WO2002020776A1 - Nouveau polypeptide, mgc-24 13.31, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, mgc-24 13.31, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002020776A1
WO2002020776A1 PCT/CN2001/001088 CN0101088W WO0220776A1 WO 2002020776 A1 WO2002020776 A1 WO 2002020776A1 CN 0101088 W CN0101088 W CN 0101088W WO 0220776 A1 WO0220776 A1 WO 0220776A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
mgc
polynucleotide
sequence
seq
Prior art date
Application number
PCT/CN2001/001088
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002212052A priority Critical patent/AU2002212052A1/en
Publication of WO2002020776A1 publication Critical patent/WO2002020776A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, MGC-2413.31, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Peanut lectin is an exogenous lectin specific to the Gal ⁇ ⁇ 3GalNAc reaction [Lotan, R. & Sharon, N. 1978. in Methods i Enzymology 50, 361-367, Academic Press, New York].
  • the binding site of PNA is the T antigen, and it is expressed in various human cancer tissues, including colon cancer and gastric cancer. It is considered as a tumor-associated sugar marker and can be used as a diagnosis and treatment of malignant tumors [Springer, GF1984 . Science.224, 1189-1206].
  • Glycoproteins isolated from gastric cancer cells are composed of various molecules, including a 280kDa major component [Miyauchi, T., Muramatsu, H., 0 zawa, ⁇ ., Mizuta, ⁇ ., Suzuki, ⁇ ., & Muramatsu, ⁇ . 1982. Gann73, 581-587]
  • the protein component in glycoproteins is mainly composed of two core proteins, one is a protein named MGC-24 rich in cysteine, and the other is polymorphic epithelial mucin (PEM)
  • MGC-24 protein and PEM are also expressed in various normal tissues.
  • PEM has been proven to be a carrier of tumor-associated epitopes in breast cancer, and it is also a PM binding site for gastric cancer cells.
  • PEM is composed of 20 amino acid repeating amino acid units, and the main region is 41-85 amino acids. Serine, threonine, and proline are the main amino acids of the repeating amino acid unit, which indicates that the connection mode of PEM and oligosaccharide is zero.
  • MGC-24 is different from PEM. It has a molecular weight of 24kDa and is rich in cysteine residues. Its strict three-dimensional structure promotes the reaction between proteins. It is worth noting that many mucin nuclear proteins are rich in cysteine in [Probst, JC, Hauser, F., Joba, W., & Hoffman, W. 1992. LBiol.Chera. 267 , 54 01- 5 4 07]. MGC- 2 4 in colon, small intestine and abundantly expressed in the thyroid indicates that MGC- 2 4 is a glycoprotein mainly secreted protein. In fact, in KATO-III cells, most of the MGC-24 glycoprotein is secreted from the cells.
  • MGC-24 glycoprotein is likely to be a mucin.
  • Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation, 1013HT, and scar formation fc is not stimulated with growth factor, 1013HC, bladder cancer construct cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer, The expression profile is very similar to that of MGC-24, so the functions of the two may also be similar.
  • the invention is named MGC-2413. 31.
  • MGC-2413.31 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • MGC-2413. 31 protein especially the amino acid sequence of this protein.
  • the isolation of the new MGC-2413.31 protein-coding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its code D. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding MGC-2413.31.
  • Another object of the present invention is to provide a method for producing MGC-2413. 31.
  • Another object of the present invention is to provide antibodies against the polypeptide ⁇ MGC-2413. 31 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention "MGC-2413. 31.”
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to MGC-2413.31 abnormalities.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 243-608 in SEQ ID NO: 1; and (b) a sequence having 1-1720 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of MGC-2413.
  • 31 protein which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of MGC-2413.31 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of MGC-2413.3'1.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of MGC-2413. 31 and MGC-24 of the present invention.
  • the upper graph is a graph of the expression profile of MGC-2413.
  • the lower graph is the graph of the expression profile of MGC-24.
  • FIG. 2 shows the isolated polyacrylamide gel electrophoresis (SDS-PAGE) of MGC-2413.31. 1 3kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. . Summary of the Invention
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with MGC-2413.31, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds MGC-2413.31.
  • Antagonist or “inhibitor” means that when combined with MGC- 2413. 31, an adjustable closure or molecular biological activity or immunological activity of MGC- 24 13. 31. Antagonists and inhibitors can include Protein, nucleic acid, carbohydrate or any other molecule that can bind MGC-2413.31.
  • Regulation refers to a change in the function of MGC-2413. 31, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of MGC-2413. 31.
  • Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify MGC-2413. 31 using standard protein purification techniques. 31. Essentially pure MGC-2413. 31 can generate a single main band on a non-reducing polyacrylamide gel. MGC-2413. 31 The purity of the peptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Higgins, D. G. and
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645). 0 "Similarity” refers to amino acids The degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between sequences.
  • Amino acids for conservative substitutions can include Including aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine and isoleucine Acids and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of MGC-2413. 31.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated MGC-2413. 31 means that MGC-2413. 31 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify MGC-2413.31 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of MGC-2413. 31 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide MGC-2413. 31, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of MGC-2413.31. As used in the present invention, the terms "fragment,””derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of MGC-2413.31 of the present invention.
  • Fragments, derivatives of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be Encoded by a genetic codon; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (in) such a type in which the mature polypeptide and Fusion of another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or The sequence used to purify this polypeptide or protease sequence.) As explained herein, such fragments, derivatives and analogs are considered Within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,720 bases in length, and its open reading frames 243-608 encode 121 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to MGC-24, and it can be deduced that MGC-2413.31 has similar functions to MGC-24.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DM, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • degenerate variant refers to a nucleic acid sequence encoding a protein or polypeptide having 'SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) And non-coding sequences.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding MGC-2413.31.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding MGC-2413. 31 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
  • genome D is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cMA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of MGC-2413. 31 ; (4) ) Through immunological techniques or determination of biological activity, to Detection of protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is usually a D sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of MGC-2413.31 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
  • a method (Sa iki, et al. Science 1985; 230: 1 350-1 354) using PCR technology to amplify D / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length c A sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using MGC-2413.31 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
  • a polynucleotide sequence encoding MGC-241 3.31 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
  • DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding MGC-2413. 31 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant MGC-2413. 31 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human MGC-2413. 31 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Peanut lectin is an exogenous lectin specific to the Gal l ⁇ ⁇ 3GalNAc response.
  • the binding site of PNA is the T antigen, and it is expressed in various human cancer tissues, including colon cancer and gastric cancer. It is considered to be a tumor-associated sugar marker and can be used as a diagnosis and treatment of malignant tumors.
  • An in-depth understanding of PNA-binding glycoproteins is a necessary step for their proper medical application.
  • Studies on glycoproteins isolated from gastric cancer cells revealed that the protein component of glycoproteins is mainly composed of two core proteins, one is a protein named MGC-24 rich in cysteine, and the other is polymorphic epithelial mucin (PEM ). In addition to being expressed in cancer cells, MGC-24 protein and PEM are also expressed in various normal tissues.
  • MGC-24 is rich in cysteine residues, and its strict three-dimensional structure facilitates the reaction between proteins.
  • the large expression of MGC-24 in the colon, small intestine and thyroid suggests that MGC-24 glycoprotein is primarily a secreted protein.
  • MGC-24 glycoprotein is secreted from the cells.
  • Immune experiments show that in the colon and small intestine, MGC-24 is produced by goblet cells that secrete mucin. Therefore, MGC-24 glycoprotein is likely to be a mucin.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human PNA-binding glycoprotein MGC-24, both of which have similar biological functions.
  • the polypeptide of the present invention has secretory protein properties. It can specifically bind to peanut agglutinin and is present in a variety of tumor tissues such as colon cancer and gastric cancer.
  • peanut agglutinin is also expressed in various human cancers. Tissues, including colon and stomach cancers, are considered tumor-associated carbohydrate markers and can be used for diagnosis and treatment of malignant tumors. It can be seen that the abnormal expression of the polypeptide of the present invention is highly correlated with the occurrence of various human cancers, especially the occurrence of digestive system tumors such as colon cancer and gastric cancer, and produces related diseases.
  • MGC-2413. 31 of the present invention will produce various diseases, especially various tumors, developmental disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
  • Tumors of various tissues gastric cancer, colon cancer, liver cancer, esophageal cancer, lung cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glial cells Tumor, neurofibromatosis, melanoma, bladder cancer, uterine cancer, endometrial cancer, "" Thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, Yue Zhi 3 ⁇ 4S
  • Developmental disorders congenital abortion, cleft palate, lack of limbs, limb differentiation disorders, atrial septal defect, neural tube defects, congenital hydrocephalus, mental retardation, brain development disorders, skin, fat and muscular dysplasia, Bone and joint dysplasia, various metabolic defects, stunt inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, multiple sclerosis of the cerebral spinal cord, glomerulonephritis, Myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • the abnormal expression of MGC-2413. 31 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, developmental disorders, inflammation, immune diseases, and some hereditary diseases. , Blood diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) MGC-2413.31.
  • Agonists enhance biological functions such as MGC-2413.31, which stimulate cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing MGC-2413. 31 can be cultured with labeled MGC-2413. 31 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of MGC-2413. 31 include screened antibodies, compounds, receptor deletions and analogs Wait.
  • the antagonist of MGC-2413.31 can bind to MGC-2413.31 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • MGC-2413.31 When #selecting a compound as an antagonist, MGC-2413.31 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between MGC-2413.31 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to MGC-2413.31 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the MGC-2413.31 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the MGC-2413.31 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by MGC-2413.31 direct injection in immunized animals (such as rabbits, mice, rats, etc.).
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing MGC-2413.31 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma technology. Wait. Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against MGC-2413.31.
  • Anti-MGC-2413.31 antibodies can be used in immunohistochemistry to detect MGC-2413.31 in biopsy specimens.
  • Monoclonal antibodies that bind to MGC-2413.31 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • MGC-2413.31 monoclonal antibodies with high affinity can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill MGC-2413.31 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to MGC-2413.31. Administration of appropriate doses of antibodies can stimulate or block the production or activity of MGC-2413.31.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of the level of MGC-2413.31.
  • Assays are well known in the art and include FISH assays and radioimmunoassays.
  • the level of MGC-241 3. 31 detected in the test can be used to explain the importance of MGC-241 3. 31 in various diseases and to diagnose diseases where MGC-241 3. 31 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding MGC-241 3. 31 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by MGC-241 3. 31's non-expression or abnormal / inactive expression.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated MGC-241 3. 31 to inhibit endogenous MGC-241 3. 31 activity.
  • a mutant MGC-241 3. 31 may be a shortened MGC-241 3. 31 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of MGC-241 3.31.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, and parvovirus can be used to transfer polynucleotides encoding MGC-241 3. 31 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding MGC-241 3.31 can be found in the existing literature (Sarabrook, et al.).
  • the polynucleotide encoding MGC-241 3. 31 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DNA
  • ribozymes that inhibit MGC-241 3.31 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RM, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense R molecules can be obtained by in vitro or in vivo transcription of the MA sequence encoding the RM.
  • This MA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding MGC-2413. 31 can be used for the diagnosis of diseases related to MGC_2413. 31.
  • the polynucleotide encoding MGC-241 3. 31 can be used to detect the expression of MGC-2413. 31 or the abnormal expression of MGC-241 3. 31 in a disease state.
  • the DNA sequence encoding MGC-2413. 31 can be used to hybridize biopsy specimens to determine the expression of MGC-241 3. 31. Hybridization including Southern blot Method, Northern blotting, in situ hybridization, etc. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • MGC-2413. 31 specific primers can also be used to detect the transcription products of MGC-2413. 31 by performing RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
  • RT-PCR RNA-polymerase chain reaction
  • Detection of mutations in the MGC-2413. 31 gene can also be used to diagnose MGC-2413. 31-related diseases. MGC-2413. 31 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type MGC-2413. 31 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • the PCR primers (preferably 15-35bp) are prepared according to cD, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If at A mutation is observed in some or all of the affected individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cMA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • MGC-2413. 31 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and range of MGC-2413.31 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRM was isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • a Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDM fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a CDM library.
  • Dye terminate cycle react ion sequencing kit Perkin-Elmer
  • ABI 377 An automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined CDM sequence was compared with an existing public DM sequence database (Genebank). As a result, the CDM sequence of one of the clones 0023a02 was found to be a new DNA. A series of primers were synthesized to perform bidirectional determination of the inserted cMA fragments contained in the clone.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Primerl 5,-CAAGCTCCTTTTGATATTCCCTGC -3 '(SEQ ID NO: 3)
  • Primer2 5'- ACCATTGAATTTATTTTATTTTAA -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer 2 is the 3 'terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1. 5 mmol / L MgCl 2 , 20 ( ⁇ raol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94.C 30sec; 55.C 30sec; 72 ° C 2min.
  • ⁇ -act in was used as a positive control and template blank was used as a negative control.
  • the amplified product was purified using a QIAGEN kit and TA cloning kit was connected to a pCR vector (Invitrogen).
  • the results of DNA sequence analysis showed that The DNA sequence of the PCR product is exactly the same as l-1720bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of MGC-2413. 31 gene expression
  • RNA extraction in one step [Anal. Biochera 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • RNA was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid ( ⁇ 7 ⁇ 0) -5 fflM sodium acetate-ImM EDTA-2. 2 M formaldehyde Electrophoresis. It was then transferred to a nitrocellulose membrane. A- 32 P dATP was used to prepare 32 P-labeled DNA probes by random primers. The DM probe used is the PCR-amplified MGC-2413. 31 coding region sequence (2 4 3bp To 608bp).
  • a 32P-labeled probe (approximately 2 x 10 6 cpra / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4) -5 x SSC- 5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0. 1 ° /. SDS at 55 ° C for 30 min Analysis and quantification using Phosphor Imager.
  • Example 4 In vitro expression, isolation and purification of recombinant MGC-2413. 31
  • Primer3 5,-CATGCTAGCATGAGCTGGATTTCTTTCTTGTTC- 3, (Seq ID No: 5)
  • Primer 4 5'-CATGGATCCTTAGCACCATGTGGAAGGAAAGGA-3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Nhel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0023a02 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: 10 pg of pBS-0023a02 plasmid was contained in a total volume of 50 ⁇ l, and primers Primer-3 and Primer-4 were lOpraol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (pET-0023a02) was transformed into E. coli BL21 (DE3) plySs (product of Novagen) with calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following MGC-2413. 31-specific peptides:
  • the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • the selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides; 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours. '
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the expression profiles of MGC-2413. 31 and MGC-24 according to the present invention are very similar.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une MGC-24 13.31, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de tumeurs malignes, de l'hémopathie, de troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la MGC-24 13.31.
PCT/CN2001/001088 2000-06-30 2001-06-29 Nouveau polypeptide, mgc-24 13.31, et polynucleotide codant ce polypeptide WO2002020776A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002212052A AU2002212052A1 (en) 2000-06-30 2001-06-29 A novel polypeptide-mgc-2413.31 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116945.9 2000-06-30
CN 00116945 CN1331114A (zh) 2000-06-30 2000-06-30 一种新的多肽——mgc－2413.31和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002020776A1 true WO2002020776A1 (fr) 2002-03-14

Family

ID=4586344

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001088 WO2002020776A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, mgc-24 13.31, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331114A (fr)
AU (1) AU2002212052A1 (fr)
WO (1) WO2002020776A1 (fr)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [online] 1 October 1996 (1996-10-01), HOFFER M.J. ET AL., retrieved from GI:547841 accession no. NCBI Database accession no. (P35951) *
DATABASE PROTEIN [online] 2 December 1998 (1998-12-02), WATT S.M. ET AL., retrieved from GI:3941728 accession no. NCBI Database accession no. (AAC82473.1) *

Also Published As

Publication number Publication date
AU2002212052A1 (en) 2002-03-22
CN1331114A (zh) 2002-01-16

Similar Documents

Publication Publication Date Title
WO2002000822A2 (fr) Nouveau polypeptide, sous-unite humaine 2 $g(b) 16.5 du facteur d'initiation necessaire a la synthese proteique, et polynucleotide codant ce polypeptide
WO2001092319A1 (fr) NOUVEAU POLYPEPTIDE, RECEPTEUR HUMAIN 19.68 DE L'INTERFERON α, ET POLYNUCLEOTIDE CODANT CE POLYPEPTIDE
WO2002014510A1 (fr) Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide
WO2002020776A1 (fr) Nouveau polypeptide, mgc-24 13.31, et polynucleotide codant ce polypeptide
WO2001096560A1 (fr) Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092329A1 (fr) Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide
WO2001090133A1 (fr) Nouveau polypeptide, uracil desoxyribonucleotide glycosylase humaine 22, et polynucleotide codant ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2002006470A1 (fr) Nouveau polypeptide, myoglobuline humaine ixa11.88, et polynucleotide codant ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2002040525A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 18.92, et polynucleotide codant ce polypeptide
WO2001092515A1 (fr) Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001092517A1 (fr) Nouveau polypeptide, proteine humaine 29.15 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2001094401A1 (fr) Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide
WO2001092518A1 (fr) Nouveau polypeptide, proteine humaine 9.5 associee a la ccr4, et polynucleotide codant ce polypeptide
WO2001083540A1 (fr) Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide
WO2001094537A2 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 21.89, et polynucleotide codant ce polypeptide
WO2001092315A1 (fr) Nouveau polypeptide, proteine humaine d'epissage 10.56, et polynucleotide codant ce polypeptide
WO2001094534A2 (fr) Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide
WO2001090381A1 (fr) Nouveau polypeptide, recepteur humain $g(a)-interferon 115.62, et polynucleotide codant ce polypeptide
WO2001083685A2 (fr) Nouveau polypeptide, proteine cap 10, et polynucleotide codant pour ce polypeptide
WO2002000833A2 (fr) Nouveau polypeptide, proteine 113.31 d'acide gamma carboxyglutamique riche en proline, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP