WO2003022995A2 - Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer - Google Patents
Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer Download PDFInfo
- Publication number
- WO2003022995A2 WO2003022995A2 PCT/US2002/028371 US0228371W WO03022995A2 WO 2003022995 A2 WO2003022995 A2 WO 2003022995A2 US 0228371 W US0228371 W US 0228371W WO 03022995 A2 WO03022995 A2 WO 03022995A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- steap
- protein
- cells
- cell
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/19—Dendritic cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/24—Antigen-presenting cells [APC]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/04—Organic compounds
- A61K51/08—Peptides, e.g. proteins, carriers being peptides, polyamino acids, proteins
- A61K51/10—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody
- A61K51/1045—Antibodies or immunoglobulins; Fragments thereof, the carrier being an antibody, an immunoglobulin or a fragment thereof, e.g. a camelised human single domain antibody or the Fc fragment of an antibody against animal or human tumor cells or tumor cell determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the invention described herein relates to a gene and its encoded protein, termed 08P1D4 or STEAP-1, expressed m certain cancers, and to diagnostic and therapeutic methods and compositions useful in the management of cancers that express STEAP-1
- Cancer is the second leadmg cause of human death next to coronary disease.
- millions of people die from cancer every year In the Umted States alone, as reported by the American Cancer Society, cancer causes the death of well over a half-million people annually, with over 1 2 million new cases diagnosed per year While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the use In the early part of the next century, cancer is predicted to become the leadmg cause of death
- prostate cancer is the fourth most prevalent cancer m men In North America and Northern Europe, it is by far the most common cancer in males and is the second leadmg cause of cancer death m men In the Umted States alone, well over 30,000 men die annually of this disease - second only to lung cancer Despite the magnitude of these figures, there is still no effective treatment for metastatic prostate cancer Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the mam treatment modalities Unfortunately, these treatments are ineffective for many and are often associated with undesirable consequences On the diagnostic front, the lack of a prostate tumor marker that can accurately detect early-stage, localized tumors remains a significant limitation in the diagnosis and management of this disease. Although the serum prostate specific antigen (PSA) assay has been a very useful tool, however its specificity and general utility is widely regarded as lacking in several important respects.
- PSA serum prostate specific antigen
- the LAPC Los Angeles Prostate Cancer
- SCID severe combined immune deficient mice
- More recently identified prostate cancer markers include PCTA-1 (Su et al, 1996, Proc. Natl. Acad. Sci.
- PSM prostate-specific membrane
- STEAP Human, etal, Proc Natl Acad Sci U S A. 1999 Dec 7; 96(25): 14523-8
- PSCA prostate stem cell antigen
- Renal cell carcinoma accounts for approximately 3 percent of adult malignancies. Once adenomas reach a diameter of 2 to 3 cm, malignant potential exists. In the adult, the two principal malignant renal tumors are renal cell adenocarcinoma and transitional cell carcinoma of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated at more than 29,000 cases in the United States, and more than 11,600 patients died of this disease in 1998. Transitional cell carcinoma is less frequent, with an incidence of approximately 500 cases per year in the United States.
- bladder cancer represents approximately 5 percent in men (fifth most common neoplasm) and 3 percent in women (eighth most common neoplasm). The incidence is increasing slowly, concurrent with an increasing older population. In 1998, there was an estimated 54,500 cases, including 39,500 in men and 15,000 in women. The age-adjusted incidence in the United States is 32 per 100,000 for men and eight per 100,000 in women. The historic male/female ratio of 3:1 may be decreasing related to smoking patterns in women. There were an estimated 11 ,000 deaths from bladder cancer in 1998 (7,800 in men and 3,900 in women). Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly.
- bladder cancers recur in the bladder.
- Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy.
- TUR transurethral resection of the bladder
- the multifocal and recurrent nature of bladder cancer points out the limitations of TUR.
- Most muscle-invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion is the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function. There continues to be a significant need for treatment modalities that are beneficial for bladder cancer patients.
- Treatment options for lung and bronchial cancer are determined by the type and stage of the cancer and include surgery, radiation therapy, and chemotherapy For many localized cancers, surgery is usually the treatment of choice Because the disease has usually spread by the time it is discovered, radiation therapy and chemotherapy are often needed in combination with surgery Chemotherapy alone or combmed with radiation is the treatment of choice for small cell lung cancer, on this regimen, a large percentage of patients experience remission, which in some cases is long lasting There is however, an ongoing need for effective treatment and diagnostic approaches for lung and bronchial cancers
- treatment of breast cancer may involve lumpectomy (local removal of the tumor) and removal of the lymph nodes under the arm, mastectomy (surgical removal of the breast) and removal of the lymph nodes under the arm, radiation therapy, chemotherapy, or hormone therapy Often, two or more methods are used in combination
- lumpectomy local removal of the tumor
- mastectomy surgical removal of the breast
- radiation therapy chemotherapy
- hormone therapy chemotherapy
- two or more methods are used in combination
- Numerous studies have shown that, for early stage disease, long-term survival rates after lumpectomy plus radiotherapy are similar to survival rates after modified radical mastectomy
- Significant advances in reconstruction techniques provide several options for breast reconstruction after mastectomy Recently, such leconstruction has been done at the same time as the mastectomy
- DCIS ductal carcinoma in situ
- pancreatic cancer There were an estimated 28,300 new cases of pancreatic cancer in the Umted States in 2000 Over the past 20 years, rates of pancreatic cancer have declined m men Rates among women have remained approximately constant but may be beginning to decline Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the Umted States Over the past 20 years, there has been a slight but significant decrease m mortality rates among men (about —09% per year) while rates have increased slightly among women
- pancreatic cancer treatments for pancreatic cancer These treatment options can extend survival and/or relieve symptoms m many patients but are not likely to produce a cure for most There is a significant need for additional therapeutic and diagnostic options for pancreatic cancer
- the present invention relates to a gene, designated STEAP-1, that has now been found to be over- expressed m the cancer(s) listed in Table I
- Northern blot expression analysis of STEAP-1 gene expression in normal tissues shows a restricted expression pattern in adult tissues
- the nucleotide ( Figure 2) and ammo acid ( Figure 2, and Figure 3) sequences of STEAP-1 are provided
- the tissue-related profile of STEAP-1 m normal adult tissues, combmed with the over-expression observed in the tissues listed m Table I shows that STEAP-1 is aberrantly over-expressed m at least some cancers, and thus serves as a useful diagnostic, prophylactic, prognostic, and or therapeutic target for cancers of the t ⁇ ssue(s) such as those listed in Table I
- the mvention provides polynucleotides corresponding or complementary to all or part of the STEAP-1 genes, mRNAs, and/or coding sequences, preferably m isolated form, including polynucleotides encodmg STEAP-1-related protems and fragments of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 contiguous ammo acids, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100 contiguous ammo acids of a STEAP-1 -related protem, as well as the peptides/proteins themselves, DNA, RNA, DNA RNA hybrids, and related molecules, polynucleotides or o gonucleotides complementary or having at least a 90% homology to the STEAP-1 genes or mRNA sequences or parts thereof, and polynucleotides or ohgonucleotides that hybridize
- Recombinant DNA molecules containing STEAP-1 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of STEAP-1 gene products are also provided.
- the invention further provides antibodies that bind to STEAP-1 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker or therapeutic agent.
- the entire nucleic acid sequence of Figure 2 is encoded and/or the entire amino acid sequence of Figure 2 is prepared, either of which are in respective human unit dose forms.
- the invention further provides methods for detecting the presence and status of STEAP-1 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express STEAP-1.
- a typical embodiment of this invention provides methods for monitoring STEAP-1 gene products in a tissue or hematology sample having or suspected of having some form of growth dysregulation such as cancer.
- the invention further provides various immunogenic or therapeutic compositions and strategies for treating cancers that express STEAP-1 such as cancers of tissues listed in Table I, including therapies aimed at inhibiting the transcription, translation, processing or function of STEAP-1 as well as cancer vaccines.
- the invention provides compositions, and methods comprising them, for treating a cancer that expresses STEAP-1 in a human subject wherein the composition comprises a carrier suitable for human use and a human unit dose of one or more than one agent that inhibits the production or function of STEAP- 1.
- the ca ⁇ ier is a uniquely human carrier.
- the agent is a moiety that is immunoreactive with STEAP-1 protein.
- Non-limiting examples of such moieties include, but are not limited to, antibodies (such as single chain, monoclonal, polyclonal, humanized, chimeric, or human antibodies), functional equivalents thereof (whether naturally occurring or synthetic), and combinations thereof.
- the antibodies can be conjugated to a diagnostic or therapeutic moiety.
- the agent is a small molecule as defined herein.
- the agent comprises one or more than one peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a human to elicit a CTL response to STEAP-1 and/or one or more than one peptide which comprises a helper T lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to elicit an HTL response.
- CTL cytotoxic T lymphocyte
- HTL helper T lymphocyte
- the peptides of the invention may be on the same or on one or more separate polypeptide molecules.
- the agent comprises one or more than one nucleic acid molecule that expresses one or more than one of the CTL or HTL response stimulating peptides as described above.
- the one or more than one nucleic acid molecule may express a moiety that is immunologically reactive with STEAP-1 as described above.
- the one or more than one nucleic acid molecule may also be, or encodes, a molecule that inhibits production of STEAP-1.
- Non-limiting examples of such molecules include, but are not limited to, those complementary to a nucleotide sequence essential for production of STEAP-1 (e.g. antisense sequences or molecules that form a triple helix with a nucleotide double helix essential for STEAP-1 production) or a ribozyme effective to lyse STEAP-1 mRNA.
- HLA Peptide Tables V-XVIII and XXII to LI (collectively HLA Peptide Tables) respective to its parental protein, e.g., variant 1, variant 2, etc.
- HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
- a unique Search Peptide is used to obtain HLA peptides of a particular for a particular vanant
- the position of each Search Peptide relative to its respective parent molecule is listed m Table LXI Accoidmgly, if a Search Peptide begins at position "X", one must add the value ' X - 1" to each position in Tables V-XVIII and XXII to LI to obtain the actual position of the HLA peptides m their parental molecule
- a particular Search Peptide begins at position 150 of its parental molecule one must add 150 - 1 , l e , 149 to each HLA peptide ammo acid position to calculate the position of that ammo acid in the parent molecule
- One embodiment of the invention comprises an HLA peptide, that occurs at least twice in Tables V- XVIII and XXII to LI collectively, or an o gonucleotide that encodes the HLA peptide
- Another embodiment of the invention compnses an HLA peptide that occurs at least once m Tables V-XVIII and at least once m tables XXII to LI, or an oligonucleotide that encodes the HLA peptide
- Another embodiment of the invention is antibody epitopes, which compnse a peptide regions, or an ohgonucleotide encodmg the peptide region, that has one two, three, four, or five of the following characteristics l) a peptide region of at least 5 ammo acids of a particular peptide of Figure 3, m any whole number increment up to the full length of that protein Figure 3, that mcludes an amino acid position having a value equal to or greater than 0 5, 0 6, 0 7, 0 8, 09, or having a value equal to 1 0, in the Hydrophilicity profile of Figure 5, u) a peptide region of at least 5 ammo acids of a particular peptide of Figure 3, m any whole number increment up to the full length of that protein in Figure 3, that mcludes an ammo acid position having a value equal to or less than 0 5, 0 4, 0 3, 02, 0 1, or having a value equal to 0 0, m the Hydropathicity profile of Figure 6,
- FIG. 2 The cDNA and ammo acid sequence of STEAP-1 variant 1 (also called “STEAP-1 v 1" or “STEAP-1 vanant 1”) is shown m Figure 2 A
- the start methionine is underlined
- the open reading frame extends from nucleic acid 66-1085 including the stop codon
- the cDNA and ammo acid sequence of STEAP 1 variant 2 (also called “STEAP-1 v 2") is shown m Figure 2B
- the codon for the start methionine is underlined
- the open reading frame extends from nucleic acid 96-872 including the stop codon
- the cDNA and ammo acid sequence of STEAP-1 vanant 3 (also called “STEAP-1 v 3") is shown m Figure 2C
- the codon for the start methionine is underlmed
- the open reading frame extends from nucleic acid 96 944 including the stop codon
- the cDNA and ammo acid sequence of STEAP-1 variant 4 (also called
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 5 (also called “STEAP-1 v.5") is shown in Figure 2E.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 6 (also called "STEAP-1 v.6”) is shown in Figure 2F.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 7 (also called “STEAP-1 v.7") is shown in Figure 2G.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 8 (also called “STEAP-1 v.8") is shown in Figure 2H.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 9 (also called “STEAP-1 v.9”) is shown in Figure 21.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 10 (also called “STEAP-1 v.10") is shown in Figure J.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP- 1 variant 11 (also called “STEAP- 1 v.11 ”) is shown in Figure 2K.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 12 (also called “STEAP-1 v.12") is shown in Figure 2L.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 13 (also called “STEAP-1 v.13") is shown in Figure 2M.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 14 (also called “STEAP-1 v.14”) is shown in Figure 2N.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 15 (also called “STEAP-1 v.15") is shown in Figure 20.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- the cDNA and amino acid sequence of STEAP-1 variant 16 (also called “STEAP-1 v.16”) is shown in Figure 2P.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- STEAP-1 variant 17 (also called “STEAP-1 v.17") is shown in Figure 2Q.
- the codon for the start methionine is underlined.
- the open reading frame extends from nucleic acid 96-872 including the stop codon.
- a reference to STEAP-1 includes all variants thereof, including those shown in Figures 10 and 12.
- Amino acid sequence of STEAP-1 v.l is shown in Figure 3A; it has 339 amino acids.
- the amino acid sequence of STEAP-1 v.2 is shown in Figure 3B; it has 258 amino acids.
- the amino acid sequence of STEAP-1 v.3 is shown in Figure 3 C; it has 282 amino acids.
- the amino acid sequence of STEAP-1 v.4 is shown in Figure 3D; it has 258 amino acids.
- a reference to STEAP-1 includes all variants thereof, including those shown in Figure 11.
- FIG 4 The amino acid sequence alignment of STEAP-1 v.l with mouse TNF ⁇ -induced adipose- related protein (gi/16905133) is shown in Figure 4A.
- Figure 4C shows Homology of STEAP-1 to mouse six transmembrane epithelial antigen of the prostate (gi
- FIG. 6 Hydropathicity am o acid profile of STEAP-1 variant 1
- 6A Hydropathicity ammo acid profile of STEAP-1 vanant 3, determined by computer algorithm sequence analysis using the method of Kyte and Doolittle (Kyte J , Doohttle R F , 1982 J Mol Biol 157 105-132) accessed on the ProtScale website located on the world wide web URL expasy ch cgi-bin/protscale pi) through the ExPasy molecular biology server
- FIG. 7 Percent accessible residues ammo acid profile of STEAP-1 variant 1
- A Percent accessible residues ammo acid profile of STEAP-1 variant 3, determined by computer algonthm sequence analysis using the method of Ja n (Janm J , 1979 Nature 277 491-492) accessed on the ProtScale website located on the world wide web URL expasy ch cgi-bm/protscale pi) through the ExPasy molecular biology server
- Figure 8 Average flexibility ammo acid profile of STEAP-1 variant 1
- 8A Average flexibility ammo acid profile of STEAP-1 variant 3, determined by computer algonthm sequence analysis usmg the method ofBhaskaran and Ponnuswamy (Bhaskaran R , and Ponnuswamy P K , 1988 Int J Pept Protem Res 32 242- 255) accessed on the ProtScale website located on the world wide web URL expasy ch/cgi-bin/protscale pi) through the ExPasy molecular biology server
- Beta-turn ammo acid profile of STEAP-1 variant 1 (9A) Beta-turn ammo acid profile of STEAP-1 variant 3, determined by computer algorithm sequence analysis using the method of Deleage and Roux (Deleage, G , Roux B 1987 Protem Engineering 1 289-294) accessed on the ProtScale website located on the world wide web URL expasy ch cgi-bin/protscale pi) through the ExPasy molecular biology server
- FIG. 10 Schematic alignment of SNP variants of 8P1D4 Vanants 8P1D4 v 4 through v 17 are va ⁇ ants with single nucleotide differences as compared to 8P1D4 v 2 Though these SNP vanants are shown separately, they could also occur in any combinations and in any transcnpt variants that contains the base pairs, e g , 8P1D4 v 1 and v 3 Numbers correspond to those of 8P1D4 v 2 Black box shows the same sequence as 8PlD4 2 SNPs are indicated above the box
- FIG. 11 Exon compositions of transcnpt variants of 8P1D4 This figure shows the structure of the transcript variants without poly
- Vanants 8P 1 D4 v 1 , v 2 and v 3 are transcript vanants that share the same exons 2 and 3
- the first exon of 8P1D4 v 1 is 30 bases shorter at 5' end than the first exons of the other two transcript variants
- the fourth exon of 8P1D4 v 2 is the same as the combmed exon 4, rntron 4 and exon 5 of 8P1D4 v 1
- variant 8P1D4 v 3 has an additional exon spliced out from intron 4 of 8P1D4 v 1 Lengths of introns and exons are not proportional
- Figure 12 Schematic alignment of protem vanants of 8P1D4 Protem vanants correspond to nucleotide vanants Nucleotide variants 8P1D4 v 5 through v 17 m
- Figure 10 code for the same protem as 8P1D4 v 2 Protems translated from transcnpt vanants 8P1D4 v 1 and v 3 as shown m
- Figure 11 may contam amino acid F (Phe) or L (Leu) at position 169 Smgle ammo acid differences were mdicated above the boxes
- Black boxes represent the same sequence as 8P1D4 v 1 Boxes with different patterns of filling show different sequences Numbers underneath the box conespond to 8P1D4 v 1
- Figure 13 Figut es 13(a) - (c) Secondary structure and transmembrane domains prediction for 8P1D4 protem variants
- the percent of the protem m a given secondary structure is also listed Figwes 13(d), 13(f), and 13(h) Schematic representation
- FIG. 14 Expression of STEAP-1 in stomach cancer patient specimen RNA was extracted from normal stomach (N) and from 10 different stomach cancer patient specimens (T) Northern blot with 10 ⁇ g of total RN A/lane was probed with STEAP-1 sequence Results show strong expression of an approximately 1 6kb STEAP-1 in the stomach tumor tissues The lower panel represents ethidmm bromide staining of the blot showing quality of the RNA samples
- FIG. 16 Expression of STEAP-1 m human umbilical vein endothelial cells (HUVEC)
- First strand cDNA was prepared from HUVEC cells, LAPC-4AD and LAPC-9AD prostate cancer xenografts, as well as from human brain tissues Normalization was performed by PCR usmg pnmers to actin and GAPDH Serrn- quantitative PCR, usmg primers to STEAP-1, was performed at 27 and 30 cycles of amplification (A) As a control, PCR using primers to actin is shown m
- Results show strong expression of STEAP-1 in HUVEC cells similar to the expression detected in prostate cancer xenograft tissues Expression of STEAP-1 m HUVEC cells indicates that targeting STEAP-1 may also target endothelial cells of the neovasculature of the tumors
- Figure 18 Shows that STEAP- 1 -mediated calcium transport regulates prostate cancer growth by regulating intracellular levels of calcium
- Figure 19 The figure demonstrates that STEAP-1 mediates the transfer of the small molecule calcem between adjacent cells, and thereby regulates cell-cell communication in prostate cancer cells.
- PC3 control cells no detectable STEAP-1 protem expression
- the expression of STEAP-1 allows the transfei of small molecules between cells, whereby the initially red recipient cells take on a brownish color, and co-localize the red and green molecules
- FIG 20 The figure demonstrates that STEAP-1 mediates the transfer of the small molecule calcem between adjacent cells, and thereby regulates cell-cell communication in prostate cancer cells
- the figure shows the time-dependent manner of cell-cell communication mediated by STEAP-1, where little transfer m PC3- STEAP-1 cells is seen at 6 hours, and much transfer is seen at 24 hours Figure 21.
- Figure 22 This figure shows the sufficiency of expression of STEAP-1 m the prostate cancer cell line PC3 to activate the mitogenic MAPK pathway, namely the ERK cascade
- Figure 22A shows that while expression of the control neo gene has no effect on ERK phosphorylation, expression of STEAP 1 m PC3 cells is sufficient to induce an increase in ERK phosphorylation
- Figure 22B shows these results were verified usmg anti-ERK western blotting and confirm the activation of the ERK pathway by STEAP-1 and STEAP-2
- Figure 23 Shows necessary expression of STEAP-1 on Donor and Recipient Cells
- FIG. 24 Shows that the introduction of STEAP-1 specific RNAl reduces the expression of STEAP-1 m recombinant 3T3 and Rat-1 cells
- Whole cell lmmunostainmg revealed that the STEAP-1 RNAl reduced STEAP-1 expression m Rat-1 and 3T3 cells This reduction was confirmed by Western blot analysis where STEAP-1 protem was substantially I educed in STEAP-1 RNAl treated cells relative to control and untreated cells
- Figure 25 Shows that RNAl reduces the endogenous expression of STEAP-1 in the prostate cancer and LNCaP cell l e
- prostate cancer locally advanced prostate cancer
- advanced disease and “locally advanced disease” mean prostate cancers that have extended through the prostate capsule, and are meant to mclude stage C disease under the American Urological Association (AUA) system, stage Cl - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system
- AUA American Urological Association
- stage Cl - C2 disease under the Whitmore-Jewett system
- TNM tumor, node, metastasis
- surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes compared to patients having clinically localized (organ-confined) prostate cancer
- Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral bolder of the prostate, or asymmetry or induration above the prostate base
- Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends
- “Altering the native glycosylation pattern” is intended for purposes herem to mean deleting one or more carbohydrate moieties found native sequence STEAP-1 (either by removing the underlying glycosylation site or by deletmg the glycosylation by chemical and/or enzymatic means), and/or add g one or more glycosylation sites that are not present in the native sequence STEAP-1
- the phrase includes qualitative changes m the glycosylation of the native protems, involving a change m the nature and proportions of the vanous carbohydrate moieties present
- the term "analog” refers to a molecule which is structurally srmilai or shares similar or corresponding attributes with anothei molecule (e g a STEAP-1 -related protem)
- an analog of a STEAP-1 protem can be specifically bound by an antibody or T cell that specifically bmds to STEAP-1
- an “antibody” can be naturally occurring or man-made such as monoclonal antibodies produced by conventional hybndoma technology Ant ⁇ -STEAP-1 antibodies compnse monoclonal and polyclonal antibodies as well as fragments containing the antigen-binding domam and/or one or more complementanty determining regions of these antibodies
- an “antibody fragment” is defined as at least a portion of the vanable region of the immunoglobulin molecule that binds to its target, 1 e , the antigen-bmdmg region In one embodiment it specifically covers smgle ant ⁇ -STEAP-1 antibodies and clones thereof (mcludmg agonist, antagomst and neutralizing antibodies) and anti- STEAP-1 antibody compositions withpolyepitopic specificity
- codon optimized sequences refers to nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20% Nucleotide sequences that have been optimized for expression m a given host species by elimination of spurious polyadenylation sequences, elimination of exon/mtron splicing signals, elimination of transposon-like repeats and/or optimization of GC content in addition to codon optimization are referred to herein as an "expression enhanced sequences"
- cytotoxic agent refers to a substance that inhibits or prevents the expression activity of cells, function of cells and/or causes destruction of cells
- the term is intended to mclude radioactive isotopes chemotherapeutic agents, and toxms such as small molecule toxms or enzymatically active toxins of bacterial, fungal, plant or animal origin, mcludmg fragments and/or variants thereof
- cytotoxic agents mclude, but are not limited to auristatins, auromycms, maytansmoids, yttnum, bismuth, ⁇ cin, ricin A-cham, combrestatm, duocarmycins, dolostatms, doxorubicm, daunorubicm, taxol, cisplatin, ccl065, ethidmm bromide, mitomycin, etoposide, tenoposide, v ncristine, vmblastme, colchicme
- homolog refers to a molecule which exhibits homology to another molecule, by for example, havmg sequences of chemical residues that are the same or similar at corresponding positions
- HLA Human Leukocyte Antigen
- HLA Human Leukocyte Antigen
- MHC Major Histocompatibility Complex
- hybridize used m the context of polynucleotides, are meant to refer to conventional hybndization conditions, preferably such as hybridization in 50% formam ⁇ de/6XSSC/0 1% SDS/100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing m 0 lXSSC/0 1% SDS are above 55 degrees C
- isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state
- isolated peptides m accordance with the invention preferably do not contain materials normally associated with the peptides m therr in situ environment
- a polynucleotide is said to be “isolated” when it is substantially separated from contammant polynucleohdes that correspond or are complementary to genes other than the STEAP-1 genes or that encode polypephdes other than STEAP-1 gene product or fragments thereof.
- a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated STEAP-1 polynucleotide A protem is said to be "isolated," for example, when physical, mechanical or chemical methods are employed to remove the STEAP-1 proteins from cellular constituents that are normally associated with the protem. A skilled artisan can readily employ standard punfication methods to obtam an isolated STEAP- 1 protem. Alternatively, an isolated protem can be prepared by chemical means.
- mammal refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human
- metastatic prostate cancer and “metastatic disease” mean prostate cancers that have spread to regional lymph nodes or to distant sites, and are meant to mclude stage D disease under the AUA system and stage TxNxM ⁇ under the TNM system.
- surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is a preferred treatment modality.
- Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation. Approximately half of these androgen-refractory patients die within 6 months after developing that status. The most common site for prostate cancer metastasis is bone.
- Prostate cancer bone metastases are often osteoblastic rather than osteolytic (i.e., resulting in net bone formation). Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
- the term "monoclonal antibody” refers to an antibody obtamed from a population of substantially homogeneous antibodies, i.e., the antibodies compnsing the population are identical except for possible naturally occurring mutations that are present in minor amounts
- a "motif, as m biological motif of a STEAP-1 -related protein, refers to any pattern of ammo acids forming part of the primary sequence of a protein, that is associated with a particular function (e.g. protein- protein interaction, protein-DNA interaction, etc) or modification (e.g. that is phosphorylated, glycosylated or amidated), or localization (e.g. secretory sequence, nuclear localization sequence, etc.) or a sequence that is correlated with being immunogemc, either humorally or cellularly.
- a motif can be either contiguous or capable of being aligned to certain positions that are generally correlated with a certain function or property.
- motif refers to the pattern of residues m a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
- Peptide motifs for HLA binding are typically different for each prote encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
- a “pharmaceutical excipient” comprises a material such as an adjuvant, a earner, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservative, and the like.
- “Pharmaceutically acceptable” refers to a non-toxic, inert, and/or composition that is physiologically compatible with humans or other mammals.
- polynucleotide means apolymenc form of nucleotides of at least 10 bases or base parrs m length, either nbonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to mclude single and double stranded forms of DNA and or RNA. In the art, this term if often used interchangeably with “oligonucleotide”.
- a polynucleotide can comprise a nucleotide sequence disclosed herein wherein thymidine (T) as shown for example in Figure 2, can also be uracil (U), this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T)
- polypeptide means a polymer of at least about 4, 5, 6, 7, or 8 ammo acids Throughout the specification, standard three letter or single letter designations for ammo acids are used In the art, this term is often used interchangeably with “peptide” or "protem”
- an HLA "p ⁇ mary anchor residue” is an ammo acid at a specific position along a peptide sequence which is understood to provide a contact pomt between the immunogemc peptide and the HLA molecule
- One to three, usually two, primary anchor residues within a peptide of defined length generally defines a "motif for an immunogemc peptide These residues are understood to fit in close contact with peptide binding groove of an HLA molecule, with their side chains buried m specific pockets of the binding groove
- the primary anchor residues for an HLA class I molecule are located at position 2 (from the ammo terminal position) and at the carboxyl terminal position of a 8, 9, 10, 11, or 12 residue peptide epitope m accordance with the invention
- the primary anchor residues of a peptide that will bind an HLA class II molecule are spaced relative to each other, rather than to the termini of a peptide, where the peptide is generally of at least 9 am
- Radioisotopes include, but are not limited to the following (non-limiting exemplary uses are also set forth)
- Rad ⁇ um-223 which is an alpha emitter used to treat metastases m the skeleton resulting from cancer (I e , breast and prostate cancers), and cancer radiormmunotherapy
- Beta/gamma emitter used in cancer radioimmunotherapy and diagnostic studies (i.e., breast and colon cancers, and lymphoma)
- Radiation source for food irradiation and for sterilization of medical supplies
- Radiation source for food irradiation and for sterilization of medical supplies
- Gold-198 Implant and intracavity therapy of ovarian, prostate, and brain cancers
- Osteoporosis detection diagnostic imaging, tracer drugs, brain cancer treatment, radiolabeling, tumor imaging, mapping of receptors in the brain, interstitial radiation therapy, brachytherapy for freatment of prostate cancer, determination of glomerular filtration rate (GFR), determination of plasma volume, detection of deep vein thrombosis of the legs
- Thyroid fimction evaluation thyroid disease detection, treatment of thyroid cancer as well as other non-malignant thyroid diseases (i.e., Graves disease, goiters, and hyperthyroidism), treatment of leukemia, lymphoma, and other forms of cancer (e.g., breast cancer) using radioimmunotherapy
- Brachytherapy brain and spinal cord tumor treatment, treatment of blocked arteries (i.e., arteriosclerosis and restenosis), and implants for breast and prostate tumors
- Tc-99m is the most widely used radioisotope used for diagnostic imaging of various cancers and diseases involving the brain, heart, liver, lungs; also used in detection of Bone cancer detection ana Dra scans
- B ⁇ smuth-212 (B ⁇ -212) which is an alpha emitter used in cancer radioimmunotherapy
- Rhemum-188 (Re-188) which is used for cancer diagnostics/treatment, bone cancer pam relief, rheumatoid arthritis treatment, and treatment of blocked artenes (l e , arteriosclerosis and restenosis)
- Neuroimaging of brain disorders high resolution SPECT studies, pulmonary function tests, and cerebral blood flow studies
- a gamma-emittmg label for Ytt ⁇ um-90 (Y-90) which is used for cancer radioimmunotherapy (I e , lymphoma, breast, colon, kidney, lung, ovarian, prostate, pancreatic, and inoperable liver cancers)
- a "recombinant" DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro
- Non-limiting examples of small molecules include compounds that bind or interact with STEAP-1, ligands mcludmg hormones, neuropeptides, chemokmes, odorants, phospholipids, and functional equivalents thereof that bind and preferably inhibit STEAP- 1 prote function
- Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably below about 9, about 8, about 7, about 6, about 5 or about 4 kDa
- small molecules physically associate with, or bind, STEAP-1 protem are not found in naturally occurring metabolic pathways, and/or are more soluble m aqueous than non-aqueous solutions
- Stimgency of hybridization reactions is readily determmable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washmg temperature, and salt concentration In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures Hybridization generally depends on the ability of denatured nucleic acid sequences to rearmeal when complementary strands are present m an environment below then melting temperature The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used.
- “Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that (1) employ low ionic strength and high temperature for washmg, for example 0 015 M sodium chlo ⁇ de/0.0015 M sodium c ⁇ trate/0 1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0 1% bovine serum albumm/0.1% F ⁇ coll/0 1% polyvmylpyrrol ⁇ done/50 mM sodium phosphate buffer atpH 6.5 with 750 mM sodium chlonde, 75 mM sodium citrate at 42 °C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0 075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0 1% sodium pyrophosphate, 5 x Denhardfs solution, sonicated
- Moderately stimgent conditions are descnbed by, but not limited to, those in Sambrook et al , Molecular Clomng. A Laboratory Manual, New York Cold Sprmg Harbor Press, 1989, and mclude the use of washing solution and hybridization conditions (e g , temperature, lomc strength and %SDS) less sfrmgent than those described above
- An example of moderately strmgent conditions is overnight incubation at 37°C m a solution comprising- 20% formamide, 5 x SSC (150 mM NaCl, 15 mM t ⁇ sodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters m i x SSC at about 37-50°C
- the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length
- HLA "supermotif is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles
- to treat or "therapeutic” and grammatically related terms, refer to any improvement of any consequence of disease, such as prolonged survival, less morbidity, and/or a lessening of side effects which are the byproducts of an alternative therapeutic modality; full eradication of disease is not required.
- a “transgenic animal” (e g., a mouse or rat) is an ammal havmg cells that contain a transgene, which transgene was mfroduced into the ammal or an ancestor of the animal at a prenatal, e.g , an embryonic stage
- a "transgene” is a DNA that is integrated mto the genome of a cell from which a transgenic ammal develops.
- an HLA or cellular immune response "vaccine” is a composition that contains or encodes one or moie peptides of the invention.
- vaccines such as a cocktail of one or more individual peptides; one or more peptides of the invention comprised by a polyepitopic peptide, or nucleic acids that encode such individual peptides or polypeptides, e g , & immgene that encodes a polyepitopic peptide
- the "one or more peptides” can mclude any whole unit integer from 1-150 or more, e g , at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110,
- vanant refers to a molecule that exhibits a vanahon from a described type or norm, such as a protem that has one or more different ammo acid residues m the correspondmg pos ⁇ tion(s) of a specifically descnbed protem (e g the STEAP-1 protem shown m Figure 2 or Figure 3
- An analog is an example of a variant protem Splice isoforms and single nucleotides polymorphisms (SNPs) are further examples of vanants
- the "STEAP-1 -related protems" of the invention mclude those specifically identified herem, as well as allehc vanants, conservative substitution vanants, analogs and homologs that can be isolated/generated and charactenzed without undue experimentation following the methods outlmed herem or readily available m the art Fusion proteins that combme parts of different STEAP- 1 protems or fragments thereof, as well as fusion protems of a STEAP-1 protem and a heterologous polypeptide are also mcluded Such STEAP-1 protems are collectively referred to as the STEAP- 1 -related protems, the proteins of the invention, or STEAP- 1
- the term "STEAP- 1 -related protem” refers to a polypeptide fragment or a STEAP-1 protem sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 ammo acids, or, at least 30, 35, 40, 45, 50, 55, 60
- One aspect of the invention provides polynucleotides co ⁇ esponding or complementary to all or part of a
- STEAP-1 gene, mRNA, and/or codmg sequence preferably m isolated form, including polynucleotides encoding a STEAP-1 -related protem and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or ohgonucleotides complementary to a STEAP-1 gene or mRNA sequence or apart thereof, and polynucleotides or ohgonucleotides that hybndize to a STEAP-1 gene, mRNA, or to a STEAP-1 encodmg polynucleotide (collectively, "STEAP-1 polynucleotides”)
- T can also be U m Figure 2
- Embodiments of a STEAP-1 polynucleotide include a STEAP-1 polynucleotide havmg the sequence shown in Figure 2, the nucleotide sequence of STEAP- 1 as shown m Figure 2 wherem T is U, at least 10 contiguous nucleotides of a polynucleotide havmg the sequence as shown m Figure 2; or, at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown m Figure 2 where T is U
- embodiments of STEAP-1 nucleotides comprise, without limitation
- V a polynucleotide comprising, consisting essentially of, oi consisting of the sequence as shown in Figure 2D, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- VI a polynucleotide compnsmg, consisting essentially of, or consistmg of the sequence as shown m Figure 2E, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherein T can also be U,
- VII a polynucleotide compnsmg, consistmg essentially of, or consistmg of the sequence as shown m Figure 2F, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- VIII a polynucleotide comp ⁇ smg, consisting essentially of, or consisting of the sequence as shown in Figure 2G, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- (X) a polynucleotide compnsmg, consisting essentially of, or consistmg of the sequence as shown m Figure 21, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- XVI a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown m Figure 2N, from nucleotide residue number 96 through nucleotide residue number 872, including the stop codon, wherem T can also be U,
- XVII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown m Figure 20, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- (XIX) a polynucleotide compnsmg, consisting essentially of, or consisting of the sequence as shown m Figure 2Q, from nucleotide residue number 96 through nucleotide residue number 872, mcludmg the stop codon, wherem T can also be U,
- (XX) a polynucleotide that encodes a STEAP-1 -related protein that is at least 90% homologous to an entire ammo acid sequence shown in Figure 2A-Q,
- XXI a polynucleotide that encodes a STEAP-1 -related piotein that is at least 90% identical to an entire ammo acid sequence shown in Figure 2A-Q,
- XXII a polynucleotide that encodes at least one peptide set forth in Tables V-XVIII and XXII LI,
- (XV) a polynucleotide that encodes a peptide region of at least 5 ammo acids of a peptide of Figure 3A in any whole number increment up to 339 that includes an ammo acid position havmg a value greater than 0 5 m the Percent Accessible Residues profile of Figure 7,
- (XVI) a polynucleotide that encodes a peptide region of at least 5 ammo acids of a peptide of Figure 3A in any whole number mcrement up to 339 that mcludes an amino acid position havmg a value greater than 0 5 m the Average Flexibility profile of Figure 8
- (XXVII) a polynucleotide that encodes a peptide region of at least 5 ammo acids of a peptide of Figure 3A in any whole number increment up to 339 that mcludes an ammo acid position havmg a value greater than 0 5 the Beta-turn profile of Figure 9
- Typical embodiments of the invention disclosed herem include STEAP 1 polynucleotides that encode specific portions of STEAP-1 mRNA sequences (and those which are complementary to such sequences) such as those that encode the protems and/or fragments thereof, for example
- representative embodiments of the invention disclosed herem mclude polynucleotides and their encoded peptides themselves encoding about ammo acid 1 to about ammo acid 10 of the STEAP-1 protem shown in Figuie 2 or Figure 3, polynucleotides encodmg about ammo acid 10 to about amino acid 20 of the STEAP-1 protem shown in Figure 2 or Figure 3, polynucleotides encoding about ammo acid 20 to about ammo acid 30 of the STEAP-1 protein shown in Figure 2 or Figure 3, polynucleotides encodmg about ammo acid 30 to about ammo acid 40 of the STEAP-1 protem shown in Figure 2 or Figure 3, polynucleotides encoding about am o acid 40 to about ammo acid 50 of the STEAP-1 protein shown in Figure 2 or Figure 3, polynucleotides encoding about am o acid 50 to about ammo acid 60 of the STEAP-1 protem shown in Figure 2 or
- Polynucleotides encodmg relatively long portions of a STEAP-1 protem are also within the scope of the invention
- polynucleotides encodmg from about ammo acid 1 (or 20 or 30 or 40 etc ) to about amino acid 20, (or 30, or 40 or 50 etc ) of the STEAP-1 protem "or vanant" shown m Figure 2 or Figure 3 can be generated by a variety of techniques well known m the art
- These polynucleotide fragments can include any portion of the STEAP-1 sequence as shown in Figure 2
- Additional illustrative embodiments of the invention disclosed herein include STEAP-1 polynucleotide fragments encodmg one or moie of the biological motifs contained within a STEAP-1 protem "or variant" sequence, including one or more of the motif-bearing subsequences of a STEAP-1 protein "or variant” set forth in Tables V-XVIII and XXII-LI.
- typical polynucleotide fragments of the invention encode one or more of the regions of STEAP-1 protein or variant that exhibit homology to a known molecule.
- typical polynucleotide fragments can encode one or more of the STEAP-1 protein or variant N-glycosylation sites, cAMP and cGMP-dependent protein kinase phosphorylation sites, casein kinase II phosphorylation sites or N-myristoylation site and amidation sites.
- HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
- HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
- search Peptides listed in Table LVII Generally, a unique Search Peptide is used to obtain HLA peptides for a particular variant. The position of each Search Peptide relative to its respective parent molecule is listed in Table LXI.
- a Search Peptide begins at position "X"
- a particular Search Peptide begins at position 150 of its parental molecule, one must add 150 - 1, i.e., 149 to each HLA peptide amino acid position to calculate the position of that amino acid in the parent molecule.
- the polynucleotides of the preceding paragraphs have a number of different specific uses.
- the human STEAP-1 gene maps to the chromosomal location set forth in the Example entitled "Chromosomal Mapping of STEAP-1.”
- polynucleotides that encode different regions of the STEAP-1 proteins are used to characterize cytogenetic abnormalities of this chromosomal locale, such as abnormalities that are identified as being associated with various cancers.
- cytogenetic abnormalities of this chromosomal locale such as abnormalities that are identified as being associated with various cancers.
- a variety of chromosomal abnormalities including rearrangements have been identified as frequent cytogenetic abnormalities in a number of different cancers (see e.g. Rrajinovic et al, Mutat. Res.
- polynucleotides encoding specific regions of the STEAP-1 proteins provide new tools that can be used to delineate, with greater precision than previously possible, cytogenetic abnormalities in the chromosomal region that encodes STEAP-1 that may contribute to the malignant phenotype.
- these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtle and less common chromosomal abnormalities (see e.g. Evans et al, Am. J. Obstet. Gynecol 171(4): 1055-1057 (1994)).
- STEAP-1 polynucleotides are used in methods assessing the status of STEAP-1 gene products in normal versus cancerous tissues.
- polynucleotides that encode specific regions of the STEAP-1 proteins are used to assess the presence of perturbations (such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.) in specific regions of the STEAP-1 gene, such as regions containing one or more motifs.
- Exemplary assays include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Manogi et al, J. Cutan. Pathol. 26(8): 369-378 (1999), both of wliich utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein. II.A.2.) Antisense Embodiments
- nucleic acid related embodiments of the invention disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules, as well as nucleic acid molecules based on an alternative backbone, or mcludmg alternative bases, whetlier de ⁇ ved from natural souices or synthesized, and mclude molecules capable of inhibiting the RNA or protem expression of STEAP-1
- antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA m a base pair-dependent manner
- PNAs peptide nucleic acids
- non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA m a base pair-dependent manner
- Antisense technology entails the administration of exogenous oligonucleotides that bmd to a target polynucleotide located within the cells
- the term "antisense” refers to the fact that such ohgonucleotides are complementary to their intracellular targets, e g , STEAP-1 See for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989, and Synthesis 1 1-5 (1988)
- the STEAP-1 antisense oligonucleotides of the present invention include derivatives such as S-ohgonucleotides (phosphorothioate denvatives or S-ohgos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action S-ohgos (nucleoside phosphorothioates) are lsoelectromc analogs of an ohgonucleotide (O- ohgo) m which
- the STEAP-1 antisense ohgonucleotides of the present invention typically can be RNA or DNA that is complementary to and stably hybndizes with the first 100 5' codons or last 100 3' codons of a STEAP-1 genomic sequence or the corresponding mRNA Absolute complementarity is not required, although high degrees of complementarity are preferred Use of an oligonucleotide complementary to this region allows for the selective hybridization to STEAP-1 mRNA and not to mRNA specifying other regulatory subunits of protem kmase
- STEAP-1 antisense ohgonucleotides of the present invention are 15 to 30-mer fragments of the antisense DNA molecule that have a sequence that hybridizes to STEAP-1 mRNA
- STEAP-1 antisense oligonucleotide is a 30-mer oligonucleotide that is complementary to a region m the first 10 5' codons or last 10 3' codons
- nucleotides of the mvention include pnmers and pnmer pairs, which allow the specific amplification of polynucleotides of the invention or of any specific parts thereof, and probes tiiat selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof Probes can be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, biolummescent compound, a chemiluminescent compound, metal chelator or enzyme Such probes and primers are used to detect the presence of a STEAP-1 polynucleotide m a sample and as a means for detecting a cell expressmg a STEAP-1 protem
- a detectable marker such as, for example, a radioisotope, fluorescent compound, biolummescent compound, a chemiluminescent compound, metal chelator or enzyme
- probes examples include polypeptides compnsmg all or part of the human STEAP-1 cDNA sequence shown m Figure 2
- primer parrs capable of specifically amphfymg STEAP-1 mRNAs are also descnbed in the Examples
- a great many different pnmers and probes can be prepared based on the sequences provided herem and used effectively to amplify and/or detect a STEAP-1 mRNA
- the STEAP-1 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and pnmers for the amplification and or detection of the STEAP-1 gene(s), mRNA(s), 01 fragments thereof, as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers, as coding sequences capable of directmg the expression of STEAP-1 polypeptides, as tools for modulating or inhibiting the expression of the STEAP-1 gene(
- the present mvention mcludes the use of any probe as desc ⁇ bed herem to identify and isolate a STEAP-1 or STEAP-1 related nucleic acid sequence from a naturally occurring source, such as humans or other mammals, as well as the isolated nucleic acid sequence pei se, which would comp ⁇ se all or most of the sequences found m the probe used
- the STEAP-1 cDNA sequences desc ⁇ bed herem enable the isolation of other polynucleotides encodmg STEAP-1 gene produces), as well as the isolation of polynucleotides encodmg STEAP 1 gene product homologs, alternatively spliced isoforms, allehc vanants, and mutant forms of a STEAP-1 gene product as well as polynucleotides that encode analogs of STEAP-1 -related protems Vanous molecular cloning methods that can be employed to isolate full length cDNAs encodmg a STEAP-1 gene are well known (see, for example, Sambrook, J et al , Molecular Cloning A Laboratory Manual, 2d edition, Cold Sprmg Harbor Press, New York, 1989, Current Protocols Molecular Biology Ausubel et al , Eds , Wiley and Sons, 1995) For example, lambda phage cloning methodologies can be convemently employed,
- the mvention also provides recombinant DNA or RNA molecules containing a STEAP-1 polynucleotide, a fragment, analog or homologue thereof, mcludmg but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as vanous viral and non-viral vectors well known in the art, and cells transformed or fransfected with such recombmant DNA or RNA molecules Methods for generating such molecules are well known (see, for example, Sambrook et al , 1989, supra)
- the mvention further provides a host- vector system comprising a recombinant DNA molecule containing a STEAP-1 polynucleotide, fragment, analog orhomologue tliereof within a suitable prokaryotic or eukaryotic host cell
- suitable eukaryotic host cells mclude a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e g , a baculovirus-rnfectible cell such as an Sf9 or HighFive cell)
- suitable mammalian cells include vanous prostate cancer cell lmes such as DU145 and TsuPrl, other fransfectable or transducible prostate cancer cell lmes, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant protems (e g , COS, CHO, 293, 293T cells) More particularly, a polynucleotide compn
- STEAP-1 can be expressed in several prostate cancer and non-prostate cell lmes, including for example 293, 293T, rat-1, NIH 3T3 and TsuPrl
- the host-vector systems of the invention are useful for the production of a STEAP-1 piotem or fragment thereof
- Such host- vector systems can be employed to study the functional properties of STEAP-1 and STEAP-1 mutations or analogs
- Recombinant human STEAP-1 protein or an analog or homolog or fragment thereof can be produced by mammalian cells fransfected with a construct encodmg a STEAP-1 -related nucleotide
- 293T cells can be fransfected with an expression plasmid encoding STEAP-1 or fragment, analog or homolog thereof, a STEAP-1 -related protein is expressed m the 293T cells, and the recombinant STEAP-1 protem is isolated using standard purification methods (e g , affinity purification usmg ant ⁇ -STEAP-1 antibodies)
- a STEAP-1 codmg sequence is subcloned into the retroviral vector pSR ⁇ MSVtkneo and used to infect various mammalian cell lines, such as NIH 3T3, TsuPrl, 293 and rat-1 m order to establish STEAP-1 expressing cell lmes
- Various other expression systems well known m the art can also be
- codon usage tables available on the INTERNET such as at URL dna affrc go jp/ ⁇ nakamura/codon html
- sequence modifications are known to enhance protem expression in a cellular host These include elimination of sequences encoding spurious polyadenylation signals, exon/mtron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression
- the GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed m the host cell Where possible, the sequence is modified to avoid predicted hairpm secondary mRNA structures
- Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described m Kozak, Mol Cell Biol , 9 5073-5080 (1989) Skilled artisans understand that the general rule that eukaryotic nbosomes initiate translation exclusively at the 5' proximal AUG codon is abrogated only under rare conditions (see, e g , Kozak PNAS 92(7) 2662-2666, (1995) and Kozak NAR 15(20) 8125-8
- STEAP-1 -related protems Specific embodiments of STEAP-1 piotems comprise a polypeptide having all or part of the ammo acid sequence of human STEAP-1 as shown m Figure 2 or Figure 3 Alternatively, embodiments of STEAP-1 protems comprise variant, homolog or analog polypeptides that have alterations the ammo acid sequence of STEAP-1 shown in Figure 2 or Figure 3
- Embodiments of a STEAP-1 polypeptide include a STEAP-1 polypeptide having a sequence shown in Figure 2, a peptide sequence of a STEAP-1 as shown in Figure 2 wherem T is U, at least 10 contiguous nucleotides of a polypeptide having the sequence as shown m Figure 2, or, at least 10 contiguous peptides of a polypeptide having the sequence as shown in Figure 2 where T is U.
- embodiments of STEAP-1 peptides comprise, without limitation:
- (V) a protein that comprises at least one peptide set forth in Tables V-XVIII, collectively, which peptide is also set forth in Tables XXII to LI, collectively, optionally with a proviso that it is not an entire protein of Figure 2;
- VI a protein that comprises at least two peptides selected from the peptides set forth in Tables V- XVIII and XXII to LI collectively, optionally with a. proviso that it is not an entire protein of Figure 2;
- VII a protein that comprises at least two peptides selected from the peptides set forth in Tables V- XVIII and XXII to LI collectively, with a proviso that the protein is not a contiguous sequence from an amino acid sequence of Figure 2;
- VIII a protein that comprises at least one peptide selected from the peptides set forth in Tables V- XVIII; and at least one peptide set forth in Tables XXII to LI, with a proviso that the protein is not a contiguous sequence from an amino acid sequence of Figure 2;
- (X) a polypeptide comprising at least 5 amino acids of a protein of Figure 3A, 3B, 3C, or 3D in any whole number increment up to 339, 258, 282, or 258, respectively, that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6;
- Typical embodiments of the invention disclosed herein include 101P3A11 polynucleohdes that encode specific portions of 101P3A11 mRNA sequences (and those which are complementary to such sequences) such as those that encode the protems and/or fragments thereof, for example
- allelic variants of human STEAP-1 share a high degree of structural identity and homology (e.g., 90% or more homology).
- allelic variants of a STEAP-1 protein contain conservative amino acid substitutions within the STEAP-1 sequences described herein or contain a substitution of an amino acid from a correspondmg position in a homologue of STEAP-1.
- One class of STEAP-1 allelic variants are proteins that share a high degree of homology with at least a small region of a particular STEAP-1 amino acid sequence, but further contain a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift.
- Proteins of the invention can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
- isoleucine I
- V valine
- L leucine
- Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa.
- substitutions can also be considered conservative, depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein.
- G glycine
- A alanine
- V valine
- M Methionine
- L Lysine
- K arginine
- R arginine
- Embodiments of the invention disclosed herein include a wide variety of art-accepted variants or analogs of STEAP-1 proteins such as polypeptides having amino acid insertions, deletions and substitutions.
- STEAP-1 variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis.
- Site-directed mutagenesis (Carter et al, Nucl. Acids Res., 73/4331 (1986); Zoller et al, Nucl. Acids Res., 70:6487 (1987)), cassette mutagenesis (Wells et al, Gene, 34:315 (1985)), restriction selection mutagenesis (Wells et al, Philos. Trans. R. Soc. London SerA, 317:415 (1986)) or other known techniques can be performed on the cloned DNA to produce the STEAP-1 variant DNA.
- Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence that is involved in a specific biological activity such as a protein-protein interaction.
- prefened scanning amino acids are relatively small, neutral amino acids.
- amino acids include alanine, glycine, serine, and cysteine.
- Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant.
- Alanine is also typically prefened because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol.
- STEAP-1 vanants, analogs or homologs have the distinguishing attribute of havmg at least one epitope that is 'cross reactive" with a STEAP-1 protem having an ammo acid sequence of Figure 3
- cross reactive means that an antibody or T cell that specifically binds to a STEAP-1 variant also specifically binds to a STEAP-1 protem having an ammo acid sequence set forth m Figure 3
- a polypeptide ceases to be a variant of a protem shown m Figure 3, when it no longer contains any epitope capable of being recognized by an antibody or T cell that specifically binds to the starting STEAP-1 piotem
- antibodies that recognize protems bind to epitopes of varying size, and a grouping of the order of about four or five ammo acids, contig
- STEAP- 1-related protem variants share 70%, 75%, 80%, 85% or 90% or more similarity with an ammo acid sequence of Figure 3, or a fragment thereof
- Another specific class of STEAP-1 protem variants or analogs compnses one or more of the STEAP-1 biological motifs described herem or presently known in the art
- analogs of STEAP-1 fragments that have altered functional (e g immunogemc) properties relative to the starting fragment
- embodiments of the claimed invention include polypeptides containing less than the full amino acid sequence of a STEAP-1 protem shown m Figure 2 or Figure 3
- representative embodiments of the invention compnse peptides/protems having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous ammo acids of a STEAP-1 protein shown in Figure 2 or Figure 3
- representative embodiments of the mvention disclosed herem include polypeptides consisting of about amino acid 1 to about ammo acid 10 of a STEAP-1 protem shown m Figure 2 or Figure 3, polypeptides consisting of about ammo acid 10 to about ammo acid 20 of a STEAP-1 protem shown m Figure 2 or Figure 3, polypeptides consisting of about ammo acid 20 to about amino acid 30 of a STEAP-1 protem shown m Figure 2 or Figure 3, polypeptides consisting of about ammo acid 30 to about ammo acid 40 of a STEAP-1 protem shown in Figure 2 or Figure 3, polypeptides consisting of about ammo acid 40 to about ammo acid 50 of a STEAP-1 protem shown in Figure 2 or Figure 3, polypeptides consisting of about a mo acid 50 to about amino acid 60 of a STEAP- 1 protem shown m Figure 2 or Figure 3 , polypeptides consisting of about ammo acid 60 to about amino acid 70 of a STEAP-1
- STEAP- 1 -related protems are generated usmg standard peptide synthesis technology or usmg chemical cleavage methods well known m the art Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode a STEAP-1 -related protem In one embodiment, nucleic acid molecules provide a means to generate defined fragments of a STEAP-1 protem (or vanants, homologs or analogs thereof) III.A. Motif-bearing Protein Embodiments
- Additional illustrative embodiments of the mvention disclosed herem include STEAP-1 polypeptides compnsmg the ammo acid residues of one or more of the biological motifs contained within a STEAP-1 polypeptide sequence set forth in Figure 2 or Figure 3
- Various motifs are known the art, and a protem can be evaluated for the presence of such motifs by a number of publicly available Internet sites (see, e g , URL addresses pfam wustl edu , http //searchlauncher bcm tmc edu/seq-search/struc-predict html, psort lms u- tokyo acjp/, cbs dtu dk/, ebi ac uk mterpro/scan html, expasy ch/tools/scnpsitl html, EpimatnxTM andEpimerTM, Brown University, brown edu/Researcl
- Table XIX sets forth several frequently occurring motifs based on pfam searches (see URL address pfam wustl edu/) The columns of Table XIX list (1) motif name abbreviation, (2) percent identity found amongst the different member of the motif family, (3) motif name or description and (4) most common function, location information is included if the motif is relevant for location
- Polypeptides comprising one or more of the STEAP-1 motifs discussed above are useful m elucidating the specific characteristics of a malignant phenotype in view of the observation that the STEAP-1 motifs discussed above are associated with growth dysregula ⁇ on and because STEAP-1 is overexpressed m certain cancels (See, e g , Table I)
- Casem kinase II, cAMP and camp-dependent protem kinase, and Protem Kinase C are enzymes known to be associated with the development of the malignant phenotype (see e g Chen et al , Lab Invest , 78(2) 165-174 (1998), Gaiddon et al , Endocrinology 136(10) 4331-4338 (1995), Hall et al , Nucleic Acids Research 24(6) 1119-1126 (1996), Peterz ⁇ el e ⁇ 7 , Oncogene 18(46) 6322-6329 (1999) and O'B ⁇
- protems of the mvention comprise one or more of the lmmunoreactive epitopes identified m accordance with art-accepted methods, such as the peptides set forth m Tables V-XVIII and XXII- LI CTL epitopes can be determined usmg specific algonthms to identify peptides within a STEAP-1 protem that are capable of optimally binding to specified HLA alleles (e g , Table IV, EpimatnxTM and Ep merTM, Brown University, URL brown edu/Research/TB-HIV_Lab/ep ⁇ matnx ep ⁇ matr ⁇ x html, and BIMAS, URL bimas dcrt mh gov/ )
- piocesses for identifying peptides that have sufficient binding affinity for HLA molecules and which are correlated with bemg immunogemc epitopes are well known m the art, and are earned out without undue experimentation
- processes are well known m the
- epitopes that bears a CTL or HTL motif (see, e g , the HLA Class I and HLA Class II motifs/supermotifs of Table IV)
- the epitope is analoged by substituting out an ammo acid at one of the specified positions, and replacmg it with another ammo acid specified for that position
- a deleterious residue favor of any other residue such as a prefened residue as defined m Table IV, substitute a less-preferred residue with a prefened residue as defined m Table IV, or substitute an originally-occurring preferred residue with another preferred residue as defined in Table IV
- substitutions can occur at primary anchor positions or at other positions m a peptide, see, e g , Table IV
- a variety of references reflect the art regarding the identification and generation of epitopes in a protein of interest as well as analogs thereof.
- polypeptides comprising combinations of the different motifs set forth in Table XX, and/or, one or more of the predicted CTL epitopes of Tables V-XVII and XXII- XLVII, and or, one or more of the predicted HTL epitopes of Tables XLVIII-LI, and/or, one or more of the T cell binding motifs known in the art.
- Preferred embodiments contain no insertions, deletions or substitutions either within the motifs or within the intervening sequences of the polypeptides.
- embodiments which include a number of either N-te ⁇ ninal and or C-terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
- the number of N-terminal and or C-terminal amino acid residues on either side of a motif is between about 1 to about 100 amino acid residues, preferably 5 to about 50 amino acid residues.
- STEAP-1 -related proteins are embodied in many forms, preferably in isolated form.
- a purified STEAP- 1 protein molecule will be substantially free of other proteins or molecules that impair the binding of STEAP-1 to antibody, T cell or other ligand. The nature and degree of isolation and purification will depend on the intended use.
- Embodiments of a STEAP- 1-related proteins include purified STEAP- 1-related proteins and functional, soluble STEAP- 1-related proteins.
- a functional, soluble STEAP-1 protein or fragment thereof retains the ability to be bound by antibody, T cell or other ligand.
- the invention also provides STEAP-1 proteins comprising biologically active fragments of a STEAP-1 amino acid sequence shown in Figure 2 or Figure 3.
- Such proteins exhibit properties of the starting STEAP-1 protein, such as the ability to elicit the generation of antibodies that specifically bind an epitope associated with the starting STEAP-1 protein; to be bound by such antibodies; to elicit the activation of HTL or CTL; and/or, to be recognized by HTL or CTL that also specifically bind to the starting protein.
- STEAP- 1-related polypeptides that contain particularly interesting structures can be predicted and/or identified using various analytical techniques well known in the art, including, for example, the methods of Chou- Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson- olf analysis, or based on immunogenicity. Fragments that contain such structures are particularly useful in generating subunit-specific anti- STEAP-1 antibodies or T cells or in identifying cellular factors that bind to STEAP-1. For example, hydrophilicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Hopp, T.P. and Woods, K.R., 1981, Proc. Natl. Acad. Sci.
- Beta-turn profiles can be generated, and immunogenic peptide fragments identified, using the method of Deleage, G., Roux B., 1987, Protein Engineering 1:289-294.
- CTL epitopes can be determined usmg specific algonthms to identify peptides withm a STEAP-1 protem that are capable of optimally bmdmg to specified HLA alleles (e g , by using the SYFPEITHI site at World Wide Web URL syfpeithi bmi-heidelberg com/, the listings in Table IV(A)-(E), EpimatnxTM and EpimerTM, Brown University, URL (brown edu/Research TB-HIV Lab/epimatnx/epunatnx html), and BIMAS, URL bunas dcrt mh gov/) Illustrating this, peptide epitopes from STEAP-1 that are presented in the context of human MHC Class I molecules, e g ,
- HLA peptide motif search algorithm was developed by Dr Ken Parker based on bmdmg of specific peptide sequences m the groove of HLA Class I molecules, in particular HLA-A2 (see, e g , Falk et al , Nature 351 290 6 (1991), Hunt et al , Science 255 1261-3 (1992), Parker et al , J Immunol 149 3580-7 (1992), Parker et al , J Immunol 152 163-75 (1994))
- This algorithm allows location and ranking of 8-mer, 9-mer, and 10-mer peptides from a complete protem sequence for predicted bmdmg to HLA-A2 as well as numerous other HLA Class I molecules
- Many HLA class I binding peptides are 8-, 9-, 10 or 11-mers
- the epitopes prefeiably contam a leucine (L) or methionine (M) at position 2 and a valme (
- every epitope predicted by the BIMAS site, EpimerTM and EpimatnxTM sites, or specified by the HLA class I or class II motifs available m the art or which become part of the art such as set forth in Table IV (or determined usmg World Wide Web site URL syfpeithi bmi-heidelberg com , or BIMAS, bimas dcrt mh gov/) are to be "applied” to a STEAP-1 protem in accordance with the invention
- “applied” means that a STEAP-1 protem is evaluated, e g , visually or by computer-based patterns findmg metliods, as appreciated by those of skill in the relevant art Every subsequence of a STEAP- 1 protem of 8, 9, 10, or 11 ammo acid residues that bears an HLA Class I motif, or a subsequence of 9 or more ammo acid residues that bear an HLA Class II motif
- STEAP-1 can be convemently expressed m cells (such as 293T cells) fransfected with a commercially available expression vector such as a CMV driven expression vector encoding STEAP-1 with a C-tenrnnal 6XH ⁇ s and MYC tag (pcDNA3 1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville TN)
- the Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of a secreted STEAP-1 protein in fransfected cells
- the secreted HIS-tagged STEAP-1 in the culture media can be purified, e g , using a nickel column usmg standard techniques
- Modifications of STEAP- 1-related protems such as covalent modifications are mcluded withm the scope of this mvention
- One type of covalent modification mcludes reacting targeted amino acid residues of a STEAP-1 polypeptide with an organic denvahzmg agent that is capable of reacting with selected side chams or the N- or C- terminal residues of a STEAP-1 protem.
- Another type of covalent modification of a STEAP-1 polypeptide included withm the scope of this invention comprises altering the native glycosylation pattern of a protein of the mvention
- Another type of covalent modification of STEAP-1 compnses linking a STEAP-1 polypeptide to one of a variety of nonprotemaceous polymers, e g , polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, m the manner set forth inU S Patent Nos 4,640,835; 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179,337
- the STEAP- 1-related protems of the present invention can also be modified to form a chimenc molecule comprising STEAP-1 fused to another, heterologous polypeptide or amino acid sequence
- a chimenc molecule can be synthesized chemically or recombmantly
- a chimenc molecule can have a protem of the invention fused to another tumor-associated antigen oi fragment theieof
- a protem m accordance with the invention can comprise a fusion of fragments of a STEAP-1 sequence (ammo or nucleic acid) such that a molecule is created that is not, through its length, directly homologous to the ammo or nucleic acid sequences shown in Figure 2 or Figure 3
- Such a chimenc molecule can comprise multiples of the same subsequence of STEAP- 1
- a chimenc molecule can comprise a fusion of a STEAP- 1 -related protem with a polyhistidine epitope
- the chimeric molecule also referred to as an "nnmunoadhesm"
- a fusion could be to the Fc region of an IgG molecule
- the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a STEAP- 1 polypeptide m place of at least one variable region within an Ig molecule
- the immunoglobulin fusion m cludes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGI molecule.
- the protems of the mvention have a number of different specific uses. As STEAP-1 is highly expressed m prostate and other cancers, STEAP- 1-related protems are used m methods that assess the status of STEAP-1 gene products m normal versus cancerous tissues, thereby elucidating the malignant phenotype Typically, polypeptides from specific regions of a STEAP-1 protem are used to assess die presence of perturbations (such as deletions, insertions, pomt mutations etc ) in those regions (such as regions contammg one or more motifs) Exemplary assays utilize antibodies or T cells targeting STEAP- 1-related protems comprising the ammo acid residues of one or more of the biological motifs contained within a STEAP-1 polypeptide sequence in order to evaluate the characte ⁇ stics of this region in normal versus cancerous tissues or to elicit an immune response to the epitope. Alternatively, STEAP- 1-related proteins that contain the amino acid residues of one or more of the
- STEAP-1 protein fragments/subsequences are particularly useful in generating and characterizing domain- specific antibodies (e.g., antibodies recognizing an extracellular or intracellular epitope of a STEAP-1 protein), for identifying agents or cellular factors that bind to STEAP-1 or a particular structural domain thereof, and in various therapeutic and diagnostic contexts, including but not limited to diagnostic assays, cancer vaccines and methods of preparing such vaccines.
- domain-specific antibodies e.g., antibodies recognizing an extracellular or intracellular epitope of a STEAP-1 protein
- Proteins encoded by the STEAP-1 genes, or by analogs, homologs or fragments thereof, have a variety of uses, including but not limited to generating antibodies and in methods for identifying ligands and otlier agents and cellular constituents that bind to a STEAP-1 gene product.
- Antibodies raised against a STEAP-1 protein or fragment thereof are useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of STEAP-1 protein, such as those listed in Table I. Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers.
- STEAP - 1 -related nucleic acids or proteins are also used in generating HTL or CTL responses.
- Various immunological assays useful for the detection of STEAP-1 proteins are used, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
- Antibodies can be labeled and used as immunological imaging reagents capable of detecting STEAP-1 -expressing cells (e.g., in radioscintigraphic imaging methods).
- STEAP-1 proteins are also particularly useful in generating cancer vaccines, as further described herein.
- Another aspect of the invention provides antibodies that bind to STEAP- 1-related proteins.
- Prefened antibodies specifically bind to a STEAP- 1-related protein and do not bind (or bind weakly) to peptides or proteins that are not STEAP- 1-related proteins.
- antibodies tiiat bind STEAP-1 can bind STEAP- 1-related proteins such as the homologs or analogs thereof.
- STEAP-1 antibodies of the invention are particularly useful in cancer (see, e.g., Table I) diagnostic and prognostic assays, and imaging methodologies. Similarly, such antibodies are useful in the treatment, diagnosis, and or prognosis of other cancers, to the extent STEAP-1 is also expressed or overexpressed in these other cancers. Moreover, intracellularly expressed antibodies (e.g., single chain antibodies) are therapeutically useful in treating cancers in which the expression of STEAP-1 is involved, such as advanced or metastatic prostate cancers.
- the invention also provides various immunological assays useful for the detection and quantification of STEAP-1 and mutant STEAP- 1-related proteins.
- Such assays can comprise one or more STEAP-1 antibodies capable of recognizing and binding a STEAP-1-related protein, as appropriate.
- These assays are performed within various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), and the like.
- Immunological non-antibody assays of the invention also comprise T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.
- T cell immunogenicity assays inhibitory or stimulatory
- MHC major histocompatibility complex
- immunological imaging metliods capable of detecting prostate cancer and other cancers expressing STEAP-1 are also provided by the invention, including but not limited to radioscintigraphic imaging methods using labeled STEAP-1 antibodies.
- assays are clinically useful in the detection, monitoring, and prognosis of STEAP-1 expressing cancers such as prostate cancer.
- STEAP- 1 antibodies are also used in methods for purifying a STEAP- 1 -related protein and for isolating STEAP-1 homologues and related molecules.
- a method of purifying a STEAP- 1-related protein comprises incubating a STEAP-1 antibody, which has been coupled to a solid matrix, with a lysate or other solution containing a STEAP-1-related protein under conditions that ' permit the STEAP-1 antibody to bind to the STEAP-1 - related protein; washing the solid matrix to eliminate impurities; and eluting the STEAP- 1-related protein from the coupled antibody.
- Other uses of STEAP-1 antibodies in accordance with the invention include generating anti- idiotypic antibodies that mimic a STEAP-1 protein.
- antibodies can be prepared by immunizing a suitable mammalian host using a STEAP- 1-related protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
- fusion proteins of STEAP-1 can also be used, such as a STEAP-1 GST-fusion protein.
- a GST fusion protein comprising all or most of the amino acid sequence of Figure 2 or Figure 3 is produced, then used as an immunogen to generate appropriate antibodies.
- a STEAP-1-related protein is synthesized and used as an immunogen.
- naked DNA immunization techniques known in the art are used (with or without purified STEAP- 1-related protein or STEAP-1 expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly et al, 1997, Ann. Rev. Immunol. 15: 617-648).
- the amino acid sequence of a STEAP- 1 protein as shown in Figure 2 or Figure 3 can be analyzed to select specific regions of the STEAP-1 protein for generating antibodies.
- hydrophobicity and hydrophilicity analyses of a STEAP-1 amino acid sequence are used to identify hydrophilic regions in the STEAP-1 structure. Regions of a STEAP-1 protein that show immunogenic structure, as well as other regions and domains, can readily be identified using various other metiiods known in the art, such as Chou-Fasman, Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson- olf analysis. Hydrophilicity profiles can be generated using the method of Hopp, T.P.
- Hydropathicity profiles can be generated using the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility profiles can be generated using the method of Bhaskaran R., Ponnuswamy P.K., 1988, Int. ' J. Pept. Protein Res. 32:242-255.
- Beta-turn profiles can be generated using the method of Deleage, G., Roux B., 1987, Protein Engineering 1:289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. Methods for the generation of STEAP-1 antibodies are further illustrated by way of the examples provided herein. Methods for preparing a protein or polypeptide for use as an immunogen are well known in the art. Also well known in the art are methods for preparing immunogenic conjugates of a protein with a carrier, such as BSA, KLH or other carrier protein. In some circumstances, direct conjugation using, for example, carbodiimide reagents are used; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, are effective.
- STEAP-1 imrnunogen is often conducted by injection over a suitable time period and with use of a suitable adjuvant, as is understood in the art.
- titers of antibodies can be taken to determine adequacy of antibody formation.
- STEAP- 1 monoclonal antibodies can be produced by various means well known in the art, For example, immortalized cell lines that secrete a desired monoclonal antibody are prepared using the standard hybridoma technology of Kohler and Milstein or modifications that immortalize antibody-producing B cells, as is generally known. Immortalized cell lines that secrete the desired antibodies are screened by immunoassay in which the antigen is a STEAP-1 -related protein. When the appropriate immortalized cell culture is identified, the cells can be expanded and antibodies produced either from in vitro cultures or from ascites fluid.
- the antibodies or fragments of the invention can also be produced, by recombinant means. Regions that bind specifically to the desired regions of a STEAP-1 protein can also be produced in the context of chimeric or complementarity-determining region (CDR) grafted antibodies of multiple species origin. Humanized or human STEAP-1 antibodies can also be produced, and are prefened for use in therapeutic contexts.
- CDR complementarity-determining region
- Fully human STEAP-1 monoclonal antibodies can be generated using cloning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man, Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. Id., pp 65-82).
- Fully human STEAP-1 monoclonal antibodies can also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application W098/24893, Kucherlapati and Jakobovits et al, published December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drags 7(4): 607-614; U.S. patents 6,162,963 issued 19 December 2000; 6,150,584 issued 12 November 2000; and, 6,114598 issued 5 September 2000). This method avoids the in vitro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.
- Reactivity of STEAP-1 antibodies with a STEAP- 1-related protein can be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, STEAP-1-related proteins, STEAP-1 -expressing cells or extracts thereof.
- a STEAP-1 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme.
- bi-specific antibodies specific for two or more STEAP-1 epitopes are generated using methods generally known in the art. Homodimeric antibodies can also be generated by cross-linking techniques known in the art (e.g., Wolff et al, Cancer Res. 53: 2560-2565).
- compositions of the invention induce a therapeutic or prophylactic immune responses in very broad segments of the world-wide population.
- immunology-related technology For an understanding of the value and efficacy of compositions of the invention that induce cellular immune responses, a brief review of immunology-related technology is provided.
- a complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA-restricted T cells (Buus, S. et al, Cell 47:1071, 1986; Babbitt, B. P. et al, Nature 317:359, 1985; Townsend, A. and Bodmer, H., Anna. Rev. Immunol 7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403, 1993).
- class I and class II allele-specific HLA binding motifs allows identification of regions within a protem that are conelated with bmdmg to particular HLA ant ⁇ gen(s)
- candidates for epitope-based vaccines have been identified, such candidates can be further evaluated by HLA-pephde binding assays to determine bmdmg affinity and/or the time penod of association of the epitope and its co ⁇ esponding HLA molecule Additional confirmatory work can be performed to select, amongst these vaccine candidates, epitopes with prefened characte ⁇ stics m terms of population coverage, and or immunogenicity
- Vanous strategies can be utilized to evaluate cellular immunogenicity, including
- PBL from subjects are cultured in vitro for 1-2 weeks in the presence of test peptide plus antigen presenting cells (APC) to allow activation of "memory" T cells, as compared to "naive” T cells.
- APC antigen presenting cells
- T cell activity is detected using assays including ⁇ Cr release involving peptide-sensitized targets, T cell proliferation, or lymphokine release.
- Nucleic acids that encode a STEAP- 1-related protein can also be used to generate either transgenic animals or "knock out" animals that, in turn, are useful in the development and screening of therapeutically useful reagents.
- cDNA encoding STEAP-1 can be used to clone genomic DNA that encodes STEAP-1. The cloned genomic sequences can then be used to generate transgenic animals containing cells that express DNA that encode STEAP-1. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos.4,736,866 issued 12 April 1988, and 4,870,009 issued 26 September 1989. Typically, particular cells would be targeted for STEAP-1 transgene incorporation with tissue-specific enhancers.
- Transgenic animals that include a copy of a transgene encoding STEAP-1 can be used to examine the effect of increased expression of DNA that encodes STEAP-1. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression. In accordance with this aspect of the invention, an animal is treated with a reagent and a reduced incidence of a pathological condition, compared to untreated animals that bear the transgene, would indicate a potential therapeutic intervention for the pathological condition.
- non-human homologues of STEAP- 1 can be used to construct a STEAP-1 "knock out" animal that has a defective or altered gene encoding STEAP-1 as a result of homologous recombination between the endogenous gene encoding STEAP-1 and altered genomic DNA encoding STEAP-1 introduced into an embryonic cell of the animal.
- cDNA that encodes STEAP-1 can be used to clone genomic DNA encoding STEAP-1 in accordance with established techniques. A portion of the genomic DNA encoding STEAP-1 can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
- flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector (see, e.g., Thomas and Capecchi, Cell. 51:503 (1987) for a description of homologous recombination vectors).
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see, e.g., Li et al., Cell, 69:915 (1992)).
- the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in Terato carcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152).
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal, and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in wliich all cells of the animal contain the homologously recombined DNA. Knock out animals can be characterized, for example, for their ability to defend against certain pathological conditions or for their development of pathological conditions due to absence of a STEAP-1 polypeptide.
- Methods for the Detection of STEAP-1 relate to methods for detecting STEAP-1 polynucleotides and STEAP- 1-related protems, as well as methods for identifying a cell that expresses STEAP-1
- the expression profile of STEAP-1 makes it a diagnostic marker for metastasized disease
- the status of STEAP-1 gene products provides mformation useful for predicting a vanety of factors mcludmg susceptibility to advanced stage disease, rate of progression, and or tumor aggressiveness
- the status of STEAP-1 gene pioducts in patient samples can be analyzed by a variety protocols that are well known in the art mcludmg lmmunohistochemical analysis, the vanety of Northern blotting techniques mcludmg in situ hybndization, RT-PCR analysis (for example on laser capture micro-dissected samples), Western blot analysis and tissue
- die mvention provides assays for the detection of STEAP-1 polynucleotides m a biological sample, such as serum, bone, prostate, and otlier tissues, urine, semen, cell preparations, and the like
- Detectable STEAP-1 polynucleotides m clude, for example, a STEAP-1 gene or fragment thereof, STEAP-1 mRNA, alternative splice vanant STEAP-1 mRNAs, and recombmant DNA or RNA molecules that contam a STEAP-1 polynucleotide
- a number of methods for amphfymg and or detecting die presence of STEAP-1 polynucleotides are well known m the art and can be employed m the practice of this aspect of die mvention
- a method for detecting a STEAP-1 mRNA m a biological sample compnses producing cDNA from the sample by reverse transcription usmg at least one pnmer, amplifying the cDNA so produced using a STEAP-1 polynucleotides as sense and antisense primers to amplify STEAP-1 cDNAs therein, and detecting the presence of the amplified STEAP-1 cDNA
- the sequence of the amplified STEAP 1 cDNA can be determined
- a method of detecting a STEAP-1 gene m a biological sample comp ⁇ ses first isolatmg genomic DNA from die sample, amplifying the isolated genomic DNA using STEAP-1 polynucleotides as sense and antisense pnmers, and detecting the presence of the amplified STEAP-1 gene
- Any number of appropriate sense and antisense probe combinations can be designed from a STEAP-1 nucleotide sequence (see, e g , Figure 2) and used for this purpose
- the mvention also provides assays for detecting the presence of a STEAP-1 protem a tissue or other biological sample such as serum, semen, bone, prostate, u ⁇ ne, cell preparations, and the like
- Methods for detecting a STEAP- 1-related protem are also well known and mclude, for example, immunoprecipitation, lmmunohistochemical analysis, Western blot analysis, molecular bmdmg assays, ELISA, ELIFA and the like
- a method of detectmg the presence of a STEAP- 1-related protem a biological sample comprises first contactmg the sample with a STEAP-1 antibody, a STEAP-1 -reactive fragment thereof, or a recombinant protem contaimng an antigen-binding region of a STEAP-1 antibody, and then detectmg the bmdmg of STEAP-1- related protem m the sample
- an assay for identifying a cell that expresses a STEAP-1 gene compnses detecting the presence of STEAP-1 mRNA in the cell
- Methods for the detection of particular mRNAs m cells are well known and mclude, for example, hybridization assays usmg complementary DNA probes (such as in situ hybridization usmg labeled STEAP-1 nboprobes, Northern blot and related techniques) and vanous nucleic acid amplification assays (such as RT-PCR usmg complementary pnmers specific for STEAP-1, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like)
- an assay for identifying a cell that expresses a STEAP-1 gene compnses detecting the presence of STEAP- 1-related protem m the cell or secreted by die cell Van
- STEAP-1 expression is significantly upregulated in prostate cancer, and is expressed in cancers of the tissues listed in Table I.
- Identification of a molecule or biological agent that inhibits STEAP-1 expression or over-expression in cancer cells is of therapeutic value.
- such an agent can be identified by using a screen that quantifies STEAP-1 expression by RT-PCR, nucleic acid hybridization or antibody binding.
- Oncogenesis is known to be a multistep process where cellular growth becomes progressively dysregulated and cells progress from a normal physiological state to precancerous and then cancerous states (see, e.g., Alers et al, Lab Invest. 77(5): 437-438 (1997) and Isaacs et al, Cancer Surv. 23: 19-32 (1995)).
- examining a biological sample for evidence of dysregulated cell growth allows for early detection of such abe ⁇ ant physiology, before a pathologic state such as cancer has progressed to a stage that therapeutic options are more limited and or the prognosis is worse.
- the status of STEAP-1 in a biological sample of interest can be compared, for example, to the status of STEAP- 1 in a conesponding normal sample (e.g. a sample from that individual or alternatively another individual that is not affected by a pathology).
- a conesponding normal sample e.g. a sample from that individual or alternatively another individual that is not affected by a pathology.
- An alteration in the status of STEAP- 1 in the biological sample provides evidence of dysregulated cellular growth.
- a predetermined normative value such as a predetermined normal level of mRNA expression (see, e.g., Grever et al, J. Comp. Neurol. 1996 Dec 9; 376(2): 306-14 and U.S. Patent No. 5,837,501) to compare STEAP-1 status in a sample.
- status in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products.
- skilled artisans use a number of parameters to evaluate the condition or state of a gene and its products. These include, but are not limited to the location of expressed gene products (including the location of STEAP-1 expressing cells) as well as the level, and biological activity of expressed gene products (such as STEAP-1 mRNA, polynucleotides and polypeptides).
- an alteration in the status of STEAP-1 comprises a change in the location of STEAP-1 and/or STEAP-1 expressing cells and/or an increase in STEAP-1 mRNA and/or protein expression.
- STEAP- 1 status in a sample can be analyzed by a number of means well known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro- dissected samples, Western blot analysis, and tissue array analysis.
- Typical protocols for evaluating the status of a STEAP-1 gene and gene products are found, for example in Ausubel et al. eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis).
- the status of STEAP-1 in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in a STEAP-1 gene), Northern analysis and or PCR analysis of STEAP-1 mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of STEAP-1 mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in polypeptide localization within a sample, alterations in expression levels of STEAP-1 proteins and/or associations of STEAP-1 proteins with polypeptide binding partners).
- genomic Southern analysis to examine, for example perturbations in a STEAP-1 gene
- Northern analysis and or PCR analysis of STEAP-1 mRNA to examine, for example alterations in the polynucleotide sequences or expression levels of STEAP-1 mRNAs
- Western and/or immunohistochemical analysis to examine, for example alterations in polypeptide sequences,
- Detectable STEAP-1 polynucleotides include, for example, a STEAP-1 gene or fragment thereof, STEAP-1 mRNA, alternative splice variants, STEAP-1 mRNAs, and recombinant DNA or RNA molecules containing a STEAP-1 polynucleotide.
- the expression profile of STEAP 1 makes it a diagnostic marker for local and/or metastasized disease, and piovides information on the growth or oncogemc potential of a biological sample
- the status of STEAP 1 provides information useful for pasichng susceptibility to particular disease stages, progression, and/or tumor aggressiveness
- the mvention provides methods and assays for deterrmmng STEAP-1 status and diagnosing cancers that express STEAP-1, such as cancers of the tissues listed m Table I
- assays that evaluate the levels of STEAP 1 mRNA transcnpts or protems m a biological sample can be used to diagnose a disease associated with STEAP-1 dysregulahon, and can provide prognostic information useful m defining appiop ⁇ ate therapeutic options
- the expression status of STEAP-1 provides information mcludmg the presence, stage and location of dysplastic, precancerous and cancerous cells, predicting susceptibility to vanous stages of disease, and/or for gaugmg tumor aggressiveness Moreover, the expression profile makes it useful as an imaging reagent for metastasized disease Consequently, an aspect of the mvention is directed to the vanous molecular prognostic and diagnostic methods for examining the status of STEAP-1 m biological samples such as those from individuals suffering from, or suspected of suffermg from a pathology characterized by dysregulated cellular growth, such as cancer
- the status of STEAP-1 m a biological sample can be examined by a number of well-known procedures the art
- the status of STEAP-1 m a biological sample taken from a specific location m the body can be examined by evaluating the sample for the presence or absence of STEAP-1 expressmg cells (e g those that express STEAP-1 mRNAs or protems)
- This examination can provide evidence of dysregulated cellular growth, for example, when STEAP-1 -expressmg cells are found m a biological sample that does not normally contain such cells (such as a lymph node), because such alterations in the status of STEAP-1 m a biological sample are often associated with dysregulated cellular growth
- one mdicator of dysregulated cellular growth is the metastases of cancer cells from an organ of ongm (such as the prostate) to a different area of the body (such as a lymph node)
- evidence of dysregulated cellular growth is important for example because occult lymph node metastases
- the invention provides methods for mo tormg STEAP-1 gene products by deterrmmng the status of STEAP-1 gene products expressed by cells from an individual suspected of having a disease associated with dysregulated cell growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of STEAP-1 gene products m a conespondmg normal sample The presence of abenant STEAP-1 gene products in the test sample relative to the normal sample provides an indication of the presence of dysregulated cell growth within the cells of the individual
- the mvention provides assays useful m determining the presence of cancer m an individual, comprising detecting a significant increase m STEAP-1 mRNA or protem expression m a test cell or tissue sample relative to expression levels m the correspondmg normal cell or tissue Thegronce of STEAP-1 mRNA can, for example, be evaluated m tissues mcludmg but not limited to those listed in Table I. The presence of significant STEAP-1 expression m any of these tissues is useful to mdicate the emergence, presence and/or seventy of a cancer, since the conesponding normal tissues do not express STEAP-1 mRNA or express it at lower levels
- STEAP-1 status is determined at the protem level rather than at the nucleic acid level
- a method compnses deterrmmng the level of STEAP 1 protem expressed by cells m a test tissue sample and comparing the level so determined to the level of STEAP-1 expressed m a correspondmg normal sample
- the presence of STEAP-1 protem is evaluated, for example usmg immunohistochemical methods STEAP 1 antibodies or bmdmg partners capable of detecting STEAP-1 protem expression are used m a vanety of assay formats well known in the art for this purpose
- a mutation m die sequence of STEAP- 1 may be indicative of the presence or promotion of a tumor
- Such assays tiierefore have diagnostic and predictive value where a mutation m STEAP-1 mdicates a potential loss of function or mcrease tumor growth
- a wide vanety of assays for observing perturbations m nucleotide and ammo acid sequences are well known m the art
- the size and structure of nucleic acid or ammo acid sequences of STEAP-1 gene products are observed by the Northern, Southern, Western, PCR and DNA sequencmg protocols discussed herem
- other methods for observing perturbations m nucleotide and ammo acid sequences such as single strand conformation polymorphism analysis are well known m die art (see, e g , U S Patent Nos 5,382,510 issued 7 September 1999, and 5,952,170 issued 17 January 1995)
- a STEAP-1 gene m Abenant demethylation and/or hypermethylation of CpG islands m gene 5' regulatory regions frequently occurs m immortalized and transformed cells, and can result m altered expression of vanous genes
- promoter hypermethylation of the pi-class glutathione S-tiansferase (a protem expressed m normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al , Am J Pathol 155(6) 1985-1992 (1999))
- this alteration is present in at least 70% of cases of high-grade prostatic mfraepithehal neoplasia (PIN) (Brooks et al , Cancer Epidemiol Biomarkers Pre , 1998, 7 531-536)
- expression of the LAGE-I tumor specific gene (which is not expressed normal prostate but is expressed
- Gene amplification is an additional method for assessmg the status of STEAP-1 Gene amplification is measured m a sample directly, for example, by conventional Southern blotting or Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc Natl Acad Sci USA, 77 5201-5205), dot blotting (DNA analysis), or in situ hybndization, using an appropriately labeled probe, based on the sequences provided herein Alternatively, antibodies are employed tiiat recognize specific duplexes, mcludmg DNA duplexes, RNA duplexes, and DNA-RNA hyb ⁇ d duplexes or DNA-protein duplexes The antibodies m turn are labeled and the assay earned out wheie the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected
- Biopsied tissue or pe ⁇ pheral blood can be conveniently assayed for the presence of cancer cells usmg for example, Northern, dot blot or RT-PCR analysis to detect STEAP-1 expression
- the presence of RT-PCR amplifiable STEAP-1 mRNA provides an mdicahon of the presence of cancer RT-PCR assays are well known in the art RT-PCR detection assays for tumor cells penpheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors In the prostate cancer field, these mclude RT-PCR assays for die detection of cells expressmg PSA and PSM (Verkaik et al , 1997, Urol Res 25 373-384, Ghossem et al , 1995, J Clm Oncol 13 1195-2000, Hesto ef al , 1995, Clin Chem 41 1687-1688)
- a fiirther aspect of the mvention is an assessment of the susceptibility that an individual has for developing cancer
- a method for predicting susceptibility to cancer compnses detecting STEAP 1 mRNA or STEAP-1 protem m a tissue sample, its presence indicating susceptibility to cancer, wherem the degree of STEAP-1 mRNA expression conelates to the degree of susceptibility
- the presence of STEAP-1 m prostate or other tissue is examined, with the presence of STEAP 1 m die sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor)
- STEAP 1 m die sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor)
- a method for gaugmg aggiessiveness of a tumor comprises determining the level of STEAP-1 mRNA or STEAP-1 protem expressed by tumor cells, comparing the level so determined to the level of STEAP-1 mRNA or STEAP-1 protem expressed in a conespondmg normal tissue taken from the same mdividual or a normal tissue reference sample, wherem the degree of STEAP-1 mRNA or STEAP-1 protem expression m the tumor sample relative to the normal sample mdicates the degree of aggressiveness
- aggressiveness of a tumor is evaluated by deterrmmng the extent to which STEAP-1 is expressed m die tumor cells, with higher expression levels indicating more aggressive tumors
- Anotiier embodiment is the evaluation of the lntegnty of STEAP-1 nucleotide and ammo acid sequences in a biological sample, order to identify perturbations in the structure
- Another embodiment of the mvention is directed to methods for observing the progression of a malignancy m an mdividual over time
- methods for observing the progression of a malignancy m an mdividual over fame compnse deteimmmg the level of STEAP-1 mRNA or STEAP-1 protem expressed by cells m a sample of the tumor, comparing the level so determined to die level of STEAP-1 mRNA or STEAP-1 protem expressed m an equivalent tissue sample taken from the same mdividual at a different time, wherem the degree of STEAP-1 mRNA or STEAP-1 protem expression in the tumor sample over time provides information on die progression of the cancer
- die progression of a cancer is evaluated by determining STEAP-1 expression in the tumor cells over time, where mcreased expression over tone mdicates a progression of the cancer
- Another embodiment of the mvention is directed to metiiods for observing a coincidence between the expression of STEAP 1 gene and STEAP-1 gene products (or perturbations in STEAP-1 gene and STEAP-1 gene products) and a factor that is associated with malignancy, as a means for diagnosing and piognosticating the status of a tissue sample
- a wide vanety of factors associated with malignancy can be utilized, such as the expression of genes associated with malignancy (e g PSA, PSCA and PSM expression for prostate cancer etc ) as well as gross cytological observations (see, e g , Bocking et al , 1984, Anal Quant Cytol 6(2) 74-88, Epstein, 1995, Hum Pathol 26(2) 223-9, Thoison et al , 1998, Mod Pathol 11(6) 543-51 , Baisden e/ ⁇ / ,
- methods for observing a comcidence between the expression of STEAP-1 gene and STEAP-1 gene products (or perturbations in STEAP-1 gene and STEAP-1 gene products) and another factor associated with malignancy entails detecting the overexpression of STEAP-1 mRNA or protem m a tissue sample, detecting the overexpression of PSA mRNA or protem in a tissue sample (or PSCA or PSM expression), and observing a comcidence of STEAP- 1 mRNA or protem and PSA mRNA or protem overexpression (or PSCA or PSM expression)
- tire expression of STEAP-1 and PSA mRNA m prostate tissue is examined, where the comcidence of STEAP-1 and PSA mRNA overexpression in the sample mdicates the existence of prostate cancer, prostate cancer susceptibdity or the emergence or status of a prostate tumor
- STEAP-1 protem and nucleic acid sequences disclosed herem allow a skilled artisan to identify protems, small molecules and other agents that mteract with STEAP-1, as well as pathways activated by STEAP- 1 via any one of a variety of art accepted protocols
- interaction trap systems also referred to as the "two-hybrid assay”
- molecules interact and reconstitute a transcription factor which directs expression of a reporter gene, whereupon the expression of the reporter gene is assayed
- Other systems identify protem-protern interactions in vivo through reconstitufaon of a eukaryotic transcriptional activator, see, e g , U S Patent Nos 5,955,280 issued 21 September 1999, 5,925,523 issued 20 July 1999, 5,846,722 issued 8 December 1998 and 6,004,746 issued 21 December 1999 Algonthms are also available m the art for genome-based predictions of protem function (see, e g , Marc
- peptide libraries to identify molecules that interact with STEAP-1 protem sequences
- peptides that bmd to STEAP-1 are identified by screening libraries that encode a random or controlled collection of amino acids.
- Peptides encoded by the libraries are expressed as fusion proteins of bacteriophage coat proteins, the bacteriophage particles are then screened agamst the STEAP-1 protein(s).
- peptides having a wide variety of uses are thus identified without any prior information on the structure of the expected ligand or receptor molecule.
- Typical peptide libraries and screening methods that can be used to identify molecules that interact with STEAP-1 protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 issued 3 March 1998 and 5,733,731 issued 31 March 1998.
- cell lines that express STEAP-1 are used to identify protein-protein interactions mediated by STEAP-1. Such interactions can be examined using immunoprecipitation techniques (see, e.g., Hamilton B.J., et al. Biochem. Biophys. Res. Commun. 1999, 261 :646-51).
- STEAP-1 protein can be immunoprecipitated from STEAP-1 -expressing cell lines using anti-STEAP-1 antibodies.
- antibodies against His-tag can be used in a cell line engineered to express fusions of STEAP-1 and a His-tag (vectors mentioned above).
- the immunoprecipitated complex can be examined for protein association by procedures such, as Western blotting, 35 S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.
- Small molecules and ligands that interact with STEAP-1 can be identified through related embodiments of such screening assays. For example, small molecules can be identified that interfere with protein function, including molecules that interfere with STEAP-1 's ability to mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA molecules as an indication of regulation of cell cycles, second messenger signaling or tumorigenesis. Similarly, small molecules that modulate STEAP- 1-related ion channel, protein pump, or cell communication functions are identified and used to treat patients that have a cancer that expresses STEAP-1 (see, e.g., Hille, B., Ionic Channels of Excitable Membranes 2 nd Ed., Sinauer Assoc, Sunderland, MA, 1992).
- ligands that regulate STEAP-1 function can be identified based on their ability to bind STEAP-1 and activate a reporter construct. Typical methods are discussed for example in U.S. Patent No. 5,928,868 issued 27 July 1999, and include methods for forming hybrid ligands in which at least one ligand is a small molecule.
- cells engineered to express a fusion protein of STEAP-1 and a DNA-binding protein are used to co-express a fusion protein of a hybrid ligand/small molecule and a cDNA library transcriptional activator protein.
- the cells further contain a reporter gene, the expression of wliich is conditioned on the proximity of the first and second fusion protems to each other, an event that occurs only if the hybrid ligand binds to target sites on both hybrid proteins. Those cells that express the reporter gene are selected and the unknown small molecule or the unknown ligand is identified. This method provides a means of identifying modulators, which activate or inhibit STEAP-1.
- An embodiment of this invention comprises a method of screening for a molecule that interacts with a STEAP-1 amino acid sequence shown in Figure 2 or Figure 3, comprising the steps of contacting a population of molecules with a STEAP-1 amino acid sequence, allowing the population of molecules and the STEAP-1 amino acid sequence to interact under conditions that facilitate an interaction, determining the presence of a molecule that interacts with the STEAP-1 amino acid sequence, and then separating molecules that do not interact with the STEAP-1 amino acid sequence from molecules that do.
- the method further comprises purifying, characterizing and identifying a molecule that interacts with the STEAP-1 amino acid sequence. The identified molecule can be used to modulate a function performed by STEAP-1.
- the STEAP-1 amino acid sequence is contacted with a library of peptides.
- STEAP-1 functions as a transcription factor involved in activating tumor-promoting genes or repressing genes that block tumorigenesis.
- therapeutic approaches that inhibit the activity of a STEAP-1 protein are useful for patients suffering from a cancer that expresses STEAP-1.
- These therapeutic approaches generally fall into two classes.
- One class comprises various methods for inhibiting the binding or association of a STEAP-1 protein with its binding partner or with other proteins.
- Another class comprises a variety of methods for inhibiting the transcription of a STEAP-1 gene or translation of STEAP-1 mRNA.
- the invention provides cancer vaccines comprising a STEAP- 1-related protein or STEAP- 1-related nucleic acid.
- cancer vaccines prevent and/or treat STEAP-1 -expressing cancers with minimal or no effects on non-target tissues.
- the use of a tumor antigen in a vaccine that generates humoral and/or cell-mediated immune responses as anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge et al, 1995, Int. J. Cancer 63:231-237; Fong et al, 1997, J. Immunol. 159:3113-3117).
- Such methods can be readily practiced by employing a STEAP- 1-related protein, or a STEAP- 1- encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the STEAP-1 immunogen (which typically comprises a number of antibody or T cell epitopes).
- Skilled artisans understand that a wide variety of vaccine systems for delivery of immunoreactive epitopes are known in the art (see, e.g., Heryln et al, Ann Med 1999 Feb 31(l):66-78; Marayama et al, Cancer Immunol Immunother 2000 Jun 49(3): 123-32) Briefly, such methods of generating an immune response (e.g.
- a STEAP-1 immunogen contains a biological motif, see e.g., Tables V-XVIII and XXII-LI, or a peptide of a size range from STEAP-1 indicated in Figure 5, Figure 6, Figure 7, Figure 8, and Figure 9.
- Such vaccine compositions can include, for example, lipopeptides (e.g.,Vitiello, A. et al, J. Clin. Invest. 95:341, 1995), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG”) microspheres (see, e.g., Eldridge, et al, Molec.
- lipopeptides e.g.,Vitiello, A. et al, J. Clin. Invest. 95:341, 1995
- PLG poly(DL-lactide-co-glycolide)
- MAPs multiple antigen peptide systems
- Toxin-targeted delivery technologies also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
- the vaccine compositions of the invention can also be used in conjunction with other treatments used for cancer, e.g., surgery, chemotherapy, drug therapies, radiation dierapies, etc. including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, and the like.
- CTL epitopes can be determined using specific algorithms to identify peptides within STEAP- 1 protein that bind corresponding HLA alleles (see e.g., Table IV; EpimerTM and EpimatrixTM, Brown University (URL brown.eduResearch/TB-HrV_Lab/ep__imtrix/epirmfrix.html); and, BIMAS, (URL bimas.dcrt.nih.gov/; SYFPEITHI at URL syfpeithi.bmi-heidelberg.com/).
- a STEAP-1 immunogen contains one or more amino acid sequences identified using techniques well known in the art, such as the sequences shown in Tables V-XVIII and XXII-LI or a peptide of 8, 9, 10 or 11 amino acids specified by an HLA Class I motif/supermotif (e.g., Table IV (A), Table IV (D), or Table TV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA Class II motif/supermotif (e.g., Table IV (B) or Table IV (C)).
- HLA Class I motif/supermotif e.g., Table IV (A), Table IV (D), or Table TV (E)
- HLA Class II motif/supermotif e.g., Table IV (B) or Table IV (C)
- the HLA Class I binding groove is essentially closed ended so that peptides of only a particular size range can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11 amino acids long.
- the HLA Class II binding groove is essentially open ended; tiierefore a peptide of about 9 or more amino acids can be bound by an HLA Class II molecule. Due to the binding groove differences between HLA Class I and II, HLA Class I motifs are length specific, i.e., position two of a Class I motif is the second amino acid in an amino to carboxyl direction of the peptide.
- HLA Class II epitopes are often 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino acids.
- Methods of generating an immune response in a mammal comprise exposing the mammal's immune system to an immunogenic epitope on a protein (e.g. a STEAP-1 protein) so that an immune response is generated.
- a protein e.g. a STEAP-1 protein
- a typical embodiment consists of a method for generating an immune response to STEAP-1 in a host, by contacting the host with a sufficient amount of at least one STEAP-1 B cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic interval thereafter re- contacting the host with the STEAP-1 B cell or cytotoxic T-cell epitope or analog thereof.
- a specific embodiment consists of a method of generating an immune response against a STEAP- 1-related protein or a man-made multiepitopic peptide comprising: administering STEAP-1 immunogen (e.g. a STEAP-1 protein or a peptide fragment thereof, a STEAP-1 fusion protein or analog etc.) in a vaccine preparation to a human or anodier mammal.
- STEAP-1 immunogen e.g. a STEAP-1 protein or a peptide fragment thereof, a STEAP-1 fusion protein or analog etc.
- a vaccine preparation further contain a suitable adjuvant (see, e.g., U.S. Patent No. 6, 146,635) or a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see, e.g., Alexander et al, J.
- An alternative method comprises generating an immune response in an individual against a STEAP-1 immunogen by: administering in vivo to muscle or skin of the individual's body a DNA molecule that comprises a DNA sequence that encodes a STEAP-1 immunogen, the DNA sequence operatively linked to regulatory sequences which control the expression of the DNA sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is expressed in the cells and an immune response is generated against the immunogen (see, e.g., U.S. Patent No. 5,962,428).
- a genetic vaccine facilitator such as anionic lipids; saponins; lectins; estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also administered.
- an antiidiotypic antibody can be administered that mimics STEAP-1, in order to generate a response to the target antigen.
- Vaccine compositions of the invention include nucleic acid-mediated modalities.
- DNA or RNA that encode protein(s) of the invention can be administered to a patient.
- Genetic immunization methods can be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing STEAP-1.
- Constructs comprising DNA encoding a STEAP- 1 -related protein/immunogen and appropriate regulatory sequences can be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded STEAP-1 proteinimmunogen.
- a vaccine comprises a STEAP- 1-related protein.
- STEAP- 1-related protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against cells that bear a STEAP-1 protein.
- Various prophylactic and therapeutic genetic immunization techniques known in the art can be used (for review, see information and references published at Internet address genweb.com). Nucleic acid-based delivery is described, for instance, in Wolff et. al, Science 247:1465 (1990) as well as U.S. Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720.
- DNA-based delivery technologies include "naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun”) or pressure-mediated delivery (see, e.g., U.S. Patent No. 5,922,687).
- proteins of the invention can be expressed via viral or bacterial vectors.
- viral gene delivery systems that can be used in the practice of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno-associated virus, lentivirus, and Sindbis virus (see, e.g., Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al J. Natl. Cancer Inst. 87:982-990 (1995)).
- Non-viral delivery systems can also be employed by introducing naked DNA encoding a STEAP- 1 -related protein into the patient (e.g., intramuscularly or intradermally) to induce an anti-tumor response.
- Vaccinia virus is used, for example, as a vector to express nucleotide sequences that encode the peptides of the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the protein immunogenic peptide, and thereby elicits a host immune response.
- Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No. 4,722,848.
- Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover et al, Nature 351:456-460 (1991).
- BCG vectors are described in Stover et al, Nature 351:456-460 (1991).
- a wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention e.g. adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax to
- gene delivery systems are used to deliver a STEAP- 1-related nucleic acid molecule.
- the full-length human STEAP-1 cDNA is employed.
- STEAP-1 nucleic acid molecules encoding specific cytotoxic T lymphocyte (CTL) and/or antibody epitopes are employed. Ex Vivo Vaccines
- Vanous ex vivo strategies can also be employed to generate an immune response
- APCs antigen presenting cells
- DC dendntic cells
- DRCs antigen presenting cells
- DC dendntic cells
- MHC class I and II molecules, B7 co-stimulator, and IL-12 are thus highly specialized antigen presenting cells
- PSMA prostate-specific membrane antigen
- dendntic cells can be used to present STEAP-1 peptides to T cells d e context of MHC class I or II molecules
- autologous dendntic cells are pulsed with STEAP-1 peptides capable of bmdm
- STEAP-1 is an attractive target for antibody-based therapeutic strategies
- a number of antibody strategies are known in the art for targeting both extracellular and intracellular molecules (see, e g , complement and ADCC mediated killing as well as the use of mfrabodies)
- STEAP-1 is expressed by cancer cells of various lineages relative to conesponding normal cells
- systemic administration of STEAP-1 -immunoreactive compositions are prepared that exhibit excellent sensitivity without toxic, non-specific and/or non-target effects caused by bmdmg of the immunoreactive composition to non-target organs and tissues
- Antibodies specifically reactive with domains of STEAP-1 are useful to treat STEAP-1 -expressmg cancers systemically, either as conjugates with a tox or therapeutic agent, or as naked antibodies capable of inhibiting cell proliferation or function
- STEAP-1 antibodies can be mfroduced into a patient such that the antibody binds to STEAP-1 and modulates a function, such as an interaction with a binding partner, and consequently mediates destruction of the tumor cells and/or inhibits the growth of the tumor cells
- Mechamsms by which such antibodies exert a therapeutic effect can include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation of the physiological function of STEAP-1, inhibition of ligand bmdmg or signal transduction pathways, modulation of tumor cell differentiation, alteration of tumor angiogenesis factor profiles, and/or apoptosis
- antibodies can be used to specifically target and bind immunogenic molecules such as an immunogemc region of a STEAP-1 sequence shown in Figure 2 or Figure 3
- cytotoxic agents see, e g , Slevers et al Blood 93 11 3678-3684 (June 1, 1999)
- cytotoxic and/or therapeutic agents are delivered directly to cells, such as by conjugatmg uiem to antibodies specific for a molecule expressed by that cell (e g STEAP-1)
- die cytotoxic agent will exert its known biological effect (l e cytotoxicity) on those cells
- compositions and methods for using antibody-cytotoxic agent conjugates to kill cells are known in the art
- typical methods entail administering to an animal havmg a tumor a biologically effective amount of a conjugate compnsmg a selected cytotoxic and/or therapeutic agent linked to a targeting agent (e g an anh-STEAP-1 antibody) that binds to a maikei (e g STEAP-1) expressed, accessible to binding or localized on the cell surfaces
- a targeting agent e g an anh-STEAP-1 antibody
- a maikei e g STEAP-1
- a typical embodiment is a method of delivering a cytotoxic and/or therapeutic agent to a cell expressmg STEAP-1, comprising conjugating the cytotoxic agent to an antibody that lmmunospecifically binds to a STEAP-1 epitope, and, exposing the cell to the antibody-agent conjugate
- Another illustrative embodiment is a method of treating an individual suspected of suffering from met
- Cancer lmmunotherapy using anti-STEAP-1 antibodies can be done m accordance with various approaches that have been successfully employed m the treatment of other types of cancer, mcludmg but not limited to colon cancer (Arlen et al , 1998, C ⁇ t Rev Immunol 18 133-138), multiple myeloma (Ozaki et al , 1997, Blood 90 3179-3186, Tsunena ⁇ et al , 1997, Blood 90 2437-2444), gastric cancer (Kasprzyk et al , 1992, Cancel Res 52 2771-2776), B-cell lymphoma (Funakoslu et al , 1996, J I ⁇ rmunother Emphasis Tumor Immunol 19 93-101), leukemia (Zhong et al , 1996, Leuk Res 20 581-589), colorectal cancer (Moun et al , 1994, Cancer Res 54 6160-6166, Velders et al , 1995
- antibody therapy can be particularly appropriate in advanced or metastatic cancers
- Treatment with the antibody therapy of the mvention is mdicated for patients who have received one or more rounds of chemotherapy
- antibody therapy of die mvention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment
- antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of die chemotherapeutic agent very well Fan et al (Cancer Res 53 4637-4642, 1993), Prewett et al (International J ofOnco 9 217- 224, 1996), and Hancock et al (Cancer Res 51 4575-4580, 1991) descnbe the use of various antibodies together with chemotherapeutic agents
- antibody therapy can be particularly appropriate rn advanced or metastatic cancers
- Treatment with the antibody therapy of the mvention is mdicated for patients who have received one or more rounds of chemotherapy
- antibody therapy of the mvention is combmed with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment
- antibody uierapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well
- Cancer patients can be evaluated for the presence and level of STEAP-1 expression, preferably usmg immunohistochemical assessments of tumor tissue, quantitative STEAP-1 imaging, or other techniques that reliably mdicate the presence and degree of STEAP-1 expression Immunohistochemical analysis of tumor biopsies or surgical specimens is prefened for this purpose Methods foi immunohistochemical analysis of tumoi tissues are well known in the art
- Anti-STEAP 1 monoclonal antibodies that treat prostate and other cancers include those that initiate a potent immune response agamst die tumor or those that are directly cytotoxic
- anti-STEAP-1 monoclonal antibodies can elicit tumor cell lysis by either complement-mediated or antibody-dependent cell cytotoxicity (ADCC) mechanisms, both of which require an mtact Fc portion of the immunoglobulin molecule for mteraction with effector cell Fc receptor sites on complement protems
- ADCC antibody-dependent cell cytotoxicity
- anti-STEAP-1 mAbs that exert a direct biological effect on tumor growth are useful to treat cancers that express STEAP-1 Mechanisms by which directly cytotoxic mAbs act include inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the mduction of apoptosis
- the mechamsm(s) by which a particular anti-STEAP-1 mAb exerts an anti-tumor effect is evaluated using any number of m vitro as
- the use of murine or other non-human monoclonal antibodies, or human/mouse chimenc mAbs can mduce moderate to strong immune responses agamst the non-human antibody This can lesult in clearance of the antibody from cnculation and reduced efficacy In the most severe cases, such an immune response can lead to the extensive formation of immune complexes which, potentially, can cause lenal failure
- prefened monoclonal antibodies used m are those that are either fully human or humanized and that b d specifically to the target STEAP-1 antigen with high affinity but exhibit low or no antigenicity m the patient
- Theiapeutic methods of the invention contemplate the administration of single anti-STEAP-1 mAbs as well as combinations, or cocktails, of different mAbs
- Such mAb cocktails can have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality
- Such mAbs in combination can exhibit synergistic therapeutic effects
- anti-STEAP-1 mAbs can be administered concormtantly with other tiierapeutic modalities, including but not limited to various chemotherapeutic agents, androgen-blockers, immune modulators (e g , IL-2, GM-CSF), surgery or radiation
- the anti-STEAP-1 mAbs are administered m their "naked" or unconjugated form, or can have a therapeutic agent(s) conjugated to them
- Anti-STEAP-1 antibody formulations are administered via any route capable of dehvenng the antibodies to a tumor cell
- Routes of administration mclude, but are not limited to, intravenous, lntrapentoneal, intramuscular, mtratumor, mtradermal, and the like
- Treatment generally mvolves repeated administration of die anti-STEAP-1 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose m the range of about 0 1, 2, 3, 4, 5, 6, 7, 8, 9 , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 mg/kg body weight
- IV intravenous injection
- doses in the range of 10-1000 mg mAb per week are effective and well tolerated
- an initial loadmg dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti-STEAP-1 mAb preparation represents an acceptable dosing regimen
- the initial loadmg dose is administered as a 90-m ⁇ nute or longer infusion
- the penodic maintenance dose is adrmmstered as a 30 minute or longer infusion, provided the initial dose was well tolerated
- various factors can influence the ideal dose regimen m a particular case Such factors include, for example, the bmding affinity and half life of the Ab or mAbs used, the degree of STEAP-1 expression m the patient, the extent of circulating shed STEAP-1 antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used m combination with the treatment method of the mvention, as well as the health status of a particular patient
- patients should be evaluated for die levels of STEAP 1 in a given sample (e g the levels of circulating STEAP-1 antigen and or STEAP-1 expressing cells) m order to assist in the determination of the most effective dosmg regimen, etc
- a given sample e g the levels of circulating STEAP-1 antigen and or STEAP-1 expressing cells
- Such evaluations are also used foi monitonng purposes throughout therapy, and are useful to gauge therapeutic success m combination with the evaluation of other parameters (for example, counter cytology and/or ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in prostate cancer therapy)
- Anti-idiotypic anti-STEAP-1 antibodies can also be used m anti-cancer therapy as a vaccine for inducing an immune response to cells expressmg a STEAP-1-related protem
- this methodology can readily be adapted to generate antiidiotypic anti-STEAP-1 antibodies that mimic an epitope on a STEAP- 1-related protem (see, for example, Wagner et al , 1997, Hybridoma 16 33-40, Foon et al , 1995, J Clin Invest 96 334-342, Herlyn et al , 1996, Cancer Immunol Immunother 43 65-76)
- Such an anti-idiotypic antibody can be used m cancer vaccine stiategies
- vaccmes m accordance with the invention encompass compositions of one or more of the claimed peptides
- a peptide can be present in a vaccine individually Alternatively, the peptide can exist as a homopolymer compnsmg multiple copies of the same peptide, or as a heteropolymer of vanous peptides
- Polymers have the advantage of increased immunological reaction and, where different peptide epitopes are used to make up the polymer, the additional ability to mduce antibodies and/or CTLs that react with different antigenic determinants of the pathogemc orgamsm or tumor-related peptide targeted for an immune response
- the composition can be a naturally occurring region of an antigen or can be prepared, e g , recombmantly or by chemical synthesis
- Carriers that can be used with vaccines of the mvention are well known in the art, and mclude, e g , thyroglobulm, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly L-lysme, poly L-glutamic acid, influenza, hepatitis B virus core protem, and the like
- the vaccines can contain a physiologically tolerable (i e , acceptable) diluent such as water, or salme, preferably phosphate buffered salme
- the vaccmes also typically include an adjuvant Adjuvants such as mcomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known m the art Additionally, as disclosed heiein, CTL responses can be pruned by conjugating peptides of the mvention to lipids, such as tnpalmitoyl-S-glycerylcystemly
- a peptide composition m accordance with the mvention Upon immunization with a peptide composition m accordance with the mvention, via injection, aerosol, oral, transdermal, transmucosal, mtrapleural, lntrathecal, or other suitable routes, the immune system of the host responds to the vaccine by producmg large amounts of CTLs and/or HTLs specific for the desired antigen Consequently, the host becomes at least partially immune to later development of cells that express or overexpress STEAP-1 antigen, or derives at least some therapeutic benefit when the antigen was tumor- associated
- a prefened embodiment of such a composition comprises class I and class II epitopes m accordance with the invention
- An alternative embodiment of such a composition comp ⁇ ses a class I and/or class II epitope in accordance with the invention, along with a cross
- a vaccme of the invention can also mclude antigen-presenting cells (APC), such as dendntic cells (DC), as a vehicle to present peptides of the mvention Vaccme compositions can be created in vitr o, following dendntic cell mobilization and harvesting, whereby loadmg of dendntic cells occurs in vitro
- APC antigen-presenting cells
- DC dendntic cells
- Vaccme compositions can be created in vitr o, following dendntic cell mobilization and harvesting, whereby loadmg of dendntic cells occurs in vitro
- dendntic cells are fransfected, e g , with a mimgene in accordance with the invention, or are pulsed with peptides
- the dendntic cell can then be adrmmstered to a patient to elicit immune responses in vivo Vaccme compositions, either DNA- or peptide-based, can also be administered in vivo m combination with dendntic cell
- the following principles are utilized when selecting an anay of epitopes for inclusion in a polyepitopic composition for use in a vaccme, or for selecting discrete epitopes to be included m a vaccine and/or to be encoded by nucleic acids such as a mimgene It is prefened that each of the following principles be balanced m order to make the selection
- the multiple epitopes to be mcorporated m a given vaccme composition may be, but need not be, contiguous in sequence in the native antigen from which the epitopes are derived
- Epitopes are selected which, upon administration, mimic immune responses that have been observed to be conelated with tumor clearance For HLA Class I this includes 3-4 epitopes that come from at least one tumor associated antigen (TAA) For HLA Class II a similar rationale is employed, again 3-4 epitopes are selected from at least one TAA (see, e g , Rosenberg et al , Science 278 1447-1450) Epitopes from one TAA may be used m combination with epitopes from one or more additional TAAs to produce a vaccme that targets tumors with varying expression patterns of frequently-expressed TAAs
- Epitopes are selected that have the requisite binding affinity established to be conelated with immunogenicity for HLA Class I an IC 50 of 500 nM or less, often 200 nM or less, and for Class II an IC 50 of 1000 nM or less
- Sufficient supermotif bearmg-peptides, or a sufficient anay of allele-specific motif-bearing peptides, are selected to give broad population coverage For example, it is preferable to have at least 80% population coverage
- a Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess die breadth, or redundancy of, population coverage
- nested epitopes Nested epitopes occur where at least two epitopes overlap m a given peptide sequence
- a nested peptide sequence can compnse B cell, HLA class I and or HLA class II epitopes
- providmg nested epitopes a general objective is to provide the greatest number of epitopes per sequence
- an aspect is to avoid providmg a peptide that is any longer than the ammo terminus of the ammo terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide
- a multi-epitopic sequence such as a sequence compnsmg nested epitopes, it is generally important to screen the sequence in order to insure that it does not have pathological or other deleterious biological properties
- a polyepitopic protem is created, or when creating a mimgene, an objective is to generate the smallest peptide that encompasses the epitopes of interest This principle is similar, if not the same as that employed when selecting a peptide comprising nested epitopes
- the size minimization objective is balanced agamst the need to integrate any spacer sequences between epitopes in the polyepitopic protem
- Spacer ammo acid residues can, for example, be mfroduced to avoid junctional epitopes (an epitope recognized by the immune system, not present m the target antigen, and only created by the man-made juxtaposition of epitopes), or to facilitate cleavage between epitopes and thereby enhance epitope presentation
- Junctional epitopes are geneially to be avoided because the recipient may generate an immune response to that non-native epitope Of particular concern is a junctional epitope that is a "
- potential peptide epitopes can also be selected on the basis of their conservancy
- a cntenon for conservancy may define that the entire sequence of an HLA class I bmding peptide 01 the entire 9-mer core of a class II bmdmg peptide be conserved a designated percentage of the sequences evaluated for a specific protem antigen
- the immunogenicity of a multi-epitopic mmigene can be confirmed in transgenic mice to evaluate the magnitude of CTL induction responses against the epitopes tested Further, the immunogenicity of DNA- encoded epitopes in vivo can be conelated with the in vitro responses of specific CTL lines agamst target cells fransfected with the DNA plasmid Thus, these experiments can show that the mmigene serves to both 1 ) generate a CTL response and 2 ) that the induced CTLs recognized cells expressmg the encoded epitopes
- the amino acid sequences of the epitopes may be reverse translated
- a human codon usage table can be used to guide the codon choice for each ammo acid
- These epitope-encodmg DNA sequences may be directly adjomed, so that when franslated, a continuous polypeptide sequence is created
- additional elements can be incorporated into the mimgene design
- ammo acid sequences that can be reverse translated and mcluded m the mimgene sequence mclude HLA class I epitopes, HLA class II epitopes, antibody epitopes, a ubiquitination signal sequence, and/or an endoplasmic rehculum targeting signal
- HLA presentation of CTL and HTL epitopes may be improved by mcludmg synthetic (e g poly-alanme) or naturally-occurring flanking sequences adjacent to the C
- Standard regulatory sequences well known to those of skill the art are preferably included m the vector to ensure expression in the target cells
- Several vector elements are desirable a promoter with a downstream cloning site for mimgene insertion, a polyadenylation signal for efficient transcription termination, an E coli ongm of replication, and an E coli selectable marker (e g ampicillin or kanamycin resistance)
- E coli selectable marker e g ampicillin or kanamycin resistance
- Numerous promoters can be used for this purpose, e g , the human cytomegalovirus (hCMV) promoter See, eg, U S Patent Nos 5,580,859 and 5,589,466 for other suitable promoter sequences
- introns are required for efficient gene expression, and one or more synthetic or naturally- occu ⁇ ing mtrons could be mcorporated mto the transcribed region of the mmigene
- mRNA stabilization sequences and sequences for replication m mammalian cells may also be considered for increasing mimgene expression
- the mimgene is cloned mto the polylinker region downstream of the promoter
- This plasmid is transformed mto an appropriate E coli strain, and DNA is prepared usmg standard techniques
- the orientation and DNA sequence of the mimgene, as well as all other elements mcluded m the vector, are confirmed using restriction mapping and DNA sequence analysis
- Bactenal cells harboring the conect plasmid can be stored as a master cell bank and a workmg cell bank
- lmmunostimulatory sequences appear to play a role m the immunogenicity of DNA vaccmes
- sequences may be mcluded m the vector, outside the mimgene codmg sequence, if desired to enhance lmrminogenicity
- a bi-cisfronic expression vector which allows production of both the mimgene- encoded epitopes and a second protem (mcluded to enhance or decrease immunogenicity) can be used.
- protems or polypeptides that could beneficially enhance the immune response if co-expressed include cytokines (eg, IL-2, IL-12, GM-CSF), cytokme-mducmg molecules (eg, LeIF), costimulatory molecules, or for HTL responses, pan-DR binding protems (PADRETM, Epimmune, San Diego, CA) Helper (HTL) epitopes can be jomed to mtoacellular targeting signals and expressed separately from expressed CTL epitopes, this allows direction of the HTL epitopes to a cell compartment different than that of the CTL epitopes If required, this could facilitate more efficient entry of HTL epitopes mto the HLA class II pathway, thereby improvmg HTL induction In contrast to HTL
- Therapeutic quantities of plasmid DNA can be produced for example, by fermentation m E coli, followed by purification Ahquots from the workmg cell bank are used to inoculate growth medium, and grown to saturation m shaker flasks or a bioreactor accordmg to well-known techniques Plasmid DNA can be purified using standard bioseparation technologies such as solid phase amon-exchange resms supplied by QIAGEN, Inc (Valencia, California) If required, supercoiled DNA can be isolated from the open circular and linear forms using gel elecfrophoresis or other methods
- Punfied plasmid DNA can be prepared for injection usmg a variety of formulations The simplest of these is reconstitution of lyophilized DNA in stenle phosphate buffer salme (PBS) This approach, known as "naked DNA," is currently bemg used for intramuscular (IM) administration in clinical tnals
- PBS stenle phosphate buffer salme
- IM intramuscular
- an alternative method for formulating punfied plasmid DNA may be desirable
- new techniques may become available Cationic lipids, glycolipids, and fusogemc liposomes can also be used m the formulation (see, e g , as desc ⁇ bed by WO 93/24640, Manmno & Gould-Foge ⁇ te, BioTechmques 6(7) 682 (1988), U S Pat No 5,279,833, WO 91/06309, and Feigner, et al Proc Nat'l Acad Sci USA 84 74
- Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of mmigene-encoded CTL epitopes
- the plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays
- the transfection method used will be dependent on the final formulation Elect operation can be used for "naked" DNA, whereas catiomc lipids allow direct in vitro transfection
- a plasmid expressmg green fluorescent protem (GFP) can be co-tiansfected to allow en ⁇ chment of fransfected cells using fluorescence activated cell sorting (FACS)
- FACS fluorescence activated cell sorting
- nucleic acids can be administered usmg ballistic delivery as desc ⁇ bed, for mstance, m U S Patent No 5,204,253 Usmg this technique, particles comprised solely of DNA are administered
- DNA can be adhered to particles, such as gold particles
- Mimgenes can also be delivered using other bacterial or viral delivery systems well known in the art, e g , an expression construct encoding epitopes of the invention can be mcorporated mto a viral vector such as vaccinia
- Vaccme compositions compnsmg CTL peptides of the mvention can be modified, e g , analoged, to provide desired attributes, such as improved serum half life, broadened population coverage or enhanced immunogenicity
- the ability of a peptide to mduce CTL activity can be enhanced by linking the peptide to a sequence which contains at least one epitope that is capable of inducing a T helper cell response
- a CTL peptide can be directly linked to a T helper peptide, often CTL epitope/HTL epitope conjugates are linked by a spacer molecule
- the spacer is typically compnsed of relatively small, neutral molecules, such as ammo acids or am o acid mimetics, which are substantially uncharged under physiological conditions
- the spacers are typically selected from, e g , Ala, Gly, or other neutral spacers of nonpolar ammo acids or neutral polar a mo acids It will be understood that the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo-ohgomer When present, the spacer will usually be at least one or two residues, moie usually three to six residues and sometimes 10 or more residues
- the T helper peptide is one that is recognized by T helper cells present m a majority of a genetically diverse population This can be accomplished by selecting peptides that bmd to many, most, or all of the HLA class II molecules Examples of such amino acid bmd many HLA Class II molecules include sequences from antigens such as tetanus toxoid at positions 830-843 (QYIKANSKFIGITE, SEQ ID NO 44), Plasmodium falciparum circumsporozoite (CS) prote at positions 378-398
- Pan-DR-bmdmg epitopes e g , PADRETM, Epimmune, Inc , San Diego, CA
- Pan-DR-bmdmg epitope peptide havmg the formula aKXVAAWTLKAAa (SEQ ID NO 47), where "X" is either cyclohexylalamne, phenylalanine, or tyrosine, and a is either D-alamne or L-alanme, has been found to bmd to most HLA-DR alleles, and to stimulate the response of T helper lymphocytes from most
- HTL peptide epitopes can also be modified to alter then: biological properties
- they can be modified to mclude D-armno acids to increase their resistance to proteases and thus extend their serum half life, or they can be conjugated to other molecules such as lipids, protems, carbohydrates, and the like to increase their biological activity
- a T helper peptide can be conjugated to one or more palmitic acid chains at either the ammo or carboxyl termini
- m the pharmaceutical compositions of the invention at least one component which primes B lymphocytes or T lymphocytes
- Lipids have been identified as agents capable of priming CTL in vivo
- palmitic acid residues can be attached to the ⁇ -and ⁇ - ammo groups of a lysine residue and then linked, e g , via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogemc peptide
- the hpidated peptide can then be adrmmstered either directly a micelle or particle, incorporated mto a liposome, or emulsified m an adjuvant, e g , incomplete Freund's adjuvant
- a particularly effective immunogemc composition compnses palmitic acid attached to ⁇ - and ⁇ - ammo groups of Lys, which is attached via linkage, e g ,
- E coli l poproteins such as tnpalmitoyl-S- glycerylcystemlyseryl- serine (P CSS) can be used to p ⁇ me virus specific CTL when covalently attached to an appropnate peptide (see, e g , Deres, et al , Natur e 342 561, 1989)
- Peptides of die invention can be coupled to P 3 CSS, for example, and the lipopephde administered to an mdividual to prime specifically an immune response to the target antigen
- two such compositions can be combined to more effectively elicit both humoral and cell- mediated responses
- Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
- An embodiment of a vaccine composition m accordance with the invention compnses ex vivo administration of a cocktail of epitope bearing peptides to PBMC, or isolated DC therefrom, from the patient's blood
- a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietanTM (Pharmacia- Monsanto, St Louis, MO) or GM-CSF/IL-4
- the DC are washed to remove unbound peptides
- a vaccme compnses peptide pulsed DCs which present the pulsed peptide epitopes complexed with HLA molecules on their surfaces
- the DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate CTL responses to STEAP-1
- a helper T cell (HTL) peptide such as a natural or artificial loosely restricted HLA Class II peptide, can be included to facilitate the CTL response
- HTL helper T cell
- a vaccme m accordance with the invention is used to freat a cancer which expresses or ovei expresses STEAP-1
- Antigenic STEAP-1-related peptides are used to elicit a CTL and/or HTL response ex vivo, as well
- the resulting CTL or HTL cells can be used to freat tumors m patients that do not respond to other conventional forms of therapy, or will not respond to a therapeutic vaccme peptide or nucleic acid in accordance with the invention
- Ex vivo CTL or HTL responses to a particular antigen are mduced by incubating m tissue culture the patient's, or genetically compatible, CTL or HTL precursor cells together with a source of antigen-presenting cells (APC), such as dendntic cells, and the appropnate immunogenic peptide After an appropnate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded mto effector cells, the cells are infused back mto the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their specific target cell (e g , a
- compositions of the invention are typically used to treat and/or prevent a cancer that expresses or overexpresses STEAP-1
- peptide and/or nucleic acid compositions are administered to a patient in an amount sufficient to elicit an effective B cell, CTL and/or HTL response to the antigen and to cure or at least partially anest or slow symptoms and/or complications
- An amount adequate to accomplish this is defined as "therapeutically effective dose"
- Amounts effective for this use will depend on, e g , the particular composition administered, the manner of administration, the stage and seventy of the disease being treated, the weight and general state of health of the patient, and the judgment of the presc ⁇ bmg physician
- the immunogenic peptides of the invention are generally adrmmstered to an individual already bearmg a tumor that expresses STEAP-1
- the peptides or DNA encodmg them can be administered individually or as fusions of one or more peptide sequences Patients can be treated with the immunogemc peptides separately or m conjunction with other treatments, such as surgery, as appropnate
- vaccme composition i e , mcludmg, but not limited to embodiments such as peptide cocktails, polyepitopic polypeptides, mmigenes, or TAA-specific CTLs or pulsed dendntic cells
- a vaccme compnsing STEAP-1 -specific CTL may be more efficacious in killing tumor cells in patient with advanced disease than alternative embodiments
- compositions which stimulate helper T cell responses can also be given in accordance with this embodiment of the mvention
- the dosage for an initial therapeutic immunization generally occurs in a unit dosage range where the lower value is about 1, 5, 50, 500, or 1,000 ⁇ g and the higher value is about 10,000, 20,000, 30,000, or 50,000 ⁇ g
- Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient
- Boosting dosages of between about 1 0 ⁇ g to about 50,000 ⁇ g of peptide pursuant to a boostmg regimen over weeks to months may be administered depending upon the patient's response and condition as determined by measuring the specific activity of CTL and HTL obtained from the patient's blood Administration should continue until at least clinical symptoms or laboratory tests indicate that the neoplasia, has been eliminated or reduced and for a penod thereafter
- the dosages, routes of administration, and dose schedules are adjusted m accordance with methodologies known m the art
- the peptides and compositions of the present mvention are employed m serious disease states, that is, life-threatening or potentially life threatening situations
- life-threatening or potentially life threatening situations in such cases, as a result of the minimal amounts of extraneous substances and the relative nontoxic nature of the peptides m prefened compositions of the mvention, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these peptide compositions relative to these stated dosage amounts
- the vaccme compositions of the invention can also be used purely as prophylactic agents Generally the dosage for an initial prophylactic immunization generally occurs m a umt dosage range where the lower value is about 1, 5, 50, 500, or 1000 ⁇ g and the higher value is about 10,000, 20,000, 30,000, or 50,000 ⁇ g Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient This is followed by boostmg dosages of between about 1 0 ⁇ g to about 50,000 ⁇ g of peptide adrmmstered at defined mtervals from about four weeks to six months after the initial administration of vaccme The immunogenicity of the vaccme can be assessed by measuring the specific activity of CTL and HTL obtamed from a sample of the patient's blood
- compositions for tiierapeutic treatment are mtended for parenteral, topical, oral, nasal, lntrathecal, or local (e g as a cream or topical ointment) administration
- the pharmaceutical compositions are administered parentally, e g , intravenously, subcutaneously, mtradermally, or intramuscularly
- compositions for parenteral administration which comprise a solution of the immunogemc peptides dissolved or suspended in an acceptable earner, preferably an aqueous earner
- a vanety of aqueous earners may be used, e g , water, buffered water, 0 8% salme, 0 3% glycine, hyaluromc acid and the like
- These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered
- the resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combmed with a sterile solution prior to administration
- compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH-adjusting and buffermg agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chlo ⁇ de, potassium chloride, calcium chloride, sorbitan monolaurate, tnethanolamme oleate, etc
- the concentration of peptides of the mvention m the pharmaceutical formulations can vary widely, i e , from less than about 0 1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc , m accordance with the particular mode of administration selected
- a human unit dose form of a composition is typically included m a phannaceuhcal composition that comprises a human unit dose of an acceptable earner, m one embodiment an aqueous carrier, and is administered m a volume/quantity that is known by those of skill m the art to be used for administration of such compositions to humans (see, e g , Remington's Pharmaceutical Sciences, 17 th Edition, A Gennaro, Editor, Mack Publishing Co , Easton, Pennsylvania, 1985)
- a peptide dose for initial immunization can be from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient
- an initial immunization may be performed using an expression vector m the form of naked nucleic acid administered IM (or SC oi ID) m the amounts of 0 5-5 mg at multiple sites
- the nucleic acid (0 1 to 1000 ⁇ g) can also be administered using a gene gun Following an incubation penod of 3-4 weeks, a
- a treatment generally involves repeated admmistration of the anti-STEAP-1 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose m the range of about 0 1 to about 10 mg/kg body weight
- IV intravenous injection
- an initial loadmg dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- STEAP-1 mAb preparation represents an acceptable dosmg regimen
- vanous factors can influence the ideal dose m a particular case Such factors mclude, for example, half life of a composition, the bmdmg affinity of an Ab, the immunogenicity of a substance, the degree of STEAP-1 expression in the patient, the extent of circulating shed STEAP-1 antigen, the desired steady-state concenfration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in comb
- human umt dose forms of polynucleohdes comprise a suitable dosage range or effective amount that provides any therapeutic effect
- a therapeutic effect depends on a number of factors, mcludmg the sequence of the polynucleotide, molecular weight of the polynucleotide and route of administration
- Dosages are generally selected by the physician or other health care professional in accordance with a vanety of parameters known in the art, such as seventy of symptoms, history of the patient and the like
- a dosage range may be selected from, for example, an independently selected lower limit such as about 0 1, 025, 0 5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater tiian the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000
- human umt dose forms of T-cells comprise a suitable dosage range or effective amount that provides any therapeutic effect
- a therapeutic effect depends on a number of factors Dosages are generally selected by the physician or other health care professional m accordance with a variety of parameters known m the art, such as seventy of symptoms, history of the patient and the like
- a dose may be about 10 4 cells to about 10 ⁇ cells, about 10 6 cells to about 10 8 cells, about 10 s to about 10" cells, or about 10 s to about 5 x l ⁇ '° cells
- a dose may also about 10 6 cells/m 2 to about 10 10 cells/m 2 , or about 10 6 cells/m 2 to about 10 8 cells/m 2
- Protems(s) of the invention, and/or nucleic acids encodmg the protem(s), can also be administered via liposomes, which may also serve to 1) target the protems(s) to a particular tissue, such as lymphoid tissue, 2) to target selectively to diseases cells, or, 3) to mcrease the half life of the peptide composition
- Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phosphohpid dispersions, lamellar layers and the like
- the peptide to be delivered is mcorporated as part of a liposome, alone or conjunction with a molecule which binds to a receptor prevalent among lymphoid cells, such as monoclonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogemc compositions
- liposomes either filled or decorated with a desired peptide of the mvention can be directed to the site of lymphoid cells, where the liposomes
- a ligand to be mcorporated mto the liposome can mclude, e g , antibodies or fragments thereof specific for cell surface determmants of the desired immune system cells
- a liposome suspension contammg a peptide may be administered intravenously, locally, topically, etc m a dose which varies accordmg to, inter alia, the manner of administration, the peptide being delivered, and the stage of the disease being treated
- nontoxic solid earners may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like
- a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those earners previously listed, and generally 10-95% of active mgredient, that is, one or more peptides of the mvention, and more preferably at a concentration of 25%-75%
- immunogemc peptides are preferably supplied in finely divided form along with a surfactant and propellant Typical percentages of peptides are about 0 01%-20% by weight, preferably about 1 %- 10%
- the surfactant must, of course, be nontoxic, and preferably soluble m the propellant
- Representative of such agents are the esters or partial esters of fatty acids contammg from about 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stea ⁇ c, hnoleic, lmolenic, oleste ⁇ c and oleic acids with an aliphatic polyhydnc alcohol or its cyclic anhydnde
- the surfactant may constitute about 0 l%-20% by weight of the composition, preferably about 0 25- 5%
- the balance of the composition is ordinarily propellant
- a carrier can also be included, as
- STEAP-1 polynucleotides, polypeptides, reactive cytotoxic T cells (CTL), reactive helper T cells (HTL) and anti-polypepbde antibodies are used m well known diagnostic, prognostic and therapeutic assays that examine conditions associated with dysregulated cell growth such as cancer, m particular the cancers listed m Table I (see, e g , both its specific pattern of tissue expression as well as its overexpression m certain cancers as described for example in the Example entitled "Expression analysis of STEAP 1 m normal tissues, and patient specimens"
- STEAP-1 can be analogized to a prostate associated antigen PSA, the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see, e g , Mer ⁇ ll et al , J Urol 163(2) 503-5120 (2000), Polascik et al , J Urol Aug, 162(2) 293 306 (1999) and Fortier et al , J Nat Cancer Inst 91(19) 1635-1640(1999))
- diagnostic markers are also used in similar contexts including p53 and K-ras (see, e g , Tulchmsky et al , Int J Mol Med 1999 Jul 4(1) 99-102 and Mmimoto et al , Cancer Detect Prev 2000,24(1) 1-12) Therefore, this disclosure of STEAP-1 polynucleotides and polypeptides (as well as STEAP-1 polynucleotide probes and anti-STEAP-1 antibodies used to identify prostate
- Typical embodiments of diagnostic methods which utilize the STEAP-1 polynucleotides, polypeptides, reactive T cells and antibodies are analogous to those methods from well-established diagnostic assays, which employ, e g , PSA polynucleotides, polypeptides, reactive T cells and antibodies
- PSA polynucleotides are used as probes (for example in Northern analysis, see, e g , Sha ⁇ ef et al , Biochem Mol Biol Int 33(3) 567-74(1994)) and primers (for example m PCR analysis, see, e g , Okegawa et al , J Urol 163(4) 1189-1190 (2000)) to observe the presence and/or the level of PSA mRNAs in methods of momtonng PSA overexpression or the metastasis of prostate cancers
- the STEAP-1 polynucleotides described herem can be utilized in the same way to detect STEAP-1 overexpression or the metastasis of
- metastases involves the movement of cancer cells from an organ of ongm (such as the lung or prostate gland etc ) to a different area of the body (such as a lymph node)
- assays which examine a biological sample for the presence of cells expressing STEAP-1 polynucleotides and/or polypeptides can be used to provide evidence of metastasis
- tissue that does not normally contain STEAP-1 -expressmg cells lymph node
- STEAP-1 -expressmg cells such as the STEAP-1 expression seen in LAPC4 and LAPC9
- STEAP- 1 polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when cells m a biological sample tiiat do not normally express STEAP-1 or express STEAP-1 at a different level are found to express STEAP-1 or have an mcreased expression of STEAP-1 (see, e g , the STEAP-1 expression m the cancers listed m Table I and m patient samples etc shown m the accompanying Figures)
- artisans may further wish to geneiate supplementary evidence of metastasis by testing the biological sample for the presence of a second tissue restncted marker (m addition to STEAP-1) such as PSA, PSCA etc (see, e g , Alanen et al Pathol Res Pract 192(3) 233-237 (1996))
- PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods of monitoring PSA
- STEAP-1 polynucleotide fragments and polynucleotide variants are used in an analogous manner
- typical PSA polynucleotides used m methods of monitoring PSA are probes or primers which consist of fragments of the PSA cDNA sequence
- primers used to PCR amplify a PSA polynucleotide must mclude less than the whole PSA sequence to function in the polymerase cham reaction
- skilled artisans generally create a variety of different polynucleotide fragments that can be used as primers m order to amplify different portions of a polynucleotide of interest or to optimize amplification reactions (see, e g , Caetano-Anolles, G Biotechniques 25(3) 472-476, 478- 480
- PSA polypeptides which contain an epitope that can be recognized by an antibody or T cell that specifically binds to that epitope are used m methods of monitoring PSA STEAP-1 polypeptide fragments and polypeptide analogs or variants can also be used m an analogous manner
- This practice of using polypeptide fragments or polypeptide vanants to generate antibodies is typical m the art with a wide variety of systems such as fusion protems bemg used by practitioners (see, e g , Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M Ausubel et al eds , 1995)
- each ep ⁇ tope(s) functions to provide the architecture with which an antibody or T cell is reactive
- skilled artisans create a variety of different polypeptide fragments that can be used in order to generate immune responses specific for different portions of a polypeptide of mterest (see, e g , U S Patent No 5,840,501 and U S Patent
- the STEAP-1 polynucleotides and polypeptides exhibit specific properties that make them useful m diagnosing cancers such as those listed m Table I Diagnostic assays that measure the presence of STEAP-1 gene products, rn order to evaluate the presence or onset of a disease condition descnbed herein, such as prostate cancer, are used to identify patients for preventive measures or further monitoring, as has been done so successfully with PSA Moreover, these materials satisfy a need m the art for molecules having similar or complementary charactenstics to PSA in situations where, for example, a defimte diagnosis of metastasis of prostatic origin cannot be made on the basis of a test for PSA alone (see, e g , Alanen et al , Pathol Res Pract 192(3) 233-237 (1996)), and consequently, materials such as STEAP-1
- the STEAP-1 polynucleotides disclosed herem have a number of other utilities such as tiieir use m the identification of oncogenetic associated chromosomal abnormalities in the chromosomal region to which the STEAP-1 gene maps (see the Example entitled "Chromosomal Mapping of STEAP-1" below)
- the STEAP-1 -related proteins and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see, e g , Takahama K Forensic Sci Int 1996 Jun 28,80(1-2) 63- 9)
- STEAP- 1-related protems or polynucleotides of the mvention can be used to treat a pathologic condition characterized by the over-expression of STEAP-1
- the amino acid or nucleic acid sequence of Figure 2 oi Figure 3, or fragments of either can be used to generate an immune response to a STEAP-1 antigen Antibodies or other molecules that react with STEAP-1 can be used to modulate the function of this molecule, and thereby provide a tiierapeutic benefit
- the invention includes vanous methods and compositions for inhibiting the binding of STEAP-1 to its bmdmg partner or its association with other protem(s) as well as methods for inhibiting STEAP-1 function
- a recombmant vector that encodes single chain antibodies that specifically b d to STEAP-1 are mfroduced mto STEAP-1 expressing cells via gene transfer technologies
- the encoded smgle chain anti-STEAP-1 antibody is expressed intracellularly, bmds to STEAP-1 protem, and thereby inhibits its function
- Methods for engineering such intracellular single chain antibodies are well known
- Such mfracellular antibodies, also known as "mfrabodies” are specifically targeted to a particular compartment withm the cell, providing control over where the inhibitory activity of the treatment is focused
- Intrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors (see, e g , Richardson et al , 1995, Pioc Natl Acad Sci USA 92 3137-3141; Beerli et al , 1994, J Biol Chem 2
- Smgle cham antibodies comprise the variable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a smgle polypeptide
- single chain antibodies are expressed as a smgle cham vanable region fragment jomed to the light cham constant region
- Well-known mfracellular trafficking signals are engineered mto recombinant polynucleotide vectors encodmg such smgle cham antibodies m order to target precisely the intrabody to the desired mfracellular compartment
- mfrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C- term al ER retention signal, such as the KDEL ammo acid motif
- Intrabodies mtended to exert activity m the nucleus are engineered to mclude a nuclear localization signal
- Lipid moieties are joined to mfrabodies m order to tether the m
- Nuclear targeting signals are engineered into such STEAP-1 intrabodies in order to achieve the desired targeting.
- Such STEAP-1 intrabodies are designed to bind specifically to a particular STEAP-1 domain.
- cytosohc intrabodies that specifically bind to a STEAP-1 protein are used to prevent STEAP-1 from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g., preventing STEAP-1 from forming transcription complexes with other factors).
- the transcription of the intrabody is placed under the regulatory control of an appropriate tumor-specific promoter and/or enhancer.
- an appropriate tumor-specific promoter and/or enhancer In order to target intrabody expression specifically to prostate, for example, the PSA promoter and/or promoter/enhancer can be utilized (See, for example, U.S. Patent No. 5,919,652 issued 6 July 1999).
- recombinant molecules bind to STEAP-1 and thereby inhibit STEAP-1 function.
- these recombinant molecules prevent or inhibit STEAP-1 from accessing/binding to its binding partner(s) or associating with other protein(s).
- Such recombinant molecules can, for example, contain the reactive part(s) of a STEAP-1 specific antibody molecule.
- the STEAP-1 binding domain of a STEAP- 1 binding partner is engineered into a dimeric fusion protein, whereby the fusion protein comprises two STEAP-1 ligand binding domains linked to the Fc portion of a human IgG, such as human IgGl.
- Such IgG portion can contain, for example, the C H 2 and C H 3 domains and the hinge region, but not the jl domain.
- Such dimeric fusion proteins are administered in soluble form to patients suffering from a cancer associated with the expression of STEAP-1, whereby die dimeric fusion protein specifically binds to STEAP-1 and blocks STEAP-1 interaction with a binding partner.
- Such dimeric fusion proteins are further combined into multirneric proteins using known antibody linking technologies.
- the present invention also comprises various methods and compositions for inhibiting the transcription of the STEAP-1 gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of STEAP-1 mRNA into protein.
- a method of inhibiting the transcription of the STEAP-1 gene comprises contacting the STEAP-1 gene with a STEAP-1 antisense polynucleotide.
- a method of inhibiting STEAP-1 mRNA translation comprises contacting a STEAP-1 mRNA with an antisense polynucleotide.
- a STEAP-1 specific ribozyme is used to cleave a STEAP-1 message, thereby inhibiting translation.
- Such antisense and ribozyme based methods can also be directed to the regulatory regions of the STEAP-1 gene, such as STEAP-1 promoter and/or enhancer elements.
- proteins capable of inhibiting a STEAP-1 gene transcription factor are used to inhibit STEAP-1 mRNA transcription.
- the various polynucleotides and compositions useful in the aforementioned methods have been described above.
- the use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.
- Gene transfer and gene therapy technologies can be used to deliver therapeutic polynucleotide molecules to tumor cells synthesizing STEAP-1 (1 e , antisense, nbozyme, polynucleotides encodmg mfrabodies and other STEAP-1 inhibitory molecules)
- STEAP-1 (1 e , antisense, nbozyme, polynucleotides encodmg mfrabodies and other STEAP-1 inhibitory molecules
- a number of gene therapy approaches are known m die art Recombmant vectors encodmg STEAP-1 antisense polynucleotides, nbozymes, factors capable of interfering with STEAP-1 uanscnption, and so forth, can be delivered to target tumor cells usmg such gene therapy approaches
- the above therapeutic approaches can be combmed with any one of a wide vanety of surgical, chemotherapy or radiation therapy regimens
- the therapeutic appioaches of the mvention can enable the use of reduced dosages of chemotherapy (or otiier therapies) and/or less frequent admimstration, an advantage for all patients and particularly for those that do not tolerate the toxicity of the chemotherapeutic agent well
- the anti-tumor activity of a particular composition can be evaluated usmg vanous in vitro and in vivo assay systems
- In vitr o assays that evaluate dierapeutic activity mclude cell growth assays, soft agar assays and other assays mdicahve of tumor promoting activity, bmdmg assays capable of deterrmmng the extent to which a therapeutic composition will inhibit the bmdmg of STEAP-1 to a bmdmg partner, etc
- a STEAP- 1 therapeutic composition can be evaluated m a suitable animal model
- xenogemc prostate cancer models canbe used, wheiem human prostate cancer explants or passaged xenograft tissues are mfroduced mto immune compromised animals, such as nude or SCID mice (Klein etal , 1997, Nature Medicine 3 402-408)
- PCT Patent Application W098/16628 and U S Patent 6,107,540 descnbe various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, rmcrometastasis, and the formation of osteoblastic metastases charactenstic of late stage disease
- Efficacy can be predicted usmg assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like
- xenografts from tumor bearmg mice treated wrth the therapeutic composition can be examined for the presence of apoptotic foci and compared to untreated control xenograft-bea ⁇ ng mice The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition
- the therapeutic compositions used in the practice of the foregomg methods can be formulated mto pharmaceutical compositions compnsmg a earner suitable for the desired delivery method
- Suitable earners m clude any matenal that when combmed with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is generally non-reactive with the patient's immune system Examples include, but are not limited to, any of a number of standard pharmaceutical earners such as sterile phosphate buffered salme solutions, bacte ⁇ ostatic water, and the like (see, generally, Remington's Pharmaceutical Sciences 16 th Edition, A Osal , Ed , 1980)
- Therapeutic formulations can be solubihzed and administered via any route capable of delivering the therapeutic composition to the tumor site
- Potentially effective routes of administration mclude, but are not limited to, intravenous, parenteral, rnfrapentoneal, intramuscular, rntratumor, mtradermal, lntraorgan, orthotopic, and the like
- a prefened formulation for intravenous injection comprises the dierapeutic composition in a solution of preserved bacte ⁇ ostatic water, stenle unpreserved water, and/or diluted m polyvmylchlo ⁇ de or polyethylene bags contaimng 0 9% stenle Sodium Chloride for Injection, USP
- Therapeutic protem preparations can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted m bacte ⁇ ostatic water (containing for example, benzyl alcohol preservative) or m stenle water pnor to injection
- kits are also withm the scope of the invention
- kits can comprise a earner, package or contamer that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the contamer(s) compnsing one of the separate elements to be used in the method
- the contamer(s) can comprise a probe that is or can be detectably labeled
- Such probe can be an antibody or polynucleotide specific for a Figure 2-related protein or a Figure 2 gene or message, respectively
- the kit can also have containers containing nucleot ⁇ de(s) for amplification of the target nucleic acid sequence and/or a contamer comprising a reporter-means, such as a biotin-bmding protem, such as avidm or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radio
- the kit of the mvention will typically comprise the contamer descnbed above and one or more other contamers compnsmg matenals desirable from a commercial and user standpoint, mcludmg buffers, diluents, filters, needles, syringes, carnei, package, container, vial and/or tube labels listing contents and/or instmctions for use, and package inserts with instructions for use
- a label can be present on the contamer to indicate that the composition is used for a specific therapy or non- therapeutic application, such as a diagnostic or laboratory application, and can also indicate directions for either in vivo or in vitro use, such as those descnbed herem Directions and or other information can also be mcluded on an ⁇ nsert(s) or label(s) which is mcluded with or on the kit
- an article(s) of manufacture contaimng compositions such as amino acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or ant ⁇ body(s), e g , matenals useful for the diagnosis, prognosis, prophylaxis and/or treatment of neoplasias of tissues such as those set forth in Table I
- the article of manufacture typically compnses at least one container and at least one label Suitable contamers include, for example, bottles, vials, syringes, and test tubes
- the contamers can be formed from a variety of matenals such as glass or plastic
- the container can hold ammo acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or ant ⁇ body(s), m one embodiment the container holds a polynucleotide for use in examining the mRNA expression profile of a cell, together with reagents used for this purpose
- the contamer can alternatively hold a composition which is effective for treating, diagnosis, prognosmg or prophylaxmg a condition and can have a stenle access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle)
- the active agents in the composition can be an antibody capable of specifically bmdmg STEAP 1 and modulating the function of STEAP-1
- the label can be on or associated with the container
- a label a can be on a container when letters, numbers or other characters forming the label are molded or etched mto the container itself, a label can be associated with a contamer when it is present withm a receptacle or earner that also holds the container, e g , as a package insert
- the label can indicate that the composition is used for diagnosing, treating, prophylaxmg or prognosmg a condition, such as a neoplasia of a tissue set forth m Table I
- the article of manufacture can further comprise a second contamer comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and/ordexfrose solution It can furthei include other matenals desirable from a commercial and user standpoint, including other buffers, diluents, filters, sh ⁇ ers, needles, syringes, and/or package inserts with indications and/
- Example 1 SSH-Generated Isolation of cDNA Fragment of the STEAP Gene
- LAPC xenografts were obtained from Dr Charles Sawyers (UCLA) and generated as described (Klem et al, 1997, Nature Med 3 402-408, Craft et al , 1999, Cancer Res 59 5030-5036) Androgen dependent and independent LAPC-4 xenografts (LAPC-4 AD and AI, respectively) and LAPC-9 xenografts (LAPC-9 AD and AI, respectively) were grown in intact male SCID mice or in castrated males, respectively, and were passaged as small tissue chunks in recipient males LAPC-4 AI xenografts were derived from LAPC-4 AD tumors and LAPC-9 AI xenografts were derived from LAPC-9 AD tumors To generate the AI xenografts, male mice bearing LAPC AD tumors were casfrated and maintained for 2 3 months After the LAPC tumors re-grew, the tumors were harvested and passaged m castrated males or in female SCID mice
- LAPC-4 AD xenografts were grown mtratibially as follows LAPC-4 AD xenograft tumor tissue grown subcutaneously was mmced mto 1-2 mm 3 sections while die tissue was bathed m IX Iscoves medium, minced tissue was then cenfrifuged at 1 3K rpm for 4 minutes, the supernatant was resuspended m 10 ml ice cold IX Iscoves medium and cenfrifuged at 1 3K rpm for 4 minutes The pellet was then resuspended m IX Iscoves with 1% pronase E and mcubated for 20 minutes at room temperature with mild rocking agitation followed by incubation on ice for 2-4 minutes Filtrate was cenfrifuged at 1 3K rpm for 4 minutes, and the pronase was removed from the aspirated pellet by resuspending m 10 ml Iscoves and re-cent ⁇ fug
- Human cell lmes (e g , HeLa) were obtamed from the ATCC and were maintained in DMEM with 5% fetal calf serum Human tissues for RNA and protem analyses were obtained from the Human Tissue Resource Center (HTRC) at the UCLA (Los Angeles, CA) and from QualTek, Inc (Santa Barbara, CA)
- Tumor tissue and cell lines were homogenized in T ⁇ zol reagent (Life Technologies, Gibco BRL) usmg 10 ml g tissue or 10 ml/ 10 8 cells to isolate total RNA Poly
- T ⁇ zol reagent Life Technologies, Gibco BRL
- RNA was punfied from total RNA using Qiagen's Ohgotex mRNA Mmi and Midi kits
- SSH Suppression Subtractive Hybridization
- Double stranded cDNAs correspondmg to the LAPC-4 AD xenograft (tester) and the BPH tissue (driver) were synthesized from 2 ⁇ g of poly(A)+ RNA isolated from xenograft and BPH tissue, as described above, usmg CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide RSACDN as primer First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No PTI 117-1, Catalog No K1804-1) The resulting cDNA was digested with Rsa I for 3 hrs at 37°C Digested cDNA was extracted with phenol/chloroform (1 1) and ethanol precipitated
- BPH Driver cDNA
- Tester cDNA (LAPC-4 AD) was generated by diluting 1 ⁇ l of Rsa I digested LAPC-4 AD cDNA (400 ng) in 5 ⁇ l of water The diluted cDNA (2 ⁇ l, 160 ng) was then ligated to 2 ⁇ l of adaptor 1 and adaptor 2 (10 ⁇ M), m separate ligation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH) Ligation was terminated with 1 ⁇ l of 0 2 M EDTA and heating at 72°C for 5 min
- the first hybndization was performed by addmg 1 5 ⁇ l (600 ng) of driver cDNA to each of two tubes contaimng 1 5 ⁇ l (20 ng) adaptor 1- and adaptor 2- ligated tester cDNA In a final volume of 4 ⁇ l, the samples were overlayed with mineral oil, denatured m an MJ Research thermal cycler at 98°C for 1 5 minutes, and then were allowed to hybridize foi 8 hrs at 68°C The two hyb ⁇ dizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C The second hybridization was then diluted m 200 ⁇ l of 20 mM Hepes, pH 8 3, 50 mM NaCl, 0 2 mM EDTA, heated at 70°C for 7 mm and stored at -20°C
- PCR products were inserted mto pCR2 1 usmg the T/A vector cloning kit (Invitrogen) Transformed E coli were subjected to blue/white and ampicillin selection White colonies were picked and anayed into 96 well plates and were grown m liquid culture overnight To identify inserts, PCR amplification was performed on 1 ml of bacterial culture usmg the conditions of PCR1 and NP 1 and NP2 as primers PCR products were analyzed using 2% agarose gel electrophoresis
- First strand cDNAs were generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming usmg the Gibco-BRL Superscript Preamplif ⁇ cation system The manufacturer's protocol was used and included an incubation for 50 mm at 42°C with reverse franscnptase followed by RNase H treatment at 37°C for 20 mm After completing the reaction, the volume was increased to 200 ⁇ l with water prior to normalization First sfrand cDNAs from 16 different normal human tissues were obtamed from Clontech
- Normalization of the first strand cDNAs from multiple tissues was performed by using the primers 5 'atatcgccgcgctcgtcgtcgacaa3 ' (SEQ ID NO- 56) and 5 'agccacacgcagctcattgtagaagg 3 ' (SEQ ID NO 57) to amplify ⁇ -actin
- First strand cDNA (5 ⁇ l) was amphfied m a total volume of 50 ⁇ l contammg 04 ⁇ M primers, 0 2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM T ⁇ s-HCL, 1 5 mM MgCl 2 , 50 mM KCl, pH8 3) and IX Klentaq DNA polymerase (Clontech)
- Five ⁇ l of the PCR reaction was removed at 18, 20, and 22 cycles and used for agarose gel elecfrophoresis PCR was performed us
- One of the cDNA clones was 436 bp m length and showed homology to an EST sequence in the NCI-CGAP tumor gene database
- the full length cDNA encodmg the 8P1D4 gene was subsequently isolated usmg this cDNA and re-named STEAP-1
- the 8P1D4 cDNA nucleotide sequence co ⁇ esponds to nucleotide residues 150 through 585 in the STEAP-1 cDNA sequence as shown m FIG 1A-B
- Another clone, designated 28P3E1, 561 bp m length showed homology to a number of EST sequences in the NCI-CGAP tumor gene database or in other databases Part of the 28P3E1 sequence (356 bp) is identical to an EST denved from human fetal tissue After the full-length STEAP-1 cDNA was obtained and sequenced, it became apparent that this clone also conesponds to STEAP-1 (more specifically, to residue
- the 436 bp 8P1D4 gene fragment (Example 1) was used to isolate additional cDNAs encoding the 8P1D4/STEAP-1 gene Bnefly, a normal human prostate cDNA library (Clontech) was screened with a labeled probe generated from the 436 bp 8P1D4 cDNA
- One of the positive clones, clone 10, is 1195 bp in length and encodes a 339 amino acid protem having nucleotide and encoded ammo acid sequences bearmg no significant homology to any known human genes or protems (homology to a rat Kidney In j ury Protem recently described International Application WO98/53071)
- the encoded protem conta at least 6 predicted transmembrane motifs implying a cell surface orientation (see FIG 1A-B, predicted transmembrane motifs underlined)
- FIG 2A-Q STEAP-1 cDNA clone 10 was deposited with the Amencan Type Culture Collection ("ATCC") (10801 University Boulevard , Manassas, VA 20110-2209 USA) as plasmid 8P1D4 clone 10 1 on August 26, 1998 as ATCC Accession Number 98849
- ATCC Amencan Type Culture Collection
- the STEAP-1 cDNA clone can be excised therefrom usmg EcoRI Xbal double digest (EcoRI at the 5'end, Xbal at the 3'end)
- Chromosomal localization can implicate genes in disease pathogenesis Several chromosome mapping approaches are available including fluorescent in situ hybridization (FISH), human hamster radiation hybrid (RH) panels (Walter et al , 1994, Nature Genetics 7 22, Research Genetics, Huntsville Al), human-rodent somatic cell hybrid panels such as is available from the Conell Institute (Camden, New Jersey), and genomic viewers utilizing BLAST homologies to sequenced and mapped genomic clones (NCBI, Bethesda, Maryland)
- FIG. 15 shows that STEAP-1 was expressed in rectum cancer patient tissues RNA was extracted from normal rectum (N), rectum cancer patient tumors (T), and rectum cancer metastasis (M) Northern blots with 10 ⁇ g of total RNA were probed with the STEAP-1 sequence Results show strong expression of STEAP-1 m the rectum cancer patient tissues The lower panel represents ethidium bromide staining of the blot showing quality of the RNA samples
- STEAP-1 is strongly expressed m human umbilical vem endotiiehal cells (HUVEC)
- Figure 16 First strand cDNA was prepared from HUVEC cells, LAPC-4AD and LAPC-9 AD prostate cancer xenografts, as well as from human bram tissues Normalization was performed by PCR using primers to actin and GAPDH Semi-quantitative PCR, usmg pnmers to STEAP-1, was performed at 27 and 30 cycles of amplification (Figure 16A) As a control, PCR using primers to actm is shown m figure 16B Results show strong expression of STEAP-1 m HUVEC cells similar to die expression detected m prostate cancer xenograft tissues Expression of STEAP-1 m HUVEC cells mdicates that targeting STEAP-1 may also target endotiiehal cells of the neovasculature of the tumors
- Transcript vanants are vanants of mature mRNA from the same gene which anse by alternative transcription or alternative splicing
- Alternative transcnpts are transcnpts from the same gene but start transcription at different pomts
- Splice variants are mRNA variants spliced differently from the same transcnpt
- a given gene can have zero to many alternative franscripts and each franscript can have zero to many splice variants
- Each transcript variant has a unique exon makeup, and can have different codmg and/or non-codmg (5' or 3' end) portions, from the original franscript
- Transcnpt variants can code for similar or different proteins with the same or a similar function or can encode protems with different functions, and can be expressed in the same tissue
- Transcnpt variants are identified by a variety of art-accepted methods For example, alternative transcripts and splice variants are identified by full-length cloning experiment, or by use of full-length transcript and EST sequences First, all human ESTs were grouped mto clusters which show direct or mdirect identity with each other Second, ESTs m the same cluster were further grouped into sub-clusters and assembled into a consensus sequence The original gene sequence is compared to the consensus sequence(s) or other full-length sequences Each consensus sequence is a potential splice vanant for that gene (see, e g , Kan, Z , et al , Gene structure prediction and alternative splicing analysis using genomically aligned ESTs, Genome Research, 2001 May, 11(5) 889-900 ) Even when a variant is identified that is not a full-length clone, that portion of the variant is very useful for antigen generation and for further clomng of the full-length splice vanant,
- Genomic-based transcript variant identification programs include FgenesH (A Salamov and V Solovyev, "Ab mitio gene finding in Drosophila genomic DNA,” Genome Research 2000 Ap ⁇ l,10(4) 516-22), Grail (URL compbio ornl gov/Grail-bin/EmptyGrailForm) and GenScan (URL genes nut edu/GENSCAN html)
- FgenesH A Salamov and V Solovyev, "Ab mitio gene finding in Drosophila genomic DNA," Genome Research 2000 Ap ⁇ l,10(4) 516-22
- Grail URL compbio ornl gov/Grail-bin/EmptyGrailForm
- GenScan URL genes nut edu/GENSCAN html
- a vanety of techmques are available in the art, such as full-length clomng, proteomic validation, PCR-based validation, and 5' RACE validation, etc (see e g , Proteormc Validation Brennan, S O , et al , Albumin banks pemnsula a new termination variant characterized by electrospray mass spectrometry, Biochem Biophys Acta 1999 Aug 17,1433(1-2) 321-6, Ferranti P, et al , Differential splicing of pre-messenger RNA produces multiple forms of mature caprme alpha(sl)-case ⁇ n, Eur J Biochem 1997 Oct 1,249(1) 1-7
- PCR-based Validation Wellmann S, et al Specific reverse transcription- PCR quantification of vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clm Chem 2001 Apr ,47(4) 654-60
- 8P1D4 has a particular expression profile related to cancer Alternative transcripts and splice variants of 8P1D4 may also be mvolved in cancers m the same or different tissues, thus serving as tumor-associated markers/antigens
- the exon composition of the original franscript, designated as 8P1D4 v.l, is shown in Table LXI. Using the full-length gene and EST sequences, two transcript variants were identified, designated as 8P1D4 v.2 and v.3.
- transcript variant 8P1D4 v.2 did not splice out intron 4 of 8P1D4 v.l and variant 8P1D4 v.3 spliced out one additional exon from intron 4 of 8P1D4 v.l, as shown in Figure 11.
- each different combination of exons in spatial order e.g. exons 2 and 3
- Figure 11 shows the schematic alignment of exons of the transcript variants.
- Tables LIII through LX are set forth on a variant by variant bases.
- Tables LIII and LVII show the nucleotide sequence of the transcript variants.
- Table LIV shows die alignment of the transcript variant with the nucleic acid sequence of 8P1D4 v.l.
- Table LVIII shows the alignment of the transcript variant with the nucleic acid sequence of 8P1D4 v.2.
- Tables LV and LIX lays out amino acid translation of the franscript variant for the identified reading frame orientation.
- Table LVI displays the alignment of the amino acid sequence encoded by the splice variant with that of 8P1D4 v.l.
- Table LX displays the alignment of the amino acid sequence encoded by the splice variant with that of 8P1D4 v.2.
- a Single Nucleotide Polymorphism is a single base pair variation in a nucleotide sequence at a specific location.
- SNP Single Nucleotide Polymorphism
- Genotype refers to the specific base pair sequence of one or more locations in the genome of an individual.
- Haplotype refers to the base pair sequence of more than one location on the same DNA molecule (or the same chromosome in higher organisms), often in the context of one gene or in the context of several tightly linked genes.
- SNPs that occur on a cDNA are called cSNPs. These cSNPs may change amino acids of the protein encoded by the gene and thus change the functions of the protein.
- SNPs are identified by a variety of art-accepted methods (P. Bean, "The promising voyage of SNP target discovery," Am. Clin. Lab. 2001 Oct-Nov; 20(9): 18-20; K. M. Weiss, "In search of human variation,” Genome Res. 1998 Jul; 8(7):691-697; M. M. She, “Enabling large-scale pharmacogenetic studies by high- throughput mutation detection and genotyping technologies," Clin. Chem. 2001 Feb; 47(2): 164-172).
- SNPs are identified by sequencing DNA fragments that show polymorphism by gel-based methods such as restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE).
- RFLP restriction fragment length polymorphism
- DGGE denaturing gradient gel electrophoresis
- SNPs can also be discovered by direct sequencing of DNA samples pooled from different individuals or by comparing sequences from different DNA samples. With the rapid accumulation of sequence data in public and private databases, one can discover SNPs by comparing sequences using computer programs (Z. Gu, L. Hillier and P. Y. Kwok, "Single nucleotide polymorphism hunting in cyberspace,” Hum. Mutat. 1998; 12(4):221-225). SNPs can be verified and genotype or haplotype of an individual can be determined by a variety of methods including direct sequencing and high throughput microa ⁇ ays (P. Y. Kwok, "Methods for genotyping single nucleotide polymorphisms," Annu. Rev. Genomics Hum. Genet.
- SNPs were identified in the transcript from clone GTH9, designated as 8P1D4 v.2, at positions 602 (C/G), 386 (C/T), 1087 (T/G), 1447 (T/C), 1621 (A/T), 1625 (G/T), 1716 (C/A), 2358 (C/T), 2646 (T/G), 2859 (T/G), 2908 (A/T), 3006 (G/C), 3107 (C/T), and 3180 (A/T).
- the transcripts or proteins with alternative alleles were designated as variants 8P1D4 v.4, v.5, v.6, v.7, v.8, v.9, v.10, v.l l, v.12, v.13, v.14, v.15, v.16 and v.17, respectively.
- Figure 10 shows the schematic alignment of the SNP variants.
- Figure 12 shows the schematic alignment of protein variants, corresponding to nucleotide variants.
- These alleles of the SNPs can occur in different combinations (haplotypes) and in any one of the transcript variants (such as 8P1D4 v.l and v.3) that contains the sequence context of the SNPs.
- the first two SNP were also on 8P1D4 v.3 at the same positions, but at 572 and 356, respectively, on 8P1D4 v.l.
- the full or partial length 8P1D4 and 8P1D4 variant cDNA sequences are cloned into any one of a variety of expression vectors known in the art.
- the full length cDNA, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 8P1D4, variants, or analogs thereof are used.
- pCRII In vitro transcription and translation constructs: pCRII: To generate 8P1D4 sense and anti-sense RNA probes for RNA in situ investigations, pCRII constructs (Invitrogen, Carlsbad CA) are generated encoding either all or fragments of the 8P1D4 cDNA. The pCRII vector has Sp6 and T7 promoters flanking the insert to drive the transcription of 8P1D4 RNA for use as probes in RNA in situ hybridization experiments. These probes are used to analyze the cell and tissue expression of 8P1D4 at the RNA level.
- Transcribed 8P1D4 RNA representing the cDNA amino acid coding region of the 8P1D4 gene is used in in vitro translation systems such as the TnTTM Coupled Reticulolysate System (Promega, Corp., Madison, WI) to synthesize 8P1D4 protein.
- TnTTM Coupled Reticulolysate System Promega, Corp., Madison, WI
- pGEX Constructs To generate recombinant 8P 1D4 proteins in bacteria that are fused to the Glutathione S-fransferase (GST) protein, all or parts of the 8P1D4 cDNA or variants are cloned into the GST- fusion vector of the pGEX family (Amersham Pharmacia Biotech, Piscataway, NJ). These constructs allow controlled expression of recombinant 8P1D4 protein sequences with GST fused at the amino-terminus and a six histidine epitope (6X His) at the carboxyl-terminus.
- GST Glutathione S-fransferase
- the GST and 6X His tags permit purification of the recombinant fusion protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-GST and anti-His antibodies.
- the 6X His tag is generated by adding 6 histidine codons to the cloning primer at the 3' end, e.g., of the open reading frame (ORF).
- a proteolytic cleavage site such as the PreScissionTM recognition site in pGEX-6P-l, may be employed such that it permits cleavage of the GST tag from 8PlD4-related protein.
- the ampicillin resistance gene and pBR322 origin permits selection and maintenance of the pGEX plasmids vnE. coli.
- pMAL Constructs To generate, in bacteria, recombinant 8P1D4 proteins that are fused to maltose- binding protein (MBP), all or parts of the 8P1D4 cDNA protein coding sequence are fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X vectors (New England Biolabs, Beverly, MA). These constructs allow controlled expression of recombinant 8P1D4 protein sequences with MBP fused at the amino-terminus and a 6X His epitope tag at the carboxyl-terminus.
- MBP maltose- binding protein
- the MBP and 6X His tags permit purification of the recombinant protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-MBP and anti-His antibodies.
- the 6X His epitope tag is generated by adding 6 histidine codons to the 3' cloning primer.
- a Factor Xa recognition site permits cleavage of the pMAL tag from 8P1D4.
- the pMAL- c2X and pMAL- ⁇ 2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds.
- pET Constructs To express 8P1D4 in bacterial cells, all or parts of the 8P1D4 cDNA protein coding sequence are cloned into the pET family of vectors (Novagen, Madison, WI). These vectors allow tightly controlled expression of recombinant 8P1D4 protein in bacteria with and without fusion to proteins that enhance solubility, such as NusA and thioredoxin (Trx), and epitope tags, such as 6X His and S-TagTM that aid purification and detection of the recombinant protein. For example, constructs are made utilizing pET NusA fusion system 43.1 such that regions of the 8P1D4 protein are expressed as amino-terminal fusions to NusA.
- Yeast Constructs To express 8P1D4 in the yeast species Saccharomyces cerevisiae for generation of recombinant protem and functional studies, all or parts of the 8P1D4 cDNA protein coding sequence are cloned into the pESC family of vectors each of which contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3 (Stratagene, La Jolla, CA). These vectors allow confrolled expression from the same plasmid of up to 2 different genes or cloned sequences containing either FlagTM or Myc epitope tags in the same yeast cell. This system is useful to confirm protein-protein interactions of 8P1D4.
- pESP Constructs To express 8P1D4 in the yeast species Saccharomyces pombe, all or parts of the 8P1D4 cDNA protein coding sequence are cloned into the pESP family of vectors. These vectors allow controlled high level of expression of a 8P1D4 protein sequence that is fused at either the amino terminus or at the carboxyl terminus to GST which aids purification of the recombinant protein.
- a Flag epitope tag allows detection of the recombinant protein with anti- FlagTM antibody.
- the full or partial length STEAP-1 cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
- One or more of the following regions of STEAP-1 are expressed in these constructs, amino acids 1 to 339 of STEAP-1 v.l, v.4, amino acids 1 to 258 of v.2, amino acids 1 to 282 of v.3, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more contiguous amino acids from STEAP-1, variants, or analogs thereof.
- a region of a specific variant of STEAP-1 is expressed that encodes an amino acid at a specific position which differs from the amino acid of any other variant found at that position.
- a region of a variant of STEAP-1 is expressed that lies partly or entirely within a sequence that is unique to that variant.
- the constructs can be fransfected into any one of a wide variety of mammalian cells such as 293T cells.
- Transfected 293T cell lysates can be probed with the anti-STEAP-1 polyclonal serum, described herein.
- ⁇ cDNA4/HisMax Constructs To express STEAP-1 in mammalian cells, a STEAP-1 ORE, or portions tliereof, of STEAP-1 are cloned into pcDNA4/HisMax Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter and the SP 16 translational enhancer.
- CMV cytomegalovirus
- the recombinant protein has XpressTM and six histidine (6X His) epitopes fused to the amino-terminus.
- the pcDNA4/HisMax vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
- BGH bovine growth hormone
- the Zeocin resistance gene allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in E. coli.
- pcDNA3.1 MvcHis Constructs To express STEAP-1 in mammalian cells, a STEAP-1 ORF, or portions thereof, of STEAP-1 with a consensus Kozak translation initiation site was cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the myc epitope and 6X His epitope fused to the carboxyl-terminus.
- CMV cytomegalovirus
- the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability, along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
- BGH bovine growth hormone
- the Neomycin resistance gene was used, as it allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in is. coli.
- pcDNA3.1/CT-GFP-TOPO Construct To express STEAP-1 in mammalian cells and to allow detection of the recombinant proteins using fluorescence, a STEAP-1 ORF, or portions thereof, with a consensus Kozak franslation initiation site are cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the Green Fluorescent Protein (GFP) fused to the carboxyl-terminus facilitating non-invasive, in vivo detection and cell biology studies.
- CMV cytomegalovirus
- the pcDNA3.1CT-GFP-TOPO vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
- BGH bovine growth hormone
- the Neomycin resistance gene allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColEl origin permits selection and maintenance of the plasmid in E. coli. Additional constructs with an amino-terminal GFP fusion are made in cDNA3.1/NT-GFP-TOPO spanning the entire length of a STEAP-1 protein.
- PAPtag A STEAP-1 ORF, or portions thereof, is cloned into pAPtag-5 (GenHunter Corp. Nashville, TN). This construct generates an alkaline phosphatase fusion at the carboxyl-terminus of a STEAP-1 protein while fusing the IgG ⁇ signal sequence to the amino-terminus. Constructs are also generated in which alkaline phosphatase with an amino-terminal IgG ⁇ signal sequence is fused to the amino-terminus of a STEAP-1 protein. The resulting recombinant STEAP-1 proteins are optimized for secretion into the media of fransfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with STEAP-1 proteins.
- Protein expression is driven from the CMV promoter and the recombinant proteins also contain myc and 6X His epitopes fused at the carboxyl-terminus that facilitates detection and purification.
- the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene permits selection of the plasmid in E. coli.
- ptag5 A STEAP-1 ORF, or portions thereof, was cloned into ⁇ Tag-5. This vector is similar to pAPtag but without the alkaline phosphatase fusion.
- This construct generated STEAP-1 protein with an amino-terminal IgG ⁇ signal sequence and myc and 6X His epitope tags at the carboxyl-terminus that facilitate detection and affinity purification.
- the resulting recombinant STEAP-1 protein was optimized for secretion into the media of fransfected mammalian cells, and is used as immunogen or ligand to identify proteins such as ligands or receptors that interact with the STEAP-1 proteins. Protein expression was driven from the CMV promoter.
- the Zeocin resistance gene present in the vector allowed for selection of mammalian cells expressing the protein ⁇ and the ampicillin resistance gene permits selection of the plasmid in E. coli.
- PsecFc A STEAP-1 ORF, or portions thereof, was also cloned into psecFc.
- the psecFc vector was assembled by cloning the human immunoglobulin Gl (IgG) Fc (hinge, CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This construct generated an IgGl Fc fusion at the carboxyl-terminus of the STEAP-1 proteins, while fusing the IgGK signal sequence to N-terminus.
- STEAP-1 fusions utilizing the murine IgGl Fc region are also used.
- STEAP-1 proteins were optimized for secretion into the media of fransfected mammalian cells, and can were used as immunogens or to identify proteins such as ligands or receptors that interact with STEAP-1 protein. Protein expression is driven from the CMV promoter.
- the hygromycin resistance gene present in the vector allowed for selection of mammalian cells that express the recombinant protein, and the ampicillin resistance gene permits selection of the plasmid in E. coli.
- pSR ⁇ Constructs To generate mammalian cell lines that express STEAP-1 constitutively, STEAP-1 ORF, or portions thereof, of STEAP-1 were cloned into pSR ⁇ constructs.
- Ampho tropic and ecofropic retroviruses were generated by transfection of pSR ⁇ constructs into the 293T-10A1 packaging line or co- fransfection of pSR ⁇ and a helper plasmid (containing deleted packaging sequences) into the 293 cells, respectively.
- the retrovirus was used to infect a variety of mammalian cell lines, resulting in the integration of the cloned gene, STEAP-1, into the host cell-lines. Protein expression was driven from a long terminal repeat (LTR).
- LTR long terminal repeat
- the Neomycin resistance gene present in the vector allowed for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColEl origin permit selection and maintenance of the plasmid in E. coli.
- the retroviral vectors were thereafter be used for infection and generation of various cell lines using, for example, PC3, NIH 3T3, TsuPrl, 293 or rat-1 cells.
- Additional pSR ⁇ constructs are made that fuse an epitope tag such as the FLAGTM tag to the carboxyl- terminus of STEAP-1 sequences to allow detection using anti-Flag antibodies.
- the FLAGTM sequence 5' gat tac aag gat gac gac gat aag 3' (SEQ ID NO: 60) is added to cloning primer at the 3' end of the ORF.
- Additional pSR ⁇ constructs were made to produce both amino-terminal and carboxyl-terminal GFP and myc/6X His fusion proteins of the full-length STEAP-1 proteins.
- Additional Viral Vectors Additional constructs are made for viral-mediated delivery and expression of STEAP-1.
- High virus titer leading to high level expression of STEAP-1 is achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors.
- a STEAP-1 coding sequences or fragments thereof are amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and virus packaging are performed according to the manufacturer's instructions to generate adenoviral vectors.
- STEAP-1 coding sequences or fragments thereof are cloned into the HSV-1 vector (Imgenex) to generate herpes viral vectors.
- the viral vectors are thereafter used for infection of various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
- coding sequences of STEAP-1, or portions thereof are cloned into regulated mammalian expression systems such as the T-Rex System (Invitrogen), the GeneSwitch System (Invitrogen) and the tightly-regulated Ecdysone System (Sratagene). These systems allow the study of the temporal and concenfration dependent effects of recombinant STEAP-1. These vectors are thereafter used to control expression of STEAP-1 in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
- regulated mammalian expression systems such as the T-Rex System (Invitrogen), the GeneSwitch System (Invitrogen) and the tightly-regulated Ecdysone System (Sratagene). These systems allow the study of the temporal and concenfration dependent effects of recombinant STEAP-1. These vectors are thereafter used to control expression of STEAP-1 in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
- STEAP-1 ORF Baculovirus Expression Systems
- STEAP-1 ORF Baculovirus Expression Systems
- pBlueBac 4.5 Invifrogen
- pBlueBac-STEAP-1 is co-fransfected with helper plasmid pBac-N-Blue (Invitrogen) into SF9 (Spodoptera frugiperd ⁇ ) insect cells to generate recombinant baculovirus (see Invitrogen instruction manual for details).
- Baculovirus is then collected from cell supernatant and purified by plaque assay.
- Recombinant STEAP-1 protein is then generated by infection of HighFive insect cells (Invitrogen) with purified baculovirus.
- Recombinant STEAP-1 protein can be detected using anti-STEAP-1 or anti-His-tag antibody.
- STEAP-1 protein can be purified and used in various cell-based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for STEAP-1.
- Figures 5-9 and Figures 5a-9a depict graphically five amino acid profiles of the 8P1D4 variants 1 and 3 respectively, each assessment available by accessing the ProtScale website (URL www.expasy.ch cgi- bin/protscale.pl) on the ExPasy molecular biology server.
- Hydrophilicity (Figure 5), Hydropathicity ( Figure 6) and Percentage Accessible Residues ( Figure 7) profiles were used to determine stretches of hydrophilic amino acids (i.e., values greater than 0.5 on the Hydrophilicity and Percentage Accessible Residues profile, and values less than 0.5 on the Hydropathicity profile). Such regions are likely to be exposed to the aqueous environment, be present on the surface of the protein, and thus available for immune recognition, such as by antibodies.
- Average Flexibility ( Figure 8) and Beta-turn ( Figure 9) profiles determine stretches of amino acids (i.e., values greater than 0.5 on the Beta-turn profile and the Average Flexibility profile) that are not constrained in secondary structures such as beta sheets and alpha helices. Such regions are also more likely to be exposed on the protein and thus accessible to immune recognition, such as by antibodies.
- Antigenic sequences of the 8P1D4 protein and of the variant proteins indicated, e.g., by the profiles set forth in Figure 5, Figure 6, Figure 7, Figure 8, and/or Figure 9 are used to prepare immunogens, either peptides or nucleic acids that encode them, to generate therapeutic and diagnostic anti-8PlD4 antibodies.
- the immunogen can be any 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids, or the corresponding nucleic acids that encode them, from the 8P1D4 protein variants listed in Figures 2 and 3.
- peptide immunogens of the invention can comprise, a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Hydrophilicity profile of Figure 5; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value less than 0.5 in the HydiOpathicity profile of Figure 6 ; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7 ; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile on Figure 8 ; and, a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in
- All immunogens of the invention, peptide or nucleic acid can be embodied in human unit dose form, or comprised by a composition that includes a pharmaceutical excipient compatible with human physiology.
- the analysis indicates that 8P1D4 variant 1 is composed of 64.60% alpha helix, 4.72%o extended strand, and 30.68% random coil (Figure 13a).
- 8P1D4 variant 2 is composed of 62.79% alpha helix, 3.10% extended strand, and 34.11% random coil (Figure 13b).
- 8P1D4 variant 3 is composed of 58.87% alpha helix, 5.32% extended sfrand, and 35.82% random coil ( Figure 13c).
- Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
- the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or infraperitoneal injections.
- computer algorithms are employed in design of immunogens that, based on amino acid sequence analysis contain characteristics of being antigenic and available for recognition by the immune system of the immunized host (see the Example entitled "Antigenicity Profiles").
- Such regions would be predicted to be hydrophilic, flexible, in beta-turn conformations, and be exposed on the surface of the protein (see, e.g., Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9 for amino acid profiles that indicate such regions of 8P 1D4 and variants).
- 8P1D4 recombinant bacterial fusion proteins or peptides containing hydrophilic, flexible, beta-turn regions of 8P1D4 variant proteins are used as antigens to generate polyclonal antibodies in New Zealand White rabbits.
- such regions include, but are not limited to, amino acids 1-40, amino acids 143-165, amino acids 180-220, of 8P1D4 variants 1, 2, and 3, amino acids 312-339 of 8P1D4 variant 1, and amino acids 250-282 of 8P1D4 variant 3. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
- immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor
- KLH keyhole limpet hemocyanin
- serum albumin serum albumin
- bovine thyroglobulin bovine thyroglobulin
- soybean trypsin inhibitor a peptide encoding ammo acids 250-282 of 8P1D4 variant 3 is conjugated to KLH and used to immunize a rabbit
- the immunizing agent may include all or portions of the 8P1D4 vanant protems, analogs or fusion protems thereof
- the 8P1D4 variant 1 ammo acid sequence can be fused using recombinant DNA techniques to any one of a variety of fusion protem partners that are well known in the art, such as glutathione-S-fransferase (GST) and HIS tagged fusion proteins
- GST glutathione-S-fran
- a GST-fusion protein encoding ammo acids 250-282 is produced, purified, and used as immunogen
- Other recombinant bacterial fusion prote s that may be employed mclude maltose binding protein, LacZ, thioredoxm, NusA, or an immunoglobulin constant region (see the section entitled "Production of 8P1D4 m Prokaryotic Systems” and Current Protocols In Molecular Biology, Volume 2, Umt 16, Fredenck M Ausubul et al eds , 1995, Lrnsley, P S , Brady, W , Urnes, M , Grosmaire, L , Damle, N , and Ledbetter, L (1991) J Exp Med 174, 561-566)
- mammalian expressed protem antigens are also used. These antigens are expressed from mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see the Example entitled "Production of Recombinant 8P1D4 in Eukaryotic Systems"), and retain post-translational modifications such as glycosylations found m native protem
- the predicted extracellular loop of variant 1, ammo acids 185-218 is cloned into the Tag5 mammalian secretion vector
- the recombinant protem is purified by metal chelate chromatography from tissue culture supernatants of 293T cells stably expressing the recombinant vector
- the purified Tag5 8P 1D4 protem is then used as immunogen
- adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate)
- rabbits are initially immunized subcutaneously with up to 200 ⁇ g, typically 100- 200 ⁇ g, of fusion prote or peptide conjugated to KLH mixed m complete Freund's adjuvant (CFA) Rabbits are then injected subcutaneously every two weeks with up to 200 ⁇ g, typically 100-200 ⁇ g, of the immunogen m mcomplete Freund's adjuvant (IFA) Test bleeds are taken approximately 7-10 days following each immunization and used to monitor the titer of the antiserum by ELISA
- the full-length 8P1D4 variant 1 cDNA is cloned into pCDNA 3 1 myc-his expression vector (Invitrogen, see the Example entitled "Production of Recombinant 8P1D4 m Eukaryotic Systems")
- cell lysates are probed with the ant ⁇ -8PlD4 serum and with anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, CA) to determine specific reactivity to denatured 8P1D4 protein usmg the Western blot technique
- the immune serum is then tested by the Western blot technique agamst 293T-8P1D4 cells
- the immune serum is tested by fluorescence microscopy, flow cytometry and immunoprecipitation agamst
- Anti-serum from rabbits immunized with 8P1D4 variant fusion protems are purified by depletion of antibodies reactive to the fusion partner sequence by passage over an affinity column contam g the fusion partner either alone or in the context of an irrelevant fusion protem
- antiserum de ⁇ ved from a GST-8P1D4 fusion protem encodmg amino acids 250-282 of variant 3 is first purified by passage over a column of GST protein covalently coupled to AffiGel matrix (BioRad, Hercules, Calif).
- the antiserum is then affinity purified by passage over a column composed of a MBP-fusion protein also encoding amino acids 250-282 covalently coupled to AffiGel matrix.
- the semm is then further purified by protein G affinity chromatography to isolate the IgG fraction.
- Sera from other His-tagged antigens and peptide immunized rabbits as well as fusion partner depleted sera are affinity purified by passage over a column matrix composed of the original protein immunogen or free peptide.
- therapeutic mAbs to 8P1D4 variants comprise those that react with epitopes specific for each variant protein or specific to sequences in common between the variants that would disrupt or modulate the biological function of the 8P1D4 variants, for example those that would disrupt the interaction with ligands and substrates or disrupt its biological activity.
- Immunogens for generation of such mAbs include those designed to encode or contain the entire 8P1D4 protein variant sequence, regions of the 8P1D4 protein variants predicted to be antigenic from computer analysis of the amino acid sequence (see, e.g., Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9, and the Example entitled "Antigenicity Profiles").
- Immunogens include peptides, recombinant bacterial proteins, and mammalian expressed Tag 5 proteins and human and murine IgG FC fusion proteins.
- cells engineered to express high levels of a respective 8P1D4 variant such as 293T-8P1D4 variant 1 or 300.19-8P1D4 variant lmurine Pre-B cells, are used to immunize mice.
- mice are first immunized intraperitoneally (IP) with, typically, 10-50 ⁇ g of protein immunogen or 10 7 8PlD4-expressing cells mixed in complete Freund's adjuvant. Mice are then subsequently immunized IP every 2-4 weeks with, typically, 10-50 ⁇ g of protein immunogen or 10 7 cells mixed in incomplete Freund's adjuvant.
- IP intraperitoneally
- MPL-TDM adjuvant is used in immunizations.
- a DNA-based immunization protocol is employed in which a mammalian expression vector encoding an 8P1D4 variant sequence is used to immunize mice by direct injection of the plasmid DNA.
- amino acids 185-218 is cloned into the Tag5 mammalian secretion vector and the recombinant vector is used as immunogen.
- the same amino acids are cloned into an Fc-fusion secretion vector in which the 8P1D4 variant 1 sequence is fused at the amino-terminus to an IgK leader sequence and at the carboxyl-terminus to the coding sequence of the human or murine IgG Fc region.
- This recombinant vector is then used as immunogen.
- the plasmid immunization protocols are used in combination with purified proteins expressed from the same vector and with cells expressing the respective 8P1D4 variant.
- test bleeds are taken 7-10 days following an injection to monitor titer and specificity of the immune response. Once appropriate reactivity and specificity is obtained as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytometric analyses, fusion and hybridoma generation is then carried out with established procedures well known in the art (see, e.g., Harlow and Lane, 1988).
- a GST-8P1D4 variant 3 antigen encoding amino acids 250-282 is expressed and purified from bacteria.
- Balb C mice are initially immunized intraperitoneally with 25 ⁇ g of the GST-8P1D4 variant 3 protein mixed in complete
- mice are subsequently immunized every two weeks with 25 ⁇ g of the antigen mixed in incomplete Freund's adjuvant for a total of three immunizations.
- ELISA using an MBP-fiision protein encoding amino acids 250-282 determines the titer of serum from immunized mice.
- Reactivity and specificity of serum to full length 8P1D4 variant 3 protein is monitored by W e stern blotting, immunoprecipitation and flow cytometry using 293T cells fransfected with an expression vector encoding the 8P1D4 variant 3 cDNA compared to cells fransfected with variant 1 and 2 cDNA (see e.g., the Example entitled "Production of Recombinant 8P1D4 in Eukaryotic Systems").
- Other recombinant 8P1D4 variant 3-expressing cells or cells endogenously expressing 8P1D4 variant 3 are also used. Mice showing the strongest specific reactivity to 8P1D4 variant 3 are rested and given a final injection of GST-antigen in PBS and then sacrificed four days later.
- the spleens of the sacrificed mice are harvested and fused to SPO/2 myeloma cells using standard procedures (Harlow and Lane, 1988). Supernatants from HAT selected growth wells are screened by ELISA, Western blot, immunoprecipitation, fluorescent microscopy, and flow cytometry to identify 8P1D4 specific antibody-producing clones.
- the binding affinity of a 8P1D4 monoclonal antibody is determined using standard technologies. Affinity measurements quantify the strength of antibody to epitope binding and are used to help define which 8P1D4 monoclonal antibodies preferred for diagnostic or therapeutic use, as appreciated by one of skill in the art.
- the BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity.
- the BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor biomolecular interactions in real time.
- BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants.
- HLA class I and class II binding assays using purified HLA molecules are performed in accordance with disclosed protocols (e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney et al, Current Protocols in Immunology 18.3.1 (1998); Sidney, et al, J. Immunol. 154:247 (1995); Sette, et al, Mol. Immunol 31:813 (1994)). Briefly, purified MHC molecules (5 to 500 nM) are incubated with various unlabeled peptide inhibitors and 1-10 nM 125 I-radiolabeled probe peptides as described.
- MHC-peptide complexes are separated from free peptide by gel filtration and the fraction of peptide bound is determined.
- each MHC preparation is titered in the presence of fixed amounts of radiolabeled peptides to determine the concentration of HLA molecules necessary to bind 10-20% of the total radioactivity. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.
- Binding assays as outlined above may be used to analyze HLA supermotif and/or HLA motif-bearing peptides (see Table IV).
- HLA vaccine compositions of the invention can include multiple epitopes.
- the multiple epitopes can comprise multiple HLA supermotifs or motifs to achieve broad population coverage. This example illustrates the identification and confirmation of supermotif- and motif-bearing epitopes for the inclusion in such a vaccine composition. Calculation of population coverage is performed using the strategy described below.
- Identified A2-, A3-, and DR-supermotif sequences are scored using polynomial algorithms to predict their capacity to bind to specific HLA-Class I or Class II molecules. These polynomial algorithms account for the impact of different amino acids at different positions, and are essentially based on the premise that the overall affinity (or ⁇ G) of peptide-HLA molecule interactions can be approximated as a linear polynomial function of the type:
- ⁇ G a H x a 2 ,- x a 3l - x a m -
- a ⁇ . is a coefficient which represents the effect of the presence of a given amino acid (j) at a given position (i) along the sequence of a peptide of n amino acids.
- the crucial assumption of this method is that the effects at each position are essentially independent of each other (i.e., independent binding of individual side- chains).
- residue y occurs at position i in the peptide, it is assumed to contribute a constant amount ) to the free energy of binding of the peptide irrespective of the sequence of the rest of the peptide.
- the ARB values corresponding to the sequence of the peptide are multiplied. If this product exceeds a chosen threshold, the peptide is predicted to bind. Appropriate thresholds are chosen as a function of the degree of stringency of prediction desired.
- Protein sequences from STEAP-1 are scanned utilizing motif identification software, to identify 8-, 9- 10- and 11-mer sequences containing the HLA-A2 -supermotif main anchor specificity. Typically, these sequences are then scored using the protocol described above and the peptides corresponding to the positive- scoring sequences are synthesized and tested for their capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201 is considered a prototype A2 supertype molecule).
- A2-supertype molecules A*0202, A*0203, A*0206, and A*6802.
- Peptides that bind to at least three of the five A2-supertype alleles tested are typically deemed A2-superty ⁇ e cross-reactive binders.
- Preferred peptides bind at an affinity equal to or less than 500 nM to three or more HLA-A2 supertype molecules.
- the STEAP-1 protein sequence(s) scanned above is also examined for the presence of peptides with the HLA-A3-supermotif primary anchors. Peptides corresponding to the HLA A3 supermotif-bearing sequences are then synthesized and tested for binding to HLA-A*0301 and HLA-A* 1101 molecules, the molecules encoded by the two most prevalent A3 -supertype alleles.
- the peptides that bind at least one of the two alleles with binding affinities of ⁇ 500 nM, often ⁇ 200 nM, are then tested for binding cross-reactivity to the other common A3- supertype alleles (e.g., A*3101, A*3301, and A*6801) to identify those that can bind at least three of the five HLA- A3 -supertype molecules tested.
- A3- supertype alleles e.g., A*3101, A*3301, and A*6801
- the STEAP-1 protein(s) scanned above is also analyzed for the presence of 8-, 9- 10-, or 11 -mer peptides with the HLA-B7-supermotif.
- Correspondmg peptides are synthesized and tested for binding to HLA- B*0702, the molecule encoded by the most common B7-supertype allele (i.e., the prototype B7 supertype allele).
- Peptides binding B*0702 with IC 50 of ⁇ 500 nM are identified using standard methods. These peptides are then tested for binding to other common B7-supertype molecules (e.g., B*3501, B*5101, B*5301, and B*5401). Peptides capable of binding to three or more of the five B7-supertype alleles tested are thereby identified.
- HLA-A 1 and -A24 epitopes can also be incorporated into vaccine compositions.
- An analysis of the STEAP-1 protein can also be performed to identify HLA-A1- and A24-motif-containing sequences.
- Cross-reactive candidate CTL A2-supermotif-bearing peptides that are identified as described herein are selected to confirm in vitro immunogenicity. Confirmation is performed using the following methodology:
- the .221A2.1 cell line produced by transferring the HLA-A2.1 gene into the HLA-A, -B, -C null mutant human B-lymphoblastoid cell line 721.221, is used as the peptide-loaded target to measure activity of HLA-A2.1 -restricted CTL.
- This cell line is grown in RPMI-1640 medium supplemented witii antibiotics, sodium pyruvate, nonessential amino acids and 10% (v/v) heat inactivated FCS.
- Cells that express an antigen of interest, or transfectants comprising the gene encoding the antigen of interest can be used as target cells to confirm the ability of peptide-specific CTLs to recognize endogenous antigen.
- DC Dendritic Cells
- PBMC/well in a 6-well plate After 2 hours at 37°C, the non-adherent cells are removed by gently shaking the plates and aspirating the supernatants. The wells a rp washed a total of three times with 3 ml RPMI to remove most of the non-adherent and loosely adherent cells. Three ml of complete medium containing 50 ng/ml of GM- CSF and 1,000 U/ml of IL-4 are then added to each well. TNF ⁇ is added to the DCs on day 6 at 75 ng/ml and the cells are used for CTL induction cultures on day 7.
- CD8+ T-cells are isolated by positive selection with Dynal immunomagnetic beads (Dynabeads® M-450) and the detacha-bead® reagent. Typically about 200-250x10 6 PBMC are processed to obtain 24x10 6 CD8 + T-cells (enough for a 48-well plate culture). Briefly, the PBMCs are thawed in RPMI with 30 ⁇ g/ml DNAse, washed once with PBS containing 1% human AB serum and resuspended in PBS/1% AB serum at a concenfration of 20xl0 6 cells/ml.
- the magnetic beads are washed 3 times with PBS/AB serum, added to the cells (140 ⁇ l beads/20xl0 6 cells) and incubated for 1 hour at 4°C with continuous mixing.
- the beads and cells are washed 4x with PBS/AB serum to remove the nonadherent cells and resuspended at lOOxlO 6 cells/ml (based on the original cell number) in PBS/AB serum containing lOO ⁇ l/ml detacha-bead® reagent and 30 ⁇ g/ml DNAse.
- the mixture is incubated for 1 hour at room temperature with continuous mixing.
- the beads are washed again with PBS/AB/DNAse to collect the CD8+ T-cells.
- the DC are collected and cenfrifuged at 1300 lpm for 5-7 minutes, washed once with PBS with 1% BSA, counted and pulsed with 40 ⁇ g/ml of peptide at a cell concenfration of l-2xl0 6 /ml in the presence of 3 ⁇ g/ml ⁇ 2 - microglobulin for 4 hours at 20°C.
- the DC are then inadiated (4,200 rads), washed 1 time with medium and counted again.
- cytokine-generated DC at lxlO 5 cells/ml
- CD8+ T-cells at 2xl0 6 cell/ml
- Recombinant human IL-10 is added the next day at a final concenfration of 10 ng/ml and rhuman IL-2 is added 48 hours later at 10 IU/ml.
- PBMCs are thawed and washed twice with RPMI and DNAse. The cells are resuspended at 5xl0 6 cells/ml and irradiated at ⁇ 4200 rads. The PBMCs are plated at 2x10 ⁇ in 0.5 ml complete medium per well and incubated for 2 hours at 37°C.
- the plates are washed twice with RPMI by tapping the plate gently to remove the nonadherent cells and the adherent cells pulsed with lO ⁇ g/ml of peptide in the presence of 3 ⁇ g/ml 6 2 microglobulin in 0.25ml RPMI/5%AB per well for 2 hours at 37°C.
- Peptide solution from each well is aspirated and the wells are washed once with RPMI.
- Most of the media is aspirated from the induction cultures (CD8+ cells) and brought to 0.5 ml with fresh media.
- the cells are then transferred to the wells containing the peptide-pulsed adherent cells.
- recombinant human IL-10 is added at a final concentration of 10 ng/ml and recombinant human IL2 is added the next day and again 2-3 days later at 50IU/ml (Tsai et al, Critical Reviews in Immunology 18(l-2):65-75, 1998). Seven days later, the cultures are assayed for CTL activity in a 51 Cr release assay. In some experiments the cultures are assayed for peptide-specific recognition in the in situ IFN7 ELISA at the time of the second restimulation followed by assay of endogenous recognition 7 days later. After expansion, activity is measured in both assays for a side-by-side comparison.
- cytotoxicity is determined in a standard (5 hr) 51 Cr release assay by assaying individual wells at a single E:T.
- Peptide-pulsed targets are prepared by incubating the cells with lO ⁇ g/ml peptide overnight at 37°C.
- Adherent target cells are removed from culture flasks with trypsin-EDTA.
- Target cells are labeled with 200 ⁇ Ci of Cr sodium chromate (Dupont, Wilmington, DE) for 1 hour at 37°C.
- Labeled target cells are resuspended at 10 6 per ml and diluted 1:10 with K562 cells at a concentration of 3.3xl0 6 /ml (an NK-sensitive erythroblastoma cell line used to reduce non-specific lysis).
- Target cells (100 ⁇ l) and effectors (lOO ⁇ l) are plated in 96 well round-bottom plates and incubated for 5 hours at 37°C. At that time, 100 ⁇ l of supernatant are collected from each well and percent lysis is determined according to the formula:
- a positive culture is defined as one in which the specific lysis (sample- background) is 10% or higher in the case of individual wells and is 15% or more at the two highest E:T ratios when expanded cultures are assayed.
- Immulon 2 plates are coated with mouse anti-human IFNy. monoclonal antibody (4 ⁇ g/ml 0.1M NaHC0 3 , pH8.2) overnight at 4°C. The plates are washed with Ca 2+ , Mg 2+ -free PBS/0.05% Tween 20 and blocked with PBS/10% FCS for two hours, after which the CTLs (100 ⁇ l/well) and targets (100 ⁇ l/well) are added to each well, leaving empty wells for the standards and blanks (which received media only). The target cells, either peptide-pulsed or endogenous targets, are used at a concentration of lxlO 6 cells/ml. The plates are incubated for 48 hours at 37°C with 5% C0 2 .
- Recombinant human IFN-gamma is added to the standard wells starting at 400 pg or 1200pg/100 microliter/well and the plate incubated for two hours at 37°C.
- the plates are washed and 100 ⁇ l of biotinylated mouse anti-human IFN-gamma monoclonal antibody (2 microgram/ml in PBS/3%FCS/0.05% Tween 20) are added and incubated for 2 hours at room temperature. After washing again, 100 microliter HRP-sfreptavidin (1:4000) are added and the plates incubated for one hour at room temperature.
- the plates are then washed 6x with wash buffer, 100 microliter/well developing solution (TMB 1:1) are added, and the plates allowed to develop for 5-15 minutes.
- the reaction is stopped with 50 microliter/well IM H P0 and read at OD450.
- a culture is considered positive if it measured at least 50 pg of IFN-gamma/well above background and is twice the background level of
- Recombinant human IL2 is added 24 hours later at a final concentration of 200 ⁇ U/ml and every three days thereafter with fresh media at 50IU/ml.
- the cells are split if the cell concentration exceeds lxl0 6 /ml and the cultures are assayed between days 13 and 15 at E:T ratios of 30, 10, 3 and 1:1 in the 51 Cr release assay or at lxl0 6 /ml in the in situ IFN ⁇ assay using the same targets as before the expansion.
- Cultures are expanded in the absence of anti-CD3 + as follows. Those cultures that demonstrate specific lytic activity against peptide and endogenous targets are selected and 5x10 4 CD8 + cells are added to a T25 flask containing the following: lxlO 6 autologous PBMC per ml which have been peptide-pulsed with 10 ⁇ tg/ml peptide for two hours at 37°C and irradiated (4,200 rad); 2xl0 5 irradiated (8,000 rad) EBV-fransformed cells per ml RPMI-1640 containing 10%(v/v) human AB serum, non-essential AA, sodium pyruvate, 25mM 2-ME, L- glutamine and gentamicin.
- A2-supermotif cross-reactive binding peptides are tested in the cellular assay for the ability to induce peptide-specific CTL in normal individuals.
- a peptide is typically considered to be an epitope if it induces peptide-specific CTLs in at least individuals, and preferably, also recognizes the endogenously expressed peptide.
- PBMCs isolated from patients bearing a tumor that expresses STEAP-1. Briefly, PBMCs are isolated from patients, re-stimulated with peptide-pulsed monocytes and assayed for the ability to recognize peptide-pulsed target cells as well as fransfected cells endogenously expressing the antigen.
- HLA-A3 supermotif-bearing cross-reactive binding peptides are also evaluated for immunogenicity using methodology analogous for that used to evaluate the immunogenicity of the HLA-A2 supermotif peptides.
- Example 15 Implementation of the Extended Supermotif to Improve the Binding Capacity of Native Epitopes by Creating Analogs
- HLA motifs and supermotifs are useful in the identification and preparation of highly cross-reactive native peptides, as demonstrated herein.
- the definition of HLA motifs and supermotifs also allows one to engineer highly cross-reactive epitopes by identifying residues within a native peptide sequence which can be analoged to confer upon the peptide certain characteristics, e.g. greater cross-reactivity within the group of HLA molecules that comprise a supertype, and/or greater binding affinity for some or all of those HLA molecules. Examples of analoging peptides to exhibit modulated binding affinity are set forth in this example.
- Peptide engineering strategies are implemented to further increase the cross-reactivity of the epitopes.
- the main anchors of A2 -supermotif-bearing peptides are altered, for example, to infroduce a preferred L, I, V, or M at position 2, and I or V at the C-terminus.
- each engineered analog is initially tested for binding to the prototype A2 supertype allele A*0201, then, if A*0201 binding capacity is maintained, for A2- supertype cross-reactivity.
- a peptide is confirmed as binding one or all supertype members and then analoged to modulate binding affinity to any one (or more) of the supertype members to add population coverage.
- the selection of analogs for immunogenicity in a cellular screening analysis is typically further restricted by the capacity of the parent wild type (WT) peptide to bind at least weakly, i.e., bind at an IC 50 of 5000nM or less, to three of more A2 supertype alleles.
- WT wild type
- the rationale for this requirement is that the WT peptides must be present endogenously in sufficient quantity to be biologically relevant.
- Analoged peptides have been shown to have increased immunogenicity and cross-reactivity by T cells specific for the parent epitope (see, e.g., Parkhurst et al, J. Immunol 157:2539, 1996; and Pogue et al, Proc. Natl Acad. Sci.
- Analogs of HLA-A3 supermotif-bearing epitopes are generated using strategies similar to those employed in analoging HLA-A2 supermotif-bearing peptides. For example, peptides binding to 3/5 of the A3- supertype molecules are engineered at primary anchor residues to possess a preferred residue (V, S, M, or A) at position 2.
- analog peptides are then tested for the ability to bind A*03 and A* 11 (prototype A3 supertype alleles). Those peptides that demonstrate ⁇ 500 nM binding capacity are then confinned as having A3-superty ⁇ e cross-reactivity.
- B7 supermotif-bearing peptides are, for example, engineered to possess a preferred residue (V, I, L, or F) at the C-terminal primary anchor position, as demonstrated by Sidney et al. (J. Immunol. 157:3480- 3490, 1996).
- analog-specific CTLs are also able to recognize the wild-type peptide and, when possible, targets that endogenously express the epitope.
- HLA supermotifs are of value in engineering highly cross-reactive peptides and/or peptides that bind HLA molecules with increased affinity by identifying particular residues at secondary anchor positions that are associated with such properties. For example, the binding capacity of a B7 supermotif-bearing peptide with an F residue at position 1 is analyzed. The peptide is then analoged to, for example, substitute L for F at position 1. The analoged peptide is evaluated for increased binding affinity, binding half life and/or increased cross-reactivity. Such a procedure identifies analoged peptides with enhanced properties.
- Engineered analogs with sufficiently improved binding capacity or cross-reactivity can also be tested for immunogenicity in HLA-B7-fransgenic mice, following for example, IFA immunization or lipopeptide immunization.
- Analoged peptides are additionally tested for the ability to stimulate a recall response using PBMC from patients with STEAP-1 -expressing tumors.
- cysteine Another form of peptide analoging, unrelated to anchor positions, involves the substitution of a cysteine with ⁇ -amino butyric acid. Due to its chemical nature, cysteine has the propensity to form disulfide bridges and sufficiently alter the peptide structurally so as to reduce binding capacity. Substitution of ⁇ -amino butyric acid for cysteine not only alleviates this problem, but has been shown to improve binding and crossbinding capabilities in some instances (see, e.g., the review by Sette et al, In: Persistent Viral Infections, Eds. R. Ahmed and I. Chen, John Wiley & Sons, England, 1999).
- Example 16 Identification and confirmation of STEAP-1 -derived sequences with HLA-DR binding motifs
- Peptide epitopes bearing an HLA class II supermotif or motif are identified and confirmed as outlined below using methodology similar to that described for HLA Class I peptides.
- a STEAP-1 antigen is analyzed for the presence of sequences bearing an HLA-DR-motif or supermotif. Specifically, 15-mer sequences are selected comprising a DR-supermotif, comprising a 9-mer core, and three-residue N- and C-terminal flanking regions (15 amino acids total).
- Protocols for predicting peptide binding to DR molecules have been developed (South wood et al, J. Immunol. 160:3363-3373, 1998). These protocols, specific for individual DR molecules, allow the scoring, and ranking, of 9-mer core regions. Each protocol not only scores peptide sequences for the presence of DR- supermotif primary anchors (i.e., at position 1 and position 6) within a 9-mer core, but additionally evaluates sequences for the presence of secondary anchors. Using allele-specific selection tables (see, e.g., Southwood et al, ibid), it has been found that these protocols efficiently select peptide sequences with a high probability of binding a particular DR molecule. Additionally, it has been found tiiat performing these protocols in tandem, specifically those for DR1, DR4w4, and DR7, can efficiently select DR cross-reactive peptides.
- the STEAP-1 -derived peptides identified above are tested for their binding capacity for various common HLA-DR molecules. All peptides are initially tested for binding to the DR molecules in the primary panel: DR1, DR4w4, and DR7. Peptides binding at least two of these three DR molecules are then tested for binding to DR2w2 ⁇ l, DR2w2 ⁇ 2, DR6wl9, and DR9 molecules in secondary assays. Finally, peptides binding at least two of the four secondary panel DR molecules, and thus cumulatively at least four of seven different DR molecules, are screened for binding to DR4wl5, DR5wl 1, and DR8w2 molecules in tertiary assays.
- Peptides binding at least seven of die ten DR molecules comprising the primary, secondary, and tertiary screening assays are considered cross-reactive DR binders.
- STEAP-1 -derived peptides found to bind common HLA-DR alleles are of particular interest.
- DR3 binding capacity is a relevant criterion in the selection of HTL epitopes.
- peptides shown to be candidates may also be assayed for their DR3 binding capacity.
- peptides binding only to DR3 can also be considered as candidates for inclusion in a vaccine formulation.
- target STEAP-1 antigens are analyzed for sequences carrying one of the two DR3-specific binding motifs reported by Geluk et al. (J. Immunol. 152:5742-5748, 1994).
- the corresponding peptides are then synthesized and confirmed as having the ability to bind DR3 with an affinity of 1 ⁇ M or better, i.e., less than 1 ⁇ M.
- Peptides are found that meet this binding criterion and qualify as HLA class II high affinity binders.
- DR3 binding epitopes identified in this manner are included in vaccine compositions with DR supermotif-bearing peptide epitopes.
- the class II motif-bearing peptides are analoged to improve affinity or cross-reactivity.
- aspartic acid at position 4 of the 9-mer core sequence is an optimal residue for DR3 binding, and substitution for that residue often improves DR 3 binding.
- Example 17 Immunogenicity of STEAP-1-derived HTL epitopes
- This example determines immunogenic DR supermotif- and DR3 motif-bearing epitopes among those identified using the methodology set forth herein.
- Immunogenicity of HTL epitopes are confirmed in a manner analogous to the detennination of immunogenicity of CTL epitopes, by assessing the ability to stimulate HTL responses and/or by using appropriate transgenic mouse models. Immunogenicity is determined by screening for: 1.) in vitro primary induction using normal PBMC or 2.) recall responses from patients who have STEAP-1 -expressing tumors.
- Example 18 Calculation of phenotypic frequencies of HLA-supertypes in various ethnic backgrounds to determine breadth of population coverage
- This example illustrates the assessment of the breadth of population coverage of a vaccine composition comprised of multiple epitopes comprising multiple supermotifs and/or motifs.
- the A3-like supertype may also include A34, A66, and A*7401, these alleles were not included in overall frequency calculations.
- confirmed members of the A2-like supertype family are A*0201, A*0202, A*0203, A*0204, A*0205, A*0206, A*0207, A*6802, and A*6901.
- the B7-like supertype-confirmed alleles are: B7, B*3501-03, B51, B*5301, B*5401, B*5501-2, B*5601, B*6701, and B*7801 (potentially also B*1401, B*3504-06, B*4201, and B*5602).
- Population coverage achieved by combining the A2-, A3- and B7-supertypes is approximately 86% in five major ethnic groups. Coverage may be extended by including peptides bearing the Al and A24 motifs. On average, Al is present in 12% and A24 in 29% of the population across five different major ethnic groups (Caucasian, North American Black, Chinese, Japanese, and Hispanic). Together, these alleles are represented with an average frequency of 39% in these same ethnic populations. The total coverage across the major ethnicities when Al and A24 are combined with the coverage of the A2-, A3- and B7-supertype alleles is >95%. An analogous approach can be used to estimate population coverage achieved with combinations of class II motif-bearing epitopes.
- an average population coverage is predicted to be greater than 95% in each of five major ethnic populations.
- the game theory Monte Carlo simulation analysis which is known in the art (see e.g., Osborne, M.J. and Rubinstein, A. "A course in game theory” MIT Press, 1994), can be used to estimate what percentage of the individuals in a population comprised of the Caucasian, North American Black, Japanese, Chinese, and Hispanic ethnic groups would recognize the vaccine epitopes described herein. A preferred percentage is 90%. A more preferred percentage is
- Effector cells isolated from transgenic mice that are immunized with peptide epitopes are re-stimulated in vitro using peptide-coated stimulator cells. Six days later, effector cells are assayed for cytotoxicity and the cell lines that contain peptide-specific cytotoxic activity are further re-stimulated. An additional six days later, these cell lines are tested for cytotoxic activity on 51 Cr labeled Jurkat-A2.1/K b target cells in the absence or presence of peptide, and also tested on 51 Cr labeled target cells bearing the endogenously synthesized antigen, i.e. cells that are stably fransfected with STEAP-1 ⁇ expression vectors.
- transgenic mouse model The results demonstrate that CTL lines obtained from animals primed with peptide epitope recognize endogenously synthesized STEAP-1 antigen.
- the choice of transgenic mouse model to be used for such an analysis depends upon the epitope(s) that are being evaluated.
- HLA-A*0201/K b transgenic mice several other transgenic mouse models including mice with human Al l, which may also be used to evaluate A3 epitopes, and B7 alleles have been characterized and others (e.g., transgenic mice for HLA-A1 and A24) are being developed.
- HLA-DR1 and HLA-DR3 mouse models have also been developed, which may be used to evaluate HTL epitopes.
- the vaccine composition used herein comprise peptides to be administered to a patient with a STEAP-1 -expressing tumor.
- the peptide composition can comprise multiple CTL and/or HTL epitopes.
- the epitopes are identified using methodology as described herein.
- This example also illustrates that enhanced immunogenicity can be achieved by inclusion of one or more HTL epitopes in a CTL vaccine composition; such a peptide composition can comprise an HTL epitope conjugated to a CTL epitope.
- the CTL epitope can be one that binds to multiple HLA family members at an affinity of 500 nM or less, or analogs of that epitope.
- the peptides may be lipidated, if desired.
- mice which are transgenic for the human HLA A2.1 allele and are used to confirm the immunogenicity of HLA-A*0201 motif- or HLA-A2 supermotif-bearing epitopes, and are primed subcutaneously (base of the tail) with a 0.1 ml of peptide in Incomplete Freund's Adjuvant, or if the peptide composition is a lipidated CTL/HTL conjugate, in DMSO/saline, or if the peptide composition is a polypeptide, in PBS or Incomplete Freund's Adjuvant. Seven days after priming, splenocytes obtained from these animals are restimulated with syngenic irradiated LPS-activated lymphoblasts coated with peptide.
- Target cells for peptide-specific cytotoxicity assays are Jurkat cells fransfected with the HLA-A2.1/K b chimeric gene (e.g., Vitiello et al, J. Exp. Med. 173:1007, 1991)
- In vitro CTL activation One week after priming, spleen cells (30x10 6 cells/flask) are co-cultured at 37°C with syngeneic, irradiated (3000 rads), peptide coated lymphoblasts (10xl0 ⁇ cells/flask) in 10 ml of culture medium/T25 flask. After six days, effector cells are harvested and assayed for cytotoxic activity.
- Target cells 1.0 to 1.5xl0 6
- Peptide is added where required at a concentration of 1 ⁇ g/ml.
- 10 4 51 Cr-labeled target cells are added to different concentrations of effector cells (final volume of 200 ⁇ l) in U-bottom 96-well plates. After a six hour incubation period at 37°C, a 0.1 ml aliquot of supernatant is removed from each well and radioactivity is determined in a Micromedic automatic gamma counter.
- % 51 Cr release data is expressed as lytic units/10 6 cells.
- One lytic unit is arbitrarily defined as the number of effector cells required to achieve 30% lysis of 10,000 target cells in a six hour 51 Cr release assay.
- the lytic units/10 6 obtained in the absence of peptide is subfracted from the lytic units/10 6 obtained in the presence of peptide.
- results are analyzed to assess the magnitude of the CTL responses of animals injected with the immunogenic CTL/HTL conjugate vaccine preparation and are compared to the magnitude of the CTL response achieved using, for example, CTL epitopes as outlined above in the Example entitled "Confirmation of Immunogenicity.” Analyses similar to this may be performed to confirm the immunogenicity of peptide conjugates containing multiple CTL epitopes and/or multiple HTL epitopes. In accordance with these procedures, it is found that a CTL response is induced, and concomitantly that an HTL response is induced upon administration of such compositions.
- Example 21 Selection of CTL and HTL epitopes for inclusion in a STEAP-1-specific vaccine.
- the peptides in the composition can be in the form of a nucleic acid sequence, either single or one or more sequences (i.e., minigene) that encodes peptide(s), or can be single and/or polyepitopic peptides.
- the following principles are utilized when selecting a plurality of epitopes for inclusion in a vaccine composition. Each of the following principles is balanced in order to make the selection.
- Epitopes are selected which, upon administration, mimic immune responses that are correlated with STEAP-1 clearance.
- the number of epitopes used depends on observations of patients who spontaneously clear STEAP-1. For example, if it has been observed that patients who spontaneously clear STEAP-1 -expressing cells generate an immune response to at least three (3) epitopes from STEAP-1 antigen, then at least three epitopes should be included for HLA class I. A similar rationale is used to determine HLA class II epitopes.
- Epitopes are often selected that have a binding affinity of an IC 50 of 500 nM or less for an HLA class I molecule, or for class II, an IC 50 of 1000 nM or less; or HLA Class I peptides with high binding scores from the BIMAS web site, at URL bimas.dcrt.nili.gov/.
- sufficient supermotif bearing peptides, or a sufficient array of allele-specific motif bearing peptides are selected to give broad population coverage.
- epitopes are selected to provide at least 80% population coverage.
- Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess breadth, or redundancy, of population coverage.
- a protein sequence for the vaccine composition is selected because it has maximal number of epitopes contained within the sequence, i.e., it has a high concentration of epitopes.
- Epitopes may be nested or overlapping (i.e., frame shifted relative to one another). For example, with overlapping epitopes, two 9-mer epitopes and one 10- mer epitope can be present in a 10 amino acid peptide.
- Each epitope can be exposed and bound by an HLA molecule upon administration of such a peptide.
- a multi-epitopic, peptide can be generated synthetically, recombinantly, or via cleavage from the native source.
- an analog can be made of this native sequence, whereby one or more of the epitopes comprise substitutions that alter the cross-reactivity and/or binding affinity properties of the polyepitopic peptide.
- Such a vaccine composition is administered for therapeutic or prophylactic purposes.
- This embodiment provides for the possibility that an as yet undiscovered aspect of immune system processing will apply to the native nested sequence and thereby facilitate the production of therapeutic or prophylactic immune response-inducing vaccine compositions.
- Such an embodiment provides for the possibility of motif-bearing epitopes for an HLA makeup that is presently unknown. Furthermore, this embodiment (absent the creating of any analogs) directs the immune response to multiple peptide sequences that are actually present in STEAP-1, thus avoiding the need to evaluate any junctional epitopes. Lastly, the embodiment provides an economy of scale when producing nucleic acid vaccine compositions.
- computer programs can be derived in accordance with principles in the art, which identify in a target sequence, the greatest number of epitopes per sequence length.
- a vaccine composition comprised of selected peptides, when administered, is safe, efficacious, and elicits an immune response similar in magnitude to an immune response that controls or clears cells that bear or overexpress STEAP-1.
- Minigene plasmids may, of course, contain various configurations of B cell, CTL and or HTL epitopes or epitope analogs as described herein.
- a minigene expression plasmid typically includes multiple CTL and HTL peptide epitopes.
- HLA-A2, -A3, -B7 supermotif-bearing peptide epitopes and HLA-A1 and -A24 motif-bearing peptide epitopes are used in conjunction with DR supermotif-bearing epitopes and/or DR3 epitopes.
- HLA class I supermotif or motif-bearing peptide epitopes derived STEAP-1 are selected such that multiple supermotifs/motifs are represented to ensure broad population coverage.
- HLA class II epitopes are selected from STEAP-1 to provide broad population coverage, i.e.
- both HLA DR- 1-4-7 supermotif-bearing epitopes and HLA DR-3 motif-bearing epitopes are selected for inclusion in the minigene construct.
- the selected CTL and HTL epitopes are then incorporated into a minigene for expression in an expression vector.
- Such a construct may additionally include sequences that direct the HTL epitopes to the endoplasmic reticulum.
- the Ii protein may be fused to one or more HTL epitopes as described in the art, wherein the CLIP sequence of the Ii protein is removed and replaced with an HLA class II epitope sequence so that HLA class II epitope is directed to the endoplasmic reticulum, where the epitope binds to an HLA class II molecules.
- This example illustrates the methods to be used for construction of a minigene-bearing expression plasmid.
- Other expression vectors that may be used for minigene compositions are available and known to those of skill in the art.
- the minigene DNA plasmid of this example contains a consensus Kozak sequence and a consensus murine kappa Ig-light chain signal sequence followed by CTL and or HTL epitopes selected in accordance with principles disclosed herein.
- the sequence encodes an open reading frame fused to the Myc and His antibody epitope tag coded for by the pcDNA 3.1 Myc-His vector.
- Overlapping oligonucleotides that can, for example, average about 70 nucleotides in length with 15 nucleotide overlaps, are synthesized and HPLC-purified.
- the oligonucleotides encode the selected peptide epitopes as well as appropriate linker nucleotides, Kozak sequence, and signal sequence.
- the final multiepitope minigene is assembled by extending the overlapping oligonucleotides in three sets of reactions using PCR.
- a Perkin/Elmer 9600 PCR machine is used and a total of 30 cycles are performed using the following conditions: 95°C for 15 sec, annealing temperature (5° below the lowest calculated Tm of each primer pair) for 30 sec, and 72°C for 1 min.
- the full-length dimer products are gel-purified, and two reactions containing the product of 1+2 and 3+4, and the product of 5+6 and 7+8 are mixed, annealed, and extended for 10 cycles. Half of the two reactions are then mixed, and 5 cycles of annealing and extension carried out before flanking primers are added to amplify the full length product.
- the full-length product is gel-purified and cloned into pCR-blunt (Invitrogen) and individual clones are screened by sequencing.
- Example 23 The Plasmid Construct and the Degree to Which It Induces Immunogenicity.
- a plasmid construct for example a plasmid constructed in accordance with the previous Example, is able to induce immunogenicity is confirmed in vitro by determining epitope presentation by APC following transduction or transfection of the APC with an epitope-expressing nucleic acid construct. Such a study determines "antigenicity" and allows the use of human APC.
- the assay determines the ability of the epitope to be presented by the APC in a context that is recognized by a T cell by quantifying the density of epitope-HLA class I complexes on the cell surface. Quantitation can be performed by directly measuring the amount of peptide eluted from the APC (see, e.g., Sijts et al, J.
- immunogenicity is confirmed through in vivo injections into mice and subsequent in vitro assessment of CTL and HTL activity, which are analyzed using cytotoxicity and proliferation assays, respectively, as detailed e.g., in Alexander et al, Immunity 1:751-761, 1994.
- HLA-A2.1/K b transgenic mice for example, are immunized intramuscularly with 100 ⁇ g of naked cDNA.
- a confrol group of animals is also immunized with an actual peptide composition that comprises multiple epitopes synthesized as a single polypeptide as they would be encoded by the minigene.
- Splenocytes from immunized animals are stimulated twice with each of the respective compositions (peptide epitopes encoded in the minigene or the polyepitopic peptide), then assayed for peptide-specific cytotoxic activity in a 5, Cr release assay.
- the results indicate the magnitude of the CTL response directed against the A2-restricted epitope, thus indicating the in vivo immunogenicity of the minigene vaccine and polyepitopic vaccine.
- the minigene elicits immune responses directed toward the HLA-A2 supermotif peptide epitopes as does the polyepitopic peptide vaccine.
- a similar analysis is also performed using other HLA- A3 and HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 and HLA-B7 motif or supermotif epitopes, whereby it is also found that the minigene elicits appropriate immune responses directed toward the provided epitopes.
- I-A b -restricted mice are immunized intramuscularly with 100 ⁇ g of plasmid DNA.
- a group of confrol animals is also immunized with an actual peptide composition emulsified in complete Freund's adjuvant.
- CD4+ T cells i.e.
- HTLs are purified from splenocytes of immunized animals and stimulated with each of the respective compositions (peptides encoded in the minigene).
- the HTL response is measured using a 3 H-thymidine incorporation proliferation assay, (see, e.g., Alexander et al. Immunity 1:751-761, 1994). The results indicate the magnitude of the HTL response, thus demonstrating the in vivo immunogenicity of the minigene. ⁇
- DNA mimgenes constructed as described in the previous Example, can also be confirmed as a vaccine in combination with a boosting agent using a prime boost protocol.
- the boosting agent can consist of recombinant protein (e.g., Barnett et al, Aids Res. and Human Retroviruses 14, Supplement 3:S299-S309, 1998) or recombinant vaccinia, for example, expressing a minigene or DNA encoding the complete protein of interest (see, e.g., Hanke et al, Vaccine 16:439-445, 1998; Sedegah et al, Proc. Natl. Acad. Sci USA 95:7648-53, 1998; Hanke and McMichael, Immunol. Letters 66:177-181, 1999; and Robinson et al, Nature Med. 5:526-34, 1999).
- recombinant protein e.g., Barnett et al, Aids Res. and Human Retroviruses 14, Supplement 3:
- the efficacy of the DNA minigene used in a prime boost protocol is initially evaluated in transgenic mice.
- A2.1/K b transgenic mice are immunized IM with 100 ⁇ g of a DNA minigene encoding the immunogenic peptides including at least one HLA-A2 supermotif-bearing peptide.
- the mice are boosted IP with 10 7 pfu/mouse of a recombinant vaccinia virus expressing the same sequence encoded by the DNA minigene.
- mice are immunized with 100 ⁇ g of DNA or recombinant vaccinia without the minigene sequence, or with DNA encoding the minigene, but without the vaccinia boost. After an additional incubation period of two weeks, splenocytes from the mice are immediately assayed for peptide-specific activity in an ELISPOT assay. Additionally, splenocytes are stimulated in vitro with the A2-restricted peptide epitopes encoded in the minigene and recombinant vaccinia, then assayed for peptide-specific activity in an alpha, beta and/or gamma IFN ELISA.
- Vaccine compositions of the present invention can be used to prevent STEAP-1 expression in persons who are at risk for tumors that bear this antigen.
- a polyepitopic peptide epitope composition (or a nucleic acid comprising the same) containing multiple CTL and HTL epitopes such as those selected in the above Examples, which are also selected to target greater than 80% of the population, is administered to individuals at risk for a STEAP-1-associated tumor.
- a peptide-based composition is provided as a single polypeptide that encompasses multiple epitopes.
- the vaccine is typically administered in a physiological solution that comprises an adjuvant, such as Incomplete Freunds Adjuvant.
- the dose of peptide for the initial immunization is from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
- the initial administration of vaccine is followed by booster dosages at 4 weeks followed by evaluation of the magnitude of the immune response in the patient, by techniques that determine the presence of epitope-specific CTL populations in a PBMC sample. Additional booster doses are administered as required.
- the composition is found to be both safe and efficacious as a prophylaxis against STEAP-1 -associated disease.
- composition typically comprising fransfecting agents is used for the administration of a nucleic acid-based vaccine in accordance with methodologies known in the art and disclosed herein.
- Example 25 Polyepitopic Vaccine Compositions Derived from Native STEAP-1 Sequences
- a native STEAP-1 polyprotein sequence is analyzed, preferably using computer algorithms defined for each class I and/or class II supermotif or motif, to identify "relatively short” regions of the polyprotein that comprise multiple epitopes.
- the "relatively short” regions are preferably less in length than an entire native antigen.
- This relatively short sequence that contains multiple distinct or overlapping, "nested” epitopes can be used to generate a minigene construct.
- the construct is engineered to express the peptide, which corresponds to die native protein sequence.
- the "relatively short” peptide is generally less than 250 amino acids in length, often less than 100 amino acids in length, preferably less than 75 amino acids in length, and more preferably less than 50 amino acids in length.
- the protein sequence of the vaccine composition is selected because it has maximal number of epitopes contained within the sequence, i.e., it has a high concentration of epitopes.
- epitope motifs may be nested or overlapping (i.e., frame shifted relative to one another). For example, with overlappmg epitopes, two 9-mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide. Such a vaccine composition is administered for therapeutic or prophylactic purposes.
- the vaccine composition will include, for example, multiple CTL epitopes from STEAP-1 antigen and at least one HTL epitope.
- This polyepitopic native sequence is administered either as a peptide or as a nucleic acid sequence which encodes the peptide.
- an analog can be made of this native sequence, whereby one or more of the epitopes comprise substitutions that alter the cross-reactivity and/or binding affinity properties of the polyepitopic peptide.
- the embodiment of this example provides for the possibility that an as yet undiscovered aspect of immune system processing will apply to the native nested sequence and thereby facilitate the production of therapeutic or prophylactic immune response-inducing vaccine compositions. Additionally, such an embodiment provides for the possibility of motif-bearing epitopes for an HLA makeup(s) that is presently unknown. Furthermore, this embodiment (excluding an analoged embodiment) directs the immune response to multiple peptide sequences that are actually present in native STEAP-1, thus avoiding the need to evaluate any junctional epitopes. Lastly, the embodiment provides an economy of scale when producing peptide or nucleic acid vaccine compositions. Related to this embodiment, computer programs are available in the art which can be used to identify in a target sequence, the greatest number of epitopes per sequence length.
- Example 26 Polyepitopic Vaccine Compositions from Multiple Antigens
- STEAP-1 peptide epitopes of the present invention are used in conjunction with epitopes from other target tumor-associated antigens, to create a vaccine composition that is useful for the prevention or treatment of cancer that expresses STEAP-1 and such other antigens.
- a vaccine composition can be provided as a single polypeptide that incorporates multiple epitopes from STEAP-1 as well as tumor- associated antigens that are often expressed with a target cancer associated with STEAP-1 expression, or can be administered as a composition comprising a cocktail of one or more discrete epitopes.
- the vaccine can be administered as a minigene construct or as dendritic cells which have been loaded with the peptide epitopes in vitro.
- Example 27 Use of peptides to evaluate an immune response
- Peptides of the invention may be used to analyze an immune response for the presence of specific antibodies, CTL or HTL directed to STEAP-1. Such an analysis can be performed in a manner described by Ogg et al, Science 279:2103-2106, 1998. In this Example, peptides in accordance with the invention are used as a reagent for diagnostic or prognostic purposes, not as an immunogen.
- teframers highly sensitive human leukocyte antigen tetrameric complexes
- teframers highly sensitive human leukocyte antigen tetrameric complexes
- teframers highly sensitive human leukocyte antigen tetrameric complexes
- STEAP-1 HLA-A*0201 -specific CTL frequencies from HLA A*0201-positive individuals at different stages of disease or following immunization comprising a STEAP-1 peptide containing an A*0201 motif.
- Tetrameric complexes are synthesized as described (Musey et al, N. Engl J. Med. 337:1267, 1997). Briefly, purified HLA heavy chain (A*0201 in this example) and ⁇ 2-microglobulin are synthesized by means of a prokaryotic expression system.
- the heavy chain is modified by deletion of the transmembrane-cytosolic tail and COOH-terminal addition of a sequence containing a BirA enzymatic biotinylation site.
- the heavy chain, ⁇ 2-microglobulin, and peptide are refolded by dilution.
- the 45-kD refolded product is isolated by fast protein liquid chromatography and then biotinylated by BirA in the presence of biotin (Sigma, St. Louis, Missouri), adenosine 5' triphosphate and magnesium.
- Sfreptavidin-phycoerythrin conjugate is added in a 1 :4 molar ratio, and the tetrameric product is concenfrated to 1 mg/ml.
- the resulting product is referred to as tetramer-phycoerythrin.
- PBMCs For the analysis of patient blood samples, approximately one million PBMCs are cenfrifuged at 300g for 5 minutes and resuspended in 50 ⁇ l of cold phosphate-buffered saline. Tri-color analysis is performed with the tetramer-phycoerythrin, along with anti-CD8-Tricolor, and anti-CD38. The PBMCs are incubated with tetramer and antibodies on ice for 30 to 60 min and then washed twice before formaldehyde fixation. Gates are applied to contain >99.98% of control samples. Controls for the teframers include both A*0201 -negative individuals and A*0201-positive non-diseased donors.
- the percentage of cells stained with the tetramer is then determined by flow cytometry.
- the results indicate the number of cells in the PBMC sample that contain epitope-resfricted CTLs, thereby readily indicating the extent of immune response to the STEAP-1 epitope, and thus the status of exposure to STEAP-1, or exposure to a vaccine that elicits a protective or therapeutic response.
- Example 28 Use of Peptide Epitopes to Evaluate Recall Responses
- the peptide epitopes of the invention are used as reagents to evaluate T cell responses, such as acute or recall responses, in patients. Such an analysis may be performed on patients who have recovered from STEAP - 1 -associated disease or who have been vaccinated with a STEAP-1 vaccine.
- the class I restricted CTL response of persons who have been vaccinated may be analyzed.
- the vaccine may be any STEAP-1 vaccine.
- PBMC are collected from vaccinated individuals and HLA typed.
- Appropriate peptide epitopes of the invention that, optimally, bear supermotifs to provide cross- reactivity with multiple HLA supertype family members, are then used for analysis of samples derived from individuals who bear that HLA type.
- PBMC from vaccinated individuals are separated on Ficoll-Histopaque density gradients (Sigma Chemical Co., St. Louis, MO), washed three times in HBSS (GIBCO Laboratories), resuspended in RPMI-1640 (GIBCO Laboratories) supplemented with L-glutamine (2mM), penicillin (50U/ml), streptomycin (50 ⁇ g/ml), and Hepes (lOmM) containing 10% heat-inactivated human AB serum (complete RPMI) and plated using microculture formats.
- a synthetic peptide comprising an epitope of the invention is added at 10 ⁇ g/ml to each well and HBV core 128-140 epitope is added at 1 ⁇ g/ml to each well as a source of T cell help during the first week of stimulation.
- a positive CTL response requires two or more of the eight replicate cultures to display greater than 10% specific 51 Cr release, based on comparison with non-diseased control subjects as previously described (Rehermann, et al, Nature Med. 2: 1104,1108, 1996; Rehermann et al, J. Clin. Invest. 97:1655-1665, 1996; and Rehermann et al. J. Clin. Invest. 98:1432-1440, 1996).
- Target cell lines are autologous and allogeneic EBV-fransformed B-LCL that are either purchased from the American Society for Histocompatibility and Immunogenetics (ASHI, Boston, MA) or established from the pool of patients as described (Guilhot, et al. J. Virol. 66:2610-261%, 1992).
- Target cells consist of either allogeneic HLA-matched or autologous EBV-fransformed B lymphoblastoid cell line that are incubated overnight with the synthetic peptide epitope of the invention at 10 ⁇ M, and labeled with 100 ⁇ Ci of 5I Cr (Amersham Corp., Arlington Heights, IL) for 1 hour after which they are washed four times with HBSS.
- Cytolytic activity is determined in a standard 4-h, split well 51 Cr release assay using U-bottomed 96 well plates containing 3,000 targets/well. Stimulated PBMC are tested at effector/target (E/T) ratios of 20-50:1 on day 14. Percent cytotoxicity is determined from the formula: 100 x [(experimental release-spontaneous release)/maximum release-spontaneous release)]. Maximum release is determined by lysis of targets by detergent (2% Triton X-100; Sigma Chemical Co., St. Louis, MO). Spontaneous release is ⁇ 25% of maximum release for all experiments.
- results of such an analysis indicate the extent to which HLA-restricted CTL populations have been stimulated by previous exposure to STEAP-1 or a STEAP-1 vaccine.
- Class II restricted HTL responses may also be analyzed.
- Purified PBMC are cultured in a 96- well flat bottom plate at a density of 1.5xl0 5 cells/well and are stimulated with 10 ⁇ g/ml synthetic peptide of the invention, whole STEAP-1 antigen, or PHA. Cells are routinely plated in replicates of 4-6 wells for each condition. After seven days of culture, the medium is removed and replaced with fresh medium containing lOU/ml IL-2. Two days later, 1 ⁇ Ci ⁇ -thymidine is added to each well and incubation is continued for an additional 18 hours. Cellular DNA is then harvested on glass fiber mats and analyzed for 3 H-thymidine incoiporation. Antigen-specific T cell proliferation is calculated as the ratio of 3 H-thymidine incorporation in the presence of antigen divided by the ⁇ -fhymidine incorporation in the absence of antigen.
- a human clinical trial for an immunogenic composition comprising CTL and HTL epitopes of the invention is set up as an IND Phase I, dose escalation study and ca ⁇ ied out as a randomized, double-blind, placebo-controlled trial.
- Such a trial is designed, for example, as follows:
- a total of about 27 individuals are enrolled and divided into 3 groups:
- Group I 3 subjects are injected with placebo and 6 subjects are injected with 5 ⁇ g of peptide composition
- Group II 3 subjects are injected with placebo and 6 subjects are injected with 50 ⁇ g peptide composition;
- Group III 3 subjects are injected with placebo and 6 subjects are injected with 500 ⁇ g of peptide composition.
- the endpoints measured in this study relate to the safety and tolerability of the peptide composition as well as its immunogenicity.
- Cellular immune responses to the peptide composition are an index of the intrinsic activity of this the peptide composition, and can therefore be viewed as a measure of biological efficacy.
- Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient cenfrifugation, aliquoted in freezing media and stored frozen. Samples are assayed for CTL and HTL activity.
- the vaccine is found to be both safe and efficacious.
- Example 30 Phase II Trials In Patients Expressing STEAP-1
- Phase II trials are performed to study the effect of administering the CTL-HTL peptide compositions to patients having cancer that expresses STEAP-1.
- the main objectives of the trial are to determine an effective dose and regimen for inducing CTLs in cancer patients that express STEAP-1, to establish the safety of inducing a CTL and HTL response in these patients, and to see to what extent activation of CTLs improves the clinical picture of these patients, as manifested, e.g., by the reduction and/or shrinking of lesions.
- Such a study is designed, for example, as follows:
- the studies are performed in multiple centers.
- the trial design is an open-label, uncontrolled, dose escalation protocol wherein the peptide composition is administered as a single dose followed six weeks later by a single booster shot of the same dose.
- the dosages are 50, 500 and 5,000 micrograms per injection. Drug- associated adverse effects (severity and reversibility) are recorded.
- the first group is injected with 50 micrograms of the peptide composition and the second and third groups with 500 and 5,000 micrograms of peptide composition, respectively.
- the patients within each group range in age from 21-65 and represent diverse ethnic backgrounds. All of them have a tumor that expresses STEAP-1.
- the vaccine composition is found to be both safe and efficacious in the freatment of STEAP-1 -associated disease.
- Example 31 Induction of CTL Responses Using a Prime Boost Protocol
- a prime boost protocol similar in its underlying principle to that used to confirm the efficacy of a DNA vaccine in fransgenic mice, such as described above in the Example entitled "The Plasmid Construct and the Degree to Which It Induces Immunogenicity,” can also be used for the administration of the vaccine to humans.
- Such a vaccine regimen can include an initial administration of, for example, naked DNA followed by a boost using recombinant virus encoding the vaccine, or recombinant protein/polypeptide or a peptide mixture administered in an adjuvant.
- the initial immunization may be performed using an expression vector, such as that constructed in the Example entitled "Construction of "Minigene” Multi-Epitope DNA Plasmids” in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
- the nucleic acid (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
- a booster dose is then administered.
- the booster can be recombinant fowlpox virus administered at a dose of 5- 10 7 to 5xl0 9 pfu.
- An alternative recombinant virus such as an MVA, canarypox, adenovirus, or adenoassociated virus, can also be used for the booster, or the polyepitopic protein or a mixture of the peptides can be administered.
- an MVA, canarypox, adenovirus, or adenoassociated virus can also be used for the booster, or the polyepitopic protein or a mixture of the peptides can be administered.
- patient blood samples are obtained before immunization as well as at intervals following administration of the initial vaccine and booster doses of the vaccine.
- Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient cenfrifugation, aliquoted in freezing media and stored frozen. Samples are assayed for CTL and HTL activity.
- Vaccines comprising peptide epitopes of the invention can be administered using APCs, or "professional" APCs such as DC.
- peptide-pulsed DC are administered to a patient to stimulate a CTL response in vivo.
- dendritic cells are isolated, expanded, and pulsed with a vaccine comprising peptide CTL and HTL epitopes of the invention.
- the dendritic cells are infused back into the patient to elicit CTL and HTL responses in vivo.
- the induced CTL and HTL then destroy or facilitate destruction, respectively, of the target cells that bear the STEAP-1 protein from which the epitopes in the vaccine are derived.
- a cocktail of epitope-comprising peptides is administered ex vivo to PBMC, or isolated DC therefrom.
- a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Monsanto, St. Louis, MO) or GM-CSF/IL-4. After pulsing the DC with peptides, and prior to reinfusion into patients, the DC are washed to remove unbound peptides.
- the number of DC reinfused into the patient can vary (see, e.g., Nature Med. 4:328, 1998; Nature Med. 2:52, 1996 and Prostate 32:272, 1997). Although 2-50 x 10 6 DC per patient are typically administered, larger number of DC, such as 10 7 or 10 s can also be provided. Such cell populations typically contain between 50-90% DC.
- peptide-loaded PBMC are injected mto patients without pu ⁇ fication of the DC
- PBMC generated after treatment with an agent such as ProgempoietmTM are injected mto patients without punfication of the DC
- the total number of PBMC that are administered often ranges from 10 8 to 10 10
- the cell doses injected mto patients is based on the percentage of DC m the blood of each patient, as determined, for example, by lmmunofluorescence analysis with specific anti-DC antibodies
- ProgempoietmTM mobilizes 2% DC in the peripheral blood of a given patient, and that patient is to receive 5 x 10 6 DC
- the patient will be injected with a total of 2 5 x 10 8 peptide-loaded PBMC
- the percent DC mobilized by an agent such as ProgempoietmTM is typically estimated to be between 2-10%, but can vary as appreciated by one of skill in the art
- ex vivo CTL or HTL responses to STEAP-1 antigens can be induced by incubating, m tissue culture, the patient's, or genetically compatible, CTL or HTL precursor cells together with a source of APC, such as DC, and immunogenic peptides After an appropnate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded mto effector cells, the cells are infused mto the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their specific target cells, i e , tumor cells
- CTL destroy
- HTL facilitate destruction
- Example 33 An Alternative Method of Identifying and Confirming Motif-Bearing Peptides
- Another method of identifying and confirming motif-bearing peptides is to elute them from cells beanng defined MHC molecules
- EBV transformed B cell lines used for tissue typing have been extensively characterized to determine which HLA molecules they express In certain cases these cells express only a single type of HLA molecule
- These cells can be fransfected with nucleic acids that express the antigen of interest, e g STEAP-1 Peptides produced by endogenous antigen processing of peptides produced as a result of transfection will then bmd to HLA molecules withm the cell and be transported and displayed on the cell's surface Peptides are then eluted from the HLA molecules by exposure to mild acid conditions and their ammo acid sequence determined, e g , by mass spectral analysis (e g , Kubo et al , J Immunol 152 3913, 1994) Because the majority of peptides that bmd a particular HLA molecule are motif-beanng, tins is an alternative
- cell lines that do not express endogenous HLA molecules can be fransfected with an expression construct encoding a single HLA allele
- These cells can then be used as described, i e , they can then be fransfected with nucleic acids that encode STEAP-1 to isolate peptides correspondmg to STEAP-1 that have been presented on the cell surface Peptides obtamed from such an analysis will bear mot ⁇ f(s) that correspond to bmdmg to the single HLA allele that is expressed in the cell
- Sequences complementary to the STEAP-l-encodmg sequences, or any parts thereof, are used to detect, decrease, or inhibit expression of naturally occurring STEAP-1
- ohgonucleotides comp ⁇ smg from about 15 to 30 base pairs is described, essentially the same proceduie is used with smaller or with larger sequence fragments
- Appropnate ohgonucleotides are designed using, e g , OLIGO 4 06 software (National Biosciences) and the coding sequence of STEAP-1.
- a complementary oligonucleotide is designed from the most unique 5' sequence and used to prevent promoter binding to the coding sequence.
- a complementary oligonucleotide is designed to prevent ribosomal binding to a STEAP- 1- encoding franscript.
- Example 35 Purification of Naturally-occurring or Recombinant STEAP-1 Using STEAP-1 -Specific Antibodies
- Naturally occurring or recombinant STEAP-1 is substantially purified by immunoaffinity chromatography using antibodies specific for STEAP-1.
- An immunoaffinity column is constructed by covalently coupling anti-STEAP-1 antibody to an activated chromatographic resin, such as CNBr-activated SEPHAROSE (Amersham Pharmacia Biotech). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
- Media containing STEAP-1 are passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of STEAP-1 (e.g., high ionic strength buffers in the presence of detergent).
- the column is eluted under conditions that disrupt antibody/STEAP-1 binding (e.g., a buffer of pH 2 to pH 3, or a high concenfration of a chaofrope, such as urea or thiocyanate ion), and GCR.P is collected.
- STEAP-1 or biologically active fragments thereof, are labeled with 121 1 Bolton-Hunter reagent.
- Bolton-Hunter reagent See, e.g., Bolton et al. (1973) Biochem. J. 133:529.
- Candidate molecules previously arrayed in the wells of a multi- well plate are incubated with the labeled STEAP-1, washed, and any wells with labeled STEAP-1 complex are assayed. Data obtained using different concentrations of STEAP-1 are used to calculate values for the number, affinity, and association of STEAP-1 with the candidate molecules.
- Example 37 In Vivo Assay for STEAP-1 Tumor Growth Promotion
- the effect of the STEAP-1 protein on tumor cell growth is evaluated in vivo by evaluating tumor development and growth of cells expressing or lacking STEAP-1.
- SCID mice are injected subcutaneously on each flank with 1 x 10 6 of either 3T3, or prostate cancer cell lines (e.g. PC3 cells) containing ti Neo empty vector or STEAP-1.
- At least two strategies may be used: (1) Constitutive STEAP-1 expression under regulation of a promoter such as a constitutive promoter obtained from the genomes of viruses such as polyoma virus, fowlpox viras (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), or from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, provided such promoters are compatible with the host cell systems, and (2) Regulated expression under control of an inducible vector system, such as ecdysone, tefracycline, etc., provided such promoters are compatible with the host cell systems.
- a promoter such as a constitutive promoter obtained from the genomes of viruses such as polyo
- Tumor volume is then monitored by caliper measurement at the appearance of palpable tumors and followed over time to determine if STEAP-1 -expressing cells grow at a faster rate and whether tumors produced by STEAP-1 -expressing cells demonstrate characteristics of altered aggressiveness (e.g. enhanced metastasis, vascularization, reduced responsiveness to chemotherapeutic drugs).
- mice can be implanted with 1 x 10 5 of the same cells ortho topically to determine if STEAP-1 has an effect on local growth in the prostate, and whether STEAP-1 affects the ability of the cells to metastasize, specifically to lymph nodes, and bone (Miki T et al, Oncol Res. 2001;12:209; Fu X et al, Int J Cancer. 1991, 49:938).
- the effect of STEAP on bone tumor formation and growth may be assessed by injecting prostate tumor cells intratibially.
- the assay is also useful to determine the STEAP-1 inhibitory effect of candidate therapeutic compositions, such as for example, STEAP-1 intrabodies, STEAP-1 antisense molecules and ribozymes.
- Example 38 STEAP-1 Monoclonal Antibody-mediated Inhibition of Prostate Tumors In Vivo
- STEAP-1 is a target for T cell-based immuno therapy.
- the therapeutic efficacy of anti-STEAP-1 mAbs in human prostate cancer xenograft mouse models is evaluated by using recombinant cell lines such as PC3-STEAP-1, and 3T3-STEAP-1 (see, e.g., Kaighn, M.E., et al, Invest Urol, 1979. 17(1): 16-23), as well as human prostate xenograft models such as LAPC 9AD (Saffran et al PNAS 1999, 10:1073-1078).
- Antibody efficacy on tumor growth and metastasis formation is studied, e.g., in a mouse orthotopic prostate cancer xenograft models.
- the antibodies can be unconjugated, as discussed in this Example, or can be conjugated to a therapeutic modality, as appreciated in the art.
- Anti-STEAP-1 mAbs inhibit formation of both lung and prostate xenografts.
- Anti-STEAP-1 mAbs also retard the growth of established orthotopic tumors and prolonged survival of tumor-bearing mice. These results indicate the utility of anti-STEAP-1 mAbs in the freatment of local and advanced stages prostate cancer. (See, e.g., Saffran, D., et al., PNAS 10:1073-1078 or world wide web URL pnas.org/cgi/doi/10.1073/pnas.051624698).
- Monoclonal antibodies are raised against STEAP-1 as described in the Example entitled "Generation of STEAP-1 Monoclonal Antibodies (mAbs)."
- the antibodies are characterized by ELISA, Western blot, FACS, and immunoprecipitation for their capacity to bind STEAP-1.
- Epitope mapping data for the anti-STEAP-1 mAbs as determined by ELISA and Western analysis, recognize epitopes on the STEAP-1 protein. Immunohistochemical analysis of prostate cancer tissues and cells with these antibodies is performed.
- the monoclonal antibodies are purified from ascites or hybridoma tissue culture supernatants by Protern-G Sepharose chromatography, dialyzed against PBS, filter sterilized, and stored at -20°C. Protein determinations are performed by a Bradford assay (Bio-Rad, Hercules, CA). A therapeutic monoclonal antibody or a cocktail comprising a mixture of individual monoclonal antibodies is prepared and used for the freatment of mice receiving subcutaneous or orthotopic injections of UM-UC3 and CaLul tumor xenografts.
- PC3 and LNCaP cell line as well as the fibroblast line NIH 3T3 (American Type Culture Collection) are maintained in RPMI and DMEM respectively, supplemented with L- glutamine and 10% FBS.
- PC3-STEAP-land 3T3-STEAP-1 cell populations are generated by retroviral gene fransfer as described in Hubert, R.S., et al., Proc Natl Acad Sci U S A, 1999. 96(25): 14523.
- LAPC-9 xenograft which expresses a wild-type androgen receptor and produces prostate-specific antigen (PSA) is passaged in 6- to 8-week-old male ICR-severe combined immunodeficient (SCID) mice (Taconic Farms) by s.c. trocar implant (Craft, N., et al., Nat Med. 1999, 5:280). Single-cell suspensions of LAPC-9 tumor cells are prepared as described in Craft, et al.
- Subcutaneous (s.c.) tumors are generated by injection of 1 x 10 6 cancer cells mixed at a 1:1 dilution with Mafrigel (Collaborative Research) in the right flank of male SCID mice.
- To test antibody efficacy on tumor formation i.e. antibody injections are started on the same day as tumor-cell injections.
- mice are injected with either purified mouse IgG (ICN) or PBS; or a purified monoclonal antibody that recognizes an irrelevant antigen not expressed in human cells.
- ICN purified mouse IgG
- PBS purified monoclonal antibody that recognizes an irrelevant antigen not expressed in human cells.
- no difference is found between mouse IgG or PBS on tumor growth.
- Tumor sizes are determined by caliper measurements, and the tumor volume is calculated as length x width x height. Mice with Subcutaneous tumors greater than 1.5 cm in diameter are sacrificed.
- Orthotopic injections are performed under anesthesia by using ketamine/xylazine.
- an incision is made through the abdomen to expose the prostate and LAPC or PC3 tumor cells (5 x 10 5 ) mixed with Mafrigel are injected into the prostate capsule in a 10- ⁇ l volume.
- LAPC or PC3 tumor cells (5 x 10 5 ) mixed with Mafrigel are injected into the prostate capsule in a 10- ⁇ l volume.
- mice are palpated and blood is collected on a weekly basis to measure PSA levels.
- the mice are segregated into groups for the appropriate treatments, with anti-STEAP-1 or control mAbs being injected i.p.
- the effect of anti-STEAP-1 mAbs on tumor formation is tested by using LNCaP and LAPC9 orthotopic models.
- the orthotopic model which requires injection of tumor cells directly in the mouse prostate, respectively, results in a local tumor growth, development of metastasis in distal sites, deterioration of mouse health, and subsequent death (Saffran, D., et al., PNAS supra).
- the features make the orthotopic model more representative of human disease progression and allowed us to follow the therapeutic effect of mAbs on clinically relevant end points.
- tumor cells are injected into the mouse prostate, and 2 days later, the mice are segregated into two groups and treated with either: a) 200-500 ⁇ g, of anti-STEAP-1 Ab, or b) PBS three times per week for two to five weeks.
- a major advantage of the orthotopic cancer models is the ability to study the development of metastases. Formation of metastasis in mice bearing established orthotopic tumors is studies by IHC analysis on lung sections using an antibody against a tumor-specific cell-surface protein such as anti-CK20 for prostate cancer (Lin S et al, Cancer Detect Prev. 2001 ;25:202).
- xenograft cancer models Another advantage of xenograft cancer models is the ability to study neovascularization and angiogenesis. Tumor growth is partly dependent on new blood vessel development. Although the capillary system and developing blood network is of host origin, the initiation and architecture of the neovasculature is regulated by the xenograft tumor (Davidoff AM et al, Clin Cancer Res. 2001;7:2870; Solesvik O et al affect Eur J Cancer Clin Oncol. 1984, 20:1295). The effect of antibody and small molecule on neovascularization is studied in accordance with procedures known in the art, such as by IHC analysis of tumor tissues and their surrounding microenvironment.
- mice bearing established orthotopic tumors are administered lOOO ⁇ g injections of either anti-STEAP-1 mAb or PBS over a 4-week period. Mice in both groups are allowed to establish a high tumor burden, to ensure a high frequency of metastasis formation in mouse lungs. Mice then are killed and their bladders, livers, bone and lungs are analyzed for the presence of tumor cells by IHC analysis. These studies demonsfrate a broad anti- tumor efficacy of anti-STEAP-1 antibodies on initiation and progression of prostate cancer in xenograft mouse models. Anti-STEAP-1 antibodies inhibit tumor formation of tumors as well as retarding the growth of already established tumors and prolong the survival of treated mice.
- anti-STEAP-1 mAbs demonsfrate a dramatic inhibitory effect on the spread of local prostate tumor to distal sites, even in the presence of a large tumor burden.
- anti-STEAP-1 mAbs are efficacious on major clinically relevant end points (tumor growth), prolongation of survival, and health.
- Example 39 Therapeutic and Diagnostic use of Anti-STEAP-1 Antibodies in Humans.
- Anti-STEAP-1 monoclonal antibodies are safely and effectively used for diagnostic, prophylactic, prognostic and/or therapeutic purposes in humans.
- Western blot and immunohistochemical analysis of cancer tissues and cancer xenografts with anti-STEAP-1 mAb show strong extensive staining in carcinoma but significantly lower or undetectable levels in normal tissues. Detection of STEAP-1 in carcinoma and in metastatic disease demonstrates the usefulness of the mAb as a diagnostic and/or prognostic indicator.
- Anti- STEAP-1 antibodies are therefore used in diagnostic applications such as immunohistochemistry of kidney biopsy specimens to detect cancer from suspect patients.
- anti-STEAP-1 mAb specifically binds to carcinoma cells.
- anti-STEAP-1 antibodies are used in diagnostic whole body imaging applications, such as radioimmunoscintigraphy and radioimmunotherapy, (see, e.g., Potamianos S., et. al. Anticancer Res 20(2A):925- 948 (2000)) for the detection of localized and metastatic cancers that exhibit expression of STEAP-1.
- Shedding or release of an extracellular domain of STEAP-1 into the extracellular milieu such as that seen for alkaline phosphodiesterase B10 (Meerson, N. R., Hepatology 27:563-568 (1998)), allows diagnostic detection of STEAP-1 by anti-STEAP-1 antibodies in serum and/or urine samples from suspect patients.
- Anti-STEAP-1 antibodies that specifically bind STEAP-1 are used in therapeutic applications for the freatment of cancers that express STEAP-1.
- Anti-STEAP-1 antibodies are used as an unconjugated modality and as conjugated form in which the antibodies are attached to one of various therapeutic or imaging modalities well known in the art, such as a prodrugs, enzymes or radioisotopes.
- Example 40 Human Clinical Trials for the Treatment and Diagnosis of Human Carcinomas through use of Human Anti-STEAP-1 Antibodies In vivo
- Antibodies are used in accordance with the present invention which recognize an epitope on STEAP-1, and are used in the treatment of certain tumors such as those listed in Table I. Based upon a number of factors, including STEAP-1 expression levels, tumors such as those listed in Table I are presently preferred indications. In connection with each of these indications, three clinical approaches are successfully pursued. I.) Adjunctive therapy: In adjunctive therapy, patients are treated with anti-STEAP-1 antibodies in combination with a chemotherapeutic or antineoplastic agent and/or radiation therapy. Primary cancer targets, such as those listed in Table I, are treated under standard protocols by the addition anti-STEAP-1 antibodies to standard first and second line therapy.
- Protocol designs address effectiveness as assessed by reduction in tumor mass as well as the ability to reduce usual doses of standard chemotherapy. These dosage reductions allow additional and/or prolonged therapy by reducing dose-related toxicity of the chemotherapeutic agent.
- Anti- STEAP-1 antibodies are utilized in several adjunctive clinical trials in combination with the chemotherapeutic or antineoplastic agents adriamycin (advanced prostrate carcinoma), cisplatin (advanced head and neck and lung carcinomas), taxol (breast cancer), and doxorubicin (preclinical).
- Monotherapy In connection with the use of the anti-STEAP-1 antibodies in monotherapy of tumors, the antibodies are administered to patients without a chemotherapeutic or antineoplastic agent.
- monotherapy is conducted clinically in end stage cancer patients with extensive metastatic disease. Patients show some disease stabilization. Trials demonstrate an effect in refractory patients with cancerous tumors.
- Imaging Agent Through binding a radionuclide (e.g., iodine or yttrium (I 131 , Y 90 ) to anti- STEAP-1 antibodies, the radiolabeled antibodies are utilized as a diagnostic and/or imaging agent. In such a role, the labeled antibodies localize to both solid tumors, as well as, metastatic lesions of cells expressing STEAP-1. In connection with the use of the anti-STEAP-1 antibodies as imaging agents, the antibodies are used as an adjunct to surgical treatment of solid tumors, as both a pre-surgical screen as well as a post-operative follow-up to determine what tumor remains and/or returns.
- a radionuclide e.g., iodine or yttrium (I 131 , Y 90 .
- a (' " In)-STEAP-1 antibody is used as an imaging agent in a Phase I human clinical trial in patients having a carcinoma that expresses STEAP- 1 (by analogy see, e.g., Divgi et al. J. Natl Cancer Inst. 83:97-104 (1991)). Patients are followed with standard anterior and posterior gamma camera. The results indicate that primary lesions and metastatic lesions are identified
- anti-STEAP-1 antibodies can be administered with doses in the range of 5 to 400 mg/m 2 , with the lower doses used, e.g., in connection with safety studies.
- the affinity of anti-STEAP-1 antibodies relative to the affinity of a known antibody for its target is one parameter used by those of skill in the art for determining analogous dose regimens.
- anti- STEAP-1 antibodies that are fully human antibodies, as compared to the chimeric antibody have slower clearance; accordingly, dosing in patients with such fully human anti-STEAP-1 antibodies can be lower, perhaps in the range of 50 to 300 mg/m 2 , and still remain efficacious.
- Dosing in mg/m 2 is a measurement based on surface area and is a convenient dosing measurement that is designed to include patients of all sizes from infants to adults.
- safety concerns are related primarily to (1) cytokine release syndrome, 1 e , hypotension, fever, shaking, chills, (n) the development of an immunogemc response to the material (1 e , development of human antibodies by the patient to the antibody therapeutic, or EIAHA response), and, (m) toxicity to normal cells that express STEAP-1 Standard tests and follow-up are utilized to monitor each of these safety concerns
- Anti-STEAP-1 antibodies are found to be safe upon human admmisfration
- a phase I human chmcal trial is initiated to assess the safety of six intravenous doses of a human anti- STEAP- 1 antibody m connection with the freatment of a solid tumor, e g , a cancer of a tissue listed m Table I
- the safety of single doses of anti-STEAP-1 antibodies when utilized as an adjunctive therapy to an antineoplastic or chemotherapeutic agent as defined herein is assessed
- the trial design includes delivery of six single doses of an anti-STEAP-1 antibody with dosage of antibody escalatmg from approximately about 25 mg/m 2 to about 275 mg/m 2 over the course of the treatment m accordance with the following schedule
- patients are closely followed for one-week following each administration of antibody and chemotherapy
- patients are assessed for the safety concerns mentioned above (l) cytokine release syndrome, l e , hypotension, fever, shaking, chills, (u) the development of an immunogemc response to the material (l e , development of human antibodies by the patient to the human antibody therapeutic, or HAHA response), and, (in) toxicity to normal cells that express STEAP-1 Standard tests and follow-up are utilized to monitor each of these safety concerns
- Patients are also assessed for clinical outcome, and particularly reduction in tumor mass as evidenced by MRI or otiier imagmg
- the anti-STEAP-1 antibodies are demonstrated to be safe and efficacious, Phase II frials confirm the efficacy and refine optimum dosmg
- Anti-STEAP-1 antibodies are safe m connection with the above-discussed adjunctive t ⁇ al, a Phase II human chmcal t ⁇ al confirms the efficacy and optimum dosmg for monotherapy Such trial is accomplished, and entails the same safety and outcome analyses, to the above-described adjunctive frial with the exception being that patients do not receive chemotherapy concurrently with the receipt of doses of anti-STEAP-1 antibodies.
- the human STEAP protein does not exhibit a high degree of homology to any known human proteins.
- the prototype member of the STEAP family, STEAP-lv.l is a type Ilia membrane protein consisting of 339 amino acids.
- STEAP-1 is a six transmembrane domain protein, with intracellular N- and C- termini.
- the STEAP-1 gene is somewhat homologous to a previously cloned gene, namely mouse TNFa- induced adipose-related protein (gi
- STEAP-lv.l shares 40% identities and 63% homology with TIARP.
- STEAP-1 shows homology to rat pHyde protein, with 49% identity and 71% homology to that protein.
- the TIARP protein is a 6 transmembrane protein of unknown function which localizes to the cell surface (Moldes M et al, J. Biol. Chem 2001, 276:33938).
- Rat pHyde is a protein expressed in Dunning rats prostate cancer lines.
- STEAP1 shows significant homology to mouse six transmembrane epithelial antigen of the prostate (gi 20820492).
- the motifs can participate in tumor growth and progression by enhancing the initial stages of tumorigenesis, such as tumor take or establishment of a tumor, by allowing adhesion to basement membranes and surrounding cells, by mediating cell communication and transport of ions.
- STEAP-1 when STEAP-1 functions as a regulator of tumor establishment, tumor formation, tumor growth, cell signaling or as a modulator of transcription involved in activating genes associated with survival, invasion, tumorigenesis or proliferation, STEAP-1 is used for therapeutic, diagnostic, prognostic and/or preventative purposes.
- a molecule, such as a variant or SNP of STEAP-1 when expressed in cancerous tissues, such as those listed in Table I, they are used for therapeutic, diagnostic, prognostic and/or preventative purposes.
- RNA from parental and STEAP-1 -expressing cells are extracted and hybridized to commercially available gene arrays (Clontech) (Smid-Koopman E et al. Br J Cancer. 2000. 83:246). Resting cells as well as cells treated with FBS, androgen or growth factors are compared. Differentially expressed genes are identified in accordance with procedures known in the art. The differentially expressed genes are then mapped to biological pathways (Chen K et al. Thyroid. 2001. 11:41.).
- luciferase reporter constructs including: NFkB-luc, SRE-luc, ELKl-luc, ARE-luc, p53-luc, and CRE-luc. These transcriptional reporters contain consensus binding sites for known franscription factors that lie downstream of well-characterized signal transduction pathways, and represent a good tool to ascertain pathway activation and screen for positive and negative modulators of pathway activation.
- STEAP-1 plays a role in gene regulation, and it is used as a target for diagnostic, prognostic, preventative and/or therapeutic purposes.
- STEAP-1 phospholipid pathways such as PI3K, AKT, etc, adhesion and migration pathways, including FAK, Rho, Rac-1, ⁇ -catenin, etc, as well as mitogenic/survival cascades such as ERK, p38, etc (Cell Growth Differ. 2000,11:279; J Biol Chem. 1999, 274:801; Oncogene. 2000, 19:3003, 1 Cell Biol. 1997, 138:913.). ).
- PC3 cells stably expressing STEAP-1 neo were grown overnight in either 1% or 10% FBS.
- Whole cell lysates were analyzed by western blotting.
- the results show that while expression of the control neo gene has no effect on p38 phosphorylation, expression of STEAP-1 in PC3 cells is sufficient to induce the activation of the p38 pathway ( Figure 21 A).
- the results were verified using western blotting with an anti-p38 Ab, which shows equal protein loading on the gels ( Figure 2 IB).
- FBS contains several components that may contribute to receptor-mediated ERK activation
- PC3 cells expressing neo or STEAP-1 were grown in either 0.1 % or 10% FBS overnight. The cells were analyzed by anti-Phospho-ERK western blotting. This experiment shows that STEAP-1 induces the phosphorylation of ERK in 0.1% FBS, and confirms that expression of STEAP-1 is sufficient to induce activation of the ERK signaling cascade in the absence of additional stimuli.
- luciferase (luc) based transcriptional reporter assays are carried out in cells expressing individual genes. These transcriptional reporters contain consensus-binding sites for known franscription factors that lie downstream of well-characterized signal transduction pathways. The reporters and examples of these associated transcription factors, signal transduction pathways, and activation stimuli are listed below.
- NFkB-luc NFkB/Rel
- Ik-kinase SAPK
- Luciferase reporter plasmids can be infroduced by lipid-mediated transfection (TFX-50, Promega). Luciferase activity, an indicator of relative transcriptional activity, is measured by incubation of cell extracts with luciferin substrate and luminescence of the reaction is monitored in a luminometer.
- STEAP-1 Signaling pathways activated by STEAP-1 are mapped and used for the identification and validation of therapeutic targets. When STEAP-1 is involved in cell signaling, it is used as target for diagnostic, prognostic, preventative and/or therapeutic purposes.
- the STEAP-1 gene can contribute to the growth and transformation of cancer cells.
- the role of STEAP-1 in tumor growth is confirmed in a variety of primary and fransfected cell lines including prostate cell lines, as well as NIH 3T3 cells engineered to stably express STEAP-1.
- Parental cells lacking STEAP-1 and cells expressing STEAP-1 are evaluated for cell growth using a well-documented proliferation assay (Fraser SP, Grimes JA, Djamgoz MB. Prostate. 2000;44:61, Johnson DE, Ochieng J, Evans SL. Anticancer Drugs. 1996, 7:288).
- STEAP-1 To confirm the role of STEAP-1 in the transformation process, its effect in colony forming assays is investigated.
- Parental NIH-3T3 cells lacking STEAP-1 are compared to NIH-3T3 cells expressing STEAP-1, using a soft agar assay under stringent and more permissive conditions (Song Z. et al. Cancer Res. 2000;60:6730).
- a well-established assay is used, e.g., a Transwell Insert System assay (Becton Dickinson) (Cancer Res. 1999; 59:6010).
- Confrol cells, including prostate, breast and kidney cell lines lacking STEAP-1 are compared to cells expressing STEAP-1.
- Cells are loaded with the fluorescent dye, calcein, and plated in the top well of the Transwell insert coated with a basement membrane analog. Invasion is determined by fluorescence of cells in the lower chamber relative to the fluorescence of the entire cell population.
- STEAP-1 can also play a role in cell cycle and apoptosis.
- Parental cells and cells expressing STEAP-1 are compared for differences in cell cycle regulation using a well-established BrdU assay (Abdel-Malek ZA. J Cell Physiol. 1988, 136:247).
- BrdU BrdU assay
- cells are grown under both optimal (full serum) and limiting (low serum) conditions are labeled with BrdU and stained with anti-BrdU Ab and propidium iodide.
- Cells are analyzed for entry into the Gl, S, and G2M phases of the cell cycle.
- the effect of stress on apoptosis is evaluated in confrol parental cells and cells expressing STEAP-1, including normal and tumor prostate cells.
- Engineered and parental cells are freated with various chemotherapeutic agents, such as etoposide, taxol, etc, and protein synthesis inhibitors, such as cycloheximide.
- Cells are stained with annexin V-FITC and cell death is measured by FACS analysis. The modulation of cell death by STEAP-1 can play a critical role in regulating tumor progression and tumor load.
- STEAP-1 plays a role in cell growth, transformation, invasion or apoptosis, it is used as a target for diagnostic, prognostic, preventative and/or therapeutic purposes.
- STEAP-1 plays a role in angiogenesis (DeFouw L et al, Microvasc Res 2001, 62:263).
- assays have been developed to measure angiogenesis in vitro and in vivo, such as the tissue culture assays endothelial cell tube formation and endothelial cell proliferation. Using these assays as well as in vitro neo-vascularization, the role of STEAP-1 in angiogenesis, enhancement or inhibition, is confirmed.
- endothelial cells engineered to express STEAP-1 are evaluated using tube formation and proliferation assays.
- the effect of STEAP-1 is also confirmed in animal models in vivo.
- cells either expressing or lacking STEAP-1 are implanted subcutaneously in immunocompromised mice.
- Endothelial cell migration and angiogenesis are evaluated 5-15 days later using immunohistochemisfry techniques.
- STEAP - 1 affects angiogenesis, and it is used as a target for diagnostic, prognostic, preventative and/or therapeutic purposes
- Fibronectin motifs have been shown to mediate interaction with other proteins, including cell surface protein. Using immunoprecipitation techniques as well as two yeast hybrid systems, protems are identified that associate with STEAP-1. Immunoprecipitates from cells expressing STEAP-1 and cells lacking STEAP-1 are compared for specific protein-protein associations.
- Protein-protein interaction is detected by colorimefric reporter activity. Specific association with effector molecules and franscription factors directs one of skill to the mode of action of STEAP-1, and thus identifies therapeutic, prognostic, preventative and/or diagnostic targets for cancer. This and similar assays are also used to identify and screen for small molecules that interact with STEAP-1.
- STEAP-1 associates with proteins and small molecules. Accordingly, STEAP-1 and these proteins and small molecules are used for diagnostic, prognostic, preventative and/or therapeutic purposes.
- Example 50 Involvement of STEAP-1 in small molecule transport and cell-cell communication.
- Cell-cell communication is essential in maintaining organ integrity and homeostasis, both of which become deregulated during tumor formation and progression. Intercellular communications can be measured using two types of assays (J. Biol. Chem. 2000, 275:25207).
- first assay cells loaded with a fluorescent dye are incubated in the presence of unlabeled recipient cells and the cell populations are examined under fluorescent microscopy. This qualitative assay measures the exchange of dye between adjacent cells.
- second assay system donor and recipient cell populations are freated as above and quantitative measurements of the recipient cell population are performed by FACS analysis. Using these two assay systems, cells expressing STEAP-1 are compared to controls that do not express STEAP-1, and it is found that STEAP-1 enhances cell communications.
- Figure 19 and Figure 20 demonstrate that STEAP-1 mediates the transfer of the small molecule calcein between adjacent cells, and thereby regulates cell-cell communication in prostate cancer cells.
- recipient PC3 cells were labeled with dexfran-Texas Red and donor PC3 cells were labeled with calcein AM (green).
- the donor (green) and recipient (red) cells were co-cultured at 37°C and analyzed by microscopy for the co-localization of Texas red and calcein.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Endocrinology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Oncology (AREA)
- Optics & Photonics (AREA)
- Biotechnology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2003527060A JP2005505271A (ja) | 2001-09-06 | 2002-09-06 | 癌の処置および検出において有用なsteap−1と名称が与えられる核酸および対応するタンパク質 |
| ES02773295.7T ES2537074T3 (es) | 2001-09-06 | 2002-09-06 | Ácido nucleico y proteína correspondiente denominados STEAP-1 útiles en el tratamiento y la detección de cáncer |
| EP02773295.7A EP1429793B1 (en) | 2001-09-06 | 2002-09-06 | Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer |
| CA2459318A CA2459318C (en) | 2001-09-06 | 2002-09-06 | Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer |
| AU2002336446A AU2002336446B2 (en) | 2001-09-06 | 2002-09-06 | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US31784001P | 2001-09-06 | 2001-09-06 | |
| US60/317,840 | 2001-09-06 | ||
| US37038702P | 2002-04-05 | 2002-04-05 | |
| US60/370,387 | 2002-04-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003022995A2 true WO2003022995A2 (en) | 2003-03-20 |
| WO2003022995A3 WO2003022995A3 (en) | 2003-08-14 |
Family
ID=26981182
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/028371 Ceased WO2003022995A2 (en) | 2001-09-06 | 2002-09-06 | Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US20060073150A1 (cg-RX-API-DMAC7.html) |
| EP (2) | EP2287186B1 (cg-RX-API-DMAC7.html) |
| JP (3) | JP2005505271A (cg-RX-API-DMAC7.html) |
| AU (2) | AU2002336446B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2459318C (cg-RX-API-DMAC7.html) |
| ES (2) | ES2532757T3 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2003022995A2 (cg-RX-API-DMAC7.html) |
Cited By (94)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005117986A3 (en) * | 2004-06-01 | 2006-06-15 | Genentech Inc | Antibody drug conjugates and methods |
| EP1569514A4 (en) * | 2002-08-16 | 2007-10-31 | SPECIFIC ANTIGEN OF TUMORS, PEPTIDES ASSOCIATED THERETO AND USE THEREOF AS IMMUNOMINAL VACCINES | |
| EP1742966A4 (en) * | 2004-04-22 | 2008-04-02 | Agensys Inc | ANTIBODIES AND DERIVED MOLECULES THAT BIND TO STEAP-1 PROTEINS |
| US7455991B2 (en) | 1999-06-01 | 2008-11-25 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7494646B2 (en) | 2001-09-06 | 2009-02-24 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| US7575749B2 (en) | 1998-06-01 | 2009-08-18 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7622569B2 (en) | 1998-06-01 | 2009-11-24 | Agensys, Inc. | Nucleic acid and corresponding protein entitled 98P4B6 useful in treatment and detection of cancer |
| JP2010220621A (ja) | 2002-09-06 | 2010-10-07 | Agensys Inc | 癌の処置および検出において有用な98p4b6と称される、核酸および対応タンパク質 |
| EP2260858A2 (en) | 2003-11-06 | 2010-12-15 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US7884179B2 (en) | 2001-09-06 | 2011-02-08 | Agensys, Inc. | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer |
| WO2011031870A1 (en) | 2009-09-09 | 2011-03-17 | Centrose, Llc | Extracellular targeted drug conjugates |
| WO2011056983A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Zirconium-radiolabeled, cysteine engineered antibody conjugates |
| US7947459B2 (en) | 1998-06-01 | 2011-05-24 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US8012937B2 (en) | 1998-06-01 | 2011-09-06 | Agensys, Inc. | Nucleic acid and corresponding protein entitled 98P4B6 useful in treatment and detection of cancer |
| WO2011130598A1 (en) | 2010-04-15 | 2011-10-20 | Spirogen Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2011156328A1 (en) | 2010-06-08 | 2011-12-15 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| US8188050B2 (en) * | 2006-10-26 | 2012-05-29 | Isp Investments Inc. | Pharmaceutical and/or cosmetic composition containing peptides |
| WO2012074757A1 (en) | 2010-11-17 | 2012-06-07 | Genentech, Inc. | Alaninyl maytansinol antibody conjugates |
| WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
| US8436147B2 (en) | 2006-10-27 | 2013-05-07 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
| WO2013130093A1 (en) | 2012-03-02 | 2013-09-06 | Genentech, Inc. | Biomarkers for treatment with anti-tubulin chemotherapeutic compounds |
| WO2014057074A1 (en) | 2012-10-12 | 2014-04-17 | Spirogen Sàrl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014140862A2 (en) | 2013-03-13 | 2014-09-18 | Spirogen Sarl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014140174A1 (en) | 2013-03-13 | 2014-09-18 | Spirogen Sàrl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014159981A2 (en) | 2013-03-13 | 2014-10-02 | Spirogen Sarl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2015023355A1 (en) | 2013-08-12 | 2015-02-19 | Genentech, Inc. | 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment |
| WO2015095223A2 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | Peptidomimetic compounds and antibody-drug conjugates thereof |
| WO2015095212A1 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment |
| WO2015095227A2 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | Peptidomimetic compounds and antibody-drug conjugates thereof |
| WO2016040825A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anthracycline disulfide intermediates, antibody-drug conjugates and methods |
| WO2016037644A1 (en) | 2014-09-10 | 2016-03-17 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| WO2016090050A1 (en) | 2014-12-03 | 2016-06-09 | Genentech, Inc. | Quaternary amine compounds and antibody-drug conjugates thereof |
| EP3088004A1 (en) | 2004-09-23 | 2016-11-02 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
| WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
| WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
| WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
| EP3235820A1 (en) | 2014-09-17 | 2017-10-25 | Genentech, Inc. | Pyrrolobenzodiazepines and antibody disulfide conjugates thereof |
| WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
| WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
| WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
| WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
| US9919056B2 (en) | 2012-10-12 | 2018-03-20 | Adc Therapeutics S.A. | Pyrrolobenzodiazepine-anti-CD22 antibody conjugates |
| US9931414B2 (en) | 2012-10-12 | 2018-04-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US9931415B2 (en) | 2012-10-12 | 2018-04-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
| US9950078B2 (en) | 2013-10-11 | 2018-04-24 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US9956299B2 (en) | 2013-10-11 | 2018-05-01 | Medimmune Limited | Pyrrolobenzodiazepine—antibody conjugates |
| US10010624B2 (en) | 2013-10-11 | 2018-07-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US10029018B2 (en) | 2013-10-11 | 2018-07-24 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10071158B2 (en) | 2005-04-26 | 2018-09-11 | Lindis Biotech Gmbh | Combination of the application of antibodies for immunostimulation together with glucocorticoids |
| WO2019060398A1 (en) | 2017-09-20 | 2019-03-28 | Ph Pharma Co., Ltd. | ANALOGUES OF THAILANSTATINE |
| US10392393B2 (en) | 2016-01-26 | 2019-08-27 | Medimmune Limited | Pyrrolobenzodiazepines |
| US10420777B2 (en) | 2014-09-12 | 2019-09-24 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10494432B2 (en) | 2007-07-16 | 2019-12-03 | Genentech, Inc. | Anti-CD79B antibodies and immunoconjugates and methods of use |
| US10544218B2 (en) | 2008-01-31 | 2020-01-28 | Genentech, Inc. | Anti-CD79B antibodies and immunoconjugates and methods of use |
| US10544223B2 (en) | 2017-04-20 | 2020-01-28 | Adc Therapeutics Sa | Combination therapy with an anti-axl antibody-drug conjugate |
| US10543279B2 (en) | 2016-04-29 | 2020-01-28 | Medimmune Limited | Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer |
| WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
| WO2020086858A1 (en) | 2018-10-24 | 2020-04-30 | Genentech, Inc. | Conjugated chemical inducers of degradation and methods of use |
| WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
| US10695439B2 (en) | 2016-02-10 | 2020-06-30 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US10695433B2 (en) | 2012-10-12 | 2020-06-30 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
| US10736903B2 (en) | 2012-10-12 | 2020-08-11 | Medimmune Limited | Pyrrolobenzodiazepine-anti-PSMA antibody conjugates |
| US10751346B2 (en) | 2012-10-12 | 2020-08-25 | Medimmune Limited | Pyrrolobenzodiazepine—anti-PSMA antibody conjugates |
| US10780096B2 (en) | 2014-11-25 | 2020-09-22 | Adc Therapeutics Sa | Pyrrolobenzodiazepine-antibody conjugates |
| US10799595B2 (en) | 2016-10-14 | 2020-10-13 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US10981987B2 (en) | 2007-07-16 | 2021-04-20 | Genentech, Inc. | Humanized anti-CD79b antibodies and immunoconjugates and methods of use |
| US11000510B2 (en) | 2014-09-23 | 2021-05-11 | Genentech, Inc. | Methods of using anti-CD79b immunoconjugates |
| US11045535B2 (en) | 2010-11-12 | 2021-06-29 | The Trustees Of The University Of Pennsylvania | Consensus prostate antigens, nucleic acid molecule encoding the same and vaccine and uses comprising the same |
| US11059893B2 (en) | 2015-04-15 | 2021-07-13 | Bergenbio Asa | Humanized anti-AXL antibodies |
| US11135303B2 (en) | 2011-10-14 | 2021-10-05 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US11160872B2 (en) | 2017-02-08 | 2021-11-02 | Adc Therapeutics Sa | Pyrrolobenzodiazepine-antibody conjugates |
| US11180571B2 (en) | 2017-04-03 | 2021-11-23 | Hoffmann-La Roche Inc. | Antibodies binding to STEAP-1 |
| WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
| US11318211B2 (en) | 2017-06-14 | 2022-05-03 | Adc Therapeutics Sa | Dosage regimes for the administration of an anti-CD19 ADC |
| US11352324B2 (en) | 2018-03-01 | 2022-06-07 | Medimmune Limited | Methods |
| US11370801B2 (en) | 2017-04-18 | 2022-06-28 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US11517626B2 (en) | 2016-02-10 | 2022-12-06 | Medimmune Limited | Pyrrolobenzodiazepine antibody conjugates |
| US11524969B2 (en) | 2018-04-12 | 2022-12-13 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof as antitumour agents |
| US11530274B2 (en) | 2018-07-02 | 2022-12-20 | Amgen Inc. | Anti-STEAP1 antigen-binding protein |
| US11612665B2 (en) | 2017-02-08 | 2023-03-28 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| WO2023078273A1 (en) | 2021-11-03 | 2023-05-11 | Hangzhou Dac Biotech Co., Ltd. | Specific conjugation for an antibody-drug conjugate |
| US11649250B2 (en) | 2017-08-18 | 2023-05-16 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US11702473B2 (en) | 2015-04-15 | 2023-07-18 | Medimmune Limited | Site-specific antibody-drug conjugates |
| WO2023147328A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof |
| WO2023147329A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation and methods thereof |
| WO2024138128A2 (en) | 2022-12-23 | 2024-06-27 | Genentech, Inc. | Cereblon degrader conjugates, and uses thereof |
| WO2024220546A2 (en) | 2023-04-17 | 2024-10-24 | Peak Bio, Inc. | Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates |
| US12209099B2 (en) | 2019-03-15 | 2025-01-28 | Medimmune Limited | Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer |
| WO2026006689A2 (en) | 2024-06-28 | 2026-01-02 | Firefly Bio, Inc. | Bcl-xl degrader antibody conjugates and uses thereof |
| WO2026006688A2 (en) | 2024-06-28 | 2026-01-02 | Firefly Bio, Inc. | Degrader antibody conjugates and uses thereof |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6136311A (en) | 1996-05-06 | 2000-10-24 | Cornell Research Foundation, Inc. | Treatment and diagnosis of cancer |
| CA2646329C (en) | 2006-03-20 | 2018-07-03 | The Regents Of The University Of California | Engineered anti-prostate stem cell antigen (psca) antibodies for cancer targeting |
| JP2008289380A (ja) * | 2007-05-22 | 2008-12-04 | Sapporo Medical Univ | 新規癌抗原ペプチドおよびその利用 |
| WO2009032949A2 (en) | 2007-09-04 | 2009-03-12 | The Regents Of The University Of California | High affinity anti-prostate stem cell antigen (psca) antibodies for cancer targeting and detection |
| CA2700410C (en) * | 2007-10-03 | 2020-10-06 | Cornell University | Treatment of proliferative disorders using antibodies to psma |
| US20100069616A1 (en) * | 2008-08-06 | 2010-03-18 | The Regents Of The University Of California | Engineered antibody-nanoparticle conjugates |
| ES2712732T3 (es) * | 2009-02-17 | 2019-05-14 | Cornell Res Foundation Inc | Métodos y kits para el diagnóstico de cáncer y la predicción de valor terapéutico |
| AU2010325969B2 (en) | 2009-12-02 | 2016-10-20 | Imaginab, Inc. | J591 minibodies and cys-diabodies for targeting human prostate specific membrane antigen |
| EP2569633B1 (en) * | 2010-05-14 | 2016-02-10 | The General Hospital Corporation | Compositions and methods of identifying tumor specific neoantigens |
| WO2012141201A1 (ja) * | 2011-04-11 | 2012-10-18 | 公立大学法人大阪市立大学 | 癌免疫療法のためのペプチド及びその利用 |
| CN110627797A (zh) | 2012-12-21 | 2019-12-31 | 麦迪穆有限责任公司 | 用于治疗增殖性和自身免疫疾病的非对称吡咯并苯并二氮杂卓二聚物 |
| CN105189507A (zh) | 2012-12-21 | 2015-12-23 | 斯皮罗根有限公司 | 吡咯并苯并二氮杂卓及其结合物 |
| WO2015077717A1 (en) | 2013-11-25 | 2015-05-28 | The Broad Institute Inc. | Compositions and methods for diagnosing, evaluating and treating cancer by means of the dna methylation status |
| WO2015085147A1 (en) | 2013-12-05 | 2015-06-11 | The Broad Institute Inc. | Polymorphic gene typing and somatic change detection using sequencing data |
| KR20230076867A (ko) | 2013-12-20 | 2023-05-31 | 더 브로드 인스티튜트, 인코퍼레이티드 | 신생항원 백신과의 병용 요법 |
| US10975442B2 (en) | 2014-12-19 | 2021-04-13 | Massachusetts Institute Of Technology | Molecular biomarkers for cancer immunotherapy |
| EP3234130B1 (en) | 2014-12-19 | 2020-11-25 | The Broad Institute, Inc. | Methods for profiling the t-cell- receptor repertoire |
| IL294183B2 (en) | 2015-05-20 | 2023-10-01 | Dana Farber Cancer Inst Inc | shared neoantigens |
| US11254744B2 (en) | 2015-08-07 | 2022-02-22 | Imaginab, Inc. | Antigen binding constructs to target molecules |
| MY199468A (en) * | 2016-09-23 | 2023-10-31 | Regeneron Pharma | Anti-steap2 antibodies, antibody-drug conjugates, and bispecific antigen-binding molecules that bind steap2 and cd3, and uses thereof |
| US11549149B2 (en) | 2017-01-24 | 2023-01-10 | The Broad Institute, Inc. | Compositions and methods for detecting a mutant variant of a polynucleotide |
| US11266745B2 (en) | 2017-02-08 | 2022-03-08 | Imaginab, Inc. | Extension sequences for diabodies |
| US10659173B1 (en) | 2019-07-18 | 2020-05-19 | Amazing Microelectronic Corp. | Digital isolator module for high level common mode transient immunity |
| CN118812648A (zh) * | 2024-07-28 | 2024-10-22 | 青岛大学附属医院 | 一种基于steap-1的t细胞抗原表位肽及其用途 |
Family Cites Families (96)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| JPS6023084B2 (ja) | 1979-07-11 | 1985-06-05 | 味の素株式会社 | 代用血液 |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4722848A (en) | 1982-12-08 | 1988-02-02 | Health Research, Incorporated | Method for immunizing animals with synthetically modified vaccinia virus |
| US4870009A (en) | 1982-11-22 | 1989-09-26 | The Salk Institute For Biological Studies | Method of obtaining gene product through the generation of transgenic animals |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US4736866B1 (en) | 1984-06-22 | 1988-04-12 | Transgenic non-human mammals | |
| US5019369A (en) | 1984-10-22 | 1991-05-28 | Vestar, Inc. | Method of targeting tumors in humans |
| EP0206448B1 (en) | 1985-06-19 | 1990-11-14 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| GB8724885D0 (en) | 1987-10-23 | 1987-11-25 | Binns M M | Fowlpox virus promotors |
| US5225538A (en) | 1989-02-23 | 1993-07-06 | Genentech, Inc. | Lymphocyte homing receptor/immunoglobulin fusion proteins |
| US5703055A (en) | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| US6020145A (en) | 1989-06-30 | 2000-02-01 | Bristol-Myers Squibb Company | Methods for determining the presence of carcinoma using the antigen binding region of monoclonal antibody BR96 |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| EP0452457B1 (en) | 1989-11-03 | 1997-08-20 | Vanderbilt University | Method of in vivo delivery of functioning foreign genes |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| DE69120146T2 (de) | 1990-01-12 | 1996-12-12 | Cell Genesys Inc | Erzeugung xenogener antikörper |
| US6673986B1 (en) | 1990-01-12 | 2004-01-06 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US5279833A (en) | 1990-04-04 | 1994-01-18 | Yale University | Liposomal transfection of nucleic acids into animal cells |
| US5204253A (en) | 1990-05-29 | 1993-04-20 | E. I. Du Pont De Nemours And Company | Method and apparatus for introducing biological substances into living cells |
| US5723286A (en) | 1990-06-20 | 1998-03-03 | Affymax Technologies N.V. | Peptide library and screening systems |
| DK0489149T3 (da) | 1990-06-27 | 2001-12-27 | Univ Princeton | Prober til påvisning af mutant P53 |
| SE9002480D0 (sv) | 1990-07-23 | 1990-07-23 | Hans Lilja | Assay of free and complexed prostate-specific antigen |
| US5733731A (en) | 1991-10-16 | 1998-03-31 | Affymax Technologies N.V. | Peptide library and screening method |
| EP0646178A1 (en) | 1992-06-04 | 1995-04-05 | The Regents Of The University Of California | expression cassette with regularoty regions functional in the mammmlian host |
| WO1994003205A1 (en) | 1992-08-07 | 1994-02-17 | Cytel Corporation | Hla binding peptides and their uses |
| US5489525A (en) | 1992-10-08 | 1996-02-06 | The United States Of America As Represented By The Department Of Health And Human Services | Monoclonal antibodies to prostate cells |
| BR9406652A (pt) | 1993-03-05 | 1996-09-10 | Cytel Corp | Composição |
| US5837501A (en) | 1993-07-09 | 1998-11-17 | Akzo Nobel N.V. | Nucleic acid quantitation by co-amplification of target with multiple internal controls |
| US5679647A (en) | 1993-08-26 | 1997-10-21 | The Regents Of The University Of California | Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides |
| US5804566A (en) | 1993-08-26 | 1998-09-08 | The Regents Of The University Of California | Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides |
| DE69435171D1 (de) | 1993-09-14 | 2009-01-08 | Pharmexa Inc | Pan dr-bindeproteinen zur erhöhung der immunantwort |
| EP0679716A4 (en) | 1993-11-12 | 1999-06-09 | Kenichi Matsubara | GENE SIGNATURE. |
| CH686982A5 (fr) | 1993-12-16 | 1996-08-15 | Maurice Stroun | Méthode pour le diagnostic de cancers. |
| US5739118A (en) | 1994-04-01 | 1998-04-14 | Apollon, Inc. | Compositions and methods for delivery of genetic material |
| DE69532127T2 (de) | 1994-07-20 | 2004-08-26 | Genetics Institute, Inc., Cambridge | Interaktions-fullensysteme zum nachweis von protein-interaktionen |
| US5919652A (en) | 1994-11-09 | 1999-07-06 | The Regents Of The University Of California | Nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof |
| US5736524A (en) | 1994-11-14 | 1998-04-07 | Merck & Co.,. Inc. | Polynucleotide tuberculosis vaccine |
| US5962428A (en) | 1995-03-30 | 1999-10-05 | Apollon, Inc. | Compositions and methods for delivery of genetic material |
| NZ306767A (en) | 1995-04-11 | 2000-03-27 | Univ Johns Hopkins | Method of identifying molecular interactions employing counterselection and at least two hybrid molecules or two hybrid systems |
| US5922687A (en) | 1995-05-04 | 1999-07-13 | Board Of Trustees Of The Leland Stanford Junior University | Intracellular delivery of nucleic acids using pressure |
| CU22559A1 (es) | 1996-01-17 | 1999-05-03 | Ct Ingenieria Genetica Biotech | Sistema de expresión de antígenos heterologos en e. coli como proteínas de fusión |
| CN1225590A (zh) | 1996-03-11 | 1999-08-11 | 埃皮曼尼公司 | 对hla分子结合亲和力提高的肽 |
| CA2252886C (en) | 1996-04-26 | 2008-02-12 | Massachusetts Institute Of Technology | Three-hybrid screening assay |
| US5859045A (en) * | 1996-05-08 | 1999-01-12 | Novo Nordisk A/S Novo Alle | Crystalline -! 3R 4R-trans-7 methoxy 2,2-dimethyl1-3-phenyl 1-4 4-12 pyrrolidin-1 -Y1!ethoxyl 1!chromane hydrogen fumarate |
| JP2000516090A (ja) | 1996-07-26 | 2000-12-05 | スローン―ケッタリング インスティチュート フォー キャンサー リサーチ | 遺伝子的免疫化のための方法と試薬 |
| US5925523A (en) | 1996-08-23 | 1999-07-20 | President & Fellows Of Harvard College | Intraction trap assay, reagents and uses thereof |
| US5824504A (en) | 1996-09-26 | 1998-10-20 | Elshourbagy; Nabil A. | Human 7-transmembrane receptor and DNA |
| JP2001502537A (ja) | 1996-10-15 | 2001-02-27 | ザ・リージェンツ・オブ・ザ・ユニバーシティ・オブ・カリフォルニア | ヒト前立腺ガンの進行の動物モデル |
| US5846722A (en) | 1996-10-16 | 1998-12-08 | Terrapin Technologies, Inc. | System to detect small molecule/peptide interaction |
| US5840501A (en) | 1996-10-25 | 1998-11-24 | Bayer Corporation | Determination of cPSA |
| WO1998018489A1 (en) | 1996-10-30 | 1998-05-07 | The Uab Research Foundation | Enhancement of tumor cell chemosensitivity and radiosensitivity using single chain intracellular antibodies |
| CA2722378C (en) | 1996-12-03 | 2015-02-03 | Amgen Fremont Inc. | Human antibodies that bind tnf.alpha. |
| US6800746B2 (en) * | 1997-02-25 | 2004-10-05 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
| CA2281954A1 (en) | 1997-02-25 | 1998-08-27 | Corixa Corporation | Compounds for immunodiagnosis of prostate cancer and methods for their use |
| PL196260B1 (pl) | 1997-02-25 | 2007-12-31 | Corixa Corp | Polipeptyd, cząsteczka DNA, komórka gospodarza, białko fuzyjne, kompozycje farmaceutyczne i szczepionki do leczenia raka prostaty |
| WO1998053071A1 (en) | 1997-05-23 | 1998-11-26 | Biogen, Inc. | Modulators of tissue regeneration |
| WO1999006548A2 (en) | 1997-08-01 | 1999-02-11 | Genset | 5'ESTs FOR NON TISSUE SPECIFIC SECRETED PROTEINS |
| JP2001512013A (ja) | 1997-08-01 | 2001-08-21 | ジェンセット | 前立腺に発現される分泌タンパク質の5’est |
| JPH11164691A (ja) | 1997-10-03 | 1999-06-22 | Rikagaku Kenkyusho | 胚盤胞cDNA |
| US20030060612A1 (en) * | 1997-10-28 | 2003-03-27 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| US6048970A (en) * | 1998-05-22 | 2000-04-11 | Incyte Pharmaceuticals, Inc. | Prostate growth-associated membrane proteins |
| US20030064397A1 (en) * | 1998-05-22 | 2003-04-03 | Incyte Genomics, Inc. | Transmembrane protein differentially expressed in prostate and lung tumors |
| EP1086223B1 (en) * | 1998-06-01 | 2009-07-29 | Agensys, Inc. | Novel serpentine transmembrane antigens expressed in human cancers and uses thereof |
| HUP0203035A3 (en) | 1998-07-14 | 2007-12-28 | Corixa Corp | Compositions and methods for therapy and diagnosis of prostate cancer |
| AU3124000A (en) | 1998-12-17 | 2000-07-03 | Human Genome Sciences, Inc. | 47 human secreted proteins |
| US6342219B1 (en) * | 1999-04-28 | 2002-01-29 | Board Of Regents, The University Of Texas System | Antibody compositions for selectively inhibiting VEGF |
| EP1189917A4 (en) | 1999-06-11 | 2003-11-05 | Human Genome Sciences Inc | 48 HUMAN SECRETED PROTEINS |
| CA2382015A1 (en) | 1999-08-17 | 2001-02-22 | Incyte Genomics, Inc. | Membrane associated proteins |
| WO2001025272A2 (en) | 1999-10-04 | 2001-04-12 | Corixa Corporation | Compositions and methods for therapy and diagnosis of prostate cancer |
| AU1656501A (en) | 1999-11-12 | 2001-06-06 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
| PT1244705E (pt) * | 1999-12-06 | 2010-05-04 | Agensys Inc | Antigénios transmembranares em serpentina expressos em cancros da próstata humanos e suas utilizações |
| CA2397741A1 (en) * | 2000-01-14 | 2001-07-19 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
| CA2399776A1 (en) * | 2000-02-03 | 2001-08-09 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
| AU3087801A (en) | 2000-02-04 | 2001-08-14 | Molecular Dynamics Inc | Human genome-derived single exon nucleic acid probes useful for analysis of geneexpression in human breast and hbl 100 cells |
| WO2001060860A2 (en) | 2000-02-17 | 2001-08-23 | Millennium Predictive Medicine, Inc. | Genes differentially expressed in human prostate cancer and their use |
| AU2001249411B2 (en) * | 2000-03-24 | 2007-02-15 | Fahri Saatcioglu | Novel prostate-specific or testis-specific nucleic acid molecules, polypeptides,and diagnostic and therapeutic methods |
| CA2403909A1 (en) | 2000-03-27 | 2001-10-04 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
| US6436703B1 (en) | 2000-03-31 | 2002-08-20 | Hyseq, Inc. | Nucleic acids and polypeptides |
| CA2411601A1 (en) | 2000-06-05 | 2001-12-13 | Avalon Pharmaceuticals | Cancer gene determination and therapeutic screening using signature gene sets |
| CA2412223A1 (en) | 2000-06-09 | 2001-12-20 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of colon cancer |
| IL154129A0 (en) | 2000-07-28 | 2003-07-31 | Compugen Inc | Oligonucleotide library for detecting rna transcripts and splice variants that populate a transcriptome |
| CA2420140A1 (en) | 2000-08-24 | 2002-02-28 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
| EP1474528A4 (en) | 2000-10-13 | 2006-06-14 | Protein Design Labs Inc | METHODS OF DIAGNOSIS OF PROSTATE CANCER, COMPOSITIONS AND METHODS OF EXAMINING PROSTATE CANCER MODULATORS |
| EP1661986A1 (en) | 2000-11-17 | 2006-05-31 | Nuvelo, Inc. | Nucleic acids and polypeptides enocoded thereby that are member of the kallikrein gene familyNovel nucleic acids and polypeptides |
| WO2002057303A2 (en) | 2001-01-12 | 2002-07-25 | Hybrigenics | Protein-protein interactions between shigella flexneri polypeptides and mammalian polypeptides |
| EP1379264A4 (en) | 2001-03-21 | 2009-07-08 | Human Genome Sciences Inc | HUMAN SECRETED PROTEINS |
| WO2003009814A2 (en) | 2001-07-25 | 2003-02-06 | Millennium Pharmaceuticals, Inc. | Novel genes, compositions, kits, and methods for identification, assessment, prevention, and therapy of prostate cancer |
| EP2287186B1 (en) * | 2001-09-06 | 2014-12-31 | Agensys, Inc. | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer |
| EP1308459A3 (en) | 2001-11-05 | 2003-07-09 | Research Association for Biotechnology | Full-length cDNA sequences |
| AU2004319915B9 (en) | 2004-04-22 | 2011-12-22 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| DK1791565T3 (en) | 2004-09-23 | 2016-08-01 | Genentech Inc | Cysteingensplejsede antibodies and conjugates |
-
2002
- 2002-09-06 EP EP10008771.7A patent/EP2287186B1/en not_active Expired - Lifetime
- 2002-09-06 WO PCT/US2002/028371 patent/WO2003022995A2/en not_active Ceased
- 2002-09-06 AU AU2002336446A patent/AU2002336446B2/en not_active Expired
- 2002-09-06 EP EP02773295.7A patent/EP1429793B1/en not_active Expired - Lifetime
- 2002-09-06 CA CA2459318A patent/CA2459318C/en not_active Expired - Lifetime
- 2002-09-06 ES ES10008771.7T patent/ES2532757T3/es not_active Expired - Lifetime
- 2002-09-06 JP JP2003527060A patent/JP2005505271A/ja not_active Withdrawn
- 2002-09-06 ES ES02773295.7T patent/ES2537074T3/es not_active Expired - Lifetime
- 2002-09-06 US US10/236,878 patent/US20060073150A1/en not_active Abandoned
-
2006
- 2006-10-12 US US11/581,227 patent/US7884179B2/en not_active Expired - Lifetime
-
2008
- 2008-04-21 JP JP2008110791A patent/JP2008285483A/ja not_active Withdrawn
- 2008-06-06 AU AU2008202540A patent/AU2008202540A1/en not_active Abandoned
-
2010
- 2010-05-11 JP JP2010109716A patent/JP5787487B2/ja not_active Expired - Lifetime
Cited By (156)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7642054B2 (en) | 1998-06-01 | 2010-01-05 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7611904B2 (en) | 1998-06-01 | 2009-11-03 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7928201B2 (en) | 1998-06-01 | 2011-04-19 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US8414898B2 (en) | 1998-06-01 | 2013-04-09 | Genentech, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7485299B2 (en) | 1998-06-01 | 2009-02-03 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7968307B2 (en) | 1998-06-01 | 2011-06-28 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7575749B2 (en) | 1998-06-01 | 2009-08-18 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7622569B2 (en) | 1998-06-01 | 2009-11-24 | Agensys, Inc. | Nucleic acid and corresponding protein entitled 98P4B6 useful in treatment and detection of cancer |
| US8012937B2 (en) | 1998-06-01 | 2011-09-06 | Agensys, Inc. | Nucleic acid and corresponding protein entitled 98P4B6 useful in treatment and detection of cancer |
| US7947459B2 (en) | 1998-06-01 | 2011-05-24 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7455991B2 (en) | 1999-06-01 | 2008-11-25 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US8053551B2 (en) | 1999-06-01 | 2011-11-08 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses therefor |
| US8241626B2 (en) | 1999-06-01 | 2012-08-14 | Agensys, Inc. | Serpentine transmembrane antigens expressed in human cancers and uses thereof |
| US7884179B2 (en) | 2001-09-06 | 2011-02-08 | Agensys, Inc. | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer |
| US8013135B2 (en) | 2001-09-06 | 2011-09-06 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| US7494646B2 (en) | 2001-09-06 | 2009-02-24 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| US9029516B2 (en) | 2001-09-06 | 2015-05-12 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| US7939503B2 (en) | 2001-09-06 | 2011-05-10 | Agensys, Inc. | Reduction of cell-cell communication in prostate cancer using STEAP-1 siRNA |
| US7947276B2 (en) | 2001-09-06 | 2011-05-24 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| EP1569514A4 (en) * | 2002-08-16 | 2007-10-31 | SPECIFIC ANTIGEN OF TUMORS, PEPTIDES ASSOCIATED THERETO AND USE THEREOF AS IMMUNOMINAL VACCINES | |
| JP2010220621A (ja) | 2002-09-06 | 2010-10-07 | Agensys Inc | 癌の処置および検出において有用な98p4b6と称される、核酸および対応タンパク質 |
| US10414826B2 (en) | 2003-11-06 | 2019-09-17 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| EP2489364A1 (en) | 2003-11-06 | 2012-08-22 | Seattle Genetics, Inc. | Monomethylvaline compounds onjugated to antibodies |
| US10808039B2 (en) | 2003-11-06 | 2020-10-20 | Seattle Genetics Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US8703714B2 (en) | 2003-11-06 | 2014-04-22 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| US8557780B2 (en) | 2003-11-06 | 2013-10-15 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| EP2486933A1 (en) | 2003-11-06 | 2012-08-15 | Seattle Genetics, Inc. | Monomethylvaline compounds conjugated with antibodies |
| EP2260858A2 (en) | 2003-11-06 | 2010-12-15 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| EP2260858A3 (en) * | 2003-11-06 | 2011-12-07 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| IL255015A (en) * | 2003-11-06 | 2018-02-28 | Seattle Genetics Inc | Monomethylvaline compounds capable of attaching to ligands |
| EP3858387A1 (en) | 2003-11-06 | 2021-08-04 | Seagen Inc. | Monomethylvaline compounds capable of conjugation to ligands |
| EP3120861A1 (en) | 2003-11-06 | 2017-01-25 | Seattle Genetics, Inc. | Intermediate for conjugate preparation comprising auristatin derivatives and a linker |
| EP2478912A1 (en) | 2003-11-06 | 2012-07-25 | Seattle Genetics, Inc. | Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy |
| EP3434275A1 (en) | 2003-11-06 | 2019-01-30 | Seattle Genetics, Inc. | Assay for cancer cells based on the use of auristatin conjugates with antibodies |
| US10597463B2 (en) | 2004-04-22 | 2020-03-24 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| EA014870B1 (ru) * | 2004-04-22 | 2011-02-28 | Эдженсис, Инк. | Антитела к белку steap-1 и их применение |
| JP2008509880A (ja) * | 2004-04-22 | 2008-04-03 | アジェンシス,インコーポレイテッド | Steap−1タンパク質に結合する抗体とそれから由来する分子 |
| AU2004319915B9 (en) * | 2004-04-22 | 2011-12-22 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| US11401347B2 (en) | 2004-04-22 | 2022-08-02 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| KR101215179B1 (ko) * | 2004-04-22 | 2012-12-24 | 어젠시스 인코포레이티드 | Steap-1 단백질과 결합하는 항체 및 그로부터 유래된분자 |
| CN101258166B (zh) * | 2004-04-22 | 2013-01-30 | 阿根西斯公司 | 与steap-1蛋白结合的抗体及其衍生的分子 |
| AU2004319915B2 (en) * | 2004-04-22 | 2011-07-14 | Agensys, Inc. | Antibodies and molecules derived therefrom that bind to STEAP-1 proteins |
| EP1742966A4 (en) * | 2004-04-22 | 2008-04-02 | Agensys Inc | ANTIBODIES AND DERIVED MOLECULES THAT BIND TO STEAP-1 PROTEINS |
| NO340451B1 (no) * | 2004-04-22 | 2017-04-24 | Agensys Inc | Monoklonale antistoff betegnet X120.545.1.1. og gitt ATCC aksesjonsnummer PTA-5803 eller en humanisert form av nevnte antistoff som binder spesifikt til STEAP-1, en modifisert form derav, et rekombinant protein derav, et deponert hybridom, en vektor som koder for antistoffet eller fragmentet, farmasøytisk preparat derav, samt anvendelser derav, blant annet til fremstilling av et medikament. |
| US8652479B2 (en) | 2004-06-01 | 2014-02-18 | Genentech, Inc. | Antibody-drug conjugates and methods |
| WO2005117986A3 (en) * | 2004-06-01 | 2006-06-15 | Genentech Inc | Antibody drug conjugates and methods |
| EP2286844A2 (en) | 2004-06-01 | 2011-02-23 | Genentech, Inc. | Antibody-drug conjugates and methods |
| US8142784B2 (en) | 2004-06-01 | 2012-03-27 | Genentech, Inc. | Antibody-drug conjugates and methods |
| EP3088004A1 (en) | 2004-09-23 | 2016-11-02 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| US10576149B2 (en) | 2005-04-26 | 2020-03-03 | Lindis Biotech Gmbh | Combination of the application of antibodies for immunostimulation together with glucocorticoids |
| US10071158B2 (en) | 2005-04-26 | 2018-09-11 | Lindis Biotech Gmbh | Combination of the application of antibodies for immunostimulation together with glucocorticoids |
| US8188050B2 (en) * | 2006-10-26 | 2012-05-29 | Isp Investments Inc. | Pharmaceutical and/or cosmetic composition containing peptides |
| US8889847B2 (en) | 2006-10-27 | 2014-11-18 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
| US8436147B2 (en) | 2006-10-27 | 2013-05-07 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
| US9593167B2 (en) | 2006-10-27 | 2017-03-14 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
| US10981987B2 (en) | 2007-07-16 | 2021-04-20 | Genentech, Inc. | Humanized anti-CD79b antibodies and immunoconjugates and methods of use |
| USRE48558E1 (en) | 2007-07-16 | 2021-05-18 | Genentech, Inc. | Anti-CD79B antibodies and immunoconjugates and methods of use |
| US10494432B2 (en) | 2007-07-16 | 2019-12-03 | Genentech, Inc. | Anti-CD79B antibodies and immunoconjugates and methods of use |
| US11866496B2 (en) | 2007-07-16 | 2024-01-09 | Genentech, Inc. | Humanized anti-CD79B antibodies and immunoconjugates and methods of use |
| US10544218B2 (en) | 2008-01-31 | 2020-01-28 | Genentech, Inc. | Anti-CD79B antibodies and immunoconjugates and methods of use |
| WO2011031870A1 (en) | 2009-09-09 | 2011-03-17 | Centrose, Llc | Extracellular targeted drug conjugates |
| WO2011056983A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Zirconium-radiolabeled, cysteine engineered antibody conjugates |
| WO2011130598A1 (en) | 2010-04-15 | 2011-10-20 | Spirogen Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2011156328A1 (en) | 2010-06-08 | 2011-12-15 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| US11045535B2 (en) | 2010-11-12 | 2021-06-29 | The Trustees Of The University Of Pennsylvania | Consensus prostate antigens, nucleic acid molecule encoding the same and vaccine and uses comprising the same |
| US11980659B2 (en) | 2010-11-12 | 2024-05-14 | The Trustees Of The University Of Pennsylvania | Consensus prostate antigens, nucleic acid molecule encoding the same and vaccine and uses comprising the same |
| WO2012074757A1 (en) | 2010-11-17 | 2012-06-07 | Genentech, Inc. | Alaninyl maytansinol antibody conjugates |
| WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
| US11135303B2 (en) | 2011-10-14 | 2021-10-05 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2013130093A1 (en) | 2012-03-02 | 2013-09-06 | Genentech, Inc. | Biomarkers for treatment with anti-tubulin chemotherapeutic compounds |
| US9919056B2 (en) | 2012-10-12 | 2018-03-20 | Adc Therapeutics S.A. | Pyrrolobenzodiazepine-anti-CD22 antibody conjugates |
| US9931415B2 (en) | 2012-10-12 | 2018-04-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US11690918B2 (en) | 2012-10-12 | 2023-07-04 | Medimmune Limited | Pyrrolobenzodiazepine-anti-CD22 antibody conjugates |
| US11771775B2 (en) | 2012-10-12 | 2023-10-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US9889207B2 (en) | 2012-10-12 | 2018-02-13 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US11779650B2 (en) | 2012-10-12 | 2023-10-10 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US12121590B2 (en) | 2012-10-12 | 2024-10-22 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10695433B2 (en) | 2012-10-12 | 2020-06-30 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US9931414B2 (en) | 2012-10-12 | 2018-04-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US11701430B2 (en) | 2012-10-12 | 2023-07-18 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014057074A1 (en) | 2012-10-12 | 2014-04-17 | Spirogen Sàrl | Pyrrolobenzodiazepines and conjugates thereof |
| US10722594B2 (en) | 2012-10-12 | 2020-07-28 | Adc Therapeutics S.A. | Pyrrolobenzodiazepine-anti-CD22 antibody conjugates |
| US10646584B2 (en) | 2012-10-12 | 2020-05-12 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10736903B2 (en) | 2012-10-12 | 2020-08-11 | Medimmune Limited | Pyrrolobenzodiazepine-anti-PSMA antibody conjugates |
| US10751346B2 (en) | 2012-10-12 | 2020-08-25 | Medimmune Limited | Pyrrolobenzodiazepine—anti-PSMA antibody conjugates |
| EP2839860A1 (en) | 2012-10-12 | 2015-02-25 | Spirogen Sàrl | Pyrrolobenzodiazepines and conjugates thereof |
| US10780181B2 (en) | 2012-10-12 | 2020-09-22 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US10799596B2 (en) | 2012-10-12 | 2020-10-13 | Adc Therapeutics S.A. | Pyrrolobenzodiazepine-antibody conjugates |
| US10994023B2 (en) | 2012-10-12 | 2021-05-04 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10335497B2 (en) | 2012-10-12 | 2019-07-02 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014159981A2 (en) | 2013-03-13 | 2014-10-02 | Spirogen Sarl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014140174A1 (en) | 2013-03-13 | 2014-09-18 | Spirogen Sàrl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2014140862A2 (en) | 2013-03-13 | 2014-09-18 | Spirogen Sarl | Pyrrolobenzodiazepines and conjugates thereof |
| WO2015023355A1 (en) | 2013-08-12 | 2015-02-19 | Genentech, Inc. | 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment |
| US10029018B2 (en) | 2013-10-11 | 2018-07-24 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| US10010624B2 (en) | 2013-10-11 | 2018-07-03 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US9956299B2 (en) | 2013-10-11 | 2018-05-01 | Medimmune Limited | Pyrrolobenzodiazepine—antibody conjugates |
| US9950078B2 (en) | 2013-10-11 | 2018-04-24 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| WO2015095227A2 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | Peptidomimetic compounds and antibody-drug conjugates thereof |
| WO2015095212A1 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment |
| WO2015095223A2 (en) | 2013-12-16 | 2015-06-25 | Genentech, Inc. | Peptidomimetic compounds and antibody-drug conjugates thereof |
| US10188746B2 (en) | 2014-09-10 | 2019-01-29 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2016037644A1 (en) | 2014-09-10 | 2016-03-17 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| WO2016040825A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anthracycline disulfide intermediates, antibody-drug conjugates and methods |
| WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
| US10420777B2 (en) | 2014-09-12 | 2019-09-24 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof |
| EP3235820A1 (en) | 2014-09-17 | 2017-10-25 | Genentech, Inc. | Pyrrolobenzodiazepines and antibody disulfide conjugates thereof |
| US12016842B2 (en) | 2014-09-23 | 2024-06-25 | Genentech, Inc. | Methods of using anti-CD79b immunoconjugates |
| US11000510B2 (en) | 2014-09-23 | 2021-05-11 | Genentech, Inc. | Methods of using anti-CD79b immunoconjugates |
| US10780096B2 (en) | 2014-11-25 | 2020-09-22 | Adc Therapeutics Sa | Pyrrolobenzodiazepine-antibody conjugates |
| WO2016090050A1 (en) | 2014-12-03 | 2016-06-09 | Genentech, Inc. | Quaternary amine compounds and antibody-drug conjugates thereof |
| US11702473B2 (en) | 2015-04-15 | 2023-07-18 | Medimmune Limited | Site-specific antibody-drug conjugates |
| US11059893B2 (en) | 2015-04-15 | 2021-07-13 | Bergenbio Asa | Humanized anti-AXL antibodies |
| WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
| WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
| WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
| US10392393B2 (en) | 2016-01-26 | 2019-08-27 | Medimmune Limited | Pyrrolobenzodiazepines |
| US10695439B2 (en) | 2016-02-10 | 2020-06-30 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US11517626B2 (en) | 2016-02-10 | 2022-12-06 | Medimmune Limited | Pyrrolobenzodiazepine antibody conjugates |
| EP4273551A2 (en) | 2016-03-25 | 2023-11-08 | F. Hoffmann-La Roche AG | Multiplexed total antibody and antibody-conjugated drug quantification assay |
| WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
| US10543279B2 (en) | 2016-04-29 | 2020-01-28 | Medimmune Limited | Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer |
| WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
| WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
| WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
| WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
| WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
| US10799595B2 (en) | 2016-10-14 | 2020-10-13 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US11612665B2 (en) | 2017-02-08 | 2023-03-28 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US11813335B2 (en) | 2017-02-08 | 2023-11-14 | Medimmune Limited | Pyrrolobenzodiazepine-antibody conjugates |
| US11160872B2 (en) | 2017-02-08 | 2021-11-02 | Adc Therapeutics Sa | Pyrrolobenzodiazepine-antibody conjugates |
| US12129306B2 (en) | 2017-04-03 | 2024-10-29 | Hoffman-La Roche Inc. | Antibodies binding to STEAP-1 |
| US11685790B2 (en) | 2017-04-03 | 2023-06-27 | Hoffmann-La Roche Inc. | Antibodies binding to STEAP-1 |
| US11180571B2 (en) | 2017-04-03 | 2021-11-23 | Hoffmann-La Roche Inc. | Antibodies binding to STEAP-1 |
| US11370801B2 (en) | 2017-04-18 | 2022-06-28 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| US10544223B2 (en) | 2017-04-20 | 2020-01-28 | Adc Therapeutics Sa | Combination therapy with an anti-axl antibody-drug conjugate |
| US11938192B2 (en) | 2017-06-14 | 2024-03-26 | Medimmune Limited | Dosage regimes for the administration of an anti-CD19 ADC |
| US11318211B2 (en) | 2017-06-14 | 2022-05-03 | Adc Therapeutics Sa | Dosage regimes for the administration of an anti-CD19 ADC |
| US11649250B2 (en) | 2017-08-18 | 2023-05-16 | Medimmune Limited | Pyrrolobenzodiazepine conjugates |
| WO2019060398A1 (en) | 2017-09-20 | 2019-03-28 | Ph Pharma Co., Ltd. | ANALOGUES OF THAILANSTATINE |
| US11352324B2 (en) | 2018-03-01 | 2022-06-07 | Medimmune Limited | Methods |
| US11524969B2 (en) | 2018-04-12 | 2022-12-13 | Medimmune Limited | Pyrrolobenzodiazepines and conjugates thereof as antitumour agents |
| US11530274B2 (en) | 2018-07-02 | 2022-12-20 | Amgen Inc. | Anti-STEAP1 antigen-binding protein |
| WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
| WO2020086858A1 (en) | 2018-10-24 | 2020-04-30 | Genentech, Inc. | Conjugated chemical inducers of degradation and methods of use |
| WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
| WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
| US12209099B2 (en) | 2019-03-15 | 2025-01-28 | Medimmune Limited | Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer |
| WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
| WO2023078273A1 (en) | 2021-11-03 | 2023-05-11 | Hangzhou Dac Biotech Co., Ltd. | Specific conjugation for an antibody-drug conjugate |
| WO2023147329A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation and methods thereof |
| WO2023147328A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof |
| WO2024138128A2 (en) | 2022-12-23 | 2024-06-27 | Genentech, Inc. | Cereblon degrader conjugates, and uses thereof |
| WO2024220546A2 (en) | 2023-04-17 | 2024-10-24 | Peak Bio, Inc. | Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates |
| WO2026006689A2 (en) | 2024-06-28 | 2026-01-02 | Firefly Bio, Inc. | Bcl-xl degrader antibody conjugates and uses thereof |
| WO2026006688A2 (en) | 2024-06-28 | 2026-01-02 | Firefly Bio, Inc. | Degrader antibody conjugates and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1429793A4 (en) | 2005-07-27 |
| EP2287186B1 (en) | 2014-12-31 |
| US7884179B2 (en) | 2011-02-08 |
| JP5787487B2 (ja) | 2015-09-30 |
| EP1429793A2 (en) | 2004-06-23 |
| EP1429793B1 (en) | 2015-02-25 |
| HK1152714A1 (en) | 2012-03-09 |
| AU2002336446B2 (en) | 2008-03-06 |
| JP2010215639A (ja) | 2010-09-30 |
| CA2459318A1 (en) | 2003-03-20 |
| EP2287186A1 (en) | 2011-02-23 |
| US20060073150A1 (en) | 2006-04-06 |
| ES2537074T3 (es) | 2015-06-02 |
| JP2005505271A (ja) | 2005-02-24 |
| ES2532757T3 (es) | 2015-03-31 |
| WO2003022995A3 (en) | 2003-08-14 |
| CA2459318C (en) | 2017-09-26 |
| JP2008285483A (ja) | 2008-11-27 |
| AU2008202540A1 (en) | 2008-06-26 |
| US20090169476A1 (en) | 2009-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2459318C (en) | Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer | |
| AU2002336446A1 (en) | Nucleic acid and corresponding protein entitled STEAP-1 useful in treatment and detection of cancer | |
| US7759474B2 (en) | Nucleic acid and corresponding protein entitled 125P5C8 useful in treatment and detection of cancer | |
| WO2004016733A2 (en) | Nucleic acid and corresponding protein entitled 251p5g2 useful in treatment and detection of cancer | |
| WO2005014780A2 (en) | Prostate stem cell antigen (psca) variants and subsequences thereof | |
| WO2002016598A2 (en) | Nucleic acid and corresponding protein named 158p1h4 useful in the treatment and detection of bladder and other cancers | |
| WO2002083919A2 (en) | Nucleic acid and corresponding protein entitled 184p1e2 useful in treatment and detection of cancer | |
| US20030229904A1 (en) | Nucleic acid and corresponding protein entitled 161P5C5 useful in treatment and detection of cancer | |
| AU2002305169A1 (en) | Nucleic acid and corresponding protein entitled 162P1E6 useful in treatment and detection of cancer | |
| AU2002258626A1 (en) | Nucleid acid and corresponding protein entitled 158P3D2 useful in treatment and detection of cancer | |
| US8647826B2 (en) | Nucleic acid and corresponding protein entitled 125P5C8 useful in treatment and detection of cancer | |
| EP1399174A2 (en) | Nucleic acid and corresponding protein entitled 121p1f1 useful in treatment and detection of cancer | |
| WO2002014501A2 (en) | Nucleic acids and corresponding proteins entitled phor1-a11 and phor1-f5d6 useful in treatment and detection of cancer | |
| AU2002307250A1 (en) | Nucleic acid and corresponding protein entitled 121P2A3 useful in treatment and detection of cancer | |
| EP1434592A1 (en) | Nucleic acid and corresponding protein entitled 121p2a3 useful in treatment and detection of cancer | |
| WO2003085081A2 (en) | Nucleic acid and corresponding protein entitled 238p1b2 useful in treatment and detection of cancer | |
| HK1152714B (en) | Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG UZ VC VN YU ZA ZM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2459318 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 160727 Country of ref document: IL Ref document number: 2003527060 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002336446 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002773295 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002773295 Country of ref document: EP |