WO2004101740A2 - Clotting factor-fc chimeric proteins to treat hemophilia - Google Patents

Clotting factor-fc chimeric proteins to treat hemophilia Download PDF

Info

Publication number
WO2004101740A2
WO2004101740A2 PCT/US2004/013940 US2004013940W WO2004101740A2 WO 2004101740 A2 WO2004101740 A2 WO 2004101740A2 US 2004013940 W US2004013940 W US 2004013940W WO 2004101740 A2 WO2004101740 A2 WO 2004101740A2
Authority
WO
WIPO (PCT)
Prior art keywords
factor
chimeric protein
clotting
constant region
immunoglobulin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/013940
Other languages
English (en)
French (fr)
Other versions
WO2004101740A3 (en
Inventor
Daniel S. Rivera
Robert T. Peters
Alan J. Bitonti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioverativ Therapeutics Inc
Original Assignee
Syntonix Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=33452235&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2004101740(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to DE602004022800T priority Critical patent/DE602004022800D1/de
Application filed by Syntonix Pharmaceuticals Inc filed Critical Syntonix Pharmaceuticals Inc
Priority to AU2004239244A priority patent/AU2004239244C1/en
Priority to CA2522859A priority patent/CA2522859C/en
Priority to PL04751357T priority patent/PL1624891T5/pl
Priority to DK04751357.7T priority patent/DK1624891T4/da
Priority to EP19157022.5A priority patent/EP3552627A1/en
Priority to EP04751357.7A priority patent/EP1624891B2/en
Priority to AT04751357T priority patent/ATE440619T1/de
Priority to SI200431290T priority patent/SI1624891T2/sl
Publication of WO2004101740A2 publication Critical patent/WO2004101740A2/en
Publication of WO2004101740A3 publication Critical patent/WO2004101740A3/en
Anticipated expiration legal-status Critical
Priority to AU2010201711A priority patent/AU2010201711C1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6437Coagulation factor VIIa (3.4.21.21)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36Blood coagulation or fibrinolysis factors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/48Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482Serine endopeptidases (3.4.21)
    • A61K38/4846Factor VII (3.4.21.21); Factor IX (3.4.21.22); Factor Xa (3.4.21.6); Factor XI (3.4.21.27); Factor XII (3.4.21.38)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6815Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/745Blood coagulation or fibrinolysis factors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/644Coagulation factor IXa (3.4.21.22)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6454Dibasic site splicing serine proteases, e.g. kexin (3.4.21.61); furin (3.4.21.75) and other proprotein convertases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21021Coagulation factor VIIa (3.4.21.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21022Coagulation factor IXa (3.4.21.22)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Definitions

  • the invention relates generally to the field of therapeutics for hemostatic disorders. More specifically, the invention relates to a chimeric protein for the treatment of a hemostatic disorder.
  • Hemostatic disorders are characterized by uncontrolled bleeding resulting from the inability or reduced ability to form fibrin clots. Hemostatic disorders can result from a genetic defect or can be acquired as a result of an unrelated medical condition (e.g., cancer and related chemotherapy, autoimmune disease) (Kasper 2000, Hemophilia 6(Supp):13; Cohen et al. 1996, Bailiere's Clinical Hematology 9(2):331 ). Typically, hemostatic disorders result from the deficiency of a specific blood clotting factor.
  • an unrelated medical condition e.g., cancer and related chemotherapy, autoimmune disease
  • hemostatic disorders include hemophilia A, which results from a deficiency in factor VIII; hemophilia B (Christmas Disease), which results from a deficiency in factor IX; and von Willebrand's disease, which results in a defect in von Willebrand's factor.
  • Von Willebrand factor circulates in association with factor VIII and stabilizes it. It mediates the adherence of platelets to each other and to injured blood vessel walls.
  • factor XI deficiency PTA deficiency
  • factor XII deficiency As well as deficiencies or structural abnormalities in fibrinogen, prothrombin, factor V, factor VII, factor X, or factor XIII (Kasper 2000, Hemophilia 6(Supp):13).
  • Clotting factors act in concert with one another in a coagulation cascade that ultimately results in the formation of a fibrin clot ( Figure 1 ). These factors can exist in a quiescent state as a proenzyme or zymogen or in an activated enzymatic state when stimulated to form a clot. Stimulation of these factors can occur by two distinct pathways, the intrinsic pathway and the extrinsic pathway.
  • the intrinsic pathway refers to those reactions that lead to clot formation through utilization of factors present only in the plasma.
  • the extrinsic pathway refers to those reactions that lead to clot formation from release of membrane bound tissue factor upon vessel endothelium disruption.
  • Factor VII participates in both pathways cleaving factor X into the activated factor Xa in conjunction with tissue factor in the extrinsic pathway or interacting with factor IXa in the intrinsic pathway. Factor VII acts down stream and independently of factors VIII and IX when acting through the extrinsic pathway, thus bypassing the need for these clotting factors. It is, therefore, an attractive therapeutic candidate for treating hemostatic disorders, especially Hemophilia A and B. (U.S. Patent No. 6,310,183; WO 01/58935).
  • Factor VII is a vitamin K-dependent plasma protein synthesized in the liver and secreted into the blood as a single-chain glycoprotein with a molecular weight of 53 kDa (Broze et al. 1980, J. Biol. Chem. 255:1242).
  • the factor VII zymogen is converted into an activated form (FVIIa) by proteolytic cleavage at a single site, Arg152-lle153, resulting in two chains, heavy (254 amino acids) and light (154 amino acids) linked by a single disulfide bond (Hagen et al. 1986, Proc. Natl. Acad. Sci. (USA) 83:2412).
  • factor VII binds to tissue factor, which then converts factor X to factor Xa.
  • Factor Xa is required to convert prothrombin to thrombin, which converts fibrinogen to fibrin as a final stage in forming a fibrin clot.
  • Factor VII undergoes post-translational modifications, including vitamin K dependent carboxylation resulting in ten ⁇ -carboxyglutamic acid residues in the N-terminal region of the molecule.
  • Other post translational modifications include sugar moiety attachment at two naturally occurring N- linked glycosylation sites at position 145 and 322, respectively, and at two naturally occurring O-linked glycosylation sites at position 52 and 60, respectively (WO 01/58935).
  • Clotting factors such as factor IX and factor VIII must be given frequently and in large doses resulting in the development of inhibitor antibodies against the clotting factor in a significant number of patients (see, e.g., Nilsson 1992, Transfusion Medicine Review 6(4):285; Cohen et al. 1996, Bailiere's Clinical Hematology 9(2):331 ).
  • One aspect of the invention provides a safer more effective treatment for hemostatic disorders. Another aspect of the invention provides for increased serum half life and increased bioavailability of therapeutics administered through non-invasive means for the treatment of hemostatic disorders thereby reducing the risk of incurring a bleeding episode, infection and injection site occlusion associated with parenteral administration. Another aspect of the invention provides therapy for hemostatic disorders with reduced risk, compared to current therapies, of developing inhibitor antibodies against the clotting factor. Yet another aspect of the invention provides for a prophylactic treatment of a hemostatic disorder.
  • the aspects of the invention provide for a chimeric protein comprised of at least one clotting factor and at least a portion of an immunoglobulin constant region, wherein the clotting factor is capable of promoting blood coagulation and/or fibrin clot formation.
  • Chimeric proteins comprising an Fc portion of an immunoglobulin are known (see, e.g., U. S. Patent Nos. 6,030,613, 6,086,875, 6,485,726, and PCT Application No. US/02/21335) and while chimeric proteins comprised of mutant clotting factors without clotting activity, and immunoglobulins have been previously described (WO 01/02439), chimeric proteins comprising a clotting factor (i.e., having clotting activity) and at least a portion of an immunoglobulin constant region have not been described.
  • Clotting factor as defined below and used herein refers to any molecule with clotting activity.
  • the invention relates to an improved chimeric protein for treating hemostatic disorders.
  • the invention provides a chimeric protein to treat a hemostatic disorder that can be administered parenterally or non-invasively (e.g., via a pulmonary, nasal, or oral route).
  • the invention thus relates to a chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • the invention relates to a method of treating a hemostatic disorder comprising administering a therapeutically effective amount of a chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • the invention relates to a method of making a chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region; said method comprising transfecting a cell with a DNA construct comprising a first DNA sequence encoding at least one clotting factor operatively linked to a second DNA sequence encoding at least a portion of an immunoglobulin.; culturing said cell under conditions such that the chimeric protein is expressed; and isolating said chimeric protein from said cell.
  • the invention relates to a nucleic acid molecule comprising a sequence encoding at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • the invention relates to a nucleic acid construct comprising a DNA sequence encoding at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • Figure 1 is a diagram showing the extrinsic and intrinsic pathway of the coagulation cascade.
  • Figure 2 is a diagram of the inactive and active forms of factor Vlla-Fc.
  • Figure 3A is the amino acid sequence of a chimeric protein comprising factor VI la and an Fc fragment of an immunoglobulin (SEQ ID NO:1).
  • Figure 3B is the amino acid sequence of an Fc fragment of an immunoglobulin (SEQ ID NO:2).
  • Figure 3C is the nucleic acid sequence of an Fc fragment of an immunoglobulin (SEQ ID NO:3).
  • Figure 3D is the nucleic acid sequence of a chimeric protein comprising factor Vila and an Fc fragment of an immunoglobulin (SEQ ID NO:4).
  • Figure 4 is a diagram of results from a STA-CLOT assay showing factor Vlla-Fc has significant clotting activity.
  • Figure 5 is a diagram showing factor Vlla-Fc binds to soluble human Fc neonatal receptor (shFcRn).
  • Figure 6 demonstrates plasma levels over time for orally administered factor Vlla-Fc in neonatal rats.
  • Figure 7 compares oral uptake in neonatal rats of Factor Vlla-Fc monomer/dimer hybrids comprising two polypeptide chains, each chain comprising at least a portion of an immunoglobulin constant region and wherein factor VII is linked to only one of the two chains versus homodimers comprising two polypeptide chains wherein both chains comprise at least a portion of an immunoglobulin constant region and both chains also comprise factor VI I.
  • Figure 8A demonstrates plasma levels over time of factor Vlla- Fc administered intravenously to minipigs, wherein the factor Vlla-Fc is a monomer/dimer hybrid comprising two polypeptide chains, each chain comprising at least a portion of an immunoglobulin constant region and wherein factor VII is linked to only one of the two chains.
  • Figure 8B demonstrates clotting activity over time of factor Vlla- Fc administered intravenously to minipigs wherein the factor Vlla-Fc is a monomer/dimer hybrid comprising two polypeptide chains, each chain comprising at least a portion of an immunoglobulin constant region and wherein factor VII is linked to only one of the two chains.
  • Figure 9A is the amino acid sequence of the chimeric protein Factor IX-Fc. Included in the sequence is the signal peptide (underlined) which is cleaved by the cell and the propeptide (bold) which is recognized by
  • Figure 9B is the nucleic acid sequence of the chimeric protein Factor IX-Fc. Included in the sequence is the signal peptide (underlined) and the propeptide (bold) which is recognized by the vitamin K-dependent Y carboxylase which modifies the Factor IX to achieve full activity. The translated sequence is subsequently cleaved by PACE to yield mature Factor IX-Fc.
  • Affinity tag means a molecule attached to a second molecule of interest, capable of interacting with a specific binding partner for the purpose of isolating or identifying said second molecule of interest.
  • Analogs of, or proteins or peptides or substantially identical to the chimeric proteins of the invention, as used herein, means that a relevant amino acid sequence of a protein or a peptide is at least 70%, 75%, 80%,
  • sequences may be variants derived from various species, or they may be derived from the given sequence by truncation, deletion, amino acid substitution or addition. Percent identity between two amino acid sequences is determined by standard alignment algorithms such as, for example, Basic Local Alignment Tool (BLAST) described in Altschul et al. (1990) J. Mol. Biol., 215:403-410, the algorithm of Needleman et al. (1970) J. Mol. Biol., 48:444-453; the algorithm of Meyers et al. (1988) Comput. Appl.
  • BLAST Basic Local Alignment Tool
  • Bioavailability means the extent and rate at which a substance is absorbed into a living system or is made available at the site of physiological activity.
  • a chimeric protein refers to any protein comprised of a first amino acid sequence derived from a first source, bonded, covalently or non-covalently, to a second amino acid sequence derived from a second source, wherein the first and second source are not the same.
  • a first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity.
  • a chimeric protein can include for example, a protein derived from at least 2 different biological sources.
  • a biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g. a genomic or cDNA sequence, a plasmid or viral vector, a native virion or a mutant or analog, as further described herein, of any of the above).
  • a synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g. solid phase synthesis of amino acid sequences).
  • a chimeric protein can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source.
  • Clotting factor means any molecule, or analog thereof, naturally occurring or recombinantly produced which prevents or decreases the duration of a bleeding episode in a subject with a hemostatic disorder. In other words, it means any molecule having clotting activity.
  • Clotting activity means the ability to participate in a cascade of biochemical reactions that culminates in the formation of a fibrin clot and/or reduces the severity, duration or frequency of hemorrhage or bleeding episode.
  • DNA construct means a DNA molecule, or a clone of such a molecule, either single- or double-stranded that has been modified through human intervention to contain segments of DNA combined in a manner that as a whole would not otherwise exist in nature.
  • DNA constructs contain the information necessary to direct the expression of polypeptides of interest.
  • DNA constructs can include promoters, enhancers and transcription terminators.
  • DNA constructs containing the information necessary to direct the secretion of a polypeptide will also contain at least one secretory signal sequence.
  • a fragment refers to a peptide or polypeptide comprising an amino acid sequence of at least 2 contiguous amino acid residues, of at least 5 contiguous amino acid residues, of at least 10 contiguous amino acid residues, of at least 15 contiguous amino acid residues, of at least 20 contiguous amino acid residues, of at least 25 contiguous amino acid residues, of at least 40 contiguous amino acid residues, of at least 50 contiguous amino acid residues, of at least 100 contiguous amino acid residues, or of at least 200 contiguous amino acid residues or any deletion or truncation of a protein.
  • Hemostasis means the stoppage of bleeding or hemorrhage; or the stoppage of blood flow through a blood vessel or body part.
  • Hemostatic disorder means a genetically inherited or acquired condition characterized by a tendency to hemorrhage, either spontaneously or as a result of trauma, due to an impaired ability or inability to form a fibrin clot.
  • Linked refers to a first nucleic acid sequence covalently joined to a second nucleic acid sequence.
  • the first nucleic acid sequence can be directly joined or juxtaposed to the second nucleic acid sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • Linked as used herein can also refer to a first amino acid sequence covalently joined to a second amino acid sequence.
  • the first amino acid sequence can be directly joined or juxtaposed to the second amino acid sequence or alternatively an intervening sequence can covalently join the first amino acid sequence to the second amino acid sequence.
  • Linked can also refer to a first amino acid sequence non- covalently joined to a second amino acid sequence.
  • Linked as used herein can also refer to a first amino acid sequence covalently joined to a nucleic acid sequence or a small organic or inorganic molecule.
  • Operatively linked means a first nucleic acid sequence linked to a second nucleic acid sequence such that both sequences are capable of being expressed as a biologically active polypeptide.
  • a small inorganic molecule means a molecule containing no carbon atoms and being no larger than 50 kD.
  • a small organic molecule means a molecule containing at least one carbon atom and being no larger than 50 kD.
  • High stringency includes conditions readily determined by the skilled artisan based on, for example, the length of the DNA. Generally, such conditions are defined as hybridization conditions as
  • temperature and wash solution salt concentration can be adjusted as necessary according to factors such as the length of the probe.
  • Moderate stringency include conditions that can be readily determined by those having ordinary skill in the art based on, for example, the length of the DNA.
  • the basic conditions are set forth by Sambrook et al. Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1 , pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), and include use of a prewashing solution for the nitrocellulose filters 5X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6X SSC at 42°C (or other similar hybridization solution, such as Stark's solution, in 50%
  • Polypeptide refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term does not exclude post-expression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation, pegylation, addition of a lipid moiety, or the addition of any organic or inorganic molecule. Included within the definition, are for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids) and polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
  • Treat, treatment, treating, as used herein means any of the following: the reduction in severity of a hemostatic disorder; the prophylaxis of one or more symptoms associated with a hemostatic disorder, e.g., a bleeding episode; the reduction in the duration of a disease course of a hemostatic disorder; the amelioration of one or more symptoms associated with a hemostatic disorder; the reduction in duration of a bleeding episode associated with a hemostatic disorder; the reduction in the titer of an inhibitor antibody against a clotting factor; the provision of beneficial effects to a subject with a hemostatic disorder, without necessarily curing the hemostatic disorder.
  • the invention relates generally to improved therapeutics for hemostatic disorders.
  • the invention thus relates to a chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • the chimeric proteins of the invention have increased stability and other improved properties when compared to known therapeutic agents having clotting activity. They can also be administered parenterally or non- invasively. Accordingly, the invention provides for improved methods for administering therapeutic agents having clotting activity. While clotting factors presently are generally administered subcutaneously, intramuscularly or intravenously, the chimeric proteins of the invention can be administered using less invasive means such as oral administration, nasal administration, or pulmonary administration. In a specific embodiment, the chimeric proteins of the invention are useful in the prophylactic treatment of hemostatic disorders.
  • the invention also relates generally to improved methods of making therapeutic clotting factors.
  • the invention relates to recombinant methods of producing therapeutic clotting factors with enhanced expression and improved yields.
  • the invention thus relates to methods of making chimeric proteins comprising at least one clotting factor and at least a portion of an immunoglobulin constant region by transfecting a cell with a DNA construct, said construct comprising a DNA sequence encoding at least one clotting factor and a DNA sequence encoding at least a portion of an immunoglobulin constant region; culturing said cell under conditions such that the chimeric protein is expressed by said cell; and isolating said chimeric protein.
  • the invention relates generally to chimeric proteins comprising at least one clotting factor, at least a portion of an immunoglobulin constant region, and optionally a linker.
  • the clotting factor can be linked covalently, or non-covalently with the portion of an immunoglobulin constant region.
  • the portion of an immunoglobulin constant region will have both an N, or an amino terminus, and a C, or carboxy terminus.
  • the chimeric protein of the invention may have a clotting factor linked to the N terminus of the portion of an immunoglobulin constant region.
  • the chimeric protein can optionally comprise at least one linker, thus the clotting factor does not have to be directly linked to the portion of an immunoglobulin constant region.
  • the linker can intervene in between the clotting factor and the portion of an immunoglobulin constant region.
  • the linker can be linked to the N terminus of the portion of an immunoglobulin constant region, or the C terminus of a portion of an immunoglobulin constant region.
  • the linker can be linked to the N terminus of the clotting factor.
  • the invention thus relates to a chimeric protein comprised of at least one clotting factor (X), optionally, a linker (L), and at least a portion of an immunoglobulin constant region (F).
  • a chimeric protein comprised of the formula
  • the invention relates to a chimeric protein comprising the amino acid sequence of Figure 3A (SEQ ID NO:1).
  • the chimeric protein of the invention includes monomers, dimers, as well as higher order multimers.
  • the chimeric protein is a monomer comprising one clotting factor and one portion of an immunoglobulin constant region.
  • the chimeric protein is a dimer comprising two clotting factors and two portions of an immunoglobulin.
  • the two clotting factors are the same.
  • the two clotting factors are different.
  • the two portions of an immunoglobulin are the same.
  • the two portions of an immunoglobulin are different.
  • the chimeric protein is a monomer/dimer hybrid wherein the chimeric protein has a dimeric aspect in that it is comprised of at least a portion of two immunoglobulin constant region polypeptides and a monomeric aspect in that it is comprised of only one clotting factor linked to one of the two immunoglobulin.
  • the invention thus relates to a chimeric protein comprising a first chain and a second chain, wherein said first chain comprises at least a portion of an immunoglobulin constant region linked to a clotting factor and said second chain comprises at least a portion of an immunoglobulin constant region without a clotting factor linked to it.
  • Such chimeric proteins may be described using the formulas set forth in Table 1 , where I, L, and F are as described above, and where (') indicates a different molecule than without (') and wherein (:) indicates a non- peptide bond
  • Derivatives and analogs of the chimeric proteins of the invention, antibodies against the chimeric proteins of the invention and antibodies against binding partners of the chimeric proteins of the invention are all contemplated, and can be made by altering their amino acid sequences by substitutions, additions, and/or deletions/truncations or by introducing chemical modifications that result in functionally equivalent molecules. It will be understood by one of ordinary skill in the art that certain amino acids in a sequence of any protein may be substituted for other amino acids without adversely affecting the activity of the protein.
  • the derivative is functionally active, i.e., capable of exhibiting one or more activities associated with the chimeric proteins of the invention, e.g., clot formation, activation of a clotting factor.
  • Activity can be measured by assays known in the art, e.g., StaCLot FVIIa-rTF assay (Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11 :S159) prothrombin time (PT assay) or a APTT assay for factor IX
  • Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs (see Table 2). Furthermore, various amino acids are commonly substituted with neutral amino acids, e.g., alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine (see, e.g., MacLennan et al. (1998) Ada Physiol. Scand. Suppl. 643:55-67; Sasaki et al. (1998) Adv. Biophys. 35:1-24). TABLE 2
  • the chimeric proteins of this invention include at least one clotting factor.
  • the clotting factor can include any molecule that has clotting activity or activates a molecule with clotting activity.
  • the clotting factor can be comprised of a polypeptide, a small organic molecule, or a small inorganic molecule.
  • the clotting factor can be a mutated clotting factor or an analog of a clotting factor so long as it maintains at least some clotting activity.
  • the clotting factor can be, as an example, but not as a limitation factor VIII, including B domain deleted factor VIII, factor IX (U.S. Patent No.
  • the clotting factor is factor Vll or factor Vila. In another embodiment, the clotting factor is a mutated factor Vll or Vila (see, e.g., Persson, et al. 2001 , Proc. Natl. Acad. Sci. USA 98:13583; U.S. Patent application Serial No. 10/109498).
  • the clotting factor can be a factor that participates in the extrinsic pathway.
  • the clotting factor can be a factor that participates in the intrinsic pathway.
  • the clotting factor can be a factor that participates in both the extrinsic and intrinsic pathway.
  • the clotting factor can be a human clotting factor or a non- human clotting factor, e.g., derived from a non-human primate, a pig, or any mammal.
  • the clotting factor can be chimeric clotting factor, e.g., the clotting factor can comprise a portion of a human clotting factor and a portion of a porcine, or any non-human clotting factor or a portion of a first non-human clotting factor and a portion of a second non-human clotting factor.
  • the clotting factor can be an activated clotting factor.
  • the clotting factor can be an inactive form of a clotting factor, e.g., a zymogen.
  • the inactive clotting factor can undergo activation subsequent to being linked to at least a portion of an immunoglobulin constant region.
  • the inactive clotting factor can be activated subsequent to administration to a subject.
  • the inactive clotting factor can be activated prior to administration.
  • the chimeric proteins of this invention include at least a portion of an immunoglobulin constant region.
  • Immunoglobulins are comprised of four protein chains that associate covalently — two heavy chains and two light chains. Each chain is further comprised of one variable region and one constant region.
  • the heavy chain constant region is comprised of 3 or 4 constant region domains (e.g., CH1, CH2, CH3, CH4). Some isotypes can also include a hinge region.
  • the portion of an immunoglobulin constant region can be a portion of an immunoglobulin constant region obtained from any mammal.
  • the portion of an immunoglobulin constant region can include, but is not limited to, a portion of a human immunoglobulin constant region, a non-human primate immunoglobulin constant region, a bovine immunoglobulin constant region, a porcine immunoglobulin constant region, a murine immunoglobulin constant region, an ovine immunoglobulin constant region or a rat immunoglobulin constant region.
  • the portion of an immunoglobulin constant region can include the entire heavy chain constant region, or a fragment or analog thereof.
  • a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a hinge region.
  • a heavy chain constant region can comprise a CH1 domain, a CH2 domain, a CH3 domain, and/or a CH4 domain.
  • the immunoglobulin can be produced recombinantly or synthetically.
  • the immunoglobulin can be isolated from a cDNA library.
  • the immunoglobulin can be isolated from a phage library (see McCafferty et al. 1990, Nature 348:552).
  • the immunoglobulin can be obtained by gene shuffling of known sequences (Mark et al. 1992, Bio/Technol. 10:779).
  • the immunoglobulin can be isolated by in vivo recombination (Waterhouse et al. 1993, Nucl. Acid Res. 21/2265).
  • the immunoglobulin can be a humanized immunoglobulin (Jones et al. 1986, Nature 332:323).
  • the portion of an immunoglobulin constant region can include a portion of an IgG, an IgA, an IgM, an IgD, an IgE.
  • the immunoglobulin is an IgG.
  • the immunoglobulin is lgG1.
  • the immunoglobulin is lgG2.
  • the portion of an immunoglobulin constant region can include an Fc fragment.
  • An Fc fragment can be comprised of the CH2 and CH3 domains of an immunoglobulin and the hinge region of the immunoglobulin.
  • the Fc fragment can be the Fc fragment of an lgG1 , an lgG2, an lgG3 or an lgG4.
  • the immunoglobulin is an Fc fragment of an lgG1.
  • the immunoglobulin is an Fc fragment of an lgG2.
  • the portion of an immunoglobulin constant region is comprised of the amino acid sequence of SEQ ID NO:2 ( Figure 3B) or an analog thereof.
  • the immunoglobulin is comprised of a protein, or fragment thereof, encoded by the nucleic acid sequence of SEQ ID NO:3 ( Figure 3C).
  • the portion of an immunoglobulin constant region can include an Fc variant.
  • Fc variant refers to a molecule or sequence that is modified from a native Fc but still comprises a binding site for the salvage receptor, FcRn (WO 97/34631).
  • Native refers to an Fc that has not been modified by a human.
  • WO 96/32478 describes exemplary Fc variants, as well as interaction with the salvage receptor.
  • the term "Fc variant” comprises a molecule or sequence that is humanized from a non-human native Fc.
  • a native Fc comprises sites that may be removed because they provide structural features or biological activity that are not required for the fusion molecules of the present invention.
  • Fc variant comprises a molecule or sequence that lacks one or more native Fc sites or residues that affect or are involved in (1 ) disulfide bond formation, (2) incompatibility with a selected host cell (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to an Fc receptor other than a salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • an immunoglobulin constant region is an neonatal Fc receptor (FcRn) binding partner.
  • FcRn binding partner is any molecule that can be specifically bound by the FcRn receptor with consequent active transport by the FcRn receptor of the FcRn binding partner.
  • the FcRn receptor has been isolated from several mammalian species including humans. The sequences of the human FcRn, rat FcRn, and mouse FcRn are known (Story et al. 1994, J. Exp. Med. 180:2377).
  • the FcRn receptor binds IgG (but not other immunoglobulin classes such as IgA, IgM, IgD, and IgE) at relatively low pH, actively transports the IgG transcellularly in a luminal to serosal direction, and then releases the IgG at relatively higher pH found in the interstitial fluids. It is expressed in adult epithelial tissue (U.S. Patent Nos. 6,030,613 and 6,086,875) including lung and intestinal epithelium (Israel et al. 1997, Immunology 92:69) renal proximal tubular epithelium (Kobayashi et al. 2002, Am. J. Physiol. Renal Physiol. 282:F358) as well as nasal epithelium, vaginal surfaces, and biliary tree surfaces.
  • IgG immunoglobulin classes such as IgA, IgM, IgD, and IgE
  • FcRn binding partners of the present invention encompass any molecule that can be specifically bound by the FcRn receptor including whole IgG, the Fc fragment of IgG, and other fragments that include the complete binding region of the FcRn receptor.
  • the region of the Fc portion of IgG that binds to the FcRn receptor has been described based on X-ray crystallography (Burmeister et al. 1994, Nature 372:379).
  • the major contact area of the Fc with the FcRn is near the junction of the CH2 and CH3 domains. Fc-FcRn contacts are all within a single Ig heavy chain.
  • the FcRn binding partners include whole IgG, the Fc fragment of IgG, and other fragments of IgG that include the complete binding region of FcRn.
  • the major contact sites include amino acid residues 248, 250-257, 272, 285, 288, 290- 291 , 308-311 , and 314 of the CH2 domain and amino acid residues 385-387, 428, and 433-436 of the CH3 domain.
  • References made to amino acid numbering of immunoglobulins or immunoglobulin fragments, or regions, are all based on Kabat et al. 1991 , Sequences of Proteins of Immunological Interest, U.S. Department of Public Health, Bethesda, MD.
  • the Fc region of IgG can be modified according to well recognized procedures such as site directed mutagenesis and the like to yield modified IgG or Fc fragments or portions thereof that will be bound by FcRn.
  • modifications include modifications remote from the FcRn contact sites as well as modifications within the contact sites that preserve or even enhance binding to the FcRn.
  • the effect of this mutation is to reduce immunogenicity, thereby enhancing circulating half life of the FcRn binding partner, and to render the FcRn binding partner incapable of binding to Fc ⁇ RI, Fc ⁇ RIIA, Fc ⁇ RIIB, and Fc ⁇ RIIIA, without compromising affinity for FcRn (Routledge et al. 1995, Transplantation 60:847; Friend et al. 1999, Transplantation 68:1632; Shields et al. 1995, J. Biol. Chem. 276:6591). Additionally, at least three human Fc gamma receptors appear to recognize a binding site on IgG within the lower hinge region, generally amino acids 234- 237.
  • Another example of new functionality and potential decreased immunogenicity may arise from mutations of this region, as for example by replacing amino acids 233-236 of human lgG1 "ELLG” to the corresponding sequence from lgG2 "PVA” (with one amino acid deletion). It has been shown that Fc ⁇ RI, Fc ⁇ RII, and Fc ⁇ RIII, which mediate various effector functions will not bind to lgG1 when such mutations have been introduced (Ward and Ghetie 1995, Therapeutic Immunology 2:77 and Armour et al.1999, Eur. J. Immunol. 29:2613). As a further example of new functionality arising from mutations described above affinity for FcRn may be increased beyond that of wild type in some instances.
  • This increased affinity may reflect an increased “on” rate, a decreased “off' rate or both an increased “on” rate and a decreased “off” rate.
  • Mutations believed to impart an increased affinity for FcRn include T256A, T307A, E380A, and N434A (Shields et al. 2001 , J Biol. Chem. 276:6591).
  • the FcRn binding partner is a polypeptide including the sequence PKNSSMISNTP and optionally further including a sequence selected from HQSLGTQ, HQNLSDGK, HQNISDGK, or VISSHLGQ (U.S. Patent No. 5,739,277).
  • FcRn receptors can bind a single Fc molecule. Crystallographic data suggest that each FcRn molecule binds a single polypeptide of the Fc homodimer. Linking the FcRn binding partner, e.g., an Fc fragment of an IgG, to a clotting factor thus provides a means of delivering the clotting factor orally or as an aerosol administered nasally, via an ocular route or via a pulmonary route.
  • FcRn binding partner e.g., an Fc fragment of an IgG
  • portions of an immunoglobulin constant region for use in the chimeric protein of the invention can include mutants or analogs thereof, or can include chemically modified immunoglobulin constant regions or fragments thereof (e.g. pegylation) (see, e.g., Aslam and Dent 1998, Bioconjugation: Protein Coupling Techniques For the Biomedical Sciences Macmilan Reference, London).
  • a mutant can provide for enhanced binding of an FcRn binding partner for the FcRn.
  • peptide mimetics of at least a portion of an immunoglobulin constant region e.g., a peptide mimetic of an Fc fragment or a peptide mimetic of an FcRn binding partner.
  • the peptide mimetic is identified using phage display (See, e.g., McCafferty et al. 1990, Nature 348:552, Kang et al. 1991 , Proc. Natl. Acad. Sci. USA 88:4363; EP 0 589 877 B1).
  • the chimeric protein of the invention can optionally comprise at least one linker molecule.
  • the linker is comprised of amino acids.
  • the linker can comprise 1-5 amino acids, 1-10 amino acids, 1- 20 amino acids, 10-50 amino acids, 50-100 amino acids, 100-200 amino acids.
  • the linker can comprise the sequence G n .
  • the linker can comprise the sequence (GGS) n (SEQ ID NO.: 5). In each instance, n may be an integer, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • linkers include, but are not limited to, GGG (SEQ ID NO.: 6), SGGSGGS(SEQ ID NO.: 7), GGSGGSGGSGGSGGG (SEQ ID NO.: 8), and GGSGGSGGSGGSGGSGGS (SEQ ID NO.: 9),.
  • the linker does not eliminate the clotting activity of the clotting factor.
  • the linker enhances the clotting activity of the clotting factor, e.g., by diminishing the effects of steric hindrance and making the clotting factor more accessible to its target binding site, e.g., another factor in the clotting cascade.
  • the invention relates to a nucleic acid construct comprising a nucleic acid sequence encoding the chimeric proteins of the invention, said nucleic acid sequence comprising a first nucleic acid sequence encoding, for example at least one clotting factor, operatively linked to a second nucleic acid sequence encoding at least a portion of an immunoglobulin constant region.
  • the nucleic acid sequence can also include additional sequences or elements known in the art (e.g. promoters, enhancers, poly A sequences, signal sequence).
  • the nucleic acid sequence can optionally include a sequence encoding a linker placed between the nucleic acid sequence encoding at least one clotting factor and the portion of an immunoglobulin.
  • the nucleic acid sequence can optionally include a linker sequence placed before or after the nucleic acid sequence encoding at least one clotting factor and the portion of an immunoglobulin.
  • the nucleic acid construct is comprised of DNA. In another embodiment, the nucleic acid construct is comprised of RNA.
  • the nucleic acid construct can be a vector, e.g., a viral vector or a plasmid. Examples of viral vectors include, but are not limited to adeno virus vector, an adeno associated virus vector or a murine leukemia virus vector. Examples of plasmids include but are not limited to, e.g., pUC and pGEX.
  • the nucleic acid construct comprises the nucleic acid sequence of Figure 3D (SEQ ID NO:4).
  • a DNA sequence can vary from that shown in SEQ ID NOS:3 or 4 and still encode a polypeptide having the amino acid sequence of SEQ ID NOS:2 or 1 respectively.
  • Such variant DNA sequences can result from silent mutations (e.g. occurring during PCR amplification), or can be the product of deliberate mutagenesis of a native sequence.
  • the invention thus provides isolated DNA sequences encoding polypeptides of the invention, selected from: (a) DNA comprising the nucleotide sequence of SEQ ID NO:3 or 4; (b) DNA encoding the polypeptide of SEQ ID NO:1 or 2; (c) DNA capable of hybridization to a DNA of (a) or (b) under conditions of moderate stringency and which encodes polypeptides of the invention; (d) DNA capable of hybridization to a DNA of (a) or (b) under conditions of high stringency and which encodes polypeptides of the invention, and (e) DNA which is degenerate as a result of the genetic code to a DNA defined in (a), (b), (c), or (d) and which encode polypeptides of the invention.
  • polypeptides encoded by such DNA sequences are encompassed by the invention.
  • the nucleic acid molecules of the invention also comprise nucleotide sequences that are at least 80% identical to a native sequence. Also contemplated are embodiments in which a nucleic acid molecule comprises a sequence that is at least 90% identical, at least 95% identical, at least 98% identical, at least 99% identical, or at least 99.9% identical to a native sequence.
  • the percent identity may be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. 1984, Nucl. Acids Res. 12:387, and available from the University of Wisconsin Genetics Computer Group (UWGCG).
  • the preferred default parameters for the GAP program include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess 1986, Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds., 1979, Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.
  • Other programs used by one skilled in the art of sequence comparison may also be used.
  • Chimeric proteins comprising at least a portion of an immunoglobulin constant region and a clotting factor can be synthesized using techniques well known in the art.
  • the chimeric proteins of the invention can be synthesized recombinantly in cells (see, e.g., Sambrook et al. 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. and Ausubel et al. 1989, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, N.Y.).
  • DNA sequences encoding immunoglobulins, or fragments thereof, or clotting factors, or fragments thereof may be cloned from a variety of genomic or cDNA libraries known in the art.
  • the techniques for isolating such DNA sequences using probe-based methods are conventional techniques and are well known to those skilled in the art.
  • Probes for isolating such DNA sequences may be based on published DNA sequences (see, for example, Hieter et al. 1980, Ce// 22: 197-207).
  • the polymerase chain reaction (PCR) method disclosed by Mullis et al. (U.S. Patent No. 4,683,195) and Mullis (U.S. Patent No. 4,683,202) may be used.
  • DNA sequences encoding immunoglobulins, or fragments thereof, or clotting factors can be obtained from vectors known in the art to contain immunoglobulins, or fragments thereof, or clotting factors.
  • a polynucleotide sequence encoding the chimeric protein is inserted into an appropriate expression vehicle, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence, or in the case of an RNA viral vector, the necessary elements for replication and translation.
  • the nucleic acid encoding the chimeric protein is inserted into the vector in proper reading frame.
  • the nucleic acid can also encode for a propeptide clotting factor which is modified by the cell to yield the mature chimeric protein of the invention.
  • the propeptide clotting factor is recognized by a vitamin K-dependent Y carboxylase which modifies the propeptide clotting factor to achieve full activity (e.g. factor Vll, factor IX, factor X, prothrombin).
  • a vitamin K-dependent Y carboxylase which modifies the propeptide clotting factor to achieve full activity
  • the propetide sequence is subsequently cleaved by an endoprotease, e.g., paired basic amino acid cleaving enzyme (PACE), or any PACE family member, such as PCSK1-9, including truncated versions thereof, or its yeast equivalent Kex2 from S. cerevisiae and truncated versions of Kex2 (see, e.g., U.S. Patent Nos. 5,077,204; 5,162,220; 5,234,830; 5,885,821 ; 6,329,176 (Kex2 1-675)).
  • PACE paired basic amino acid cleaving enzyme
  • the expression vehicle is then transfected into a suitable target cell which will express the protein, e.g., a chimeric protein.
  • Transfection techniques known in the art include, but are not limited to, calcium phosphate precipitation (Wigler et al. 1978, Cell 14:725) and electroporation (Neumann et al. 1982, EMBO, d. 1 :841 ).
  • a variety of host-expression vector systems may be utilized to express the chimeric proteins described herein in eukaryotic cells.
  • the eukaryotic cell is an animal cell, including mammalian cells (e.g. CHO, BHK, Cos, HeLa cells).
  • the DNA encoding the chimeric protein may also code for a signal sequence that will permit the chimeric protein to be secreted.
  • a signal sequence that will permit the chimeric protein to be secreted.
  • the signal sequence is cleaved by the cell to form the mature chimeric protein.
  • Various signal sequences are known in the art e.g., native factor Vll signal sequence, native factor IX signal sequence and the mouse lg ⁇ light chain signal sequence.
  • the chimeric protein can be recovered by lysing the cells.
  • the chimeric protein of the invention can be synthesized in a transgenic animal, such as a rodent, goat, sheep, pig, or cow.
  • transgenic animals refers to non-human animals that have incorporated a foreign gene into their genome. Because this gene is present in germline tissues, it is passed from parent to offspring. Exogenous genes are introduced into single-celled embryos (Brinster et al. 1985, Proc. Natl. Acad. Sci. USA 82:4438). Methods of producing transgenic animals are known in the art, including transgenics that produce immunoglobulin molecules (Wagner et al. 1981 , Proc. Natl. Acad. Sci.
  • the expression vectors can encode for tags that permit for easy purification or identification of the recombinantly produced protein.
  • tags include, but are not limited to, vector pUR278 (Ruther et al. 1983, EMBO J. 2:1791 ) in which the chimeric protein described herein coding sequence may be ligated into the vector in frame with the lac z coding region so that a hybrid protein is produced;
  • pGEX vectors may be used to express proteins with a glutathione S-transferase (GST) tag. These proteins are usually soluble and can easily be purified from cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the vectors include cleavage sites (e.g. PreCission ProteaseTM (Pharmacia, Peapack, N.J.)) for easy removal of the tag after purification.
  • the polynucleotide can be designed to encode multiple units of the chimeric protein of the invention separated by enzymatic cleavage sites.
  • the resulting polypeptide can be cleaved (e.g. by treatment with the appropriate enzyme) in order to recover the polypeptide units.
  • This can increase the yield of polypeptides driven by a single promoter.
  • the translation of each polypeptide encoded by the mRNA is directed internally in the transcript; e.g., by an internal ribosome entry site, IRES.
  • the polycistronic construct directs the transcription of a single, large polycistronic mRNA which, in turn, directs the translation of multiple, individual polypeptides. This approach eliminates the production and enzymatic processing of polyproteins and may significantly increase yield of a polypeptide driven by a single promoter.
  • Vectors used in transformation will usually contain a selectable marker used to identify transformants.
  • this can include an antibiotic resistance gene such as ampicillin, blasticidin or kanamycin.
  • Selectable markers for use in cultured mammalian cells include genes that confer resistance to drugs, such as neomycin, hygromycin, and methotrexate.
  • the selectable marker may be an amplifiable selectable marker.
  • One amplifiable selectable marker is the dihydrofolate reductase gene (DHFR gene).
  • Another amplifiable marker is the DHFRr cDNA (Simonsen and Levinson 1983, Proc. Natl. Acad. Sci. (USA) 80:2495). Selectable markers are reviewed by Thilly (Mammalian Cell Technology, Butterworth Publishers, Stoneham, Mass.) and the choice of selectable markers is well within the level of ordinary skill in the art.
  • Selectable markers may be introduced into the cell on a separate plasmid at the same time as the gene of interest, or they may be introduced on the same plasmid. If on the same plasmid, the selectable marker and the gene of interest may be under the control of different promoters or the same promoter, the latter arrangement producing a dicistronic message. Constructs of this type are known in the art (for example, U.S. Pat. No. 4,713,339).
  • the expression elements of the expression systems vary in their strength and specificities.
  • any of a number of suitable transcription and translation elements including constitutive and inducible promoters, may be used in the expression vector.
  • inducible promoters such as pL of bacteriophage ⁇ , plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used;
  • promoters such as the baculovirus polyhedron promoter may be used;
  • promoters derived from the genome of plant cells e.g.
  • heat shock promoters the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g. the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g. metallothionein promoter) or from mammalian viruses (e.g.
  • the adenovirus late promoter may be used; when generating cell lines that contain multiple copies of expression product, SV40-, BPV- and EBV-based vectors may be used with an appropriate selectable marker.
  • the expression of sequences encoding linear or non-cyclized forms of the chimeric proteins of the invention may be driven by any of a number of promoters.
  • viral promoters such as the 35S RNA and 19S RNA promoters of CaMV (Brisson et al. 1984, Nature 310:511-514), or the coat protein promoter of TMV (Takamatsu et al. 1987, EMBO d. 3:17-311 ) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al. 1984, EMBO J. 3:1671-1680; Broglie et al.
  • Autographa californica nuclear poiyhidrosis virus (AcNPV) is used as a vector to express the foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • a coding sequence may be cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of an AcNPV promoter (for example, the polyhedron promoter). Successful insertion of a coding sequence will result in inactivation of the polyhedron gene and production of non-occluded recombinant virus (i.e. virus lacking the proteinaceous coat coded for by the polyhedron gene).
  • a number of viral based expression systems may be utilized.
  • a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g.
  • region E1 or E3 will result in a recombinant virus that is viable and capable of expressing a polypeptide peptide in infected hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. (USA) 81 :3655- 3659).
  • the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. (USA) 79:7415; Mackett et al. 1984, J. Virol. 49:857; Panicali et al. 1982, Proc. Natl. Acad. Sci. (USA) 79:4927).
  • a coding sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g. region E1 or E3) will result in a recombinant virus that is viable and capable of expressing a polypeptide in infected hosts (see, e.g., Logan & Shenk 1984, Proc. Natl. Acad. Sci. (USA) 81 :3655-3659).
  • the vaccinia 7.5 K promoter may be used (see, e.g., Mackett et al. 1982, Proc. Natl. Acad. Sci. (USA) 79:7415-7419; Mackett et al. 1984, J. Virol. 49:857- 864; Panicali et al. 1982, Proc. Natl. Acad. Sci. (USA) 79:4927).
  • Host cells containing DNA constructs of the chimeric protein are grown in an appropriate growth medium.
  • appropriate growth medium means a medium containing nutrients required for the growth of cells. Nutrients required for cell growth may include a carbon source, a nitrogen source, essential amino acids, vitamins, minerals and growth factors.
  • the media contains vitamin K which is necessary for a cellular y carboxylase to confer activity upon a recombinantly produced clotting factor, e.g., factor Vll.
  • the media can contain bovine calf serum or fetal calf serum.
  • the growth medium will generally select for cells containing the DNA construct by, for example, drug selection or deficiency in an essential nutrient, which is complemented by the selectable marker on the DNA construct or co-transfected with the DNA construct.
  • Cultured mammalian cells are generally grown in commercially available serum-containing or serum-free media (e.g. MEM, DMEM). Selection of a medium appropriate for the particular cell line used is within the level of ordinary skill in the art.
  • the recombinantly produced chimeric protein of the invention can be isolated from the culture media using procedures well-established in the art (e.g., affinity chromatography, size exclusion chromatography, ion exchange chromatography).
  • the chimeric protein of the invention can be isolated from the culture media by column chromatography, e.g., a protein A column, or by ion exchange chromatography.
  • column chromatography e.g., a protein A column, or by ion exchange chromatography.
  • the chromatographic separation can contribute to the activation of the chimeric protein of the invention, e.g., by converting factor Vll to factor Vila.
  • the culture medium from appropriately grown transformed or transfected host cells is separated from the cell material, and the presence of chimeric proteins is demonstrated.
  • One method of detecting the chimeric proteins is by the binding of the chimeric proteins or portions of the chimeric proteins to a specific antibody recognizing the chimeric protein of the invention (e.g., an anti-Fc antibody).
  • An anti-chimeric protein antibody may be a monoclonal or polyclonal antibody raised against the chimeric protein in question.
  • the chimeric protein can contain a portion of an immunoglobulin constant region.
  • Antibodies recognizing the constant region of many immunoglobulins are known in the art and are commercially available.
  • An antibody can be used to perform an ELISA or a western blot to detect the presence of the chimeric protein of the invention.
  • chimeric proteins of the invention have many uses as will be recognized by one skilled in the art, including, but not limited to methods of treating a subject having a hemostatic disorder and methods of treating a subject in need of a general hemostatic agent.
  • the invention relates to a method of treating a subject having a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises at least a portion of an immunoglobulin constant region and at least one clotting factor.
  • the chimeric protein of the invention treats or prevents a hemostatic disorder by promoting the formation of a fibrin clot.
  • the chimeric protein of the invention can activate any member of a coagulation cascade.
  • the clotting factor can be a participant in the extrinsic pathway, the intrinsic pathway or both. In one embodiment, the clotting factor is factor Vll or factor Vila. Factor Vila can activate factor X which interacts with factor Va to cleave prothrombin to thrombin, which in turn cleaves fibrinogen to fibrin.
  • the chimeric protein of the invention can be used to treat any hemostatic disorder.
  • hemostatic disorders that may be treated by administration of the chimeric protein of the invention include, but are not limited to, hemophilia A, hemophilia B, von Willebrand's disease, factor XI deficiency (PTA deficiency), factor XII deficiency, as well as deficiencies or structural abnormalities in fibrinogen, prothrombin, factor V, factor Vll, factor X, or factor XIII.
  • the hemostatic disorder is an inherited disorder.
  • the subject has hemophilia A, and the chimeric protein comprises factor VIII or factor Villa.
  • the subject has hemophilia A and the chimeric protein comprises factor Vll or factor Vila.
  • the subject has hemophilia B and the chimeric protein comprises factor IX or factor IXa.
  • the subject has hemophilia B and the chimeric protein comprises factor Vll or factor Vila.
  • the subject has inhibitory antibodies to factor VIII or factor Villa and the chimeric protein comprises factor Vll or factor Vila.
  • the subject has inhibitory antibodies against factor IX or factor IXa and the chimeric protein comprises factor Vll or factor Vila.
  • the chimeric protein of the invention can be used to prophylactically treat a subject with a hemostatic disorder.
  • the chimeric protein of the invention can be used to treat an acute bleeding episode in a subject with a hemostatic disorder.
  • the hemostatic disorder is the result of a deficiency in a clotting factor, e.g., factor IX, factor VIII, factor Vll.
  • a clotting factor e.g., factor IX, factor VIII, factor Vll.
  • the hemostatic disorder can be the result of a defective clotting factor, e.g., von Willebrand's factor.
  • the hemostatic disorder can be an acquired disorder.
  • the acquired disorder can result from an underlying secondary disease or condition.
  • the unrelated condition can be, as an example, but not as a limitation, cancer, an auto-immmune disease, or pregnancy.
  • the acquired disorder can result from old age or from medication to treat an underlying secondary disorder (e.g. cancer chemotherapy).
  • the invention also relates to methods of treating a subject that does not have a hemostatic disorder or a secondary disease or condition resulting in acquisition of a hemostatic disorder.
  • the invention thus relates to a method of treating a subject in need of a general hemostatic agent comprising administering a therapeutically effective amount of at least one chimeric protein, wherein the chimeric protein comprises at least a portion of an immunoglobulin constant region and at least one clotting factor.
  • the subject in need of a general hemostatic agent is undergoing, or is about to undergo, surgery.
  • the chimeric protein of the invention can be administered prior to, during, or after surgery as a prophylactic.
  • the chimeric protein of the invention can be administered prior to, during, or after surgery to control an acute bleeding episode.
  • the surgery can include, but is not limited to liver transplantation, liver resection, or stem cell transplantation.
  • the chimeric protein of the invention can be used to treat a subject having an acute bleeding episode who does not have a hemostatic disorder.
  • the acute bleeding episode can result from severe trauma, e.g., surgery, an automobile accident, wound, laceration gun shot, or any other traumatic event resulting in uncontrolled bleeding.
  • the chimeric protein of the invention can be administered intravenously, subcutaneously, intra-muscularly, or via any mucosal surface, e.g., orally, sublingually, buccally, nasally, rectally, vaginally or via pulmonary route.
  • the chimeric protein can be implanted within or linked to a biopolymer solid support that allows for the slow release of the chimeric protein to the site of bleeding or implanted into bandage/dressing.
  • the dose of the chimeric protein of the invention will vary depending on the subject and upon the particular route of administration used. Dosages can range from 0.1 to 100,000 ⁇ g/kg body weight. In one embodiment, the dosing range is 0.1-1 ,000 ⁇ g/kg.
  • the protein can be administered continuously or at specific timed intervals.
  • In vitro assays may be employed to determine optimal dose ranges and/or schedules for administration.
  • In vitro assays that measure clotting factor activity are known in the art, e.g., STA-CLOT Vlla-rTF clotting assay.
  • effective doses may be extrapolated from dose-response curves obtained from animal models, e.g., a hemophiliac dog (Mount et al. 2002, Blood 99(8):2670).
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a clotting factor, at least a portion of an immunoglobulin constant region and a pharmaceutically acceptable carrier or excipients.
  • suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E.W. Martin.
  • excipients can include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, giycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like.
  • the composition can also contain pH buffering reagents, and wetting or emulsifying agents.
  • the pharmaceutical composition can take the form of tablets or capsules prepared by conventional means.
  • the composition can also be prepared as a liquid for example a syrup or a suspension.
  • the liquid can include suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (lecithin or acacia), non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils), and preservatives (e.g. methyl or propyl-p- hydroxybenzoates or sorbic acid).
  • the preparations can also include flavoring, coloring and sweetening agents.
  • the composition can be presented as a dry product for constitution with water or another suitable vehicle.
  • composition may take the form of tablets or lozenges according to conventional protocols.
  • the compounds for use according to the present invention are conveniently delivered in the form of a nebulized aerosol with or without excipients or in the form of an aerosol spray from a pressurized pack or nebulizer, with optionally a propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoromethane, carbon dioxide or other suitable gas.
  • a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the pharmaceutical composition can be formulated for parenteral administration (i.e. intravenous or intramuscular) by bolus injection.
  • parenteral administration i.e. intravenous or intramuscular
  • Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multidose containers with an added preservative.
  • the compositions can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., pyrogen free water.
  • the pharmaceutical composition can also be formulated for rectal administration as a suppository or retention enema, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the invention in another embodiment, relates to a method of treating a subject with a hemostatic disorder comprising administering a therapeutically effective amount of at least one chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region in combination with at least one other clotting factor or agent that promotes hemostasis.
  • Said other clotting factor or agent that promotes hemostasis can be any therapeutic with demonstrated clotting activity.
  • the clotting factor or hemostatic agent can include factor V, factor Vll, factor VIII, factor IX, factor X, factor XI, factor XII, factor XIII, prothrombin, fibrinogen, von Willebrand factor or recombinant soluble tissue factor (rsTF) or activated forms of any of the preceding.
  • the clotting factor of hemostatic agent can also include anti-fibrinolytic drugs, e.g., epsilon-amino-caproic acid, tranexamic acid.
  • the invention provides a kit for the diagnosis of a hemostatic disorder.
  • the kit can include a container and a chimeric protein comprising at least one clotting factor and at least a portion of an immunoglobulin constant region.
  • the chimeric protein can be provided in an appropriate buffer or solvent.
  • the buffer can be an aqueous buffer, e.g., PBS or alternatively the chimeric protein can be lyophilized.
  • the kit can also provide instructions for detecting the presence of a clotting factor in a sample, e.g., contacting an aliquot of a sample with the chimeric protein of the invention and detecting the presence of a clot. Detection can include visible detection.
  • the kit can optionally provide an aliquot of blood lacking a known clotting factor.
  • Asp-Lys (SEQ ID NO: 23), a common affinity tag used to identify or purify proteins, was cloned into the pcDNA 3.1-Fc plasmid, which contains the mouse lg ⁇ signal sequence followed by the Fc fragment of human lgG1
  • FlagFc-FI 5'- GCTGGCTAGCCACCATGGA -3'(SEQ ID NO: 10)
  • FlagFc-R1 5'- CTTGTCATCGTCGTCCTTGTAGTCGTCA CCAGTGGAACCTGGAAC -3' (SEQ ID NO: 11)
  • FlagFc-F2 5'- GACTACAAGG ACGACGATGA CAAGGACAAA ACTCACACAT GCCCACCGTG CCCAGCTCCG GAACTCC -3' (SEQ ID NO: 12)
  • FlagFc-R2 5'- TAGTGGATCCTCATTTACCCG -3' (SEQ ID NO: 13)
  • the pcDNA 3.1-Fc template was then added to two separate PCR reactions containing 50 pmol each of the primer pairs FlagFc-F1/R1 or FlagFc-F2/R2 in a 50 ⁇ l reaction using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes.
  • Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes.
  • the products of these two reactions were then mixed in another PCR reaction (2 ⁇ l each) with 50 pmol of FlagFc-F1 and FlagFc-R2 primers in a 50 ⁇ l reaction using Pfu Ultra DNA polymerase (Stratagene, CA) according to manufacturer's standard protocol in a MJ Thermocycler using the following cycles: 95°C 2 minutes; 30 cycles of (95°C 30 seconds, 52°C 30 seconds, 72°C 45 seconds), followed by 72°C for 10 minutes.
  • the resulting fragment was gel purified, digested and inserted into the pcDNA 3.1-Fc plasmid Nhel- Bam HI.
  • the resulting plasmid contains the mouse lg ⁇ signal sequence producing the FlagFc protein.
  • PACE-F1 5'- GGTAAGCTTGCCATGGAGCTGAGGCCCTGGTTGC - 3'(SEQ ID NO: 15)
  • PACE-R1 5'- GTTTTCAATCTCTAGGACCCACTCGCC -3'(SEQ ID NO: 16)
  • PACE-F2 5'- GCCAGGCCACATGACTACTCCGC -3'(SEQ ID NO: 17)
  • PACE-R2 5'- GGTGAATTCTCACTCAGGCAGGTGTGAGGGCAGC - 3'(SEQ ID NO: 18)
  • the PACE-F1 primer adds a Hindlll site to the 5' end of the
  • PLATINUM® Taq system (Invitrogen, Carlsbad, CA) according to manufacturers protocol. The reaction was carried out in a MJ Thermocycler using the following cycles: 50°C 30 minutes; 94°C 2 minutes; 30 cycles of
  • pcDNA6-PACE produces a soluble form of PACE (amino acids 1-715), as the transmembrane region has been deleted.
  • sequence of PACE in pcDNA6-PACE is essentially as described in Harrison et al. 1998, Seminars in Hematology
  • the coding sequence for Factor Vll was obtained by RT-PCR from human fetal liver RNA (Clontech, Palo Alto, CA).
  • the cloned region is comprised of the cDNA sequence from bp 36 to bp 1430 terminating just before the stop codon.
  • a Sbfl site was introduced on the N-terminus.
  • a BspEI site was introduced on the C-terminus.
  • the construct was cloned by PCR using the primers:
  • the fragment was digested Sbfl - BspE I and inserted into pED.dC-Fc a plasmid encoding for the Fc fragment of an lgG1.
  • CHO DG-44 cells were grown at 37°C, 5% C02, in MEM Alpha plus
  • DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A total of 10 ⁇ g of DNA was used to transfect one 100 mm dish: either 9 ⁇ g pED.dC.FVII-Fc + 1 ⁇ g of pcDNA6- PACE for the dimer transfection, or 7.5 ⁇ g of pED.dC.FVII-Fc + 1.5 ⁇ g pcDNA3/Flag-Fc + 1 ⁇ g of pcDNA6-PACE for the monomer transfection.
  • the cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The media was removed after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 ⁇ g/ml of Blasticidin (Invitrogen, Carlsbad, CA) for both transfections, while the monomer-dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 10 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition 25 nM methotrexate.
  • Approximately 2 x 10 7 cells were used to inoculate 300 ml of growth medium in a 1700 cm 2 roller bottle (Corning, Corning, NY) supplemented with 5 ⁇ g/L of vitamin K 3 (menadione sodium bisulfite) (Sigma, St Louis, MO).
  • the roller bottles were incubated in a 5% C0 2 at 37°C for 72 hours.
  • the growth medium was then exchanged with 300 ml serum-free production medium (DMEM/F12 with 5 ⁇ g/ml bovine insulin and 10 ⁇ g/ml Gentamicin) supplemented with 5 ⁇ g/L of vitamin K 3 .
  • the production medium (conditioned medium) was collected every day for 10 days and stored at 4°C.
  • Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Pooled media was first clarified using a Sartoclean glass fiber filter (3.0 ⁇ m + 0.2 ⁇ m) (Sartorious Corp. Gottingen, Germany) followed by an Acropack 500 filter (0.8 ⁇ m + 0.2 ⁇ m) (Pall Corp., East Hills, NY). The clarified media was then concentrated approximately 20-fold using Pellicon Biomax tangential flow filtration cassettes (10 kDa MWCO) (Millipore Corp., Billerica, MA).
  • Fc chimeras were then captured from the concentrated media by passage over a Protein A Sepharose 4 Fast Flow Column (AP Biotech,
  • the monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of FVII-Fc:FVII-Fc homodimer, FVll-Fc: FLAG-Fc monomer-dimer hybrid, and FLAG-Fc: FLAG- Fc homodimers.
  • FVII-Fc FVII-Fc homodimer
  • FVll-Fc FLAG-Fc monomer-dimer hybrid
  • FLAG-Fc FLAG- Fc homodimers.
  • the Protein A Sepharose 4 Fast Flow pool was first dialyzed into 20 mM MES, 20 mM NaCI, pH 6.1 and was then passed over a Unosphere S cation- exchange column (BioRad Corp., Richmond, CA).
  • the dialyzed material was then loaded onto a 1.1 x 11 cm (9.9 ml) column at 150 cm/hour. During the wash and elution, the flow rate was increased to 500 cm/hour.
  • the column was washed sequentially with 8 column volumes of 20 mM MES, 20 mM NaCI, pH 6.1 and 8 column volumes of 20 mM MES, 40 mM NaCI, pH 6.1.
  • the bound protein was eluted with 20 mM MES, 750 mM NaCI, pH 6.1. Elution fractions containing the protein peak were pooled and sterile filtered through a 0.2 ⁇ m
  • An anti-FLAG MAB affinity column was used to separate chimeric Fc dimers with hFVII fused to both Fc molecules from those with one FLAG peptide and one hFVII fusion.
  • the Unosphere S Eluate pool was diluted 1 :1 with 20 mM Tris, 50 mM NaCI, 5 mM CaCI 2, pH 8 and loaded onto a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. Loading was targeted to ⁇ 2.5 mg monomer-dimer hybrid /ml column volume.
  • the StaClot FVIIa-rTF assay kit was purchased from Diagnostica Stago (Parsippany, NJ) and modified as described in Johannessen et al. 2000, Blood Coagulation and Fibrinolysis 11 : S159. A standard curve was performed with the FVIIa World Health Organization standard 89/688.
  • the assay compared a homodimer comprised of two factor Vll molecules and two Fc molecules with a monomer/dimer hybrid comprised of one factor Vll molecule and two Fc molecules. Significant clotting activity was observed for both the monomer/dimer hybrid and the homodimer. The clotting activity of the monomer/dimer hybrid compared to the homodimer was almost four times as great (Figure 4).
  • CM5 chip (Biacore, Uppsala, Sweden) was coated with 3500 resonance units (RU) of shFcRn using amine chemistry.
  • RU resonance units
  • Factor Vll-Fc was diluted, 10 fold or 100 fold, in 50 mM P0 4> pH 6.0, 100 mM NaCI, 0.01%
  • 25 gram day 9 newborn rats were purchased from Charles River (Wilmington, MA) and allowed to acclimate for 24 hours.
  • the rats were dosed orally with FVlla-Fc homodimer, or monomer/dimer hybrid(consisting of two Fc chains, one of which was linked to Fc-VII).
  • a volume of 200 ⁇ l of a FVlla- Fc solution was used for a dose of 1 mg/kg.
  • the solution was comprised of a Tris-HCl buffer pH 7.4 with 5 mg/ml soybean trypsin inhibitor.
  • the rats were euthanized with C0 2 at several time points, and 200 ⁇ l of blood was drawn by cardiac puncture.
  • Plasma was obtained by the addition of a 1/10 volume 3.8% sodium citrate solution and centrifuged at room temperature at a speed of 1268xg. The plasma samples were either used in the assays fresh or
  • the Asserachrom Factor VII:Ag ELISA was performed on the minipig samples.
  • a Factor VII:Ag Elisa assay was purchased from Diagnostica Stago (Parsippany, NJ) and preformed as described in the kit manual with one change.
  • the standard for the standard curve was replaced with purified Factor Vlla-Fc.
  • the standard was run in the same percent normal animal plasma as being analyzed. Plasma levels of intravenously administered monomer/dimer hybrid are shown in Figure 8A. The half life was determined to be 9.4 hours.
  • a time course assay using monomer/dimer hybrid chimeric protein demonstrated sustained plasma levels of intravenously administered Factor Vlla-Fc over time with a T ⁇ 2 of 22 hours ( Figure 8A).
  • Clotting activity using was measured by the StaClot FVIIa-rTF assay kit ( Figure 8B).
  • the T- ⁇ /2 for clotting was found to be 6.4 hours for one pig and 5.7 for the other pig.
  • the human Factor IX coding sequence was obtained by RT-PCR amplification from adult human liver RNA using the following primers: natFIX-F: 5'-TTACTGCAGAAGGTTATGCAGCGCGTGAACATG- 3'(SEQ ID NO: 21)
  • F9-R 5'-TTTTTCGAATTCAGTGAGCTTTGTTTTTTCCTTAATCC- 3'(SEQ ID NO: 22)
  • Example 10 Factor IX-Fc homodimer and monomer-dimer hybrid expression and purification
  • CHO DG-44 cells expressing Factor IX-Fc were established. DG44 cells were plated in 100 mm tissue culture petri dishes and grown to a confluency of 50%- 60%. A total of 10 ⁇ g of DNA was used to transfect one 100 mm dish: for the homodimer transfection, 8 ⁇ g of pED.dC.Factor IX-Fc + 2 ⁇ g of pcDNA6-PACE was used; for the monomer-dimer hybrid transfection, 8 ⁇ g of pED.dC.Factor IX-Fc + 1 ⁇ g of pcDNA3-FlagFc +1 ⁇ g pcDNA6-PACE was used.
  • the cells were transfected as described in the Superfect transfection reagent manual (Qiagen, Valencia, CA). The media was removed from transfection after 48 hours and replaced with MEM Alpha without nucleosides plus 5% dialyzed fetal bovine serum and 10 ⁇ g/ml of Blasticidin (Invitrogen, Carlsbad, CA) for both transfections, while the monomer-dimer hybrid transfection was also supplemented with 0.2 mg/ml geneticin (Invitrogen, Carlsbad, CA). After 3 days, the cells were released from the plate with 0.25% trypsin and transferred into T25 tissue culture flasks, and the selection was continued for 10-14 days until the cells began to grow well as stable cell lines were established. Protein expression was subsequently amplified by the addition 10 nM or 100 nM methotrexate for the homodimer or monomer-dimer hybrid, respectively.
  • Fresh production medium was added to the roller bottles after each collection and the bottles were returned to the incubator. Prior to chromatography, the medium was clarified using a SuporCap-100 (0.8/0.2 ⁇ m) filter from Pall Gelman Sciences (Ann Arbor, Ml). All of the following steps were performed at 4°C. The clarified medium was applied to Protein A Sepharose, washed with 5 column volumes of 1X PBS (10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI), eluted with 0.1 M glycine, pH 2.7 , and then neutralized with 1/10 volume of 1 M Tris-HCl, pH 9.0. The protein was then dialyzed into PBS.
  • 1X PBS 10 mM phosphate, pH 7.4, 2.7 mM KCI, and 137 mM NaCI
  • the monomer-dimer hybrid transfection protein sample was subject to further purification, as it contained a mixture of FIX-Fc:FIX-Fc homodimer, FIX-Fc:Flag-Fc monomer-dimer hybrid, and Flag-Fc:Flag-Fc homodimer. Material was concentrated and applied to a 2.6 cm x 60 cm (318 ml) Superdex 200 Prep Grade column at a flow rate of 4 ml/minute (36 cm/hour) and then eluted with 3 column volumes of 1X PBS. Fractions corresponding to two peaks on the UV detector were collected and analyzed by SDS-PAGE.
  • Fractions from the first peak contained either FlX-Fc:FIX-Fc homodimer or FIX-Fc:FlagFc monomer-dimer hybrid, while the second peak contained FIagFc:FlagFc homodimer. All fractions containing the monomer- dimer hybrid but no FlagFc homodimer were pooled and applied directly to a 1.6 x 5 cm M2 anti-FLAG sepharose column (Sigma Corp., St. Louis, MO) at a linear flow rate of 60 cm/hour. After loading, the column was washed with 5 column volumes PBS. Monomer-dimer hybrids were then eluted with 100 mM Glycine, pH 3.0.
  • Elution fractions containing the protein peak were then neutralized by adding 1/10 volume of 1 M Tris-HCl, and analyzed by reducing and nonreducing SDS-PAGE. Fractions were dialyzed into PBS, concentrated to 1-5 mg/ml, and stored at -80°C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Orthopedics, Nursing, And Contraception (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
PCT/US2004/013940 2003-05-06 2004-05-06 Clotting factor-fc chimeric proteins to treat hemophilia Ceased WO2004101740A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP04751357.7A EP1624891B2 (en) 2003-05-06 2004-05-06 Clotting factor-fc chimeric proteins to treat hemophilia
EP19157022.5A EP3552627A1 (en) 2003-05-06 2004-05-06 Clotting factor-fc chimeric proteins to treat hemophilia
AU2004239244A AU2004239244C1 (en) 2003-05-06 2004-05-06 Clotting factor-Fc chimeric proteins to treat hemophilia
CA2522859A CA2522859C (en) 2003-05-06 2004-05-06 Clotting factor-fc chimeric proteins to treat hemophilia
PL04751357T PL1624891T5 (pl) 2003-05-06 2004-05-06 Białka chimeryczne o strukturze czynnik krzepliwości krwi-fc do leczenia hemofilii
DK04751357.7T DK1624891T4 (da) 2003-05-06 2004-05-06 Kimære koagulationsfaktor Fc proteiner til behandling af hæmofili
AT04751357T ATE440619T1 (de) 2003-05-06 2004-05-06 Gerinnungsfaktor-fc chimere proteine zur behandlung von hämophilie
DE602004022800T DE602004022800D1 (de) 2003-05-06 2004-05-06 Gerinnungsfaktor-fc chimere proteine zur behandlung von hämophilie
SI200431290T SI1624891T2 (sl) 2003-05-06 2004-05-06 Strjevalni faktor-FC himerni proteini za zdravljenje hemofilije
AU2010201711A AU2010201711C1 (en) 2003-05-06 2010-04-29 Clotting Factor-Fc Chimeric Proteins to Treat Hemophilia

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46883703P 2003-05-06 2003-05-06
US60/468,837 2003-05-06

Publications (2)

Publication Number Publication Date
WO2004101740A2 true WO2004101740A2 (en) 2004-11-25
WO2004101740A3 WO2004101740A3 (en) 2005-10-27

Family

ID=33452235

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/013940 Ceased WO2004101740A2 (en) 2003-05-06 2004-05-06 Clotting factor-fc chimeric proteins to treat hemophilia

Country Status (18)

Country Link
US (6) US20050147618A1 (enExample)
EP (5) EP1624891B2 (enExample)
AT (2) ATE497783T1 (enExample)
AU (2) AU2004239244C1 (enExample)
BE (1) BE2016C058I2 (enExample)
CA (1) CA2522859C (enExample)
CY (4) CY1109640T1 (enExample)
DE (2) DE602004022800D1 (enExample)
DK (3) DK2298347T3 (enExample)
ES (3) ES2558102T3 (enExample)
FR (1) FR16C0041I2 (enExample)
HU (2) HUE026384T2 (enExample)
LU (1) LU93265I2 (enExample)
NL (1) NL300835I2 (enExample)
PL (3) PL1624891T5 (enExample)
PT (3) PT1624891E (enExample)
SI (3) SI2077121T1 (enExample)
WO (1) WO2004101740A2 (enExample)

Cited By (107)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006074199A1 (en) * 2005-01-05 2006-07-13 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
WO2006079120A3 (en) * 2005-01-24 2007-07-19 Univ Texas Fc-fusion constructs binding to phosphatidylserine and their therapeutic use
EP1867660A1 (en) * 2006-06-14 2007-12-19 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
WO2007144173A1 (en) 2006-06-14 2007-12-21 Csl Behring Gmbh Proteolytically cleavable fusion protein comprising a blood coagulation factor
EP1877037A2 (en) 2005-04-28 2008-01-16 Novo Nordisk Health Care AG A closed container comprising an activated factor vii polypeptide, processes for the preparation of the same, and a kit and a method for use of the kit
WO2007112005A3 (en) * 2006-03-24 2008-02-07 Syntonix Pharmaceuticals Inc Pc5 as a factor ix propeptide processing enzyme
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
EP1935430A1 (en) * 2006-12-22 2008-06-25 CSL Behring GmbH Modified coagulation factors with prolonged in vivo half-life
WO2008077616A1 (en) 2006-12-22 2008-07-03 Csl Behring Gmbh Modified coagulation factors with prolonged in vivo half-life
US7737260B2 (en) 2003-11-13 2010-06-15 Hanmi Pharm. Co., Ltd Protein complex using an immunoglobulin fragment and method for the preparation thereof
EP2213733A2 (en) 2006-05-24 2010-08-04 Novo Nordisk Health Care AG Factor IX analogues having prolonged in vivo half life
US7939632B2 (en) 2006-06-14 2011-05-10 Csl Behring Gmbh Proteolytically cleavable fusion proteins with high molar specific activity
JP2011525363A (ja) * 2008-06-24 2011-09-22 ツェー・エス・エル・ベーリング・ゲー・エム・ベー・ハー 延長されたインビボ半減期を有する第viii因子、フォン・ヴィレブランド因子又はそれらの複合体
EP2371857A1 (en) 2010-04-01 2011-10-05 CSL Behring GmbH Factor XII inhibitors for treating interstitial lung disease
WO2012006635A1 (en) * 2010-07-09 2012-01-12 Biogen Idec Hemophilia Inc. Processable single chain molecules and polypeptides made using same
US8110665B2 (en) 2003-11-13 2012-02-07 Hanmi Holdings Co., Ltd. Pharmaceutical composition comprising an immunoglobulin FC region as a carrier
WO2012061654A1 (en) 2010-11-03 2012-05-10 Catalyst Biosciences, Inc. Modified factor ix polypeptides and uses thereof
EP2497489A1 (en) 2011-03-09 2012-09-12 CSL Behring GmbH Factor XII inhibitors for the treatment of silent brain ischemia and ischemia of other organs
WO2012120128A1 (en) 2011-03-09 2012-09-13 Csl Behring Gmbh Factor xii inhibitors for the administration with medical procedures comprising contact with artificial surfaces
US8283319B2 (en) 2007-02-12 2012-10-09 Csl Behring Gmbh Therapeutic application of Kazal-type serine protease inhibitors
EP2411024A4 (en) * 2009-03-24 2013-02-27 Bayer Healthcare Llc Variants of factor viii and associated methods of use
WO2013057171A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Combined use of a sulfated glycosaminoglycan and a hyaluronidase for improving the bioavailability of factor viii
WO2013057219A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Method for improving the stability of purified factor viii after reconstitution
WO2013057167A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Use of sulfated glycosaminoglycans for improving the bioavailability of factor viii
US8449884B2 (en) 2003-05-06 2013-05-28 Syntonix Pharmaceuticals, Inc. Clotting factor-fc chimeric proteins to treat hemophilia
WO2013113774A1 (en) 2012-01-31 2013-08-08 Csl Behring Gmbh Factor xii inhibitors for the treatment of neurological inflammatory disorders
WO2013120939A1 (en) 2012-02-15 2013-08-22 Csl Behring Gmbh Von willebrand factor variants having improved factor viii binding affinity
US8633300B2 (en) 2005-06-17 2014-01-21 Novo Nordisk Healthcare Ag Selective reduction and derivatization of engineered proteins comprising at least one non-native cysteine
WO2014063108A1 (en) 2012-10-18 2014-04-24 Biogen Idec Ma Inc. Methods of using a fixed dose of a clotting factor
US8716240B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US8716239B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF
US8765915B2 (en) 2006-02-06 2014-07-01 Csl Behring Gmbh Modified coagulation factor VIIa with extended half-life
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
WO2014144795A1 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Factor viii polypeptide formulations
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
US8853161B2 (en) 2003-04-09 2014-10-07 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
WO2014173873A1 (en) 2013-04-22 2014-10-30 Csl Behring Gmbh Complex
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
WO2014207199A1 (en) 2013-06-28 2014-12-31 Csl Behring Gmbh Combination therapy using a factor xii inhibitor and a c1-inhibitor
CN104292341A (zh) * 2014-10-11 2015-01-21 上海兴迪金生物技术有限公司 一种凝血八因子融合蛋白及其制备方法和用途
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US9050318B2 (en) 2009-12-06 2015-06-09 Biogen Idec Hemophilia Inc. Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
WO2015085276A1 (en) 2013-12-06 2015-06-11 Biogen Idec Ma Inc. Population pharmacokinetics tools and uses thereof
WO2015148444A1 (en) 2014-03-24 2015-10-01 Biogen Ma Inc. Lyophilized factor ix formulations
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
WO2015193457A1 (en) 2014-06-18 2015-12-23 Csl Behring Gmbh Therapy using a factor xii inhibitor in a neurotraumatic disorder
WO2016000039A1 (en) 2014-07-02 2016-01-07 Csl Limited Modified von willebrand factor
US9233145B2 (en) 2010-07-09 2016-01-12 Biogen Hemophila Inc. Factor IX polypeptides and methods of use thereof
WO2016142288A1 (en) 2015-03-06 2016-09-15 Csl Behring Recombinant Facility Ag Modified von willebrand factor having improved half-life
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography
WO2016188905A1 (en) 2015-05-22 2016-12-01 Csl Behring Recombinant Facility Ag Methods for preparing modified von willebrand factor
WO2016188907A1 (en) 2015-05-22 2016-12-01 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for treating hemophilia
US9518127B2 (en) 2011-07-22 2016-12-13 Csl Behring Gmbh Inhibitory anti-factor XII/XIIA monoclonal antibodies and their uses
US9611310B2 (en) 2010-07-09 2017-04-04 Bioverativ Therapeutics Inc. Systems for factor VIII processing and methods thereof
EP3184149A1 (en) 2015-12-23 2017-06-28 Julius-Maximilians-Universität Würzburg Soluble glycoprotein v for treating thrombotic diseases
WO2017117631A1 (en) 2016-01-07 2017-07-13 Csl Limited Mutated truncated von willebrand factor
WO2018087267A1 (en) 2016-11-11 2018-05-17 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for treating hemophilia
WO2018087271A1 (en) 2016-11-11 2018-05-17 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for extravascular administration in the treatment or prophylaxis of a blood coagulation disorder
WO2018102760A1 (en) 2016-12-02 2018-06-07 Bioverativ Therapeutics Inc. Methods of inducing immune tolerance to clotting factors
WO2018102743A1 (en) 2016-12-02 2018-06-07 Bioverativ Therapeutics Inc. Methods of treating hemophilic arthropathy using chimeric clotting factors
US10001495B2 (en) 2012-07-25 2018-06-19 Bioverativ Therapeutics Inc. Blood factor monitoring assay and uses thereof
US10010622B2 (en) 2011-07-08 2018-07-03 Bioverativ Therapeutics Inc. Factor VIII chimeric and hybrid polypeptides, and methods of use thereof
US10023628B2 (en) 2012-07-06 2018-07-17 Bioverativ Therapeutics Inc. Cell line expressing single chain factor VIII polypeptides and uses thereof
WO2018234518A1 (en) 2017-06-22 2018-12-27 CSL Behring Lengnau AG Modulation of fviii immunogenicity by truncated vwf
US10202595B2 (en) 2012-06-08 2019-02-12 Bioverativ Therapeutics Inc. Chimeric clotting factors
EP3446700A1 (en) 2012-10-30 2019-02-27 Bioverativ Therapeutics Inc. Methods of using fviii polypeptide
US10221455B2 (en) 2012-01-12 2019-03-05 Bioverativ Therapeutics Inc. Methods of reducing immunogenicity against factor VIII in individuals undergoing factor VIII therapy
WO2019067766A1 (en) 2017-09-27 2019-04-04 Sigilon Therapeutics, Inc. METHODS, COMPOSITIONS AND IMPLANTABLE ELEMENTS COMPRISING ACTIVE CELLS
US10286047B2 (en) 2013-03-08 2019-05-14 Csl Behring Gmbh Treatment and prevention of remote ischemia-reperfusion injury
US10287564B2 (en) 2012-06-08 2019-05-14 Bioverativ Therapeutics Inc. Procoagulant compounds
US10335459B2 (en) 2016-06-22 2019-07-02 Alkermes, Inc. Compositions for modulating IL-10 immunostimulatory and anti-inflammatory properties
EP3542861A1 (en) 2012-09-25 2019-09-25 Bioverativ Therapeutics Inc. Methods of using fix polypeptides
WO2019191295A1 (en) 2018-03-28 2019-10-03 Bristol-Myers Squibb Company Interleukin-2/interleukin-2 receptor alpha fusion proteins and methods of use
WO2019195055A1 (en) 2018-04-04 2019-10-10 Sigilon Therapeutics, Inc. Implantable particles and related methods
WO2019195056A1 (en) 2018-04-04 2019-10-10 Sigilon Therapeutics, Inc. Methods, compositions, and implantable elements comprising stem cells
CN110520152A (zh) * 2017-03-14 2019-11-29 俄亥俄州创新基金会 与靶向组织因子的igg3免疫缀合物有关的方法和组合物
US10588949B2 (en) 2013-03-15 2020-03-17 Bioverativ Therapeutics Inc. Factor IX polypeptide formulations
WO2020069429A1 (en) 2018-09-27 2020-04-02 Sigilon Therapeutics, Inc. Implantable devices for cell therapy and related methods
US10611794B2 (en) 2013-09-25 2020-04-07 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US10656167B2 (en) 2011-07-25 2020-05-19 Bioverativ Therapeutics Inc. Assays to monitor bleeding disorders
US10808023B2 (en) 2016-01-07 2020-10-20 CSL Behring Lengnau AG Mutated von Willebrand factor
WO2020234195A1 (en) 2019-05-17 2020-11-26 Universitaet Zuerich Haptoglobin for use in treating an adverse secondary neurological outcome following a haemorrhagic stroke
US10881741B2 (en) 2014-12-19 2021-01-05 Alkermes, Inc. Single chain Fc fusion proteins
WO2021001522A1 (en) 2019-07-04 2021-01-07 CSL Behring Lengnau AG A truncated von willebrand factor (vwf) for increasing the in vitro stability of coagulation factor viii
WO2021094344A1 (en) 2019-11-11 2021-05-20 CSL Behring Lengnau AG Polypeptides for inducing tolerance to factor viii
WO2021154414A2 (en) 2020-01-29 2021-08-05 Catalyst Biosciences, Inc. Gene therapy for hemophilia b with a chimeric aav capsid vector encoding modified factor ix polypeptides
WO2021158938A1 (en) 2020-02-06 2021-08-12 Bristol-Myers Squibb Company Il-10 and uses thereof
US11174321B2 (en) 2016-04-06 2021-11-16 Csl Limited Method of treating atherosclerosis
WO2022094275A1 (en) 2020-10-29 2022-05-05 Bristol-Myers Squibb Company Fusion proteins for the treatment of disease
WO2022109124A1 (en) 2020-11-20 2022-05-27 Csl Behring Gmbh Method for treating antibody-mediated rejection
WO2022162218A1 (en) 2021-02-01 2022-08-04 Csl Behring Ag Method of treating or preventing an adverse secondary neurological outcome following a haemorrhagic stroke
US11491212B1 (en) 2017-09-27 2022-11-08 Catalyst Biosciences, Inc. Subcutaneous administration of modified factor IX polypeptides and treatment of hemophilia B
WO2022234070A1 (en) 2021-05-07 2022-11-10 Csl Behring Ag Expression system for producing a recombinant haptoglobin (hp) beta chain
WO2024047219A1 (en) 2022-09-02 2024-03-07 Csl Behring Ag Haptoglobin for use in treating or preventing exaggerated erectile response or erectile dysfunction
WO2024081309A1 (en) 2022-10-11 2024-04-18 Sigilon Therapeutics, Inc. Engineered cells and implantable elements for treatment of disease
WO2024081310A1 (en) 2022-10-11 2024-04-18 Sigilon Therapeutics, Inc. Engineered cells and implantable elements for treatment of disease
US12030925B2 (en) 2018-05-18 2024-07-09 Bioverativ Therapeutics Inc. Methods of treating hemophilia A
US12054495B2 (en) 2019-11-25 2024-08-06 Alkermes, Inc. Substituted macrocyclic compounds and related methods of treatment
US12441710B2 (en) 2020-12-21 2025-10-14 Alkermes, Inc. Substituted piperidino compounds and related methods of treatment
WO2025257801A1 (en) 2024-06-13 2025-12-18 CSL Innovation Pty Ltd Heme-binding protein for the treatment of ischemia-reperfusion injury (iri)

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SK782002A3 (en) * 1999-07-21 2003-08-05 Lexigen Pharm Corp FC fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US8007805B2 (en) 2003-08-08 2011-08-30 Paladin Labs, Inc. Chimeric antigens for breaking host tolerance to foreign antigens
JP5730211B2 (ja) 2008-11-20 2015-06-03 バイオジェン アイデック エムエー インコーポレイティドBiogen Idec Inc. ウイルスのアルギニン不活化
WO2010096394A2 (en) 2009-02-17 2010-08-26 Redwood Biosciences, Inc. Aldehyde-tagged protein-based drug carriers and methods of use
WO2011060242A2 (en) * 2009-11-13 2011-05-19 Talecris Biotherapeutics, Inc. Von willebrand factor (vwf)-containing preparations, and methods, kits, and uses related thereto
EP3578205A1 (en) 2010-08-06 2019-12-11 ModernaTX, Inc. A pharmaceutical formulation comprising engineered nucleic acids and medical use thereof
EP2619228A1 (en) 2010-09-22 2013-07-31 Novo Nordisk A/S Therapeutic factor viii antibodies
CN103429606A (zh) 2010-10-01 2013-12-04 现代治疗公司 设计核酸及其使用方法
KR101853405B1 (ko) * 2010-10-20 2018-05-02 주식회사 티움바이오 인자 ix 활성을 갖는 융합 단백질
EP2663647A4 (en) 2011-01-14 2015-08-19 Redwood Bioscience Inc POLYPEPTIDE IMMUNOGLOBULINS WITH ALDEHYDIC MARKING AND THEIR USE METHOD
CA2828769A1 (en) * 2011-03-02 2012-09-07 Novo Nordisk A/S Coagulation factor-targeting to tlt-1 on activated platelets
CA2831613A1 (en) 2011-03-31 2012-10-04 Moderna Therapeutics, Inc. Delivery and formulation of engineered nucleic acids
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
KR20190099538A (ko) 2011-10-03 2019-08-27 모더나 세라퓨틱스, 인코포레이티드 변형된 뉴클레오사이드, 뉴클레오타이드, 및 핵산, 및 이들의 용도
EP4144378A1 (en) 2011-12-16 2023-03-08 ModernaTX, Inc. Modified nucleoside, nucleotide, and nucleic acid compositions
RS59670B1 (sr) 2012-01-12 2020-01-31 Bioverativ Therapeutics Inc Himerni polipeptidi faktora viii i njihove upotrebe
EA201491388A1 (ru) 2012-02-15 2015-01-30 Байоджен Айдек Ма Инк. Рекомбинантные белки фактора viii
DK3564260T5 (da) 2012-02-15 2024-09-02 Bioverativ Therapeutics Inc Faktor viii-sammensætninger og fremgangsmåder til fremstilling og anvendelse deraf
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
AU2013243954A1 (en) 2012-04-02 2014-10-30 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
CN104661674A (zh) 2012-07-11 2015-05-27 阿穆尼克斯运营公司 具有xten和血管性血友病因子蛋白的因子viii复合物、及其用途
DK2922554T3 (en) 2012-11-26 2022-05-23 Modernatx Inc Terminalt modificeret rna
US10703799B2 (en) * 2012-12-10 2020-07-07 Vib Vzw IL-33R and IL-1RAcP fusion proteins
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US10023626B2 (en) 2013-09-30 2018-07-17 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
BR112016007255A2 (pt) 2013-10-03 2017-09-12 Moderna Therapeutics Inc polinucleotídeos que codificam receptor de lipoproteína de baixa densidade
CN114736305B (zh) 2014-01-10 2023-05-05 比奥贝拉蒂治疗公司 因子viii嵌合蛋白及其用途
CN109804432B (zh) 2016-04-15 2023-07-14 武田药品工业株式会社 提供药代动力学药物给药方案的方法和设备
US11208632B2 (en) 2016-04-26 2021-12-28 R.P. Scherer Technologies, Llc Antibody conjugates and methods of making and using the same
EP3502143A4 (en) 2016-08-19 2020-07-15 Ampsource Biopharma Shanghai Inc. BINDING PEPTIDE FOR THE CONSTRUCTION OF A FUSION PROTEIN
CN106279437B (zh) 2016-08-19 2017-10-31 安源医药科技(上海)有限公司 高糖基化人凝血因子viii融合蛋白及其制备方法与用途
CN107759694B (zh) 2016-08-19 2023-01-13 安源医药科技(上海)有限公司 双特异性抗体及其制备方法与用途
US10896749B2 (en) 2017-01-27 2021-01-19 Shire Human Genetic Therapies, Inc. Drug monitoring tool
CN110248964B (zh) 2017-02-01 2024-08-27 诺和诺德股份有限公司 促凝血抗体
US11220554B2 (en) 2018-09-07 2022-01-11 Novo Nordisk A/S Procoagulant antibodies
US11981718B2 (en) 2020-05-27 2024-05-14 Ampsource Biopharma Shanghai Inc. Dual-function protein for lipid and blood glucose regulation

Family Cites Families (122)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3941763A (en) * 1975-03-28 1976-03-02 American Home Products Corporation PGlu-D-Met-Trp-Ser-Tyr-D-Ala-Leu-Arg-Pro-Gly-NH2 and intermediates
US4215051A (en) 1979-08-29 1980-07-29 Standard Oil Company (Indiana) Formation, purification and recovery of phthalic anhydride
US4456591A (en) * 1981-06-25 1984-06-26 Baxter Travenol Laboratories, Inc. Therapeutic method for activating factor VII
US6936694B1 (en) * 1982-05-06 2005-08-30 Intermune, Inc. Manufacture and expression of large structural genes
US4713339A (en) 1983-01-19 1987-12-15 Genentech, Inc. Polycistronic expression vector construction
US5189015A (en) * 1984-05-30 1993-02-23 Alfa-Laval Agri International Ab Method for prophylactic treatment of the colonization of a Staphylococcus aureus bacterial strain by bacterial cell surface protein with fibronectin and fibrinogen binding ability
US5077204A (en) * 1984-06-21 1991-12-31 Chiron Corporation Yeast endopeptidase for basic amino-acid site cleavage, preparation and use
DK525384D0 (da) * 1984-11-05 1984-11-05 Nordisk Insulinlab Praeparat paa basis af faktor viii til behandling af haemofili a inhibitorpatienter samt fremgangsmaade til fremstilling af et saadan praeparat
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
GR860984B (en) 1985-04-17 1986-08-18 Zymogenetics Inc Expression of factor vii and ix activities in mammalian cells
US5180583A (en) * 1985-11-26 1993-01-19 Hedner Ulla K E Method for the treatment of bleeding disorders
US4902505A (en) 1986-07-30 1990-02-20 Alkermes Chimeric peptides for neuropeptide delivery through the blood-brain barrier
US4987071A (en) * 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
EP0307434B2 (en) * 1987-03-18 1998-07-29 Scotgen Biopharmaceuticals, Inc. Altered antibodies
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4994371A (en) 1987-08-28 1991-02-19 Davie Earl W DNA preparation of Christmas factor and use of DNA sequences
US6018026A (en) * 1988-01-22 2000-01-25 Zymogenetics, Inc. Biologically active dimerized and multimerized polypeptide fusions
ZA89430B (en) 1988-01-22 1989-10-25 Gen Hospital Corp Cloned genes encoding ig-cd4 fusion proteins and the use thereof
US5234830A (en) 1988-02-03 1993-08-10 Suntory Limited DNA encoding a KEX2 endoprotease without a C-terminal hydrophobic region
JP2643968B2 (ja) 1988-02-03 1997-08-25 サントリー株式会社 Kex2エンドプロテアーゼ及びその製造方法
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
FR2641468A1 (fr) 1989-01-11 1990-07-13 Merieux Inst Anticorps chimeriques anti-recepteur de l'interleukine-2 humaine, leur preparation et compositions pharmaceutiques les contenant
US5225538A (en) * 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5116964A (en) * 1989-02-23 1992-05-26 Genentech, Inc. Hybrid immunoglobulins
SE8901687D0 (sv) * 1989-05-11 1989-05-11 Alfa Laval Agri Int Fibronectin binding protein as well as its preparation
DK0939121T4 (da) * 1989-09-12 2008-02-04 Ahp Mfg B V TNF-bindende proteiner
GB9009106D0 (en) 1990-04-23 1990-06-20 3I Res Expl Ltd Processes and intermediates for synthetic antibody derivatives
ES2120949T4 (es) * 1990-06-28 2011-12-29 Sanofi-Aventis Deutschland Gmbh 50% Proteinas de fusión con porciones de inmunoglobulinas, su preparación y empleo.
GB9015198D0 (en) 1990-07-10 1990-08-29 Brien Caroline J O Binding substance
CA2097060A1 (en) 1990-12-04 1992-06-05 Peter J. Curtis Bifunctional antibodies and method of preparing same
US5374617A (en) * 1992-05-13 1994-12-20 Oklahoma Medical Research Foundation Treatment of bleeding with modified tissue factor in combination with FVIIa
DE69226877T2 (de) * 1991-05-31 1999-03-11 Genentech, Inc., South San Francisco, Calif. Behandlung der hiv-assoziierten immun-thrombopenie purpura
AU2795892A (en) * 1991-10-03 1993-05-03 Center For Blood Research, The Cd36 immunoadhesins and their use in selectively killing (plasmodium falciparum) infected erythrocytes
US5932448A (en) 1991-11-29 1999-08-03 Protein Design Labs., Inc. Bispecific antibody heterodimers
AU676150B2 (en) * 1992-01-23 1997-03-06 Merck Patent Gmbh Monomeric and dimeric antibody-fragment fusion proteins
DK0615451T3 (da) * 1992-05-26 2006-04-24 Immunex Corp Hidtil ukendt cytokin der binder til CD30
AU5093593A (en) 1992-08-28 1994-03-29 Scripps Research Institute, The Inhibition of tumor metastasis via neutralization of tissue factor function
GB2270845B (en) 1992-09-24 1996-07-10 Smiths Ind Med Syst Inc Suction catheter assemblies
US5563045A (en) * 1992-11-13 1996-10-08 Genetics Institute, Inc. Chimeric procoagulant proteins
US6518013B1 (en) * 1993-06-07 2003-02-11 Trimeris, Inc. Methods for the inhibition of epstein-barr virus transmission employing anti-viral peptides capable of abrogating viral fusion and transmission
US6017536A (en) * 1993-06-07 2000-01-25 Trimeris, Inc. Simian immunodeficiency virus peptides with antifusogenic and antiviral activities
US5464933A (en) * 1993-06-07 1995-11-07 Duke University Synthetic peptide inhibitors of HIV transmission
US6479055B1 (en) * 1993-06-07 2002-11-12 Trimeris, Inc. Methods for inhibition of membrane fusion-associated events, including respiratory syncytial virus transmission
US5621039A (en) 1993-06-08 1997-04-15 Hallahan; Terrence W. Factor IX- polymeric conjugates
US6310180B1 (en) * 1993-06-21 2001-10-30 Vanderbilt University Method for synthesis of proteins
US5648240A (en) * 1994-05-24 1997-07-15 Texas A&M University MHC II analog from Staphylococcus aureus
US6027726A (en) 1994-09-30 2000-02-22 Inex Phamaceuticals Corp. Glycosylated protein-liposome conjugates and methods for their preparation
US6485726B1 (en) 1995-01-17 2002-11-26 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US6030613A (en) 1995-01-17 2000-02-29 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of therapeutics
US6086875A (en) 1995-01-17 2000-07-11 The Brigham And Women's Hospital, Inc. Receptor specific transepithelial transport of immunogens
ES2194973T3 (es) 1995-01-17 2003-12-01 Brigham & Womens Hospital Transporte de inmunogenes transepitelial especifico del receptor.
US6036482A (en) 1995-02-10 2000-03-14 Tokyo Electron Limited Heat treatment method
US5731168A (en) * 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
US5591573A (en) * 1995-04-10 1997-01-07 Alpha Therapeutic Corporation Method and system for testing blood samples
US5739277A (en) * 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5869046A (en) * 1995-04-14 1999-02-09 Genentech, Inc. Altered polypeptides with increased half-life
US6096871A (en) 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US5579277A (en) * 1995-05-01 1996-11-26 Apple Computer, Inc. System and method for interleaving memory banks
US6184344B1 (en) * 1995-05-04 2001-02-06 The Scripps Research Institute Synthesis of proteins by native chemical ligation
NZ311319A (en) * 1995-06-07 2000-01-28 Trimeris Inc The treatment of HIV and other viral infections using the peptide DP-178 or DP-107 in combination therapy
US5723125A (en) * 1995-12-28 1998-03-03 Tanox Biosystems, Inc. Hybrid with interferon-alpha and an immunoglobulin Fc linked through a non-immunogenic peptide
CA2198968C (en) * 1996-03-04 2010-02-09 Toyofumi Masuda Process for production of secretory kex2 derivatives
AU728657B2 (en) 1996-03-18 2001-01-18 Board Of Regents, The University Of Texas System Immunoglobulin-like domains with increased half-lives
BR9806793A (pt) * 1997-01-22 2000-05-16 Univ Texas Processos e composições de fator tissular para coagulação e tratamento de tumores.
TW502011B (en) * 1997-02-05 2002-09-11 Ajinomoto Kk Process for producing n-long-chain acyl acidic amino acids or salts thereof
CA2225189C (en) * 1997-03-06 2010-05-25 Queen's University At Kingston Canine factor viii gene, protein and methods of use
CA2292724A1 (en) * 1997-06-13 1998-12-17 Gryphon Sciences Solid phase native chemical ligation of unprotected or n-terminal cysteine protected peptides in aqueous solution
US6310183B1 (en) 1997-09-10 2001-10-30 Novo Nordisk A/S Coagulation factor VIIa composition
PL199659B1 (pl) 1998-02-25 2008-10-31 Merck Patent Gmbh Białko fuzyjne przeciwciała hu-KS IL2, cząsteczka DNA kodująca białko fuzyjne przeciwciała hu-KS IL2 i sposób wytwarzania białka fuzyjnego przeciwciała hu-KS IL2
US6008321A (en) * 1998-03-16 1999-12-28 Pharmacopeia, Inc. Universal linker for combinatorial synthesis
US6281331B1 (en) * 1998-03-23 2001-08-28 Trimeris, Inc. Methods and compositions for peptide synthesis
WO1999059643A2 (en) 1998-05-20 1999-11-25 Sdg, Inc. Liposomal delivery complex
ES2207278T3 (es) 1998-07-28 2004-05-16 Micromet Ag Heterominicuerpos.
WO2000009560A2 (en) 1998-08-17 2000-02-24 Abgenix, Inc. Generation of modified molecules with increased serum half-lives
WO2000018881A2 (en) 1998-09-30 2000-04-06 New England Biolabs, Inc. Intein mediated peptide ligation
US7488590B2 (en) * 1998-10-23 2009-02-10 Amgen Inc. Modified peptides as therapeutic agents
US6660843B1 (en) * 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
WO2000028065A1 (en) 1998-11-06 2000-05-18 Novo Nordisk A/S Method for the production of fvii
US6280994B1 (en) * 1998-11-25 2001-08-28 Zymogenetics, Inc. Zace 1: a human metalloenzyme
CA2270600A1 (en) 1999-05-03 2000-11-03 Infectio Recherche Inc. Method and formulations for the treatment of diseases, particularly those caused by human immunodeficiency virus and leishmania
CN1361793A (zh) * 1999-05-19 2002-07-31 利思进药品公司 干扰素-α蛋白作为Fc融合蛋白的表达和运输
WO2001002439A1 (en) 1999-07-01 2001-01-11 Yale University Neovascular-targeted immunoconjugates
IL147269A0 (en) * 1999-07-02 2002-08-14 Genentech Inc FVIIa ANTAGONISTS
IL147270A0 (en) * 1999-07-02 2002-08-14 Genentech Inc Fusion peptides comprising a peptide ligand domain and a multimerization domain
US6469136B1 (en) * 1999-07-07 2002-10-22 Trimeris, Inc. Methods and composition for peptide synthesis
JP4944324B2 (ja) 1999-07-13 2012-05-30 ボルダー バイオテクノロジー, インコーポレイテッド 免疫グロブリン融合タンパク質
WO2001034654A1 (en) 1999-11-05 2001-05-17 Biogen, Inc. Hedgehog fusion proteins and uses
AU2154401A (en) 1999-11-12 2001-05-30 Merck Patent Gmbh Erythropoietin forms with improved properties
AU1920301A (en) 1999-11-17 2001-05-30 Immunex Corporation Receptor activator of nf-kappa b
DE19963859A1 (de) * 1999-12-30 2001-07-12 Apotech Res & Dev Ltd Bi- oder Oligomer eines Di-, Tri-, Quattro- oder Pentamers von rekombinanten Fusionsproteinen
HUP0204475A2 (en) 2000-02-11 2003-04-28 Merck Patent Gmbh Enhancing the circulating half-life of antibody-based fusion proteins
JP2003521930A (ja) 2000-02-11 2003-07-22 マキシゲン・エイピーエス 第VII因子または第VIIa因子様分子
US6756480B2 (en) 2000-04-27 2004-06-29 Amgen Inc. Modulators of receptors for parathyroid hormone and parathyroid hormone-related protein
US20020090646A1 (en) 2000-05-03 2002-07-11 Amgen Inc. Calcitonin-related molecules
CN1318084C (zh) 2000-05-26 2007-05-30 奥索-麦克尼尔药品公司 神经保护肽
WO2002018417A1 (en) 2000-09-01 2002-03-07 Gryphon Therapeutics, Inc. Nucleophile-stable thioester generating compounds, methods of production and use
US7138119B2 (en) * 2000-09-15 2006-11-21 Progenics Pharmaceuticals, Inc. Compositions and methods for inhibition of HIV-1 infection
EP1339427A4 (en) 2000-11-01 2004-09-15 Elusys Therapeutics Inc PROCESS FOR PRODUCING BISPECIFIC MOLECULES BY TRANSEPISSANCE OF PROTEINS
AU2002310922A1 (en) 2001-05-04 2002-11-18 Institute Of Molecular And Cell Biology Interferons in the treatment of ischemia
US7419949B2 (en) * 2001-07-16 2008-09-02 Novo Noridsk Healthcare A/G Single-dose administration of factor VIIa
US20030078180A1 (en) * 2001-10-24 2003-04-24 Benchmark Research & Technology, Inc. Contaminant-tolerant foaming additive
PL215168B1 (pl) * 2002-02-27 2013-10-31 Immunex Corp Formulacja polipeptydowa
CN101143221A (zh) 2002-03-15 2008-03-19 布赖汉姆妇女医院 适合治疗剂全身性递送的中央气道给药
MXPA05000063A (es) 2002-07-01 2005-04-08 Kenneth S Warren Inst Inc Citocinas recombinantes protectoras de tejido y acidos nucleicos que las codifican para la proteccion, restauracion y mejora de celulas, tejidos y organos respondedores.
AU2003232081B2 (en) 2002-07-03 2009-02-05 Brandeis University Central airway administration for systemic delivery of therapeutics
WO2004006962A2 (en) * 2002-07-12 2004-01-22 Novo Nordisk A/S A tissue factor binding immunoconjugate comprising factor viia
US20040110929A1 (en) * 2002-07-12 2004-06-10 Bjorn Soren E. TF binding compound
CA2522690A1 (en) * 2003-05-06 2004-11-25 Syntonix Pharmaceuticals, Inc. Inhibition of drug binding to serum albumin
ATE497783T1 (de) * 2003-05-06 2011-02-15 Syntonix Pharmaceuticals Inc Gerinnungsfaktor vii-fc chimäre proteine zur behandlung von hämostatischen krankheiten
US20050281829A1 (en) 2003-05-06 2005-12-22 Hehir Cristina A T Fc chimeric proteins with anti-HIV drugs
US7348004B2 (en) * 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
TWI353991B (en) 2003-05-06 2011-12-11 Syntonix Pharmaceuticals Inc Immunoglobulin chimeric monomer-dimer hybrids
US8263084B2 (en) 2003-11-13 2012-09-11 Hanmi Science Co., Ltd Pharmaceutical composition for treating obesity-related disease comprising insulinotropic peptide conjugate
DK1682583T3 (da) 2003-11-13 2012-05-07 Hanmi Holdings Co Ltd Proteinkompleksdannelse under anvendelse af immunoglobulinfragment samt fremgangsmåde til fremstilling deraf
US8110665B2 (en) 2003-11-13 2012-02-07 Hanmi Holdings Co., Ltd. Pharmaceutical composition comprising an immunoglobulin FC region as a carrier
WO2005051289A2 (en) * 2003-11-18 2005-06-09 Iconic Therapeutics, Inc. Homogeneous preparations of chimeric proteins
KR100754667B1 (ko) 2005-04-08 2007-09-03 한미약품 주식회사 비펩타이드성 중합체로 개질된 면역글로불린 Fc 단편 및이를 포함하는 약제학적 조성물
EP2729161B1 (en) * 2011-07-08 2018-12-19 Bioverativ Therapeutics Inc. Factor viii chimeric and hybrid polypeptides, and methods of use thereof
WO2016175279A1 (ja) 2015-04-28 2016-11-03 サトーホールディングス株式会社 保管庫

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of EP1624891A4 *

Cited By (233)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8716240B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US8716239B2 (en) 2001-10-10 2014-05-06 Novo Nordisk A/S Granulocyte colony stimulating factor: remodeling and glycoconjugation G-CSF
US8853161B2 (en) 2003-04-09 2014-10-07 Novo Nordisk A/S Glycopegylation methods and proteins/peptides produced by the methods
US9636416B2 (en) 2003-05-06 2017-05-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8932830B2 (en) 2003-05-06 2015-01-13 Biogen Idec Hemophilia, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8329182B2 (en) 2003-05-06 2012-12-11 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7348004B2 (en) 2003-05-06 2008-03-25 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7381408B2 (en) 2003-05-06 2008-06-03 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US8449884B2 (en) 2003-05-06 2013-05-28 Syntonix Pharmaceuticals, Inc. Clotting factor-fc chimeric proteins to treat hemophilia
US11168125B2 (en) 2003-05-06 2021-11-09 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7404956B2 (en) 2003-05-06 2008-07-29 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US7820162B2 (en) 2003-05-06 2010-10-26 Syntonix Pharmaceuticals, Inc. Methods for chemically synthesizing immunoglobulin chimeric proteins
US11401322B2 (en) 2003-05-06 2022-08-02 Bioverativ Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US8815250B2 (en) 2003-05-06 2014-08-26 Biogen Idec Hemophilia Inc. Clotting factor-Fc chimeric proteins to treat hemophilia
EP2361932B1 (en) 2003-05-06 2016-05-04 Biogen Hemophilia Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9725496B1 (en) 2003-05-06 2017-08-08 Bioverative Therapeutics Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9005625B2 (en) 2003-07-25 2015-04-14 Novo Nordisk A/S Antibody toxin conjugates
US7736653B2 (en) 2003-11-13 2010-06-15 Hanmi Pharm. Co., Ltd Pharmaceutical composition comprising an immunoglobulin Fc region as a carrier
US8110665B2 (en) 2003-11-13 2012-02-07 Hanmi Holdings Co., Ltd. Pharmaceutical composition comprising an immunoglobulin FC region as a carrier
US10071166B2 (en) 2003-11-13 2018-09-11 Hanmi Science Co., Ltd. Protein complex using an immunoglobulin fragment and method for the preparation thereof
US7737260B2 (en) 2003-11-13 2010-06-15 Hanmi Pharm. Co., Ltd Protein complex using an immunoglobulin fragment and method for the preparation thereof
US8916360B2 (en) 2003-11-24 2014-12-23 Novo Nordisk A/S Glycopegylated erythropoietin
US8791066B2 (en) 2004-07-13 2014-07-29 Novo Nordisk A/S Branched PEG remodeling and glycosylation of glucagon-like peptide-1 [GLP-1]
US9200049B2 (en) 2004-10-29 2015-12-01 Novo Nordisk A/S Remodeling and glycopegylation of fibroblast growth factor (FGF)
US10874714B2 (en) 2004-10-29 2020-12-29 89Bio Ltd. Method of treating fibroblast growth factor 21 (FGF-21) deficiency
WO2006074199A1 (en) * 2005-01-05 2006-07-13 Syntonix Pharmaceuticals, Inc. Immunoglobulin chimeric monomer-dimer hybrids
US9029331B2 (en) 2005-01-10 2015-05-12 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
WO2006079120A3 (en) * 2005-01-24 2007-07-19 Univ Texas Fc-fusion constructs binding to phosphatidylserine and their therapeutic use
US8956616B2 (en) 2005-01-24 2015-02-17 Board Of Regents, The University Of Texas System Constructs binding to phosphatidylserine and their use in disease treatment
US9187546B2 (en) 2005-04-08 2015-11-17 Novo Nordisk A/S Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
EP1877037A2 (en) 2005-04-28 2008-01-16 Novo Nordisk Health Care AG A closed container comprising an activated factor vii polypeptide, processes for the preparation of the same, and a kit and a method for use of the kit
US8703706B2 (en) 2005-04-28 2014-04-22 Novo Nordisk Healthcare Ag Closed container comprising an activated factor VII polypeptide, processes for the preparation of the same, and a kit and a method for use of the kit
US8633300B2 (en) 2005-06-17 2014-01-21 Novo Nordisk Healthcare Ag Selective reduction and derivatization of engineered proteins comprising at least one non-native cysteine
US8911967B2 (en) 2005-08-19 2014-12-16 Novo Nordisk A/S One pot desialylation and glycopegylation of therapeutic peptides
US8841439B2 (en) 2005-11-03 2014-09-23 Novo Nordisk A/S Nucleotide sugar purification using membranes
US8765915B2 (en) 2006-02-06 2014-07-01 Csl Behring Gmbh Modified coagulation factor VIIa with extended half-life
US7795400B2 (en) 2006-03-24 2010-09-14 Syntonix Pharmaceuticals, Inc. PC5 as a factor IX propeptide processing enzyme
US7566565B2 (en) 2006-03-24 2009-07-28 Syntonix Pharmaceuticals, Inc. PC5 as a factor IX propeptide processing enzyme
US8021880B2 (en) 2006-03-24 2011-09-20 Syntonix Pharmaceuticals, Inc. PC5 as a factor IX propeptide processing enzyme
WO2007112005A3 (en) * 2006-03-24 2008-02-07 Syntonix Pharmaceuticals Inc Pc5 as a factor ix propeptide processing enzyme
EP2650305A1 (en) * 2006-03-24 2013-10-16 Biogen Idec Hemophilia Inc. PC5 as a factor IX propeptide processing enzyme
EP2213733A2 (en) 2006-05-24 2010-08-04 Novo Nordisk Health Care AG Factor IX analogues having prolonged in vivo half life
EP2256135B1 (en) 2006-06-14 2019-03-13 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
KR101641899B1 (ko) 2006-06-14 2016-08-01 체에스엘 베링 게엠베하 혈액 응고 인자를 포함하는 단백질분해적으로 절단가능한 융합 단백질
WO2007144173A1 (en) 2006-06-14 2007-12-21 Csl Behring Gmbh Proteolytically cleavable fusion protein comprising a blood coagulation factor
EP1867660A1 (en) * 2006-06-14 2007-12-19 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
EP3564267A1 (en) 2006-06-14 2019-11-06 CSL Behring GmbH Proteolytically cleavable fusion proteins with high molar specific activity
EP3564267B1 (en) 2006-06-14 2021-03-17 CSL Behring GmbH Proteolytically cleavable fusion proteins with high molar specific activity
EP2256135A1 (en) 2006-06-14 2010-12-01 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
KR20090023486A (ko) * 2006-06-14 2009-03-04 체에스엘 베링 게엠베하 혈액 응고 인자를 포함하는 단백질분해적으로 절단가능한 융합 단백질
US7939632B2 (en) 2006-06-14 2011-05-10 Csl Behring Gmbh Proteolytically cleavable fusion proteins with high molar specific activity
EP3896090A1 (en) 2006-06-14 2021-10-20 CSL Behring GmbH Proteolytically cleavable fusion protein comprising a blood coagulation factor
US9187532B2 (en) 2006-07-21 2015-11-17 Novo Nordisk A/S Glycosylation of peptides via O-linked glycosylation sequences
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
US8754194B2 (en) 2006-12-22 2014-06-17 Csl Behring Gmbh Modified coagulation factors with prolonged in vivo half-life
WO2008077616A1 (en) 2006-12-22 2008-07-03 Csl Behring Gmbh Modified coagulation factors with prolonged in vivo half-life
EP1935430A1 (en) * 2006-12-22 2008-06-25 CSL Behring GmbH Modified coagulation factors with prolonged in vivo half-life
KR101542752B1 (ko) * 2006-12-22 2015-08-10 체에스엘 베링 게엠베하 연장된 생체내 반감기를 갖는 변형된 응고 인자
EP3231440A1 (en) 2006-12-22 2017-10-18 CSL Behring GmbH Modified coagulation factors with prolonged in vivo half-life
AU2007338298B2 (en) * 2006-12-22 2013-02-07 Csl Behring Gmbh Modified coagulation factors with prolonged in vivo half-life
US8283319B2 (en) 2007-02-12 2012-10-09 Csl Behring Gmbh Therapeutic application of Kazal-type serine protease inhibitors
EP2526962A1 (en) 2007-02-12 2012-11-28 CSL Behring GmbH Therapeutic application of Kazal-type serine protease inhibitors
US9050304B2 (en) 2007-04-03 2015-06-09 Ratiopharm Gmbh Methods of treatment using glycopegylated G-CSF
US9493499B2 (en) 2007-06-12 2016-11-15 Novo Nordisk A/S Process for the production of purified cytidinemonophosphate-sialic acid-polyalkylene oxide (CMP-SA-PEG) as modified nucleotide sugars via anion exchange chromatography
US9150848B2 (en) 2008-02-27 2015-10-06 Novo Nordisk A/S Conjugated factor VIII molecules
EP2865760A1 (en) 2008-06-24 2015-04-29 CSL Behring GmbH Factor VIII, von Willebrand factor or complexes thereof with prolonged in vivo half-life
US9290561B2 (en) 2008-06-24 2016-03-22 Csl Behring Gmbh Factor VIII, von Willebrand factor or complexes thereof with prolonged in vivo half-life
US8575104B2 (en) 2008-06-24 2013-11-05 Csl Behring Gmbh Factor VIII, von willebrand factor or complexes thereof with prolonged in vivo half-life
JP2011525363A (ja) * 2008-06-24 2011-09-22 ツェー・エス・エル・ベーリング・ゲー・エム・ベー・ハー 延長されたインビボ半減期を有する第viii因子、フォン・ヴィレブランド因子又はそれらの複合体
EP2411024A4 (en) * 2009-03-24 2013-02-27 Bayer Healthcare Llc Variants of factor viii and associated methods of use
US9241978B2 (en) 2009-12-06 2016-01-26 Biogen Hemophilia Inc. Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof
EP4382170A2 (en) 2009-12-06 2024-06-12 Bioverativ Therapeutics Inc. Factor viii-fc chimeric and hybrid polypeptides, and methods of use thereof
US11266720B2 (en) 2009-12-06 2022-03-08 Bioverativ Therapeutics Inc. Factor VIII-FC chimeric and hybrid polypeptides, and methods of use thereof
EP3906937A1 (en) 2009-12-06 2021-11-10 Bioverativ Therapeutics Inc. Factor viii-fc chimeric and hybrid polypeptides, and methods of use thereof
US9050318B2 (en) 2009-12-06 2015-06-09 Biogen Idec Hemophilia Inc. Factor VIII-Fc chimeric and hybrid polypeptides, and methods of use thereof
EP3326643A1 (en) 2009-12-06 2018-05-30 Bioverativ Therapeutics Inc. Factor viii-fc chimeric and hybrid polypeptides, and methods of use thereof
EP2371857A1 (en) 2010-04-01 2011-10-05 CSL Behring GmbH Factor XII inhibitors for treating interstitial lung disease
US9150638B2 (en) 2010-04-01 2015-10-06 Justus-Liebig-Universität Giessen Factor XII inhibitors for treating interstitial lung disease
WO2011121123A1 (en) 2010-04-01 2011-10-06 Csl Behring Gmbh Factor xii inhibitors for treating interstitial lung disease
US10927362B2 (en) 2010-07-09 2021-02-23 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
US9629903B2 (en) 2010-07-09 2017-04-25 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
EP3560962A1 (en) * 2010-07-09 2019-10-30 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
US9233145B2 (en) 2010-07-09 2016-01-12 Biogen Hemophila Inc. Factor IX polypeptides and methods of use thereof
EP3552619A1 (en) 2010-07-09 2019-10-16 Bioverativ Therapeutics Inc. Factor ix polypeptides and methods of use thereof
US10898554B1 (en) 2010-07-09 2021-01-26 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US9867873B2 (en) 2010-07-09 2018-01-16 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
WO2012006635A1 (en) * 2010-07-09 2012-01-12 Biogen Idec Hemophilia Inc. Processable single chain molecules and polypeptides made using same
US10548954B2 (en) 2010-07-09 2020-02-04 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US9856468B2 (en) 2010-07-09 2018-01-02 Bioverativ Therapeutics Inc. Processable single chain molecules and polypeptides made using same
EP3508573A1 (en) 2010-07-09 2019-07-10 Bioverativ Therapeutics Inc. Systems for factor viii processing and methods thereof
US10561714B2 (en) 2010-07-09 2020-02-18 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US10568943B2 (en) 2010-07-09 2020-02-25 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US9675676B2 (en) 2010-07-09 2017-06-13 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US9611310B2 (en) 2010-07-09 2017-04-04 Bioverativ Therapeutics Inc. Systems for factor VIII processing and methods thereof
US9670475B2 (en) 2010-07-09 2017-06-06 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
US10968442B2 (en) 2010-07-09 2021-04-06 Bioverativ Therapeutics Inc. Chimeric clotting factors
US9623091B2 (en) 2010-07-09 2017-04-18 Bioverativ Therapeutics Inc. Factor IX polypeptides and methods of use thereof
WO2012061654A1 (en) 2010-11-03 2012-05-10 Catalyst Biosciences, Inc. Modified factor ix polypeptides and uses thereof
EP3663399A1 (en) 2010-11-03 2020-06-10 Catalyst Biosciences, Inc. Modified factor ix polypeptides and uses thereof
US9624307B2 (en) 2011-03-09 2017-04-18 The General Hospital Corporation Factor XII inhibitors for the treatment of silent brain ischemia and ischemia of other organs
US9352016B2 (en) 2011-03-09 2016-05-31 Csl Behring Gmbh Factor XII inhibitors for the administration with medical procedures comprising contact with artificial surfaces
US9987328B2 (en) 2011-03-09 2018-06-05 Csl Behring Gmbh Factor XII inhibitors for the administration with medical procedures comprising contact with artificial surfaces
WO2012120128A1 (en) 2011-03-09 2012-09-13 Csl Behring Gmbh Factor xii inhibitors for the administration with medical procedures comprising contact with artificial surfaces
WO2012120124A1 (en) 2011-03-09 2012-09-13 Csl Behring Gmbh Factor xii inhibitors for the treatment of silent brain ischemia and ischemia of other organs
EP2497489A1 (en) 2011-03-09 2012-09-12 CSL Behring GmbH Factor XII inhibitors for the treatment of silent brain ischemia and ischemia of other organs
US10881742B2 (en) 2011-07-08 2021-01-05 Bioverativ Therapeutics Inc. Factor VIII chimeric and hybrid polypeptides, and methods of use thereof
US12186375B2 (en) 2011-07-08 2025-01-07 Bioverativ Therapeutics Inc. Factor VIII chimeric and hybrid polypeptides, and methods of use thereof
EP3513804A1 (en) 2011-07-08 2019-07-24 Bioverativ Therapeutics Inc. Factor viii chimeric and hybrid polypeptides, and methods of use thereof
US10010622B2 (en) 2011-07-08 2018-07-03 Bioverativ Therapeutics Inc. Factor VIII chimeric and hybrid polypeptides, and methods of use thereof
EP4169525A1 (en) 2011-07-08 2023-04-26 Bioverativ Therapeutics Inc. Factor viii chimeric and hybrid polypeptides, and methods of use thereof
US9856326B2 (en) 2011-07-22 2018-01-02 Csl Behring Gmbh Methods of administering inhibitory anti-factor XII/XIIA monoclonal antibodies
US9856325B2 (en) 2011-07-22 2018-01-02 Csl Behring Gmbh Nucleic acids encoding inhibitory anti-factor XII/XIIa monoclonal antibodies
US10513560B2 (en) 2011-07-22 2019-12-24 Csl Behring Gmbh Methods of administering inhibitory anti-factor XII/XIIA monoclonal antibodies
US11345759B2 (en) 2011-07-22 2022-05-31 Csl Behring Gmbh Methods of administering inhibitory anti-factor XII/XIIa monoclonal antibodies
US9518127B2 (en) 2011-07-22 2016-12-13 Csl Behring Gmbh Inhibitory anti-factor XII/XIIA monoclonal antibodies and their uses
US11747351B2 (en) 2011-07-25 2023-09-05 Bioverativ Therapeutics Inc. Assays to monitor bleeding disorders
US10656167B2 (en) 2011-07-25 2020-05-19 Bioverativ Therapeutics Inc. Assays to monitor bleeding disorders
US9956269B2 (en) 2011-10-18 2018-05-01 Csl Limited Method for improving the stability of purified factor VIII after reconstitution
US10881717B2 (en) 2011-10-18 2021-01-05 Csl Limited Method for improving the stability of purified Factor VIII after reconstitution
US11510968B2 (en) 2011-10-18 2022-11-29 Csl Limited Method for improving the stability of purified Factor VIII after reconstitution
US9394353B2 (en) 2011-10-18 2016-07-19 Csl Limited Method for improving the stability of purified factor VIII after reconstitution
WO2013057219A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Method for improving the stability of purified factor viii after reconstitution
US9393289B2 (en) 2011-10-18 2016-07-19 Csl Behring Gmbh Use of sulfated glycosaminoglycans for improving the bioavailability of factor VIII
WO2013057167A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Use of sulfated glycosaminoglycans for improving the bioavailability of factor viii
WO2013057171A1 (en) 2011-10-18 2013-04-25 Csl Behring Gmbh Combined use of a sulfated glycosaminoglycan and a hyaluronidase for improving the bioavailability of factor viii
US10537616B2 (en) 2011-10-18 2020-01-21 Csl Limited Method for improving the stability of purified factor VIII after reconstitution
US9511123B2 (en) 2011-10-18 2016-12-06 Csl Behring Gmbh Combined use of a sulfated glycosaminoglycan and a hyaluronidase for improving the bioavailability of factor VIII
US10221455B2 (en) 2012-01-12 2019-03-05 Bioverativ Therapeutics Inc. Methods of reducing immunogenicity against factor VIII in individuals undergoing factor VIII therapy
EP3453402A1 (en) 2012-01-12 2019-03-13 Bioverativ Therapeutics Inc. Reducing immunogenicity against factor viii in individuals undergoing factor viii therapy
US12371747B2 (en) 2012-01-12 2025-07-29 Bioverativ Therapeutics Inc. Methods of reducing immunogenicity against factor VIII in individuals undergoing factor VIII therapy
EP3970737A1 (en) 2012-01-12 2022-03-23 Bioverativ Therapeutics Inc. Reducing immunogenicity against factor viii in individuals undergoing factor viii therapy
US11286528B2 (en) 2012-01-12 2022-03-29 Bioverativ Therapeutics Inc. Methods of reducing immunogenicity against factor VIII in individuals undergoing factor VIII therapy
US9957329B2 (en) 2012-01-31 2018-05-01 Csl Behring Gmbh Factor XII inhibitors for the treatment of neurological inflammatory disorders
WO2013113774A1 (en) 2012-01-31 2013-08-08 Csl Behring Gmbh Factor xii inhibitors for the treatment of neurological inflammatory disorders
WO2013120939A1 (en) 2012-02-15 2013-08-22 Csl Behring Gmbh Von willebrand factor variants having improved factor viii binding affinity
US9458223B2 (en) 2012-02-15 2016-10-04 Csl Behring Gmbh Von willebrand factor variants having improved factor VIII binding affinity
US10202595B2 (en) 2012-06-08 2019-02-12 Bioverativ Therapeutics Inc. Chimeric clotting factors
EP4079316A1 (en) 2012-06-08 2022-10-26 Bioverativ Therapeutics Inc. Procoagulant compounds
US11261437B2 (en) 2012-06-08 2022-03-01 Bioverativ Therapeutics Inc. Procoagulant compounds
US10287564B2 (en) 2012-06-08 2019-05-14 Bioverativ Therapeutics Inc. Procoagulant compounds
EP3693000A1 (en) 2012-06-08 2020-08-12 Bioverativ Therapeutics Inc. Procoagulant compounds
US11168316B2 (en) 2012-06-08 2021-11-09 Bioverativ Therapeutics, Inc. Chimeric clotting factors
EP3404105A1 (en) 2012-07-06 2018-11-21 Bioverativ Therapeutics Inc. Cell line expressing single chain factor viii polypeptides and uses thereof
US10023628B2 (en) 2012-07-06 2018-07-17 Bioverativ Therapeutics Inc. Cell line expressing single chain factor VIII polypeptides and uses thereof
US10001495B2 (en) 2012-07-25 2018-06-19 Bioverativ Therapeutics Inc. Blood factor monitoring assay and uses thereof
US11372008B2 (en) 2012-07-25 2022-06-28 Bioverativ Therapeutics Inc. Blood factor monitoring assay and uses thereof
EP3542861A1 (en) 2012-09-25 2019-09-25 Bioverativ Therapeutics Inc. Methods of using fix polypeptides
US11225650B2 (en) 2012-09-25 2022-01-18 Bioverativ Therapeutics Inc. Methods of using FIX polypeptides
WO2014063108A1 (en) 2012-10-18 2014-04-24 Biogen Idec Ma Inc. Methods of using a fixed dose of a clotting factor
US10391152B2 (en) 2012-10-18 2019-08-27 Bioverativ Therapeutics Inc. Methods of using a fixed dose of a clotting factor
EP3446700A1 (en) 2012-10-30 2019-02-27 Bioverativ Therapeutics Inc. Methods of using fviii polypeptide
EP3943102A1 (en) 2012-10-30 2022-01-26 Bioverativ Therapeutics Inc. Methods of using fviii polypeptide
US10286047B2 (en) 2013-03-08 2019-05-14 Csl Behring Gmbh Treatment and prevention of remote ischemia-reperfusion injury
US10973891B2 (en) 2013-03-08 2021-04-13 Csl Behring Gmbh Treatment and prevention of remote ischemia-reperfusion injury
EP4122487A1 (en) 2013-03-15 2023-01-25 Bioverativ Therapeutics Inc. Factor viii polypeptide formulations
EP3666283A1 (en) 2013-03-15 2020-06-17 Bioverativ Therapeutics Inc. Factor viii polypeptide formulations
WO2014144795A1 (en) 2013-03-15 2014-09-18 Biogen Idec Ma Inc. Factor viii polypeptide formulations
US12403183B2 (en) 2013-03-15 2025-09-02 Bioverativ Therapeutics Inc. Factor VIII polypeptide formulations
US9623088B2 (en) 2013-03-15 2017-04-18 Bioverativ Therapeutics Inc. Factor VIII polypeptide formulations
US10786554B2 (en) 2013-03-15 2020-09-29 Bioverativ Therapeutics Inc. Factor VIII polypeptide formulations
US10588949B2 (en) 2013-03-15 2020-03-17 Bioverativ Therapeutics Inc. Factor IX polypeptide formulations
US11642398B2 (en) 2013-03-15 2023-05-09 Bioverativ Therapeutics Inc. Factor IX polypeptide formulations
US9878017B2 (en) 2013-04-22 2018-01-30 Csl Ltd. Covalent complex of von Willebrand Factor and factor VIII, compositions, and uses relating thereto
WO2014173873A1 (en) 2013-04-22 2014-10-30 Csl Behring Gmbh Complex
WO2014207199A1 (en) 2013-06-28 2014-12-31 Csl Behring Gmbh Combination therapy using a factor xii inhibitor and a c1-inhibitor
US10611794B2 (en) 2013-09-25 2020-04-07 Bioverativ Therapeutics Inc. On-column viral inactivation methods
EP3903599A1 (en) 2013-09-25 2021-11-03 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US12134632B2 (en) 2013-09-25 2024-11-05 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US11578098B2 (en) 2013-09-25 2023-02-14 Bioverativ Therapeutics Inc. On-column viral inactivation methods
US10325687B2 (en) 2013-12-06 2019-06-18 Bioverativ Therapeutics Inc. Population pharmacokinetics tools and uses thereof
EP4332839A2 (en) 2013-12-06 2024-03-06 Bioverativ Therapeutics Inc. Population pharmacokinetics tools and uses thereof
WO2015085276A1 (en) 2013-12-06 2015-06-11 Biogen Idec Ma Inc. Population pharmacokinetics tools and uses thereof
WO2015148444A1 (en) 2014-03-24 2015-10-01 Biogen Ma Inc. Lyophilized factor ix formulations
US10772942B2 (en) 2014-03-24 2020-09-15 Bioverativ Therapeutics Inc. Lyophilized factor IX formulations
US12128092B2 (en) 2014-03-24 2024-10-29 Bioverativ Therapeutics Inc. Lyophilized factor IX formulations
WO2015193457A1 (en) 2014-06-18 2015-12-23 Csl Behring Gmbh Therapy using a factor xii inhibitor in a neurotraumatic disorder
US12065481B2 (en) 2014-06-18 2024-08-20 Csl Behring Gmbh Therapy using a factor XII inhibitor in a neurotraumatic disorder
US10253088B2 (en) 2014-07-02 2019-04-09 CSL Behring Lengnau AG Modified von Willebrand Factor
WO2016000039A1 (en) 2014-07-02 2016-01-07 Csl Limited Modified von willebrand factor
CN104292341A (zh) * 2014-10-11 2015-01-21 上海兴迪金生物技术有限公司 一种凝血八因子融合蛋白及其制备方法和用途
US10881741B2 (en) 2014-12-19 2021-01-05 Alkermes, Inc. Single chain Fc fusion proteins
US11155601B2 (en) 2015-03-06 2021-10-26 CSL Behring Lengnau AG Modified von Willebrand factor having improved half-life
WO2016142288A1 (en) 2015-03-06 2016-09-15 Csl Behring Recombinant Facility Ag Modified von willebrand factor having improved half-life
US10688157B2 (en) 2015-05-22 2020-06-23 CSL Behring Lengnau AG Truncated von Willebrand factor polypeptides for treating hemophilia
EP4089109A2 (en) 2015-05-22 2022-11-16 CSL Behring Lengnau AG Methods for preparing modified von willebrand factor
WO2016188907A1 (en) 2015-05-22 2016-12-01 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for treating hemophilia
US11564976B2 (en) 2015-05-22 2023-01-31 CSL Behring Lengnau AG Methods for preparing modified von Willebrand Factor
US10772936B2 (en) 2015-05-22 2020-09-15 CSL Behring Lengnau AG Methods for preparing modified von Willebrand factor
WO2016188905A1 (en) 2015-05-22 2016-12-01 Csl Behring Recombinant Facility Ag Methods for preparing modified von willebrand factor
US10905747B2 (en) 2015-05-22 2021-02-02 CSL Behring Lengnau AG Methods for preparing modified von Willebrand factor
EP3184149A1 (en) 2015-12-23 2017-06-28 Julius-Maximilians-Universität Würzburg Soluble glycoprotein v for treating thrombotic diseases
US11028144B2 (en) 2015-12-23 2021-06-08 Julius-Maximilians-Universität Würzburg Soluble glycoprotein V for treating thrombotic diseases
WO2017117631A1 (en) 2016-01-07 2017-07-13 Csl Limited Mutated truncated von willebrand factor
US10806774B2 (en) 2016-01-07 2020-10-20 CSL Behring Lengnau AG Mutated truncated von Willebrand Factor
US10808023B2 (en) 2016-01-07 2020-10-20 CSL Behring Lengnau AG Mutated von Willebrand factor
US11174321B2 (en) 2016-04-06 2021-11-16 Csl Limited Method of treating atherosclerosis
US11534480B2 (en) 2016-06-22 2022-12-27 Alkermes, Inc. Compositions and methods for modulating IL-10 immunostimulatory and anti-inflammatory properties
US10335459B2 (en) 2016-06-22 2019-07-02 Alkermes, Inc. Compositions for modulating IL-10 immunostimulatory and anti-inflammatory properties
US11814421B2 (en) 2016-11-11 2023-11-14 CSL Behring Lengnau AG Truncated von Willebrand Factor polypeptides for treating hemophilia
US11890327B2 (en) 2016-11-11 2024-02-06 CSL Behring Lengnau AG Truncated von Willebrand factor polypeptides for extravascular administration in the treatment or prophylaxis of a blood coagulation disorder
WO2018087267A1 (en) 2016-11-11 2018-05-17 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for treating hemophilia
WO2018087271A1 (en) 2016-11-11 2018-05-17 Csl Behring Recombinant Facility Ag Truncated von willebrand factor polypeptides for extravascular administration in the treatment or prophylaxis of a blood coagulation disorder
WO2018102760A1 (en) 2016-12-02 2018-06-07 Bioverativ Therapeutics Inc. Methods of inducing immune tolerance to clotting factors
US12161696B2 (en) 2016-12-02 2024-12-10 Bioverativ Therapeutics Inc. Methods of treating hemophilic arthropathy using chimeric clotting factors
US12257288B2 (en) 2016-12-02 2025-03-25 Bioverativ Therapeutics Inc. Methods of inducing immune tolerance to clotting factors
WO2018102743A1 (en) 2016-12-02 2018-06-07 Bioverativ Therapeutics Inc. Methods of treating hemophilic arthropathy using chimeric clotting factors
US11872194B2 (en) 2017-03-14 2024-01-16 Ohio State Innovation Foundation Methods and compositions related to a tissue factor-targeting IGG3 immunoconjugates
CN110520152A (zh) * 2017-03-14 2019-11-29 俄亥俄州创新基金会 与靶向组织因子的igg3免疫缀合物有关的方法和组合物
EP3595707A4 (en) * 2017-03-14 2021-01-13 Ohio State Innovation Foundation METHODS AND COMPOSITIONS RELATING TO IGG3 IMMUNOCONJUGATES TARGETING TISSUE FACTOR
WO2018234518A1 (en) 2017-06-22 2018-12-27 CSL Behring Lengnau AG Modulation of fviii immunogenicity by truncated vwf
US11141466B2 (en) 2017-06-22 2021-10-12 CSL Behring Lengnau AG Modulation of FVIII immunogenicity by truncated VWF
US11491212B1 (en) 2017-09-27 2022-11-08 Catalyst Biosciences, Inc. Subcutaneous administration of modified factor IX polypeptides and treatment of hemophilia B
WO2019067766A1 (en) 2017-09-27 2019-04-04 Sigilon Therapeutics, Inc. METHODS, COMPOSITIONS AND IMPLANTABLE ELEMENTS COMPRISING ACTIVE CELLS
WO2019191295A1 (en) 2018-03-28 2019-10-03 Bristol-Myers Squibb Company Interleukin-2/interleukin-2 receptor alpha fusion proteins and methods of use
WO2019195056A1 (en) 2018-04-04 2019-10-10 Sigilon Therapeutics, Inc. Methods, compositions, and implantable elements comprising stem cells
WO2019195055A1 (en) 2018-04-04 2019-10-10 Sigilon Therapeutics, Inc. Implantable particles and related methods
US12030925B2 (en) 2018-05-18 2024-07-09 Bioverativ Therapeutics Inc. Methods of treating hemophilia A
WO2020069429A1 (en) 2018-09-27 2020-04-02 Sigilon Therapeutics, Inc. Implantable devices for cell therapy and related methods
WO2020234195A1 (en) 2019-05-17 2020-11-26 Universitaet Zuerich Haptoglobin for use in treating an adverse secondary neurological outcome following a haemorrhagic stroke
WO2021001522A1 (en) 2019-07-04 2021-01-07 CSL Behring Lengnau AG A truncated von willebrand factor (vwf) for increasing the in vitro stability of coagulation factor viii
WO2021094344A1 (en) 2019-11-11 2021-05-20 CSL Behring Lengnau AG Polypeptides for inducing tolerance to factor viii
US12054495B2 (en) 2019-11-25 2024-08-06 Alkermes, Inc. Substituted macrocyclic compounds and related methods of treatment
WO2021154414A2 (en) 2020-01-29 2021-08-05 Catalyst Biosciences, Inc. Gene therapy for hemophilia b with a chimeric aav capsid vector encoding modified factor ix polypeptides
WO2021158938A1 (en) 2020-02-06 2021-08-12 Bristol-Myers Squibb Company Il-10 and uses thereof
WO2022094275A1 (en) 2020-10-29 2022-05-05 Bristol-Myers Squibb Company Fusion proteins for the treatment of disease
WO2022109124A1 (en) 2020-11-20 2022-05-27 Csl Behring Gmbh Method for treating antibody-mediated rejection
US12441710B2 (en) 2020-12-21 2025-10-14 Alkermes, Inc. Substituted piperidino compounds and related methods of treatment
WO2022162218A1 (en) 2021-02-01 2022-08-04 Csl Behring Ag Method of treating or preventing an adverse secondary neurological outcome following a haemorrhagic stroke
WO2022234070A1 (en) 2021-05-07 2022-11-10 Csl Behring Ag Expression system for producing a recombinant haptoglobin (hp) beta chain
WO2024047219A1 (en) 2022-09-02 2024-03-07 Csl Behring Ag Haptoglobin for use in treating or preventing exaggerated erectile response or erectile dysfunction
WO2024081310A1 (en) 2022-10-11 2024-04-18 Sigilon Therapeutics, Inc. Engineered cells and implantable elements for treatment of disease
WO2024081309A1 (en) 2022-10-11 2024-04-18 Sigilon Therapeutics, Inc. Engineered cells and implantable elements for treatment of disease
WO2025257801A1 (en) 2024-06-13 2025-12-18 CSL Innovation Pty Ltd Heme-binding protein for the treatment of ischemia-reperfusion injury (iri)

Also Published As

Publication number Publication date
US20180237762A1 (en) 2018-08-23
SI1624891T1 (sl) 2010-01-29
CA2522859C (en) 2017-10-24
AU2010201711C1 (en) 2012-11-08
SI1624891T2 (sl) 2013-09-30
HK1134432A1 (en) 2010-04-30
SI2077121T1 (sl) 2011-07-29
DK2298347T3 (en) 2016-01-11
EP1624891A2 (en) 2006-02-15
FR16C0041I2 (fr) 2019-07-05
FR16C0041I1 (enExample) 2016-09-12
EP2077121B1 (en) 2011-02-09
EP1624891B2 (en) 2013-04-10
AU2010201711B2 (en) 2012-04-05
PL2077121T3 (pl) 2011-07-29
ATE497783T1 (de) 2011-02-15
DE602004022800D1 (de) 2009-10-08
EP2298347A1 (en) 2011-03-23
AU2004239244A1 (en) 2004-11-25
EP1624891A4 (en) 2007-06-06
EP2077121A1 (en) 2009-07-08
AU2004239244B2 (en) 2010-01-28
AU2010201711A1 (en) 2010-05-20
US8449884B2 (en) 2013-05-28
BE2016C058I2 (enExample) 2023-08-09
EP2298347B1 (en) 2015-09-30
CY1109640T1 (el) 2014-08-13
CY1111725T1 (el) 2015-10-07
HK1153947A1 (en) 2012-04-20
PL1624891T5 (pl) 2014-02-28
CY2016039I1 (el) 2017-03-15
CA2522859A1 (en) 2004-11-25
US20210348150A1 (en) 2021-11-11
NL300835I2 (enExample) 2017-03-16
PT1624891E (pt) 2010-01-05
CY1117090T1 (el) 2017-03-15
US8815250B2 (en) 2014-08-26
ES2333598T3 (es) 2010-02-24
WO2004101740A3 (en) 2005-10-27
EP3002012A1 (en) 2016-04-06
US20110182896A1 (en) 2011-07-28
US20150044207A1 (en) 2015-02-12
ATE440619T1 (de) 2009-09-15
DK1624891T4 (da) 2013-07-15
DK2077121T3 (da) 2011-06-06
HUE026384T2 (en) 2016-06-28
ES2361036T3 (es) 2011-06-13
EP3002012A9 (en) 2016-11-16
CY2016039I2 (el) 2017-03-15
US20130273047A1 (en) 2013-10-17
ES2558102T3 (es) 2016-02-02
AU2004239244C1 (en) 2015-04-23
LU93265I2 (fr) 2016-12-19
EP1624891B1 (en) 2009-08-26
PT2077121E (pt) 2011-05-23
DE602004031390D1 (de) 2011-03-24
EP3552627A1 (en) 2019-10-16
PL2298347T3 (pl) 2016-03-31
ES2333598T5 (es) 2013-09-04
PT2298347E (pt) 2016-01-29
HUS1600041I1 (hu) 2016-11-28
US20050147618A1 (en) 2005-07-07
PL1624891T3 (pl) 2010-02-26
SI2298347T1 (sl) 2016-03-31
DK1624891T3 (da) 2010-01-04

Similar Documents

Publication Publication Date Title
US20210348150A1 (en) Clotting factor-fc chimeric proteins to treat hemophilia
EP3103809B1 (en) Immunoglobulin chimeric monomer-dimer hybrids
AU2012203896B2 (en) Clotting Factor-Fc Chimeric Proteins to Treat Hemophilia
HK40015592A (en) Clotting factor-fc chimeric proteins to treat hemophilia
AU2012200470B2 (en) Immunoglobulin Chimeric Monomer-Dimer Hybrids
HK1153947B (en) Clotting factor chimeric proteins for treatment of a hemostatic disorder
HK1134432B (en) Clotting factor vii-fc chimeric proteins for treatment of a hemostatic disorder
HK40072272A (en) Immunoglobulin chimeric monomer-dimer hybrids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2522859

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2004239244

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004751357

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004239244

Country of ref document: AU

Date of ref document: 20040506

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004239244

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2004751357

Country of ref document: EP