WO2002042333A1 - Anticorps monoclonal anti-cd14 exerçant un effet d'inhibition de la fixation cd14/tlr - Google Patents
Anticorps monoclonal anti-cd14 exerçant un effet d'inhibition de la fixation cd14/tlr Download PDFInfo
- Publication number
- WO2002042333A1 WO2002042333A1 PCT/JP2001/008563 JP0108563W WO0242333A1 WO 2002042333 A1 WO2002042333 A1 WO 2002042333A1 JP 0108563 W JP0108563 W JP 0108563W WO 0242333 A1 WO0242333 A1 WO 0242333A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- human
- cells
- amino acid
- binding
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the present invention relates to an anti-CD14 antibody and a fragment thereof, a hybridoma producing the antibody or the fragment, a peptide, a method for producing the antibody, and a pharmaceutical composition for sepsis. More specifically, the present invention relates to an anti-CD14 antibody that specifically recognizes an epitope containing 8 or more amino acids in the region from position 269 to position 315 of human CD14, CD12 and Toll.
- the antibody which is a binding inhibitor to Like Receptor (TLR), an anti-CD14 monoclonal antibody, a humanized antibody or a chimera having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8 as CDR
- TLR binding inhibitor to Like Receptor
- the present invention relates to an antibody, a peptide having the amino acid sequence, and a pharmaceutical composition for sepsis.
- CD14 is a 356 amino acid glycoprotein that is anchored on the membranes of macrophages, monocytes, Kupffer cells, neutrophils and some B cells by glycosylphosphatidylinositol (GPI).
- GPI glycosylphosphatidylinositol
- Human CD14 includes soluble CD14 (hereinafter also referred to as sCD14 or soluble CD14) in addition to membrane-bound CD14 (hereinafter also referred to as mCD14). It has been reported that there are multiple sCD14s with different molecular weights in blood. (Labeta MO: Eur. J. Immunol., 23: 2144, 1993).
- Human CD14 is known as the LPS receptor for Gram-negative bacillus endotoxin (Wright et al .: Science, 249: 1431, 1990), and receives LPS from blood LBP (LPS binding protein) to form a complex. Form the body.
- Macrophages and the like expressing mCD14 are activated by a complex of LPS and sCD14, and induce the production of inflammatory cytokines (Hailmann E et al .: J. Immnol., 156: 4384, 1996).
- vascular endothelial cells and vascular smooth muscle cells which are said to not express mCD14, are induced to produce inflammatory cytokines by a complex of sCD14 and LPS (hereinafter also referred to as sCD14ZLPS) (Loppnow H et al .: Infection & Immunity, 63: 1020, 1995).
- sCD14ZLPS LPS
- LTA lipoteichoic acid
- PepG peptide glycan
- Cytokine production of cells via CD14 such as LPS or LTA has a damaging effect on the living body and causes sepsis.
- the initial symptoms of sepsis include chills, hyperhidrosis, fever, and weakness, etc., followed by hypotension, neutropenia, generalized intravascular coagulation, and adult respiratory distress syndrome that cause shock.
- Serious clinical symptoms occur, such as respiratory failure and renal organ failure.
- TLR TLR6
- TLR4 is responsible for signaling Gram-negative bacterial cell components to cells and TLR2 is responsible for signaling Gram-positive bacterial cell components to cells Is reported to be
- TLR2 is involved in signal transduction of LPS into cells, that TLR2 reacts directly to LPS on the cell surface, and that the response is enhanced in the presence of CD14.
- CD14 directly binds to the TLR or to a complex of the TLR and accessory molecules, a low molecular weight substance whose other functions have not been elucidated. No, and the binding region between TLR and CD14 is completely unknown.
- a human anti-CD14 antibody that controls signaling of LPS through human CD14 As a human anti-CD14 antibody that controls signaling of LPS through human CD14, a 3C10 antibody that binds to the 7th to 14th positions of human CD14 (Steinman: J. Exp. Med., 158: 126 ( 1983) and; fuan TS: J. Biol. Che., 270: 29, 17237 (1995)) and MEM-18 antibodies that bind to positions 57 and 64 (Bazil: Eur. J. I. unol., 16: 1583 (1986) and Juan TS: J. Biol. Cem., 270, 10, 5219 (1995) )) Is known, and application to a therapeutic agent for sepsis is disclosed.
- the 28C5 antibody and 23G4 antibody which suppress LPS binding and suppress cytokine release
- the 18E12 antibody which suppresses LPS binding only partially and suppress cytokine release (Table of Contents) Hei 8-510909) is disclosed.
- the present invention is directed to signal transduction into cells even with the formed CD14ZL PS.
- An object of the present invention is to provide a peptide containing the same, a method for producing an antibody using the peptide as an immunogen, and a pharmaceutical composition for sepsis.
- the present inventors have conducted intensive studies to overcome the conventional problems as described above, and are antibodies that suppress human CD14-mediated cell activation.
- the present invention provides a monoclonal antibody, a humanized antibody, and a chimeric antibody having a specific amino acid sequence as CDR. Further, the present invention provides an antibody that suppresses binding to TLR.
- a medical composition for sepsis comprising a substance that acts as an active ingredient. That is, the present invention provides the following (1) to (11) anti-CD14 antibody, (12) anti-CD14 humanized antibody preparation method, and (13) pharmaceutical composition.
- An anti-CD14 antibody that specifically recognizes an epitope containing 8 or more amino acids in the region from position 269 to position 315 of human CD14 described in SEQ ID NO: 1.
- An anti-CD14 monoclonal antibody having at least one complementarity determining region (CDR) having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8.
- a peptide comprising at least one of the amino acid sequences of SEQ ID NOs: 3, 4, 5, 6, 7, or 8.
- a peptide comprising eight or more amino acids of the region from position 269 to position 315 of human CD14 described in SEQ ID NO: 1.
- a host cell which integrates a DNA containing a nucleotide sequence encoding a CDR having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8 into a vector containing a human antibody gene; and A method for producing an anti-CD 14 humanized antibody, comprising producing an anti-CD 14 humanized antibody.
- a pharmaceutical composition for sepsis comprising as an active ingredient any of the antibodies or peptides according to (1) to (8).
- the present invention further provides the following monoclonal antibodies (14) to (17).
- the monoclonal antibody of (3) above which is a rat monoclonal antibody.
- FIG. 1 is a diagram showing the results of measurement of F1024-11 antibody showing suppression of Toll4-mediated NF- ⁇ B activation by LP SZCD14 in screening for a therapeutic agent for sepsis against human CD14 antibody. .
- FIG. 2 is a diagram showing the cross-reactivity of the F1024-1.3 antibody with soluble CD14 in dogs, lizards, primroses, porcupines, and humans.
- FIGS. 3 (a) to 3 (c) are diagrams showing the results of examining the binding of the F1024-1-3-3 antibody to the egret CD14 by the Fluorocytomtry method.
- FIG. 4 is a graph showing the effect of F1024-113 antibody on suppressing IL-6 production in endothelial cells by LPS / CD14. conAb indicates control rat IgG.
- FIG. 5 is a graph showing the effect of F1024-1-3 antibody on inhibiting IL-16 production in endothelial cells after formation of the LPS / CD14 complex.
- FIGS. 6 (a) to 6 (c) are diagrams showing that as a result of the binding test of FITC-LPS to CD14-expressing cells, the F1024-1-3 antibody is not inhibited.
- FIG. 7 is a diagram showing that TNF production is suppressed by pre-administration of the F1024-1-3 antibody in an LPS-loaded heron sepsis model.
- FIG. 8 is a diagram showing that leukopenia is improved by pre-administration of the F1024-1-3-antibody in the LTA / PepG-administered egret sepsis model.
- FIG. 9 is a graph showing that the values of ALT and creatinine are improved by post-administration of the F1024-1-3-antibody in the LPS-loaded heron sepsis model.
- the black marks indicate the groups to which the antibody was administered, and the open circles indicate the groups to which the saline was administered.
- Figure 10 shows the binding amount when an LPS / CD14 / TLR4-COS complex was formed using BIACORE3000 and the binding inhibitory effect of TLR4-COS when the F1024-1-3 antibody was bound.
- FIG. The response is a Biacore index, with 1000 RU indicating 1.2 ng binding.
- FIG. 11 is a graph showing the inhibitory effect of F1024-13-1 and sCD14 (1-307) S286C on the induced production of IL-18 in HEKT4-14.
- the inhibitory activity was calculated as follows.
- FIG. 12 is a diagram showing a peptide having an activity of inhibiting the binding of the F1024-1-3 antibody to CD14 (1-356).
- FIG. 13 is a graph showing the binding activity of the F1024-13 antibody to various CD14 deletion variants.
- FIG. 14 is a graph showing the binding activity of the F1024-13 antibody to various CD14 amino acid substitution variants.
- FIG. 15 shows the determined amino acid sequences of the variable regions of the heavy and light chains of the F1024-1-3 antibody.
- FIG. 16 shows the CDR sequences of the heavy and light chains of the F1024-1-3 antibody.
- FIG. 17 is a diagram showing an example of DNA encoding the determined amino acid sequences of the variable regions of the heavy and light chains of the F1024-1-3 antibody.
- FIG. 18 is a diagram showing an example of a DNA encoding the heavy chain and light chain CDR sequences of the F1024-11 antibody.
- a first embodiment of the present invention is an anti-CD14 antibody that specifically recognizes an epitope containing eight or more amino acids in the region from position 269 to position 315 of human CD14 described in SEQ ID NO: 1. .
- the amino acid sequence set forth in SEQ ID NO: 1 is the amino acid sequence of human CD14.
- the protein consisting of 356 amino acids described in SEQ ID NO: 1 has the full length of human CD14.
- the epitope is an antigenic determinant and refers to a structural site that specifically binds to an antibody.
- the regions recognized by antibodies are not limited to those that recognize consecutive amino acid residues in the primary sequence.
- Some antibodies have epitopes that recognize the three-dimensional structure of proteins
- an antibody that recognizes a discontinuous amino acid residue on the primary sequence has a three-dimensional structure in which the discontinuous amino acid residue is sufficiently close to be recognized by the antibody.
- discontinuous amino acid residues are used as epitopes.
- the epitope includes a part of continuous amino acids in the region, but also includes the discontinuous amino acids in the region as described above. That is, as long as it exists in the region from position 269 to position 315 of human CD14, a set of continuous or discontinuous amino acids or a set of two or more amino acids in which continuous or discontinuous amino acids are interspersed can be expressed as ⁇ human CD 14 episodes 269 to 315! " Preferably, it is an anti-CD14 antibody that specifically perceives an epitope containing eight or more consecutive amino acids.
- the antibody of the present invention also includes an antibody that recognizes an epitope containing a region other than the regions 269 to 315.
- an epitope formed by eight or more amino acid residues in the region from position 269 to 315 of human CD14 and several amino acid residues in the region other than region 269 to 315 of human CD14 Antibodies that specifically recognize it are also included.
- the antibody of the present invention specifically recognizes an epitope containing eight or more amino acids in the region from position 269 to position 315 of human CD14 and binds to human CD14.
- the human CD14 is not limited to sCD14 or mCD14.
- Antibodies that specifically recognize tope are also included.
- sCD14 is present in blood
- mCD14 is present in macrophages.
- an epitope containing eight or more amino acids in the region from position 269 to position 315 of human CD14 means, for example, the N-terminal of human CD14 as in the method of Example 11 described later. This can be determined by binding to the soluble polypeptide having amino acids 1 to 315 (S CD14 (1-315)) but not to s CD 14 (1-268).
- the antibody of the present invention has a function of inhibiting the binding between CD14 and TLR by specifically recognizing an epitope containing 8 or more amino acids in the region from position 269 to position 315 of human CD14.
- CD14 binds to bacterial cell components, and the bound CD14Z bacterial cell component complex binds to TLRs, transmits signals to cells, and activates cells.
- TLRs TLRs
- inflammatory cytokines are released from the cells, and inflammation such as cytotoxicity and sepsis is induced.
- the antibody of the present invention suppresses cell activation by bacterial components by having a function of inhibiting the binding between CD14 and TLR, and suppresses inflammation such as cell damage and sepsis.
- the "binding between CD14 and TLR” is described in detail as the binding between CD14 and the bacterial cell component complex of CD14 and the bacterial cell component and TLR.
- bacterial cell components include LPS, LTA, peptide darican (PGN), lipoarabinomannan, and the like, and mycoplasma.
- LPSZCD14 which is a complex of LPS and CD14, transmits a signal to cells by associating with TLRs, particularly TLR2 or TLR4. Intracellular by TLR When the signal is transmitted, NF- ⁇ is activated via MyD88, I RAK and NIK, and the cell is activated. In this process, the antibody of the present invention inhibits the binding between LPS / CD14 and TLR.
- Having a function of inhibiting the binding between CD14 and TLR is not limited as long as it has a function of inhibiting the binding between CD14 and TLR, but is measured, for example, by the system of Example 2 or 4 described later. Can be determined.
- the antibody of the present invention is preferably an antibody that suppresses cell activation of TLR-expressing cells by 30% or more.
- TLR-expressing cells in the presence of 1 g / m1 LPS and 0.5 g / m1 exogenous CD14 at an antibody concentration of 10 agZm1 or less
- Antibodies that inhibit NF- ⁇ activation or IL-8 production by 30% or more are preferred. More preferably, it is an antibody that suppresses 40% or more. More preferably, the antibody suppresses 50% or more. Particularly preferred is an antibody that suppresses 70% or more.
- the antibody of the present invention is preferably an antibody that suppresses the production of endothelial cell cytokines by exogenous LP SZCD14 to 60% or less. More specifically, IL-6 production of endothelial cells in the presence of 10 ng / ml LPS and 300 ng / ml exogenous CD14 was 60% when the antibody concentration was lgZml or more. Antibodies that suppress the following are preferred. More preferably, the antibody is suppressed to 40% or less.
- the binding between CD14 and TLR includes direct binding, binding through another factor, or binding activated by another factor.
- binding may be performed in the presence of animal-derived serum.
- MD2 In the presence, TLR4 or a dimer of TLR4 binds when the structure is stable.
- the antibody of the present invention only needs to have a function of inhibiting binding in any case.
- an anti-CD14 antibody having a function of inhibiting the binding of CD14 to TLR in the presence of animal-derived serum can be mentioned.
- the antibody of the present invention has a function of inhibiting the binding between CD14 and TLR because the region is a region related to the binding between CD14 and TLR. Therefore, an antibody that specifically recognizes an epitope containing a part of the region from human CD14 to 269 to 315 inhibits the binding between CD14 and TLR by altering the function of that region. It has a function to do.
- an antibody in which a region to be used as an epitope is completely contained in human CD14 at positions 269 to 315 is preferable.
- a more preferred region to be an epitope is a region from human No. 285 to 315 of human CD14 in terms of having the same epitope as that of the F1024-1-3 antibody of Example. Also preferably, it is a region from human CD14 at positions 269 to 307. More preferably, an antibody that specifically recognizes a continuous amino acid as an epitope is preferable.
- the antibody of the present invention has an epitope similar to that of the F1024-1_3 antibody of the example, and has an epitope containing at least 8 amino acids in the region from human 285 to 315 of human CD14. Antibodies that specifically recognize the loop are preferred. The antibody recognizes an epitope present at the amino acid at position 315 from the amino acid at position 285 in the three-dimensional structure that can be generated when the amino acid at position 294 of CD14 is Pro. Understand.
- Pro differs from other amino acids in that the N atom bonded to the carbon is incorporated into the ring structure to form an> NH group, so the primary structure of the polypeptide is limited by the Pro backbone, affecting the three-dimensional structure of the protein give. In other words, Pro cannot form a hydrogen bond because there is no NH group and cannot form a helix (Protein Biotechnology, F. Frank, Baifukan).
- the antibody does not bind by point mutation of the Pro at position 294 of CD14, but this is due to the altered conformation of CD14. That is, the antibody recognizes an epitope present at the amino acid at position 315 from the amino acid at position 285 in a three-dimensional structure that can be generated when the amino acid at position 294 is Pro.
- the antibody of the present invention is an anti-human CD14 antibody.
- An antibody showing the following is included in the present invention.
- amino acid sequence set forth in SEQ ID NO: 2 is the amino acid sequence at positions 269 to 315 of human CD14.
- an antibody comprising a part or the whole of the amino acid sequence of SEQ ID NO: 2 and prepared using a peptide having eight or more consecutive amino acids as an immunogen is included in the antibody of the present invention.
- the immunogen is prepared using a peptide consisting of a part or all of the amino acid sequence of the region from the 285th position to the 307th position of human CD14 and having eight or more consecutive amino acids.
- Antibodies also, considering that the peptide takes a three-dimensional structure, an antibody produced using a peptide having preferably 10 or more consecutive amino acids, more preferably 15 or more consecutive amino acids, as an immunogen is preferred. You.
- the antibodies of the present invention specifically bind to CD14. It has the function of inhibiting the binding between 014 and Ding1.
- CD 14 can be s CD 14 or mCD 14.
- an antibody having a function of inhibiting the binding of either one of CD14 and TLR is included.
- an antibody having a function of inhibiting the binding of sCD14 present in blood to TLR or an antibody having a function of inhibiting binding of mCD14 present in macrophages and the like to TLR can be mentioned.
- the antibody of the present invention may be a polyclonal antibody or a monoclonal antibody. Monoclonal antibodies are preferred in order to clarify or demonstrate the function of the antibody.
- the animal species from which the antibody of the present invention is derived is not particularly limited. Rats are preferred for ease of antibody production.
- human antibodies are preferred. Human antibodies also include human antibodies produced by immunizing human antibody-producing mice.
- humanized antibodies, phage antibodies, chimeric antibodies and the like are also included in the antibodies of the present invention.
- a humanized antibody is an antibody in which the constant region and the framework region are derived from human and the complementarity determining region is derived from non-human.
- a phage antibody is an antibody produced by fusing an antibody to the coat protein of a filamentous phage to display the antibody on the surface of a phage particle. Used for A chimeric antibody is a body comprising a variable region of a non-human mammal, for example, a mouse monoclonal antibody and a constant region of a human antibody.
- the molecular species of the antibody of the present invention is not particularly limited.
- the antibodies may be classified into any of the classes, subclasses and isotypes.
- biologically active Antibody fragments such as Fab, Fab 'and (Fab') 2 are also included in the present invention.
- the antibody of the present invention can be prepared by using a known technique.
- a monoclonal antibody can be prepared by the following method.
- Immune cells of a mammal immunized with the entire protein of the amino acid sequence shown in SEQ ID NO: 1 or a peptide consisting of eight or more contiguous regions in the region from 269 to 315 as an immunogen are fused with myeloma cells.
- the antibody of the present invention can be prepared by selecting a clone from the hybridoma by the screening method according to the fifth aspect of the present invention described below.
- the antibody of the present invention can be prepared even if a clone that binds to SCD14 (1-315) but does not bind to SCD14 (1-268) is selected.
- a peptide consisting of consecutive 10 or more amino acids, particularly preferably 15 or more consecutive amino acids is used as the immunogen.
- the mammal to be immunized is not particularly limited, but is preferably selected in consideration of compatibility with the myeloma cells used for cell fusion, and is preferably a mouse, a rat, a hamster, or the like.
- the myeloma cells various known cells can be used. This includes myeloid cells such as P3, P3U1, SP2 / ⁇ , NS-1, YB2 / 0 and Y3_Ag1,2,3.
- Immunization can be performed by a known method.
- the antigen is administered intraperitoneally, subcutaneously, intravenously or in a footpad.
- This antigen may be administered in combination with an adjuvant, and is preferably administered a plurality of times.
- Immune cells are preferably spleen cells or lymph node-derived cells removed several days after the last administration of the antigen, for example, three days later. Good.
- Fusion of the immune cells and myeloma cells can be performed using a known method such as the method of Milstein et al. (Methods in Enzymo 1..73, p. 3).
- a method using polyethylene glycol (PEG) as a fusion agent, an electrofusion method, and the like can be mentioned.
- the mixing ratio of the immune cells to the myeloid cells is not limited as long as they can be fused, but it is preferable to use 1Z10 or an equivalent amount of myeloma cells with respect to the immune cells.
- the PEG concentration is not particularly limited, but is preferably 50%.
- An auxiliary such as dimethyl sulfoxide (DMSO) may be added as a fusion efficiency promoter.
- the fusion is started by adding the PEG solution heated to 37 ° C to the mixed cells, and is terminated by adding the medium after reacting for 1 to 5 minutes.
- the hybridoma formed by this fusion is cultured for 1 to 7 days in a selection medium such as a medium containing hypoxanthine, thymidine and aminopterin (HAT medium) for 1 to 7 days, and separated from unfused cells.
- a selection medium such as a medium containing hypoxanthine, thymidine and aminopterin (HAT medium) for 1 to 7 days, and separated from unfused cells.
- the resulting hybridomas are further selected according to the antibodies produced.
- the selected hybridoma is monocloned according to the known limiting dilution method and established as a monoclonal antibody-producing hybridoma.
- Known methods can be used for detecting the activity of the antibody produced by the hybridoma.
- the ELISA method, the agglutination reaction method, and the radioimmunoassay method are mentioned.
- the established hybridoma is cultured by a known method, and a monoclonal antibody can be obtained from the culture supernatant.
- the hybridoma can be proliferated by administration to a mammal having compatibility with the hybridoma, and can be obtained from the ascites.
- the antibody can be purified using a known purification method such as a salting out method, a gel filtration method, an ion exchange chromatography method or an affinity chromatography method.
- Human antibodies can be produced using the method developed by Ishida et al. (PNAS, 97: 722, 2000). That is, first, Tran s—ch romo s ome) (Tc) mice were prepared according to the method of Ishida et al. And the chromosome 14 fragment (Ig heavy chain) were introduced into mouse ES cells by the microcell fusion method, and according to the method of Joyner et al. (Gene Targeting, Experimental Method Series, Medical Science International), A chimeric mouse having each chromosome fragment is prepared.
- Tc Tran s—ch romo s ome
- a chimeric mouse having both a human chromosome 2 fragment (Ig light chain /) and a chromosome 14 fragment (Ig heavy chain) is produced by mating the two kinds of chimeric mice thus produced.
- endogenous Ig heavy chains were used according to the method of Cape cchi et al. (MoI. Cell. Biol. 12: 2919-2923, 1992).
- a double K ⁇ mouse in which the ⁇ chain was knocked out was prepared and bred with a chimeric mouse into which a human chromosome fragment was introduced, containing a human chromosome 2 fragment (1 ⁇ light chain / and a chromosome 14 fragment (Ig heavy chain), Create transchromosomal mice in which endogenous Ig heavy chains and ⁇ chains are knocked out
- the produced Tc mice produce human-derived antibodies in the blood, and some antibodies have mouse-chains. However, mouse Ig ( ⁇ ) was not detected
- the obtained Tc mice maintained their chromosomes even after several generations, and their offspring were Can be used to make body.
- the mixture After mixing 50 g of the purified CD14 antigen with Tc mouse and Ita Max Gold (Titer Max Gold, Cytx), the mixture is subcutaneously administered, and 3 weeks later, the same administration is performed.
- the diluted antiserum is reacted with the plate on which the antigen is immobilized, and then the human antibody in the bound serum is detected using an anti-human IgG antibody.
- Cell fusion is performed 3 days after intraperitoneal administration of 50 ⁇ g of the antigen to mice in which the antibody titer has increased.
- the collected splenocytes were mixed with mouse myeloma cells (SP 2 / 0—Ag14), fused with PEG4000 (Merck), and hybridomas were selected using HAT medium containing G418 (lmg mL). I do. The appeared hybridomas were anti-human IgGK antibody, anti-IgG antibody, anti-IgG2 antibody, and anti-I8. Screen 3 antibodies or anti-lgG4 antibody as a secondary antibody and select a hybridoma that produces a human antibody that binds to CD14. Furthermore, the human CD14 antibody of the present invention can be obtained by the screening method described in Example 2.
- a humanized antibody is obtained by a known method (Nature, 321: 522, 1986), a phage antibody is obtained by a known method (Annu Rev, Immunol, 12: 433, 1994), and a chimeric antibody is obtained by a known method. (Nature, 312: 643, 1984).
- Fab, Fab ', (Fab') 2, etc. which are fragments of the antibody of the present invention, can also be prepared by known methods (Eiji Ishikawa, ultra-sensitive enzyme immunoassay, Gakkai Shuppan Center).
- the polypeptide can be prepared by purifying soluble CD14 in human serum by a known method.
- commonly used peptide synthesizers Genetic recombination method cancer Research Division, Institute of Medical Science, The University of Tokyo, New Cell Engineering Experimental Protocol, Shujunsha), etc. .
- a peptide consisting of eight or more consecutive amino acids in the region from No. 269 to No. 315 can be synthesized by the Fmoc method using a 432A peptide synthesizer, and after deprotection with TFA and cleavage from the resin, Purification using a C18 HPLC column (Capcel Pak, Shiseido) enables preparation of the desired peptide.
- a hybridoma F 1024-1-3 obtained by cell fusion of immune cells and myeloma cells obtained by immunizing a rat with CD14 protein purified from human serum as an antigen is produced. F1024-1-3 antibodies.
- Hypridoma F 1024-1-13 is dated September 29, 2000, 1-chome, Tsukuba-Higashi, Ibaraki Pref., Japan, 1st Central 6th National Institute of Advanced Industrial Science and Technology Patent Organism Depositary (I POD) ) (Accession No. P-18061) and transferred from the original deposit to the International Depositary on March 16, 2001 (Accession No. FERM B P-7511).
- the monoclonal antibody of the present invention includes an anti-CD14 monoclonal antibody having at least one of the CDRs having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8.
- at least one of VL-CDR1 to CDR3 has any of the corresponding amino acid sequences of SEQ ID NOS: 3 to 5, and HL-CDR1 to CDR3.
- An anti-CD14 monoclonal antibody wherein at least one of CD3 has any of the amino acid sequences set forth in SEQ ID NOs: 6-8. More preferably, it is an anti-CD14 monoclonal antibody in which VL-CDR1 to HL-CDR3 have the amino acid sequences of SEQ ID NOS: 3 to 8, respectively.
- the anti-CD14 monoclonal antibody is not limited in its subtype. Includes IgA, IgD, IgE and IgM, as well as IgG of the F1024_ 1-3 antibody subtype. They maintain the sequence of the hypervariable region (CDR) of the F1024_1-3 antibody, shifting the heavy chain of the antibody from ⁇ to ⁇ chains or the light chain from ⁇ to ⁇ , ⁇ , ⁇ or It can be created by genetic engineering by substituting the i-chain.
- CDR hypervariable region
- the present invention includes an anti-CD14 chimeric antibody or a humanized human CD14 antibody having at least one of the CDRs having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8. .
- one or more of VL-CDR1 to CDR3 has any of the corresponding amino acid sequences of SEQ ID NOs: 3 to 5, and one or more of HL-CDR1 to CDR3 corresponds to An anti-CD14 chimeric antibody or an anti-CD14 human antibody having any of the amino acid sequences of SEQ ID NOs: 6 to 8. More preferably, it is an anti-CD14 chimeric antibody or an anti-CD14 humanized antibody in which VL-CDR1 to HL-CDR3 have the amino acid sequences of SEQ ID NOS: 3 to 8, respectively.
- a peptide comprising at least one amino acid sequence described in SEQ ID NOs: 3 to 8 is also included in the present invention.
- a peptide consisting of the amino acid sequence shown in any of SEQ ID NOs: 3 to 8 is preferred.
- SEQ ID NO: 3 also preferred are peptides comprising the amino acid sequence up to SEQ ID NO: 8 in that order.
- An appropriate linker may be inserted between the six amino acid sequences.
- the CD14 / TLR binding inhibitory action of the peptide can be determined by screening in Example 2 described later.
- a specific method for producing a chimeric antibody and a humanized antibody will be described.
- Human constant regions and rearranged variable region DNA can be isolated from various human cells, preferably immortalized B cells, according to known procedures.
- Non-human antibody sequences can be isolated from non-human material by similar methods. Cells of the material for the DNA sequence and host cells for the expression and secretion can be obtained from a variety of materials, such as the American Type Culture Collection (Cell Line and Hybridoma Catalog, 5th Edition (1989)). , Rockville, MD, which is hereby incorporated by reference.
- antibody heavy and light chains utilize various recombinant DNA techniques well known to those skilled in the art. It can be easily designed and manufactured. For example, a chain can change from its native sequence at its primary structure level by substitution of some amino acids, additions and deletions at the ends and intermediates, and the like. Alternatively, polypeptide fragments could be produced that have only one portion of the primary antibody structure, such that they have one or more antibody activities (eg, binding activity). In particular, it is noted that, like many genes, antibody genes also contain isolated functional regions, with each region having a different biological activity.
- modification of the gene encoding the desired epitope binding component can be accomplished by a variety of well-known techniques, including site-directed mutagenesis. Dosmith, Gene 8: 81-97 (1979) and Mouth Parts et al., Neythya 3 28: 731-734 (1987), which is incorporated herein by reference. Can be achieved.
- the epitope binding component is encoded by a "chimeric” or “humanized” antibody gene (Co and QueenNature, 351: 501, 1991).
- a chimeric antibody is an antibody in which the light and heavy chain genes are composed of antibody gene segments belonging to different species, typically by genetic engineering.
- the variable (V) segments of the genes from a mouse monoclonal antibody Hitojo normal (C) segments, for example, be connected to the ⁇ and ⁇ 4.
- a typical therapeutic chimeric antibody is an eight-hybrid protein consisting of the V or antigen binding domain from a mouse antibody and the C or effector domain from a human antibody, although other mammalian species may be used.
- framework region as defined by Kabat et (Sequences of proteins of immunological interest, 5 th ed., US Department of Health and Human Services, 1991) as, among the various antibodies in a single species, compared Is preserved
- a "human framework region” is substantially identical (about 85% or more) to a naturally occurring framework region of a human antibody or to the consensus sequence of some such antibodies. Is the framework area.
- Humanized antibody refers to an antibody comprising at least one CDR from a human framework, non-human antibody, wherein any constant region present therein is defined as a human antibody constant. It is substantially identical to the normal region, ie, at least about 85-90%, preferably at least 95%. Thus, all parts of the humanized antibody, except possibly the CDRs, are substantially identical to corresponding parts of one or more natural human antibody sequences. For example, a humanized antibody does not include a chimeric mouse variable region / human constant region antibody. More specifically, the present invention provides for the use of at least one, and preferably at least one, framework region (FR) from a plurality, preferably one, human receptor (Axcept) antibody.
- FR framework region
- Axcept human receptor
- the antibody can have two pairs of light chain Z heavy chain complexes, wherein at least one chain, especially the heavy chain, is operably linked to a human framework region segment, one or more, Preferably, it contains the complementarity determining regions of all (three) donor (rat) antibodies.
- a donor (rat) complementarity-determining region is introduced into the human framework region with or without additional naturally associated donor (rat) amino acid residues.
- the humanized antibody of the present invention contains or consists of the amino acid sequence of any one of SEQ ID NOs: 3, 4, 5, 6, 7, and 8 in the sequence listing. It contains at least one, and preferably all (3) of CDRs. Desirably, the position of each CDR and framework in the humanized antibody corresponds to the position in the original donor antibody.
- the humanized antibody of the present invention has a content of 65% or more and 95% or less, preferably 70% or more and 9% or less, between the humanized antibody heavy chain variable region framework and the donor antibody heavy chain variable region framework.
- heavy and light chains from the same human antibody are chosen to provide the framework sequence, reducing the likelihood of incompatibility in the assembly of the two chains, but differing by two or more. May be derived from human antibodies.
- the sequence of the framework or variable region amino acid of the non-human antibody from which the CDR is obtained is compared with the corresponding sequence in the human antibody sequence collection, and a sequence with high homology is selected and used.
- the homology of the framework amino acid sequences is at least 60%, more preferably at least 65%.
- the amino acid sequence of the acceptor antibody heavy chain variable region is one of five of the representative collections of human antibody heavy chain variable region sequences most homologous to the amino acid sequence of the donor antibody heavy chain variable region.
- the design of a humanized antibody can be performed as follows.
- the framework amino acids of the human antibody (acceptor antibody) used are those derived from the non-human antibody (donor antibody) that provides the CDR. Replaced by an amino acid.
- the amino acid in the human framework region of the acceptor antibody is rare at that position in the human antibody, and the corresponding amino acid in the donor antibody is typical at that position in the human antibody;
- the amino acid is adjacent or adjacent to one of the CDRs in primary sequence; or (c) the amino acid is about 5, preferably 4 in the three-dimensional model of the donor or humanized antibody. More preferably, it has atoms within 3 angstroms ( ⁇ 0 etc.? 1 "0, Natl. Acc. Sci. USA, 88, 2869, 1991). 2) If the amino acid in the human framework region of the acceptor antibody and the corresponding amino acid in the donor antibody are rare at that position in the human antibody, substitute those amino acids typical for that position in the human framework. I do.
- CDR and FR should be optimized by computer modeling. After a human antibody V region with high homology is found, the CDR sequence of the F1024-113 antibody is transplanted into its framework, and the three-dimensional structure is simulated by computer single molecule modeling. The programs used at this time are ABMOD and ENCAD (Biochemistry, 29: 10032, 1990).
- optimization can be performed by substituting the amino acid of FR near the CDR with another amino acid so that the arrangement of amino acids in the CDR region has optimal binding activity to CD14.
- CDR and FR it is also possible to use a partial amino acid sequence of FR of F1024-1-3 antibody as it is and transplant it to human antibody V region.
- the FR region of the F1024-1-13 antibody is shown in FIG.
- the CDR and FR sequences of the F1024-113 antibody are transplanted into the human antibody V region, and the three-dimensional structure is simulated by computer single molecule modeling.
- Mode 1 er and QUANT A / CHARMm are used as programs at this time.
- the FR approaches the structure of the rat antibody, and the arrangement of the amino acids in the CDR region increases the binding activity to CD14. It may be easier to optimize.
- amino acids of the CDR region may be deleted, substituted, inserted or added.
- substitution of homologous amino acids such as Gly and Ala, Val, Leu and lie, Asn and Gln, Cys and Met, or Lys and Arg, etc. 14 It is understood that the binding activity as an antibody is easily maintained.
- amino acids at some positions in the framework region can directly interact with the antigen, for example, contact non-covalently, and these positions are also subject to the above substitution.
- the amino acids at positions 26 to 30 are said to be contained in a hypervariable loop in terms of steric structure (Chiyotia and Resque, J. Mo 1. Biol., 196: 901-917 (1987)), and in that sense, It can be transplanted in the same way as CDR.
- a humanized antibody is prepared based on the obtained amino acid sequence. For example, from the above From the determined amino acid sequence, the humanized antibody gene sequence is determined, and a gene encoding a humanized monoclonal antibody is prepared. Specifically, the DNA encoding the CDR is deleted from the gene in the human V region, and instead, a DNA encoding the CDR derived from rat is inserted. Furthermore, in accordance with the amino acid to be changed by molecular modeling, the corresponding DNA sequence is changed by site-directed mutagenesis using PCR or the like to produce a recombinant human V region gene. This is cloned into a vector containing the C region of the heavy and light chains of a human antibody to obtain an expression vector.
- the expression vector introduces a gene into mouse spleen cell Sp 2-0-ag 1 (ATCC CRL 1581) or hamster ovary cell CH ⁇ for expression.
- Humanized antibodies have at least three potential advantages over rat antibodies and, in some cases, over chimeric antibodies for use in human therapy.
- the effector moiety is human, it may interact better with other parts of the human immune system (eg, complement dependent cytotoxicity (CDC) or antibody dependent cellular cytotoxicity).
- CDC complement dependent cytotoxicity
- antibody dependent cellular cytotoxicity e.g., antibody dependent cellular cytotoxicity
- ADCC ADCC for more efficient destruction of target cells
- the human immune system does not recognize the framework or C region of the humanized antibody as foreign and therefore the antibody response to such injected antibodies is entirely foreign Mouse antibodies or partially foreign Less than chimeric antibodies.
- Injected mouse antibodies have been reported to have a circulating half-life in the human body that is much shorter than that of normal antibodies (Show, D. et al., J. Im. mun o 1. 138: 4534-4538 (1987)).
- the injected humanized antibody will likely have a half-life closer to that of the naturally-occurring human antibody, and may give smaller or less frequent doses.
- the antibody of the present invention specifically binds to human CD14 and inhibits the binding between CD14 and TLR. Since it has the function of suppressing lignin, it can be used for treating or preventing diseases associated with bacterial infection. For example, it is useful for treating or preventing inflammatory cytokines associated with diseases such as sepsis, especially symptoms associated with elevated TNF levels in the blood, and more specifically fever, hypotension, leukopenia, and platelets It is useful for treating or preventing symptoms such as hypotension, shock and multiple organ failure. Further, the substance causing cell activation suppressed by the antibody of the present invention is not limited to LPS alone. For example, it suppresses cell activation of CD14 which has formed a complex with LTA, PGN or mycoplasma. In other words, it is useful for treating or preventing diseases caused by these as described above.
- the antibody of the present invention has a function of specifically recognizing an epitope containing a part of the region from human 269 to 315 of human CD14, it is useful as a tool for qualitatively or quantitatively determining human CD14.
- this is a measurement method in which an antigen-antibody complex is formed by contacting a sample with the antibody of the present invention, and then the complex is detected or quantified.
- the sample is exemplified by serum, urine, body fluid or culture supernatant.
- Examples of the method for detecting or quantifying the antigen-antibody complex include the ELISA method and the RIA method.
- a second aspect of the present invention is a hybridoma that produces the monoclonal antibody of the present invention.
- the hybridoma of the present invention can be used in the method described in the first aspect of the present invention. Can be manufactured.
- a preferred example of the hybridoma of the present invention is a hybridoma F1024-1-3 (FERM BP-7511) that produces a F1024-1-3 antibody, which is a preferred example of the antibody of the present invention.
- the third embodiment of the present invention is a peptide comprising eight or more consecutive amino acids in the region from CD No. 269 to CD No. 315 of CD14 shown in SEQ ID NO: 1.
- it is a peptide containing eight or more consecutive amino acids in the region from position 285 to position 307.
- it is preferably a peptide consisting of 10 or more consecutive amino acids, particularly preferably 15 or more consecutive amino acids.
- the peptide of the present invention can be produced by the method described in the first embodiment of the present invention.
- a fourth aspect of the present invention is a method for producing an antibody which is a binding inhibitor between CD14 and TLR, which comprises using the peptide of the third aspect of the present invention as an immunogen.
- Preferred examples of peptides used as immunogens are examples of preferred peptides of the third aspect of the present invention.
- Confirmation that the prepared antibody is a binding inhibitor between CD14 and TLR can be performed, for example, by the method described in Example 2.
- a DNA comprising a nucleotide sequence encoding a CDR having an amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7 or 8 is converted to a human antibody gene.
- a method for preparing an anti-CD14 humanized antibody which comprises incorporating the vector into a vector containing the same and causing a host cell to produce the anti-CD14 humanized antibody.
- Anti-CD 14 of the present invention The method for preparing a humanized antibody is as follows: a DNA containing a nucleotide sequence encoding a CDR having an amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8 is converted into a vector containing a human antibody gene.
- a DNA comprising a nucleotide sequence encoding a CDR having the amino acid sequence of SEQ ID NOs: 3, 4, 5, 6, 7, and 8 is incorporated into a vector containing a human antibody gene, and the host cell To produce anti-CD14 humanized antibodies.
- a molecule obtained by grafting a CDR having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7 or 8 into a human antibody variable region is modeled, and a CDR is generated on a computer. It is preferable to determine the amino acid sequence of the anti-CD14 humanized antibody by optimizing the amino acid sequences of the CDR and the framework region (F) by simulating the three-dimensional structure of the antibody and the framework region (FR).
- the vector containing the gene of the human antibody encoding at least the heavy or light chain constant region of the amino acid sequence of the anti-CD14 humanized antibody determined in this manner contains SEQ ID NO: 3, 4, 5, 6, 7, or A CDR having the amino acid sequence described in 8 and a DNA encoding an optimized or changed FR or a part of the FR may be incorporated.
- a part of FR includes not only a continuous amino acid sequence of a part of FR but also a discontinuous amino acid sequence to be replaced for optimization.
- the method of optimizing the amino acid sequence to prepare a humanized anti-CD14 antibody also involves grafting a CDR having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8 into a human antibody variable region.
- the molecule is modeled and optimized, it is included in the present invention. It is preferable to model a molecule in which a CDR having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7 or 8 is transplanted into a human antibody variable region.
- a host cell produces an anti-CD14 humanized antibody.
- a nucleotide sequence encoding a CDR having the amino acid sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8 is shown in FIG.
- An example of a nucleotide sequence encoding the heavy and light chains including FR is shown in FIG.
- Confirmation that the prepared humanized antibody is a binding inhibitor between CD14 and TLR can be performed, for example, by the method described in Example 2.
- a sixth aspect of the present invention is a method for screening a therapeutic agent for sepsis, which comprises a step of contacting CD14, TLR and a test substance.
- the screening method for a therapeutic agent for sepsis is a method for examining whether a test substance is a therapeutic agent for sepsis or a candidate for a therapeutic agent for sepsis.
- the screening method of the present invention includes a step of contacting CD14, TLR and a test substance.
- Examples of the CD14 source in the screening method of the present invention include CD14 expressed in cells, sCD14 present in blood or the like, and sCD14 produced by a genetic recombination method.
- CD14 expressed in cells may be expressed in cells by genetic recombination.
- S CD 14 may be a modified form of s CD 14 containing at least 269 to 315 of human CD 14, and may be a modified form.
- CD 14 is the full length.
- TLR source TLR-expressing cells, created by genetic recombination TLR and the like.
- TLR expressed in cells may be expressed in cells by genetic recombination.
- the CD14 and TLR sources may be the same cells.
- CD14 activator In the step of contacting CD14, TLR and a test substance, it is preferable to simultaneously contact a CD14 activator. This is because the activated CD 14 easily binds to the TLR by the CD 14 activator.
- the CD14 activator is not particularly limited as long as it has a function of forming a complex by binding to CD14 and activating CD14.
- a cell component such as LPS or LTA, mycoplasma and the like can be mentioned.
- the step of bringing CD14, TLR and the test substance into contact is not particularly limited as long as they are in contact with each other. For example, contact directly in a solution, immobilize CD14 or TLR on a plate, etc., mix the others in the solution and add to the plate, or add others to the culture of cells expressing CD14 or TLR And so on.
- the order of contacting CD14, TLR and the test substance, and the CD14 activator is not particularly limited. For example, contact these at the same time, contact CD 14 activator and CD 14 first, before contacting CD 14 activator and CD 14 with TLR, CD 14 activator and CD 14 and test substance And the order of contact.
- the determination of whether or not the test substance is a therapeutic agent for sepsis is not particularly limited. For example, by directly observing the binding between CD14 and TLR, if the test substance inhibits the binding, or depending on the degree of inhibition of the binding, it is determined to be a therapeutic agent for sepsis. Or determination or selection by measuring the activation of cells expressing CD14 or TLR.
- the test substance is not particularly limited.
- examples thereof include antibodies such as anti-CD14 antibody, polypeptides such as CD14-modified polypeptide, low molecular weight compounds and the like.
- the screening method of the present invention a therapeutic agent for sepsis can be easily selected. That is, the screening method of the present invention is useful as a simple and convenient method for screening for an effective component of a pharmaceutical composition for sepsis.
- a seventh aspect of the present invention is a pharmaceutical composition for sepsis, comprising an inhibitor of the binding between CD14 and TLR as an active ingredient.
- the binding inhibitor of CD14 and TLR contained in the pharmaceutical composition of the present invention is an agent that inhibits binding of CD14 directly to TLR, or a complex in which CD14 binds to TLR via a third substance.
- the agent is not particularly limited as long as it is an agent that inhibits the formation of etc. In addition, its inhibition mechanism is not limited.
- an inhibitor that suppresses the cell activation of TLR-expressing cells by 30% or more is preferable as the inhibitory ability.
- NF- of TLR-expressing cells in the presence of antibody concentration of 3 gZml or more, 1 ⁇ ? 3 of 181111 and 0.5 g / m1 of exogenous CD14, Inhibitors that suppress the activation of ⁇ by 30% or more are preferred. More preferably, it is an inhibitor that suppresses more than 40%.
- the titer of the substance obtained by the above-described screening method is preferably a titer that suppresses cell activation of TLR-expressing cells by 30% or more.
- a titer that suppresses NF- ⁇ B activation of TLR-expressing cells in the presence of 3, 0.5 g / ml of exogenous CD 14 by 30% or more is preferable. More preferably, the titer is 40% or more.
- a binding inhibitor between CD14 and TLR inhibits the binding between CD14 and TLR, thereby signaling from CD14 to TLR. Because it is inhibited, signal transduction after TLR is blocked, suppressing cell activation and showing a therapeutic effect on sepsis.
- the pharmaceutical composition of the present invention is useful for treating or preventing a disease associated with bacterial infection.
- a disease associated with bacterial infection For example, sepsis, rheumatoid arthritis, AIDS, autoimmune disease, hemolytic anemia, tumor, atopic disease, allergic disease, sarcoidosis, malaria, psoriasis, fever, hypotension, leukopenia, thrombocytopenia, shock and multiple organs It is useful for failure.
- it is useful for treating or preventing inflammatory cytotoxicity associated with these diseases, particularly symptoms associated with an increase in blood TNF concentration.
- a binding inhibitor of CD14 and TLR may contain various chemically acceptable additives.
- carriers, excipients, stabilizers, lubricants, coloring agents, disintegrants, preservatives, isotonic agents, stabilizers, dispersants, antioxidants, interference agents, preservatives, suspending agents It may contain, as appropriate, emulsifiers, suitable solvents generally used (sterilized water, vegetable oil, etc.), and physiologically acceptable solubilizers.
- the pharmaceutical composition of the present invention may contain an antibiotic, a steroid, various cytotoxic antibodies, an anticoagulant factor, or the like. These show an additive effect or a synergistic effect with the antibody of the present invention as an active ingredient, and can be a more effective pharmaceutical composition.
- the dose when the pharmaceutical composition of the present invention is administered as a drug is not particularly limited.
- the dose is preferably 0.1 mg / kg or more. More preferred is a dosage of 1-1 O mg / kg.
- the dosage form is preferably a suppository, an inhalant, particularly an injection.
- parenteral administration is preferred. Examples of parenteral administration include injections such as intravenous administration, intraarterial administration, subcutaneous administration, and intramuscular administration, and also include rectal administration, transdermal absorption, and transmucosal absorption. The timing or frequency of administration depends on the condition of the patient, and examples include prophylactic administration, single administration or continuous administration, and the like.
- the present invention also discloses a modified CD14 polypeptide having a function of inhibiting the binding of CD14 to TLR, and which is either of the following (1) or (2).
- the N-terminus of the amino acid sequence described in SEQ ID NO: 1 is any one of the 1st to 6th amino acids, and the C-terminus has any of the amino acid sequences of the 24th to 36th amino acids, (2)
- the N-terminus of the amino acid sequence described in SEQ ID NO: 1 is any of 1st to 6th, the C-terminus is any of 269th to 356th, and at least one of the 269th to 307th amino acids is Has an amino acid sequence substituted with another amino acid.
- CD14 is a non-human species of CD14. It may be a peptide.
- a CD14 variant polypeptide j is a polypeptide in which a part of the CD14 polypeptide has been deleted, a polypeptide in which a part of the amino acids of the CD14 polypeptide has been substituted, and a CD14 polypeptide. Includes polypeptides with added amino acids, and also includes modified polypeptides in which these modifications are combined.
- the polypeptide of the present invention has a function of inhibiting the binding between CD14 and TLR.
- the details of the function of inhibiting the binding between CD14 and TLR are as described in the first embodiment of the present invention.
- polypeptide of the present invention is preferably a polypeptide that suppresses cell activation of TLR-expressing cells by 30% or more.
- TLR expression in the presence of exogenous CD14 of 1 ⁇ ? 3 of 1 1111 and 0.5 ⁇ gZm 1 at a polypeptide concentration of 1 ⁇ / ig gml or less Inhibits NF- ⁇ B activation or IL-18 production in cells by 30% or more are preferred. More preferably, it is a polypeptide that suppresses by 40% or more. More preferably, it is a polypeptide that suppresses 50% or more. Particularly preferred are polypeptides that inhibit more than 70%.
- the CD14 variant polypeptide of the present invention is preferably a polypeptide which does not itself induce endothelial cell cytokines in the presence of LPS.
- a polypeptide that does not induce IL-6 production of endothelial cells in the presence of 1 Ong / ml LPS when the concentration of the polypeptide is 300 ng / ml or less is preferable.
- No induction means that IL-6 measured in the Atsushi system is below the detection limit. For example, in measuring IL-16 production,
- modified CD14 polypeptide of the present invention is preferably a polypeptide which suppresses the production of cytosolic force in endothelial cells by exogenous LPS / CD14 to 60% or less.
- the concentration of the polypeptide was greater than 300 ng / m 1, and the IL-1 of endothelial cells in the presence of 1 ⁇ ? 3 of 10118 /] 111 and 300 ng of 6
- a polypeptide that suppresses production to 60% or less is preferred. More preferably, it is a polypeptide that suppresses it to 40% or less.
- LPS / CD 14 is a complex in which LPS and CD 14 bind.
- a CD14 variant polypeptide having a C-terminal at any of positions 246 to 285 is preferable.
- Sa More preferably, it is a polypeptide having a C-terminus at position 246 or position 285.
- the C-terminus is any one of positions 269 to 356, and at least one of the amino acids 269 to 286 is at least one of other amino acids.
- CD14 variant polypeptides that have been substituted with the amino acids Leu, Ala, A3 or 01. More preferably, Leu, A1a, wherein the C-terminus is any one of positions 284 to 356, and at least one of the amino acids 284 to 286 is another amino acid.
- CD14 variant polypeptide with 3 or 01 substitution is preferred.
- the polypeptide of the present invention binds to bacterial cell components.
- the binding site for LPS on CD14? -14th and 57-64th, and the sequence at that position is the same as the polypeptide of the present invention.
- polypeptide of the present invention maintains its function
- 1 to 6 amino acids at the N-terminal may be deleted, substituted, inserted or added.
- a polypeptide further having a Met added to the N-terminus is also included in the polypeptide of the present invention.
- one or several amino acids may be deleted, substituted, inserted or added.
- polypeptides of the present invention may be modified with any modifications, as long as they do not lose their characteristics. Good.
- modifications include a translation process or a post-translational modification and a chemical modification of a polypeptide which may be subjected to a process in which the protein is produced by culturing animal cells or eukaryotic cells such as yeast.
- a method for producing the polypeptide of the present invention is disclosed.
- Transformants are prepared, cultured, and gene amplification and expression induction are performed as necessary. Next, the culture mixture is recovered, and if necessary, the polypeptide of the present invention is purified by appropriately combining operations such as concentration, solubilization, dialysis, and various kinds of chromatography.
- “Culture mixture” refers to a transformant, a medium containing the transformant, or a culture supernatant or lysate of cells.
- the polypeptide when the produced polypeptide of the present invention is secreted into the cell culture supernatant, the polypeptide can be purified from the culture supernatant.
- one suitable for the host cell is appropriately selected from lysozyme treatment, detergent treatment, freeze-thaw, pressurization, ultrasonic treatment and other methods. After lysing or disrupting the cells, the polypeptide is recovered as a soluble fraction or an insoluble fraction by a method such as centrifugation or filtration, and purified.
- nucleotide sequences of the DNA encoding the polypeptide of the present invention are shown in SEQ ID NOs: 9 to 11.
- Recombinant vectors can be obtained by ligating the DNA with another DNA fragment having an arbitrary nucleotide sequence, or by introducing the DNA into an arbitrary vector (Sambrook J., et al., Molecular Clon. , a Labo rato ry
- the vector may be any vector such as a plasmid vector, a phage vector, a virus vector, or a commercially available product.
- Representative vectors are pUC118, pBR322, pSV2-dhfr, pBluescriptll, PHIL-SI, ⁇ ZapII, ⁇ gt10, pAc700, YRP17, pEF-BOS , PE FN-II and the like.
- a transformant can be obtained by introducing the above-described recombinant vector into a host cell or microorganism.
- the transformant of the present invention may be a transformant of a prokaryotic cell or a eukaryotic cell.
- Prokaryotic cells include Escherichia coli and Bacillus subtilis.
- Examples of eukaryotic cells include mammalian cells such as COS cells, CHO cells, He La cells, and Namalwa cells, as well as insect cells such as Sf cells and yeast. Of these, transformants obtained by transforming Escherichia coli, mammalian cells, and yeast are preferred because they are easy to handle and high expression levels can be expected.
- the copy number of the gene can be increased in mammalian cells, it is preferable to use a dhfr-deficient strain of CHO cells as a host.
- a dhfr-deficient strain of CHO cells As a host.
- yeasts the secretory production of foreign proteins is large, so that yeasts of the genus Pichia and Schizos ac cha romyc espomb e, whose additional sugar chains are similar to mammals, are used as hosts. Is preferred.
- the culture of the transformant can be performed by a general method with reference to various written books (for example, “Microbial Experiment Method” edited by The Biochemical Society of Japan, Tokyo Chemical Co., Ltd., 1992, See).
- an appropriate drug is selected and used depending on the incorporated promoter.
- the trp promoter is incorporated, 3] 3-indoleacrylic acid is used.
- the MMTV promoter dexameezone is used.
- AOX1 promoter methanol is used.
- a typical example of a method for amplifying a gene includes a method using methotrexate when a dhfr-deficient CHO cell is used as a host and a vector having dhfr is used.
- the transformant used in the production method is not limited as long as it is the transformant of the present invention.
- the transformant is any one of mammalian cells such as COS cells and CHO cells, yeast, or Escherichia coli. It is preferable that the transformant uses a cell selected from the above as a host.
- a transformant obtained by transforming a mammalian cell such as a CHO cell with a recombinant vector having an EF1 ⁇ promoter is cultured in a DMEM medium containing 10% fetal bovine serum.
- Cells are inoculated at a concentration of about 1 to 10 ⁇ 10 4 cells Zm 1 and cultured under the conditions of 37 ° C., 5% carbon dioxide, and 95% air.
- the cells become confluent after 2-3 days, at which point the medium is replaced with serum-free D-MEM.
- a culture mixture containing the target protein can be obtained.
- a dh fr-deficient CHO cell is used as a host, and a vector having dh fr is used.
- an appropriate method is appropriately selected from the methods usually used for purifying polypeptides.
- 3C10 5 mg of purified anti-human CD14 monoclonal antibody 3C10 (purchased from ATCC, prepared and purified by usual methods) was used for Hitrap NHS-activated (Amersham Pharmacia)
- the 3C10 binding affinity column was prepared by binding to the resin according to the manual.
- Soluble CD14 was added to the prepared column with human serum (purchased from Nippon Biotest) lO OmL, followed by washing with phosphate buffer (pH 7.4) (hereinafter referred to as PBS) .
- the column was eluted from the column with 0.1 M daricin hydrochloride buffer (pH 3.0), and concentrated using DiaFlo-1 (Grace Japan).
- Wistar rat purchased from SLC
- Female An 8-week-old foot pad was administered with a 100: 1 mixture of purified soluble CD14 and Freund's complete adjuvant (Difco) at a ratio of 1: 1. Bone lymph nodes were removed and lymphocytes were aseptically collected.
- the obtained lymphocytes were mixed with mouse myeloma cells SP2 / ⁇ _Ag14 (ATCC CRL1581) at a ratio of 5 to 1, and cell fusion was carried out using polyethylene glycol 1500 (Sigma). After the fusion, the cells were suspended in 10% fetal serum / RPM 11640 containing hypoxanthine, aminopterin, and thymidine, and seeded on a 96-well plate (Nunc).
- DAK0 peroxidase-labeled anti-rat immunoglobulin antibody
- the selected hybridomas are cloned by limiting dilution (introduction to the monoclonal antibody experiment procedure, Tamami Ando and Takeshi Chiba / Kodansha), and screened 10 days later in the same manner to produce anti-CD14 antibody. Seventeen hybridoma clones were obtained.
- the hybridoma was cultured in RPMI 1640 containing 10% fetal calf serum, and then the cells were collected and antibody production was performed using Hybridoma-SFM (Gibco) to obtain a culture supernatant containing the monoclonal antibody. After removing the cells from the culture supernatant with a filter paper, the cells were purified with a protein G column (Prosep-G, Millipore) to obtain 17 types of purified human CD14 antibodies.
- a protein G column Protein G column
- TLR4 cDNA Since human TLR4 cDNA has a translation region of about 2.5 kb (Genbank accession N0.AF17765), cloning of TLR4 cDNA separates 1.1 kb on the 5 'end and 2.3 kb on the 3' end. I went to.
- a sense primer 1 (tcgaggaagagaagacacca) and an antisense primer 1 (ccatccgaaattataagaaaagtc) were designed. Cycle at 98 ° C for 10 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute PCR was performed 30 times repeatedly.
- a sense primer 2 (cccatccagagtttagccct) and an antisense primer 2 ccaagcttt ggaattactcacccttagcc) were designed, and human spleen (human spleen) cDNA (CLONTECH) was subjected to PCR in the same manner as type III. .
- human spleen human spleen cDNA (CLONTECH) was subjected to PCR in the same manner as type III.
- the amplified DNA fragment was inserted into the Eco RV site of pBluescript IISK (+) (STRATAGENE) to confirm the nucleotide sequence of the obtained TLR4c DNA.
- the 5 'end and 3' end of the TLR4 cDNA were ligated at the EcoRI site 856 bp downstream of the translation initiation codon, and the expression vector of honey cell pcDNA3 .1 (-) (Invitrogen) to prepare a human TLR4 expression plasmid pCDNAT4.
- Plasmid PCDNAT4 prepared in 1 was introduced into HEK293 cells (ATCC), a cell line derived from human fetal kidney, by the following method. That is, FuGENE6 (Roche Diagnostics) 251 was mixed with 6.3 (g of pCDNAT4) according to the attached protocol and added to HEK293 cells grown in a semi-confluent in a 75 cm 2 flask. After culturing for 24 hours under conditions of 5% C ⁇ 2 and 37 ° C., the cells were detached, and resuspended in DMEM medium containing 1.2 mg of G418 (GIBCO-BRL) and 10% inactivated FBS. Thereafter, the medium was exchanged twice a week, and the culture was continued for 20 days to obtain a G418-resistant strain T4-14.
- G418-resistant strain T4-14 a G418-resistant strain
- T4-14 cells are suspended in DMEM medium containing 10% inactivated FBS, seeded at 1 ⁇ 10 5 cells / well in a 24-well plate, and 5% C ⁇ 2 , 37 For 24 hours. Then, 100 ng / well of reporter gene pNFKB-Luc (CL0NTECH) was introduced using Fu GENE 6, and the culture was continued for another 24 hours. LPS (E.
- coli 055: B5, Difco) at a final concentration of 1 ag / m1, sCD14 (1--356) at a final concentration of 0.5 xg / ml, and anti-CD14 antibody 3C10 or Examples Add the anti-CD14 antibody obtained in Step 1 to a final concentration of 1-10 ag / m1 and continue culturing for 6 hours. Then, lyse the cells with Passive Lysis Buffer (Promega) and luciferase (Luc if erase) The activity was measured using a Luc if erase Assay System (Promega) according to the attached protocol. As a result, as shown in Fig. 1, the F1024-1-3 antibody, which inhibited the activation of NF- ⁇ B by about 50% in a 10 g / m1 antibody-added system, as shown in Fig. Obtained.
- the binding of the F1024- 1-3 antibody to human CD14 was inhibited by 52% in puppies, 30% in dogs, 44% in lizards, 57% in linden cubs, and 83% in humans.
- the 1024_1-3 antibody was shown to show cross-reactivity with CD14 from egrets, dogs and monkeys.
- the cells were suspended in ImL of 5% bovine serum / 0.1% EDTAZPBS- and F1024-1-3 antibodies were preincubated with 275 ng of human CD14 (1-356) F1024_1-3.
- the antibody and rat IgG were added to a final concentration of 1 gZmL each, and reacted at 4 ° C for 1 hour.
- Cell suspension 0.25% bovine blood
- Ki-ZP BS- the cells were resuspended in a 1000-fold diluted FITC-labeled anti-rat antibody (DAK0) and reacted at 4 ° C for 30 minutes.
- DAK0 FITC-labeled anti-rat antibody
- perch monocytes were stained with the F1024-13 antibody, and pretreatment with human CD14 inhibited the staining. No staining was observed with the control antibody (rat IgG). Therefore, it was confirmed that the F1024-1_3 antibody binds to egret CD14 on monocytes.
- IL-6 was measured according to the protocol attached to the human IL-6 EIA kit. That is, the culture supernatant 100 1 was placed on the IL-16 antibody-immobilized plate. Transferred and incubated at 37 ° C for 60 minutes. Thereafter, the reaction solution was removed, washed four times with 400 1 / well of Wash Buffer 2, and an anti-human IL-16 antibody was added thereto at 100 1 / well, followed by incubation at 37 ° C for 30 minutes. After removing the reaction solution and washing four times with 400 1 / ⁇ of Wash Buffer 2, 100/1 / ⁇ of a peroxidase-labeled streptavidin solution was added, followed by incubation at 37 ° C for 30 minutes.
- TMB chromogenic substrate
- Fig. 4 shows the results.
- the amount of IL-16 produced when no antibody was added was defined as 100%.
- F1024-1-3 and 3C10 antibodies exhibited IL-16 production inhibitory activity, but F1024-1-3 antibody inhibited more than 60% at 0.3 g / mL. did.
- the 3C10 antibody had less inhibition than the F1024-1-3 antibody. It was revealed that the F1024-1-1_3 antibody was superior to the 3C10 antibody in inhibiting inflammatory cytokine production of endothelial cells.
- Example 5 Measurement of suppression of IL-16 production after formation of LPS / CD14 complex system of F1024-1-3 antibody
- 900 ng / ml F1024-1-3 antibody or 3C10 antibody 401 was added to the LPS / CD14 mixture, and the mixture was added to the cells. After further culturing for 20 hours, IL-16 in the culture supernatant was measured using a human IL-6 EI II kit (PE Biosystems).
- IL-16 The measurement of IL-16 was performed according to the protocol attached to the human IL-6EIA kit.
- control antibodies rat IgG and 3C10 antibodies were purified samples.
- Figure 5 shows the results.
- the amount of IL-16 produced when no antibody was added was set to 100%.
- the F1024-1--3 antibody exhibited IL-6 production inhibitory activity, but the 3C10 antibody was comparable to the control antibody and did not inhibit IL-6 production after LPSZCD14 complex formation.
- the F1024-1-3 antibody has an inhibitory effect on inflammatory cytokine production even after the formation of LPSZCD14 complex in endothelial cells. Therefore, patients after LPS has already entered the body, that is, sepsis It was clarified that the effect of improving symptoms could be expected even for patients who were judged to be.
- Example 6 Binding Test of F1024-1-3 Antibody to LP SZCD 14 Complex
- the effect of the anti-CD14 antibody on the binding between CD14 and LPS on the cell membrane was analyzed by flow cytometry.
- the human monocyte cell line THP-1 was cultured for 48 hours in 40 ng Zm1 and 25-dihydroxyvitamin D3 (Funakoshi) for 48 hours to induce differentiation, and then 10 ig / m1
- the cells were incubated at 37 ° C for 30 minutes in a medium (containing 10% 83? 11640) with or without anti-CD14 antibody (3C10 or F1024-1-3 antibody). After that, FI TC labeled LPS
- Fig. 6 shows the results. As shown in Fig. 6, the specific fluorescence observed by LPS binding to CD14 was completely suppressed by the 3C10 antibody, but was only partially suppressed by F1024-1-3 and F1024- It was shown that the 1-3 antibody did not suppress the binding of LPS to CD14.
- the human kidney-derived cell line U-373MG (ATC C) was detached with PBS containing 0.05% Tripsin and 0.53 mM EDTA, and suspended in RPMI 1640 medium (Asahi Techno Glass Co., Ltd.). And 3 ⁇ 10 4 cells / we 11 (100 l Zwe 11) were inoculated into a 96-well plate and cultured at 37 ° C. under 5% CO 2 for 24 hours.
- RPMI 1 640 medium was added to 70 1, 1 / m 1 (w / v) of Staphylococcus aureu scellsuspendion (Sigma) 10 ⁇ 1, 5 ⁇ g / m1 of sCD14 (1-3 56) was added to the wells with 101 and 10 g / m1 of F1024-1-1-3 antibody 101, and the cells were further cultured for 20 hours.
- the measurement was performed using a uman IL-6 EIA kit (IL-6Eli-pair: GI BCO BRL).
- SCD14 (1-356) was added instead of the CD14 variant polypeptide, F1024_1-3 antibody.
- the measurement of IL-6 was performed according to the protocol attached to human IL-6 EI Kit. That is, the culture supernatant 501 diluted 4 times with 1% (w / v) BSA / PBS (-) was transferred to an IL-6 antibody-immobilized plate, and the biotinylated anti-human IL-16 antibody 501 was added. In addition, it was incubated at 37 for 60 minutes. Thereafter, the reaction solution was removed, washed with 0.05% (v / v) Tween-20 / PBS (-) of 400 1 Zwe 11 three times, and the peroxidase-labeled streptavidin solution was added to 100 1 / we11 was added, and incubation was further performed at 37 ° C for 20 minutes.
- a chromogenic substrate TMB
- a stop solution 1M HC1
- the absorbance at a wavelength of 450 nm was measured, and the amount of IL-16 produced in the sample was calculated.
- the IL-16 production inhibitory activity of the F1024-113 antibody was 55.2%.
- LPS-loaded Egret sepsis model was obtained by using LPS (Salmonella minnesota Re595, Sigma) in New Zealand white according to the method of Schi et al. (Proc. Natl. Acad. Sci. USA, 95: 13875, 1998).
- Species (2. 1-2. 4 kg, Kitayama Labes) were prepared by injecting 5 g Z kg from ear vein every 0, 5, 24 hours.
- the protocol of the pre-administration group administered the F1024-1-3 antibody 2.5 mg / kg every 1, 4, and 23 hours from the ear vein, and the control group received the saline in place of the antibody.
- the animals were divided into groups according to body weight, and five birds were selected from each group, and pre-blood sampling was performed at _1 hours.
- blood was collected every 1, 3, 5, 7, 23, 25, 28, and 48 hours, and the body weight, white blood cell count, serum GPT value, serum creatinine value, and serum TNF o; value were measured.
- the leukocyte count was measured by Sysiiiex F-280 (Toa Medical Electronics), and serum GPT and serum creatinine were measured by DRI-CHEM5000 (FUJI FILM).
- TNFa was isolated from 929 cells (8 chops (0: 0.25% trypsin / PBS-, 5.5 x 10) after detachment with 929 cells according to the method of David et al. (Journal of Immunological Methods, 68: 167, 1984). 5 resuspended in cells / mL, 5. 5 X 1 0 were seeded in plates at a cell Z Ueru.
- TNF standard human TNF, Mochida
- Akuchinomaishin D (Sigma) such that the GZmL, were incubated for 20 hours at 37 ° C, 5% C0 2 below.
- Table 1 shows the improvement of the mortality and the various parameters of the F1024-1_3 antibody in the LPS-loaded ⁇ heron sepsis model after the previous administration.
- LTA / PepG was administered instead of LPS, and the effect of the F1024-1_3 antibody on improving leukopenia was examined. That is, 1024-1-3 antibody (2.5 mg / kg) or saline was administered to New Zealand white species (2.1-2.4 kg, Kitayama Labes), and 1 hour later, LTA (Sigma) and PepG (Fluka ) 160 g / mL was administered via the ear vein.
- an LPS-loaded ⁇ sagi sepsis model was prepared.
- the protocol of the post-administration group was administered F1024_1-3 antibody at 2.5 mg / kg via the ear vein every 4 to 23 hours, and the control group was administered saline in place of the antibody.
- pre-bleeding was carried out 11 hours later from 5 herons in each group.
- LPS was administered according to the protocol, and blood samples were collected every 1, 3, 5, 7, 24, 26, 28, and 48 hours, and the body weight, white blood cell count, serum GPT value, and serum creatinine value were similarly measured. It was measured.
- Table 2 shows the improvement of various parameters in the post-administration of LPS-loaded ⁇ heron sepsis model of F1024-1-3-antibody.
- peptide 13 The sequence from position 316 to position 328 described in SEQ ID NO: 1 was selected as a CD14-specific peptide having a high molecular weight of 49 kDa and used for immunization (hereinafter referred to as peptide 13).
- cysteine was inserted at the C-terminus in order to bind the selected peptide to the carrier protein via the SH group at the C-terminus.
- Peptide synthesis was performed using an ABI 432 A peptide synthesizer (Applied). The peptide is cut out from the resin by a standard method, and the peptide is extracted using C18 ffiHPLC (CAPCELL—PAK, Shiseido). Was purified.
- the peptide prepared in (1) was dissolved in distilled water at 1 Omg / mL, and mixed with an equivalent amount of 1 Omg / mL maleimidated keyhole limpet with Mosyanin (KLH, PIERCE). After reacting at room temperature for 2 hours, the mixture was desalted with a NAP-10 column (Pharmacia) to obtain a peptide 13 carrier antigen (hereinafter referred to as peptide 13-KLH). The protein concentration was obtained by dividing the used KLH amount by the liquid amount.
- the recombinant human CD14 protein purified with a 0.01M carbonate buffer (pH 9.5) was diluted to 1 gZmL, and 50 L was added to each well of an immunoplate (Maxisorb, NUNC). After reacting at 37 ° C for 1 hour, the plate was washed 5 times with ion-exchanged water, and 100 L of PBS containing 0.5% BSA was added to each well to perform blocking. Next, the culture supernatant sampled from the selected hybridoma was added to each well, reacted at 37 ° C. for 1 hour, and washed three times with a physiological saline solution containing 0.05% Tween 20.
- Peroxidase-labeled anti-rat immunoglobulin antibody was diluted 1000-fold with PBS containing 10% egret serum, and 50 L was added to each well. After reacting for 1 hour at 37, the wells were washed 5 times in the same manner, and a tetramethylbenzidine solution containing 0.01% hydrogen peroxide was added to each well. At room temperature After the reaction for 10 minutes, the reaction was stopped with a 0.5 M sulfuric acid solution, and the absorbance at 450 nm was measured with a plate spectrophotometer (NJ-2100, Nippon Intermed).
- a well (F1025-4-1) containing a hybridoma that reacted with the high-molecular-weight CD14 protein was selected and cloned by the limiting dilution method.
- the selected hybridomas are cultured in 10% FCS / RPM I-1640 medium (GI BCO), and then cultured in Hybridoma SFM medium (GI BCO) to produce the antibody.
- the antibody was purified using i op rossesing).
- the subtype of the purified F1025-4-1 antibody was rat IgG1 / ⁇ .
- TLR4-COS the supernatants of COS-1 cells expressing the TLR4 molecule on the cell membrane
- PBS- PBS- (Sigma).
- the cells were washed twice.
- 5 ml of a 1% EDTA / PBS solution was added, and after gentle stirring, the cells were peeled off from the culture flask using a cell scraper (COSTAR) and collected in a 5 OmL centrifuge tube. Wash the flask with an additional 5 mL of PBS, add to a 5 OmL centrifuge tube, centrifuge at 1000 rpm for 10 minutes, precipitate the cells, discard the supernatant, and wash the cells twice more with PBS did.
- washed cells were filtered through a 40 m cell strainer (FALCON), and the number of cells was counted.
- the mixture was centrifuged once, diluted with PBS_ to a concentration of 5 x 10 5 ce 11 sZmL, and stored at 4 ° C.
- FITC-LPS (Sigma, Serotype Ollll: B4) diluted to 6 g / mL with PBS— (pH 7.4) and the recombinant sCD14 (1-356) prepared above at 300 g / mL The mixture was mixed 1: 1 and left at 37 for 30 minutes to form a complex. The formation of the complex was confirmed by an ELISA system using an anti-FITC antibody-immobilized plate and a peroxidase-labeled anti-CD14 antibody (F125-4-1) prepared in (1). That is, the anti-FITC antibody was immobilized on a plate at 10 / g / mL and blocked with 0.5% bovine serum albumin / 83_.
- FITC-LP SZCD14 complex three kinds of prepared samples of FITC-LP SZCD14 complex, FITC-LPS, and sCD14 were added to the antibody-immobilized well and reacted at 37 ° C for 1 hour. After washing each well, react with peroxidase-labeled anti-CD14 antibody diluted to 1 igZmL.After washing, react with TMB chromogenic substrate solution (BioFix, Funakoshi). The reaction was stopped with sulfuric acid, and the absorbance at 450 nm was measured. As a result, no increase in absorbance was observed with FITC_LPS and sCD14 alone, whereas the absorbance increased only with the FITC-LP SZCD14 complex, confirming that a complex was formed. .
- the prepared FI TC-L PS / CD 14 complex was bound on the chip, and then the F1024-1-1-3 antibody diluted to 130 gZmL with HBS-EP buffer was injected and immobilized. The antibody was bound to 14. Next, add TLR4-COS cells and COS cells as a control, and add TLR4-COS cells and COS The amount of cells bound was measured. The results are shown in Figure 10, where the height of the bar graph indicates the amount bound on the cell. That is, an increase in response was observed due to the binding of the LP SZCD14 complex to the cell. Next, no binding was observed in the COS cells since no response was observed. On the other hand, increased response (200 RU) was observed in TOLL4-COS cells, confirming the binding.
- the inhibition rate was calculated as follows: (Response of TLR 4-COS (TOLL 4-COS) cells without F1024-1-3 antibody) 1 ⁇ (Response of TOLL 4-COS cells when antibody F1024-1-3 antibody bound) 1) (Response of COS cells upon binding of F1024-1-3 antibody) ⁇ I (Response of TOLL4-COS cells without F1024-1-3 antibody) XI 00 (%).
- Example 10 Inhibition test of cytokine production in a human TLR4 expressing transformant HEKT4-14 obtained in Example 2 (1) was added to a 24-well plate with 0.8 X 10 5 eel I s / we 11 Implantation, as in Example 2 (2) The cells were stimulated with LPS / sCD14 in the presence or absence of F1024-1-3 or sCD14 (1-307) S286C prepared in Example 11 described later. After 20 hours, the culture supernatant was collected, and the amount of IL-18 produced in the supernatant was confirmed by EIA. As a result, both F1024-1-3 and sCD14 (1-307) S286C showed inhibitory activity in a concentration-dependent manner. (Fig. 11)
- SEQ ID NO: 16 was synthesized. That is, a peptide is synthesized using a peptide synthesizer (432A, Applied Biosystems) according to the usage, deprotected and cleaved according to a standard method, and HPLC is performed using a C18 column (CAPCELL-PAK, Shiseido). Purified. The purified fraction was collected, lyophilized, weighed, and dissolved in 1 OmgZml with distilled water.
- a plasmid pMl650 for expressing mCD14 in mammalian cells was constructed. From the plasmid pUCH14P-4 described in W98 / 39438, a DNA fragment of about 1.4 kb containing human CD14 cDNA was cut out with XbaI and Hindlll, and pCDNA3, a mammalian cell expression vector, was excised. 1 (I) was inserted into the XbaIZH indill site of (InV Itrogen).
- the amplified DNA fragment was subjected to doub1edigestion with XhoI and Apali and inserted into the XholZApaLI site of pM1650. After transformation of JM109 cells, the resulting colonies were confirmed by PCR to obtain a plasmid (PM1656) expressing the desired sCD14.
- the plasmid pM1656 prepared in step (1) was used as type III, and cycled with Pyrobest DNA Polymerase (TaKaRa) for 10 seconds at 98 t, 30 seconds at 55 ° C, and 1 minute at 72 ° C. Was repeated 30 times to perform a PCR reaction.
- TaKaRa Pyrobest DNA Polymerase
- the amplified DNA fragment was subjected to doubly-edition with XhoI and Hindlll, and separated and purified by 1% agarose gel electrophoresis.
- pM1656 was digested and purified with XhoI and Hindlll in the same manner, and the obtained DNA fragment of about 5.8 kb and the above PCR fragment were ligated at 1 igation.
- the resulting colonies were confirmed by PCR, and plasmids expressing the desired CD14 variant polypeptide (pM1658, pM1674, p1675, pM1676, pM1659, pM1660, pM1662, and pM16 61) was obtained.
- the plasmids ⁇ 1656, ⁇ 1658 to ⁇ 1662 and pMl674 to pM1676 prepared in (1) and (2) were introduced into COS-1 cells by the following method, and SCD14 (1-356), sCD14 ( 1—307), s CD 14
- the expression level of the CD14 variant polypeptide was measured by EIA using an anti-human CD14 antibody. That is, MEM-18, an anti-CD14 antibody (MONOSAN) diluted 200-fold with 10 mM NaHC03 buffer at pH 8.3, was added to a 96-well plate (Maxisorp, Nunc) at 501 / we11. At 4 ° C for 24 hours. Thereafter, the plate was washed with pure water and blocked with PBS containing 0.5% BSA (left standing at room temperature for 60 minutes).
- the absorbance at a wavelength of 450 nm was measured, and the production amount of the CD14 variant polypeptide of the sample was calculated.
- deletion portions are indicated by ⁇
- Plasmids for expressing ⁇ 57-64, ⁇ 180-234, ⁇ 235-282, and ⁇ 180-282 in mammalian cells were prepared in the same manner as in 1 and 2.
- the primers used for sense primers 7 to 11 were: sense primer 4 (SEQ ID NO: 27) and antisense primer 12 (SEQ ID NO: 28), and sense primer 5 (SEQ ID NO: 29) and antisense primer 12 (SEQ ID NO: 12).
- sense primer 14 and antisense primer 14 SEQ ID NO: 31
- sense primer 6 SEQ ID NO: 32
- antisense primer 13 for ⁇ 57-64
- sense primer 14 for ⁇ 180-234.
- Primer 4 and antisense primer 15 SEQ ID NO: 33
- sense primer 7 SEQ ID NO: 34
- antisense primer 13 for ⁇ 235-282
- sense primer 14 and antisense primer 16 SEQ ID NO: 35
- sense primer 8 SEQ ID NO: 36
- antisense primer 13 for ⁇ 180-282.
- sense primer 4 and antisense primer 17 SEQ ID NO: 37
- sense primer 9 SEQ ID NO: 38
- the obtained plasmid was introduced into COS-1 cells according to (3) to obtain a human soluble CD14 deletion variant.
- the expression level of the CD14 variant was measured by EIA using an anti-human CD14 antibody. That, pH 8. 3 of l Omm NaH C_ ⁇ 3 anti CD 14 antibody diluted 200-fold with buffer MEM- 18 (MONO SAN Co.) 96 ⁇ El plate (Max isorp, Nunc Co.) 50 i 1 / We the 11 was added, and the mixture was allowed to stand at 4 ° C. overnight. After that, wash with pure water and include 0.5% 838? Blocking was carried out at room temperature (rest for 60 minutes at room temperature).
- the absorbance at a wavelength of 450 nm was measured, and the production amount of the CD14 variant polypeptide of the sample was calculated.
- the molecular weight of the CD14 variant was measured using an anti-human CD14 antibody (3C10 and MEM-18). Confirmed by Western blotting used. Ie each CD 14 The 30 ng lane of the modified product was electrophoresed on SDS-polyacrylamide degraded gel (5-20% ATTO), and the protein was transferred to a PVDF membrane (Millipore Japan). A blocking reaction was performed for 1 hour at room temperature in 30 ml of PBS containing% skim milk, 10 / xg / ml of 3C10 and 100-fold diluted MEM-18 were added, and reacted at room temperature for 1 hour.
- sCD14 (1-307) amino acid-substituted variant in which the amino acid Leu at position 283 from the N-terminus of sCD14 (1-307) is substituted with A1a is referred to as "sCD14 (1-307)".
- 14 (1-307) L283A "and other human SCD14 (1-307) amino acid substitution variant polypeptides as well.
- human SCD14 (1-307) amino acid substitution variant polypeptide in which one or two amino acid mutations were introduced at various positions in human CD14 (1-307), mammalian cells were expressed by the following method.
- a plasmid was prepared.
- K279A contains sense primer 4 and antisense primer 18 (SEQ ID NO: 38) or sense primer 10 (SEQ ID NO: 39) and antisense primer 13
- SEQ ID NO: 38 sense primer 4 and antisense primer 18
- SEQ ID NO: 39 sense primer 10
- antisense primer 13 Using plasmid PM1658 prepared in 2 as type ⁇ , Pyrobe st DN The PCR reaction was repeated 30 times at 98 ° C., 30 seconds at 55 ° C., and 1 minute at 12 ° C. 30 times by APolymerase (TaKaRa).
- the sequence encoding A1a GCT (the antisense primer was AGC) was used instead of the sequence encoding Lys.
- the DNA fragments amplified by these PCRs were separated and recovered by 1% agarose gel electrophoresis, and the ends of the DNA fragments were blunt-ended using K1newFragment (TaKaRa).
- the PCR reaction was performed again under the same conditions as described above, using sense primers 5 and antisense primers 16 using the mixtures of these fragments as the type III.
- Approximately 5.8 kb obtained by doubly digesting the DNA fragment amplified by the second PCR with XhoI and Hindlll and digesting pM1656 with XhoI and Hind ⁇ . 1 igation with the DNA fragment.
- the resulting colonies were confirmed by PCR to obtain a plasmid (pMl673) expressing the desired CD14 variant polypeptide.
- Sense primer 22 SEQ ID NO: 63
- antisense primer 30 in which (AGA) was changed to the Asp codon sequence GAT (the antisense primer was ATC).
- plasmids were prepared which expressed the variants in which Ser at position 286 was replaced with Cys, G1y, Thr, and Leu, respectively.
- the construction method was the same as that for the construction of the sCD14 (1-3 07) S286A expression plasmid.
- the sense primer 23 SEQ ID NO: 65
- the antisense primer 31 SEQ ID NO: 66
- sense primer 24 SEQ ID NO: 67
- And antisense primer 32 SEQ ID NO: 68
- sense primer 25 SEQ ID NO: 69
- antisense primer 33 SEQ ID NO: 70
- Construction was performed using No. 26 (SEQ ID NO: 71) and antisense primer 35 (SEQ ID NO: 72).
- the obtained plasmid was introduced into COS-1 cells according to (3) to obtain a human sCD14 (1-307) amino acid substitution variant.
- the culture supernatant containing the obtained CD14 variant was purified as necessary. That is, an affinity purification column to which an anti-human CD14 antibody (3C10) was bound.
- F1024-1_3 antibody labeled with peroxidase according to the method of Nakane et al. (J. Histo chem. Cytochem. 22: 1084, 1974) was added at 1 ⁇ gZmL, and the solution was added at 37 ° C. Let react for hours. 0. 9% NaC 1/0. 5% in Twe en 20 washed 5 times, H 2 0 2 / TM B solution quenched with 0. 5M sulfuric acid after developed using, F 10 24 bound The amount of —1—3 antibody was measured.
- F1024-1-3 antibody was weakly blocked by peptides A and B, but not by peptides C and D and irrelevant peptide E used as a control.
- the region recognized by the F1024-1-3 antibody was estimated to be between the 283rd amino acid and the 283rd amino acid.
- the 3C10 antibody or MEM-18 antibody diluted 100-fold at 10 g / ml was immobilized on a plate (Maxisorp, Nunc) and blocked with 0.5% BSAZPBS. Next, the blocking solution was removed, and each CD14 deletion variant whose concentration was measured was added and reacted at room temperature for 1 hour. After washing, 10% RS / 0.1%
- the F1024-13 antibody showed binding activity from SCD14 (1-356) to SCD14 (1-307). And CD14 ( ⁇ 7-11) lacking the binding site of 3C10, CD14 ( ⁇ 57-64) lacking the binding site of MEM-18, and also SCD14 (1 The binding activity was also observed with CD14 ( ⁇ 180-282), which deleted the 282nd amino acid from the 180th amino acid of -307). This revealed that the F1024-1-3 antibody was different from the 3C10 and MEM-18 antibodies, and that the binding region was on the C-terminal side from position 285. Since the SCD14 (1-307) binding activity was weaker than that of other CD14 deletion mutants, it is indicated by (+).
- the F1024-1.3 antibody does not treat a linear peptide composed of 10 amino acids as an epitope, but recognizes an epitope caused by a three-dimensional structure.
- the binding region of the F1024- 1-3 antibody is located at the amino acid at position 315 from the amino acid at position 285 of CD14 in SEQ ID NO: 1, and the amino acid at position 294 is located at Pro- It became clear that they recognized the three-dimensional structure that could be caused by the above. That is, the antibody recognizes the epitope present in the amino acid at position 315 from the amino acid at position 285 from the amino acid at position 285 which can be generated when the amino acid at position 294 of CD14 is Pro. It became clear.
- Example 12 Analysis of Epitope Range of Anti-CD14 Antibody
- the region was a region where a loop could be formed under physiological conditions, and was a site capable of interacting with other proteins.
- Example 11 the epitope of the F1024-113 antibody in Example 11 and the above analysis indicate that the epitope of the anti-CD14 antibody capable of inhibiting the binding between human CD14 and TLR is human The region was from 269 to 315 of CD14.
- Example 13 Rat F1024-Three antibody variable region sequencing
- the gene sequences of the heavy and light chain variable regions of the rat F1024-T3 antibody were analyzed by the method described below, and the amino acid sequence of the complementary determinant region (CDR) was determined.
- PE polypeptide chain
- RP-HPLC RP-HPLC
- the amino acid sequence of the PE light chain was directly analyzed by Procise494cLC (Applied Biosystems Inc.).
- the peptide sequence at the amino terminus of the heavy chain could not be determined because the amino terminus was blocked. Therefore, the PE-compound heavy chain was decomposed with CNBr, followed by separation and purification of peptides and fragments by RP-HPLC, and amino acid sequence analysis was performed by Peptide Sequencer-Procise494cLC (Applied Biosystems Inc.).
- the amino acid sequence of the peptide fragment was analyzed for the PE-modified light chain.
- primers of SEQ ID NOs: 73 to 82 were synthesized.
- primers of SEQ ID NOs: 83 and 84 derived from the 5 ′ UTR and 3 ′ UTR regions were synthesized as light chain primers.
- Table 3 shows the nucleotide sequence of the primer and the corresponding amino acid sequence position on FIG. 15 (described later).
- the mixed base was in accordance with international standards. (Y; AC, GH; A, C, TN; A, CG, TR; AGW; ATS; CGK; GTI; Inosine)
- Y AC, GH; A, C, TN; A, CG, TR; AGW; ATS; CGK; GTI; Inosine
- F1024-Th3 antibody-producing hybridoma F1024-1-3 was thawed and cultured in RPMI1640 medium containing 10% FCS.
- PBS- pH 7.4
- the following cDNA analysis was performed based on Y.Kagawa et al., Mutagenesis, 14 (2), 199-205 (1999). Went like so.
- total RNA was extracted from IS0GENE (Nippon Gene Poko).
- cDNA was synthesized using the oligo dT primer according to the manual of Superscript preampli cation system for first strand cDNA synthesis (Invitrogen). PCR was carried out using sense and antisense primers as the type I. PCR was performed using ExTaq polymerase (Takara) at 94 ° C, 60 seconds, 55 ° C 30 seconds, 72.C, 120 seconds 35 cycles. Using the GeneAmp PCR system 2400 (Perkin Elmer) After confirming the band on the gel, the PCR product was cut out and purified, and the ABI373A DNA sequencer (Applied Biosystems) was used according to the manual of the ABI Dye deoxy cycle sequencing kit (Applied Biosystems Inc.).
- V region having antigen-binding activity is derived from F1024-1-3 antibody, that is, rat antibody.
- C region human-derived antibody chimeric antibody
- an antibody with low antigenicity to human can be obtained. I can do it.
- Many chimeric antibodies have been developed since the report of Morrison et al. (Proc, Natl. Acad. Sci. USA, 81: 6851, 1984) in 1984.
- the cell line F1024-1-3 producing the F1024-1-3 antibody is cultured to prepare cells. After washing the obtained cells with PBS- (Sigma), total RNA is isolated and purified using Isogene (Nippon Gene). Next, cDNA is synthesized using Oligo-dT primer-1 and Superscript II system (Invitrogen). A sense primer is synthesized based on the amino terminal amino acid sequences of the heavy and light chains. The heavy chain antisense primer is prepared based on the framework 4 sequence, and the light chain antisense primer is prepared based on the V ⁇ sequence. After PCR, the DNA fragment is incorporated into a TA cloning vector (Invitrone), and the sequence is analyzed.
- TA cloning vector Invitrone
- a nucleotide sequence encoding the N-terminal side of the CH1 region of human immunoglobulin G1 is synthesized as a sense primer, and an antisense primer synthesizes a region containing the sequence of the untranslated region of human immunoglobulin G1.
- the sense primer and the antisense primer the human immunoglobulin CH region is amplified by PCR from HumanS ⁇ 1een5'-Stretch cDNA Library (manufactured by Clontech).
- the heavy chain sense primer has a nucleotide sequence encoding the heavy chain region of Example 1-1 and an amino acid sequence encoding the N-terminal side of the CH1 region of human immunoglobulin G1 with a sequence encoding an EcoRI site. It is made to include.
- the antisense primer is prepared so as to include a base sequence encoding an amino acid sequence located on the C-terminal side of the CH3 region of human immunoglobulin G1 and a BamHI site. Combining these chimeric primers, the human immunoglobulin CH region was adjusted to match the orientation of the rat VH region. Incorporate.
- the PCR product obtained is digested with a restriction enzyme, and the DNA fragment is incorporated into an expression vector pcDNA3.1 (Invitrogen) to prepare a rat-human heavy chain expression plasmid.
- an expression plasmid containing a chimeric antibody gene having a human CL region and a rat-derived light chain region is constructed.
- each expression plasmid is cut with restriction enzymes and linearized.
- the gene was introduced into SP2 / 0-ag14 (ATCC CRL1581) using a gene pulser (BI ORAD), etc., and the desired antibody was determined based on the presence of the rat-human chimeric antibody produced in the supernatant after culture.
- Select cells to produce Specifically, about 20 ⁇ g of the linearized DNA fragment is electroporated to 1 ⁇ 10 7 cells at a capacitance of 360 V and 25 FD.
- framework residues are selected according to the general method of Queen et al. (Proc. Natl. Acad. Sci. USA 86: 10029, 1989). Human sequences Kab at et (Sequences of proteins of immunological inter est , 5 th ed., US Department of Health and Human Services, 1991) cutlet path rat F 1024- 1 based on the light and heavy chain sequences data base Ichisu of — Select sequences with high framework homology to 3 antibodies. In addition, the most suitable amino acids in the framework are modified by computer analysis.
- a gene encoding an amino acid sequence containing a signal peptide, a splice donor signal, and a restriction site (for example, Xbal) is constructed.
- Several types of constructed genes have synthetic nucleotides (about 80 bases long) Prepare to overlap. That is, the oligos are paired and annealed, and extended with the Klenow fragment of DNA polymerase to obtain a double-stranded fragment. After denaturing this fragment to make it a single strand, it is similarly annealed and extended with a K1 enow fragment of DNA polymerase to obtain a double-stranded fragment encoding the full-length gene.
- the resulting fragment is amplified by PCR with Taq polymerase, purified, cut with a restriction enzyme (eg, XbaI) and purified.
- the purified fragment was converted from a constant region gene containing CH1 exon to CH3 exon of the human 1 gene to a plasmid pVgl (Co et al., J. Immunol. 148: 1149 (1992) having an XbaI-BamHI fragment. ) Insertion into the plasmid containing the constant region gene of a4 by the same procedure.If the number of amino acids to be replaced is small, create by site-directed mutagenesis.
- the light chain variable region sequence can be constructed in the same manner as described above, in which case a pVk vector containing a human C ⁇ region is used.
- the heavy and light chain plasmids are cut with restriction enzymes (BamHI and FspI in the case of pVk plasmid) and linearized. Introduce into S ⁇ — O— ag 14 (ATC C CRL 1 581) using Gene Pulser (B IORAD). Specifically, about 1 ⁇ 10 7 cells of the linearized DNA fragment are subjected to electroporation at a capacitance of 360 V and 25 w FD.
- the CD14ZTLR binding inhibitory activity and the binding affinity are compared.
- the CD14 ZTLR binding inhibitory activity is performed as described in Example 2 and compared with the F1024-1-3 antibody.
- the affinity is measured using the BI ACORE system (BI AC ORE). That is, using BI ACORE 3000, immobilize purified CD 14 on a CM5 chip (BIACORE) according to the manual. Next, prepare antibody dilution series diluted with HBS-EP buffer-1 (BIACORE), and inject and analyze each sample. Dissociate the antigen-antibody bond with a 10 OmM hydrochloric acid solution and inject the next sample. The obtained data is analyzed using the BI ACORE analysis program (BIA Evaluation, BI ACORE) to calculate the affinity (Kd).
- BI ACORE BI ACORE analysis program
- the sequence of the original FR region is also transplanted.
- Which amino acids are involved in maintaining the CDR domain structure is analyzed by analyzing the properties of amino acids in FR (hydrophobicity, hydrophilicity, acidity, basicity, molecular size, etc.), and by modeling using a computer. . In other words, modeling is performed using software QUANTA / CHARMm or Mode 1 er (Molecule / Schedule) that runs on silicon graphics.
- amino acid group (group 1) in the FR region which is presumed to be bonded to CDR by energy interaction such as electrostatic interaction or Van der Waalz force, and further bonded to them Select the amino acid group (Group 2) in the putative FR region.
- the amino acid group in the FR region selected in this manner is transplanted together with the CDR amino acid onto the human antibody sequence, and is classified by Kabat et al. (Sequences of proteins of immunological interest, 5 th , US Department of Health and Human Services, 1991) and the NCBI (National Center for Biotec hnology Information). If a sequence that does not exist occurs, the amino acid is not transplanted. Based on the information thus obtained, sequences to be transplanted into the human antibody sequences VH and VL are determined, and a gene used for producing a humanized antibody is constructed.
- the constructed gene is obtained by combining Amersham's kit (Oligonucleotide-directed in vitro mutagenesis system version 2) with the PCR method, by combining several types of long-chain synthetic nucleotides, and by amplifying the chimeric antibody VH or VL gene. After amplification using several types of primers, the amplified gene fragments are used to obtain a full-length gene fragment by using the type III gene.
- An expression plasmid is prepared by introducing the obtained amplified gene fragment into a restriction enzyme site of plasmid pVk containing plasmid pVgl or VK described in Example 15. The prepared plasmid is introduced into cells according to the method described in Example 15, and a transformant is obtained. Similarly, a purified antibody is prepared. In addition, evaluation of antibodies is performed in the same manner.
- Example 17 Preparation of CDR peptide
- each peptide is synthesized using a peptide synthesizer (433A, Applied Biosystems).
- the synthetic peptide is excised by a conventional method and purified by HPLC to obtain a lyophilized product.
- the resulting peptide is confirmed to have CD14 / TLR binding inhibitory activity by the method of Example 2.
- Example 18 Establishment of Cell Line Highly Expressing CD14 Modified Polypeptide
- the plasmid expressing sCD14 (1-307) S286C obtained in Example 11 was prepared.
- the domid is digested with XbaI and Hindfl, and a DNA fragment encoding sCD14 (1-307) S286C is excised.
- DHFR folate dehydrogenase
- the expression plasmid pMl 675 prepared in (1) was trans feet ionized into the DHFR gene-deleted Chinese hamster uterine tumor cell line CHO DxB11 by the following method. That is, after mixing 501 FuGENE6 (Roche's Diagnostics) and 12.5 g PMl 675 according to the attached protocol,
- the cells were added to CH ⁇ DxB11 cells grown semi-confluently in a 150 cm 2 roux flask. The next day, cells were harvested by performing trypsin ZED TA treatment, 1 at MEMamo dification nucleic acid deletion medium containing 10% inactivated dialyzed FBS Oyobi 2 mM L-glutamic in 10 cm 2 dishes Disshua 2 ⁇ 10 4 cells were seeded. After every 3 to 4 days, the medium was exchanged with a MEM amodification nucleic acid-deficient medium containing 10% non-active dialysis FBS and 2 mM L-glutamine, and selective culture was performed for 18 days. 24 clones were obtained.
- the production amount of the CD14 variant polypeptide in the culture supernatant of the obtained clone 24 strain was measured in the same manner as in Example 11. As a result, nine clones with a production volume exceeding 2 gZmL were obtained. Among them, the TfS286C-99 strain produced the highest amount, at 5.7 ng ZmL.
- the medium was replaced with a MEMamodification nucleic acid-deficient medium containing MTX at a final concentration of 150 nM, 10% inactivated FBS and 2 mM L-glutamine, and selective culture was performed for 5 days.
- 15 clones grown in a medium containing 150 nM MTX were obtained.
- the production amount of the CD14 variant polypeptide was examined. The concentration of the CD14 variant polypeptide in the culture supernatant of each of the 15 clones was measured in the same manner as in Example 11.
- an antibody which suppresses human CD14-mediated cell activation, and which can regulate intracellular signal transduction even with the formed CD14 ZL PS. . It also provides a monoclonal antibody, a humanized human body, and a chimeric antibody having a specific amino acid sequence as a CDR. Furthermore, the present invention provides an antibody that suppresses binding to TLR.
- CD14 the recognition region required for the anti-human CD14 to exert the action
- a method for preparing an antibody using the specific region, and a substance that inhibits the binding between CD14 and TLR are described.
- a medical composition for sepsis is provided as an active ingredient.
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/432,236 US7264967B2 (en) | 2000-11-22 | 2001-09-28 | Anti-CD14 monoclonal antibody having effect of inhibiting CD14/TLR binding |
AU2001290315A AU2001290315A1 (en) | 2000-11-22 | 2001-09-28 | Anti-cd14 monoclonal antibody having effect of inhibiting cd14/tlr binding |
CA002429467A CA2429467A1 (en) | 2000-11-22 | 2001-09-28 | Anti-cd14 monoclonal antibody having effect of inhibiting cd14/tlr binding |
JP2002544466A JPWO2002042333A1 (ja) | 2000-11-22 | 2001-09-28 | Cd14/tlr結合阻害作用を有する抗cd14モノクローナル抗体 |
EP01970291A EP1336620A4 (en) | 2000-11-22 | 2001-09-28 | MONOCLONAL ANTI-CD14 ANTIBODIES INHIBITING THE CD14 / TLR BINDING |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2000-356719 | 2000-11-22 | ||
JP2000356719 | 2000-11-22 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002042333A1 true WO2002042333A1 (fr) | 2002-05-30 |
Family
ID=18828903
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/JP2001/008563 WO2002042333A1 (fr) | 2000-11-22 | 2001-09-28 | Anticorps monoclonal anti-cd14 exerçant un effet d'inhibition de la fixation cd14/tlr |
Country Status (6)
Country | Link |
---|---|
US (1) | US7264967B2 (ja) |
EP (1) | EP1336620A4 (ja) |
JP (1) | JPWO2002042333A1 (ja) |
AU (1) | AU2001290315A1 (ja) |
CA (1) | CA2429467A1 (ja) |
WO (1) | WO2002042333A1 (ja) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004044005A1 (ja) * | 2002-11-12 | 2004-05-27 | Mochida Pharmaceutical Co., Ltd. | ヒト低分子量cd14測定キットおよび抗体 |
WO2006129849A1 (ja) * | 2005-06-03 | 2006-12-07 | Mochida Pharmaceutical Co., Ltd. | 抗cd14抗体融合蛋白質 |
JP2006528981A (ja) * | 2003-05-15 | 2006-12-28 | タノックス インコーポレーテッド | 敗血症の予防及び治療のための方法及び組成物 |
JP2008523048A (ja) * | 2004-12-10 | 2008-07-03 | ノビミューン エスアー | toll様レセプターを標的とする併用療法およびその使用 |
US7608684B2 (en) | 2002-11-12 | 2009-10-27 | Mochida Pharmaceuticals Co., Ltd. | Soluble CD14 antigen |
WO2019217916A1 (en) | 2018-05-10 | 2019-11-14 | The Methodist Hospital | Methods for prognosis and management of disease |
WO2021253335A1 (zh) * | 2020-06-18 | 2021-12-23 | 深圳迈瑞生物医疗电子股份有限公司 | 抗可溶性cd14亚型抗体、试剂盒及其应用 |
US11618782B2 (en) | 2020-10-07 | 2023-04-04 | Line 6 Biotechnology, Inc. | Methods and agents for the treatment of ocular disease |
Families Citing this family (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1252333A4 (en) * | 2000-01-25 | 2005-01-05 | Nuvelo Inc | Methods and materials related to CD84-like polypeptides and polynucleotides |
US20040092712A1 (en) * | 2000-03-31 | 2004-05-13 | Shoji Furusako | Tlr/cd14 binding inhibitor |
WO2008027739A2 (en) * | 2006-08-28 | 2008-03-06 | Nuvelo, Inc. | Antibodies to ntb-a |
CN102898527B (zh) | 2011-07-25 | 2016-12-21 | 三星电子株式会社 | 融合蛋白、药物组合物及预防或治疗癌症的方法 |
CN102940538B (zh) * | 2012-12-06 | 2014-10-15 | 吉林大学 | 可调节周期性下颌前伸牵引装置 |
WO2017160599A1 (en) | 2016-03-14 | 2017-09-21 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Use of cd300b antagonists to treat sepsis and septic shock |
WO2018106959A1 (en) | 2016-12-07 | 2018-06-14 | Progenity Inc. | Gastrointestinal tract detection methods, devices and systems |
EP4108183A1 (en) | 2017-03-30 | 2022-12-28 | Biora Therapeutics, Inc. | Treatment of a disease of the gastrointestinal tract with an immune modulatory agent released using an ingestible device |
WO2019246312A1 (en) | 2018-06-20 | 2019-12-26 | Progenity, Inc. | Treatment of a disease of the gastrointestinal tract with an immunomodulator |
WO2019246317A1 (en) | 2018-06-20 | 2019-12-26 | Progenity, Inc. | Treatment of a disease or condition in a tissue originating from the endoderm |
WO2020106757A1 (en) | 2018-11-19 | 2020-05-28 | Progenity, Inc. | Ingestible device for delivery of therapeutic agent to the gastrointestinal tract |
CN115232211A (zh) * | 2019-11-19 | 2022-10-25 | 武汉全景生物技术有限公司 | 新的抗可溶性cd14亚型抗体及其应用 |
US11707610B2 (en) | 2019-12-13 | 2023-07-25 | Biora Therapeutics, Inc. | Ingestible device for delivery of therapeutic agent to the gastrointestinal tract |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2744130B2 (ja) * | 1989-08-01 | 1998-04-28 | スクリップス クリニック アンド リサーチ ファウンデーション | 敗血症治療用組成物 |
EP0751962B1 (en) | 1993-05-28 | 2006-08-02 | The Scripps Research Institute | Methods for inhibiting cd14 mediated cell activation |
EP0759999A1 (en) * | 1994-05-12 | 1997-03-05 | Quest International B.V. | Process for inhibiting the growth of a culture of lactic acid bacteria, and optionally lysing the bacterial cells, and uses of the resulting lysed culture |
ATE308994T1 (de) | 1994-09-16 | 2005-11-15 | Scripps Research Inst | Gebrauch von antikörpern zur verhinderung von auswirkungen hervorgerufen durch grampositive- und myko-bakterien |
WO1996020957A1 (en) * | 1994-12-30 | 1996-07-11 | Amgen Inc. | Anti-inflammatory cd14 polypeptides |
KR20000065204A (ko) | 1997-03-07 | 2000-11-06 | 모치다 에이 | Cd14에 대한 안티센스 화합물 |
US20040092712A1 (en) * | 2000-03-31 | 2004-05-13 | Shoji Furusako | Tlr/cd14 binding inhibitor |
-
2001
- 2001-09-28 JP JP2002544466A patent/JPWO2002042333A1/ja active Pending
- 2001-09-28 US US10/432,236 patent/US7264967B2/en not_active Expired - Fee Related
- 2001-09-28 AU AU2001290315A patent/AU2001290315A1/en not_active Abandoned
- 2001-09-28 WO PCT/JP2001/008563 patent/WO2002042333A1/ja active Application Filing
- 2001-09-28 EP EP01970291A patent/EP1336620A4/en not_active Withdrawn
- 2001-09-28 CA CA002429467A patent/CA2429467A1/en not_active Abandoned
Non-Patent Citations (5)
Title |
---|
MASAHITO HASHIMOTO ET AL.: "Cytokine-inducing macromolecular glycolipids from enterococcus hirae: improved method for separation and analysis of its effects on cellular activation", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 273, no. 1, June 2000 (2000-06-01), pages 164 - 169, XP002907752 * |
NICOLAS W.J. SCHRODER ET AL.: "Involvement of lipopolysaccharide binding protein, CD14 and toll-like receptor in the initiation of innate immune responses by treponema glycolipids", THE JOURNAL OF IMMUNOLOGY, vol. 165, September 2000 (2000-09-01), pages 2683 - 2693, XP002907754 * |
RICHARD I. TAPPING ET AL.: "Toll-like receptor 4, but not toll-like receptor 2, is a signaling receptor for escherichia and salmonella lipopolysaccharides", THE JOURNAL OF IMMUNOLOGY, vol. 165, 15 November 2000 (2000-11-15), pages 5780 - 5787, XP002907753 * |
SACHIKO AKASHI ET AL.: "Regulatory roles for CD14 and phosphatidylinositol in the signaling via toll-like receptor 4-MD-2", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 268, no. 1, February 2000 (2000-02-01), pages 172 - 177, XP002907751 * |
See also references of EP1336620A4 * |
Cited By (17)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8124722B2 (en) | 2002-11-12 | 2012-02-28 | Mochida Pharmaceutical Co., Ltd. | Soluble CD14 antigen |
US7465547B2 (en) | 2002-11-12 | 2008-12-16 | Mochida Pharmaceutical Co., Ltd. | Methods for detecting human low molecular weight CD14 |
WO2004044005A1 (ja) * | 2002-11-12 | 2004-05-27 | Mochida Pharmaceutical Co., Ltd. | ヒト低分子量cd14測定キットおよび抗体 |
US7901900B2 (en) | 2002-11-12 | 2011-03-08 | Mochida Pharmaceutical Co., Ltd. | Assay kit and antibody for human low molecular weight CD14 |
US7608684B2 (en) | 2002-11-12 | 2009-10-27 | Mochida Pharmaceuticals Co., Ltd. | Soluble CD14 antigen |
JP2006528981A (ja) * | 2003-05-15 | 2006-12-28 | タノックス インコーポレーテッド | 敗血症の予防及び治療のための方法及び組成物 |
JP4768620B2 (ja) * | 2003-05-15 | 2011-09-07 | ジェネンテック, インコーポレイテッド | 敗血症の予防及び治療のための方法及び組成物 |
US8329169B2 (en) | 2003-05-15 | 2012-12-11 | Genentech, Inc. | Methods and compositions for the prevention and treatment of sepsis |
JP2008523048A (ja) * | 2004-12-10 | 2008-07-03 | ノビミューン エスアー | toll様レセプターを標的とする併用療法およびその使用 |
JP2012197316A (ja) * | 2004-12-10 | 2012-10-18 | Novimmune Sa | toll様レセプターを標的とする併用療法およびその使用 |
US8252905B2 (en) | 2005-06-03 | 2012-08-28 | Mochida Pharmaceutical Co., Ltd. | Anti-CD14 antibody fusion protein |
WO2006129849A1 (ja) * | 2005-06-03 | 2006-12-07 | Mochida Pharmaceutical Co., Ltd. | 抗cd14抗体融合蛋白質 |
US8541565B2 (en) | 2005-06-03 | 2013-09-24 | Mochida Pharmaceutical Co., Ltd. | Polynucleotide encoding anti-CD14 antibody fusion protein |
CN101189334B (zh) * | 2005-06-03 | 2013-11-06 | 持田制药株式会社 | 抗cd14抗体融合蛋白质 |
WO2019217916A1 (en) | 2018-05-10 | 2019-11-14 | The Methodist Hospital | Methods for prognosis and management of disease |
WO2021253335A1 (zh) * | 2020-06-18 | 2021-12-23 | 深圳迈瑞生物医疗电子股份有限公司 | 抗可溶性cd14亚型抗体、试剂盒及其应用 |
US11618782B2 (en) | 2020-10-07 | 2023-04-04 | Line 6 Biotechnology, Inc. | Methods and agents for the treatment of ocular disease |
Also Published As
Publication number | Publication date |
---|---|
US7264967B2 (en) | 2007-09-04 |
AU2001290315A1 (en) | 2002-06-03 |
JPWO2002042333A1 (ja) | 2004-03-25 |
EP1336620A1 (en) | 2003-08-20 |
EP1336620A4 (en) | 2004-11-17 |
CA2429467A1 (en) | 2002-05-30 |
US20040091478A1 (en) | 2004-05-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002042333A1 (fr) | Anticorps monoclonal anti-cd14 exerçant un effet d'inhibition de la fixation cd14/tlr | |
ES2645026T3 (es) | Anticuerpos de NKG2D para su uso en el tratamiento de artritis reumatoide o enfermedad de Crohn | |
JP2011523414A (ja) | 抗fn14抗体、およびその使用 | |
US20050154192A1 (en) | Anti-il13 receptor alpha1 neutralizing antibody | |
KR20230009441A (ko) | 항-tigit 항체, 이의 제조 방법 및 용도 | |
US20210032350A1 (en) | Antibodies to galectin-3 and methods of use thereof | |
EP1275713A1 (en) | Tlr/cd14 binding inhibitor | |
EA037397B1 (ru) | Гуманизированные антитела к рецептору ccr7 | |
EP2452950B1 (en) | Anti-podxl2 antibody having anti-cancer activity | |
KR20220071264A (ko) | 항-pd-l1 항원 결합 단백질 및 이의 응용 | |
US20040092712A1 (en) | Tlr/cd14 binding inhibitor | |
JP6872756B2 (ja) | 抗Myl9抗体 | |
CN115515625A (zh) | 与人类ceacam1/3/5特异性结合的新抗体及其用途 | |
US20220306754A1 (en) | Therapeutic binding molecules | |
US11028178B2 (en) | Method of treating nonalcoholic steatohepatitis by administering an antagonist human tumor necrosis factor receptor 1 (HUTNFR1) antibody |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2002544466 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2429467 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2001970291 Country of ref document: EP Ref document number: 10432236 Country of ref document: US |
|
WWP | Wipo information: published in national office |
Ref document number: 2001970291 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |