WO2005017127A2 - Rna interference compositions and methods - Google Patents
Rna interference compositions and methods Download PDFInfo
- Publication number
- WO2005017127A2 WO2005017127A2 PCT/US2004/005400 US2004005400W WO2005017127A2 WO 2005017127 A2 WO2005017127 A2 WO 2005017127A2 US 2004005400 W US2004005400 W US 2004005400W WO 2005017127 A2 WO2005017127 A2 WO 2005017127A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- sequence
- acid sequence
- sense
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/60—Salicylic acid; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/121—Hammerhead
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the invention relates to methods and materials involved in RNA interference.
- the invention relates to nucleic acids that form RNA molecules that induce RNA interference as well as methods for using the nucleic acids to reduce the level of RNA (e.g., mRNA) within a cell.
- RNA e.g., mRNA
- RNA interference also known as gene silencing, typically employs small RNA molecules, called small interfering RNAs (siRNAs), to down-regulate the expression of targeted sequences in cells.
- siRNAs are double stranded molecules, one strand of which can be complementary to an mRNA.
- RISC RNA- Induced Silencing Complex
- the invention provides isolated nucleic acids having at least one strand with both sense and antisense sequences that are complementary to each other.
- the invention also provides isolated nucleic acids having at least one strand that is a template for both sense and antisense sequences that are complementary to each other.
- the isolated nucleic acids can be single- or double-stranded.
- the isolated nucleic acids having at least one strand with both sense and antisense sequences that are complementary to each other also contain one or more cis-acting ribozyme sequences on the same strand containing the sense and antisense sequences.
- a single- stranded RNA molecule can contain a sense sequence followed by an antisense sequence followed by a cis-acting ribozyme sequence.
- the isolated nucleic acids having at least one strand that is a template for both sense and antisense sequences can be configured such that the strand that is a template for the sense and antisense sequences is also a template for one or more cis-acting ribozyme sequences.
- a double- stranded DNA molecule can have one strand that is a template for synthesis of a single- stranded RNA molecule having a sense sequence followed by an antisense sequence followed by a cis-acting ribozyme sequence.
- isolated nucleic acids can be designed to have at least one strand with (1) sense and antisense sequences that are complementary to each other and (2) one or more cis-acting ribozyme sequences.
- the cis-acting ribozyme sequences can be positioned anywhere along the strand.
- a cis-acting ribozyme sequence can be positioned 3' of the sense and antisense sequences.
- the cis-acting ribozyme sequence can be used to limit the number of nucleotides 3' of the sense and antisense sequences.
- cis-acting ribozyme sequences can be positioned 5' and 3' of the sense and antisense sequences as well as between the sense and antisense sequences to form the following 5' to 3' configuration: a first cis-acting ribozyme sequence followed by a sense sequence followed by a second cis-acting ribozyme sequence followed by an antisense sequence followed by a third cis-acting ribozyme sequence.
- the cis-acting ribozyme sequences can be used to liberate the sense and antisense sequences, which can then form double-stranded RNA molecules capable of acting as siRNAs.
- isolated nucleic acids can be designed to have at least one strand that is a template for (1) sense and antisense sequences that are complementary to each other and (2) one or more cis-acting ribozyme sequences.
- the isolated nucleic acids can be designed such that the template strand is transcribed to form a single RNA molecule containing the sense and antisense sequences and the one or more cis-acting ribozyme sequences.
- the cis-acting ribozyme sequences can be positioned anywhere along the RNA molecule.
- a cis-acting ribozyme sequence can be positioned 3' of the sense and antisense sequences.
- the cis-acting ribozyme sequence can be used to limit the number of nucleotides 3' of the sense and antisense sequences, hi another example, cis-acting ribozyme sequences can be positioned 5' and 3' of the sense and antisense sequences as well as between the sense and antisense sequences to form the following 5' to 3' configuration: a first cis-acting ribozyme sequence followed by a sense sequence followed by a second cis-acting ribozyme sequence followed by an antisense sequence followed by a third cis-acting ribozyme sequence.
- the cis-acting ribozyme sequences can be used to liberate the sense and antisense sequence, which can then form double-stranded RNA molecules capable of acting as siRNAs.
- the isolated nucleic acids provided herein can be used to form RNA molecules having the ability to induce RNA interference.
- isolated nucleic acids with one strand containing sense, antisense, and cis-acting ribozyme sequences can form (1) double-stranded RNA and/or (2) single-stranded RNA upon cleavage by one or more cis- acting ribozyme sequences.
- isolated nucleic acids having at least one strand that is a template for an RNA molecule containing sense, antisense, and cis-acting ribozyme sequences can form (1) double-stranded RNA and/or (2) single-stranded RNA upon cleavage of the RNA molecule by one or more cis-acting ribozyme sequences.
- the double-stranded RNA can result from the bonding interaction between the sense and antisense sequences.
- the double-stranded RNA is about 15-35 nucleotides in length and functions as siRNA molecules.
- the single-stranded RNA in each case can have zero, one, two, three, four, five, or more hairpin loop structures.
- the single-stranded RNA can have no more than one hairpin loop structure.
- These hairpin loop structures can result from the bonding interaction between the sense and antisense sequences of the single-stranded RNA.
- the stem portion of the hairpin loop structure is about 15-35 nucleotides in length and can induce RNA interference.
- the double- and single-stranded RNA can be enzymatically inactive (e.g., lack trans-acting ribozyme activity).
- a single- stranded RNA having no more than one hairpin loop structure can lack trans-acting ribozyme activity.
- the isolated nucleic acids provided herein can be designed such that the presence of RNA molecules having the ability to induce RNA interference is controlled in a temporal, inducible, or tissue-specific manner.
- a DNA molecule having one strand that is a template for (1) sense and antisense sequences that are complementary to each other and (2) one or more cis-acting ribozyme sequences can be constructed to have a tissue-specific promoter that promotes transcription of the template strand in a particular cell type.
- the isolated nucleic acid can be used to form RNA molecules containing the sense and antisense sequences and the one or more cis-acting ribozyme sequences in those particular cells.
- the cis-acting ribozyme sequences can cleave the RNA molecules, for example, to liberate the sense and antisense sequences from other nucleotide sequences of the originally transcribed RNA molecules.
- cis-acting ribozyme sequences can be positioned such that sequences flanking the sense sequence and sequences flanking the antisense sequence are removed.
- the RNA molecules containing the sense sequence can bind to the RNA molecules containing the complementary antisense sequence to form siRNA molecules.
- RNA molecules having the ability to induce RNA interference in a temporal, inducible, or tissue-specific manner using promoter sequences can provide scientists with powerful tools for down-regulating mRNAs at particular stages of development or in particular cell types. These tools have several advantages over transfecting cells with (1) double-stranded RNA and (2) DNA constructs lacking the ability to transcribe cis-acting ribozyme sequences.
- transfected double- stranded RNA molecules can be used as substrates for degradation by endonuclease
- RNA RNase III to yield siRNA molecules
- the RNA is labile and subject to degradation by a number of other nucleases.
- the delivery of double-stranded RNA molecules relies on the efficiency of transfection of the double-stranded RNA at a particular tissue or cell type.
- the use of DNA constructs containing tissue-specific promoters that are promoters for RNA polymerase II can lead to transcription termination problems, resulting in lengthy RNA transcripts not suitable for subsequent siRNA generation.
- RNA polymerase III e.g., U2, HI, or U6 promoters
- promoters for RNA polymerase III typically do not control transcription in a temporal, inducible, or tissue- specific manner. Transcription by RNA polymerase III is usually ubiquitous. In addition, RNA transcripts resulting from transcription by RNA polymerase III often remain nucleoplasmic.
- the invention also provides cells, viruses, and transgenic animals (e.g., transgenic non-human animals) containing one or more of the isolated nucleic acids provided herein as well as methods for using one or more of the isolated nucleic acids provided herein to reduce the level of an RNA (e.g., an mRNA) within a cell.
- an isolated nucleic acid provided herein can be used to form RNA molecules having the ability to induce RNA interference in that they can target an RNA sequence such as an mRNA from a virus, bacteria, fungus, parasite, plant, or animal (e.g., a mammal such as a human).
- Cells containing one or more of the isolated nucleic acids provided herein can be used to generate substantially pure preparations of the isolated nucleic acid.
- E. coli cells containing an isolated nucleic acid can be grown such that large amounts of the isolated nucleic acid are produced.
- cells containing the isolated nucleic acids provided herein can provide scientists with tools for studying gene function.
- mammalian cells can be designed to contain an isolated nucleic acid provided herein such that siRNA molecules targeting a mammalian mRNA are formed within those cells. The phenotype of these resulting cells can be studied to determine the particular function of the targeted mammalian mRNA.
- Viruses containing one or more of the isolated nucleic acids provided herein can be used to deliver isolated nucleic acids to cells.
- neuron-specific viruses e.g., herpes viruses
- the viruses can contain additional modifications.
- viruses can be designed to infect specific cells or groups of cells not normally infected by those viruses. See, e.g., Fields Virology, 3rd Edition (Fields, B., Knipe, D., and Howley, P, eds.), Lippincott Williams & Wilkins,
- viruses can be designed to lack virulence.
- replication-defective viruses can be designed to contain an isolated nucleic acid provided herein.
- Transgenic animals containing one or more of the isolated nucleic acids provided herein can be used to make knockout animals.
- an isolated nucleic acid provided herein can be introduced into the genome of an animal such that each cell of the animal produces siRNA molecules that target a particular mRNA, thereby reducing or eliminating the presence of that particular mRNA within cells. Using the isolated nucleic acids provided herein to make knockout animals can avoid the need for homologous recombination.
- knockout animals can be produced using standard transgenic technology without a homologous recombination step since disruption of the endogenous targeted gene sequences is not needed.
- the isolated nucleic acids can contain promoter sequences such that RNA molecules having the ability to induce RNA interference are formed in specific cell types.
- transgenic animals can be produced such that each cell of the animal contains the isolated nucleic acid but only specific cells transcribe the isolated nucleic acid.
- the specific cells can form RNA molecules having the ability to induce RNA interference, while cells other than those specific cells do not.
- one aspect of the invention features an isolated nucleic acid containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence.
- the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence.
- the antisense nucleic acid sequence can be complementary to a viral mRNA sequence.
- the antisense nucleic acid sequence can be complementary to a mammalian mRNA sequence.
- the sense nucleic acid sequence can be at least 15 nucleotides in length.
- the sense nucleic acid sequence can be from about 15 to about 300 nucleotides in length.
- the sense nucleic acid sequence can be from about 15 to about 50 nucleotides in length.
- the sense nucleic acid sequence can contain the sequence as set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, or 54.
- the cis-acting ribozyme sequence can be 3' of the sense nucleic acid sequence or the antisense nucleic acid sequence.
- the cis-acting ribozyme sequence can be 3' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the cis-acting ribozyme sequence is 5' of the sense nucleic acid sequence or the antisense nucleic acid sequence.
- the cis-acting ribozyme sequence can be 5' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the cis-acting ribozyme sequence can be between the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the nucleic acid can be double stranded or single stranded.
- the nucleic acid can be DNA or RNA.
- the nucleic acid can contain a restriction site.
- the nucleic acid can be a plasmid.
- the nucleic acid can contain a promoter sequence that promotes transcription of the RNA molecule.
- the promoter sequence can be a tissue-specific promoter, cell- specific promoter, or pathogen-specific promoter.
- the promoter sequence can promote transcription by RNA polymerase II.
- the promoter sequence can promote transcription by RNA polymerase III.
- the promoter sequence can be an HI promoter sequence or a U6 promoter sequence.
- the promoter sequence can be a mouse albumin enhancer promoter sequence, a transferrin promoter sequence, a probasin promoter sequence, or a whey acidic protein promoter sequence.
- the promoter sequence can be a keratin 7 promoter sequence, a keratin 13 promoter sequence, or a keratin enhancer promoter sequence.
- the RNA molecule can be transcribed from the nucleic acid when the nucleic acid is within a cell.
- the cell can be selected from the group consisting of kidney cells, skin cells (e.g., keratinocytes), liver cells, neurons, muscle cells, and lymphocytes.
- the strand can be a template for more than one cis-acting ribozyme sequence. Each of the more than one cis-acting ribozyme sequence can be different. One of the more than one cis-acting ribozyme sequence can be 5' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- Another of the more than one cis-acting ribozyme sequence can be 3' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the sense nucleic acid sequence and the antisense nucleic acid sequence can each be flanked by at least one of the more than one cis-acting ribozyme sequence.
- the strand can be a template for three cis-acting ribozyme sequences.
- the invention features an isolated nucleic acid containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucleic acid sequences form a single-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence, and where the single-stranded RNA contains no more than one hairpin loop structure and lacks RNA cleaving activity.
- the cis-acting ribozyme sequence can be 3' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the cis-acting ribozyme sequence can be 5' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the nucleic acid can be double stranded or single stranded.
- the nucleic acid can be DNA or RNA.
- the nucleic acid can contain a promoter sequence that promotes transcription of the RNA molecule.
- the nucleic acid can contain a restriction site.
- the nucleic acid can be a plasmid.
- the nucleic acid can contain a promoter sequence that promotes transcription of the RNA molecule.
- the promoter sequence can be a tissue-specific promoter, cell-specific promoter, or pathogen-specific promoter.
- the promoter sequence can promote transcription by RNA polymerase II.
- the promoter sequence can promote transcription by RNA polymerase III.
- the promoter sequence can be an HI promoter sequence or a U6 promoter sequence.
- the promoter sequence can be a mouse albumin enhancer promoter sequence, a transferrin promoter sequence, a probasin promoter sequence, or a whey acidic protein promoter sequence.
- the promoter sequence can be a keratin 7 promoter sequence, a keratin 13 promoter sequence, or a keratin enhancer promoter sequence.
- the RNA molecule can be transcribed from the nucleic acid when the nucleic acid is within a cell.
- the cell can be selected from the group consisting of kidney cells, skin cells (e.g., keratinocytes), liver cells, neurons, muscle cells, and lymphocytes.
- the strand can be a template for more than one cis-acting ribozyme sequence. Each of the more than one cis-acting ribozyme sequence can be different.
- One of the more than one cis-acting ribozyme sequence can be 5' of the sense nucleic acid sequence and the antisense nucleic acid sequence, and another of the more than one cis- acting ribozyme sequence can be 3' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- Another embodiment of the invention features an isolated nucleic acid containing an RNA strand that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA strand by the cis-acting ribozyme sequence.
- the nucleic acid can be single stranded.
- the RNA strand can contain more than one cis-acting ribozyme sequence. Each of the more than one cis-acting ribozyme sequence can be different.
- the sense nucleic acid sequence and the antisense nucleic acid sequence can each be flanked by at least one of the more than one cis-acting ribozyme sequence.
- Another embodiment of the invention features an isolated nucleic acid containing an RNA strand that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucleic acid sequences form a single-stranded RNA upon cleavage of the RNA strand by the cis-acting ribozyme sequence, and where the single-stranded RNA contains no more than one hairpin loop structure and lacks RNA cleaving activity.
- the nucleic acid can be single stranded.
- the RNA strand can contain more than one cis-acting ribozyme sequence. Each of the more than one cis-acting ribozyme sequence can be different. One of the more than one cis-acting ribozyme sequence can be 5' of the sense nucleic acid sequence and the antisense nucleic acid sequence, and another of the more than one cis- acting ribozyme sequence can be 3' of the sense nucleic acid sequence and the antisense nucleic acid sequence.
- compositions containing a pharmaceutically acceptable carrier and an isolated nucleic acid selected from the group consisting of: (a) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence, (b) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucle
- the invention features an isolated cell containing an isolated nucleic acid selected from the group consisting of: (a) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence, (b) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucleic acid sequences form
- Another aspect of the invention features a virus containing an isolated nucleic acid selected from the group consisting of: (a) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence, (b) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucleic acid sequences form
- the virus can be a retrovirus, adenovirus, herpes virus, adeno-associated viruse, lentivirus, baculovirus, cauliflower mosaic virus, tobacco mosaic virus, togavirus, poliovirus, cytomegalovirus, Paramyxovirus, Epstein-
- Another aspect of the invention features a nonhuman transgenic animal, where the genome of the nonhuman transgenic animal contains a nucleic acid sequence, present on one strand, that is a template for an RNA molecule that contains: (a) a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis-acting ribozyme sequence, or (b) a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, where the sense and antisense nucleic acid sequences form
- the nonhuman transgenic animal can be a mouse.
- Another aspect of the invention features a method of identifying sequences capable of inducing RNA interference against a target mRNA, the method including: (a) introducing a vector preparation into cells, where each vector of the vector preparation contains: (1) a target nucleic acid sequence, where the target nucleic acid sequence is a template for the target mRNA; (2) a reporter nucleic acid sequence, where the reporter nucleic acid sequence encodes a polypeptide, and where the target nucleic acid sequence and the reporter nucleic acid sequence are transcribed as a single fusion mRNA; and (3) a promoter sequence region, where the promoter sequence region contains: (i) a member of a plurality of test nucleic acid sequences, and (ii) two promoter sequences operably linked to the member in an arrangement that promotes transcription of both strands of the member; (b) identifying at least one cell lacking the polypeptide; and (c) obtaining the sequence of the member from the cell identified
- the polypeptide can be a fluorescent polypeptide or can be lethal to the cell.
- Another aspect of the invention features a method for reducing the level of an mRNA in a cell, the method including introducing an isolated nucleic acid into the cell, where the isolated nucleic acid is selected from the group consisting of: (a) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence, and a cis-acting ribozyme sequence, where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, and where the sense and antisense nucleic acid sequences form double-stranded RNA upon cleavage of the RNA molecule by the cis- acting ribozyme sequence, (b) isolated nucleic acids containing a strand that is a template for an RNA molecule that contains a sense nucleic acid sequence, an antisense nucleic acid sequence,
- Another aspect of the invention features a mixture containing at least two isolated nucleic acids, where one of the at least two isolated nucleic acids contains a strand that is a template for an RNA molecule containing a sense nucleic acid sequence and a first cis- acting ribozyme sequence, where another of the at least two isolated nucleic acids contains a strand that is a template for an RNA molecule containing an antisense nucleic acid sequence and a second cis-acting ribozyme sequence, and where the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence.
- Another aspect of the invention features an isolated nucleic acid containing: (a) a target nucleic acid sequence, wherein the target nucleic acid sequence is a template for target mRNA, and (b) a promoter sequence region, wherein the promoter sequence region contains (i) a nucleic acid sequence and (ii) two promoter sequences operably linked to the nucleic acid sequence in an arrangement that promotes transcription of both strands of the nucleic acid sequence, wherein the nucleic acid sequence contains a sequence present in the target nucleic acid sequence, and wherein transcription, within a cell, of the target nucleic acid sequence and both strands of the nucleic acid sequence is capable of inducing RNA interference against the target mRNA.
- the target nucleic acid sequence can be a viral sequence.
- the target nucleic acid sequence can be an HPN sequence or an HBN sequence.
- One of the two promoter sequences can be a U6 promoter sequence or an HI promoter sequence.
- the two promoter sequences can be the same or different.
- the two promoter sequences can be separated by no more than 200 base pairs, no more than 100 base pairs, or no more than 50 base pairs.
- the promoter sequence region can contain more than two promoter sequences (e.g., three, four, five, six, seven, or more promoter sequences).
- the sequence present in the target nucleic acid sequence can be between 15 and 50 nucleotides in length.
- the sequence present in the target nucleic acid sequence can be between 18 and 25 nucleotides in length.
- the isolated nucleic acid can contain a reporter nucleic acid sequence, wherein the reporter nucleic acid sequence encodes a polypeptide, and wherein the target nucleic acid sequence and the reporter nucleic acid sequence are transcribed as a single fusion mRNA.
- the polypeptide can be a fluorescent polypeptide.
- the polypeptide can be a green fluorescent polypeptide (e.g., GFP).
- nucleic acid library containing isolated nucleic acids, wherein each isolated nucleic acid contains: (a) a target nucleic acid sequence, wherein the target nucleic acid sequence is a template for target mR A, and (b) a promoter sequence region, wherein the promoter sequence region contains (i) a nucleic acid sequence and (ii) two promoter sequences operably linked to the nucleic acid sequence in an arrangement that promotes transcription of both strands of the nucleic acid sequence, wherein the nucleic acid sequence is different for each isolated nucleic acid, wherein the nucleic acid sequence of at least one of the isolated nucleic acids contains a sequence present in the target nucleic acid sequence, and wherein transcription, within a cell, of the target nucleic acid sequence and both strands of the nucleic acid sequence of at least one of the isolated nucleic acids is capable of inducing RNA interference against the target mRNA.
- the target nucleic acid sequence can be a viral sequence.
- the target nucleic acid sequence can be an HPN sequence or an HBN sequence.
- One of the two promoter sequences can be a U6 promoter sequence or an HI promoter sequence.
- the two promoter sequences can be the same or different.
- the two promoter sequences can be separated by no more than 200 base pairs, no more than 100 base pairs, or no more than 50 base pairs.
- the promoter sequence region can contain more than two promoter sequences.
- the sequence present in the target nucleic acid sequence can be between 15 and 50 nucleotides in length.
- the sequence present in the target nucleic acid sequence can be between 18 and 25 nucleotides in length.
- the isolated nucleic acid can contain a reporter nucleic acid sequence, wherein the reporter nucleic acid sequence encodes a polypeptide, and wherein the target nucleic acid sequence and the reporter nucleic acid sequence are transcribed as a single fusion mR ⁇ A.
- the polypeptide can be a fluorescent polypeptide.
- the polypeptide can be a green fluorescent polypeptide (e.g., GFP).
- Another aspect of the invention features an isolated nucleic acid containing: (a) a target nucleic acid sequence, wherein the target nucleic acid sequence is a template for target mR ⁇ A, and (b) a promoter sequence region, wherein the promoter sequence region contains a promoter sequence operably linked to a nucleic acid sequence, wherein one strand of the nucleic acid sequence is a template for a sense nucleic acid sequence and an antisense nucleic acid sequence, wherein the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, wherein the sense nucleic acid sequence contains a sequence present in the target mR ⁇ A, and wherein transcription, within a cell, of the target nucleic acid sequence and at least one strand of the nucleic acid sequence is capable of inducing R ⁇ A interference against the target mR ⁇ A.
- the target nucleic acid sequence can be a viral sequence.
- the target nucleic acid sequence can be an HPN sequence or an HBN sequence.
- the promoter sequence can be a U6 promoter sequence or an HI promoter sequence.
- the promoter sequence region can contain two promoter sequences operably linked to the nucleic acid sequence in an arrangement that promotes transcription of both strands of the nucleic acid sequence.
- the two promoter sequences can be the same or different.
- the two promoter sequences can be separated by no more than 200 base pairs, no more than 100 base pairs, or no more than 50 base pairs.
- the promoter sequence region can contain more than two promoter sequences.
- the sequence present in the target nucleic acid sequence can be between 15 and 50 nucleotides in length.
- the sequence present in the target nucleic acid sequence can be between 18 and 25 nucleotides in length.
- the transcription product from at least one strand of the nucleic acid sequence can be capable of forming a hairpin loop structure. At least a portion of the stem portion of the hairpin loop structure can be formed by the sense nucleic acid sequence and the antisense nucleic acid sequence.
- the isolated nucleic acid can contain a reporter nucleic acid sequence, wherein the reporter nucleic acid sequence encodes a polypeptide, and wherein the target nucleic acid sequence and the reporter nucleic acid sequence are transcribed as a single fusion mRNA.
- the polypeptide can be a fluorescent polypeptide.
- the polypeptide can be a green fluorescent polypeptide.
- nucleic acid library containing isolated nucleic acids, wherein each isolated nucleic acid contains a promoter sequence operably linked to a nucleic acid sequence, wherein one strand of the nucleic acid sequence is a template for a sense nucleic acid sequence and an antisense nucleic acid sequence, wherein the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, wherein the sense nucleic acid sequence is different for each isolated nucleic acid, and wherein transcription, within a cell, of a target nucleic acid sequence and at least one sfrand of the nucleic acid sequence of at least one of the isolated nucleic acids is capable of inducing RNA interference against a target mRNA, the target nucleic acid sequence being a template for the target mRNA.
- Each isolated nucleic acid can contain the target nucleic acid sequence.
- the sense nucleic acid sequence of at least one of the isolated nucleic acids can contain a sequence present in the target mRNA.
- the target nucleic acid sequence can be a viral sequence.
- the target nucleic acid sequence can be an HPN sequence or an HBN sequence.
- the promoter sequence can be a U6 promoter sequence or an HI promoter sequence.
- the isolated nucleic acids can contain two promoter sequences operably linked to the nucleic acid sequence in an arrangement that promotes transcription of both strands of the nucleic acid sequence.
- the two promoter sequences can be the same or different.
- the two promoter sequences can be separated by no more than 200 base pairs, no more than 100 base pairs, or no more than 50 base pairs.
- the isolated nucleic acids can contain more than two promoter sequences.
- the sequence present in the target nucleic acid sequence can be between 15 and 50 nucleotides in length.
- the isolated nucleic acids can contain a reporter nucleic acid sequence, wherein the reporter nucleic acid sequence encodes a polypeptide, and wherein the target nucleic acid sequence and the reporter nucleic acid sequence are transcribed as a single fusion mRNA.
- the polypeptide can be a fluorescent polypeptide.
- the polypeptide can be a green fluorescent polypeptide (e.g., GFP).
- Another aspect of the invention features a method for making a library containing isolated nucleic acids, wherein each isolated nucleic acid contains a nucleic acid sequence, wherein one strand of the nucleic acid sequence is a template for a sense nucleic acid sequence and an antisense nucleic acid sequence, wherein the sense nucleic acid sequence is complementary to the antisense nucleic acid sequence, wherein the sense nucleic acid sequence is different for each isolated nucleic acid, wherein transcription, within a cell, of a target nucleic acid sequence and at least one strand of the nucleic acid sequence of at least one of the isolated nucleic acids is capable of inducing RNA interference against a target mRNA, and wherein the target nucleic acid sequence is a template for the target mRNA, the method including: (a) obtaining a nucleic acid collection containing nucleic acid molecules, wherein one strand of each nucleic acid molecule contains the sense nucleic acid sequence or the antisense nucleic acid sequence, wherein
- the method can include removing a portion of the sequence located between the sense nucleic acid sequence and the antisense nucleic acid sequence of each extended nucleic acid molecule. After the removing step, the sense nucleic acid sequence and the antisense nucleic acid sequence of each extended nucleic acid molecule can be separated by 4 to 20 nucleotides.
- the method can include inserting each extended nucleic acid molecule into an expression vector.
- FIG. 1 is a schematic diagram of a single-stranded RNA molecule that can be transcribed from plCL-P s /HPN16c+ 5 o- 6 8+Guu-
- the sense sequence is 5'- CCAGAAAGUUACCACAGUU-3' (SEQ ID NO: 1, a HPN16 50 - 68 sequence) and is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- This sense sequence is from the HPN sequence set forth in GenBank Accession No. gi333031.
- the sense sequence can be designed to correspond to HPN sequences from other HPN strains such as the Hershey strain.
- the sense sequence can be 5'- CCGGAAAGUUA-CCACAGUU-3' (SEQ ID NO: 2, a HPN16 50 - 68(H) sequence).
- Such sense sequences can be from the HPN sequences set forth in GenBank Accession ⁇ os. gi3377787, 2196720, 1098775, and 1098731.
- Figure 2 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from pi CLIP A S /HP V16 C + 68 -5 O + GU U-
- the antisense sequence is 5'-AACUGU- GGUAACUUUCUGG-3' (SEQ ID NO: 3, the HPV16 68 .
- antisense sequence is from the HPV sequence set forth in GenBank Accession No. gi333031.
- the antisense sequence can be designed to correspond to HPV sequences from other HPV strains such as the Hershey strain.
- the antisense sequence can be 5'- AACUGU-GGUAACUUUCCGG -3' (SEQ ID NO: 4, a HPV16 68 - 50(H) sequence).
- Such antisense sequences can be from the HPV sequences set forth in GenBank Accession Nos. gi3377787, 2196720, 1098775, and 1098731.
- Figure 3 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from plCLIPs/HPV16 57 - 77 +uu.
- the sense sequence is 5'-GUUACCA- CAGUUAUGCACAGA-3' (SEQ ID NO: 5, the HPV16 57 - 77 sequence) and is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 4 is a schematic diagram of a single-stranded RNA molecule that can be transcribed from plCLIPAs/HPV16 77 - 57 +uu.
- the sense sequence is 5'-UCUGU- GCAUAACUGUGGUAAC-3' (SEQ ID NO: 6, the HPV16 77 - 57 sequence) and is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 5 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from p2CLIPs/HPV16c+ 5 o-68+GUU-
- Figure 6 is a schematic diagram of a single-stranded RNA molecule that can be transcribed from p2CLff As/HPVl ⁇ c+ ⁇ s-so+GUU-
- Figure 7 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from plCHOPs/HPV16c+ 5 o- 68 +Guu-
- the sense sequence is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 8 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from pi CHOP A S /HP V16c+ 68 -so +G uu- The antisense sequence is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 9 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from p2CHOPs/HPV16c+ 5 o- 68 +Guu- The sense sequence is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 10 is a schematic diagram of a single-stranded RNA molecule that can be transcribed from p2CHOP A S /HP V16 C + 68 - 5O + G U U - The antisense sequence is positioned between two cis-acting ribozyme cleavage sites designated SI and S2.
- Figure 11 is a schematic diagram of an RNA transcribed from a pSIR cassette containing any two (or more) of the following cassettes with one containing a sense sequence and another containing an antisense sequence: (1) pi CLIP, (2) p2CLIP, (3) pi CHOP, and (4) p2CHOP.
- Figure 12 is a listing of the sense and antisense sequences that can be self liberated from an RNA molecule transcribed from apSIR cassette containing pi CLIP, pi CHOP, or a combination of pi CLIP and pi CHOP cassettes.
- Figure 13 is a listing of the sense and antisense sequences that can be self liberated from an RNA molecule transcribed from a pSIR cassette containing p2CLIP, ⁇ 2CHOP, or a combination of p2CLIP and p2CHOP cassettes.
- Figure 14 is a schematic diagram of an RNA molecule with three cis-acting ribozyme sequences. This RNA molecule can be transcribed from a P2CLIP HR cassette such as p2CLIP HR ⁇ PV16 47 - 68 . SI, S2, and S3 identify cis-acting ribozyme cleavage sites.
- FIG 15 is a schematic diagram of an RNA molecule with three cis-acting ribozyme sequences.
- This RNA molecule can be transcribed from a P2CHOP HR cassette such as P2CHOP HR HPV16 7 . 68 . SI, S2, and S3 identify cis-acting ribozyme cleavage sites.
- Figure 16 is a listing of three sets of sense and antisense RNA sequences that can be transcribed from inserts placed into p 1 CLIP, p2CLIP, p 1 CHOP, or p2CHOP cassettes to form PICLIPHR, p2CL ⁇ > H R. plCHOP H R, or p2CHOP H R cassettes.
- Figure 17 is a schematic diagram of an RNA molecule that is transcribed from a pSNDP cassette.
- the inverted-U symbols represent loop structures, while the bulged hairpin loop structures represent cis-acting ribozymes.
- SI, S2, S3, S4, S5, and S6 identify cis-acting ribozyme cleavage sites.
- a pSNDP cassette can contain any two or more of the following cassettes: (1) plCLIP H R, (2) P2CLIPHR . (3) plCHOP HR , and (4) p2CHOP HR .
- Figure 18 is a schematic diagram of a single-sfranded RNA molecule that can be transcribed from p2CLIPHp HPV16c+5o- 68 +Guu-
- the sequence of the loop portion of the hairpin loop is 5'-GUUCAAGACCC-3' (SEQ ID NO: 7) and is located between the HPV sense and antisense sequences that form the stem portion.
- Figure 19 is a listing of three sets of sense and antisense RNA sequences that can be transcribed from inserts placed into pi CLIP, p2CLIP, pi CHOP, or p2CHOP cassettes to form PICLIPHP, P2CLIPHP, plCHOP H p, or p2CHOP H p cassettes.
- Figure 20 is a schematic diagram of an in vivo selection process. While the figure shows a U6 promoter and an HI promoter, both promoters can be U6 promoters.
- the inserts can be from any source.
- the inserts can be the inserts obtained from the in vitro selection process depicted in Figure 21.
- the RNA-processing enzyme DICER and the RNA-Induced Silencing Complex (RISC) can be present endogenously within Flp-fri 293 cells.
- Figure 21 is a schematic diagram of an in vitro selection process.
- Figure 22 is a bar graph plotting the relative level of HPV 16 mRNA in cells containing the following nucleic acid.
- Figure 23 contains two bar graphs.
- the top bar graph plots the relative level of HPN 16 mR ⁇ A in cells containing the following nucleic acid, hi each case, target mR ⁇ A expression was under the control of a CMN promoter sequence.
- Column 1 cells containing p 1 CLIPs/HPN 16 C +5 O - 68 (H)+GUU;
- Column 2 cells containing plCLIPAs HPN16c+ 68 - 5 o(H)+Guu;
- Column 3 cells containing pSIR (pi CLIPs/HPN 16 c+50 - 68(H)+GUU and plCLIPAs HPV16c4- 6 8-50(H)+Guu);
- Column 4 cells containing ⁇ lCLIPHp/HPV16c+ 5 o-68(H)+Guu;
- Column 5 cells containing pSIR (P1CLIPHP/HPV16C+5O- 68(H)+GUU and P1CLIPHP
- Figure 24 is a schematic diagram of an in vitro selection process that can be used to obtain an enriched pool of sequences that interact with a target mRNA.
- Figure 25 is a schematic diagram of a cloning process that can be used to obtain a library of hairpin loop sequences.
- Each strand of the final double-stranded product can encode both a sense and antisense sequence (e.g., the E21 and e21 sequences).
- E21 and e21 sequences of a single-stranded RNA molecule can form the stem portion of a hairpin loop.
- the loop portion can be encoded by the 5'-TTCTAGAA-3' (SEQ ID)
- Figure 26 is a schematic diagram of an in vivo selection process. While the figure shows a U6 promoter and an HI promoter, both promoters can be U6 promoters.
- the inserts can be from any source.
- the inserts can be the inserts obtained from the in vitro selection process depicted in Figure 21 or can be the inserts obtained from the cloning process depicted in Figure 25. The depicted inserts are from Figure 25.
- RNA-processing enzyme DICER and the RNA-hiduced Silencing Complex (RISC) can be present endogenously within Flp-fri 293 cells.
- DICER and the RNA-hiduced Silencing Complex (RISC) can be present endogenously within Flp-fri 293 cells.
- RISC RNA-hiduced Silencing Complex
- the invention provides cells, viruses, and transgenic animals (e.g., transgenic non-human animals) containing one or more of the isolated nucleic acids provided herein as well as methods for using one or more of the isolated nucleic acids provided herein to reduce the level of an RNA (e.g., an mRNA) within a cell.
- transgenic animals e.g., transgenic non-human animals
- nucleic acids The invention provides isolated nucleic acids.
- nucleic acid encompasses both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA.
- the nucleic acid can be double-stranded or single- stranded.
- nucleic acid can be circular or linear.
- the nucleic acid can be a plasmid.
- the nucleic acid can contain one or more restriction sites.
- isolated refers to a naturally-occurring nucleic acid that is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived.
- an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanlcing that recombinant DNA molecule in a naturally-occurring genome is removed or absent.
- an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
- an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.
- isolated as used herein with reference to nucleic acid also includes any non-naturally-occurring nucleic acid since non-naturally-occurring nucleic acid sequences are not found in nature and do not have immediately contiguous sequences in a naturally- occurring genome.
- non-naturally-occurring nucleic acid such as an engineered nucleic acid is considered to be isolated nucleic acid.
- Engineered nucleic acid can be made using common molecular cloning or chemical nucleic acid synthesis techniques.
- Isolated non-naturally-occurring nucleic acid can be independent of other sequences, or incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or the genomic DNA of a prokaryote or eukaryote.
- a virus e.g., a retrovirus, lentivirus, adenovirus, or herpes virus
- the genomic DNA of a prokaryote or eukaryote e.g., a retrovirus, lentivirus, adenovirus, or herpes virus
- a nucleic acid existing among hundreds to millions of other nucleic acid molecules within, for example, cDNA or genomic libraries, or gel slices containing a genomic DNA restriction digest is not to be considered an isolated nucleic acid.
- the invention provides isolated nucleic acids having at least one strand with both sense and antisense sequences that are complementary to each other.
- the invention provides isolated nucleic acids having at least one strand that is a template for both sense and antisense sequences that are complementary to each other.
- complementary as used herein with reference to two nucleic acid sequences (e.g., sense and antisense sequences) means the two nucleic acid sequences are
- the sense and antisense sequences can be part of a larger nucleic acid molecule or be part of separate nucleic acid molecules having sequences that are not complementary.
- the sense and antisense sequences can be any length greater than 12 nucleotides (e.g., 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides).
- an antisense sequence can be 21 or 22 nucleotides in length.
- the sense and antisense sequences range in length from about 15 nucleotides to about 30 nucleotides (e.g., from about 18 nucleotides to about 28 nucleotides, or from about 21 nucleotides to about 25 nucleotides).
- sense and antisense refer to the two members of a pair of complementary sequences. If one member of the pair is designated a sense sequence, then the other member of the pair is designated an antisense sequence.
- the sense and antisense sequences of an isolated nucleic acid can have any sequence.
- an antisense sequence can be (1) a sequence complementary to an mRNA sequence or (2) a sequence that is not complementary to an mRNA sequence. In each case, the sense sequence is the sequence complementary to the antisense sequence.
- an antisense sequence is a sequence complementary to an mRNA sequence of a virus (e.g., papilloma virus, hepatitis B virus, herpes virus, retrovirus, adenovirus, or HIV), parasite (Schistosoma mansoni, Fasciola, or Paragonimus), bacterium (e.g., E.
- a virus e.g., papilloma virus, hepatitis B virus, herpes virus, retrovirus, adenovirus, or HIV
- parasite Schota mansoni, Fasciola, or Paragonimus
- bacterium e.g., E.
- coli coli, Staphlococcus, Pseudomonas, Streptococcus, Nisseria, or Haemophilus
- pathogenic protozoa e.g., Entamoeba, Plasmodium, Tryphnosoma, or Toxoplasm
- fungus e.g., Aspergillus, Candida, Cryptococcus, or Coccidioides
- plant e.g., corn, wheat, or rice
- animal e.g., a mammal such as a mouse, rat, pig, cow, monkey, or human.
- the sense sequence complementary to the antisense sequence is a sequence present within the mRNA of a virus, parasite, bacterium, fungus, plant, or animal, respectively.
- sense and antisense sequences are designed to correspond to a 15-30 nucleotide sequence of a target mRNA such that the level of that target mRNA is reduced via RNA interference. Examples of sense and antisense sequences include, without limitation, those sequences set forth in Table 1.
- HPV16 47 Human papillomavirus 5 '-GACCCGGAAAGUUACCACAGUU-3 '
- HBV 8 60-881 Human hepatitis B virus 5'-AAUUUGGAGCUACUGUGGAGUU-3' strain ayw variant SEQ ID NO: 51 precore/core
- HBV 88 Human hepatitis B virus 5 '-UAACUCCACAGUAGCUCCAAA-3 ' strain ayw variant SEQ ID NO: 54 precore/core
- sense and antisense sequences can be designed to target mRNA that encodes polypeptides necessary for the growth and/or survival of parasites, bacteria, viruses, fungi, and tumors.
- sense and antisense sequences can be designed to target mRNA that encodes polypeptides essential for cell viability or fitness, DNA biosynthesis, cell division, franscription, reverse transcription, metabolism, catabolism, angiogenesis, and cellular respiration (e.g., Her-2/neu, Akt-3, and UGT2B7 polypeptides).
- Sense and antisense sequences also can be designed to target structural RNA molecules such as DD3.
- the isolated nucleic acids provided herein can have (1) at least one strand with more than one sense sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more sense sequences) or (2) at least one strand that is a template for more than one sense sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more sense sequences).
- the isolated nucleic acids provided herein can have (1) at least one strand with more than one antisense sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more antisense sequences) or (2) at least one strand that is a template for more than one antisense sequence (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more antisense sequences).
- an isolated nucleic acid can have at least one strand that is a template for two sense sequences and two antisense sequences.
- the multiple sense sequences can be identical or different, and the multiple antisense sequences can be identical or different.
- an isolated nucleic acid can have one strand that is a template for (1) two identical sense sequences and (2) two identical antisense sequences that are complementary to the two identical sense sequences.
- an isolated nucleic acid can have one strand that is a template for (1) two identical sense sequences 20 nucleotides in length, (2) one antisense sequence that is complementary to the two identical sense sequences 20 nucleotides in length, (3) a sense sequence 30 nucleotides in length, and (4) three identical antisense sequences that are complementary to the sense sequence 30 nucleotides in length.
- the isolated nucleic acids provided herein can be designed to have any arrangement of sense and antisense sequences. For example, two identical sense sequence (1) can be followed by two identical antisense sequences or (2) can be positioned between two identical antisense sequences.
- the isolated nucleic acids having at least one strand with both sense and antisense sequences that are complementary to each other can also have one or more cis-acting ribozyme sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more cis-acting ribozyme sequences) on the same strand having the sense and antisense sequences.
- a single- stranded RNA molecule can contain a first cis-acting ribozyme sequence followed by a sense sequence followed by a second cis-acting ribozyme sequence followed by an antisense sequence followed by a third cis-acting ribozyme sequence.
- the isolated nucleic acids having at least one strand that is a template for both sense and antisense sequences that are complementary to each other can be designed such that the strand that is a template for the sense and antisense sequences is also a template for one or more cis-acting ribozyme sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more cis-acting ribozyme sequences).
- an isolated DNA molecule can contain one strand that is a template for a first cis-acting ribozyme sequence followed by a sense sequence followed by a second cis-acting ribozyme sequence followed by an antisense sequence followed by a third cis-acting ribozyme sequence.
- a ribozyme is a catalytic RNA molecule that cleaves RNA in a sequence specific manner. Ribozymes that cleave themselves are called cis-acting ribozymes, while ribozymes that cleave other RNA molecules are called trans-acting ribozymes.
- cis-acting ribozyme sequence refers to the sequence of an RNA molecule that has the ability to cleave the RNA molecule containing the cis-acting ribozyme sequence.
- a cis-acting ribozyme sequence can have any sequence provided it has the ability to cleave the RNA molecule containing the cis-acting ribozyme sequence.
- a cis-acting ribozyme sequence can have a sequence from a hammerhead, axhead, or hairpin ribozyme.
- a cis-acting ribozyme sequence can have a sequence from a hammerhead, axhead, or hairpin ribozyme that is modified to have either slow cleavage activity or enhanced cleavage activity.
- nucleotide substitutions can be made to modify cleavage activity as described elsewhere (see, e.g., Doudna and Cech, Nature, 418:222-228 (2002)).
- Examples of ribozyme sequences that can be used herein include, without limitation, those described herein as well as those described in U.S. Patent No. 6,271,359, U.S. Patent No. 5,824,519, and Doudna and Cech, Nature, 418:222-228 (2002).
- the multiple cis-acting ribozyme sequences can be identical or different.
- an isolated nucleic acid can have one strand that is a template for three cis-acting ribozyme sequences; where two are identical, and the third is different.
- the isolated nucleic acids provided herein can be designed to have any arrangement of sense, antisense, and cis-acting ribozyme sequences.
- each sense and each antisense sequence can be flanked by at least one cis- acting ribozyme sequence.
- a first cis-acting ribozyme followed by a sense sequence followed by a second cis- acting ribozyme followed by a third cis-acting ribozyme followed by an antisense sequence followed by a fourth cis-acting ribozyme (2) a first cis-acting ribozyme followed by a sense sequence followed by an antisense sequence followed by a second cis-acting ribozyme, (3) a sense sequence followed by a first cis-acting ribozyme followed by a second cis-acting ribozyme followed by an antisense sequence followed by a third cis-acting ribozyme, (4) a sense sequence followed by a first cis-acting ribozyme followed by an antisense sequence followed by a second cis-acting ribozyme, (5) a first cis-acting ribozyme followed
- the isolated nucleic acids provided herein can be designed such that a particular product is formed.
- a single-sfranded RNA containing a first cis-acting ribozyme followed by a sense sequence followed by a second cis-acting ribozyme followed by an antisense sequence followed by a third cis-acting ribozyme can result in multiple single strands of RNA.
- One strand can contain the sense sequence
- another strand can contain the antisense sequence.
- These two liberated strands can come together via their complementary sequence to form a double-stranded RNA molecule having the ability to induce RNA interference.
- a double-sfranded RNA molecule contains two strands of RNA with each strand having its own 5' and 3' end.
- the sense and antisense sequences are liberated from a larger sequence as one piece of single-stranded RNA.
- the isolated nucleic acid can be designed such that the sense and antisense sequences of the resulting single-stranded RNA come together via their complementary sequence to form a hairpin loop structure having the ability to induce RNA interference. Any number of hairpin loop structures can be formed.
- an isolated nucleic acid can be designed such that a resulting single-stranded RNA forms zero, one, two, three, four, five, six, seven, eight, nine, ten, or more hai ⁇ in loop structures.
- the resulting single-stranded RNA forms no more than one hairpin loop structure.
- the sense and antisense sequences that come together to form the stem portion of a hairpin loop structure are typically separated by 3 to 25 nucleotides (e.g., 3 to 20, 3 to 15, 3 to 10, 3 to 9, 5 to 15, or 5 to 10 nucleotides) that form the loop portion of a hai ⁇ in loop structure.
- an isolated nucleic acid can be designed such that the sense and antisense sequences are separated by 5'- UUCAAGACC-3' (SEQ ID NO: 8).
- SEQ ID NO: 8 5'- UUCAAGACC-3'
- These resulting single- or double-stranded RNA molecules that are formed upon cleavage by one or more cis-acting ribozyme sequences can be enzymatically inactive (e.g., lack ribozyme activity such as trans-acting ribozyme activity).
- a single-sfranded RNA having no more than one hai ⁇ in loop structure can lack trans-acting ribozyme activity.
- Cis-acting ribozyme activity is measured using the following method.
- in vitro franscription is performed using P-labeled nucleotides, and the products are analyzed by polyacrylamide gel electrophoresis. The presence of cis-acting ribozyme activity is confirmed by observing the presence of defined cleavage products in a Mg- dependent manner. Trans-acting ribozyme activity is measured using the following method. Briefly, in vitro transcription is performed to generate RNA to be tested for trans-acting ribozyme activity. The generated RNA is then incubated with 32 P-labeled target RNA.
- the presence of trans-acting ribozyme activity is confirmed by observing the presence of cleaved target RNA in a Mg-dependent manner when analyzed by polyacrylamide gel electrophoresis.
- the invention also provides mixtures having at least two isolated nucleic acids.
- one of the isolated nucleic acids of the mixture can have one strand that contains (or is a template for) one or more sense sequences and one or more cis-acting ribozyme sequences, while a second isolated nucleic acid of the mixture has one strand that contains (or is a template for) one or more antisense sequences and one or more cis- acting ribozyme sequences.
- a mixture can contain a first isolated nucleic acid having one strand that is a template for a sense sequence followed by an antisense sequence followed by a cis-acting ribozyme sequence in combination with a second isolated nucleic acid having one strand that is a template for a first cis-acting ribozyme followed by a sense sequence followed by a second cis-acting ribozyme sequence followed by an antisense sequence followed by a third cis-acting ribozyme sequence.
- the isolated nucleic acids provided herein can contain a promoter sequence to promote franscription of an RNA molecule containing sense, antisense, and cis-acting ribozyme sequences.
- Any promoter sequence can be used.
- a constitutive promoter e.g., an SV40 promoter
- an inducible promoter e.g., a tet-regulated promoter
- the promoter sequence can be a promoter for RNA polymerase II (e.g., a CMN promoter sequence, an albumin promoter sequence, or a fransferrin promoter sequence) or a promoter sequence for R ⁇ A polymerase III (e.g., a U6 promoter sequence, a U2 promoter sequence, or a val-tR ⁇ A promoter sequence).
- a tissue-specific promoter, cell-specific promoter, or pathogen- specific promoter sequence can be used.
- promoter sequences include, without limitation, a mouse albumin enhancer promoter, a fransferrin promoter, a probasin promoter, a keratin 7 promoter, a keratin 13 promoter, a keratin enhancer promoter, and a whey acidic protein promoter.
- Other promoter sequences include those described in U.S. Pat. ⁇ os. 5,824, 519 and 6,271,359. Tissue-specific, cell-specific, and pathogen-specific promoter sequences can be used to control the location of synthesis of R ⁇ A molecules having the ability to induce R ⁇ A interference.
- an isolated nucleic acid having a liver-specific promoter can be used to drive transcription of an R ⁇ A molecule containing sense, antisense, and cis-acting ribozyme sequences such that siR ⁇ A molecules are formed in liver cells.
- the antisense sequence can be a sequence complementary to an mR ⁇ A from liver or an mR ⁇ A from a hepatitis B virus (e.g., an mR ⁇ A encoding an envelope or polymerase/reverse transcriptase polypeptide) such that siR ⁇ A molecules targeting the liver or hepatitis B virus mR ⁇ A are formed.
- sense or antisense sequences can be, without limitation, HBN 859 . 88 ⁇ , HBN 88 ⁇ _ 859 , HBV 860 - 88 ⁇ , HBV 88 ⁇ - 86 o, HBV 86 ⁇ - 882 , or HBV 882 - 86 ⁇ .
- an isolated nucleic acid can be designed to generate, in skin cells (e.g., keratinocytes), RNA molecules that have the ability to induce RNA interference against a target mRNA from a human papilloma virus.
- an isolated nucleic acid having a skin-specific promoter can be used to drive transcription of an RNA molecule containing sense, antisense, and cis-acting ribozyme sequences such that RNA molecules having the ability to induce RNA interference are formed in skin cells.
- the antisense sequence can be a sequence complementary to an mRNA from a human papilloma virus (e.g., an mRNA encoding an E6 or E7 polypeptide such as the translational start site for an E6 or E7 polypeptide) such that RNA molecules having the ability to induce RNA interference against human papilloma virus mRNA are formed.
- sense and antisense sequences can be, without limitation, as set forth in SEQ ID NOs: 1-6.
- the components of the isolated nucleic acids provided herein can be obtained using any method including, without limitation, coimnon molecular cloning and chemical nucleic acid synthesis techniques.
- PCR can be used to obtain a promoter sequence, a sense nucleic acid sequence, or a cis-acting ribozyme sequence.
- PCR refers to procedures in which target nucleic acid is amplified in a manner similar to that described in U.S. Patent No. 4,683,195, and subsequent modifications of the procedure described therein.
- sequence information from the ends of the region of interest or beyond are used to design oligonucleotide primers that are identical or similar in sequence to opposite strands of a potential template to be amplified.
- a nucleic acid sequence can be amplified from RNA or DNA.
- a nucleic acid sequence can be isolated by PCR amplification from total cellular RNA, total genomic DNA, and cDNA as well as from bacteriophage sequences, plasmid sequences, viral sequences, and the like.
- reverse transcriptase can be used to synthesize complementary DNA strands.
- mutagenesis e.g., site-directed mutagenesis
- site-directed mutagenesis can be used to design particular sense and antisense sequences within a nucleic acid construct containing a template strand for one or more cis-acting ribozyme sequences.
- Possible mutations include, without limitation, deletions, insertions, and substitutions, as well as combinations of deletions, insertions, and substitutions.
- Nucleic acid and amino acid databases e.g., GenBank ®
- GenBank ® also can be used to obtain sequence information such that particular sense and antisense sequences as well as promoter sequences and cis-acting ribozyme sequences can be obtained.
- GenBank ® can be used to design sense and antisense sequences such that siRNA molecules are formed that target a human mRNA sequence.
- the isolate nucleic acids provided herein can be linear or circular.
- an isolated nucleic acid can be in the form of a vector such as a plasmid, phage, or cosmid.
- the isolated nucleic acids can contain an ori of replication, a sequence encoding a polypeptide that confers antibiotic resistance, and restriction enzyme sites.
- an isolated nucleic acid provided herein is in the fonn of a vector derived from bacteriophage, baculoviruses, tobacco mosaic virus, he ⁇ es viruses, cytomegaloviruses, retroviruses, vaccinia viruses, adenoviruses, and/or adeno-associated viruses.
- a vector derived from bacteriophage baculoviruses, tobacco mosaic virus, he ⁇ es viruses, cytomegaloviruses, retroviruses, vaccinia viruses, adenoviruses, and/or adeno-associated viruses.
- Numerous vectors and expression systems are commercially available from, for example, Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitro gen/Life Technologies (Carlsbad, CA).
- Cells The invention also provides cells containing one or more of the isolated nucleic acids provided herein. Such cells can be prokaryotic or eukaryotic. Examples of cells that can contain one or more of the isolated nucleic acids provided herein include, without limitation, animal cells, mammalian cells, plant cells, insect cells, fungal cells, bacterial cells, and yeast cells.
- ⁇ cells include, without limitation, primary cells, skin cells (e.g., keratinocytes), liver cells, neurons, muscle cells, lymphocytes, bone mareow cells, kidney cells, adrenal cells, T-cells, B-cells, macrophages, monocytes, adipocytes, perictyes, fibroblasts, colon epithelial cells, reticular cells, pancreatic cells, cervical cells, endometrial cells, and prostate cells.
- Cells containing at least one of the isolated nucleic acids provided herein can be in vitro or in vivo.
- the isolated nucleic acid can be integrated into the genome of the cell or maintained in an episomal state.
- cells can be stably or transiently transfected with a construct containing one or more of the isolated nucleic acids provided herein.
- Any method can be used to introduce an isolated nucleic acid into a cell in vivo or in vitro.
- calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer are common methods that can be used to introduce an isolated nucleic acid into a cell.
- naked DNA can be delivered directly to cells in vivo as describe elsewhere (See, e.g., U.S. Patent Nos. 5,580,859 and 5,589,466).
- isolated nucleic acids can be introduced into cells by generating transgenic animals as described herein. Any method can be used to identify cells containing an isolated nucleic acid provided herein. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analysis.
- viruses The invention provides viruses containing one or more of the isolated nucleic acids provided herein.
- viruses that can contain one or more of the isolated nucleic acids provided herein include, without limitation, retroviruses, adenoviruses, he ⁇ es viruses, adeno-associated viruses, lentiviruses, baculoviruses, cauliflower mosaic viruses, tobacco mosaic viruses, togaviruses, polioviruses, cytomegaloviruses, Paramyxoviruses, Epstein-Barr viruses, human papillomavirus, and hepatitis C viruses.
- a virus containing one or more of the isolated nucleic acids provided herein can be used as a viral vector to package and/or deliver the isolated nucleic acids to a tissue, cell, pathogen, bacteria, virus, or fungus.
- a retroviral vector can be used to deliver an isolated nucleic acid provided herein to cells in vivo or ex vivo.
- Other examples of viral vector that can be used to deliver one or more of the isolated nucleic acids provided herein include, without limitation, those described in WO 97/17458 and U.S. Patent No. 6,271,359. Any method can be used to introduce an isolated nucleic acid into a virus.
- common molecular cloning techniques can be used to introduce an isolated nucleic acid provided herein into the sequence of a virus.
- standard virology techniques can be used to generate and isolate virus particles containing one or more of the isolated nucleic acids provided herein. Any method can be used to identify viruses containing an isolated nucleic acid provided herein. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analysis. For example, cells infected with a particular virus can be analyzed for the presence or absence of nucleic acid corresponding to an isolated nucleic acid provided herein.
- transgenic Animals The invention provides non-human transgenic animals containing one or more of the isolated nucleic acids provided herein.
- Such transgenic animals can be aquatic animals (such as fish, sharks, dolphin, and the like), farm animals (such as pigs, goats, sheep, cows, horses, rabbits, and the like), rodents (such as rats, guinea pigs, and mice), non-human primates (such as baboon, monkeys, and chimpanzees), and domestic animals (such as dogs and cats).
- Several techniques known in the art can be used to introduce an isolated nucleic acid into animals to produce the founder lines of transgenic animals. Such techniques include, without limitation, pronuclear microinjection (U.S. Patent No.
- transgenic animals can be replicated using traditional breeding or animal cloning.
- the transgenic animals provided herein can be designed to be functional knockouts of the polypeptide encoded by the mRNA that the siRNA molecules target for degradation.
- Such transgenic animals can be used to screen compounds for their ability restore the function or functions of the polypeptide knocked out.
- screening methods can include administering a test compound to the transgenic animal and determining if the function of the knocked out polypeptide is fully or partially restored relative to a control transgenic animal that did not receive the test compound.
- Any method can be used to identify transgenic animals containing an isolated nucleic acid provided herein. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analysis.
- the invention provides methods for reducing the level of RNA (e.g., an mRNA) within a cell. Such methods typically involve introducing one or more of the isolated nucleic acids provided herein into a cell.
- the invention also provides methods for inducing RNA interference in a cell by introducing an isolated nucleic acid into the cell such that a single-stranded RNA having no more than one hai ⁇ in loop structure is formed within the cell as a result of cleavage by at least one cis-acting ribozyme.
- the isolated nucleic acid introduced into a cell is designed such that the sense and antisense sequences target an mRNA normally within that cell.
- the isolated nucleic acid introduced into a cell can be designed such that the sense and antisense sequences target an mRNA not normally within that cell.
- the sense and antisense sequences can target an RNA sequence from a virus.
- the isolated nucleic acid can be used to protect cells from infection and/or lysis normally caused by that virus.
- the methods and materials provided herein can be used to treat conditions arising from (1) expression of an abnormal polypeptide (e.g., a mutated or dysfunctional polypeptide) or (2) abnormal expression (e.g., over-expression) of a normal polypeptide.
- an isolated nucleic acid provided herein can be designed such that the sense and antisense sequences target an mRNA encoding a particular polypeptide.
- the isolated nucleic acid can be administered to a subject (e.g., a human) suspected of having a disease or condition that can be alleviated by down-regulating the expression of the polypeptide encoded by the targeted mRNA.
- a subject e.g., a human
- diseases and conditions that can be treated using an isolated nucleic acid provided herein include, without limitation, bacterial infections (e.g., E. coli, S. aureus, and P.
- the isolated nucleic acids can be designed such that the sense and antisense sequences target mRNA that encodes an indispensable polypeptide from the bacterium or virus.
- an isolated nucleic acid can be designed such that the sense and antisense sequences target mRNA that encodes a bacterial enzyme required for the bacterium's survival.
- the isolated nucleic acids can be delivered directly to the bacteria using, for example, bacteriophage vectors.
- the isolated nucleic acids can be delivered to the infected cells or the cells susceptible to infection using, for example, viral vectors having a tropism for those cells.
- the isolated nucleic acids can be designed such that the sense and antisense sequences target mRNA that encodes an oncogene product (e.g., ras, myc, Src, myb, and Wnt).
- an oncogene product e.g., ras, myc, Src, myb, and Wnt.
- the isolated nucleic acids can be delivered to the cancerous cells via intratumoral injection or tlirough the use of viral vectors having a tropism for the cancerous cells.
- the isolated nucleic acids can be designed such that the sense and antisense sequences target mRNA that encodes a pro-inflammatory cytokine (e.g., interferon- ⁇ , TNF- ⁇ , TGF- ⁇ , and interleukins such as IL-11).
- the isolated nucleic acids can be delivered to the cells at the site of inflammation via localized injections or through the use of viral vectors having a tropism for the pro- inflammatory cells (e.g., macrophages and lymphocytes) at the site of inflammation.
- the invention provides in vitro and in vivo screening methods and materials that can be used to identify mRNA sequences that can be targeted for RNA interference.
- the following in vitro screen can be performed as outlined in Figure 21 or 24 to identify regions of an mRNA that are available for hybridization.
- PCR can be used to construct a pool of nucleic acids with each member containing a sequence of between about 10 and about 30 (e.g., 11, 13, 15, 17, 19, 21, 23, 25, 27, or 29) randomized nucleotides located downsfream from a promoter sequence (e.g., a T7 promoter) and between two restriction enzyme sites (e.g., two Bgi ⁇ sites).
- the transcripts containing the randomized sequences can be annealed to a target mRNA and RT-PCR is performed. After amplification, the amplification products can be cleaved with the restriction enzymes (e.g., Bglll), and the cleavage products can be cloned into vectors linearized to receive the cleaved products.
- the resulting collection of vectors can contain sequences that are a template for RNA molecules having the ability to bind to the mRNA sequence used as the selection target. These inserts can be sequenced and used to design the sense and antisense sequences provided herein such that RNA interference in induced. Each step of this selection protocol can be perfonned used methods similar to those described in U.S. Provisional Patent Application Serial No. 60/417,997, PCT
- an in vivo screen can involve introducing a vector preparation into cells.
- Each vector of the vector preparation can contain two main components: (1) a nucleic acid sequence that is a template for a target mRNA and (2) a nucleic acid sequence that is a template for a double-stranded RNA molecule to be tested for the ability to induce RNA interference such that the levels of the target mRNA and encoded polypeptide are reduced.
- the cells can contain the target mRNA, and each vector of the vector preparation can contain one main component: a nucleic acid sequence that is a template for a double-stranded RNA molecule to be tested for the ability to induce RNA interference such that the levels of the target mRNA and encoded polypeptide are reduced.
- a nucleic acid sequence that is a template for a double-stranded RNA molecule to be tested for the ability to induce RNA interference such that the levels of the target mRNA and encoded polypeptide are reduced.
- Such cells can contain the target mRNA endogenously.
- the cells can be provided with a nucleic acid sequence that encodes the target mRNA.
- cells can be transfected with an expression vector that encodes a target mRNA.
- the nucleic acid sequence that is a template for the target mRNA can be fused to a sequence encoding a reporter polypeptide (e.g., green fluorescent protein or red fluorescent protein) such that the target mRNA and the mRNA encoding the reporter polypeptide are transcribed as a single fusion mRNA.
- a reporter polypeptide e.g., green fluorescent protein or red fluorescent protein
- Any polypeptide can be used as a reporter polypeptide.
- the reporter polypeptide can be a polypeptide that kills cells when expressed.
- the reporter polypeptide can be lethal to cells or can be a polypeptide that induces lethal responses (e.g., a polypeptide that activates a lethal polypeptide such as caspase 3).
- target mRNA can be transcribed without a sequence encoding a reporter polypeptide.
- franscription of the fusion mRNA (or target mRNA) can be driven by any type of promoter sequence.
- each vector of the vector preparation can contain a CMV promoter sequence operably linked to the sequence that is a template for the fusion mRNA.
- a promoter sequence that promotes transcription to a lesser degree than a strong promoter such as a CMV promoter can be used.
- a weak promoter sequence can allow researchers to distinguish easily cells exhibiting effective target mRNA reduction from those cells that do not reduce target mRNA levels.
- the U6 promoter sequence is an example of a weak promoter that can allow researchers to distinguish easily cells exhibiting effective target mRNA reduction.
- each vector that contains the nucleic acid sequence that is a template for a double-stranded RNA molecule to be tested can be arranged such that a first promoter sequence (e.g., a U6, HI, or CMV promoter sequence) directs transcription from the top strand and a second promoter sequence (e.g., a U6, HI, or CMV promoter sequence) directs transcription from the bottom strand ( Figure 20).
- a first promoter sequence e.g., a U6, HI, or CMV promoter sequence
- a second promoter sequence e.g., a U6, HI, or CMV promoter sequence
- the two resulting transcripts can anneal to from a double-stranded RNA molecule.
- Each nucleic acid sequence that is a template for a double-sfranded RNA molecule to be tested can be positioned between the two promoter sequences using restriction enzyme sites.
- the nucleic acid sequence between the two promoter sequences can be any length.
- the nucleic acid sequence between the two promoter sequences can be from about 15 to about 300 nucleotides in length.
- the nucleic acid sequence between the two promoter sequences is from about 15 to about 200 nucleotides in length, from about 15 to about 100 nucleotides in length, from about 15 to about 50 nucleotides in length, from about 18 to about 50 nucleotides in length, from about 18 to about 40 nucleotides in length, from about 18 to about 30 nucleotides in length, or from about 18 to about 25 nucleotides in length.
- the two promoter sequences can be different.
- one promoter sequence can be a U6 promoter sequence, while the other can be an HI promoter sequence.
- the use of two different promoter sequences can simplify the sequencing procedures used to determine the sequence located between the two promoter sequences. For example, a sequencing primer designed to anneal to one of the promoter sequences will not anneal to the other promoter sequence when two different promoter sequences are used.
- the two promoter sequences can direct transcription of two transcripts: one from the top strand, and one from the bottom strand.
- the level of the reporter polypeptide expressed by the cell will be lower than the level observed in control cells (e.g., cells lacking the ability to transcribe both transcripts).
- the cells exhibiting a reduced level of reporter polypeptide can be isolated. Once a cell is isolated, the vector sequences responsible for the observed reduced level can be identified and used to design sense and antisense sequences as described herein.
- a nucleic acid sequence that is a template for a target mRNA is fused to a sequence that encodes eGFP. See, e.g., Jang et al, J. Virol. 62:2636-2643 (1988).
- the resulting construct can be cloned into a vector (e.g., the pcDNA5 vector; Invitrogen, Carlsbad, CA) such that transcription is under the control of a CMV or U6 promoter.
- a construct having two U6 promoter sequences (or one U6 promoter sequence and one HI promoter sequence) with one promoter sequence driving franscription from the top strand and the other driving transcription from the bottom strand can be made such that one or more restriction enzyme sites are located between the two promoter sequences. This construct can be used to clone in sequences to be tested.
- nucleic acids obtained using an in vitro screen can be cloned into a restriction site (e.g., a BarnHI site) to produce a collection of constructs containing each member of the nucleic acids obtained using an in vitro screen.
- This resulting collection of constructs can be cloned into the pcDNA5 vector containing the nucleic acid sequence that is a template for the target mRNA fused to the sequence that encodes eGFP to produce a library.
- the library can be used to transfect human 293 FliphiTM cells (Invitrogen, Carlsbad, CA) such that a construct containing the component(s) described herein integrates into the recombination site of the human 293 FliplnTM cells as a single copy.
- Transformants can be selected using Hygromycin antibiotic and screened for a reduction or elimination of fluorescence. Cells that do not fluoresce can contain a single copy of the integrated construct. The sequence of this integrated construct can be sequenced and used to design sense and antisense sequences as described herein. Collections of sequences such as the collection of sequences obtained using an in vitro screen ( Figure 24) can be subjected to a cloning process that produces a library of sequences that encode hai ⁇ in loop sequences ( Figure 25).
- hai ⁇ in loop sequences can be designed such that (1) the stem portion of the hai ⁇ in loop is formed, at least in part, by sense and antisense sequences, and (2) the loop portion of the hai ⁇ in loop is formed by a sequence located between the sense and antisense sequences.
- the loop portion can be any size (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides) and can have any sequence.
- the hai ⁇ in loop sequences can be used to induce RNA interference.
- the following cloning procedure can be used to produce a library of sequences that encode hai ⁇ in loop sequences ( Figure 25).
- a library of cDNA sequences from, for example, an in vitro screen such as the one depicted in Figure 24 can be combined with three PCR primers.
- Such cDNA sequences can contain a restriction site (e.g., Bglll) 3' of the random sequences (e.g., e21) and a different restriction site (e.g., Xbal) 5' of the random sequences (e.g., e21).
- the first PCR primer (first strand of Figure 25) can be complementary to the 3' end of the cDNA sequences.
- the second PCR primer (third strand of Figure 25) can contain a sequence that overlaps with the 5' end of the cDNA sequences and a sequence that extends beyond the 5' end of the cDNA sequences.
- the sequence that extends beyond the 5' end of the cDNA sequences can be designed to form a loop structure.
- the third PCR primer (fourth strand of Figure 25) can contain a sequence that overlaps with the 5' end of the second PCR primer and a sequence that extends beyond the 5' end of the second PCR primer.
- the sequence that extends beyond the 5' end of the second PCR primer can contain the same restriction site (e.g., Xbal) that is located in the cDNA sequences 5' of the random sequences (e.g., e21).
- the sequences from the cDNA sequences and PCR primers can be inco ⁇ orated into a larger product.
- the 3' end of this product can fold onto itself and allow for cis-extension during a PCR reaction.
- This reaction can be performed using the first PCR primer.
- This primer can be used at a concentration that is higher than normal. For example, 700 pM of the first primer can be used in this cis-extension PCR reaction as opposed to the 100 pM amount normally used in PCR reactions.
- the products can be edited to remove at least a portion of the sequence (e.g., most of the sequence) located between the sense and antisense sequences (e.g., E21 and e21) present in each strand.
- the amplified products can be cleaved at the flanking outer restriction sites (e.g., Bglll sites) and cloned into a vector (e.g., a pCR2 vector).
- the vector can be modified or designed to lack restriction sites that are cleaved by the restriction enzyme that cleaves at the inner flanking restriction sites (e.g., Xbal).
- the vectors After amplifying the vectors, the vectors can be cleaved at the inner flanking restriction sites (e.g., Xbal). The excised fragment can be discarded, and the vector fragments can be re-ligated. The sequences located between the outer flanking restriction sites can be excised and cloned into any type of vector such as an in vivo screening vector ( Figure 26).
- the library of sequences that encode hai ⁇ in loop sequences can be subjected to an in vivo screen to obtain large numbers of sequences that can be used to induce RNA interference in an efficient manner ( Figure 26).
- an in vivo screen can involve introducing a vector preparation into cells.
- Each vector of the vector preparation can contain two main components: (1) a nucleic acid sequence that is a template for a target mRNA and (2) a nucleic acid sequence that is a template for an RNA molecule with a hai ⁇ in loop sequence to be tested for the ability to induce RNA interference such that the levels of the target mRNA and encoded polypeptide are reduced.
- the cells can contain the target mRNA, and each vector of the vector preparation can contain one main component: a nucleic acid sequence that is a template for an RNA molecule with a hai ⁇ in loop sequence to be tested for the ability to induce RNA interference such that the levels of the target mRNA and encoded polypeptide are reduced.
- Such cells can contain the target mRNA endogenously.
- the cells can be provided with a nucleic acid sequence that encodes the target mRNA.
- cells can be transfected with an expression vector that encodes a target mRNA.
- the nucleic acid sequence that is a template for the target mRNA can be fused to a sequence encoding a reporter polypeptide (e.g., green fluorescent protein or red fluorescent protein) such that the target mRNA and the mRNA encoding the reporter polypeptide are transcribed as a single fusion mRNA.
- a reporter polypeptide e.g., green fluorescent protein or red fluorescent protein
- Any polypeptide can be used as a reporter polypeptide.
- the reporter polypeptide can be a polypeptide that kills cells when expressed.
- the reporter polypeptide can be lethal to cells or can be a polypeptide that induces lethal responses (e.g., a polypeptide that activates a lethal polypeptide such as caspase 3).
- target mRNA can be franscribed without a sequence encoding a reporter polypeptide.
- transcription of the fusion mRNA (or target mRNA) can be driven by any type of promoter sequence.
- each vector of the vector preparation can contain a CMV promoter sequence operably linked to the sequence that is a template for the fusion mRNA.
- a promoter sequence that promotes franscription to a lesser degree than a strong promoter such as a CMV promoter can be used.
- a weak promoter sequence can allow researchers to distinguish easily cells exhibiting effective target mRNA reduction from those cells that do not reduce target mRNA levels.
- the U6 promoter sequence is an example of a weak promoter that can allow researchers to distinguish easily cells exhibiting effective target mRNA reduction.
- each vector that contains the nucleic acid sequence that is a template for an RNA molecule with a hai ⁇ in loop sequence to be tested can be arranged such that a single promoter sequence (e.g., a U6, HI, or CMV promoter sequence) directs transcription from either the top or bottom strand.
- a single promoter sequence e.g., a U6, HI, or CMV promoter sequence
- each vector that contains the nucleic acid sequence that is a template for an RNA molecule with a hai ⁇ in loop sequence to be tested can be arranged such that a first promoter sequence (e.g., a U6, HI, or CMV promoter sequence) directs transcription from the top strand and a second promoter sequence (e.g., a U6, HI, or CMV promoter sequence) directs transcription from the bottom strand ( Figure 26).
- a first promoter sequence e.g., a U6, HI, or CMV promoter sequence
- a second promoter sequence e.g., a U6, HI, or CMV promoter sequence
- the two resulting transcripts can form separate hai ⁇ in loop structures.
- Each nucleic acid sequence that is a template for an RNA molecule with a hai ⁇ in loop sequence to be tested can be positioned behind a promoter sequence or between two promoter sequences using restriction enzyme sites.
- the nucleic acid sequence behind a promoter sequence or between two promoter sequences can be any length.
- the nucleic acid sequence between two promoter sequences can be from about 15 to about 300 nucleotides in length.
- the two promoter sequences can be different.
- one promoter sequence can be a U6 promoter sequence, while the other can be an HI promoter sequence.
- the use of two different promoter sequences can simplify the sequencing procedures used to determine the sequence located between the two promoter sequences. For example, a sequencing primer designed to anneal to one of the promoter sequences will not anneal to the other promoter sequence when two different promoter sequences are used.
- the RNA molecules can form a hai ⁇ in loop structure. If a transcript forms a structure that induces degradation of the target mRNA, then the level of the reporter polypeptide expressed by the cell will be lower than the level observed in control cells (e.g., cells lacking the ability to transcribe the RNA molecules).
- the cells exhibiting a reduced level of reporter polypeptide can be isolated. Once a cell is isolated, the vector sequences responsible for the observed reduced level can be identified and used to design sense and antisense sequences as described herein.
- nucleic acid delivery As described herein, any method can be used to deliver an isolated nucleic acid to a cell, hi some embodiments, delivery of an isolated nucleic acid provided herein can be performed via biologic or abiologic means as described in, for example, U.S. Patent No. 6,271,359.
- Abiologic delivery can be accomplished by a variety of methods including, without limitation, (1) loading liposomes with an isolated nucleic acid provided herein and (2) complexing an isolated nucleic acid with lipids or liposomes to form nucleic acid- lipid or nucleic acid-liposome complexes.
- the liposome can be composed of cationic and neutral lipids commonly used to transfect cells in vitro.
- Cationic lipids can complex (e.g., charge-associate) with negatively charged nucleic acids to form liposomes.
- cationic liposomes include lipofectin, lipofectamine, lipofectace, and DOTAP.
- Liposome compositions can be formed, for example, from phosphatidylcholine, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimyristoyl phosphatidylglycerol, or dioleoyl phosphatidylethanolamine.
- Numerous lipophilic agents are commercially available, including Lipofectin ® ( ivitrogen Life Technologies, Carlsbad, CA) and EffecteneTM (Qiagen, Valencia, CA).
- systemic delivery is optimized using commercially available cationic lipids such as DDAB or DOTAP, each of which can be mixed with a neutral lipid such as DOPE or cholesterol, hi some cases, liposomes such as those described by Templeton et al (Nature Biotechnology, 15:647-652 (1997)) can be used.
- commercially available cationic lipids such as DDAB or DOTAP, each of which can be mixed with a neutral lipid such as DOPE or cholesterol, hi some cases, liposomes such as those described by Templeton et al (Nature Biotechnology, 15:647-652 (1997)) can be used.
- polycations such as polyethyleneimine can be used to achieve delivery in vivo and ex vivo (Boletta et al, J. Am Soc. Nephrol. 7: 1728 (1996)). Additional information regarding the use of liposomes to deliver isolated nucleic acids can be found in U.S. Patent No. 6,271,359.
- the mode of delivery can vary with the targeted cell or tissue.
- isolated nucleic acids can be delivered to lung and liver tissue to treat a disease (e.g., cancer, tuberculosis, and hepatitis) via the intravenous injection of liposomes since both lung and liver tissue take up liposomes in vivo.
- a disease e.g., cancer, tuberculosis, and hepatitis
- catheritization in an artery upstream of the affected organ can be used to deliver liposomes containing an isolated nucleic acid. This catheritization can avoid clearance of the liposomes from the blood by the lungs and/or liver.
- lesions such as skin cancer, human papilloma virus lesions, he ⁇ es lesions, and precancerous cervical dysplasia
- topical delivery of liposomes can be used.
- Leukemias can be treated by ex vivo administration of the liposomes to, for example, to bone marrow.
- Liposomes containing an isolated nucleic acid provided herein can be administered parenterally, intravenously, intramuscularly, intraperitoneally, transdermally, exco ⁇ oreally, or topically.
- the dosage can vary depending on the species, age, weight, condition of the subject, and the particular compound delivered.
- biologic delivery vehicles can be used.
- viral vectors can be used to deliver an isolated nucleic acid to a desired target cell.
- Standard molecular biology teclmiques can be used to introduce one or more of the isolated nucleic acids provided herein into one of the many different viral vectors previously developed to deliver nucleic acid to particular cells. These resulting viral vectors can be used to deliver the one or more isolated nucleic acids to the targeted cells by, for example, infection.
- compositions can be administered to a subject suspected of having a disease or condition associated with the expression of a target polypeptide.
- the isolated nucleic acids and/or delivery vehicles can be in a pharmaceutically acceptable carrier or diluent, and can be administered in amounts and for periods of time that will vary depending upon the nature of the particular disease, its severity, and the subject's overall condition.
- an isolated nucleic acid is administered in an inhibitory amount such as an amount that is effective for inhibiting the production of the target polypeptide.
- RNA interference against a target can be assessed, for example, by measuring mRNA or polypeptide levels in a subject before and after treatment. Any method can be used to measure mRNA and polypeptide levels in tissues or biological samples such as Northern blots, RT-PCR, immunostaining, ELISAs, and radioimmunoassays. Any method can be used to formulate and subsequently administer a composition containing one or more of the isolated nucleic acids provided herein. Dosing is generally dependent on the severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved.
- Routine methods can be used to determine optimum dosages, dosing methodologies, and repetition rates.
- Optimum dosages can vary depending on the relative potency of individual nucleic acids, and can generally be estimated based on EC 5 o values found to be effective in in vitro and/or in vivo animal models. Typically, dosage is from about 0.01 ⁇ g to about 100 g per kg of body weight, and can be given once or more daily, weekly, or even less often. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state.
- compositions containing one or more of the isolated nucleic acids provided herein can be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of nucleic acids such as, for example, liposomes, receptor targeted molecules, or oral, rectal, topical or other formulations, for assisting in uptake, distribution, and/or abso ⁇ tion.
- Compositions containing one or more of the isolated nucleic acids provided herein can contain one or more pharmaceutically acceptable carriers.
- a "pharmaceutically acceptable carrier” (also referred to herein as an "excipient”) is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle.
- Pharmaceutically acceptable carriers can be liquid or solid, and can be selected with the planned manner of adminisfration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties.
- Typical pharmaceutically acceptable carriers include, by way of example and not limitation: water; saline solution; binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose and other sugars, gelatin, or calcium sulfate); lubricants (e.g., starch, polyethylene glycol, or sodium acetate); disintegrates (e.g., starch or sodium starch glycolate); and wetting agents (e.g., sodium lauryl sulfate).
- binding agents e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose
- fillers e.g., lactose and other sugars, gelatin, or calcium sulfate
- lubricants e.g.
- compositions provided herein can be administered by a number of methods depending upon whether local or systemic treatment is desired and upon the area to be treated.
- Administration can be, for example, topical (e.g., transdermal, ophthalmic, or infranasal); pulmonary (e.g., by inhalation or insufflation of powders or aerosols); oral; or parenteral (e.g., by subcutaneous, intrathecal, intraventricular, intramuscular, or intraperitoneal injection, or by intravenous drip).
- Administration can be rapid (e.g., by injection) or can occur over a period of time (e.g., by slow infusion or administration of slow release formulations).
- compositions for topical administration include, for example, sterile and non- sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions in liquid or solid oil bases. Such solutions also can contain buffers, diluents, and other suitable additives.
- compositions for topical administration can formulated in the form of transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Coated condoms, gloves, and the like also can be used.
- compositions for oral administration include, for example, powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Such compositions also can inco ⁇ orate thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders.
- compositions for parenteral, intrathecal, or intraventricular administration can include, for example, sterile aqueous solutions, which also can contain buffers, diluents, and other suitable additives (e.g., penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers).
- a composition containing one or more of the isolated nucleic acids provided herein can contain other therapeutic agents such as anti- inflammatory drugs (e.g., nonsteroidal anti-inflammatory drugs and corticosteroids) and antiviral drugs (e.g., ribivirin, vidarabine, acyclovir, and ganciclovir).
- anti- inflammatory drugs e.g., nonsteroidal anti-inflammatory drugs and corticosteroids
- antiviral drugs e.g., ribivirin, vidarabine, acyclovir, and ganciclovir.
- HPV16 50 - 68(H) sequence is 5'-CCGGAAAGTTACCACAGTT-3' (SEQ ID NO: 9), while the HPV16 57 . 77 sequence is 5'-GTTACCACAGTTATGCACAGA-3' (SEQ ID NO: 10).
- the HP VI 6 sequences used herein were obtained from the Hershey strain of HPV16. See, GenBank ® Accession Nos. gi3377787, 2196720, 1098775, and 1098731. In some cases, the HPV16 sequences correspond to the HPV16 sequences found in GenBank ® Accession No. gi333031.
- HPV16 5 o- 68 sequence would be 5'-CCAGAAA-GTTACCACAGTT-3' (SEQ ID NO: 11).
- Figures 1-4 contain the predicted structure (mFold program; see, e.g., Zuker and
- RNA Jacobson, RNA, 4:669-679 (1998)) of the RNA molecules transcribed from plCLIPs/ ⁇ PN16c + 50-68+Guu; plCL--P A s/HPN16c-.- 68 - 5 o + Guu; plCLIPs/HPN16 57 . 77+ uu; and plCLIPAs/HPN16 77 -5 7+ uu, respectively.
- a portion of pi CLIPs HPN 16 C +5O-68(H)+GUU contains the following sequence: 5 '-GGATCCTTCCGGGCTGATGAGTCCA- ATTGGACGAAACGGTACTCGAGTACCGTCCCCGGAAAGTTACCACAGTTGTT GACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAACAACTGAGATC TTTTTCTAGA-3' (SEQ ID NO: 12).
- plCLIPAs/HPN16c +68 -50(H)+Guu contains the following sequence: 5'-GGATCCACAGTTGCTGATGAGTCCAATTG- GACGAAACGGTACTCGAGTACCGTCCAACTGTGGTAACTTTCCGGGTTGACG GAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAACCCGGAAGATCTTTTT CTAGA-3' (SEQ ID NO: 13).
- a portion of pi CLIPs/HPN 16 57 -77 + uu contains the following sequence: 5'-GGATCCTGGTAACCTGATGAGTCCAATTGGACGAAACG- GTACTCGAGTACCGTCGTTACCACAGTTATGCACAGATTGACGGAGAATTCTC CGTCCTGATGAGTCCGGCCGGACGAAATCTGTGAGATCTTTTTCTAGA -3 ' (SEQ ID NO: 14).
- a portion of plCLff A s/HPV16 77 - 57 +uuu contains the following sequence: 5'-GGATCCGCACAGACTGATGAGTCCAATTGGACGAAACGGTA-
- the middle underlined sequence is either the sense or antisense sequence that corresponds to an HPV sequence.
- the first underlined sequence is complementary to a first region of the sense or antisense sequence and helps position the cis-acting ribozyme cleavage site within a few nucleotides of the sense or antisense sequence.
- the last underlined sequence is complementary to a last region of the sense or antisense sequence and helps position the cis-acting ribozyme cleavage site within a few nucleotides of the sense or antisense sequence.
- the cassette can be designed such that the sense and antisense sequences are further away from the cleavage sites.
- the sense and antisense sequences can be designed to be entirely within the bulge shown in Figure 1 at positions 62-69.
- Two p2CLIP cassettes are constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) either a sense or antisense sequence followed by (3) a cis acting ribozyme sequence (p2CL--Ps HPV16c+ 5 o- 68 +Guu and p2CLIP A s/HPV16c+6 8 - 5 o+Guu; Figures 5 and 6).
- Figures 5 and 6 contain the predicted structure (mFold program; see, e.g., Zuker and Jacobson, RNA, 4:669-679 (1998)) of the RNA molecules transcribed from p2CLIPs/HPN16c+ 5 o- 68 +Guu and p2CLff A s/HPN16 c + 68 -50+GUu. respectively.
- a portion of ⁇ 2CL-P s /HPN16c+ 5 o- 6 8+Guu contains the following sequence: 5'-GGATCA- GCTTCGAGCTCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCAG CTCGACCTCAGATCCCCAGAAAGTTACCACAGTTGTTAATTGATCCGTCGACG GATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACGGATCTGCAGCGGA TGATCTTTTTCTAGA-3' (SEQ ID NO: 16).
- the underlined sequence corresponds with the sense sequence, and the bold nucleotide is the nucleotide present in the HPV strain having its sequence set forth in GenBank ® Accession No. gi333031.
- the "A" can be replaced with a "G.”
- the cassette would be designated ⁇ 2CLIPs/HPV16c+5o-68(H)+Guu-
- a portion of P2CLIPAS HPV16C+ 6 8-5O+GUU contains the following sequence: 5'- G- GATCAGCTTCGAGCTCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACC GTCAGCTCGACCTCAGATCCAACTGTGGTAACTTTCTGGGTTAATTGATCCGT CGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACGGATCTGCA GCGGATGATCTTTTTCTAGA-3' (SEQ ID NO: 17).
- the underlined sequence corresponds with the antisense sequence, and the bold nucleotide is the nucleotide from GenBank ® Accession No. gi333031.
- the "T" can be replaced with a "C.”
- the cassette would be designated p2CLIP A s HPVl 6 c+ 68-50(H)+Guu.
- portions of the constructs were synthesized as overlapping oligonucleotides that were combined together to make the i CLIP cassettes using standard cloning vectors such as pCRII vector.
- the various HPV regions like HPV16 C + 5O - 68 + G U U are synthesized as overlapping oligonucleotides with the appropriate endonuclease restriction sites on the ends.
- the oligonucleotides are then digested and ligated into the digested p2CLIP cassette.
- common molecular cloning techniques similar to those described elsewhere were or are used (Benedict et al, Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene
- Example 2 Construction of pCLIP cassettes containing hepatitis B virus ( ⁇ BV) sequences
- ⁇ BV hepatitis B virus
- Two ⁇ l CLIP cassettes were constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) either a sense or antisense sequence followed by (3) a cis acting ribozyme sequence (plCLIPs/HBV 862 - 882 and pi CLIPAs HBN 882 -86 2 ).
- the HBN 862 - 882 sequence is 5 '-TTTGGAGCTACTGT- GGAGTTA-3' (SEQ ID NO: 18).
- the HBV sequences used herein correspond to the HBV sequences found in GenBank ® Accession No. X02496.
- plCLIPs/HBN 862 - 882 contains the following sequence: 5'-AAGCT- TCTCCAAACTGATGAGTCCAATTGGACGAAACGGTACTCGAGTACCGTCTTTG GAGCTACTGTGGAGTTATTGACGGAGAATTCTCCGTCCTGATGAGTCCGGCCG GACGAAATAACTCAGATCTTTTTCTAGA-3 ' (SEQ ID NO: 19).
- plCLIP A s/HBN 882 - 862 contains the following sequence: 5 ' -AAGCTTGGAGTTACTGAT- GAGTCCAATTGGACGAAACGGTACTCGAGTACCGTCTAACTCCACAGTAGCT CCAAATTGACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAATTTG GAAGATCTTTTTCTAGA-3 ' (SEQ ID NO: 20).
- the middle underlined sequence is either the sense or antisense sequence that conesponds to an HBN sequence.
- the first underlined sequence is complementary to a first region of the sense or antisense sequence and helps position the cis-acting ribozyme cleavage site within a few nucleotides of the sense or antisense sequence.
- the last underlined sequence is complementary to a last region of the sense or antisense sequence and helps position the cis-acting ribozyme cleavage site within a few nucleotides of the sense or antisense sequence.
- the cassette can be designed such that the sense and antisense sequences are further away from the cleavage sites.
- pi CLIP cassettes portions of the constructs were synthesized as overlapping oligonucleotides that were combined together to make the pi CLIP cassettes using standard cloning vectors such as pCRJI vector.
- standard cloning vectors such as pCRJI vector.
- common molecular cloning techniques similar to those described elsewhere were used (Benedict et al, Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol. Biol, 3:257-269 (1999); Crone et al, Hepatology, 29:1114-1123 (1999); Pan et al, RNA, 7:610-621 (2001); Zhang et al, Exp. Cell Res., 273:73-84 (2002); and Pan et al, Mol. Ther., 7:129- 139 (2003)).
- Example 3 Construction of pCHOP cassettes
- Four pi CHOP cassettes were constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) either a sense or antisense sequence followed by (3) a cis acting ribozyme sequence (plCHOPs/ ⁇ PN16c+5o- 68 (H)+Guu .
- Figures 7 and 8 contain the predicted structure (mFold program; see, e.g., Zuker and Jacobson, SNA, 4:669-679 (1998)) of the RNA molecules transcribed from plCHOP s HPV16 c +50- 68 +Guu and plCHOP A s HPV16 c +68-5o+Guu, respectively.
- plCHOP s /HPV16 c+ 5o-68+Guu contains the following sequence: 5 '-GGATCCTTCTGGGCT- GATGAGTCCAATTGGACGAAACGATGACATTCTGGTACTCGAGTACCAGAATGT CATCGTCCCCAGAAAGTTACCACAGTTGTTGAGCGCAACGACGCGGAGAATTCTC CGCGTCGTTGCGCTCCTGATGAGTCCGGCCGGACGAAACAACTGAGATCTTTTTC TAGA-3' (SEQ ID NO: 21).
- plCHOP A s HPV16 c + 68 - 5 o+GUu contains the following sequence: 5'- GGATCCACAGTTGCTGATGAGTCCAATTGG- ACGAAACGATGACATTCTGGTACTCGAGTACCAGAATGTCATCGTCCAACTGTGG TAACTTTCTGGGTTGAGCGCAACGACGCGCGGAGAATTCTCCGCGTCGTTGCGCTCC TGATGAGTCCGGCCGGACGAAACCCAGAAGATCTTTTTCTAGA-3 ' (SEQ ID NO: 22).
- the bold "T” was replaced with a "C”
- the bold "A” was replaced with a "G.”
- the bold "G was replaced with a "G.”
- Two p2CHOP cassettes are constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) either a sense or antisense sequence followed by (3) a cis acting ribozyme sequence (p2CHOPs/HPV16c4-so-68+Guu and P2CHOPAS/HPV16C+ 68 -5O+GUU .
- Figures 9 and 10 Figures 9 and 10).
- Figures 9 and 10 contain the predicted structure (mFold program; see, e.g., Zuker and Jacobson, RNA, 4:669-679 (1998)) of the RNA molecules transcribed from p2CHOP s HPV16 c +5o-68+Guu and p2CHOP AS /HPV16 c +68- 50+Guu- respectively.
- a portion of p2CHOPs/HPV16c+ 5 o- 6 8+Guu contains the following sequence: 5 '-GGATCATCCAGCTTTGGAACCCTGATGAGTC- CGTGAGGACGAAACGATGACATTCTGCTGACCAGATTCACGGTCAGCAGAATGT CATCGTCGGTTCCAGGATCCCCAGAAAGTTACCACAGTTGTTAATTCCAAGGGTC TGCGCAACGACGACGATGAGGTACCACATCGTCGTCGTTGCGCACTGATGAGGC CGTGAGGCCGAAACCCTTGACGCGTTCCTATGCGGCCGCTCTAGGATCTTTTTCT AGA-3' (SEQ ID NO: 23).
- the cassette would be designated p2CHOP s /HPV16 c +5o-68(H)+Guu.
- a portion of p2CHOP A s/HPV16 c +68-50+Guu contains the following sequence: 5'-GGATCATCCAGCTTTGGAACCCTGATGAGTCCGTGAGG- ACGAAACGATGACATTCTGCTGACCAGATTCACGGTCAGCAGAATGTCATCGTCG GTTCCAGGATCCAACTGTGGTAACTTTCTGGGTTAATTCCAAGGGTCTGCGCAAC GACGACGATGAGGTACCACATCGTCGTCGTTGCGCACTGATGAGGCCGTGAGGC CGAAACCCTTGACGCGTTCCTATGCGGCCGCTCTAGGATCTTTTTCTAGA-3 ' (SEQ ID NO: 24).
- the cassette would be designated P2CHOPAS/HPV16C+ 6 8- 5 O(H)+GUU-
- portions of the constructs were synthesized as overlapping oligonucleotides that were combined together to make the pi CHOP cassettes using standard cloning vectors such as pCRII vector.
- the various HPV regions like HPV16 C + 5O - 68 + G UU are synthesized as overlapping oligonucleotides with the appropriate endonuclease restriction sites on the ends.
- oligonucleotides are then digested and ligated into the digested p2CHOP cassette.
- common molecular cloning teclmiques similar to those described elsewhere were or are used (Benedict et al, Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol. Biol, 3:257-269 (1999); Crone et «/., Hepatology, 29:1114-1123 (1999); Pan et al, RNA, 7:610-621 (2001); Zhang et al, Exp. Cell Res., 273:73-84 (2002); and Pan et al, Mol. Ther., 7:129-139 (2003)).
- Example 4 Construction of pSIR cassettes from pCLIP and pCHOP cassettes
- the plCLIPs and PICLIPA S cassettes were used to construct pSIR cassettes containing one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) a sense sequence followed by (3) a cis acting ribozyme sequence followed by (4) a cis-acting ribozyme sequence followed by (5) an antisense sequence followed by (6) a cis acting ribozyme sequence ( Figure 11).
- Similar pSIR cassettes can be made using any combination of two or more of the following cassettes: plCLIPs . plCLIPAs- p2CLIPs, p2CL ⁇ As.
- plCHOPs plCHOPs, ⁇ lCHOP A s, ⁇ 2CHOP s , and p2CHOP AS .
- the plCLIPs/HPV16c+5o-68(H)+Guu and plCLff AS/HPV16 C + 68 -50(H)+GUU cassettes were used to construct pS--R/HPV16si c + 5 o- 6 8(H)+Guu- the plCLIP s /HPV16 57 - 77+U u and pCLIPAs/HPV16 77 - 57+uu cassettes were used to construct pSIR/HPV16si 57 - 77+ uu; and the plCL-P s /HBV 862 - 882 and plCLIP A s/HBV 882 - 862 cassettes were used to construct pSIR HBVsi 86 - 882 .
- RNA liberated from an RNA molecule transcribed from a pSIR cassette can form double-stranded RNA capable of inducing RNA interference ( Figures 12 and 13).
- a portion of pSIR/HPV16sic+ 5 o- 68 (H) + Guu contains the following sequence: 5'-GG- ATCCTTCCGGGCTGATGAGTCCAATTGGACGAAACGGTACTCGAGTACCGTCC CCGGAAAGTTACCACAGTTGTTGACGGAGAATTCTCCGTCCTGATGAGTCCGG CCGGACGAAACAACTGAGATCCACAGTTGCTGATGAGTCCAATTGGACGAAA CGGTACTCGAGTACCGTCCAACTGTGGTAACTTTCCGGGTTGACGGAGAATTC TCCGTCCTGATGAGTCCGGCCGGACGAAACCCGGAAGATCTTTTTCTAGA-3' (SEQ ID NO: 25).
- a portion of pSIR HPV16si5 7 - 77+ uu contains the following sequence: 5'-GGATCCTGGTAACGCTGATGAGTCCAATTGGACGAAACGGTACTCGAGT- ACCGTCCGTTACCACAGTTATGCACAGAGTTGACGGAGAATTCTCCGTCCTGA TGAGTCCGGCCGGACGAAATCTGTGAGATCCGCACAGAGCTGATGAGTCCAA TTGGACGAAACGGTACTCGAGTACCGTCCTCTGTGCATAACTGTGGTAACGTT GACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAACGTTACCAGAT CTTTTTCTAGA-3' (SEQ ID NO: 26).
- a portion of pSIR/HBVsi 862 - 882 contains the following sequence: 5'-AAGCTTCTCCAAACTGATGAGTCCAATTGGACGAAA- CGGTACTCGAGTACCGTCTTTGGAGCTACTGTGGAGTTATTGACGGAGAATTC TCCGTCCTGATGAGTCCGGCCGGACGAAATAACTCATGGAGTTACTGATGAG TCCAATTGGACGAAACGGTACTCGAGTACCGTCTAACTCCACAGTAGCTCCA AATTGACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAATTTGGAA GATCTTTTTCTAGA-3' (SEQ ID NO: 27).
- the underlined sequence is a Hindlll restriction enzyme site.
- common molecular cloning techniques similar to those described elsewhere were used to make the pSIR cassettes (Benedict et al., Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol. Biol, 3:257-269 (1999); Crone et al, Hepatology, 29:1114-1123 (1999); Pan et al., RNA, 7:610-621 (2001); Zhang et al, Exp. Cell Res., 273:73-84 (2002); and Pan et al, Mol. Ther., 7:129-139 (2003)).
- Example 5 Construction of pCLIP and pCHOP cassettes with three cis-acting ribozyme sequences (pCLDr and PCHOPHR p2CLIP and p2CHOP cassettes were constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) a sense sequence followed by (3) a cis acting ribozyme sequence followed by (4) an antisense sequence followed by (5) a cis-acting ribozyme sequence (p2CLIP HR HPN16 47 - 68 ( Figure 14); p2CHOP H R/ ⁇ PN16 47 - 68 Figure 15); p2CLff H R/ ⁇ PN16 5 5-74+uu; and p2CHOP H R/HPN16 55 - 74+uu)-
- the R ⁇ A transcribed from these cassettes can form double-stranded R ⁇ A capable of inducing R ⁇ A interference ( Figure 16).
- 6S contains the following sequence: 5'-GGA- TCAGCTTCGAGCTCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGT CAGCTCGACCTCAGATCGACCCAGAAAGTTACCACAGTTGACGGATGTAGAT CCGTCCTGATGAGTCCGTGAGGACGAAACTGTGGTAACTTTCTGGGTCAATTG ATCCGTCGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACGGA TCTGCAGCGGATGATCTTTTTCTAGA-3' (SEQ ID NO: 30).
- a portion of p2CHOP HR HPV16 47 - 68 contains the following sequence: 5'-GGATCATCCAGCTTTGG- AACCCTGATGAGTCCGTGAGGACGAAACGATGACATTCTGCTGACCAGATTC ACGGTCAGCAGAATGTCATCGTCGGTTCCAGGATCGACCCAGAAAGTTACCA CAGTTGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACTGTGG TAACTTTCTGGGTCAATTCCAAGGGTCTGCGCAACGACGACGATGAGGTACC ACATCGTCGTCGTTGCGCACTGATGAGGCCGTGAGGCCGAAACCCTTGACGC GTTCCTATGCGGCCGCTCTAGGATCTTTTTCTAGA-3' (SEQ ID NO: 31).
- a portion of p2CLlP HR /HPV16 55 - 7 + uu contains the following sequence: 5'-GGATCAG- CTTCGAGCTCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCAGC TCGACCTCAGATCAAGTTACCACAGTTATGCACTTGACGGATGTAGATCCGTC CTGATGAGTCCGTGAGGACGAAAGTGCATAACTGTGGTAACTTAATTGATCC GTCGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACGGATCTG CAGCGGATGATCTTTTTCTAGA-3' (SEQ ID NO:32).
- a portion of p2CHOP H R/HPN16 5 5-74+uu contains the following sequence: 5'-GGATCATCCAGCTT- TGGAACCCTGATGAGTCCGTGAGGACGAAACGATGACATTCTGCTGACCAGA TTCACGGTCAGCAGAATGTCATCGTCGGTTCCAGGATCAAGTTACCACAGTTA TGCACTTGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAAGTGC ATAACTGTGGTAACTTAATTCCAAGGGTCTGCGCAACGACGACGATGAGGTA CCACATCGTCGTCGTTGCGCACTGATGAGGCCGTGAGGCCGAAACCCTTGAC GCGTTCCTATGCGGCCGCTCTAGGATCTTTTTCTAGA-3' (SEQ ID ⁇ O:33).
- the sense and antisense sequences are underlined.
- the various HPN regions like HPN16 47 . 68 were synthesized as overlapping oligonucleotides with the appropriate endonuclease restriction sites on the ends. The oligonucleotides were then digested and ligated into the digested p2CLIP or ⁇ 2CHOP cassette.
- common molecular cloning techniques similar to those described elsewhere were used (Benedict et al, Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol.
- PCLIPHR cassettes PICLIPHR or P2CL1PHR
- pCHOP HR cassettes plCHOP HR or P2CHOP HR
- pSNIP cassettes containing one strand that is a template for (l) a cis-acting ribozyme sequence followed by (2) a sense sequence followed by (3) a cis acting ribozyme sequence followed by (4) an antisense sequence followed by (5) a cis-acting ribozyme sequence followed by (6) a cis-acting ribozyme sequence followed by (7) a sense sequence followed by (8) a cis acting ribozyme sequence followed by (9) an antisense sequence followed by (10) a cis- acting ribozyme sequence ( Figure 17).
- the pSNIP cassette can have the following general sequence: 5'-AAGCTT(HindIII)CGAGCTCTGATGAGTCCGTGAGGACGAA- ACGGTACCCGGTACCGTCAGCTCGACCTCAGATCT(BglH)CTCGAGCAATTG(M feI)ATCCGTCGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACG GATCTGCAGCGGATATCCAGCTTTGGAACCCTGATGAGTCCGTGAGGACGAA ACGATGACATTCTGCTGACCAGATTCACGGTCAGCAGAATGTCATCGTCGGTT CCAGGATCC(BamHI)TTGCCTGAATTC(EcoRl)CAAGGGTCTGCGCAACGACGA CGATGAGGTACCACATCGTCGTCGTTGCGCACTGATGAGGCCGTGAGGCCGA AACCCTTGACGCGTTCCTATGCGGCCGCTCTAGA(XbaI)-3' (SEQ ID NO:34).
- p2CL ⁇ HPV16 47 - 68 and p2CHOP HR / ⁇ PV16 47 - 68 cassettes were used to form pSNIP/HPV16 47 - 68 , which contains the following sequence: 5'-GGATC-
- ⁇ 2CLIPHR/HPV165 5 - 74 4-uu and p2CHOPHR/ ⁇ PV16 55 - 74 +uu cassettes were used to form pSNIP HPV1655- 7 +uu- which contains the following sequence: 5'-GGATCAGC- TTCGAGCTCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTCAGCT CGACCTCAGATCAAGTTACCACAGTTATGCACTTGACGGATGTAGATCCGTCC TGATGAGTCCGTGAGGACGAAAGTGCATAACTGTGGTAACTTAATTGATCCG TCGACGGATGTAGATCCGTCCTGATGAGTCCGTGAGGACGAAACGGATCTGC AGCGGATATCCAGCTTTGGAACCCTGATGAGTCCGTGAGGACGAAACGATGA CATTCTGCTGACCAGATTCACGGTCAGCAGAATGTCATCGTCGGTTCCAGGAT CAAGTTACCACAGTTATGCACTTGACGGATGTAGATCCGTCCTGATGAGTCCG
- a pSNIP cassette was constructed to contain the following DNA fragment, which is a template for sense and antisense HBV sequences (HBV 86 o- 88 ⁇ ) flanking a cis-acting ribozyme sequence: 5'-GATCAATTTGGAGCTACTGTGGAGTTGACGGATGTAG- ATCCGTCCTGATGAGTCCGTGAGGACGAAACTCCACAGTAGCTCCAAATTAA TT-3' (SEQ ID NO: 37).
- cassettes were constructed using common molecular cloning techniques similar to those described elsewhere (Benedict et al, Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol Biol, 3:257-269 (1999); Crone et al, Hepatology, 29:1114-1123 (1999); Pan et al, RNA, 7:610-621 (2001); Zhang et al, Exp. CellRes., 273:73-84 (2002); and Pan et al, Mol. Ther., 7:129-139 (2003)).
- Example 7 Construction of pCLIP and pCHOP cassettes with hai ⁇ in loop sequences
- Three pi CLIP cassettes were constructed to contain one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) a hai ⁇ in loop sequence where the stem portion contains sense and antisense sequences followed by (3) a cis acting ribozyme sequence (P1CLIPHP/HPV16C+5O-68(H)+GUU; plCLff H p/HPV16 57 - 77 ; and plCLIPHp HBV 862 - 882 ).
- a p2CL--P H p/HPV16 c +5o-68(H)+GUu construct was made.
- Figure 18 contains the predicted structure (mFold program; see, e.g., Zuker and Jacobson, RNA, 4:669-679 (1998)) of the RNA molecules transcribed from P2CLIPHP/HPV16C+5 O - 68 + G U U - Similar cassettes can be made using pCHOP sequences.
- the RNA transcribed from PCLIP HP and pCHOPnp cassettes can form single-stranded RNA capable of forming a hai ⁇ in loop structure, which can induce RNA interference (Figure 19).
- a portion of P1CLIPHP/HPV16C+5O-68(H)+GUU contains the following sequence: 5'- GGATCCTTCCGGGCTGATGAGTCCAATTGGACGAAACGGTACTCGAGTACCG TCCCCGGAAAGTTACCACAGTTGTTCAAGACCCAACTGTGGTAACTTTCCGGG TTGACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGAAACCCGGAAGA TCTTTTTCTAGA-3 ' (SEQ ID NO: 39).
- a portion of lCLIP H p/HPV16 57 - 77 contains the following sequence: 5'-GGATCCTGGTAACCTGATGAGTCCAATTGGACG- AAACGGTACTCGAGTACCGTCGTTACCACAGTTATGCACAGATTCAAGACCTC TGTGCATAACTGTGGTAACTTGACGGAGAATTCTCCGTCCTGATGAGTCCGGC CGGACGAAAGTTACCAGATCTTTTTCTAGA-3 ' (SEQ ID NO: 40).
- a portion of plCLIP H p/HBV 862 - 882 contains the following sequence: 5 '-AAGCTTCTCCAAACT-
- Two plCLIP H p/HBV 862 - 882 cassettes were joined together to form a cassette containing one strand that is a template for (1) a cis-acting ribozyme sequence followed by (2) a hai ⁇ in loop sequence where the stem portion contains sense and antisense sequences followed by (3) a cis acting ribozyme sequence followed by (4) a cis-acting ribozyme sequence followed by (5) a hai ⁇ in loop sequence where the stem portion contains sense and antisense sequences followed by (6) a cis acting ribozyme sequence (plCLIP H P-double/H-BV 86 - 882 ).
- plCLIP H p-double/HBV 86 - 882 contains the following sequence: 5'-AAGCTTCTCCAAACTGATGAGTCCAATTGGACG- AAACGGTACTCGAGTACCGTCTTTGGAGCTACTGTGGAGTTATTCAAGACCTA ACTCCACAGTAGCTCCAAATTGACGGAGAATTCTCCGTCCTGATGAGTCCGGC CGGACGAAATTTGGAATCTCCAAACTGATGAGTCCAATTGGACGAAACGGTA CTCGAGTACCGTCTTTGGAGCTACTGTGGAGTTATTCAAGACCTAACTCCACA GTAGCTCCAAATTGACGGAGAATTCTCCGTCCTGATGAGTCCGGCCGGACGA AATTTGGAAGATCTTTTTCTAGA-3 ' (SEQ ID NO: 42).
- Each cassette was constructed using common molecular cloning techniques similar to those described herein and elsewhere (Benedict et al., Carcinogenesis, 19:1223-1230 (1998); Schalles et al, Gene Ther. Mol. Biol, 3:257-269 (1999); Crone et al, Hepatology, 29:1114-1123 (1999); Pan et al, RNA, 7:610-621 (2001); Zhang et al, Exp. Cell Res., 273:73-84 (2002); and Pan et al, Mol. Ther., 7:129-139 (2003)).
- Example 8 In Vivo screen A modified version of the Flp-fri system commercially available from Invitrogen is used in conjunction with human 293 embryonic kidney cells as follows ( Figure 20).
- An HPV16 E6/E7 target sequence is cloned between the Hindlll and EcoRV restriction endonuclease sites of pcDNA5-FRT such that transcription of the HPV mRNA is under control of the CMV promoter.
- the various sequences to be tested flanked by two U6 promoter sequences such that each strand is transcribed are cloned into the Sa l site of pcDNA5-FRT.
- These library sequences can be randomly generated sequences or sequences obtained from an in vitro screening process (Figure 21).
- the DNA encoding a red fluorescent protein (RFP) is added to the vector, either upsfream or downstream from the DNA encoding the HPV16 E6/E7 target.
- RFP red fluorescent protein
- These constructs are then co-fransfected together with pOG44 constructs (which produce the recombinase) into the Flp-In 293 cell line. These cells are resistant to Zeocin selection and express RFP. Selection of stably transfected cells is performed using 20 j Ug/mL of Hygromycin B.
- Example 9 Reduction of mRNA levels within cells
- P1CLIPHP/HPV16C+5O-68(H)+GUU The following cassettes were tested for the ability to reduce mRNA levels within cells: P1CLIPHP/HPV16C+5O-68(H)+GUU; pSIR (plCLIP s /HPV16c+5o- 6 8(H)+Guu and plCLP A s HPV16 c+ 68-50 ( H) +G uu); plCLIPs/HPV16c +50 - 68 ( H)+G uu; p2CLIP HR /HPV16 47 - 68 ; p2CHOP HR /HPV16 47 - 68 ; and pSIR (plCLIPs/HPV16 57 - 77( H)+Guu and plCLIP AS /HPV16 77 - 57(H) + GUU )- Constructs containing the various cassettes driven by a
- Each construct also contained an HPV16 sequence under the control of a CMV promoter.
- RNA was isolated from the cells and real-time PCR was used to measure HPV16 target RNA levels as described in Pan et al. (Mol. Ther., 7:129-139 (2003)).
- a significant reduction in target mRNA was detected for cells containing the pSIR (plCLIPs/HPV165 7 - 77 (H)+GUu and plCLIPAs/HPV16 77 -5 7( H) + GUu) cassette ( Figure 22).
- Constructs containing the various cassettes driven by a U6 promoter were co-fransfected together with pOG44 constructs (which produce the recombinase) into the Flp-In 293 cell line.
- Each construct also contained an HPN 16 sequence under the control of a CMN promoter.
- CMN promoter One day after transfection, total R ⁇ A was isolated from the cells, and quantitative PCR was used to measure HPN 16 target R ⁇ A levels.
- the control was cells transfected with an empty pS ⁇ IP (p2CLIP and p2CHOP) cassette.
- Constructs containing the various cassettes driven by a U6 promoter were co-fransfected together with pOG44 constructs (which produce the recombinase) into the Flp-In 293 cell line. Each construct also contained an HPV16 sequence under the control of a U6 promoter. Two days after transfection, total R ⁇ A was isolated from the cells, and quantitative PCR was used to measure HPV16 target R ⁇ A levels.
- the control was cells transfected with an empty pS ⁇ IP (p2CLIP and p2CHOP) cassette, hi addition, cells transfected with a cassette containing a pS ⁇ IP-type of anangement with trans-acting rybozymes targeting the target mR ⁇ A (as opposed to sense and antisense sequences) were used.
- This cassette contained one p2CLIP and one p2CHOP, with each being capable of transcribing a trans-acting ribozyme directed against the HPV16 5 o- 68 region.
- a reduction in target mR ⁇ A was detected for cells containing each cassette ( Figure 23).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002516425A CA2516425A1 (en) | 2003-02-21 | 2004-02-23 | Rna interference compositions and methods |
| EP04775796A EP1611231A4 (en) | 2003-02-21 | 2004-02-23 | RNA-INTERFERING COMPOSITIONS AND METHODS THEREOF |
| US10/552,914 US20060269530A1 (en) | 2003-02-21 | 2004-02-23 | RNA interference compositions and methods |
| JP2006508809A JP2006523103A (ja) | 2003-02-21 | 2004-02-23 | Rna干渉組成物および方法 |
| AU2004265550A AU2004265550A1 (en) | 2003-02-21 | 2004-02-23 | RNA interference compositions and methods |
| US12/578,035 US20100036107A1 (en) | 2003-02-21 | 2009-10-13 | Rna interference compositions and methods |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US44906603P | 2003-02-21 | 2003-02-21 | |
| US60/449,066 | 2003-02-21 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/578,035 Division US20100036107A1 (en) | 2003-02-21 | 2009-10-13 | Rna interference compositions and methods |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005017127A2 true WO2005017127A2 (en) | 2005-02-24 |
| WO2005017127A3 WO2005017127A3 (en) | 2006-04-06 |
Family
ID=34192976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2004/005400 Ceased WO2005017127A2 (en) | 2003-02-21 | 2004-02-23 | Rna interference compositions and methods |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US20060269530A1 (enExample) |
| EP (1) | EP1611231A4 (enExample) |
| JP (1) | JP2006523103A (enExample) |
| AU (1) | AU2004265550A1 (enExample) |
| CA (1) | CA2516425A1 (enExample) |
| WO (1) | WO2005017127A2 (enExample) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US12084659B2 (en) | 2016-05-18 | 2024-09-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004002416A2 (en) * | 2002-06-26 | 2004-01-08 | The Penn State Research Foundation | Methods and materials for treating human papillomavirus infections |
| US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10758558B2 (en) | 2015-02-13 | 2020-09-01 | Translate Bio Ma, Inc. | Hybrid oligonucleotides and uses thereof |
| AU2016344384A1 (en) | 2015-10-26 | 2018-05-17 | Translate Bio Ma, Inc. | Nanoparticle formulations for delivery of nucleic acid complexes |
| MX2018014152A (es) | 2016-05-18 | 2019-03-28 | Voyager Therapeutics Inc | Composiciones y métodos para tratar la enfermedad de huntington. |
| AU2018261790B2 (en) | 2017-05-05 | 2024-10-03 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| AU2018261003A1 (en) | 2017-05-05 | 2019-11-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating Huntington's Disease |
| EP3619310A4 (en) * | 2017-05-05 | 2021-01-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| WO2019079240A1 (en) | 2017-10-16 | 2019-04-25 | Voyager Therapeutics, Inc. | TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS) |
| WO2019079242A1 (en) | 2017-10-16 | 2019-04-25 | Voyager Therapeutics, Inc. | TREATMENT OF AMYOTROPHIC LATERAL SCLEROSIS (ALS) |
Family Cites Families (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4873191A (en) * | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5703055A (en) * | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| US5500357A (en) * | 1990-11-02 | 1996-03-19 | Agency Of Industrial Science & Technology, Ministry Of International Trade & Industry | RNA transcription system using novel ribozyme |
| US5824519A (en) * | 1995-11-08 | 1998-10-20 | Medical University Of South Carolina | Tissue-specific and target RNA-specific ribozymes |
| US6013447A (en) * | 1997-11-21 | 2000-01-11 | Innovir Laboratories, Inc. | Random intracellular method for obtaining optimally active nucleic acid molecules |
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| EP1068350B1 (en) * | 1998-03-28 | 2008-02-13 | University Of Utah Research Foundation | Directed antisense libraries |
| US6458559B1 (en) * | 1998-04-22 | 2002-10-01 | Cornell Research Foundation, Inc. | Multivalent RNA aptamers and their expression in multicellular organisms |
| WO2000009673A1 (en) * | 1998-08-13 | 2000-02-24 | Johnson & Johnson Research Pty. Limited | Dnazymes and methods for treating hpv-related disorders |
| EP2314700A1 (en) * | 1999-01-28 | 2011-04-27 | Medical College of Georgia Research Institute, Inc | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA |
| US6271359B1 (en) * | 1999-04-14 | 2001-08-07 | Musc Foundation For Research Development | Tissue-specific and pathogen-specific toxic agents and ribozymes |
| CZ302719B6 (cs) * | 2000-12-01 | 2011-09-21 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Izolovaná molekula dvouretezcové RNA, zpusob její výroby a její použití |
| EP1354038A2 (en) * | 2000-12-28 | 2003-10-22 | J & J Research Pty Ltd | Double-stranded rna-mediated gene suppression |
| AU2002343792A1 (en) * | 2001-11-28 | 2003-06-10 | Center For Advanced Science And Technology Incubation, Ltd. | siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME |
| US20040053876A1 (en) * | 2002-03-26 | 2004-03-18 | The Regents Of The University Of Michigan | siRNAs and uses therof |
| WO2004002416A2 (en) * | 2002-06-26 | 2004-01-08 | The Penn State Research Foundation | Methods and materials for treating human papillomavirus infections |
| WO2004011624A2 (en) * | 2002-07-31 | 2004-02-05 | Nucleonics, Inc. | Double stranded rna structures and constructs, and methods for generating and using the same |
| WO2004022782A2 (en) * | 2002-09-04 | 2004-03-18 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | Compositions and methods for tissue specific or inducible inhibition of gene expression |
-
2004
- 2004-02-23 JP JP2006508809A patent/JP2006523103A/ja active Pending
- 2004-02-23 EP EP04775796A patent/EP1611231A4/en not_active Withdrawn
- 2004-02-23 WO PCT/US2004/005400 patent/WO2005017127A2/en not_active Ceased
- 2004-02-23 AU AU2004265550A patent/AU2004265550A1/en not_active Abandoned
- 2004-02-23 US US10/552,914 patent/US20060269530A1/en not_active Abandoned
- 2004-02-23 CA CA002516425A patent/CA2516425A1/en not_active Abandoned
-
2009
- 2009-10-13 US US12/578,035 patent/US20100036107A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1611231A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US12084659B2 (en) | 2016-05-18 | 2024-09-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2516425A1 (en) | 2005-02-24 |
| US20100036107A1 (en) | 2010-02-11 |
| WO2005017127A3 (en) | 2006-04-06 |
| EP1611231A2 (en) | 2006-01-04 |
| JP2006523103A (ja) | 2006-10-12 |
| EP1611231A4 (en) | 2008-08-13 |
| AU2004265550A1 (en) | 2005-02-24 |
| US20060269530A1 (en) | 2006-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100036107A1 (en) | Rna interference compositions and methods | |
| JP3316216B2 (ja) | 安定化外部ガイド配列 | |
| US5665593A (en) | Antisense oligonucleotides which combat aberrant splicing and methods of using the same | |
| JP4062365B2 (ja) | 短い外部ガイド配列 | |
| US6057153A (en) | Stabilized external guide sequences | |
| JP2009159971A6 (ja) | 異常スプライシングを阻害するアンチセンスオリゴヌクレオチドと同物質の利用法 | |
| KR102825946B1 (ko) | IL4Rα, TRPA1, 또는 F2RL1을 표적화하는 RNA 복합체를 사용한 아토피 피부염 및 천식의 치료 | |
| CA3026112A1 (en) | Cpf1 complexes with reduced indel activity | |
| US20040209263A1 (en) | Selection of catalytic nucleic acids targeted to infectious agents | |
| US20150031871A1 (en) | RNA-Mediated Gene Modulation | |
| KR20190042660A (ko) | 화학적으로 변형된 단일 가닥 rna-편집 올리고뉴클레오타이드 | |
| KR20080066987A (ko) | siRNA에 대한 전달 운반체로서의 펩티드-다이서 기질RNA 접합체들 | |
| US5994124A (en) | Ribozyme-snRNA chimeric molecules having a catalytic activity for nuclear RNAs | |
| WO2020186150A2 (en) | Non-viral dna vectors and uses thereof for expressing phenylalanine hydroxylase (pah) therapeutics | |
| JPH1052264A (ja) | N‐ras発現阻害剤およびその方法 | |
| KR20010042848A (ko) | 인슐린유사 성장인자 ⅱ의 안티센스 올리고뉴클레오타이드서열 및 이를 이용한 세포성장 조절방법 | |
| WO1999067400A1 (en) | Tissue-specific and target rna-specific ribozymes | |
| JP2023542131A (ja) | フェニルアラニンヒドロキシラーゼ(pah)を発現させるための閉端dnaベクター及びその使用 | |
| US20040248114A1 (en) | Novel maxizyme | |
| JP2002541795A (ja) | 核酸分子を用いるリプレッサー遺伝子の制御 | |
| EP3145553B1 (en) | Small interfering rna (sirna) for the therapy of type 2 (ado2) autosomal dominant osteopetrosis caused by clcn7 (ado2 clcn7-dependent) gene mutation | |
| JP2001521738A (ja) | IL−15mRNAを標的とするリボザイム | |
| JP2022513159A (ja) | Rnaを調節する方法 | |
| KR20230110293A (ko) | Umlilo 안티센스 전사 억제제 | |
| JPWO2000014252A1 (ja) | プロドラッグ化リボザイム |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2516425 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004265550 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006508809 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2004265550 Country of ref document: AU Date of ref document: 20040223 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004265550 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004775796 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006269530 Country of ref document: US Ref document number: 10552914 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004775796 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 10552914 Country of ref document: US |