WO2003092600A2 - Site specific listeria integration vectors and methods for using the same - Google Patents
Site specific listeria integration vectors and methods for using the same Download PDFInfo
- Publication number
- WO2003092600A2 WO2003092600A2 PCT/US2003/013492 US0313492W WO03092600A2 WO 2003092600 A2 WO2003092600 A2 WO 2003092600A2 US 0313492 W US0313492 W US 0313492W WO 03092600 A2 WO03092600 A2 WO 03092600A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- integration
- listeria
- vector
- site
- monocytogenes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0208—Specific bacteria not otherwise provided for
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/975—Kit
Definitions
- the field of this invention is Listeria species, e.g., Listeria monocytogenes, particularly recombinant strains of Listeria species, and methods for their fabrication and use.
- Listeria species e.g., Listeria monocytogenes, particularly recombinant strains of Listeria species, and methods for their fabrication and use.
- Listeria monocytogenes is a Gram-positive, food-borne human and animal pathogen responsible for serious infections in immunocompromised individuals and pregnant women. Severe L. monocytogenes infections in humans are characterized by meningitis, meningoencephalitis, septicemia, and fetal death. L. monocytogenes is ubiquitous in nature and, in addition, can be isolated from a wide variety of warm blooded animals.
- Protocols for recombinantly engineering Listeria species are of interest in both research and therapeutic applications.
- Listeria species transformation protocols find use in the elucidation of the mechanisms responsible for growth and virulence of these types of bacteria.
- such protocols also find use in the preparation of live Listeria vaccines, which vaccines find use in a variety of different medical applications.
- a variety of different protocols have been employed to transform Listeria species, where such protocols include: homologous recombination, transposon based recombination, etc. While different protocols are currently available for engineering Listeria species, such methods are not entirely satisfactory.
- Patents and published patent applications of interest include: U.S. Patent No. 5,830,702 and published PCT application serial nos.: WO 99/25376 and WO 00/09733.
- the subject vectors include a bacteriophage integrase gene and a bacteriophage attachment site, where in many embodiments the bacteriophage that is source of these elements is a listeriophage.
- the subject vectors further include a multiple cloning site, where the multiple cloning site may further include a coding sequence, e.g., a coding sequence for a heterologous polypeptide, etc.
- the subject vectors and methods find use in a variety of different applications, including the study of Listeria species and the preparation of Listeria species, vaccines.
- FIG. 1 Plasmid map of the pPL1 integration vector.
- SEQ ID NO:24 provides the sequence of pPL1. Chloramphenicol resistance genes and E. coli origin of replication are shown in grey, RP4 origin of transfer shown in white, integrase gene and L. monocytogenes p60 promoter shown in black. Multiple cloning site is shown at the bottom of the plasmid with unique restriction sites noted below the MCS in a box.
- pPL24 and pPL25 inserts are shown schematically below the MCS and were cloned as described in Materials and Methods.
- SEQ ID NO:28 provides the sequence of pPL2. The color scheme and genes are the same as in FIG. 1A except the PSA integrase and PSAattPF sites as noted. The multiple cloning site with 13 unique restriction sites is shown at the bottom of the plasmid.
- FIG. 2 Genomic organization of the attachment sites within the comK gene (A and B) and the tRNA Ar9 gene (C and D).
- A Non-lysogenic L. monocytogenes strain, with an intact comK gene. Primers PL60 and PL61 amplify across the bacterial attachment site comK-attBB'.
- B Lysogenic L. monocytogenes strain (with approximately 40 kb of phage DNA inserted into the comK gene) or integrated strain (with pPL1 construct inserted into the comK gene). Primers PL14 and PL61 amplify across the hybrid attachment site comK- attPB'.
- Primers NC16 and NC17 amplify across the bacterial attachment site tRNA Arg - attBB' in serotype 4b strains. Asterisk indicates primers NC16 and NC17 are substituted with PL102 and PL103 to amplify across the bacterial attachment site tRNA Ar9 -af- ⁇ ' in serotype 1/2 strains.
- Primers NC16 and PL95 amplify across the hybrid attachment site tRNA Arg -a-fBP' in both serotype 4b and 1/2 strains.
- FIG. 3 Expression and functional complementation of ActA in SLCC- 5764.
- A Coomassie blue stained SDS-PAGE of SLCC-5764 derived strains grown to late-log phase. ActA is indicated by an arrow. Lane 1 : molecular size marker; lane 2: DP-L3780; lane 3: DP-L4083; lane 4: DP-L4086; lane 5: SLCC- 5764; lane 6: DP-L4082; lane 7: DP-L4084; lane 8: DP-L4085; lane 9: DP-L4087. Strains are described in Table 1.
- B Actin tail formation and movement of DP- L4087 in Xenopus cell extract. The top panel is a phase image; the bottom panel is a fluorescent image of the same field.
- FIG 4. Clover-leaf diagram of tRNA Arg utilized as the PSA attachment site. The arginine anticodon is circled. The region with sequence identity between the tRNA gene and the PSA attPP' is outlined. The boundaries of the tRNA Arg gene and Cove score (82.37) were predicted with tRNAscan-SE (31).
- B Alignment of the tRNA Ar9 -af- ⁇ ' region of L. monocytogenes WSLC 1042 (top line) and the attPP' region of PSA downstream of the integrase gene. The 74 nt tRNA Arg gene of L.
- the subject vectors include a bacteriophage integrase gene and a bacteriophage attachment site, where in many embodiments the bacteriophage that is source of these elements is a listeriophage.
- the subject vectors further include a multiple cloning site, where the multiple cloning site may further include a coding sequence, e.g., for a heterologous polypeptide, etc.
- the subject vectors and methods find use in a variety of different applications, including the study of Listeria species and the preparation of Listeria species vaccines.
- the subject vectors are reviewed first in greater detail, followed by a review of the methods of using the subject vectors, as well as representative applications in which the subject vectors and methods find use.
- the subject invention provides Listeria site-specific integration vectors, i.e., vectors that integrate into Listeria genomes in a site- specific manner.
- the subject vectors are characterized in that they stably integrate into a genome of a Listeria species in a site-specific, as opposed to random, manner.
- the vectors of the subject invention typically are inserted into a specific location or sequence (i.e., domain, location) of the target genome by a mechanims mediated by a recombinase, specifically an integrase, where the integrase is one that uses two distinct recognition sites as substrates, one of which is positioned in the integration site of the target genome (the site into which a nucleic acid is to be integrated) and another adjacent a nucleic acid of interest to be introduced into the integration site (i.e., a site on the subject vector referred to herein as the "bacteriophage attachment site").
- the recognition sites for phage integrases are generically referred to as attB, which is present in the bacterial genome (into which nucleic acid is to be inserted) and attP (which is present in the phage nucleic acid adjacent the nucleic acid for insertion into the bacterial genome, which is referred to herein as the "bacteriophage attachment site").
- Recognition sites can be native (endogenous to a target genome) or altered relative to a native sequence.
- Use of the term "recognize” in the context of an integrase "recognizes" a recognition sequence is meant to refer to the ability of the integrase to interact with the recognition site and facilitate site- specific recombination.
- the subject vectors are capable of integrating into the genomes of a wide variety of different Listeria species. Integration is readily determined by using any convenient assay, including those known to those of skill in the art, that can identify whether or not vector DNA has integrated into the genomic DNA of a target organism.
- vector DNA can be introduced into a target organism, e.g., via conjugation, and then integration can be determined via PCR amplification of the integrated sequence using primers flanking the target site, where the size of the amplification product is determinative of whether integration has occurred.
- An example of such an assay is provided in the experimental section, below. Additional features of many embodiments of the subject vectors is that they replicate autonomously in a non-Listeria host cell, e.g., E. coli, and are stable and innocuous in such non-Listeria host cells.
- the subject integration vectors are typically double-stranded plasmid vectors, where the vectors are generally at least about 3 kb, often at least about 5 kb and may be large as 15 kb, 20 kb, 25 kb, 30 kb or larger, where the vectors sometimes range in size from about 3-6 to about 20 kb.
- the vectors include a number of structural features that impart to the vectors the above-described functional characteristics.
- bacteriophage integrase gene i.e., a nucleic acid coding sequence for a bacteriophage integrase, which is operably linked to a Listeria specific promoter, such that the gene (coding sequence) is expressed in the Listeria cell for which the vector is designed to be employed.
- the bacteriophage integrase gene is one obtained from a listeriophage, i.e., it is a listeriophage integrase gene.
- integrase gene i.e., the integrase encoding nucleic acid.
- Specific integrases of interest include, but are not limited to: the U153 integrase, the PSA integrase; and the like.
- the integrase gene is operably linked to a promoter
- any convenient promoter may be employed, where in certain embodiments the promoter is a Listeria specific promoter.
- promoters of interest include, but are not limited to: the Listeria p60 promoter, the Listeria actA promoter, the Listeria plcA promoter, the Listeria mpl promoter, the Listeria plcB promoter, the Listeria inlA promoter; a heat shock promoter; and the like
- Promoters may also include certain bacteriophage promoters such as the promoters for T7, Q ⁇ , SP6 and the like if the strain of Listeria also expresses the cognate bacteriophage RNA polymerase.
- the subject vectors also include a phage attachment site, i.e., a sequence or domain of nucleotides that provide for a site-specific integration with a Listeria genome.
- a phage attachment site i.e., a sequence or domain of nucleotides that provide for a site-specific integration with a Listeria genome. Any convenient phage attachment site may be employed, where selection of the phage attachment site will depend, at least in part, on the desired integration location for the vector.
- Representative phage attachment sites of interest include, but are not limited to: the comK integration site (as described in greater detail in the experimental section below); the tRNA Arg integration site (as described in greater detail in the experimental section below); and the like.
- the subject vectors may include an origin of replication that provides for replication of the vector in a non-Listeria host cell, e.g., E.coli.
- This origin of replication may be any convenient origin of replication or ori site, where a number of ori sites are known in the art, where particular sites of interest include, but are not limited to: p15A; pSC101 ; ColEI; pUC; pMB9; and the like.
- the subject vectors may include an origin of transfer site or element when convenient, e.g., when the vector is introduced in the target Listeria cell using a conjugation protocol, as described in greater detail below.
- Any convenient origin of transfer may be employed, where representative origins of transfer of interest include, but are not limited to: RP4 oriT; RSF1010 oriT; and the like.
- the subject vectors typically include at least one restriction endonuclease recognized site, i.e., restriction site, which is located on the vector at a location which is amenable to insertion of a heterologous gene/expression cassette.
- restriction sites are known in the art and may be present on the vector, where such sites include those recognized by the following restriction enzymes: H/ ⁇ dlll, Psfl, Sail, Acc ⁇ , HincW, Xba ⁇ , ⁇ amHI, Smal, Xma ⁇ , Kpn ⁇ , Sac ⁇ , EcoRI, Ss-XI, Eagl, ⁇ /o-1, Spel and the like.
- the vector includes a polylinker or multiple cloning site, i.e., a closely arranged series or array of sites recognized by a plurality of different restriction enzymes, such as those listed above.
- the subject vectors include at least one coding sequence, e.g., a coding sequence for heterologous polypeptide/protein coding sequence present in the multiple cloning site, e.g., as a result of using a restriction endonuclease site present in the multiple cloning site to insert the coding sequence into the vector, according to well known recombinant technology protocols.
- heterologous is meant that the coding sequence encodes a product, e.g., a protein, peptide, polypeptide, glycoprotein, lipoprotein, or other macromolecule, that is not normally expressed in Listeria.
- this coding sequence is part of an expression cassette, which provides for expression of the coding sequence in the Listeria cell for which the vector is designed.
- expression cassette refers to an expression module or expression construct made up of a recombinant DNA molecule containing at least one desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism, i.e., the Listeria cell for which the vector is designed, such as the promoter/regulatory/signal sequences identified above, where the expression cassette may include coding sequences for two or more different polypeptides, or multiple copies of the same coding sequence, as desired.
- the size of the coding sequence and/or expression cassette that includes the same may vary, but typically falls within the range of about 25-30 to about 6000 bp, usually from about 50 to about 2000 bp. As such, the size of the encoded product may vary greatly, and a broad spectrum of different products may be encoded by the expression cassettes present in the vectors of this embodiment.
- the nature of the coding sequence and other elements of the expression cassette may vary, depending on the particular application of the vector, e.g., to study Listeria species, to produce Listeria species vaccines, for cytosolic delivery of macromolecules, etc.
- the coding sequence may encode a heterologous antigen, where representative heterologous antigens of interest include, but are not limited to: (a) viral antigens, e.g., influenza np protein, HIV gag protein, HIV env protein or parts thereof, e.g., gp120 and gp41 , HIV nef protein, HIV pol proteins, HIV reverse transcriptase, HIV protease, herpes virus proteins, etc., (b) malarial antigens; (c) fungal antigens; (d) bacterial antigens; (e) tumor and tumor related antigens; and the like.
- viral antigens e.g., influenza np protein, HIV gag protein, HIV env protein or parts thereof, e.g., gp120 and gp41 , HIV nef protein, HIV pol proteins, HIV reverse transcriptase, HIV protease, herpes virus proteins, etc.
- malarial antigens e.g., g
- the expression cassette may include a coding sequence for a fusion protein of a selected foreign antigen and a protein that directs secretion, e.g., Listeriolysin O or PI-PLC; a signal sequence, such as hemolysin signal sequence, etc.
- a fusion protein of a selected foreign antigen and a protein that directs secretion e.g., Listeriolysin O or PI-PLC
- a signal sequence such as hemolysin signal sequence, etc.
- the heterologous polypeptide coding sequence may be a cytolysin, e.g., phospholipase, pore forming toxin, listeriolysin O, streptolysin O, perfringolysin O, acid activated cytolysins, phage lysins, etc.
- Other coding sequences of interest include, but are not limited to: cytokines, costimulatory molecules, and the like.
- the vector may include at least one coding sequence, where in certain embodiments the vectors include two or more coding sequences, where the coding sequences may encode products that act concurrently to provide a desired results.
- the coding sequence may encode any of a number of different products and may be of a variety of different sizes, where the above discussion merely provides representative coding sequences of interest.
- the vectors of the subject invention may be produced using any convenient protocol, including by standard methods of restriction enzyme cleavage, ligation and molecular cloning.
- One protocol for constructing the subject vectors includes the following steps. First, purified nucleic acid fragments containing desired component nucleotide sequences as well as extraneous sequences are cleaved with restriction endonucleases from initial sources. Fragments containing the desired nucleotide sequences are then separated from unwanted fragments of different size using conventional separation methods, e.g., by agarose gel electrophoresis. The desired fragments are excised from the gel and ligated together in the appropriate configuration so that a circular nucleic acid or plasmid containing the desired sequences, e.g.
- sequences corresponding to the various elements of the subject vectors, as described above is produced.
- the circular molecules so constructed are then amplified in a host, e.g. E. coli.
- a host e.g. E. coli.
- the procedures of cleavage, plasmid construction, cell transformation and plasmid production involved in these steps are well known to one skilled in the art and the enzymes required for restriction and ligation are available commercially. (See, for example, R. Wu, Ed., Methods in Enzymology, Vol. 68, Academic Press, N.Y. (1979); T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982); Catalog 1982-83, New England Biolabs, Inc.; Catalog 1982-83, Bethesda Research Laboratories, Inc. An example of how to construct a vector of the present invention is provided in the Experimental section, below.
- Also provided by the subject invention are methods of using the above described Listeria site specific integration vectors to integrate a heterologous nucleic acid into a Listeria genome.
- a vector of the subject invention is introduced into a target Listeria cell under conditions sufficient for integration of the vector into the target cell genome to occur. Any convenient protocol for introducing the vector into the target cell may be employed.
- Suitable protocols include: calcium phosphate mediated transfection; protoplast fusion, in which protoplasts harboring amplified amounts of vector are fused with the target cell; electroporation, in which a brief high voltage electric pulse is applied to the target cell to render the cell membrane of the target cell permeable to the vector; microinjection, in which the vector is injected directly into the cell, as described in Capechhi et al, Cell (1980) 22: 479; and the like.
- the above in vitro protocols are well known in the art and are reviewed in greater detail in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press)(1989) pp16.30-16.55.
- one representative method that may be employed is a conjugation method, which comprises: (a) introducing the vector into a non-Listeria host cell, e.g., E.coli; followed by (b) transfer of the vector from the non-Listeria host cell to the Listeria host cell, e.g., by conjugation.
- a conjugation method which comprises: (a) introducing the vector into a non-Listeria host cell, e.g., E.coli; followed by (b) transfer of the vector from the non-Listeria host cell to the Listeria host cell, e.g., by conjugation.
- Introduction into the non-Listeria host cell may be accomplished using any of the protocols described above.
- any convenient protocol may be employed, where suitable protocols typically include combining the donor and acceptor cells in a suitable medium and maintaining under suitable conditions for conjugation and vector transfer to occur. Specific representative conditions are provided in the Experimental section below.
- the above methods result in stable integration of the vector and any expression cassette carried thereby, e.g., that encodes a heterologous protein/foreign antigen, into a target Listeria cell genome in a site specific manner.
- the subject methods find use with a wide variety of different Listeria species.
- the subject vectors and methods of using may be employed in research of Listeria species.
- the subject vectors and methods allow simple and efficient strain construction and are widely useful in various strains used to study the intracellular life cycle of /_. monocytogenes.
- the subject vectors and methods may be employed to produce stable merodiploid strains to allow refined copy number studies and studies of interactions within a protein through multimerization and testing of the dominance or recessive nature of different alleles of a gene in the same bacterial strain.
- the subject vectors and methods also find use in vaccine preparation applications.
- the subject vectors find use in the production of Listeria cultures capable of expressing a heterologous antigen, i.e., Listeria vaccines, where the Listeria cells employed may be attenuated.
- the attenuated strains employed may be capable of normal invasion of a host cell, but incapable of normal survival or growth in the cell or cell-to-cell spread, or they may have other alterations that preclude normal pathogenicity.
- the vaccines produced using vectors of the present invention are administered to a vertebrate by contacting the vertebrate with a sublethal dose of the genetically engineered Listeria vaccine, where contact typically includes administering the vaccine to the host.
- the present invention provides for vaccines genetically engineered with the integration vector and provided in a pharmaceutically acceptable formulation.
- Administration can be oral, parenteral, intranasal, intramuscular, intravascular, direct vaccination of lymph nodes, administration by catheter or any one or more of a variety of well-known administration routes.
- the vaccine may be administered orally by incorporation of the vaccine in feed or liquid (such as water).
- diluents include, for example, sterile, distilled water, saline, phosphate buffered solution, and the like. The amount of the diluent may vary widely, as those skilled in the art will recognize. Suitable excipients are also well known to those skilled in the art and may be selected, for example, from A. Wade and P.J.
- the dosage administered may be dependent upon the age, health and weight of the patient, the type of patient, and the existence of concurrent treatment, if any.
- the vaccines can be employed in dosage forms such as capsules, liquid solutions, suspensions, or elixirs, for oral administration, or sterile liquid for formulations such as solutions or suspensions for parenteral, intranasal intramuscular, or intravascular use.
- the vaccine may be employed, in combination with a pharmaceutically acceptable diluent, as a vaccine composition, useful in immunizing a patient against infection from a selected organism or virus or with respect to a tumor, etc.
- Immunizing a patient means providing the patient with at least some degree of therapeutic or prophylactic immunity against selected pathogens, cancerous cells, etc.
- the subject vaccines prepared with the subject vectors find use in methods for eliciting or boosting a helper T cell or a cytotoxic T-cell response to a selected agent, e.g., pathogenic organism, tumor, etc., in a vertebrate, where such methods include administering an effective amount of the Listeria vaccine.
- the subject vaccines prepared with the subject vectors find use in methods for eliciting in a vertebrate an innate immune response that augments the antigen- specific immune response.
- the vaccines of the present invention may be used for treatment post-exposure or post diagnosis. In general, the use of vaccines for post-exposure treatment would be recognized by one skilled in the art, for example, in the treatment of rabies and tetanus.
- the same vaccine of the present invention may be used, for example, both for immunization and to boost immunity after exposure.
- a different vaccine of the present invention may be used for post-exposure treatment, for example, such as one that is specific for antigens expressed in later stages of exposure.
- the subject vaccines prepared with the subject vectors find use as both prophylactic and therapeutic vaccines to induce immune responses that are specific for antigens that are relevant to various disease conditions.
- the patient may be any human and non-human animal susceptible to infection with the selected organism.
- the subject vaccines will find particular use with vertebrates such as man, and with domestic animals.
- domestic animals include domestic fowl, bovine, porcine, ovine, equine, caprine, Leporidate (such as rabbits), or other animal which may be held in captivity.
- the subject vectors also find use in the production of listerial delivery vehicles for delivery of macromolecules to target cells, e.g., as described in: PCT publication no. WO 00/09733 (the priority application of which is herein incorporated by reference); and Dietrich et al., Nature Biotechnology (1998) 16: 181-185.
- a variety of different types of macromolecules may be delivered, including, but not limited to: nucleic acids, polypeptides/proteins, etc., as described in these publications.
- kits and systems that find use in preparing the subject vectors and/or preparing recombinant Listeria cells using the subject vectors and methods, as described above.
- kits and systems for producing the subject vectors may include one or more of: an initial vector with a multiple cloning site; a restriction endonuclease for cleaving a site in the multiple cloning site, a vector including an expression cassette of interest which is to be inserted into the multiple cloning site; etc.
- the kits and systems are designed for the production of the recombinant Listeria cells, the kits and systems may include vectors, or components for making the same, as described above, Listeria target cells, non-Listeria host cells, and the like.
- kits may further include other components that find use in the subject methods, e.g., reaction buffers, growth mediums, etc.
- the various reagent components of the kits may be present in separate containers, or may all be precombined into a reagent mixture for combination with template DNA.
- the subject kits will further include instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit.
- One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc.
- Yet another means would be a computer readable medium, e.g., diskette, CD, etc., on which the information has been recorded.
- Yet another means that may be present is a website address which may be used via the internet to access the information at a removed site. Any convenient means may be present in the kits.
- pPL1 6101 bp integration vector pPL1 (Fig. 1A).
- the complete sequence of the pPL1 vector is provided as SEQ ID NO:25.
- pPL1 is a low copy plasmid that replicates autonomously in E. coli and integrates in a site-specific manner in /_. monocytogenes, and was assembled from 6 independent DNA sources as follows. Restriction sites in the PCR primers used for construction are underlined. All PCR reactions used in cloning steps utilized Vent DNA polymerase (New England Biolabs).
- MCS multiple cloning site
- GGACGTCAATACGACTCACTATAGG-3' SEQ ID NOS: 01 & 02.
- CAT chloramphenicol acetyltransferase
- the L. monocytogenes p60 promoter (Lauer, P., J. A. Theriot, J. Skoble, M. D. Welch, and D. A. Portnoy. 2001. Systematic mutational analysis of the amino-terminal domain of the Listeria monocytogenes ActA protein reveals novel functions in actin-based motility. Mol. Microbiol. 42:1163-1177.) was PCR amplified with primers 5'- CCTAAGCTTTCGATCATCATAATTCTGTC-3' and 5'-
- Base pairs 4570-6101 are a Hind ⁇ U-Aat II restriction fragment subcloned from pUC18-Cat (a kind gift from Nancy Freitag), and contain the inducible Gram-positive CAT gene from pC194 (Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825) (bp 4788-5850).
- the hly gene was subcloned from the plasmid pDP-906 (Jones, S., and D.
- the 2220 bp PCR product was gel purified, cut with ⁇ amH I and Xba I, and cloned into pPL1 cut with ⁇ amH I and Spe I.
- the resultant plasmid was designated pPL25 (Fig.
- Phage curing was accomplished by adapting historical methodologies (Cohen, D. 1959. A variant of Phage P2 Originating in Escherichia coli, strain B. Virology 7:112-126; Six, E. 1960. Prophage substitution and curing in lysogenic cells superinfected with hetero-immune phage. J. Bacteriol. 80:728-729.). . monocytogenes 10403S derivatives carrying a prophage at comK-attBB' (integrated in the comK ORF as described (Loessner, M. J., R. B. Inman, P. Lauer, and R. Calendar. 2000.
- the primer pair PL14/PL61 specifically amplifies attBP' in a PCR reaction, resulting in a 743 bp product on integrated strains (both prophage and pPL1 derivatives).
- the primer pair PL60/PL61 specifically amplifies comK-attBB' in a PCR reaction, resulting in a 417 bp product only on non-lysogenic strains (i.e. DP-L4056).
- PCR assays were performed in a Hybaid Omn-E thermocycler with an annealing temperature of 55°C for 30 cycles. Integrants arose at a frequency of approximately 2x10 "4 per donor cell.
- Hemolysis on blood plates was scored on tryptic soy agar plates supplemented with 5% defimbrinated sheep blood (HemoStat, Davis CA). Hemolytic assays were performed essentially as described (Portnoy, D. A., P. S. Jacks, and D. J. Hinrichs. 1988. Role of hemolysin for the intracellular growth of Listeria monocytogenes. J. Exp. Med. 167(4):1459-1471.). Hemolytic activity is expressed as the reciprocal of the dilution of culture supernatant required to lyse 50% of sheep erythrocytes.
- X. laevis egg cytoplasmic extract was prepared as described (Theriot, J. A., J. Rosenblatt, D. A. Portnoy, P. J. Goldschmidt-Clermont, and T. J. Mitchison. 1994. Involvement of profilin in the actin-based motility of L. monocytogenes in cells and in cell-free extracts. Cell 76(3):505-517.) and supplemented with tetramethylrhodamine iodoacetamide-labeled actin (Theriot, J. A., and D. C. Fung. 1998. Listeria monocytogenes-based assays for actin assembly factors. Methods Enzymol. 298:114-122.). SLCC-5764-derived strains were grown overnight to stationary phase, washed 1 , added to cell extracts and incubated for 45 minutes before microscopic observation.
- Limited LD 50 were performed in BALB/c mice as described (Portnoy, D. A.,
- the PSA attachment site (tRNA Arg -atf ⁇ ) DNA sequence was obtained through a combination of inverse PCR and genome walking. Inverse PCR was performed on Sau3 Al-digested DP-L4061 DNA (WSLC 1042 lysogenic for PSA) (SEQ ID NO:26 is the sequence of 2,072 bp surrounding WSLC 1042 tRNA Arg - attBB using the divergent primers PL95 (5'-
- ACATAATCAGTCCAAAGTAGATGC (SEQ ID NO: 16) and PL97 (5'- ACGAATGTAAATATTGAGCGG) (SEQ ID NO:17) that anneal within the PSA int gene.
- the resultant DNA sequence was used to design further oligonucleotides and these were used with the Genome Walker kit (Clontech), per the manufacturer's recommendations.
- DNA sequence and tRNA analysis was done with using MacVector (Accelrys), DNAsis (Hitachi), BLAST algorithm (2), and tRNAscan-SE (Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.
- pPL1 was modified to utilize a different attachment site on the L. monocytogenes chromosome by replacing the U153 integrase gene and attachment site in the plasmid.
- the PSA int and attPP' were PCR amplified from PSA genomic DNA with primers PL100 (5'-
- pPL2 (FIG 1 B).
- the sequence of pPL2 is provided as SEQ ID NO:28.
- the DNA sequence of the PSA tRNA Arg -af- ⁇ ' from serotype 1/2 L monocytogenes strains was obtained by a plasmid-trap strategy.
- DP-L4211 pPL2 integrated in 10403S genomic DNA was digested with Nsi I and Nhe I, which do not cleave in the vector, and ligated under dilute conditions to promote self-ligation. The ligations were transformed into XL1-blue and chloramphenicol resistant colonies were selected.
- the plasmids obtained were sequenced with the convergent primers PL94 (5'-GGAGGGAAAGAAGAACGC) (SEQ ID NO:20) and PL95 (sequence above) for attPB' and attBP', respectively, which flank attPP' in the PSA genomic DNA sequence. Further, because of the divergence between the sequences downstream of the tRNA Arg gene among serotypes, a serotype 1/2 specific PCR assay across tRNA Arg -aff ⁇ ' was developed from the 10403S DNA sequence and used to determine the prophage status of various L monocytogenes strains. Primers PL102 (5'-
- TATCAGACCTAACCCAAACCTTCC SEQ ID NO:21
- PL103 5'- AATCGCAAAATAAAAATCTTCTCG
- SEQ ID NO:22 specifically amplify a 533 bp PCR product in non-lysogenic serotype 1/2 strains.
- the primer pair NC16 (5'- GTCAAAACATACGCTCTTATC)(SEQ ID NO:23) and PL95 specifically amplify a 499 bp PCR product in strains that are either lysogenic or contain an integration vector at tRNA Arg -atf ⁇ '.
- SEQ ID NO:27 provides the 643 bp surrounding 10403S tRNA Arg -aff ⁇ '
- A. pPL1 forms stable, single-copy integrants in various L. monocytogenes strains.
- pPL1 is the first shuttle integration vector that we constructed to facilitate strain construction in L. monocytogenes.
- L. monocytogenes strain that did not have a phage at the comK bacterial attachment site.
- the prophage-cured 10403S strain was designated DP-L4056 and was used in subsequent experiments.
- Conjugation was chosen as a method for introducing the vector into the target cells, as many Listeria spp. are inefficiently transformed. Conjugation of pPL1 from E. coli into L. monocytogenes was successful. Drug resistant transconjugants arose at a reproducible frequency of -2x10 "4 per donor E. coli cell, approximately three-fold lower than conjugation with autonomously replicating plasmids, indicating -30% integration efficiency for strains receiving the plasmid by conjugation.
- the PL60/PL61 primer pair specifically amplify a 417 bp PCR product in non-lysogenic strains and result in no PCR product in lysogenic strains.
- the PL14/PL61 primer pair specifically amplify a 743 bp PCR product in lysogenic strains and result in no PCR product in non-lysogenic strains.
- Plaque size is the average of 8 to 10 independent experiments and 5 shown as a percent of wild type (defined as 100%). Standard deviations are shown in parentheses, na: not applicable.
- c LD 50 s of 10403S and Ahly (DP- L2161) were determined in (37), the LD 50 of the AactA strain (DP-L1942, a smaller deletion within the actA ORF that does not support actin nucleation at the bacterial surface) was determined in (4).
- Listeriolysin-O (LLO), the gene product of hly, is a secreted pore-forming cytolysin that is responsible for escape from the membrane-bound vacuole when L. monocytogenes first enters a host cell. LLO is absolutely required for the
- LLO activity can be measured by hemolytic activity on red blood cells. Hly mutants fail to form plaques in monolayers of L2 cells and are 5 logs less virulent in the mouse LD 50 assay.
- the hly promoter is self-contained. Additionally, a two-fold increase in the amount of LLO is not deleterious to the virulence and intracellular life cycle of L. monocytogenes, at least as measured by plaquing. D. Complementation of actA at the phage attachment site approaches wild-type expression. ActA, a second major L monocytogenes virulence factor, is responsible for commandeering host cell actin-cytoskeletal factors used for intracellular bacterial motility. ActA is also absolutely required for bacterial pathogenesis as mutants in actA are both unable to spread from cell-to-cell and form a plaque in a cell monolayer and are 3 logs less virulent than wild type. Additionally, ActA expression appears to be more complex than that of LLO: there are two promoters that drive actA expression. One is immediately upstream of the actA ORF and the second is in front of the mpl gene upstream of actA.
- the first group included making second-site complemented (DP-L4077) and merodiploid (DP-L4078) strains in the 10403S background. These were assayed for plaque formation in an L2 monolayer (Table 3). Integrated ActA did not fully complement in this assay (plaque size of 86%) and the merodiploid strain formed an even smaller plaque (72% of wild type). We interpret these results to indicate that there may be a small contribution of the second promoter upstream of the mpl gene for optimal actA expression.
- DP-L4087 supports actin nucleation at the bacterial surface, actin tail formation and bacterial motility in cell extracts (Fig. 3B).
- the results of these cell-extract experiments indicate that the integration vector system for complementation will be useful for in vitro studies of L. monocytogenes motility, facilitating strain construction and placing various molecular constructs in different host strains for study in a desired set of assays.
- several alleles of actA that have unusual motility phenotypes have been transferred to the SLCC-5764 AactA strain using pPL1 and are currently being evaluated in cell extracts. The study of these mutants in the simplified cell-extract system should yield insights into the activities of poorly understood regions of the ActA protein.
- PSA integrates into a tRNA Arg gene and pPL2 construction.
- pPL1 integration into L. monocytogenes strains that harbour a prophage in the comK attachment site is hindered by the process of first having to cure the prophage from the host strain.
- PSA (Phage from ScottA) is the prophage of L. monocytogenes strain ScottA, a serotype 4b strain that was isolated during an epidemic of human listeriosis.
- PSA genomic DNA sequence we identified an integrase-like ORF with a contiguous non-coding sequence that we predicted to contain the attPP' sequences.
- the PSA integrase sequence was then used to obtain the DNA sequence of PSA-af- ⁇ 'from the PSA lysogenic strain DP-L4061 (see Materials and Methods).
- PSA was found to integrate in a tRNA Arg gene that is 88% identical to a tRNA Arg gene ⁇ nSL-ARG2) from ⁇ . subtilis.
- the anticodon of the tRNA Arg gene is 5'UCU, the most commonly used arginine anticodon in L. monocytogenes.
- the PSA and bacterial attachment sites share 17 bp of DNA identity, and the tRNA Ar9 -af/ ⁇ ' contains a short nucleotide sequence that completes the tRNA Arg sequence that is interrupted by integration of PSA (Fig 4).
- the attachment site tRNA Arg gene is present only once in the genome of . monocytogenes strain EGDe and apparently only once in the serotype 4b. This indicates that not only is the PSA integration site unique, but also that precise reconstitution of the gene upon integration (or excision) is likely required for survival of the cell.
- pPL2 was constructed by replacing the U153 listeriophage integrase gene and attachment site in pPL1 with the PSA listeriophage integrase gene and attachment site.
- pPL2 was tranformed into SM10 and the resulting strain was mated into 10403S, EGDe (carrying a streptomycin resistance mutation) and the serotype 4b strain DP-L4088. Chloramphenicol resistant transconjugants arose from each of these crosses at approximately 2x10 "4 per donor cell, the same rate as pPL1 integration. Two recombinants from each cross were restreaked under drug selection and tested by PCR for the presence of PSA-attBP using primers NC16 and PL95. The expected 499 bp PCR product was obtained in each of the colonies tested, indicating pPL2 integrates into tRNA Arg -aft ⁇ ' in both serotype 1/2 and 4b strains.
- a GFP coding sequence as described in United States Patent No. 5,777,079 (the disclosure of which is herein incorporated by reference), is cloned into plasmid pPL1 , transferred into the genome of L. monocytogenes.
- the GFP coding sequence is amplified by polymerase chain reaction (PCR) and the PCR fragment is cloned into the multiple cloning site of pPL1.
- PCR polymerase chain reaction
- a suitable promoter, containing appropriate transcriptional elements and a translational leader sequence for expressing the GFP in L. monocytogenes are cloned at the 5' end of the GFP coding sequence such that they induce the expression of the GFP protein.
- the modified pPL1 plasmid constructs are electroporated into E.
- L. monocytogenes are selected on BHI plates supplemented with 7.5 ⁇ g/ml chloramphenicol and 200 ⁇ g/ml streptomycin.
- the construction and characterization of the first single step site specific integration vectors for use in L. monocytogenes furthers the genetic tools available for the study of this pathogen. These vectors allow more facile strain construction than historic methods and are widely useful in various strains used to study the intracellular life cycle of L. monocytogenes. Additionally, stable merodiploid strains can be constructed to allow refined copy number studies and studies of interactions within a protein through multimerization and testing of the dominance or recessive nature of different alleles of a gene in the same bacterial strain.
- pPL1 and pPL2 are also useful for vaccine development, e.g., for at least enhancing, including both eliciting and boosting, an immune response to a target cells or cells, e.g., a foreign pathogen, etc.
- a target cells or cells e.g., a foreign pathogen, etc.
- monocytogenes systems have been used to elicit cell-mediated immune responses in mice (Frankel, F. R., S. Hegde, J. Lieberman, and Y. Paterson. 1995. Induction of cell-mediated immune responses to human immunodeficiency virus type 1 Gag protein by using Listeria monocytogenes as a live vaccine vector. J. Immunol. 155(10):4775-4782.; Goossens, P. L, G.
- subject invention provides a number of advantages.
- the construction and characterization of the first single step site specific integration vectors for use in L. monocytogenes as described herein furthers the genetic tools available for the study of this pathogen.
- the subject vectors and methods allow more facile strain construction than historic methods and are widely useful in various strains used to study the intracellular life cycle of L. monocytogenes.
- the subject invention provides important new tools for the production of vaccine preparations.
- One limitation with plasmid-based expression of recombinant proteins in L. monocytogenes is the stability of the plasmids in vivo ⁇ i.e. in the host animal) without selection. Additionally, chromosomal construction of strains expressing foreign antigens is time consuming.
- the subject vectors and methods of use alleviate both of these concerns. As such, the present invention represents a significant contribution to the art.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Transplantation (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Food Preservation Except Freezing, Refrigeration, And Drying (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2004500785A JP2005523716A (ja) | 2002-04-30 | 2003-04-29 | 部位特異的リステリア組込みベクターおよびその使用方法 |
| CA002484185A CA2484185A1 (en) | 2002-04-30 | 2003-04-29 | Site specific listeria integration vectors and methods for using the same |
| AU2003237138A AU2003237138B2 (en) | 2002-04-30 | 2003-04-29 | Site specific Listeria integration vectors and methods for using the same |
| US10/547,999 US7749510B2 (en) | 2002-04-30 | 2003-04-29 | Methods of eliciting or boosting a cellular immune response |
| EP03736520A EP1504095B2 (en) | 2002-04-30 | 2003-04-29 | Site specific listeria integration vectors and methods for using the same |
| DE60311252T DE60311252T3 (de) | 2002-04-30 | 2003-04-29 | Stellenspezifische listeria-integrationsvektoren und verfahren zu deren verwendung |
| US12/783,491 US8192991B2 (en) | 2002-04-30 | 2010-05-19 | Methods of eliciting or boosting a cellular immune response |
| US13/461,408 US8865469B2 (en) | 2002-04-30 | 2012-05-01 | Methods of transforming a Listeria |
| US14/485,556 US9556441B2 (en) | 2002-04-30 | 2014-09-12 | Methods of transforming a Listeria |
| US15/379,257 US20170204423A1 (en) | 2002-04-30 | 2016-12-14 | Methods of Transforming a Listeria |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/136,860 US7425449B2 (en) | 2002-04-30 | 2002-04-30 | Site specific Listeria integration vectors and methods for using the same |
| US10/136,860 | 2002-04-30 |
Related Parent Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/136,860 Continuation US7425449B2 (en) | 2002-04-30 | 2002-04-30 | Site specific Listeria integration vectors and methods for using the same |
| US10/136,860 Continuation-In-Part US7425449B2 (en) | 2002-04-30 | 2002-04-30 | Site specific Listeria integration vectors and methods for using the same |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/547,999 A-371-Of-International US7749510B2 (en) | 2002-04-30 | 2003-04-29 | Methods of eliciting or boosting a cellular immune response |
| US54799906A Continuation-In-Part | 2002-04-30 | 2006-09-07 | |
| US12/783,491 Continuation US8192991B2 (en) | 2002-04-30 | 2010-05-19 | Methods of eliciting or boosting a cellular immune response |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003092600A2 true WO2003092600A2 (en) | 2003-11-13 |
| WO2003092600A3 WO2003092600A3 (en) | 2004-04-08 |
Family
ID=29249682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/013492 Ceased WO2003092600A2 (en) | 2002-04-30 | 2003-04-29 | Site specific listeria integration vectors and methods for using the same |
Country Status (9)
| Country | Link |
|---|---|
| US (6) | US7425449B2 (https=) |
| EP (1) | EP1504095B2 (https=) |
| JP (1) | JP2005523716A (https=) |
| AT (1) | ATE351913T1 (https=) |
| AU (1) | AU2003237138B2 (https=) |
| CA (1) | CA2484185A1 (https=) |
| DE (1) | DE60311252T3 (https=) |
| ES (1) | ES2280758T5 (https=) |
| WO (1) | WO2003092600A2 (https=) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7588930B2 (en) | 2000-03-29 | 2009-09-15 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7662396B2 (en) | 2001-03-26 | 2010-02-16 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7700344B2 (en) | 2001-03-26 | 2010-04-20 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7794729B2 (en) | 1994-11-08 | 2010-09-14 | The Trustees Of The University Of Pennsylvania | Methods and compositions for immunotherapy of cancer |
| US7820180B2 (en) | 2004-09-24 | 2010-10-26 | The Trustees Of The University Of Pennsylvania | Listeria-based and LLO-based vaccines |
| US7842289B2 (en) | 2003-12-24 | 2010-11-30 | Aduro Biotech | Recombinant nucleic acid molecules, expression cassettes, and bacteria, and methods of use thereof |
| US7935804B2 (en) | 2006-03-01 | 2011-05-03 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US8114414B2 (en) | 1994-11-08 | 2012-02-14 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of cervical cancer |
| US8241636B2 (en) | 2006-08-15 | 2012-08-14 | The Trustees Of The University Of Pennsylvania | Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof |
| US8268326B2 (en) | 2006-08-15 | 2012-09-18 | The Trustees Of The University Of Pennsylvania | Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof |
| US8771702B2 (en) | 2001-03-26 | 2014-07-08 | The Trustees Of The University Of Pennsylvania | Non-hemolytic LLO fusion proteins and methods of utilizing same |
| US8791237B2 (en) | 1994-11-08 | 2014-07-29 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of non-hodgkins lymphoma |
| US8906664B2 (en) | 2004-08-13 | 2014-12-09 | The Trustees Of The University Of Pennsylvania | Methods for constructing antibiotic resistance free vaccines |
| US8956621B2 (en) | 1994-11-08 | 2015-02-17 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of cervical dysplasia |
| EP2860253A2 (en) | 2006-03-01 | 2015-04-15 | Aduro Biotech | Engineered listeria and methods of use thereof |
| US9012141B2 (en) | 2000-03-27 | 2015-04-21 | Advaxis, Inc. | Compositions and methods comprising KLK3 of FOLH1 antigen |
| US9644212B2 (en) | 2008-05-19 | 2017-05-09 | Advaxis, Inc. | Dual delivery system for heterologous antigens |
| US9650639B2 (en) | 2008-05-19 | 2017-05-16 | Advaxis, Inc. | Dual delivery system for heterologous antigens |
| US9919038B2 (en) | 2009-03-04 | 2018-03-20 | The Trustees Of The University Of Pennsylvania | Compositions comprising angiogenic factors and methods of use thereof |
| US9943590B2 (en) | 2010-10-01 | 2018-04-17 | The Trustees Of The University Of Pennsylvania | Use of Listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals |
| US9944903B2 (en) | 2006-10-16 | 2018-04-17 | Genelux Corporation | Modified vaccinia virus strains for use in diagnostic and therapeutic methods |
| US10016617B2 (en) | 2009-11-11 | 2018-07-10 | The Trustees Of The University Of Pennsylvania | Combination immuno therapy and radiotherapy for the treatment of Her-2-positive cancers |
| US10058599B2 (en) | 2012-03-12 | 2018-08-28 | Advaxis, Inc. | Suppressor cell function inhibition following Listeria vaccine treatment |
| US10064898B2 (en) | 2011-03-11 | 2018-09-04 | Advaxis, Inc. | Listeria-based adjuvants |
| US10463730B2 (en) | 2003-06-18 | 2019-11-05 | Genelux Corporation | Microorganisms for therapy |
| US10801030B2 (en) | 2014-11-05 | 2020-10-13 | The Regents Of The University Of California | General secretory pathway (GSP) mutant listeria SPP., and methods for making and using the same |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9521568D0 (en) * | 1995-10-20 | 1995-12-20 | Lynxvale Ltd | Delivery of biologically active polypeptides |
| US6099848A (en) * | 1997-11-18 | 2000-08-08 | The Trustees Of The University Of Pennsylvania | Immunogenic compositions comprising DAL/DAT double-mutant, auxotrophic, attenuated strains of Listeria and their methods of use |
| US7780961B2 (en) * | 2001-05-03 | 2010-08-24 | Actogenix N.V. | Self-containing Lactococcus strain |
| US7425449B2 (en) * | 2002-04-30 | 2008-09-16 | The Regents Of The University Of California | Site specific Listeria integration vectors and methods for using the same |
| WO2003102168A1 (en) * | 2002-05-29 | 2003-12-11 | The Regents Of The University Of California | Attenuated listeria spp. and methods for using the same |
| CA2506031A1 (en) * | 2002-11-15 | 2004-06-03 | Vib Vzw | Self-containing lactobacillus strain comprising a thya mutation and therapeutic applications thereof |
| US7833775B2 (en) * | 2003-02-06 | 2010-11-16 | Aduro Biotech | Modified free-living microbes, vaccine compositions and methods of use thereof |
| KR101192652B1 (ko) * | 2003-02-06 | 2012-10-19 | 앤저 테라퓨틱스 인코퍼레이티드 | 비포식 세포로의 침투가 약화된 리스테리아, 리스테리아를 포함하는 백신, 및 그것의 사용방법 |
| US7695725B2 (en) * | 2003-02-06 | 2010-04-13 | Aduro Biotech | Modified free-living microbes, vaccine compositions and methods of use thereof |
| AU2004281834A1 (en) * | 2003-10-15 | 2005-04-28 | Cerus Corporation | Listeria-based EphA2 vaccines |
| WO2006045110A2 (en) * | 2004-10-18 | 2006-04-27 | Medimmune, Inc. | High cell density process for growth of listeria |
| AU2006319216B2 (en) | 2005-11-29 | 2012-09-13 | Intrexon Actobiotics Nv | Induction of mucosal tolerance to antigens |
| US20070207171A1 (en) * | 2006-03-01 | 2007-09-06 | Cerus Corporation | Engineered listeria and methods of use thereof |
| US8277797B2 (en) | 2006-11-22 | 2012-10-02 | The Regents Of The University Of California | Interferon-β production modulating Listeria strains and methods for using same |
| CN103933563B (zh) | 2007-01-25 | 2016-09-28 | 英特瑞克斯顿阿克图比奥帝克斯有限公司 | 使用遗传修饰的乳杆菌通过抗原的粘膜递送治疗免疫疾病 |
| JP2010534058A (ja) * | 2007-04-16 | 2010-11-04 | ザ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・ペンシルバニア | 抗生物質耐性のないリステリア菌およびその構築および使用方法 |
| US9017660B2 (en) | 2009-11-11 | 2015-04-28 | Advaxis, Inc. | Compositions and methods for prevention of escape mutation in the treatment of Her2/neu over-expressing tumors |
| FR2976811A1 (fr) | 2011-06-22 | 2012-12-28 | Lfb Biotechnologies | Utilisation d'un anticorps anti-cd20 a haute adcc pour le traitement de la maladie de waldenstrom |
| HK1213008A1 (zh) * | 2012-11-06 | 2016-06-24 | 艾杜罗生物科技公司 | 兼性减毒细菌种类及其制备和使用方法 |
| NO339948B1 (no) * | 2013-12-20 | 2017-02-20 | Energynest As | Element for termisk energilager |
| FR3016633B1 (fr) | 2014-01-17 | 2018-04-13 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Immunoglobuline anti-toxine du charbon |
| US9976149B2 (en) | 2014-05-08 | 2018-05-22 | Ramot At Tel-Aviv University Ltd. | Modified listeria bacteria and uses thereof |
| FR3038517B1 (fr) | 2015-07-06 | 2020-02-28 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Utilisation de fragments fc modifies en immunotherapie |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009733A1 (en) | 1998-08-13 | 2000-02-24 | The Regents Of The University Of California | Intracellular delivery vehicles |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5830702A (en) | 1990-10-31 | 1998-11-03 | The Trustees Of The University Of Pennsylvania | Live, recombinant listeria monocytogenes and production of cytotoxic T-cell response |
| AU3710597A (en) * | 1997-08-06 | 1999-03-01 | Laboratorio Medinfar-Produtos Farmaceuticos, Lda | Dna integration into "mycobacterium spp." genome by trans-complementation using a site-specific integration system |
| US6099848A (en) * | 1997-11-18 | 2000-08-08 | The Trustees Of The University Of Pennsylvania | Immunogenic compositions comprising DAL/DAT double-mutant, auxotrophic, attenuated strains of Listeria and their methods of use |
| DE19949594A1 (de) * | 1999-10-14 | 2001-04-26 | Deutsches Krebsforsch | Rekombinante attenuierte Listerien zur Immuntherapie |
| AU2001242019A1 (en) | 2000-07-06 | 2002-02-05 | Xenogen Corporation | Compositions and methods for use thereof in modifying the genomes of microorganisms |
| US7425449B2 (en) * | 2002-04-30 | 2008-09-16 | The Regents Of The University Of California | Site specific Listeria integration vectors and methods for using the same |
-
2002
- 2002-04-30 US US10/136,860 patent/US7425449B2/en not_active Expired - Lifetime
-
2003
- 2003-04-29 ES ES03736520T patent/ES2280758T5/es not_active Expired - Lifetime
- 2003-04-29 US US10/547,999 patent/US7749510B2/en not_active Expired - Fee Related
- 2003-04-29 JP JP2004500785A patent/JP2005523716A/ja active Pending
- 2003-04-29 EP EP03736520A patent/EP1504095B2/en not_active Expired - Lifetime
- 2003-04-29 AU AU2003237138A patent/AU2003237138B2/en not_active Ceased
- 2003-04-29 AT AT03736520T patent/ATE351913T1/de not_active IP Right Cessation
- 2003-04-29 CA CA002484185A patent/CA2484185A1/en not_active Abandoned
- 2003-04-29 DE DE60311252T patent/DE60311252T3/de not_active Expired - Lifetime
- 2003-04-29 WO PCT/US2003/013492 patent/WO2003092600A2/en not_active Ceased
-
2010
- 2010-05-19 US US12/783,491 patent/US8192991B2/en not_active Expired - Fee Related
-
2012
- 2012-05-01 US US13/461,408 patent/US8865469B2/en not_active Expired - Lifetime
-
2014
- 2014-09-12 US US14/485,556 patent/US9556441B2/en not_active Expired - Fee Related
-
2016
- 2016-12-14 US US15/379,257 patent/US20170204423A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009733A1 (en) | 1998-08-13 | 2000-02-24 | The Regents Of The University Of California | Intracellular delivery vehicles |
Non-Patent Citations (3)
| Title |
|---|
| "Methods in Enzymology", vol. 68, 1979, ACADEMIC PRESS |
| DIETRICH ET AL., NATURE BIOTECHNOLOGY, vol. 16, 1998, pages 181 - 185 |
| T. MANIATIS; E. F. FRITSCH; J. SAMBROOK: "Molecular Cloning: A Laboratory Manual", 1982, COLD SPRING HARBOR LABORATORY PRESS |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7794729B2 (en) | 1994-11-08 | 2010-09-14 | The Trustees Of The University Of Pennsylvania | Methods and compositions for immunotherapy of cancer |
| US8956621B2 (en) | 1994-11-08 | 2015-02-17 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of cervical dysplasia |
| US8791237B2 (en) | 1994-11-08 | 2014-07-29 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of non-hodgkins lymphoma |
| US8114414B2 (en) | 1994-11-08 | 2012-02-14 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treatment of cervical cancer |
| US9012141B2 (en) | 2000-03-27 | 2015-04-21 | Advaxis, Inc. | Compositions and methods comprising KLK3 of FOLH1 antigen |
| US9549973B2 (en) | 2000-03-27 | 2017-01-24 | The Trustees Of The University Of Pennsylvania | Compositions and methods comprising KLK3 or FOLH1 antigen |
| US7655238B2 (en) | 2000-03-29 | 2010-02-02 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7588930B2 (en) | 2000-03-29 | 2009-09-15 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7635479B2 (en) | 2000-03-29 | 2009-12-22 | The Trustees Of The University Of Pennsylvania | Composition and methods for enhancing immunogenecity of antigens |
| US8771702B2 (en) | 2001-03-26 | 2014-07-08 | The Trustees Of The University Of Pennsylvania | Non-hemolytic LLO fusion proteins and methods of utilizing same |
| US9499602B2 (en) | 2001-03-26 | 2016-11-22 | Advaxis, Inc. | Non-hemolytic LLO fusion proteins and methods of utilizing same |
| US7700344B2 (en) | 2001-03-26 | 2010-04-20 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US7662396B2 (en) | 2001-03-26 | 2010-02-16 | The Trustees Of The University Of Pennsylvania | Compositions and methods for enhancing the immunogenicity of antigens |
| US10463730B2 (en) | 2003-06-18 | 2019-11-05 | Genelux Corporation | Microorganisms for therapy |
| US7842289B2 (en) | 2003-12-24 | 2010-11-30 | Aduro Biotech | Recombinant nucleic acid molecules, expression cassettes, and bacteria, and methods of use thereof |
| US10426823B2 (en) | 2004-08-13 | 2019-10-01 | The Trustees Of The University Of Pennsylvania | Methods for constructing antibiotic resistance free vaccines |
| US8906664B2 (en) | 2004-08-13 | 2014-12-09 | The Trustees Of The University Of Pennsylvania | Methods for constructing antibiotic resistance free vaccines |
| US9700608B2 (en) | 2004-08-13 | 2017-07-11 | The Trustees Of The University Of Pennsylvania | Methods for constructing antibiotic resistance free vaccines |
| US9492527B2 (en) | 2004-08-13 | 2016-11-15 | The Trustees Of The University Of Pennsylvania | Methods for constructing antibiotic resistance free vaccines |
| US7820180B2 (en) | 2004-09-24 | 2010-10-26 | The Trustees Of The University Of Pennsylvania | Listeria-based and LLO-based vaccines |
| EP2860253A2 (en) | 2006-03-01 | 2015-04-15 | Aduro Biotech | Engineered listeria and methods of use thereof |
| US7935804B2 (en) | 2006-03-01 | 2011-05-03 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US8580939B2 (en) | 2006-03-01 | 2013-11-12 | Aduro Biotech | Engineered Listeria and methods of use thereof |
| US10166276B2 (en) | 2006-05-02 | 2019-01-01 | The Trustees Of The University Of Philadelphia | Compositions and methods for treatment of non-hodgkins lymphoma |
| US8241636B2 (en) | 2006-08-15 | 2012-08-14 | The Trustees Of The University Of Pennsylvania | Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof |
| US8268326B2 (en) | 2006-08-15 | 2012-09-18 | The Trustees Of The University Of Pennsylvania | Compositions comprising HMW-MAA and fragments thereof, and methods of use thereof |
| US9944903B2 (en) | 2006-10-16 | 2018-04-17 | Genelux Corporation | Modified vaccinia virus strains for use in diagnostic and therapeutic methods |
| US10584317B2 (en) | 2006-10-16 | 2020-03-10 | Genelux Corporation | Modified vaccinia virus strains for use in diagnostic and therapeutic methods |
| US11446369B2 (en) | 2007-05-10 | 2022-09-20 | Advaxis, Inc. | Compositions and methods comprising KLK3 or FOLH1 antigen |
| US9644212B2 (en) | 2008-05-19 | 2017-05-09 | Advaxis, Inc. | Dual delivery system for heterologous antigens |
| US9650639B2 (en) | 2008-05-19 | 2017-05-16 | Advaxis, Inc. | Dual delivery system for heterologous antigens |
| US10189885B2 (en) | 2008-06-23 | 2019-01-29 | The Trustees Of The University Of Pennsylvania | Non-hemolytic LLO fusion proteins and methods of utilizing same |
| US9919038B2 (en) | 2009-03-04 | 2018-03-20 | The Trustees Of The University Of Pennsylvania | Compositions comprising angiogenic factors and methods of use thereof |
| US10695410B2 (en) | 2009-03-04 | 2020-06-30 | The Trustees Of The University Of Pennsylvania | Compositions comprising angiogenic factors and methods of use thereof |
| US10016617B2 (en) | 2009-11-11 | 2018-07-10 | The Trustees Of The University Of Pennsylvania | Combination immuno therapy and radiotherapy for the treatment of Her-2-positive cancers |
| US9943590B2 (en) | 2010-10-01 | 2018-04-17 | The Trustees Of The University Of Pennsylvania | Use of Listeria vaccine vectors to reverse vaccine unresponsiveness in parasitically infected individuals |
| US10064898B2 (en) | 2011-03-11 | 2018-09-04 | Advaxis, Inc. | Listeria-based adjuvants |
| US10058599B2 (en) | 2012-03-12 | 2018-08-28 | Advaxis, Inc. | Suppressor cell function inhibition following Listeria vaccine treatment |
| US10801030B2 (en) | 2014-11-05 | 2020-10-13 | The Regents Of The University Of California | General secretory pathway (GSP) mutant listeria SPP., and methods for making and using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| ES2280758T3 (es) | 2007-09-16 |
| WO2003092600A3 (en) | 2004-04-08 |
| DE60311252T2 (de) | 2007-11-22 |
| AU2003237138B2 (en) | 2008-04-03 |
| US20150037369A1 (en) | 2015-02-05 |
| US7749510B2 (en) | 2010-07-06 |
| US20120321662A1 (en) | 2012-12-20 |
| AU2003237138A1 (en) | 2003-11-17 |
| US9556441B2 (en) | 2017-01-31 |
| ES2280758T5 (es) | 2011-05-04 |
| US20170204423A1 (en) | 2017-07-20 |
| EP1504095B1 (en) | 2007-01-17 |
| DE60311252T3 (de) | 2011-06-30 |
| US20110027319A1 (en) | 2011-02-03 |
| ATE351913T1 (de) | 2007-02-15 |
| US8865469B2 (en) | 2014-10-21 |
| US20070059322A1 (en) | 2007-03-15 |
| US8192991B2 (en) | 2012-06-05 |
| CA2484185A1 (en) | 2003-11-13 |
| US7425449B2 (en) | 2008-09-16 |
| EP1504095A4 (en) | 2005-06-22 |
| US20030203472A1 (en) | 2003-10-30 |
| DE60311252D1 (de) | 2007-03-08 |
| JP2005523716A (ja) | 2005-08-11 |
| EP1504095B2 (en) | 2010-12-29 |
| EP1504095A2 (en) | 2005-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9556441B2 (en) | Methods of transforming a Listeria | |
| US11920139B2 (en) | Regulated expression of antigen and/or regulated attenuation to enhance vaccine immunogenicity and/or safety | |
| Lauer et al. | Construction, characterization, and use of two Listeria monocytogenes site-specific phage integration vectors | |
| US7700104B2 (en) | Attenuated Salmonella SP12 mutants as antigen carriers | |
| US6969513B2 (en) | Plasmid maintenance system for antigen delivery | |
| EP1537214B1 (en) | Regulated bacterial lysis for gene vaccine vector delivery and antigen release | |
| AU2013341242A1 (en) | Facultatively attenuated bacterial species and methods of preparation and use thereof | |
| EP2916854A1 (en) | Facultatively attenuated bacterial species and methods of preparation and use thereof | |
| US8076130B2 (en) | Plasmid maintenance system for antigen delivery | |
| Portnoy et al. | Construction, Characterization, and Use of |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2484185 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004500785 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003237138 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003736520 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20038154862 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003736520 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007059322 Country of ref document: US Ref document number: 10547999 Country of ref document: US |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2003736520 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 10547999 Country of ref document: US |