequence that could initiate a /raws-acting siRNA phasing identified (see Allen et al. (2005) Cell, 121:207-221; Vaucheret (2005) ScL STKE, 2005, e43; and Yoshikawa et al. (2005) Genes Dev., 19:2164-2175). RNA gel blot analysis of the most abundant phased small RNA confirmed that expression was specific to rice grain (Figure 8C). Neither of the two most abundant phased small RNAs ("P7", SEQ ID NO. 6, and "P4", SEQ ID NO. 3) was detected in rice seedlings or in other plant species tested.

[00120] The phased small RNAs form a novel class of regulatory small RNAs that differ from both canonical microRNAs (miRNAs) and trans-acting siRNAs. The phased small RNAs disclosed herein are to some extent reminiscent of miR163 in Arabidopsis in which two phases of siRNAs were sequenced with a single small RNA (miR163 itself) significantly accumulating; see Allen et al. (2004) Nat. Genet., 36:1282-1290; and Kurihara and Watanabe (2004) Proc. Natl. Acad. ScL U. S. A., 101:12753-12758. However, the phased small RNAs clearly differ from miR163 in that multiple abundant phased small RNAs are processed and can be isolated from a single transcript. The phased small RNAs locus is a single, extended, imperfect foldback structure (for example, the loci depicted in Figure 1, Figure 6, or Figure 8B), and therefore is also clearly different from the trans-acting siRNA loci identified in Arabidopsis, which require an RNA -dependent RNA polymerase (RDR6) to generate the double-stranded RNA from which the phased siRNAs are processed.

[00121] The extended foldback structure of the Os06g21900 phased small RNA locus suggests that this precursor is not processed via the canonical miRNA pathway. The phased nature of the phased small RNAs further indicates that they are the result of processing by DCL4 or a DCL4 orthologue rather than by DCLl. To further confirm that the phased small RNAs disclosed herein are unique and distinct from both canonical microRNAs (miRNAs) and mms-acting siRNAs, the full length cDNA from the Os06g21900 phased small RNA locus was transformed into Arabidopsis thaliana Columbia (Col-0) ecotype and mutants dell -7 (a DCLl knock-out) and dcl4-l (a DCL4 knock-out). RNA was extracted and blots analyzed using probes corresponding to phased small RNAs "P7" (SEQ ID NO. 6), and "P5" (SEQ ID NO. 4), a canonical miRNA (miR173) and a mms-acting siRNA (ta-siR255) (Figure 8D).

[00122] Phased 21-nucleotide small RNAs were highly expressed in transformation events from CoI-O and dcll-7, but in the dcl4-l mutant, 21-nucleotide phased sRNAs were absent, with only faint 24-nucleotide small RNAs observed (similar to what was observed for ta-siR255). These data are consistent with the function of DCL4 in processing small RNAs in phase, but, unlike trans-acting siRNAs, no miRNA initiation site was required in the case of the phased small RNA loci disclosed herein. These data also demonstrated that the phased small RNA locus from a monocot crop plant was efficiently processed in a dicot plant. Thus, phased sRNAs are processed through pathways distinct from those of both canonical microRNAs (miRNAs) and trans-acting siRNAs. As described in other Examples disclosed herein, the phased small RNA locus is useful as a template for designing a recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression, or alternatively as a template for designing a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression.

Example 6

[00123] This example describes a non-limiting embodiment of a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression.

[00124] This example provides an embodiment of a recombinant DNA construct including nucleic acid sequences derived from monocot crop plants, that transcribes to an RNA containing a single foldback structure cleavable in vivo and in phase to multiple small double- stranded RNAs for gene suppression, independently of an RNA-dependent RNA polymerase. This example is a recombinant DNA construct designed to suppress multiple target genes. The Os06g21900 phased small RNA locus (see Example 1) was modified to suppress three target genes as follows: nucleotides of the phased small RNAs with the identifiers 1196700 (SEQ ID NO. 3), 1379342 (SEQ ID NO. 6), and 544819 (SEQ ID NO. 7) were replaced, respectively, with nucleotides corresponding to a segment of the GLl, IDA, and LFY genes from Arabidopsis thaliana. The resulting sequence was GGTACCAATCTTATT(^ACATATTTCTATCTTATATAGAACAACTAGCATAGCTCTCGTTGC










CΓTAAAATGTATGAGGCATATATACTTTCTACCT AATATTATAAAGTATATGCCTCTATATA GATCAAATAAAGCAGAAAAGTCATTGTTATTACGTTAAC (SEQ ID NO. 70). THIS sequence was synthesized, subcloned into a dicot binary vector (pMON97890) including a glyphosate resistance selectable marker, and transformed into Arabidopsis thaliana using a floral dip technique as described by Clough and Bent (1998), Plant J., 16:735-743. The resulting events are selected using glyphosate, and selected plants are screened for the expected phenotypes, i. e., loss of trichomes by GLl suppression (Marks and Feldmann (1989) Plant Cell, 1:1043-1050), prevention of petal abscission by IDA suppression (Butenko et al. (2003) Plant Cell, 15:2296-2307), and flower to leaf conversion by LFY suppression (Schwab et al. (2006) Plant Cell, 18:1121-1133).

Example 7

[00125] This example describes a non-limiting embodiment of a recombinant DNA construct including DNA that transcribes to: (a) a first series of contiguous RNA segments, and (b) a second series of contiguous RNA segments, wherein the first series of contiguous RNA segments hybridize in vivo to the second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs ("phased small RNAs") for gene suppression. More specifically, this example describes a recombinant DNA construct that transcribes to RNA that is cleaved in vivo in phase into phased small RNAs for gene suppression of multiple viruses in plants.

[00126] Phased small RNAs were designed to target highly homologous regions of economically important geminiviruses, tospoviruses, and a potexvirus that infect tomato. These viruses include Tomato yellow leaf curl virus (Dominican Republic isolate), Tomato leaf curl New Delhi virus, Tomato severe leaf curl virus, Pepper huasteco yellow vein virus, Pepper golden mosaic virus, Pepino mosaic virus, Tomato spotted wilt virus, Groundnut bud necrosis virus, and Capsicum chlorosis virus. Homologous regions allow a limited set of phased small RNAs to control many viruses; additionally, these conserved regions are predicted to be less likely to evolve resistance due to base changes that would impede or prevent suppression by phased small RNAs. Reynolds score, functional asymmetry, and miRNA properties were considered when selecting target sequences for suppression. Multiple phased small RNAs are utilized to improve silencing and prevent resistance. [00127] In this non-limiting example, nucleotide sequences for suppressing multiple viral targets were used to replace native sequences (i. e., segments each of 21 contiguous nucleotides) of the abundant phased small RNAs derived from a scaffold sequence (the Os06g21900 cDNA, SEQ ID NO. 69), with additional nucleotides changed where necessary in order to preserve secondary structure as found in the native precursor transcript. The replacement 21 -nucleotide segments included two sequences for suppressing gemini viruses, TGGTACAACGTCATTGATGAC (SEQ ID NO. 71) and TGGACCTTACATGGCCCTTCA (SEQ ID NO. 72), one sequence for suppressing potexviruses,

TAATTGTGCAGCTCATCACCC (SEQ ID NO. 73), and three sequences for suppressing tospoviruses (one for each segment of these tripartite viruses),

TAGATGGGAAATATAGATATC (SEQ ID NO. 74, targetting the tospovirύs M segment), TGCTTATATGTATGTTCTGTA (SEQ ID NO. 75, targetting the tospovirus L segment), and TCAAGAGTCTTTGAAAGAAAG (SEQ ID NO.76, targetting the tospovirus S segment). The replacement segments were incorporated into a DNA sequence encoding a synthetic phased small RNA precursor (i. e., an RNA transcript that is cleaved in vivo in phase into phased small RNAs for gene suppression of multiple viruses in plants),


Example 8

[00128] This example describes identification of targets of an RNA that is cleaved in vivo in phase into phased small RNAs for gene suppression. More specifically, this example describes identification of targets of phased small RNAs produced from a native phased small RNA locus.

[00129] Putative target genes regulated by the phased small RNAs (see Table 4) produced from the locus having SEQ ID NO. 33 were predicted from plant cDNA databases using the miRSite algorithm. miRSite predicts miRNA targets by comparison of sequence similarity between the input miRNA and the target cDNA dataset. The miRNArtarget pairs (or analogously, the phased small RNA:target pairs) were scored based on rules established from experimentally validated miRNA targets (Allen et al. (2005) Cell, 121:207-221). Briefly, mispairs and single nucleotide gaps were scored as 1, G:U pairs as 0.5, scores for mispairs from bases 2 to 13 doubled, and summed along the length of the target. The predicted targets were ranked according to their penalty scores, with scores less than 4.5 considered as putative targets. In the case of conserved miRNAs or phased small RNA, targets present in orthologous genes and locations were given preference. Table 5 provides non-limiting examples of target genes (and the recognition site identified in the target gene's RNA transcript) predicted to be regulated by regulated by phased small RNAs from the locus having SEQ ID NO. 33; the alignment of the phased small RNA and the recognition site is also depicted.

Table 5


[00130] The technique known as RNA ligase-mediated rapid amplification of cDNA 5' ends ("5' RLM-RACE") is used to experimentally validate predicted targets in plants (e. g., rice and maize); see, for example, Kasschau et al. (2003) Dev. Cell, 4:205-217, and Llave et al. (2002) Science, 297:2053-2056. This approach relies on ligation of an RNA adapter molecule to the 5' end of the cleavage site and is dependent on the 5' phosphate left by RNAase HI enzymes including Agol. The resulting PCR products are sequenced and the relative number of clones which align to the predicted miRNA (or phased small RNA) cleavage site between nucleotides 10 and 11 relative to the miRNA (or phased small RNA) 5' end provide an estimate of miRNA (or phased small RNA) activity. Results from 5' RLM-RACE assays are used to confirm cleavage of a predicted target by any of the phased small RNAs.

[00131] Identification and validation of endogenous genes regulated by phased small RNAs from a natively expressed phased small RNA locus is useful, e. g., to eliminate or modify a phased small RNA recognition site in an endogenous gene in order to decouple expression of that gene from regulation by the phased small RNA that natively regulates expression of the gene. For example, the number of mispairs involving bases at positions 2 to 13 (in a phased small RNA recognition site having contiguous 21 nucleotides) can be increased to prevent recognition and cleavage by the phased small RNA.

[00132] AU of the materials and methods disclosed and claimed herein can be made and used without undue experimentation as instructed by the above disclosure. Although the materials and methods of this invention have been described in terms of preferred embodiments and illustrative examples, it will be apparent to those of skill in the art that variations can be applied to the materials and methods described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.


What is claimed is:
1. A recombinant DNA construct encoding a transcript that folds into hybridized RNA that is cleaved in phase in vivo into multiple small double-stranded RNAs for gene suppression.
2. The recombinant DNA construct of claim 1, wherein said hybridized RNA is produced independently of an RNA-dependent RNA polymerase.
3. The recombinant DNA construct of claim 1, wherein said hybridized RNA is cleaved in phase in vivo by DCL4 or a DCL4 orthologue into multiple small double-stranded RNAs for gene suppression.
4. The recombinant DNA construct of claim 1, wherein said multiple small double-stranded RNAs comprise at least 3 small double-stranded RNAs.
5. The recombinant DNA construct of claim 1, wherein said hybridized RNA comprises a structure derived from a transcript of a naturally occurring phased small RNA locus.
6. The recombinant DNA construct of claim 1, wherein said construct comprises a nucleotide sequence derived from a phased small RNA template sequence, wherein at least one segment of 21 contiguous nucleotides in said phased small RNA template sequence is modified to suppress a target gene.
7. The recombinant DNA construct of claim 1, wherein said small double-stranded RNAs each contains at least one mismatch.
8. The recombinant DNA construct of claim 1, wherein said gene suppression is of one target gene.
9. The recombinant DNA construct of claim 1, wherein said gene suppression is of multiple target genes.
10. A recombinant DNA construct comprising DNA that transcribes to:
(a) a first series of contiguous RNA segments, and
(b) a second series of contiguous RNA segments, wherein said first series of contiguous RNA segments hybridize in vivo to said second series of RNA segments to form hybridized RNA that is cleaved in phase in vivo by DCL4 or a DCL4 orthologue into multiple small double- stranded RNAs for gene suppression.
11. The recombinant DNA construct of claim 10, wherein each of said RNA segments consists of between 20 to 27 nucleotides.
12. The recombinant DNA construct of claim 10, wherein said first and second series comprise RNA segments of 21 nucleotides.
13. The recombinant DNA construct of claim 10, wherein strands of said hybridized RNA are located on a single molecule and said construct further comprises DNA that transcribes to a spacer that links said first and second series of contiguous RNA segments.
14. The recombinant DNA construct of claim 10, wherein strands of said hybridized RNA are located on separate molecules.
15. The recombinant DNA construct of claim 10, comprising at least one nucleotide sequence derived from a transcript of a naturally occurring phased small RNA locus selected from the group consisting of 5' flanking sequence, 3' flanking sequence, and spacer sequence.
16. A recombinant DNA construct comprising a promoter operably linked to DNA that transcribes to RNA comprising:
(a) at least one exogenous recognition site recognizable by a phased small RNA expressed in a specific cell of a multicellular eukaryote, and
(b) target RNA to be suppressed in said specific cell, wherein said target RNA is to be expressed in cells of said multicellular eukaryote other than said specific cell.
17. The recombinant DNA construct of claim 16, wherein said at least one exogenous recognition site is located within at least one of:
(a) the 5' untranslated region of said target RNA;
(b) the 3' untranslated region of said target RNA; and
(c) said target RNA.
18. A non-natural transgenic plant cell having in its genome the recombinant DNA construct of claim 1, claim 10, or claim 16.
19. A non-natural transgenic plant comprising the non-natural transgenic plant cell of claim 18.
PCT/US2007/019283 2006-08-31 2007-08-31 Phased small rnas WO2008027592A3 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US84160806 true 2006-08-31 2006-08-31
US60/841,608 2006-08-31

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20070837683 EP2059596B1 (en) 2006-08-31 2007-08-31 Phased small rnas
ES07837683T ES2655700T3 (en) 2006-08-31 2007-08-31 Small RNAs phase

Publications (3)

Publication Number Publication Date
WO2008027592A2 true true WO2008027592A2 (en) 2008-03-06
WO2008027592A9 true WO2008027592A9 (en) 2008-04-24
WO2008027592A3 true WO2008027592A3 (en) 2008-09-04



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/019283 WO2008027592A3 (en) 2006-08-31 2007-08-31 Phased small rnas

Country Status (5)

Country Link
US (3) US8404928B2 (en)
EP (2) EP3287524A1 (en)
CN (1) CN101600798A (en)
ES (1) ES2655700T3 (en)
WO (1) WO2008027592A3 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010002984A1 (en) 2008-07-01 2010-01-07 Monsanto Technology, Llc Recombinant dna constructs and methods for modulating expression of a target gene
WO2014160383A1 (en) * 2013-03-13 2014-10-02 E. I. Dupont De Nemours & Company Production of small interfering rnas in planta
WO2014201361A1 (en) * 2013-06-14 2014-12-18 Monsanto Technology Llc Differential maturing refuge and methods thereof

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008133643A8 (en) 2006-10-12 2011-10-06 Monsanto Technology, Llc Plant micrornas and methods of use thereof
EP2262896B1 (en) 2008-04-07 2014-01-22 Monsanto Technology LLC Plant regulatory elements and uses thereof
ES2651909T3 (en) 2009-04-20 2018-01-30 Monsanto Technology Llc Multiple virus resistance in plants
EP2524045B1 (en) 2010-01-14 2015-12-02 Monsanto Technology LLC Plant regulatory elements and uses thereof
US9222100B2 (en) 2010-08-24 2015-12-29 Monsanto Technology Llc Methods and DNA constructs for autoregulating transgene silencing
CA2831133A1 (en) 2011-03-25 2012-10-04 Monsanto Technology Llc Plant regulatory elements and uses thereof
KR20140039224A (en) 2011-05-13 2014-04-01 몬산토 테크놀로지 엘엘씨 Plant regulatory elements and uses thereof
US9663793B2 (en) 2012-04-20 2017-05-30 Monsanto Technology, Llc Plant regulatory elements and uses thereof
CA2887349A1 (en) * 2012-10-16 2014-04-24 Monsanto Technology Llc Methods and compositions for controlling plant viral infection
WO2018005589A1 (en) 2016-06-28 2018-01-04 Cellectis Altering expression of gene products in plants through targeted insertion of nucleic acid sequences

Citations (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5015580A (en) 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5190931A (en) 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5208149A (en) 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5272065A (en) 1983-10-20 1993-12-21 Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
WO1995006128A2 (en) 1993-08-25 1995-03-02 Dekalb Genetics Corporation Fertile, transgenic maize plants and methods for their production
WO1995006722A1 (en) 1993-09-03 1995-03-09 Japan Tobacco Inc. Method of transforming monocotyledon by using scutellum of immature embryo
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5453566A (en) 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5500365A (en) 1989-02-24 1996-03-19 Monsanto Company Synthetic plant genes
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5538880A (en) 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US5550318A (en) 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5591616A (en) 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5750871A (en) 1986-05-29 1998-05-12 Calgene, Inc. Transformation and foreign gene expression in Brassica species
US5750848A (en) 1996-08-13 1998-05-12 Monsanto Company DNA sequence useful for the production of polyhydroxyalkanoates
US5763245A (en) 1991-09-23 1998-06-09 Monsanto Company Method of controlling insects
US5780708A (en) 1990-01-22 1998-07-14 Dekalb Genetics Corporation Fertile transgenic corn plants
US5846797A (en) 1995-10-04 1998-12-08 Calgene, Inc. Cotton transformation
US5888732A (en) 1995-06-07 1999-03-30 Life Technologies, Inc. Recombinational cloning using engineered recombination sites
US5914451A (en) 1998-04-06 1999-06-22 Monsanto Company Efficiency soybean transformation protocol
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
US6118047A (en) 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US6153812A (en) 1994-10-26 2000-11-28 Monsanto Company Rapid and efficient regeneration of transgenic wheat plants
US6194636B1 (en) 1999-05-14 2001-02-27 Dekalb Genetics Corp. Maize RS324 promoter and methods for use thereof
US6207879B1 (en) 1999-05-14 2001-03-27 Dekalb Genetics Corporation Maize RS81 promoter and methods for use thereof
US6232526B1 (en) 1999-05-14 2001-05-15 Dekalb Genetics Corp. Maize A3 promoter and methods for use thereof
US6277608B1 (en) 1997-10-24 2001-08-21 Invitrogen Corporation Recombinational cloning using nucleic acids having recombination sites
US6288312B1 (en) 1991-05-15 2001-09-11 Monsanto Company Method of creating transformed rice plant
US20020007051A1 (en) 1999-12-10 2002-01-17 David Cheo Use of multiple recombination sites with unique specificity in recombinational cloning
US6372965B1 (en) 1992-11-17 2002-04-16 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and hydroxylases from plants
US6384301B1 (en) 1999-01-14 2002-05-07 Monsanto Technology Llc Soybean agrobacterium transformation method
US6403865B1 (en) 1990-08-24 2002-06-11 Syngenta Investment Corp. Method of producing transgenic maize using direct transformation of commercially important genotypes
WO2002057471A2 (en) 2001-01-09 2002-07-25 Monsanto Technology Llc Maize chloroplast aldolase promoter compositions and methods for use thereof
US6426448B1 (en) 1998-05-11 2002-07-30 E. I. Du Pont De Nemours And Company Gene combinations that alter the quality and functionality of soybean oil
US6429357B1 (en) 1999-05-14 2002-08-06 Dekalb Genetics Corp. Rice actin 2 promoter and intron and methods for use thereof
US6433252B1 (en) 1998-05-18 2002-08-13 Dekalb Genetics Corporation Maize L3 oleosin promoter
WO2002062129A2 (en) 2001-02-06 2002-08-15 Dow Agrosciences Llc High oil maize plants, and methods for obtaining same
US20020133852A1 (en) 2000-01-07 2002-09-19 Hauge Brian M. Soybean SSRs and methods of genotyping
US20030005491A1 (en) 2000-01-07 2003-01-02 Monsanto Company Nucleic acid molecules and other molecules associated with soybean cyst nematode resistance
US20030049612A1 (en) 1999-01-15 2003-03-13 Craig S. Echt Microsatelite dna markers and uses thereof
US20030167537A1 (en) 2001-03-30 2003-09-04 Cai-Zhong Jiang Method for modifying plant biomass
US6624344B1 (en) 1987-11-18 2003-09-23 Mycogen Corp. Transformation of cotton plants
US20040087030A1 (en) 1998-12-18 2004-05-06 Armstrong Toni A. Method for the regeneration of cotton
US20040098761A1 (en) 2002-07-10 2004-05-20 Kansas State University Research Foundation Compositions and methods for controlling parasitic nematodes
US20040115642A1 (en) 2002-12-12 2004-06-17 Changlin Fu Single-step methods for gene cloning
US20040126845A1 (en) 2002-06-21 2004-07-01 Eenennaam Alison Van Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
US6759575B2 (en) 1996-09-03 2004-07-06 Bayer Bioscience N.V. Barstar gene
US20040244075A1 (en) 2003-05-30 2004-12-02 Monsanto Technology Llc Methods for corn transformation
US20050005321A1 (en) 2003-06-16 2005-01-06 Monsanto Technology Llc Method and apparatus for preparation of genetically transformable plant tissue
WO2005007829A2 (en) 2003-07-14 2005-01-27 Monsanto Technology, Llc Materials and methods for the modulation of cyclin-dependent kinase inhibitor-like polypeptides in maize
US6872872B1 (en) 1992-11-17 2005-03-29 E. I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
WO2005110068A2 (en) 2004-04-09 2005-11-24 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US20060021087A1 (en) 2004-04-09 2006-01-26 Baum James A Compositions and methods for control of insect infestations in plants
US7060876B2 (en) 1992-07-07 2006-06-13 Japan Tobacco Inc. Method for transforming monocotyledons
US20060200878A1 (en) 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US20070079393A1 (en) 2005-08-24 2007-04-05 Pioneer Hi-Bred International, Inc. Methods and compositions for providing tolerance to multiple herbicides

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4187413B2 (en) * 1998-03-20 2008-11-26 コモンウェルス サイエンティフィック アンドインダストリアル リサーチ オーガナイゼーション Control of gene expression
EP3214177A3 (en) * 1998-04-08 2017-11-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
KR20010071315A (en) * 1998-05-26 2001-07-28 한스 루돌프 하우스, 헨리테 브룬너, 베아트리체 귄터 DSRNA-mediated regulation of gene expression in plants
DE10212893A9 (en) * 2002-03-20 2004-09-09 Basf Plant Science Gmbh A method for increasing the oil content in plants
DE10212892A9 (en) * 2002-03-20 2004-09-09 Basf Plant Science Gmbh Constructs and methods for regulation of gene expression
JP4558711B2 (en) * 2003-02-19 2010-10-06 コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガニゼイション Efficient gene silencing in plants in using short dsRNA sequences
WO2005011816A3 (en) 2003-08-01 2005-06-02 Todd Peterson Training umbrella golf grip
WO2005035769A3 (en) * 2003-10-09 2005-06-02 Du Pont Gene silencing by using micro-rna molecules
CA2555415A1 (en) * 2004-02-10 2005-08-25 Monsanto Technology, Llc. Transgenic corn seed with enhanced amino acid content
US7855323B2 (en) * 2004-02-10 2010-12-21 Monsanto Technology Llc Recombinant DNA for gene suppression
EP1809748B1 (en) * 2004-10-12 2012-12-26 The Rockefeller University Micrornas
CA2582550A1 (en) * 2004-10-25 2006-05-04 Devgen Nv Rna constructs
US8314290B2 (en) 2004-12-21 2012-11-20 Monsanto Technology Llc Temporal regulation of gene expression by MicroRNAs
WO2006073727A3 (en) * 2004-12-21 2007-06-28 Monsanto Technology Llc Recombinant dna constructs and methods for controlling gene expression
EP1838144B1 (en) * 2005-01-07 2016-08-31 Oregon State University Method to trigger rna interference
EP1874936B1 (en) * 2005-04-19 2013-10-30 BASF Plant Science GmbH Improved methods controlling gene expression
EP1907549A1 (en) * 2005-06-17 2008-04-09 Pioneer-Hi-Bred International, Inc. Methods and compositions for gene silencing
US8334430B2 (en) * 2005-10-13 2012-12-18 Monsanto Technology Llc Methods for producing hybrid seed
KR101454939B1 (en) 2006-11-30 2014-10-27 각고호우징 게이오기주크 Abnormal electrical conduction-blocking apparatus using photodynamic therapy(pdt)

Patent Citations (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5208149A (en) 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5272065A (en) 1983-10-20 1993-12-21 Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5190931A (en) 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5107065A (en) 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5453566A (en) 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5759829A (en) 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US5463174A (en) 1986-05-29 1995-10-31 Calgene Inc. Transformation and foreign gene expression in Brassica species
US5750871A (en) 1986-05-29 1998-05-12 Calgene, Inc. Transformation and foreign gene expression in Brassica species
US5004863B2 (en) 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US5004863A (en) 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5159135B1 (en) 1986-12-03 2000-10-24 Agracetus Genetic engineering of cotton plants and lines
US5004863B1 (en) 1986-12-03 1992-12-08 Agracetus
US5159135A (en) 1986-12-03 1992-10-27 Agracetus Genetic engineering of cotton plants and lines
US5015580A (en) 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
US6624344B1 (en) 1987-11-18 2003-09-23 Mycogen Corp. Transformation of cotton plants
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5569834A (en) 1988-07-22 1996-10-29 Monsanto Company Method for soybean transformation and regeneration
US5824877A (en) 1988-07-22 1998-10-20 Monsanto Company Method for soybean transformation and regeneration
US5500365A (en) 1989-02-24 1996-03-19 Monsanto Company Synthetic plant genes
US5538880A (en) 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US6160208A (en) 1990-01-22 2000-12-12 Dekalb Genetics Corp. Fertile transgenic corn plants
US5780708A (en) 1990-01-22 1998-07-14 Dekalb Genetics Corporation Fertile transgenic corn plants
US5550318A (en) 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6399861B1 (en) 1990-04-17 2002-06-04 Dekalb Genetics Corp. Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6403865B1 (en) 1990-08-24 2002-06-11 Syngenta Investment Corp. Method of producing transgenic maize using direct transformation of commercially important genotypes
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US6288312B1 (en) 1991-05-15 2001-09-11 Monsanto Company Method of creating transformed rice plant
US5518908A (en) 1991-09-23 1996-05-21 Monsanto Company Method of controlling insects
US5763245A (en) 1991-09-23 1998-06-09 Monsanto Company Method of controlling insects
US7060876B2 (en) 1992-07-07 2006-06-13 Japan Tobacco Inc. Method for transforming monocotyledons
US5591616A (en) 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
US6872872B1 (en) 1992-11-17 2005-03-29 E. I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and related enzymes from plants
US6372965B1 (en) 1992-11-17 2002-04-16 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and hydroxylases from plants
WO1995006128A2 (en) 1993-08-25 1995-03-02 Dekalb Genetics Corporation Fertile, transgenic maize plants and methods for their production
US6118047A (en) 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
WO1995006722A1 (en) 1993-09-03 1995-03-09 Japan Tobacco Inc. Method of transforming monocotyledon by using scutellum of immature embryo
US6153812A (en) 1994-10-26 2000-11-28 Monsanto Company Rapid and efficient regeneration of transgenic wheat plants
US5888732A (en) 1995-06-07 1999-03-30 Life Technologies, Inc. Recombinational cloning using engineered recombination sites
US5846797A (en) 1995-10-04 1998-12-08 Calgene, Inc. Cotton transformation
US5750848A (en) 1996-08-13 1998-05-12 Monsanto Company DNA sequence useful for the production of polyhydroxyalkanoates
US6759575B2 (en) 1996-09-03 2004-07-06 Bayer Bioscience N.V. Barstar gene
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
US6277608B1 (en) 1997-10-24 2001-08-21 Invitrogen Corporation Recombinational cloning using nucleic acids having recombination sites
US5914451A (en) 1998-04-06 1999-06-22 Monsanto Company Efficiency soybean transformation protocol
US6426448B1 (en) 1998-05-11 2002-07-30 E. I. Du Pont De Nemours And Company Gene combinations that alter the quality and functionality of soybean oil
US6433252B1 (en) 1998-05-18 2002-08-13 Dekalb Genetics Corporation Maize L3 oleosin promoter
US20040087030A1 (en) 1998-12-18 2004-05-06 Armstrong Toni A. Method for the regeneration of cotton
US6384301B1 (en) 1999-01-14 2002-05-07 Monsanto Technology Llc Soybean agrobacterium transformation method
US7002058B2 (en) 1999-01-14 2006-02-21 Monsanto Technology Llc Soybean transformation method
US20030049612A1 (en) 1999-01-15 2003-03-13 Craig S. Echt Microsatelite dna markers and uses thereof
US6426446B1 (en) 1999-05-14 2002-07-30 Dekalb Genetics Corporation Maize RS324 promoter and methods for use thereof
US6207879B1 (en) 1999-05-14 2001-03-27 Dekalb Genetics Corporation Maize RS81 promoter and methods for use thereof
US6437217B1 (en) 1999-05-14 2002-08-20 Dekalb Genetics Corporation Maize RS81 promoter and methods for use thereof
US6583338B2 (en) 1999-05-14 2003-06-24 Dekalb Genetics Corporation Maize A3 promoter and methods for use thereof
US6194636B1 (en) 1999-05-14 2001-02-27 Dekalb Genetics Corp. Maize RS324 promoter and methods for use thereof
US6429357B1 (en) 1999-05-14 2002-08-06 Dekalb Genetics Corp. Rice actin 2 promoter and intron and methods for use thereof
US6232526B1 (en) 1999-05-14 2001-05-15 Dekalb Genetics Corp. Maize A3 promoter and methods for use thereof
US20020007051A1 (en) 1999-12-10 2002-01-17 David Cheo Use of multiple recombination sites with unique specificity in recombinational cloning
US20030005491A1 (en) 2000-01-07 2003-01-02 Monsanto Company Nucleic acid molecules and other molecules associated with soybean cyst nematode resistance
US20020133852A1 (en) 2000-01-07 2002-09-19 Hauge Brian M. Soybean SSRs and methods of genotyping
US20040216189A1 (en) 2001-01-09 2004-10-28 Nancy Houmard Maize chloroplast aldolase promoter compositions and methods for use thereof
WO2002057471A2 (en) 2001-01-09 2002-07-25 Monsanto Technology Llc Maize chloroplast aldolase promoter compositions and methods for use thereof
WO2002062129A2 (en) 2001-02-06 2002-08-15 Dow Agrosciences Llc High oil maize plants, and methods for obtaining same
US20030167537A1 (en) 2001-03-30 2003-09-04 Cai-Zhong Jiang Method for modifying plant biomass
US20040126845A1 (en) 2002-06-21 2004-07-01 Eenennaam Alison Van Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
US20040098761A1 (en) 2002-07-10 2004-05-20 Kansas State University Research Foundation Compositions and methods for controlling parasitic nematodes
US20040115642A1 (en) 2002-12-12 2004-06-17 Changlin Fu Single-step methods for gene cloning
US20040244075A1 (en) 2003-05-30 2004-12-02 Monsanto Technology Llc Methods for corn transformation
US20050005321A1 (en) 2003-06-16 2005-01-06 Monsanto Technology Llc Method and apparatus for preparation of genetically transformable plant tissue
WO2005007829A2 (en) 2003-07-14 2005-01-27 Monsanto Technology, Llc Materials and methods for the modulation of cyclin-dependent kinase inhibitor-like polypeptides in maize
WO2005110068A2 (en) 2004-04-09 2005-11-24 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US20060021087A1 (en) 2004-04-09 2006-01-26 Baum James A Compositions and methods for control of insect infestations in plants
US20060200878A1 (en) 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US20070079393A1 (en) 2005-08-24 2007-04-05 Pioneer Hi-Bred International, Inc. Methods and compositions for providing tolerance to multiple herbicides

Non-Patent Citations (64)

* Cited by examiner, † Cited by third party
"Protein Protocols Handbook", 2002, HUMANA PRESS
"Short Protocols in Molecular Biology", 2002, JOHN WILEY AND SONS
"Transgenic Plants: Methods and Protocols", 2004, HUMANA PRESS
ALLEN ET AL., CELL, vol. 121, 2005, pages 207 - 221
ALLEN ET AL., NAT. GENET., vol. 36, 2004, pages 1282 - 1290
ALTSCHUL ET AL., J MOL. BIOL., vol. 215, 1990, pages 403 - 410
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
AMBROS ET AL., RNA, vol. 9, 2003, pages 277 - 279
AMBROS, RNA, vol. 9, 2003, pages 277 - 279
ASLANDIS ET AL., NUCLEIC ACIDS RES., vol. 18, 1990, pages 6069 - 6074
BARTEL, CELL, vol. 116, 2004, pages 281 - 297
BECKER ET AL., PLANT J, vol. 5, 1994, pages 299
BRODERSEN; VOINNET, TRENDS GENETICS, vol. 22, 2006, pages 268 - 280
BUTENKO ET AL., PLANT CELL, vol. 15, 2003, pages 2296 - 2307
BYTEBIER ET AL., PROC. NATL. ACAD. SCI. USA., vol. 84, 1987, pages 5345
CHENG ET AL., PLANT CELL REP., vol. 15, 1996, pages 653
CHUANG ET AL., PNAS, vol. 97, 2000, pages 4985 - 4990
CLOUGH; BENT, PLANT J, vol. 16, 1998, pages 735 - 743
DI GIUSTO; KING, J BIOL. CHEM., vol. 279, 2004, pages 46483 - 46489
DU ET AL., NUCLEIC ACIDS RES., vol. 33, 2005, pages 1671 - 1677
ERDMANN ET AL., NUCLEIC ACIDS RES., vol. 29, 2001, pages 189 - 193
FRAMOND, BIOTECHNOLOGY, vol. 1, 1983, pages 262 - 269
FU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 12282 - 12287
G. N. AGRIOS: "Plant Pathology", 1997, ACADEMIC PRESS, pages: 635
GENDEL, ADV. FOOD NUTR. RES., vol. 42, 1998, pages 63 - 92
GOTTESMAN, TRENDS GENET., vol. 21, 2005, pages 399 - 404
GRIFFITHS-JONES ET AL., NUCLEIC ACIDS RES., vol. 33, 2005, pages 121 - 124
HARTINGS ET AL., PLANT MOL. BIOL., vol. 14, 1990, pages 1031 - 1040
HOEKEMA ET AL., NATURE, vol. 303, 1983, pages 179
JONES-RHOADES ET AL., ANNU. REV. PLANT BIOL., vol. 57, 2006, pages 19 - 53
KASSCHAU ET AL., DEV. CELL, vol. 4, 2003, pages 205 - 217
KHVOROVA ET AL., CELL, vol. 115, 2003, pages 209 - 216
KIM, NATURE REV. MOL. CELL BIOL., vol. 6, 2005, pages 376 - 385
KURIHARA; WATANABE, PROC. NATL. ACAD. SCI. U S. A., vol. 101, 2004, pages 12753 - 12758
LEE ET AL., EMBO JOURNAL, vol. 21, 2002, pages 4663 - 4670
LLAVE ET AL., SCIENCE, vol. 297, 2002, pages 2053 - 2056
LUND ET AL., SCIENCE, vol. 303, 2004, pages 95 - 98
MALLORY ET AL., EMBO J, vol. 23, 2004, pages 3356 - 3364
MARCHETTI, NUCLEIC ACID RES., vol. 28, 2000, pages 3339 - 3346
MARGULIES ET AL., NATURE, vol. 437, 2005, pages 376 - 380
MARKS; FELDMANN, PLANT CELL, vol. 1, 1989, pages 1043 - 1050
MASOUD ET AL., TRANSGEN. RES., vol. 5, 1996, pages 313
MILLAR; WATERHOUSE, FUNCT. INTEGR GENOMICS, vol. 5, 2005, pages 129 - 135
RADKE ET AL., PLANT CELL REP., vol. 11, 1992, pages 499 - 505
RASHTCHIAN ET AL., BIOCHEM., vol. 206, 1992, pages 91 - 97
REDENBAUGH ET AL.: "Safety Assessment of Genetically Engineered Fruits and Vegetables", 1992, CRC PRESS
REINHART ET AL., GENES & DEV., vol. 16, 2002, pages 161611626
REYNOLDS ET AL., NATURE BIOTECHNOL., vol. 22, 2004, pages 326 - 330
SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
SCHWAB ET AL., PLANT CELL, vol. 18, 2006, pages 1121 - 1133
SCIENCE, vol. 303, 2004, pages 832 - 835
STEEVES ET AL., FUNCT. PLANT BIOL., vol. 33, 2006, pages 991 - 999
SUN ET AL., PLANT CELL PHYSIOL., vol. 47, 2006, pages 426 - 431
TOMARI; ZAMORE, GENES & DEV., vol. 19, 2005, pages 517 - 529
TORIYAMA ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 10
VASIL ET AL., BIOLTECHNOLOGY, vol. 10, 1992, pages 667
VAUCHERET, SCI. STKE, 2005, pages E43
WAN; LEMAUX, PLANT PHYSIOL., vol. 104, 1994, pages 37
WESLEY, PLANT J, vol. 27, 2001, pages 581 - 590
YOSHIKAWA ET AL., GENES DEV., vol. 19, 2005, pages 2164 - 2175
ZHANG ET AL., NUCLEIC ACIDS RES., vol. 32, 2004, pages D271 - D272
ZHANG ET AL., PLANT CELL REP., vol. 7, 1988, pages 379

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010002984A1 (en) 2008-07-01 2010-01-07 Monsanto Technology, Llc Recombinant dna constructs and methods for modulating expression of a target gene
US9040774B2 (en) 2008-07-01 2015-05-26 Monsanto Technology Llc Recombinant DNA constructs encoding ribonuclease cleavage blockers and methods for modulating expression of a target gene
EP2924118A1 (en) 2008-07-01 2015-09-30 Monsanto Technology LLC Recombinant DNA constructs and methods for modulating expression of a target gene
WO2014160383A1 (en) * 2013-03-13 2014-10-02 E. I. Dupont De Nemours & Company Production of small interfering rnas in planta
WO2014201361A1 (en) * 2013-06-14 2014-12-18 Monsanto Technology Llc Differential maturing refuge and methods thereof

Also Published As

Publication number Publication date Type
US9309512B2 (en) 2016-04-12 grant
EP3287524A1 (en) 2018-02-28 application
WO2008027592A3 (en) 2008-09-04 application
ES2655700T3 (en) 2018-02-21 grant
US20080066206A1 (en) 2008-03-13 application
US8404928B2 (en) 2013-03-26 grant
CN101600798A (en) 2009-12-09 application
US20160168569A1 (en) 2016-06-16 application
WO2008027592A9 (en) 2008-04-24 application
US20130232644A1 (en) 2013-09-05 application
EP2059596B1 (en) 2017-10-04 grant
EP2059596A2 (en) 2009-05-20 application

Similar Documents

Publication Publication Date Title
Gallagher et al. Gene duplication in the carotenoid biosynthetic pathway preceded evolution of the grasses
Chourey et al. Genetic evidence that the two isozymes of sucrose synthase present in developing maize endosperm are critical, one for cell wall integrity and the other for starch biosynthesis
Singh et al. Gibberellins are required for seed development and pollen tube growth in Arabidopsis
Chincinska et al. Sucrose transporter StSUT4 from potato affects flowering, tuberization, and shade avoidance response
Aluru et al. Generation of transgenic maize with enhanced provitamin A content
US20060174380A1 (en) Method to trigger RNA interference
Lu et al. The cauliflower Or gene encodes a DnaJ cysteine-rich domain-containing protein that mediates high levels of β-carotene accumulation
WO2010077816A1 (en) Corn event 5307
WO2009009142A2 (en) Transgenic plants with enhanced agronomic traits
US20070078105A1 (en) Methods and means for obtaining modified phenotypes
Dijkstra et al. Over-expression of a gibberellin 2-oxidase gene from Phaseolus coccineus L. enhances gibberellin inactivation and induces dwarfism in Solanum species
Kooter et al. Trans-inactivation of gene expression in plants
WO2004063333A2 (en) Seed-oil suppression to enhance yield of commercially important macromolecules
US20070011775A1 (en) Double-stranded RNA stabilized in planta
US20060200878A1 (en) Recombinant DNA constructs and methods for controlling gene expression
Zhou et al. From model to crop: functional analysis of a STAY-GREEN gene in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement
US20060041957A1 (en) Recombinant constructs for use in reducing gene expression
WO2006073727A2 (en) Recombinant dna constructs and methods for controlling gene expression
US20070199095A1 (en) Methods for producing hybrid seed
Kamthan et al. Small RNAs in plants: recent development and application for crop improvement
WO2010002984A1 (en) Recombinant dna constructs and methods for modulating expression of a target gene
US20120005773A1 (en) Transgenic plants with enhanced agronomic traits
WO2012058266A1 (en) Overexpression of plant mirnas for parasite control
US20120297501A1 (en) Plants resistant to insect pests
US20050155114A1 (en) Stress-inducible plant promoters

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07837683

Country of ref document: EP

Kind code of ref document: A2

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007290367

Country of ref document: AU


Ref document number: 2007837683

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: RU

ENP Entry into the national phase in:

Ref document number: 2007290367

Country of ref document: AU

Date of ref document: 20070831

Kind code of ref document: A

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)