WO2001081562A1 - Novel insulin/igf/relaxin family polypeptides and dnas thereof - Google Patents
Novel insulin/igf/relaxin family polypeptides and dnas thereof Download PDFInfo
- Publication number
- WO2001081562A1 WO2001081562A1 PCT/JP2001/003399 JP0103399W WO0181562A1 WO 2001081562 A1 WO2001081562 A1 WO 2001081562A1 JP 0103399 W JP0103399 W JP 0103399W WO 0181562 A1 WO0181562 A1 WO 0181562A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- seq
- dna
- amino acid
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/64—Relaxins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/65—Insulin-like growth factors, i.e. somatomedins, e.g. IGF-1, IGF-2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/26—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against hormones ; against hormone releasing or inhibiting factors
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/575—Hormones
- G01N2333/62—Insulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/575—Hormones
- G01N2333/64—Relaxins
Definitions
- the present invention relates to a novel secretory biofunction regulating protein and its DNA. More specifically, it relates to a novel insulin / IGFZ Ming relaxin family protein and its DNA.
- Living organisms perform integrated regulation of development, differentiation, proliferation, and maintenance of homeostasis by transmitting information between cells or tissues.
- proteinaceous factors mediate them.
- secretory factors humoral factors
- cytodynamics include lymphoforce, monoforce, interferon, colony stimulating factor, and tumor necrosis factor.
- humoral factors such as peptide hormones and growth factors produced from endocrine tissues also play a very important role in maintaining homeostasis and growth, and their application to medicine has been studied energetically. I have.
- Insulin insulin-like growth factor-I (IGF-1), insulin-like growth factor-II (IGF-II), relaxin HI (relaxin HI), relaxin H2 (relaxin H2) Is considered to be a humoral factor that forms a family of proteins, and plays a wide range of physiological roles in living organisms, such as regulating carbohydrate metabolism, promoting tissue growth, and regulating reproductive function [Bioscience Terminology Library In 'Growth Factor, Yodosha, pp. 108-109, 1995; Molecular Biology of Hormones 6 Development and Growth Factors' Hormone, Center for the Publication of Society, pp. 1-23, 1996]. We also see new molecular species belonging to the same family.
- Insulin has a signal sequence-one B domain-one C domain-one A domain structure. It is important for the expression of the activity. Insulin, insulin-like growth factor, and relaxin have many physiological activities and are important signaling factors for living organisms. Insulin is secreted by 3 cells of the kidney, and is important for regulating energy metabolism such as promoting sugar uptake in liver, muscle and adipose tissue, promoting fatty acid synthesis, promoting glycogen synthesis, and cell proliferation. Has an action. IGF-I is mainly synthesized in the liver and promotes proliferation and differentiation of many cells, including bone-derived cells.
- IGF-II has a cell growth promoting action and an insulin-like action similarly to IGF-1. These factors bind to a specific receptor and trigger autophosphorylation of that receptor, triggering a series of subsequent actions.
- relaxin has a wide range of physiological effects, mainly those related to reproductive functions, such as relaxation of the birth canal, softening of connective tissue by collagen reconstruction, and promotion of growth and differentiation of the mammary gland. ing.
- An object of the present invention is to provide a novel protein belonging to the insulin / IGFZ relaxin family which can be used in biology, medicine, veterinary medicine, etc., a precursor protein thereof, a fragment thereof, and a polynucleotide encoding the same. It is to be.
- Another object of the present invention is to provide a recombinant vector containing the polynucleotide, a transformed host cell containing the vector, and a transgenic animal into which a gene containing the polynucleotide has been introduced. .
- the present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have succeeded in discovering a novel gene expressed in a human body, and the protein encoded by the gene is insulin ZIGFZ relaxin family. It is a new secretory biological function regulating protein belonging to the group. ⁇ Further, as a result of intensive studies, the present inventors have found that, following a novel human-type secretory biological function regulating protein, a novel rat-type, rat-type variant, mouse-type and pig-type secretory biological function A regulatory protein was found.
- polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, an amide thereof, an ester thereof, or a salt thereof;
- polypeptide according to claim 1 wherein the substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 47, an amide thereof, an ester thereof, or a salt thereof;
- polypeptide according to claim 3 wherein the substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 49, an amide thereof, an ester thereof, or a salt thereof;
- a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, its amide or its ester, and the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 8 A polypeptide having the same amino acid sequence as the above, a polypeptide having an amide or an ester thereof bonded through a disulfide bond, an amide or an ester thereof, or a salt thereof;
- an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 is the amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 47, represented by SEQ ID NO: 8 7.
- the polypeptide according to claim 5 or claim 6, wherein the amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 49 is an amino acid sequence represented by SEQ ID NO: 21 or 49. Or its salt ,.
- polypeptide according to claim 1 or 3 which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 3, an amide thereof, an ester thereof, or a salt thereof,
- polypeptide according to claim 9 wherein the substantially identical amino acid sequence is the amino acid sequence represented by SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 45 or SEQ ID NO: 51. , Or its ester or its salt,
- the transformant according to claim 14 is cultured to produce the polypeptide according to claim 1, claim 3, or claim 6, wherein the polypeptide according to claim 1, claim 3, or claim 6 is produced.
- polypeptide according to claim 1, claim 3 or claim 6 comprising the polypeptide according to claim 1, claim 3 or claim 6, an amide thereof, or an ester thereof or a salt thereof.
- polypeptide according to claim 1, claim 3 or claim 6, obtained by using the screening method according to claim 17 or the screening kit according to claim 18, or an amide thereof, or A medicament comprising a compound that promotes or inhibits the activity of the ester or a salt thereof or a salt thereof;
- a pharmaceutical comprising the polypeptide according to claim 1, claim 3 or claim 6, an amide thereof, or an ester or a salt thereof,
- a diagnostic agent comprising the antibody according to claim 16,
- Claim 1, Claim 3 or Claim 4 obtained by using the screening method or claim 18 according to claim 17 or a amide thereof, or an ester thereof or a salt thereof.
- a metabolic regulator which comprises administering to the mammal a compound or a salt thereof that promotes or inhibits the activity of the polypeptide of claim 6, its amide, or its ester, or a salt thereof, or 3 the antibody of claim 16.
- Abnormalities, tissue growth, inhibition of proliferation and differentiation, impaired reproductive function, connective tissue dysplasia, tissue fibrosis, cardiovascular disorders, endocrine disorders, abnormal fluid balance, central disorders, immune system disorders, angiogenesis disorders It provides methods for prevention and treatment of cancer.
- DNA of the present invention and the polypeptide, its amide or its ester or its salt, etc. may be used for molecular weight, tissue, chromosome mapping, genetic disease identification, primer and probe design, etc. It can be used for basic research. 'Brief description of the drawings
- FIG. 1 shows the open reading frame of the novel protein (precursor protein) of the present invention and the encoded amino acid sequence.
- FIG. 2 shows the results obtained by examining the tissue expressing the human polypeptide of the present invention in Example 4 by RT-PCR.
- lane 1 is heart
- lane 2 is brain
- lane 3 is placenta (placenta)
- lane 4 is lung
- lane 5 is liver
- lane 7 is kidney (kidney)
- lane 8 is pancreas (lean)
- lane 9 is spleen (spleen)
- lane 10 is thymus (thymus)
- lane 11 prostate (prostate)
- Lane 1 2 is tes t is (testis)
- lane 13 is ovary (ovary)
- lane 14 is small intestine (small intestine)
- lane 15 is colon (colon)
- lane 16 is peripheral blood leukocyte
- Lane 17 is hypothalamus (hypothalamus)
- lane 18 is hippocampus (hippocampus)
- lane 19 is pi tui tary (pituitary)
- lane 20 is adipocyte (adipocyte)
- FIG. 3 shows an alignment of the amino acid sequences of the novel human, mouse, rat, and pig proteins (precursor proteins) of the present invention.
- FIG. 4 shows the antibody titer of mouse antiserum against the novel polypeptide A-chain N-terminal peptide of the present invention.
- FIG. 5 shows the results of detection of the novel polypeptide gene-introduced AtT20 cell line of the present invention based on the absorbance at 215 nm and immunoreactivity when the novel polypeptide was purified by reversed-phase HPLC from the culture supernatant of the AtT20 cell line.
- FIG. 6 shows the action of a purified human polypeptide preparation to promote intracellular cAMP production in the THP-1 cell line.
- FIG. 7 shows a construction diagram of a plasmid for expressing a human novel polypeptide fusion protein E. coli.
- T7 / lac0 promoter indicates the T7 promoter and lacoperator regions
- Amp indicates the ampicillin resistance region
- ColEl orij indicates the plasmid replication origin
- lacI q indicates l ac reblesser region
- B chain is the base sequence represented by SEQ ID NO: 16
- a chain is the base sequence represented by SEQ ID NO: 15
- C chain is the SEQ ID NO: This shows the 184th to 375th base sequence of the base sequence represented by 4.
- FIG. 8 shows the results of SDS-PAGE of whole bacterial proteins prepared from recombinant E. coli expressing a novel human polypeptide fusion protein.
- FIG. 9 shows the cell stimulating effect of the purified human novel polypeptide on the THP-1 cell line.
- FIG. 10 shows a pattern when the reaction product after treating (16-53) / (110-133) with trypsin and CPB was separated by HPLC using a TSKgel ODS-80Ts column.
- FIG. 11 shows the effect of a novel human polypeptide prepared from Escherichia coli in promoting intracellular cAMP production in a THP-1 cell line.
- FIG. 12 shows the action of a novel human polypeptide derivative prepared from Escherichia coli to promote intracellular cAMP production in the THP-1 cell line.
- the first place indicates the novel human polypeptide (16-42) ⁇ (110-133), the first row is (16-53) I (110-133), and the first row is (16-41) I (110-133).
- FIG. 13 shows the effect of the purified human novel polypeptide (16-42) I (110-133) on the expression of MMP-1 and EGF genes in normal human lung fibroblast cell line CCD-19Lu. Show.
- FIG. 14 shows the effect of the purified human novel polypeptide (16-42) / (110-133) preparation on intracellular cAMP production in normal human dermal fibroblast cell line NHDF.
- FIG. 15 shows the effect of a purified human novel polypeptide (16-42) I (110-133) preparation on intracellular cAMP production in primary cultured cells of rat anterior pituitary gland.
- FIG. 16 shows the effect of the purified human novel polypeptide (16-42) I (110-133) on the expression of VEGF gene in THP-1 cells.
- Figure 17 shows the immunoreactivity of the new polypeptide in the C0S-7 cell culture supernatant into which various novel polypeptide expression vectors were introduced. Control indicates immunological activity in the culture supernatant of COS-7 cells into which the original parent plasmid pCAN618 was introduced, and blank indicates immunoreactivity in the culture supernatant of COS-7 cells.
- FIG. 18 shows the intracellular cAMP production promoting activity on THP-1 cells in the culture supernatant of COS-7 cells into which the novel polypeptide expression vector was introduced. Control replaces the original parental plasmid, PCAN618.
- the culture supernatant of the introduced COS-7 cells, and 1 OOnM novel polypeptide shows the activity of promoting intracellular cAMP production on THP-1 cells when a novel purified polypeptide ⁇ is added.
- polypeptide of the present invention having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8 (hereinafter, represented by SEQ ID NO: 7 or SEQ ID NO: 8)
- Polypeptides containing the same or substantially the same amino acid sequence as the amino acid sequence to be prepared are sometimes collectively referred to as the polypeptide of the present invention), human warm blooded animals (for example, guinea pig, rat, mouse, Cells (eg, hepatocytes, spleen cells, nerve cells, endocrine cells, neuroendocrine cells, glial cells, kidney cells, bone marrow cells, mesangial cells) , Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophil
- polypeptide of the present invention when the polypeptide of the present invention has a signal peptide, the polypeptide can be efficiently secreted extracellularly.
- the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8 is preferably about 50% or more, preferably 50% or more, of the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8. Is about 60% or more, more preferably about 70% or more, more preferably about 70% or more. Amino acid sequences having a homology of 80% or more, particularly preferably about 90% or more, and most preferably about 95% or more.
- amino acid sequence represented by SEQ ID NO: 3 contains both the amino acid sequence represented by SEQ ID NO: 7 and the amino acid sequence represented by SEQ ID NO: 8.
- the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 3 is about 50% or more, preferably about 60% or more, more preferably the amino acid sequence represented by SEQ ID NO: 3. Is an amino acid sequence having a homology of about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more, and most preferably about 0.95% or more.
- Examples of the polypeptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8 of the present invention include, for example, those represented by the aforementioned SEQ ID NO: 7 or SEQ ID NO: 8. Having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 7 or SEQ ID NO: 8, and having substantially the same properties as the polypeptide having the amino acid sequence represented by SEQ ID NO: 8. Peptides and the like are preferred.
- amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 7 includes, for example, the amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 47.
- amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 8, more specifically, for example, the amino acid sequence represented by SEQ ID NO: 21 or SEQ ID NO: 49 Can be any amino acid sequence represented by SEQ ID NO: 8 or SEQ ID NO: 49.
- polypeptide having an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 3 include, for example, an amino acid sequence substantially the same as the amino acid sequence represented by the aforementioned SEQ ID NO: 3 And a polypeptide having substantially the same properties as a polypeptide containing the amino acid sequence represented by SEQ ID NO: 3.
- amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 3 more specifically, for example, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 45 or SEQ ID NO: 5 And the amino acid sequence represented by 1.
- Substantially the same properties include, for example, antigenicity and secreted humoral factors. And the effect of promoting intracellular cyclic AMP production. Substantially the same means that those properties are qualitatively the same. Therefore, secretion action, solubility, and physiological action properties are equivalent (eg, about 0.1 to 100 times, preferably about 0.5 to 10 times, more preferably 0.5 to 2 times). It is preferred that the degree of these properties and the quantitative factors such as the molecular weight of the polypeptide be different.
- One or more (preferably about 1 to 30, preferably about 1 to 10, and more preferably a number of (1 to 5)) amino acids in the amino acid sequence A so-called mutin such as a polypeptide containing a substituted amino acid sequence or an amino acid sequence obtained by combining them is also included.
- the position of the insertion, deletion or substitution is not particularly limited, but may be SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: : Amino acid residues other than cysteine residues in the amino acid sequence represented by each SEQ ID NO: 3.
- a polypeptide comprising the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 and the polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by 1H SEQ ID NO: 8 has the following sequence: The amino acid sequence represented by No.
- the polypeptide may be abbreviated as a B-chain) (hereinafter sometimes abbreviated as a double-chain polypeptide in the present specification).
- the double-chain polypeptide has the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7 and the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 8
- Examples of the combination of bonds between cysteine residues include, for example, Cysll of A chain (Cysll of A chain is the amino acid sequence represented by SEQ ID NO: 7, SEQ ID NO: 19 or SEQ ID NO: 47).
- the 1st and 1st cysteine residues from the N-terminal are shown.
- CyslO of B chain (CyslO of B chain is represented by SEQ ID NO: 8, SEQ ID NO: 21 or SEQ ID NO: 49)
- the cysteine residue at position 10 from the N-terminus of the amino acid sequence is the same.
- Cys24 on the A chain and Cys22 on the B chain bind, and CyslO on the A chain and Cysl5 on the A chain It is desirable that they are combined.
- Preferred polypeptides containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3 are as follows: 1
- SEQ ID NO: 3 Contains the amino acid sequence represented by SEQ ID NO: 8 (that is, the amino acid sequence encoding the B chain) from the 26th position (A rg) to the 52nd position (T rp) from the N-terminal;
- the amino acid sequence represented by SEQ ID NO: 7 that is, the amino acid sequence encoding the A chain is contained at the 119th (Asp) to the 142nd (Cys) from the N-terminus of 3
- SEQ ID NO: 8 that is, the amino acid sequence encoding the B chain
- T rp 52nd position
- amino acid sequence represented by SEQ ID NO: 21 that is, the amino acid sequence encoding the B chain
- amino acid sequence represented by SEQ ID NO: 19 ie, the amino acid sequence encoding A chain
- amino acid sequence represented by SEQ ID NO: 19 is contained at the 117th (Asp) to 140th (Cys) from the N-terminal of SEQ ID NO: 23.
- the amino acid sequence represented by SEQ ID NO: 21 (that is, the amino acid sequence encoding the B chain) is contained at the 24th position (Arg) to 50th position (Trp) from the N-terminal.
- the amino acid sequence represented by SEQ ID NO: 19 (ie, the amino acid sequence encoding A chain) is contained at the 151st position (Asp) to the 174th position (Cys) from the N-terminal of SEQ ID NO: 51.
- polypeptide of the present invention (hereinafter, the A-chain, B-chain, double-chain polypeptide, and precursor protein may be collectively referred to as the “polypeptide of the present invention”) is located at the left end according to the convention of peptide labeling. Indicates the N-terminus (amino terminus), and the right end indicates the C-terminus (potassium terminus).
- Polypeptides of the present invention typically have a C-terminus at the C-terminus It is a poxylate (one C OCT), but may be an amide (one CONH 2 ) or ester (one COOR) at the C-terminus.
- R in the ester e.g., methyl, Echiru, n- propyl, I an isopropyl or n _ butyl, etc. (6 alkyl group, for example, C 3 _ 8 cycloalkyl group cyclohexyl, etc.
- cyclopentyl to cyclo, for example, phenyl, shed one naphthyl C 6 _ 1 2 Ariru group, e.g., benzyl, phenylene Lou such phenethyl ( ⁇ _ 2 alkyl group if, Ku is alpha - naphthylmethyl etc. ⁇ - naphthyl - alkyl group or the like of C 7 - 1 4 other Araruki group, pivaloyl I Ruo carboxymethyl group is generally used as an ester for oral administration and the like are found using.
- Ariru group e.g., benzyl, phenylene Lou such phenethyl ( ⁇ _ 2 alkyl group if, Ku is alpha - naphthylmethyl etc. ⁇ - naphthyl - alkyl group or the like of C 7 - 1 4 other Araruki group, pivaloyl I Ruo carboxymethyl group is generally used as an ester for oral administration
- polypeptide of the present invention has a lipoxyl group (or propyloxylate) other than at the C-terminus
- a polypeptide in which the lipoxyl group is amidated or esterified is also included in the polypeptide of the present invention.
- ester for example, the above-mentioned C-terminal ester and the like are used.
- polypeptides of the present invention the amino acid residues at the N-terminus (eg, Mechionin residues) Amino group protecting groups (e.g., formyl group, etc. Ashiru groups such as ( ⁇ _ 6 Arukanoiru such Asechiru group) N-terminal gluminin residue generated by cleavage in vivo, pyroglutamine oxidation, C-terminal amino acid residue is homoserine-homoserine lactone, Substituents on the side chains of amino acids (eg — o
- H, SH, amino group, imidazole group, indole group, guanidino group, etc. are suitable protecting groups (for example, formyl group, acetyl group, etc. ( ⁇ 6 alkanoyl group, etc. d- 6 acyl group, etc.) ), Or complex polypeptides such as so-called sugar polypeptides to which sugar chains are bound.
- the polypeptide of the present invention may be a monomer, for example, a multimer such as a dimer, a tetramer, a hexamer, and an octamer.
- salts with physiologically acceptable acids eg, inorganic acids, organic acids
- bases eg, alkali metal salts
- Acid addition salts are preferred.
- Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acid, tartaric acid, citric acid, malic acid, oxalic acid Acid, benzoic acid, sulfonic acid, and benzenesulfonic acid).
- inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
- organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid
- Acid tartaric acid, citric acid, malic acid, oxalic acid Acid
- the polypeptide of the present invention or a salt thereof can be produced from the above-mentioned human or warm-blooded animal cell or tissue by a known method for purifying a polypeptide (protein), or a polypeptide described below. It can also be produced by culturing a transformant containing the DNA to be loaded. It can also be produced according to the peptide synthesis method described below.
- the human or mammalian tissues or cells are homogenized and then extracted with an acid or the like, and the extract is subjected to reverse phase chromatography or ion exchange chromatography. Purification and isolation can be achieved by combining the methods of chromatography.
- a commercially available resin for polypeptide (protein) synthesis can be usually used.
- resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-Hydroxymethylmethylphenylacetamide methyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl 2-hydroxymethyl) phenoxy resin, 4- (2', 4'-dimethoxyphenyl-1-Fmocaminoethyl G) phenoxy resins and the like.
- an amino acid having an ⁇ -amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target polypeptide according to various condensation methods known per se.
- the polypeptide is cleaved from the resin, and at the same time, various protecting groups are removed.
- an intramolecular disulfide bond formation reaction is performed in a highly diluted solution to obtain the target polypeptide or an amide thereof. .
- various activating reagents that can be used for the synthesis of polypeptides can be used, and carbodiimides are particularly preferable.
- the carbopimides include DCC, ⁇ , ⁇ ′-diisopropyl carbopimide, ⁇ -ethyl- ⁇ ′-(3-dimethylaminoprolyl) carbopimide, and the like.
- Activation by these means racemization suppression Add protected amino acids directly to the resin together with a protective additive (e.g., ⁇ , HOOBt) or add to the resin after activating the protected amino acid in advance as a symmetric anhydride or HOBt ester or HOOBt ester be able to.
- a protective additive e.g., ⁇ , HOOBt
- the solvent used for activating the protected amino acid or condensing with the resin may be appropriately selected from solvents known to be usable for the polypeptide (protein) condensation reaction.
- acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride, chloroform, alcohols such as trifluoroethanol , Sulfoxides such as dimethylsulfoxide, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitolil; esters such as methyl acetate and ethyl acetate; And the like are used.
- the reaction temperature is appropriately selected from a range known to be usable for a polypeptide (protein) bond formation reaction, and is usually appropriately selected from a range of about 120 to 50 ° C.
- the activated amino acid derivative is usually used in a 1.5 to 4-fold excess.
- Examples of the protecting group for the starting amino group include Z, Boc, t-pentyloxycarbonyl, isoporonyloxycarbonyl, 4-methoxybenzyloxycarbonyl, CutZ, Br-Z, and adaman.
- Tyloxycarbonyl, trifluoroacetyl, phthaloyl, formyl, 2-ditrophenylsulfenyl, diphenylphosphinochioyl, Fmoc and the like are used.
- the lipoxyl group can be, for example, an alkyl esterified (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl, etc.) Or cyclic alkyl esterification), aralkyl esterification (eg, benzyl ester, 4-port benzyl ester) Tert-, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide, etc. .
- an alkyl esterified eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl
- the hydroxyl group of serine can be protected, for example, by esterification or etherification.
- Suitable groups for this esterification include, for example, those derived from carbonic acids such as lower (C ⁇ e) alkanol groups such as acetyl groups, aroyl groups such as benzoyl groups, benzyloxycarbonyl groups, ethoxycarbonyl groups and the like. Groups and the like are used.
- Examples of a group suitable for etherification include a benzyl group, a tetrahydroviranyl group, and a tributyl group.
- the protecting group of the phenolic hydroxyl group of tyrosine for example, Bz K Cl 2 - Bzl, 2- two Torobenjiru, Br - Z, t-butyl and the like are used.
- imidazole protecting group for histidine for example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.
- Examples of the activated form of the raw oxypoxyl group include, for example, corresponding acid anhydrides, azides, active esters [alcohols (eg, phenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol, paranitrophenol, H0NB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt).
- active esters eg, phenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, cyanomethyl alcohol, paranitrophenol, H0NB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt.
- Methods for removing (eliminating) the protecting group include, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, or anhydrous hydrogen fluoride, methanesulfone, or the like.
- a catalyst such as Pd-black or Pd-carbon, or anhydrous hydrogen fluoride, methanesulfone, or the like.
- Acid treatment with acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, etc. is also used.
- the elimination reaction by the above-mentioned acid treatment is generally carried out at a temperature of about 120 to 40 ° C.
- a cation scavenger such as anisol, phenol, thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol, etc. Is valid.
- the 2,4-dinitro phenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment
- the formyl group used as an indole protecting group of tributofan is 1,2-ethanedithiol, 1
- alkali treatment with dilute sodium hydroxide solution, dilute ammonia and the like.
- the protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.
- a peptide (polypeptide) chain is extended to a desired chain length on the amino group side. After that, a polypeptide in which only the protecting group of the ⁇ -amino group at the ⁇ -terminus of the peptide chain is removed and a polypeptide in which only the protecting group of the C-terminal lipoxyl group is removed are produced.
- the peptide is condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above.
- an ester of the polypeptide for example, after condensing a hydroxyl group of a carboxy-terminal amino acid with a desired alcohol to form an amino acid ester, the desired amino acid ester is prepared in the same manner as in the amide of a polypeptide.
- An ester of the peptide can be obtained.
- the polypeptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known per se.
- a peptide synthesis method for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used.
- a partial peptide that can constitute the partial peptide of the present invention can be produced by condensing an amino acid with the remaining portion and, if the product has a protecting group, removing the protecting group.
- Known condensation methods and elimination of protecting groups include, for example, the methods described in the following 1 to 5.
- the polypeptide of the present invention can be purified and isolated by a combination of ordinary purification methods, for example, solvent extraction, distillation-column chromatography, liquid chromatography, and recrystallization.
- the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, the known method or It can be converted into a free form or another salt by a method analogous thereto.
- the DNA encoding the polypeptide of the present invention may be any as long as it contains a base sequence encoding the amino acid sequence of the polypeptide of the present invention described above. Further, it may be any of genomic DNA, cDNA derived from the above-mentioned cells and tissues, and synthetic DNA. .
- the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like.
- amplification can be carried out directly by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR) using a total RNA or mRNA fraction prepared from the cells and tissues described above.
- RT-PCR Reverse Transcriptase Polymerase Chain Reaction
- DNA encoding the polypeptide of the present invention examples include: SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: '16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: twenty two, DNA containing the nucleotide sequence represented by SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, or SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 1'8, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO No .: 46, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, having a nucleotide sequence which hybridizes under high stringency conditions to the nucleotide sequence, and substantially the same as the polypeptide of the present invention.
- DNA encoding a polypeptide having the following properties eg, biological activity, immunogenicity, secreted and acting as a humoral factor, promotion of intracellular cyclic AMP production, etc.
- Polypeptides having properties substantially the same as those of polypeptides Any DNA may be used as long as it encodes a tide.
- SEQ ID NO: 12 SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 46
- Examples of the DNA that can hybridize with the base sequence represented by SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52 under high stringent conditions include, for example, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: : 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO.:46, SEQ ID NO: 48, SEQ ID NO: 50
- DN.A or the like containing a nucleotide sequence having about 60% or more, preferably about 70% or more, and more preferably about 80% or more homology with the nucleotide sequence represented by SEQ ID NO: 52 is used.
- SEQ ID NO: 12 SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50 or SEQ ID NO: 52, as a DNA that can hybridize under high stringent conditions to a nucleotide sequence represented by the polypeptide of the present invention.
- Biological activity, immunogenicity, secreted and acting as a humoral factor, intracellular cyclic AMP production promoting action, etc. examples include DNA encoding a polypeptide having the same properties.
- Hybridization can be performed by a method known per se or a method analogous thereto, for example, Molecular Cloning; 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989).
- a commercially available library it can be performed according to the method described in the attached instruction manual.5 More preferably, it is performed under high stringent conditions. Can be.
- High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM, and a temperature of about 50 to 70 ° C, preferably about 60 to 6 ° C. The conditions at 5 ° C are shown.
- SEQ ID NO: 12 SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 18; SEQ ID NO: 20; SEQ ID NO: 22 , SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 46, SEQ ID NO: 48,.
- SEQ ID NO: 50 or base represented by SEQ ID NO: 52 A DNA having a sequence is used.
- DNA encoding “” include, for example, the nucleotide sequence represented by SEQ ID NO: 15 DNA containing DNA having
- the DNA encoding the A chain (rat type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 19) includes, for example, a base represented by SEQ ID NO: 20 A DNA containing a DNA having the sequence 0, etc.
- the DNA encoding the A chain (mouse type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 19) has, for example, a nucleotide sequence represented by SEQ ID NO: 25 DNA containing DNA, etc.
- Examples of the DNA encoding the A chain include, for example, a base represented by SEQ ID NO: 48 DNA containing sequenced DNA, etc.
- (V) B chain (human type; polypeptide containing the amino acid sequence represented by SEQ ID NO: 8)
- Examples of the DNA encoding include, for example, a DNA containing a DNA having a base sequence represented by SEQ ID NO: 16, and the like.
- the DNA encoding the B chain includes, for example, a DNA having the base sequence represented by SEQ ID NO: 22 Such as DNA containing
- the DNA encoding the B chain (mouse type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 21) is, for example, a DNA having the base sequence represented by SEQ ID NO: 26 DNA containing
- DNA encoding the 'B chain (butane type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 49) has, for example, a nucleotide sequence represented by SEQ ID NO: 50 DNA containing DNA, etc.
- Examples of the DNA encoding a double-chain polypeptide (human type) and a precursor protein (human type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 3) include, for example, SEQ ID NO: Represented by 12: a DNA containing a DNA having a base sequence, such as (X) a double-chain polypeptide (rat type) and a precursor protein (rat type; SEQ ID NO: 17 or SEQ ID NO:
- Examples of the DNA encoding the polypeptide comprising the amino acid sequence represented by SEQ ID NO: 51) include, for example, a DNA containing a DNA having the base sequence represented by SEQ ID NO: 18 or SEQ ID NO: 52,
- Examples of the DNA encoding the double-chain polypeptide (mouse type) and the precursor protein (mouse type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 23) include, for example, SEQ ID NO: : DNA containing DNA having the base sequence represented by 24, etc.
- Examples of the DNA encoding the double-chain polypeptide (Busun type) and the precursor protein (Busun type; a polypeptide containing the amino acid sequence represented by SEQ ID NO: 45) include, for example, And DNA containing DNA having the nucleotide sequence represented by SEQ ID NO: 46.
- Means for cloning DNA that completely encodes the polypeptide of the present invention include: Amplify by the PCR method using a synthetic DNA primer having a partial nucleotide sequence of the polypeptide of the present invention, or encode a part or the whole region of the polypeptide of the present invention with DNA incorporated in an appropriate vector. Selection can be carried out by hybridization with DNA fragments or those labeled with synthetic DNA. Hybridization can be performed, for example, according to the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.
- the DNA base sequence can be converted using PCR or a known kit, for example, Mutan (registered trademark)-super Express Km (Takara Shuzo), Mutan (registered trademark)-K (Takara Shuzo), or the like. It can be carried out according to a method known per se, such as the ODA-LA PCR method, the Gupped duplex method, the Kunkel method, or a method analogous thereto.
- the DNA encoding the cloned polypeptide can be used as it is depending on the purpose, or digested with a restriction enzyme, if desired, or added with a linker.
- the DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation termination codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter.
- the expression vector for the polypeptide of the present invention includes, for example, (a) cutting out a DNA fragment of interest from DNA encoding the polypeptide of the present invention, and (mouth) converting the DNA fragment into a promoter of an appropriate expression vector. It can be produced by ligating downstream, or downstream of a nucleotide sequence encoding an appropriate protective peptide.
- the vector examples include a plasmid derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), a plasmid derived from Bacillus subtilis (eg, pUB110, pTP5, pC194), a plasmid derived from yeast (eg, pSH19 5)
- E. coli eg, pBR322, pBR325, pUC12, pUC13
- Bacillus subtilis eg, pUB110, pTP5, pC194
- yeast eg, pSH19 5
- bacteriophage such as ⁇ phage
- animal viruses such as retrovirus, vaccinia virus, baculovirus, etc., ⁇ -II, pXTl, pRcZCMV, pRcZRSV, pcDNAI / Neo, pET-1, pET-2, pET-3, pET-4
- the promoter used in the present invention may be any promoter as long as it is an appropriate promoter corresponding to the host used for gene expression.
- SRa promoter when an animal cell is used as a host, SRa promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter,] 3-actin promoter are exemplified.
- CMV cytomegalovirus
- SR SR promoter
- 3-actin promoter a CMV (cytomegalovirus) promoter
- the host is Escherichia, the host is Bacillus, such as trp promoter, lac promoter, rec A promoter, ⁇ PL promoter, lpp promoter, T7 promoter, etc.
- the host is yeast, PH ⁇ 5 promoter, PGK promoter, GAP promoter, ADH promoter, etc. Is preferred.
- polyhedrin promoter overnight, P10 promoter, etc. are preferred.
- T7 promoter expression system When a T7 promoter expression system is used, 17 types of promoters found on T7 DNA as T7 promoters [JL Oakley et al., Proc. Natl. Acad. Sci, USA, 74: 4266-4270 (1977), MD Rosa, Cell 16: 815-825 (1979), N. Panayotatos et al., Nature, 280: 35 (1979), JJ Dunn et al., J. Mol. Biol., 166: 477 -535 (1983)], but the ⁇ 10 promoter [AH Rosenberg et al., Gene, 56: 125-135 (1987)] is preferred.
- the vector is preferably constructed by incorporating the T7 promoter and the T7 promoter into the vector described above.
- Such vectors include pET-1, pET-2, and pET-3. , PET-4, pET-5, pET-11 [AH Rosenberg, Gene 56: 125-135 (1987)].
- the expression vector may further include an enhancer, a splicing signal, a polyA addition signal, a selection marker, and an SV40 replication origin (hereinafter referred to as SV40o).
- SV40o SV40 replication origin
- the selection Ma one force one, for example, dihydrofolate reductase (hereinafter, there Ru sometimes abbreviated as dhfr) gene [Mesotorekise Ichito (MTX) resistance], ampicillin resistant gene (hereinafter sometimes abbreviated as Amp r there), neomycin resistant gene (hereinafter sometimes you abbreviated as Ne o r, include Geneticin resistance) and the like.
- dh fr gene is used as a selection marker using Chinese hamster cells deficient in the dh fr gene
- recombinant cells can also be selected using a thymidine-free medium.
- a signal sequence suitable for the host is added to the N-terminal of the polypeptide of the present invention.
- the host is a bacterium belonging to the genus Escherichia
- the host comprises the a-amylase ⁇ signal sequence, subtilisin ⁇ signal sequence, etc. If yeast, MFo; signal sequence, SUC2, signal sequence, etc.If the host is an animal cell, insulin-signal sequence, Hi-I interferon, signal sequence, folded molecule, signal sequence, etc. Available for each.
- a transformant can be produced.
- genus Escherichia for example, genus Escherichia, genus Bacillus, yeast, insect cells, insects, animal cells and the like are used.
- Escherichia examples include, for example, Escherichia coli Kl 2 ⁇ DH1 Proc. Natl. Acad. Sci. USA), 60, 160 (1968)], JM103 [Nucleic Acids Research, (Nucleic Acids Research), 9th volume, 309 (1981)], J ⁇ 21 [Journal ' Journal of Molecular Biology], 120, 517 (1978)], 101 [Journal of Molecular Biology, 41, 459 (1969)], C 600 [Genetic (Genetics), 39, 440 (1954)].
- T7 promoter expression system the T7 RNA polymerase gene [FW Studier et al., J. Mol. Biol.
- Escherichia coli strains such as MM294, DH-1, C600, JM109, BL21, or an E. coli strain in which the T7 RNA polymerase gene has been integrated together with other plasmids are used.
- MM 294 strain, BL21 strain, BL21 (DE3) strain or the like in which a ⁇ phage into which a T7 RNA polymerase gene has been incorporated are lysogenized are used.
- a promoter of the T7 RNA polymerase gene a lac promoter whose expression is induced by isopropyl-11-galactopyranoside (IPTG) is used.
- Bacillus bacteria examples include, for example, Bacillus' Bacillus subtilis M1114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry, Vol. 95, 87 (1984)].
- yeasts include, for example, Saccharomyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D, 20B12, Schizosaccharomyces pombe NCYC 1913, NCYC2036, Pichia pastoris (Pichia pasta) Are used.
- Insect cells include, for example, when the virus is Ac NPV, a cell line derived from the larvae of night moth (Spodoptera frugiperda cell; Sf cell), MG1 cells derived from the midgut of Trichoplusia ni, and High derived from eggs of Trichoplusia ni Five TM cells, cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used.
- the virus is BmNPV
- a silkworm-derived cell line Boombyx mori N cell; BmN cell
- Sf cells for example, Sf9 cells (ATCCCRL1711), Sf21 cells (above, Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like are used.
- insects for example, silkworm larvae are used [Maeda et al., Nature, Vol. 315, 592 (1985)].
- animal cells examples include monkey cells COS-7, Vero, Chinese Hams Single cell CHO (hereinafter abbreviated as CHO cell), dh fr gene deficient Chinese Muscle Yuichi cell CHO (hereinafter abbreviated as CHO (dh fr—) cell), mouse L cell, mouse At T20, mouse mye Cells, rat GH3, human FL cells, etc. are used.
- CHO cell Chinese Hams Single cell CHO
- dh fr— Chinese Muscle Yuichi cell CHO
- mouse L cell mouse At T20
- mouse mye Cells rat GH3, human FL cells, etc.
- Escherichia for example, Processings of the National 'Academy of the Sciences' of the 'Us' (Pro ail. Acad. Sci. USA), 69 Vol., 21 10 (1972) and Gene, 17, 17 (1982).
- Transformation of Bacillus spp. Can be performed, for example, according to the method described in Molecular & General Genetics, Vol. 168, 111 (1979).
- Insect cells or insects can be transformed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988). To transform animal cells, see, for example, Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973). It can be performed according to the method described.
- a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is contained therein.
- Carbon sources include, for example, glucose, dextrin, soluble starch, sucrose, etc.
- Nitrogen sources include, for example, ammonium salts, nitrates, corn chip liquor, peptone, casein, yeast extract, Inorganic or organic substances such as meat extract, soybean meal and potato extract, and inorganic substances include, for example, calcium chloride, sodium dihydrogen phosphate, magnesium chloride and the like.
- yeast extract, vitamins, growth promoting factors and the like may be added.
- the pH of the medium is preferably about 5-8.
- Examples of a medium for culturing the genus Escherichia include, for example, an M9 medium containing glucose and casamino acid (Miller, Journal of Obesperimen in, Journal of Experiments in Molecular Genetics). ), 431-433, Cold Spring Harbor Laboratory, New York 1972].
- a drug such as 3; 6-indolylacrylic acid can be added to make the promoter work efficiently if necessary.
- culturing is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.
- the culture medium may be, for example, the minimum medium of Parkholder (Burkholder) [Bostian, KL et al., Processings of the National 'Academy' Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)] and SD medium containing 0.5% casamino acid [Bitter, GA et al., Proc. Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)].
- the pH of the medium is preferably adjusted to about 5-8. Culture is usually performed at about 20-35 ° C for about 24-72 hours, and aeration and agitation are added as necessary.
- the medium used is Grace's Insect Medium (Grace, TC, Nature, 195, 788 (1962)), immobilized 10% serum. And the like to which the additives described above are appropriately added.
- the pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days. Add aeration or agitation as appropriate.
- a MEM medium containing about 5 to 20% fetal bovine serum [Science, 122, 501 (1952)] ⁇ , DMEM medium [Virology, 8, 396 (1959)], RPMI 1640 medium [Journal of the American Medical Association; Volume 199, 51 9 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine], 73, 1 (1950)], etc.
- the pH is preferably about 6 to 8. Culture is usually performed at about 30 to 40 for about 15 to 60 hours, and if necessary, aeration and agitation are added.
- polypeptide of the present invention can be produced in the cells, in the cell membrane, or outside the cells of the transformant.
- polypeptide of the present invention can be separated and purified from the culture by, for example, the following method.
- the cells or cells are collected by a known method after culturing, suspended in an appropriate buffer, and subjected to ultrasonication, lysozyme or the like. After disrupting cells or cells by freeze-thawing or the like, a method of obtaining a crude polypeptide extract by centrifugation or filtration is used as appropriate. If the polypeptide produced by the recombinant forms an inclusion body in the cells, collect the cells by centrifugation and disrupt the cells with ultrasonic waves, etc. (2-8 M guanidine hydrochloride, 5-9 M urea, etc.) to remove the polypeptide. When the polypeptide is secreted into the culture solution, after the culture is completed, bacterial cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected.
- Purification of the polypeptide contained in the culture supernatant or extract obtained in this manner can be carried out by an appropriate combination of separation and purification methods known per se.
- Known separation and purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, and the like.
- Ultrafiltration, gel filtration, SDS-polyacrylamide gel electrophoresis, etc. mainly using differences in molecular weight, ion exchange chromatography, etc., methods using zero charge, affinity chromatography, etc.
- Methods that use specific affinity such as chromatography, methods that use differences in hydrophobicity such as reversed-phase high-performance liquid chromatography, methods that use differences in isoelectric points such as isoelectric electrophoresis, etc. are used.
- the polypeptide thus obtained when obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide is obtained as a salt, a method known per se or It can be converted to a free form or another salt by an analogous method.
- the polypeptide produced by the recombinant may be treated with an appropriate protein-modifying enzyme or protease before or after purification, or may be arbitrarily modified by a chemical reaction, or the polypeptide may be partially modified. Can also be removed.
- enzymes include, for example, trypsin, chymotrypsin, arginyl endopeptidase, furin, oral hormone convertase 1 (PC1), prohormone convertase 2 (PC2) lipoxypeptidase II, protein kinase Ise, glycosidase and the like are used.
- Examples of the chemical reaction include a cleavage reaction using cyanogen bromide (CNBr).
- the extracted target protein or the separated and purified target protein is subjected to protein refolding as required.
- the refolding can be performed by a known method described in, for example, “Folding of Proteins” (edited by RH Pain, 245-279 (1995), Springer Fuerlark Tokyo) or a method analogous thereto. .
- Buffers free of extractants eg, guanidine hydrochloride, chaotropic solubilizers such as urea, surfactants such as n-laurylyl methylglycine, SDS, etc.
- extractants eg, guanidine hydrochloride, chaotropic solubilizers such as urea, surfactants such as n-laurylyl methylglycine, SDS, etc.
- It can be carried out by dilution in multiple steps or multiple steps, dialysis using a semi-permeable membrane, replacement of a buffer using gel filtration, and the like.
- arginine, polyethylene daricol, neutral surfactant, etc.] can be added to prevent aggregation of the target protein.
- Air oxidation may be performed to form a disulfide bond of the protein, or a redox buffer system or the like may be added.
- Dartachi in redox buffer Based on, cysteine, dithioth
- both can be linked by a disulfide bond.
- the DNA fragments encoding the A chain and the .B chain are each ligated to the lacZ (-galactosidase) gene, and Escherichia coli is used as a host; 6-galactosidase + A chain and 3-galactosidase + B chain.
- the A and B chains can be cut out of the fusion protein by cyanogen bromide treatment or enzyme treatment.
- the cut A-chain and B-chain are mixed in a reduced state, and then gradually oxidized, so that the A-chain and the B-chain can be converted into a protein linked by a disulfide bond.
- the linked state of A chain and B chain is, for example, that Cys 11 of A chain binds to Cys 10 of B chain, Cys 24 of A chain binds to Cys 22 of B chain, and furthermore, CyslO of A chain and CyslO of A chain Preferably, Cysl5 is bound.
- the conversion conditions at this time may be, for example, a method for producing an insulin molecule [Pro atl. Acad. Sci. USA (Pro atl. Acad. Sci. USA) ), 76, 106 (19779)].
- the presence of the thus produced polypeptide of the present invention or a salt thereof can be measured by an enzyme immunoassay or Western blot analysis using a specific antibody.
- An antibody against the polypeptide of the present invention, its amide, or its ester or a salt thereof may be any antibody capable of recognizing the polypeptide of the present invention. Either a polyclonal antibody or a monoclonal antibody may be used.
- An antibody against the polypeptide of the present invention can be produced using the polypeptide of the present invention as an antigen according to a method for producing an antibody or antiserum known per se. .
- the polypeptide of the present invention is administered to a warm-blooded animal at a site capable of producing an antibody by administration, itself or together with a carrier or a diluent.
- Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to increase antibody production during administration. No. Administration is usually performed once every 2 to 6 weeks, for a total of 2 to 10 times.
- Examples of the warm-blooded animal to be used include monkeys, rabbits, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, and mice and rats are preferably used.
- a warm-blooded animal immunized with an antigen for example, a mouse with an antibody titer was selected from a mouse, and the spleen or lymph node was collected 2 to 5 days after the final immunization.
- the monoclonal antibody-producing hybridoma can be prepared by fusing the antibody-producing cells contained in the above with myeloma cells of the same or different species.
- the antibody titer in the antiserum can be measured, for example, by reacting the labeled polypeptide described below with the antiserum, and then measuring the activity of the labeling agent bound to the antibody.
- the fusion operation can be performed according to a known method, for example, the method of Köhler and Milstein [Nature, (Nature), 256, 495 (1975)].
- the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used.
- myeloma cells examples include myeloma cells of warm-blooded animals such as NS-1, P3U1, SP2Z0, and AP-1, but P3U1 is preferably used.
- the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG 1000 to PEG 6000) is used at a concentration of about 10 to 80%.
- Cell fusion can be carried out efficiently by adding the mixture and incubating at about 20 to 40 ° C, preferably about 30 to 37 ° C for about 1 to 10 minutes.
- a hybridoma culture supernatant is added to a solid phase (eg, microplate) on which a polypeptide antigen is adsorbed directly or together with a carrier, and Next, an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cell used for cell fusion is a mouse) or protein A labeled with a radioactive substance or an enzyme is added, and the monoclonal antibody bound to the solid phase is added.
- a solid phase eg, microplate
- an anti-immunoglobulin antibody anti-mouse immunoglobulin antibody is used if the cell used for cell fusion is a mouse
- protein A labeled with a radioactive substance or an enzyme is added, and the monoclonal antibody bound to the solid phase is added.
- a method for detecting a null antibody adding a hybridoma culture supernatant to a solid phase to which anti-immunoglobulin antibody or protein A has been adsorbed, adding a polypeptide labeled with a radioactive substance, an enzyme, etc.
- Methods for detecting oral antibodies and the like can be mentioned.
- the selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Usually, it can be performed in an animal cell culture medium supplemented with HAT (hypoxanthine, aminopterin, thymidine).
- HAT hyperxanthine, aminopterin, thymidine
- any medium can be used as long as it can grow a hybridoma.
- RPMI 1640 medium containing about 1 to 20%, preferably about 10 to 20% fetal bovine serum, GIT medium containing about 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) Or a serum-free culture medium for hybridoma culture (SF M-101, Nissui Pharmaceutical Co., Ltd.).
- the cultivation temperature is usually about 20 to 40 ° C, preferably about 37 ° C.
- the culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks.
- the culture can be usually performed under 5% carbon dioxide.
- the antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.
- Monoclonal antibodies can be separated and purified by a method known per se, for example, an immunoglobulin separation and purification method [eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method, ion exchanger (eg, DEAE ), Specific centrifugation method, gel filtration method, antigen-binding solid phase or specific purification method in which only antibody is collected using an active adsorbent such as protein A or protein G and the bond is dissociated to obtain the antibody). It can be carried out.
- an immunoglobulin separation and purification method eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method, ion exchanger (eg, DEAE ), Specific centrifugation method, gel filtration method, antigen-binding solid phase or specific purification method in which only antibody is collected using an active adsorbent such as protein A or protein G and the bond is dissociated to obtain the antibody. It can be carried out.
- the polyclonal antibody of the present invention can be produced according to a method known per se or a method analogous thereto.
- an immunizing antigen (the polypeptide antigen of the present invention) itself or a complex thereof with a carrier protein is formed, and a warm-blooded animal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. It can be produced by collecting the substance containing the antibody against the polypeptide of the present invention and separating and purifying the antibody.
- the type of carrier-protein and the mixing ratio of carrier-hapten to hapten immunized by cross-linking with carrier- Any antibody can be cross-linked at any ratio as long as the antibody can be efficiently prepared.
- a method is used in which brin, hemocyanin and the like are coupled in a weight ratio of about 0.1 to 20 and preferably about 1 to 5 with respect to 1 hapten.
- various condensing agents can be used for the coupling of octabutene and carrier.
- an active ester reagent containing a daltaraldehyde dicarbodiimide, a maleimide active ester, a thiol group, or a dithioviridyl group is used.
- the condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible.
- Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is usually performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.
- the polyclonal antibody can be collected from blood, ascites, or the like, preferably from blood of a warm-blooded animal immunized by the above method.
- the polyclonal antibody titer in the antiserum can be measured in the same manner as the measurement of the antibody titer in the antiserum described above. Separation and purification of the polyclonal antibody can be carried out according to the same immunoglobulin separation and purification method as the above-mentioned separation and purification of the monoclonal antibody.
- the antisense DNA having a nucleotide sequence complementary to or substantially complementary to the DNA encoding the polypeptide of the present invention (hereinafter sometimes referred to as the DNA of the present invention) is defined as Any antisense DNA may be used as long as it has a base sequence complementary or substantially complementary to the DNA of the present invention and has an action capable of suppressing the expression of the DNA.
- the nucleotide sequence substantially complementary to the DNA of the present invention is, for example, the entire nucleotide sequence or a partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention (that is, the complementary strand of the DNA of the present invention). And about 70% or more, preferably about 80% or more, more preferably about 90% or more, and most preferably about 95% or more. In particular, among the entire base sequence of the complementary strand of the DNA of the present invention, it encodes the N-terminal portion of the polypeptide of the present invention.
- Antisense DNA having the above homology is preferred. These antisense DNAs can be produced using a known DNA synthesizer or the like.
- polypeptide of the present invention When the polypeptide of the present invention has a signal peptide, it is efficiently secreted extracellularly and exerts important biological activities such as regulation of biological functions as a humoral factor.
- the polypeptide of the present invention is expressed in a tissue-specific manner, it can be used as a tissue marker. That is, it is useful as a tool for detecting tissue differentiation, disease state, metastasis of cancer, and the like. It can also be used for sorting corresponding receptors, binding polypeptides, and the like. Furthermore, it can be used as a panel for high-throughput screening known per se to examine biological activity.
- the polypeptide of the present invention exists as a humoral factor in vivo, and promotes the expression of MMP-1 (matrix meta-oral proteinase-1) and VEGF (vascular endothelial cell growth factor) as described in Examples below.
- MMP-1 matrix meta-oral proteinase-1
- VEGF vascular endothelial cell growth factor
- the polypeptide of the present invention or the DNA of the present invention is abnormal or defective, or if the expression level is abnormally decreased or enhanced, for example, the energy of carbohydrate or the like
- Abnormal metabolic regulation of sources sugar metabolism, lipid metabolism, etc.) (eg, diabetes, obesity, etc.), inhibition of tissue growth / proliferation / differentiation, impaired reproductive function, abnormal formation of connective tissue (eg, strong Skin fibrosis), tissue fibrosis (eg, cirrhosis ⁇ pulmonary fibrosis, scleroderma or renal fibrosis), cardiovascular disorders (peripheral artery disease, myocardial
- the polypeptide of the present invention and the DNA of the present invention are, for example, abnormally regulated in metabolism of energy sources such as carbohydrates (sugar metabolism, lipid metabolism, etc.). Diabetes, obesity, etc.), inhibition of tissue growth, proliferation and differentiation, impaired reproductive function, connective tissue dysplasia (eg, scleroderma), tissue fibrosis (eg, cirrhosis, pulmonary fibrosis, Scleroderma or renal fibrosis, etc., circulatory disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteriosclerosis, endocrine disorders, abnormal fluid balance, central illness, immune system disorders (eg allergies, inflammation, self It can be used as a medicament such as an agent for treating or preventing various diseases such as immune diseases and angiogenesis disorders.
- energy sources such as carbohydrates (sugar metabolism, lipid metabolism, etc.). Diabetes, obesity, etc.), inhibition of tissue growth, proliferation and differentiation, impaired reproductive function, connective tissue dysplasia (eg,
- the polypeptide of the present invention forms a family with another insulin / IGFZ relaxin family polypeptide, the polypeptide of another family or its DNA or the like is abnormal or defective. Even if the expression ⁇ is abnormally low or increased, the present invention can be used even if the expression level is not abnormal, especially when the expression level is not abnormal.
- the polypeptide of the present invention is preferably formed from one set of disulfide bonds in the A chain and two sets of disulfide bonds between the A and B chains. There may also be molecular species of the A chain alone or the B chain alone having one set of disulfide bonds.
- Metabolic regulation of the molecular species of the A or B chain alone (sugar metabolism, lipid metabolism, etc.) Abnormality (eg, diabetes, obesity, etc.), tissue growth / proliferation / differentiation inhibition, decline in reproductive function connective tissue Dysplasia (eg, scleroderma), tissue fibrosis (eg, cirrhosis-pulmonary fibrosis, scleroderma or kidney fibrils, etc.), cardiovascular disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteries Sclerosis, endocrine disorders, fluid balance imbalance, central illness, immune system disorders (eg, allergies, inflammation, autoimmune disorders, etc.), angiogenesis disorders, etc. It can be used as a medicine for treating and preventing diseases.
- Abnormality eg, diabetes, obesity, etc.
- tissue growth / proliferation / differentiation inhibition decline in reproductive function connective tissue Dysplasia
- tissue fibrosis eg, cirrhosis-pulmonary fibros
- the DNA of the present invention is used. After administering to the patient and expressing the polypeptide of the present invention in vivo, the DNA of the present invention is inserted into (oral) cells to express the polypeptide of the present invention.
- the role of the polypeptide of the present invention in the patient can be satisfactorily or normally exerted in the patient by, for example, administering the polypeptide of the present invention to the patient.
- the DNA of the present invention when used as the above-mentioned therapeutic or prophylactic agent, the DNA may be used alone or in an appropriate form such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. After insertion into a suitable vector, it can be administered to humans or warm-blooded animals according to conventional means.
- the DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting ingestion, and by means of a catheter such as a gene gun ⁇ hydrogel catheter.
- polypeptide of the present invention When used as the above-mentioned therapeutic / prophylactic agent, it is purified to at least 90%, preferably 95% or more, more preferably 98% or more, and still more preferably 99% or more. It is preferred to use one.
- the polypeptide of the present invention can be used, for example, in the form of tablets, capsules, elixirs, microcapsules, etc., which are sugar-coated as required, orally, or aseptically with water or other pharmaceutically acceptable liquids. It can be used parenterally in the form of injections such as aqueous solutions or suspensions.
- the polypeptide of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like in a unit dosage form generally required for the practice of pharmaceutical preparations. It can be manufactured by doing. The amount of the active ingredient in these preparations is such that an appropriate dosage in the indicated range can be obtained. Additives that can be mixed with tablets, capsules, etc.
- the unit dosage form is a capsule
- the above type of material can further contain a liquid carrier such as an oil or fat.
- Sterile compositions for injection can be formulated in accordance with normal formulation practice, including dissolving or suspending the active substance in vehicles, such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil. it can.
- aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.).
- isotonic solutions containing glucose and other adjuvants eg, D-sorbitol, D-mannitol, sodium chloride, etc.
- alcohols eg, ethanol, etc.
- polyalcohols eg, propylene glycol, polyethylene glycol, etc.
- non-ionic surfactants eg, Polysorbate 80 TM , HCO-50, etc. It may be used together.
- oily liquid examples include vegetable oils such as olive oil, sesame oil, soybean oil, laccase oil, cottonseed oil, and corn oil, and propylene glycol. And the like.
- buffers for example, phosphate buffer, sodium acetate buffer, etc.
- soothing agents for example, benzal conidum chloride, proforce hydrochloride, etc.
- stabilizers for example, human serum albumin, polyethylene) Glycol, etc.
- preservatives eg, benzyl alcohol, phenol, etc.
- antioxidants antioxidants and the like.
- the prepared injection is usually filled in an appropriate ampoule.
- the vector containing the DNA of the present invention is also formulated as described above, and is usually used parenterally.
- the preparations obtained in this way are safe and low toxic and can be used, for example, in warm-blooded animals (eg, humans, rats, mice, mice> Cats, dogs, monkeys, etc.).
- the dosage of the polypeptide of the present invention varies depending on the target disease, the administration subject, the administration route, and the like.
- metabolic regulation sucgar metabolism, lipid metabolism, etc.
- abnormal eg, diabetes, obesity, etc.
- tissue growth 'Proliferation' inhibition eg, reproductive dysfunction
- connective tissue dysplasia eg, scleroderma
- tissue fibrosis eg, menstrual cirrhosis, pulmonary fibrosis, scleroderma or kidney
- Fibrosis etc.
- cardiovascular disorders peripheral artery disease, myocardial infarction or heart failure, etc.
- arteriosclerosis endocrine disorders
- fluid balance imbalance central illness
- immune system disorders eg, allergic, inflammation
- the peptide is administered in an amount of about 0.01 mg to 1000 mg, preferably about lmg to 1000 mg, more preferably about 10 to 500 mg, more preferably about 10 to 20 Omg.
- the single dose of the polypeptide of the present invention varies depending on the administration subject, target disease, and the like. For example, metabolic regulation (sugar metabolism, lipid metabolism, etc.) is abnormal (for example, diabetes, obesity, etc.).
- the polypeptide of the present invention is about 0.001 to 50 mg / day.
- the compound or its salt that promotes the function (activity) of the polypeptide of the present invention can be produced, for example, by metabolizing energy sources such as carbohydrates. Regulation (sugar metabolism, lipid metabolism, etc.) abnormal (eg diabetes, obesity, etc.), inhibition of tissue growth, proliferation, differentiation, impaired reproductive function, connective tissue dysplasia (eg, bowel dermatosis, etc.), tissue Fibrosis (eg, cirrhosis, pulmonary fibrosis, scleroderma or renal fibrosis), circulatory disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteriosclerosis, endocrine disorders, abnormal fluid balance, central illness, It can be used as a medicament for the treatment of various diseases such as immune system diseases (eg, allergic diseases, inflammation, autoimmune diseases, etc.) and angiogenesis disorders.
- a compound or a salt thereof that inhibits the function (activity) of the polypeptide of the present invention can be used as a medicament such as an agent for treating or preventing a disease caused by excessive production of the polypeptide of the present invention.
- the polypeptide of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the function (activity) of the polypeptide of the present invention.
- a compound or salt thereof which promotes the function (activity) of the polypeptide of the present invention or a salt thereof characterized by using the polypeptide of the present invention or a salt thereof hereinafter sometimes referred to as an accelerator.
- a compound that inhibits the function (activity) of the polypeptide of the present invention or a salt thereof hereinafter sometimes abbreviated as an inhibitor.
- the screening kit of the present invention contains the polypeptide of the present invention or a salt thereof.
- the screening method of the present invention (i) a case in which the polypeptide of the present invention is brought into contact with a tissue, a cell, or a membrane fraction thereof to which the polypeptide of the present invention binds;
- a tissue, a cell, or a membrane fraction thereof to which the polypeptide binds for example, a tissue, a cell, or the like to which the polypeptide of the present invention binds
- the screening method of the present invention comprises:
- the labeled polypeptide of the present invention When the labeled polypeptide of the present invention is brought into contact with a tissue, a cell, or a membrane fraction thereof to which the polypeptide of the present invention binds, the labeled polypeptide of the present invention and the test compound are compared with those of the present invention. Tissues, cells, or membrane fractions of the labeled polypeptide of the present invention, to which the polypeptides of the present invention bind, in contact with tissues, cells, or their membrane fractions to which the polypeptides bind.
- a compound that alters the binding of a polypeptide of the present invention to a tissue, cell, or membrane fraction thereof to which the polypeptide of the present invention binds which is characterized by measuring the amount of binding to A compound that promotes or inhibits the activity of the polypeptide of the invention) or a salt thereof,
- the labeled polypeptide of the present invention When the labeled polypeptide of the present invention is brought into contact with a cell containing the receptor for the polypeptide of the present invention or the si fraction of the cell, the labeled polypeptide of the present invention and the test compound are compared with each other. The amount of the labeled polypeptide of the present invention bound to the cell or the membrane fraction when the cell was contacted with the cell containing the receptor for the polypeptide of the present invention or the membrane fraction of the cell was measured.
- a compound that changes the binding property between the polypeptide of the present invention and a receptor for the polypeptide of the present invention compound that promotes or inhibits the activity of the polypeptide of the present invention
- a compound thereof Salt screening method
- the labeled polypeptide of the present invention is expressed on the cell membrane by culturing a transformant containing a DNA encoding a receptor for the polypeptide of the present invention, and expressed on the cell membrane.
- a test compound By contacting the labeled polypeptide of the present invention and a test compound with a receptor for the polypeptide of the present invention, and culturing a transformant containing a DNA encoding the receptor for the polypeptide of the present invention.
- a compound that alters the binding between the polypeptide of the present invention and a receptor for the polypeptide of the present invention a compound that promotes or inhibits the activity of the polypeptide of the present invention
- a compound that activates a receptor for the polypeptide of the present invention for example, a polypeptide of the present invention
- cell-stimulating activity via the receptor for the polypeptide of the present invention for example, Arakidon acid release, acetylcholine release, intracellular C a 2 + free intracellular c AM P production, intracellular c GM P production formation, inositol phosphate production, change in cell membrane potential, phosphorylation of intracellular proteins, c - fos
- ⁇ culturing a transformant containing a DNA encoding the receptor for the polypeptide of the present invention with a compound that activates the receptor for the polypeptide of the present invention for example, the polypeptide of the present invention
- a compound that activates the receptor for the polypeptide of the present invention for example, the polypeptide of the present invention
- a compound that activates the receptor for the polypeptide of the present invention and a compound that activates the receptor for the polypeptide of the present invention expressed on the cell membrane by the method of the present invention The polypeptide of the present invention when the transformant containing the DNA encoding the receptor for the polypeptide is brought into contact with the receptor for the polypeptide of the present invention expressed on the cell membrane by culturing.
- a compound that alters the binding between the polypeptide of the present invention and the receptor of the polypeptide of the present invention which is characterized by measuring and comparing the activity of promoting or suppressing the activity of the polypeptide (the present invention).
- a compound that promotes or inhibits the activity of the polypeptide) or a salt thereof e.g., arachidonic acid release, acetylcholine release, intracellular Ca2 + release, intracellular CAMP generation, intracellular cGMP generation, Nositol phosphate production, fluctuations in cell membrane potential, phosphorylation of intracellular proteins, activation of c-fos, decrease in extracellular fluid pH, NO production, production of physiologically active substances specifically produced by the cells.
- a compound that alters the binding between the polypeptide of the present invention and the receptor of the polypeptide of the present invention which is characterized by measuring and comparing the activity of promoting or suppressing the activity of the polypeptide (the present invention).
- DNA DNA encoding the receptor for the polypeptide of the present invention can be obtained by the following method.
- Labeled polypeptides of the present invention a fluorescent substance such as a radioisotope or Furuoresein such 1 2 5 I or Piochin like, find cell lines which the label is specifically binding, tissue, organs and the like.
- mRNA is extracted therefrom by a known method, and cDNA is synthesized, and then cloned into an expression vector for animal cells. This is introduced into COS 7 cells or the like, and the transformed cell into which DNA encoding the receptor for the polypeptide of the present invention has been incorporated is determined whether or not the above-mentioned marker binds to the transformed cell. (Expression cloning).
- a tissue, a cell, or a membrane fraction thereof to which the polypeptide of the present invention binds for use in the screening method of the present invention that is, a receptor for the polypeptide of the present invention
- Any substance may be used as long as it is capable of binding specifically, but human, organs of warm-blooded animals, cultured cells, or their membrane fractions are preferred.
- human recombinant receptors expressed in large amounts using recombinants are suitable for screening.
- the screening method includes a receptor for the polypeptide of the present invention.
- the preparation method described below may be used.
- the cells containing the receptor for the polypeptide of the present invention are used, the cells may be immobilized with daltaraldehyde, formalin, or the like.
- the immobilization method can be performed according to a method known per se.
- the cell containing the receptor for the polypeptide of the present invention refers to a cell line that expresses the receptor for the polypeptide of the present invention.
- Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like can be used as host cells.
- the method for obtaining a host cell that has expressed the receptor for the polypeptide of the present invention includes the above-described method for producing a transformant transformed with the expression vector containing the polypeptide of the present invention. Similar methods can be used.
- the membrane fraction refers to a fraction containing a large amount of cell membrane obtained by a method known per se after cell disruption.
- the cells can be crushed by crushing the cells with a Potter-Elvehj em-type homogenizer, crushing with a Warinda blender-Polytron (Kinematica), crushing with ultrasonic waves, or pressing with a French press. Disruption by ejecting cells from thin nozzles can be mentioned.
- centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used.
- the cell lysate is centrifuged at a low speed (500 rpm to 300 rpm) for a short time (usually about 1 to 10 minutes), and the supernatant is further centrifuged (150 rpm to 150 rpm). And centrifugation at 3,000 rpm for 30 minutes to 2 hours, and the resulting precipitate is used as a membrane fraction.
- the membrane fraction contains a large amount of receptors for the expressed polypeptide of the present invention and membrane components such as cell-derived phospholipids and membrane proteins.
- the amount of the receptor for the polypeptide of the present invention in the cell or membrane fraction containing the receptor for the polypeptide of the present invention is preferably 10 3 to 10 8 molecules per cell, 1 0 5-1 of 0 7 molecule is preferred.
- an appropriate fraction of the receptor for the polypeptide of the present invention is used.
- a labeled polypeptide of the present invention or the like is used.
- the receptor fraction for the polypeptide of the present invention may be a natural tissue or cell receptor fraction for the polypeptide of the present invention, or a recombinant receptor fraction having an activity equivalent thereto. Is desirable.
- the equivalent activity means equivalent ligand binding activity and the like.
- a labeled polypeptide of the present invention or the like is used as the labeled ligand. For example [3 H],
- the receptor for the polypeptide of the present invention is used.
- a receptor preparation is prepared by suspending the cells containing the body or the membrane fraction of the cells in a buffer suitable for screening. Any buffer may be used as long as it does not inhibit the binding between the ligand and the receptor, such as a phosphate buffer having a pH of 4 to 10 (preferably, a pH of 6 to 8) and a buffer of tris-hydrochloride.
- a surfactant such as CHAPS, Tween-80 TM (Kao-Atlas), digitonin, or dexcholate can be added to the buffer.
- a proteinase inhibitor such as PMSF, leptin, E-64 (manufactured by Peptide Research Institute), pepstatin, etc. is added for the purpose of suppressing the degradation of the receptor and the polypeptide of the present invention by the protease. You can also.
- a certain amount 5000 c pm ⁇ 500000 c pm
- a reaction tube containing a large excess of unlabeled polypeptide of the present invention is also prepared to determine the non-specific binding amount (NSB).
- the reaction is carried out at 0 to 50 ° C, preferably at 4 to 37 ° C, for 20 minutes to 24 hours, preferably 30 minutes to 3 hours.
- the solution is filtered through a glass fiber filter paper, etc., washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter paper is measured by liquid scintillation. It is measured at the counter or at night.
- the specific binding amount (B-NSB) is calculated by subtracting the non-specific binding amount (NSB) from the count (B 0 ) when there is no antagonistic substance and the count (B, one NSB) as 100%. ) Can be selected as a candidate substance having an antagonistic ability.
- the cell stimulating activity mediated by that receptor against the polypeptides of the present invention e.g., Arakidon acid release, acetylcholine release, intracellular C a 2 + free intracellular c AMP generation, intracellular c GMP generation, wild boar phosphate production, fluctuations in cell membrane potential, phosphorylation of intracellular proteins, activation of c-fOS, decrease in pH of extracellular fluid, NO production, specific production of cells Activity that promotes or suppresses the production of a physiologically active substance, etc.
- the cell stimulating activity mediated by that receptor against the polypeptides of the present invention e.g., Arakidon acid release, acetylcholine release, intracellular C a 2 + free intracellular c AMP generation, intracellular c GMP generation, wild boar phosphate production, fluctuations in cell membrane potential, phosphorylation of intracellular proteins, activation of c-fOS, decrease in pH of extracellular fluid, NO production, specific production of cells Activity that promotes or suppresses the production
- the assay Before performing the screening, replace the cells with a fresh medium or an appropriate buffer that is not toxic to the cells, add the test compound, etc., incubate for a certain period of time, and then extract the cells or remove the supernatant. Collect and quantify the product produced according to each method. If the production of a substance that is an indicator of cell stimulating activity (for example, arachidonic acid) is difficult due to the presence of a degrading enzyme contained in cells, the assay may be performed by adding an inhibitor against the degrading enzyme. Good. In addition, activities such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production has been increased by forskolin or the like. Regarding the decrease in the pH of the extracellular fluid, the change in the acidification rate can be measured using a microphysiometer (such as Cytosensor TM ).
- a microphysiometer such as Cytosensor TM
- test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.
- the kit for screening a compound (a compound that promotes or inhibits the activity of the polypeptide of the present invention) or a salt thereof that changes the binding between the polypeptide of the present invention and the receptor for the polypeptide of the present invention includes the polypeptide of the present invention.
- a target to which the polypeptide of the present invention binds (a receptor for the polypeptide of the present invention, a cell containing the receptor for the polypeptide of the present invention, or a cell containing the receptor for the polypeptide of the present invention) Etc.).
- the compound or a salt thereof obtained by using the screening method or the screening kit of the present invention alters the binding between the polypeptide of the present invention and the receptor for the polypeptide of the present invention (inhibiting or promoting the binding).
- a compound a compound that promotes or inhibits the activity of the polypeptide of the present invention. More specifically, a compound having a cell stimulating activity via a receptor for the polypeptide of the present invention or a salt thereof (so-called Agonists of the receptor for the polypeptide of the present invention) or compounds having no stimulating activity (so-called antagonists of the receptor for the polypeptide of the present invention).
- the compound include a peptide, a protein, a non-peptidyl conjugate, a synthetic compound, and a fermentation product. The compound may be a novel compound or a known compound. Good.
- a specific method for evaluating whether the receptor is an agonist or an antagonist of the polypeptide of the present invention may be in accordance with the following (i) or (ii).
- a compound having a cell stimulating activity or a salt thereof is an agonist of a receptor for the polypeptide of the present invention, and a compound or a salt thereof having no such activity is an antagonist of the receptor for the polypeptide of the present invention.
- a cell containing a compound that activates a receptor for the polypeptide of the present invention for example, the polypeptide of the present invention or a receptor agonist for the polypeptide of the present invention
- a compound that activates the receptor for the polypeptide of the present invention and a test compound are contacted with cells containing the receptor for the polypeptide of the present invention.
- Receptor-mediated cell stimulating activity on the peptide is measured and compared.
- a compound or a salt thereof capable of decreasing the cell stimulating activity of the compound of the present invention that activates the receptor for the polypeptide of the present invention is an agonist of the receptor for the polypeptide of the present invention.
- the receptor agonist for the polypeptide of the present invention has the same activity as the biological activity of the polypeptide of the present invention for the receptor for the polypeptide of the present invention. Similarly, it is useful as a safe and low toxic drug. Conversely, the receptor agonist for the polypeptide of the present invention can suppress the physiological activity of the polypeptide of the present invention for the receptor for the polypeptide of the present invention, It is useful as a safe, low-toxicity drug that suppresses the activity when the peptide is in excess.
- Compounds or salts thereof obtained using the screening method or screening kit of the present invention include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, and animals. It is a compound selected from tissue extract, plasma and the like, and is a compound that promotes or inhibits the function of the polypeptide of the present invention.
- salt of the compound those similar to the aforementioned salts of the polypeptide of the present invention are used.
- a compound obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means.
- a compound obtained by using the screening method or the screening kit of the present invention it can be carried out according to conventional means.
- the above-mentioned drug containing the polypeptide of the present invention tablets, Capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be used.
- the preparations obtained in this way are safe and have low toxicity, for example, warm-blooded animals (eg humans, mice, rats, rabbits, sheep, pigs, pigs, horses, birds, cats, dogs) , Monkeys, etc.).
- warm-blooded animals eg humans, mice, rats, rabbits, sheep, pigs, pigs, horses, birds, cats, dogs
- Monkeys etc.
- the dose of the compound or a salt thereof varies depending on its action, target disease, administration subject, administration route, and the like.
- metabolic regulation sucgar metabolism, lipid metabolism, etc.
- abnormality eg, diabetes, obesity, etc.
- Tissue growth ⁇ proliferation 'differentiation inhibition, reproductive function decline ' connective tissue dysplasia (eg scleroderma etc.), tissue fibrosis (eg cirrhosis ⁇ pulmonary fibrosis, scleroderma, renal fiber Circulatory disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arterial stiffening, endocrine disorders, abnormal fluid balance, central illness, immune system disorders (e.g., allergic diseases, inflammation, autoimmune diseases, etc.) '
- the dose is generally administered to an adult (with a body weight of 60 kg) per day.
- the single dose of the compound may vary depending on the administration subject, the target disease, etc., for example, metabolic regulation (sugar metabolism, lipid metabolism, etc.) abnormal (eg, diabetes, obesity ), Tissue growth, proliferation, differentiation inhibition, reproductive dysfunction, connective tissue dysplasia (eg, scleroderma, etc.), tissue fibrosis.
- metabolic regulation sucrose metabolism, lipid metabolism, etc.
- abnormal eg, diabetes, obesity
- connective tissue dysplasia eg, scleroderma, etc.
- tissue fibrosis tissue fibrosis.
- Fibrosis Fibrosis, etc.
- cardiovascular disorders peripheral artery disease, myocardial infarction or insufficiency, etc.
- arterial stiffness endocrine disorders, abnormal fluid balance, central disorders, immune system disorders (eg, allergies, inflammation, autoimmune disorders, etc.)
- angiogenesis disorder or the like When a compound which promotes the function of the polypeptide of the present invention for the purpose of treatment of angiogenesis disorder or the like is usually administered to an adult (as 60 kg) in the form of an injection, the compound is added in an amount of about 0.0 per day.
- the dose can be administered in terms of 60 kg.
- a compound that inhibits the function of the polypeptide of the present invention is orally administered, generally, in an adult (with a body weight of 60 kg), the compound is used in an amount of about 0.01 to 1000 mg, preferably about 0.1 to 100 mg per day; L 000 mg, more preferably about 1.0 to 200 mg, more preferably about 1.0 to 50 mg is administered.
- the single dose of the compound varies depending on the administration subject, target disease, etc., but the compound that inhibits the function of the polypeptide of the present invention is usually administered in the form of an injection to an adult (60%).
- the compound is administered by intravenous injection at about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 1 Omg per day. It is convenient to do so.
- the dose of other animals can also be administered in terms of 60 kg.
- an antibody against the polypeptide of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) can specifically recognize the polypeptide of the present invention. It can be used for quantification of tide, especially for quantification by sandwich immunoassay.
- the antibody of the present invention is allowed to competitively react with the test solution and the labeled polypeptide of the present invention, and the ratio of the labeled polypeptide of the present invention bound to the antibody is determined.
- a method for quantifying the polypeptide of the present invention in a test solution which comprises measuring
- the present invention provides a method for quantifying the polypeptide of the present invention in a test liquid, characterized by measuring
- a monoclonal antibody against the polypeptide of the present invention (hereinafter sometimes referred to as “monoclonal antibody of the present invention”)
- detection by tissue staining or the like can be performed.
- the antibody molecule itself may be used, or F (ab ′) 2 , Fab ′, or Fab fraction of the anti-principal molecule may be used.
- the method for quantifying the polypeptide of the present invention using the antibody of the present invention is particularly limited. Instead, the amount of the antibody, antigen or antibody-antigen complex corresponding to the amount of the antigen (eg, the amount of the polypeptide of the present invention) in the test solution is detected by chemical or physical means, and the amount is detected by a known amount. Any measurement method may be used as long as it is a measurement method calculated from a standard curve prepared using a standard solution containing an antigen. For example, nephrometry, a competitive method, an immunometric method and a sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later.
- a labeling agent used in a measurement method using a labeling substance for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used.
- the radioisotope e.g., 2 5 I], [1 3 1 I], [3 H], etc. [1 4 C] used.
- the enzyme those which are stable and have a large specific activity are preferable.
- the fluorescent substance for example, fluorescamine, fluorescein isothiosinate and the like are used.
- the luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
- a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.
- the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass.
- a test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction).
- primary reaction the insolubilized monoclonal antibody of the present invention
- secondary reaction another labeled monoclonal antibody of the present invention
- the primary reaction and the secondary reaction may be performed in the reverse order, or may be performed at the same time or at different times.
- the labeling agent and the method of insolubilization can be in accordance with those described above.
- the antibody used for the solid phase antibody or the labeling antibody must be used. There is no need to use one type of antibody, and a mixture of two or more types of antibodies may be used for the purpose of improving measurement sensitivity and the like.
- the monoclonal antibody of the present invention used for the primary reaction and the secondary reaction has different sites to which the polypeptide of the present invention binds.
- Antibodies are preferably used. That is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the polypeptide of the present invention, the antibody used in the primary reaction is Preferably, an antibody that recognizes other than the C-terminal, for example, the N-terminal, is used.
- the monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry.
- the competition method after the antigen in the test solution and the labeled antigen are allowed to react competitively with the antibody, the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated. (BZF separation), the labeling amount of either B or F is measured, and the amount of antigen in the test solution is quantified.
- a soluble antibody is used as an antibody
- B / F separation is performed using polyethylene glycol
- a liquid phase method using a second antibody against the antibody and a solid phase antibody is used as the first antibody.
- a solid-phase method using a soluble first antibody and a solid-phased antibody as the second antibody is used.
- the antigen in the test solution and the immobilized antigen are subjected to a competitive reaction with a fixed amount of the labeled antibody, and then the solid phase and the liquid phase are separated. After reacting the antigen with an excess amount of the labeled antibody, and then adding the immobilized antigen and binding the unreacted labeled antibody to the solid phase, the solid phase and the liquid phase are separated. Next, the amount of label in either phase is measured to determine the amount of antigen in the test solution.
- nephrometry the amount of insoluble sediment resulting from an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.
- polypeptide measurement system of the present invention may be constructed by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews and publications.
- the polypeptide of the present invention can be quantified with high sensitivity by using the antibody of the present invention.
- an increase or decrease in the concentration of the polypeptide of the present invention is detected by quantifying the concentration of the polypeptide of the present invention using the antibody of the present invention, for example, Abnormal metabolic regulation of energy ⁇ (sugar metabolism, lipid metabolism, etc.) (e.g., diabetes mellitus, menopause etc.), tissue growth inhibition of 'proliferation' differentiation, reduced reproductive function, abnormal connective tissue formation (e.g., strong Scleroderma, etc.), tissue fibrosis (eg, floliosis, pulmonary fibrosis, scleroderma or renal fibrosis, etc.), circulatory disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteriosclerosis, It is likely to be various diseases such as endocrine disorders, abnormal fluid balance, central illness, immune system diseases (e.g., allergic diseases, inflammation, autoimmune diseases, etc.), angiogenesis disorders, etc., or is likely to be affected in the future Can be diagnosed That
- the antibody of the present invention can be used for detecting the polypeptide of the present invention present in a subject such as a body fluid or a tissue.
- preparation of an antibody column used for purifying the polypeptide of the present invention detection of the polypeptide of the present invention in each fraction at the time of purification, and analysis of the behavior of the polypeptide of the present invention in test cells. It can be used for analysis, etc.
- the DNA of the present invention can be used, for example, as a probe to produce warm-blooded animals (for example, humans, rats, mice, guinea pigs, egrets, birds, higgies, bushes, horses, horses, cats, and cats).
- warm-blooded animals for example, humans, rats, mice, guinea pigs, egrets, birds, higgies, bushes, horses, horses, cats, and cats.
- the above-described genetic diagnosis using the DNA of the present invention includes, for example, the known Northern Eighth hybridization and PCR-SSCP method (Genomics, Vol. 5, pp. 874-879 (1989); 'Ob the National A Power Demi —'Ob' Sciences' Op'Proceedings of the National Academy of Sciences of the United States of America., Vol. 86, pp. 2766-2770 (1989 )), DNA microarray (Science, Vol. 270, pp. 467-470 (1995)) and the like.
- energy source such as carbohydrate Metabolic regulation (sugar metabolism, lipid metabolism, etc.) Abnormal (eg diabetes, obesity, etc.), tissue growth, proliferation, differentiation inhibition, reproductive dysfunction, connective tissue dysplasia (eg, scleroderma, etc.), tissue (Eg, cirrhosis, pulmonary fibrosis, scleroderma or renal fibrosis), cardiovascular disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteriosclerosis, endocrine disorders, abnormal fluid balance, central Venereal disease It can be diagnosed that there is a high possibility of various diseases such as disease, immune system disease (eg, allergy, inflammation, autoimmune disease, etc.) and angiogenesis disorder.
- diseases such as disease, immune system disease (eg, allergy, inflammation, autoimmune disease, etc.) and angiogenesis disorder.
- An antisense DNA that can complementarily bind to the DNA of the present invention and suppress the expression of the DNA can suppress the g of the polypeptide of the present invention or the DNA of the present invention in vivo.
- it can be used as an agent for treating or preventing a disease caused by excessive expression of the polypeptide of the present invention.
- the above-mentioned antisense DNA can be used as the above-mentioned therapeutic / prophylactic agent in the same manner as the above-mentioned therapeutic / prophylactic agent for various diseases containing the DNA of the present invention.
- the antisense DNA may be administered alone or after insertion into a suitable vector such as a retrovirus vector, adenovirus vector, adenovirus associa tion, or a virus vector vector, and then administered in a conventional manner.
- a suitable vector such as a retrovirus vector, adenovirus vector, adenovirus associa tion, or a virus vector vector
- the antisense DNA can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, and can be administered by a gene gun or a catheter such as a hydrogel catheter. Alternatively, they can be administered as an aerosol into the trachea as an inhalant.
- the dosage of the antisense DNA varies depending on the target disease, the administration subject, the administration route, and the like.
- the antisense DNA of the present invention is locally administered intratracheally as an inhalant, it is generally used in adults. (Body weight 6 O kg), the antisense DNA is administered from about 0.1 to: LOO mg per day.
- the antisense DNA can also be used as a diagnostic oligonucleotide probe for examining the presence or expression of the DNA of the present invention in tissues or cells. .
- the antibody of the present invention having an activity of neutralizing the activity of the polypeptide of the present invention can be used as a medicament such as an agent for treating or preventing a disease caused by overexpression of the polypeptide of the present invention. .
- the therapeutic or prophylactic agent for the above-mentioned diseases containing the antibody of the present invention can be used as it is as a liquid preparation, or Oral or parenteral administration to mammals (eg, humans, rats, rabbits, sheep, sheep, dogs, cats, cats, dogs, monkeys, etc.) as appropriate pharmaceutical compositions I can do it.
- mammals eg, humans, rats, rabbits, sheep, sheep, dogs, cats, cats, dogs, monkeys, etc.
- the dosage varies depending on the administration subject, target disease, symptoms, administration route, and the like.
- a single dose of the antibody of the present invention is usually about 0.01 to 2 OmgZ kg body weight.
- LO mg / .kg body weight more preferably 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably about 1 to 3 times a day, intravenous injection It is convenient to administer by the following. In the case of other parenteral administration and oral administration, an equivalent dose can be administered. If the symptoms are particularly severe, the dose may be increased accordingly.
- the antibodies of the present invention can be administered by themselves or as a suitable pharmaceutical composition.
- the pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient.
- Such compositions are provided in dosage forms suitable for oral or parenteral administration.
- compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft Gabcell preparations), syrups, emulsions, suspensions and the like.
- Such a composition is produced by a method known per se and contains a carrier, diluent or excipient commonly used in the pharmaceutical field.
- a carrier for example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.
- compositions for parenteral administration for example, injections, suppositories, etc. are used. Is included.
- injections are prepared according to a method known per se, for example, by dissolving, suspending, or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid used for usual injections.
- aqueous liquid for injection for example, physiological saline, isotonic solution containing glucose and other auxiliary agents and the like are used, and a suitable solubilizing agent, for example, alcohol (eg, ethanol), polyalcohol ( E.g., propylene glycol, polyethylene glycol), nonionic surfactants (e.g., polysorbate 80, HC-50 (polyoxyethylene (5 O mol) adduct of hydrogenated castor oil)), etc. Is also good.
- benzyl benzoate, benzyl alcohol and the like may be used in combination.
- the prepared injection solution is usually filled in a suitable ampoule.
- a suppository for rectal administration is prepared by mixing the above antibody or a salt thereof with a usual suppository base.
- the above-mentioned oral or parenteral pharmaceutical composition is conveniently prepared in a unit dosage form suitable for the dose of the active ingredient.
- dosage unit forms include tablets, pills, capsules, injections (ampoules), suppositories and the like.
- each dosage unit form is about 5 to 500 mg, especially injection.
- the above-mentioned antibody is contained in the form of 5 to about 100 mg of the above-mentioned antibody, and about 10 to 25 mg of the above-mentioned antibody in other dosage forms.
- Each of the above-mentioned compositions may contain another active ingredient as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.
- the present invention relates to a DNA encoding an exogenous polypeptide of the present invention (hereinafter abbreviated as the exogenous DNA of the present invention) or a mutant DNA thereof (hereinafter sometimes abbreviated as the exogenous mutant DNA of the present invention).
- exogenous DNA of the present invention an exogenous polypeptide of the present invention
- mutant DNA thereof hereinafter sometimes abbreviated as the exogenous mutant DNA of the present invention.
- the present invention provides (1) a non-human mammal having the exogenous DNA of the present invention or a mutant DNA thereof, (2) the animal according to (1), wherein the non-human mammal is a rodent, 3) The animal according to (2), wherein the rodent is a mouse or a rat, and (4) a recombinant vector containing the exogenous DNA of the present invention or a mutant DNA thereof and capable of being expressed in a mammal. Is what you do.
- the non-human mammal having the exogenous DNA of the present invention or its mutant DNA is a germ cell containing an unfertilized egg, a fertilized egg, a sperm, and a progenitor cell thereof.
- the calcium phosphate method, the electric pulse method, the lipofection method, Coagulation method, Micro Inge It can be produced by transferring the desired DNA by the extrusion method, the particle gun method, the DEAE-Destran method, or the like.
- the exogenous DNA of the present invention can be transferred to somatic cells, organs of living organisms, tissue cells, and the like, and used for cell culture, tissue culture, and the like. These cells can be fused with the above-mentioned germinal cells by a cell fusion method known per se to produce the DNA transgenic animal of the present invention.
- non-human mammal for example, monkeys, pigs, pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice, rats, and the like are used.
- a cross line a B6C3F line, a BDFi line, a BGDSFi line, a BALB / c line, an ICR line, etc.
- a rat for example, Wistar, SD etc.
- Examples of the “mammal” in a recombinant vector that can be expressed in mammals include humans and the like in addition to the above-mentioned non-human mammals.
- the exogenous DNA of the present invention refers not to the DNA of the present invention originally possessed by a non-human mammal, but to the DNA of the present invention once isolated and extracted from the mammal.
- mutant DNA of the present invention examples include those in which the base sequence of the original DNA of the present invention has a mutation (for example, mutation), specifically, addition of a base, deletion of a base, or deletion of another base. DNA or the like in which the substitution of DNA has occurred is used, and abnormal DNA is also included.
- the abnormal DNA means a DNA capable of expressing an abnormal polypeptide of the present invention, such as, for example, a DNA expressing a polypeptide that suppresses the function of the normal polypeptide of the present invention. .
- the exogenous DNA of the present invention may be derived from a mammal that is the same or different from the animal of interest.
- the DNA of the present invention In transferring the DNA of the present invention to a target animal, it is generally advantageous to use the DNA as a DNA construct linked downstream of a promoter capable of being expressed in animal cells.
- various mammals eg, egrets, DNA constructs (eg, vectors, etc.) in which the human DNA of the present invention is bound downstream of various promoters capable of expressing DNA from dogs, cats, guinea pigs, hamsters, rats, mice, etc.
- a fertilized egg of a mammal for example, a mouse fertilized egg
- a DNA-transferred mammal that highly expresses the DNA of the present invention can be produced.
- Examples of the expression vector of the polypeptide of the present invention include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacterium such as ⁇ phage, a retrovirus such as Moroni leukemia virus, and a vaccinia. Viruses or animal viruses such as baculovirus are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used.
- Examples of the promoter that regulates DNA expression include: (1) a DN.A promoter derived from a virus (eg, simian virus, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus, poliovirus, etc.); , 2 Promoters derived from various mammals (human, egret, dog, cat, guinea pig, hamster, rat, mouse, etc.), for example, albumin, insulin II, ⁇ robrakin II, eras ose, erythropoietin, endothelin, muscle Creatine kinase, glial fibrillary acid protein, dalyuthione S_transferase, platelet-derived growth factor] 3, keratin Kl, K10 and K14, collagen type I and type II, cyclic AMP-dependent protein kinase ] 3 I subunit, dystrophin, tartar Resistant alkaline phosphatase, atrial natriure
- the above vector preferably has a sequence that terminates the transcription of the messenger RNA of interest in a DNA-transferred mammal (generally referred to as an evening promoter).
- the sequence of each animal-derived DNA can be used, and preferably, SV40 terminator of Simian virus or the like is used.
- the splicing signal of each DNA, the enhancer region, a part of the intron of eukaryotic DNA, etc. are translated 5 'upstream of one promoter region and the promoter region to further express the target foreign DNA'. Linkage between regions or three downstreams of the translation region is also possible depending on the purpose.
- the translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional DNA engineering technique in which the translation region is ligated downstream of the above-mentioned promoter and, if desired, upstream of the transcription termination site.
- Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal.
- the presence of the exogenous DNA of the present invention in the germ cells of the animal produced after the transfer of the DNA indicates that all the progeny of the animal produced have the exogenous DNA of the present invention in all of the germ cells and somatic cells. Means to do so.
- the progeny of this type of animal that has inherited the exogenous DNA of the present invention has the exogenous DNA of the present invention in all of its germinal and somatic cells.
- the non-human mammal to which the exogenous normal DNA of the present invention has been transferred is confirmed to stably maintain the exogenous DNA by mating, and should be subcultured in a normal breeding environment as the DNA-bearing animal. Can be done.
- Transfer of the exogenous DNA of the present invention at the fertilized egg cell stage is ensured to be present in excess in all germ cells and somatic cells of the target mammal.
- Excessive presence of the exogenous DNA of the present invention in the germinal cells of the animal after transfer of DNA indicates that the offspring of the animal produced It means that all of the germinal cells and somatic cells have an excessive amount of the exogenous DNA of the present invention.
- the offspring of such animals that have inherited the exogenous DNA of the present invention have an excess of the exogenous DNA of the present invention in all of their germ cells and somatic cells.
- the non-human mammal having the normal DNA of the present invention in which the normal DNA of the present invention is highly expressed, promotes the function of the endogenous normal DNA, and finally the function of the polypeptide of the present invention. It can develop hypertension and can be used as a model animal for the disease. For example, using the normal DNA-transferred animal of the present invention to elucidate the pathological mechanism of the hyperactivity of the polypeptide of the present invention and the disease associated with the polypeptide of the present invention, and the method of treating these diseases. It is possible to conduct a study.
- the mammal to which the exogenous normal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention, it can be used as a therapeutic agent for a disease associated with the polypeptide of the present invention. It can also be used for screening tests. ,
- the non-human mammal having the exogenous abnormal DNA of the present invention can be subcultured in a normal breeding environment as an animal having the DNA after confirming that the exogenous DNA is stably maintained by mating.
- the desired exogenous DNA can be incorporated into the above-mentioned plasmid and used as a substance.
- a DNA construct with the promoter can be prepared by ordinary DNA engineering techniques. The transfer of the abnormal DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal.
- the presence of the abnormal DNA of the present invention in the germinal cells of the produced animal after DNA transfer means that all the offspring of the produced animal have the abnormal DA of the present invention in all of the germinal and somatic cells.
- the progeny of such animals that have inherited the exogenous DNA of the present invention have the abnormal DNA of the present invention in all of their germinal and somatic cells.
- a homozygous animal having the introduced DNA on both homologous chromosomes is obtained, and by breeding the male and female animals, it is possible to breed so that all offspring have the DNA. Monkey
- the non-human mammal having the abnormal DNA of the present invention expresses the abnormal DNA of the present invention at a high level, and finally inhibits the function of the endogenous normal DNA to thereby inhibit the polypeptide of the present invention. It may become functionally inactive refractory, and can be used as a model animal for the disease. For example, it is possible to elucidate the pathological mechanism of the functionally inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease using the abnormally DNA-transferred animal of the present invention. .
- the abnormal DNA highly expressing animal of the present invention can be used to inhibit the function of a normal polypeptide by the abnormal polypeptide of the present invention in the function-inactive refractory disease of the polypeptide of the present invention ( dominant negative action).
- the mammal to which the foreign abnormal DNA of the present invention has been transferred has an increased symptom of the released polypeptide of the present invention. It can also be used for therapeutic drug screening tests. .
- DNA-transferred animals of the present invention include, for example, 1 use as a cell source for tissue culture,
- polypeptide of the present invention by directly analyzing DNA or RNA in the tissue of the DNA-transferred animal of the present invention or by analyzing the polypeptide tissue expressed by the DNA Or analysis of its relationship to activating polypeptides,
- the DNA-transferred animal of the present invention it is possible to examine clinical symptoms of a disease associated with the polypeptide of the present invention, including a functionally inactive refractory disease of the polypeptide of the present invention, and the like. More detailed in each organ of the disease model related to the polypeptide of the present invention Pathological findings can be obtained, and this can contribute to the development of new treatment methods, and the research and treatment of secondary diseases caused by the disease.
- each organ is taken out from the DNA-transferred animal of the present invention, cut into small pieces, and then the released DNA-transferred cells are obtained, cultivated, or systematized with the cultured cells using a polypeptide (protein) degrading enzyme such as trypsin. It is possible. Furthermore, it is possible to examine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or its signal transduction mechanism, and its abnormalities. It is an effective research material for elucidating peptides and their effects.
- a polypeptide (protein) degrading enzyme such as trypsin.
- the above-described test was conducted to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including a functionally inactive refractory disease of the polypeptide of the present invention. It is possible to provide an effective and rapid screening method for the therapeutic agent for the disease by using the method and the quantification method. Further, using the DNA transgenic animal of the present invention or the exogenous DNA expression vector of the present invention, it is possible to study and develop a method for treating a DNA associated with the polypeptide of the present invention.
- the present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated, and a non-human mammal deficient in expression of the DNA of the present invention.
- the DNA is inactivated by introducing a reporter gene (eg, an i3-galactosidase gene derived from Escherichia coli);
- a reporter gene eg, an i3-galactosidase gene derived from Escherichia coli
- the non-human mammal according to (6) which can be expressed under the control of a promoter
- a compound or a salt thereof that promotes or inhibits the promoter activity of the DNA of the present invention which comprises administering a test compound to the animal according to (7) and detecting the expression of a repo all-in-one gene.
- the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated is an ability to artificially mutate the DNA of the present invention possessed by the non-human mammal to suppress the expression ability of the DNA, Alternatively, by substantially eliminating the activity of the polypeptide of the present invention encoded by the DNA, the DNA does not substantially have the ability to express the polypeptide of the present invention (hereinafter, referred to as the following).
- Non-human mammal embryonic stem cells hereinafter abbreviated as ES cells).
- non-human mammal the same one as described above is used.
- the method of artificially mutating the DNA of the present invention can be performed, for example, by deleting a part or all of the DNA sequence by a genetic engineering technique, and inserting or substituting another DNA.
- the knockout DNA of the present invention may be prepared by, for example, shifting the codon reading frame or disrupting the function of the promoter or exon by these mutations.
- non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated include, for example, The DNA of the present invention possessed by a non-human mammal is isolated, and its exon portion has a neomycin resistance gene, a drug resistance gene typified by a hygromycin resistance gene, or lac Z ( ⁇ -galactosidase gene), cat ( A DNA sequence that disrupts exon function by inserting a reporter gene or the like represented by the chloram phenicol acetyltransferase gene or terminates transcription of the gene in the intron region between exons (eg, insertion of a polyA addition signal, etc., and the inability to synthesize complete messenger RNA
- a DNA strand having a DNA sequence constructed so as to disrupt the gene hereinafter abbreviated as “Yuichi G
- Southern hybridization analysis using a DNA sequence on or near the DNA of the present invention as a probe or a DNA sequence on the evening getter vector and a DNA sequence other than the DNA of the present invention used for the production of the evening getter vector It can be obtained by analyzing by a PCR method using the DNA sequence of the neighboring region as a primer and selecting the knockout ES cells of the present invention.
- ES cells from which the DNA of the present invention is inactivated by the homologous recombination method or the like for example, those already established as described above may be used, or according to the known Evans and Kaufma method. It may be a newly established one.
- ES cells For example, in the case of mouse ES cells, currently, 129 ES cells are generally used, but since the immunological background is not clear, an alternative pure immunogenic genetically
- BDFi mice C57BL / 6 and DBAZ2 FBD
- C57BLZ6 mice and C57BLZ6 have a reduced number of eggs collected by crossing with DBAZ2 BDF mice
- the ES cells obtained by using the C57BLZ6 mouse can be used to replace the genetic background of the C57BLZ6 mouse by backcrossing with the C57BLZ6 mouse when the disease model mouse is created. Can be used advantageously.
- blastocysts 3.5 days after fertilization are generally used, but in addition to this, a large number of initial cells can be efficiently obtained by collecting embryos at the 8-cell stage and culturing them up to blastocysts. Embryos can be obtained.
- male ES cells are generally more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor.
- a method for determining the sex of ES cells for example, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by PCR can be mentioned.
- This one The conventional method requires about 10 6 cells for karyotype analysis, but only about 1 colony of ES cells (about 50 cells).
- the primary selection of ES cells in the early stage can be performed by gender discrimination, and the early selection of male cells can greatly reduce the labor required in the initial stage of culture.
- Embryonic stem cell lines obtained in this way usually have very good proliferative properties, but must be carefully subcultured because they tend to lose their ontogenetic potential.
- a suitable feeder cell such as ST ST fibroblast, in the presence of LIF (1-1000 OU / ml) in a carbon dioxide incubator (preferably, about 5% carbon dioxide, about 95% air or about Culture at about 37 ° C in 5% oxygen, about 5% carbon dioxide, about 90% air).
- trypsin-ZEDTA solution (usually about 0.001-0.5% trypsin-Z)
- Single cell culture is performed by treatment with about 0.1-5 mM EDTA, preferably about 0.1% trypsin / about 1 mM EDTA, and the cells are seeded on freshly prepared feeder cells.
- Such subculture is usually performed every 13 days. At this time, it is desirable to observe the cells, and if morphologically abnormal cells are found, discard the cultured cells.
- ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, under appropriate conditions by monolayer culture up to high density or by suspension culture until cell clumps are formed.
- the DNA-deficient cells of the present invention obtained by separating the ES cells of the present invention are: It is useful in vitro in cell biological studies of the polypeptides of the invention.
- the non-human mammal deficient in DNA expression of the present invention can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level. is there.
- non-human mammal the same one as described above is used.
- the non-human mammal deficient in expression of the DNA of the present invention may be prepared, for example, by introducing the above-prepared targeting vector into mouse embryonic stem cells or mouse egg cells, and introducing the targeting vector into the DNA of the present invention.
- the DNA of the present invention can be knocked out by causing homologous recombination of the inactivated DNA sequence to replace the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by homologous recombination. .
- a cell in which the DNA of the present invention has been knocked out is a DNA sequence on a Southern hybridization analysis or evening getting vector using the DNA sequence on or near the DNA of the present invention as a probe, and a targeting vector. It can be determined by analysis by a PCR method using, as a primer, the DNA sequence of a neighboring region other than the DNA of the present invention derived from the mouse used in the above.
- a cell line in which the DNA of the present invention has been inactivated is cloned by genetic homologous recombination, and the cells are cultured at an appropriate time, for example, at the 8-cell stage.
- the chimeric embryo is injected into a non-human mammal embryo or blastocyst, and the resulting chimeric embryo is transplanted into the uterus of the pseudo-pregnant non-human mammal.
- the produced animal is a chimeric animal comprising both a normal cell having the DNA locus of the present invention and an artificially mutated cell having the DNA locus of the present invention.
- all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual.
- the individual thus obtained is usually an individual having a heterozygous expression of the polypeptide of the present invention, which is crossed with an individual having a heterozygous expression of the polypeptide of the present invention.
- Polypeptide E An individual with insufficient expression can be obtained.
- a transgenic non-human mammal having a getter vector introduced into a chromosome can be obtained by injecting a DNA solution into the nucleus of an egg by a microinjection method. Compared to these transgenic non-human mammals, they can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination of the gene.
- the germline can be obtained and maintained according to a standard method. That is, by crossing male and female animals having the inactivated DNA, a homozygote animal having the inactivated DNA in both homologous chromosomes can be obtained.
- the obtained homozygous animal can be efficiently obtained by rearing the mother animal in such a manner that one normal individual and a plurality of homozygous animals are obtained.
- homozygous and heterozygous animals having the inactivated DNA are bred and passaged.
- the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing the non-human mammal deficient in expression of the DNA of the present invention.
- the non-human mammal deficient in expression of the DNA of the present invention lacks various biological activities that can be induced by the polypeptide of the present invention
- the non-human mammal may inactivate the biological activity of the polypeptide of the present invention. It is useful for investigating the causes of these diseases and examining treatment methods.
- the non-human mammal deficient in expression of the DNA of the present invention may have abnormalities (eg, metabolic regulation of energy sources such as carbohydrates, metabolism of lipids, lipid metabolism, etc.) due to DNA deficiency or damage of the present invention (eg, diabetes, obesity) Etc.), tissue growth, proliferation, differentiation inhibition, decline in reproductive function, Abnormal formation of synthetic tissue (eg, scleroderma), tissue fibrosis (eg, cirrhosis' pulmonary fibrosis, scleroderma or renal fibrosis), cardiovascular disorders (peripheral artery disease, myocardial infarction or heart failure) Screening for compounds that have therapeutic and / or prophylactic effects on atherosclerosis, endocrine disorders, abnormal fluid balance, central illness, immune system disorders (eg, allergies, inflammation, autoimmune disorders, etc.), and 'angiogenic disorders, etc.' Can be used.
- abnormalities eg, metabolic regulation of energy sources such as carbohydrates, metabolism of lipids, lipid metabolism,
- the present invention provides a method for administering a test compound to a non-human mammal deficient in DNA expression of the present invention, and observing and measuring a change in the animal.
- a method for screening a compound or a salt thereof having a therapeutic / preventive effect on diseases caused by the above To provide a method for screening a compound or a salt thereof having a therapeutic / preventive effect on diseases caused by the above.
- Examples of the non-human mammal deficient in DNA expression of the present invention used in the screening method include the same as described above.
- Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic conjugates, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma, and the like. It may be a compound or a known compound.
- a non-human mammal deficient in DNA expression of the present invention is treated with a test compound and compared with an untreated control animal, and changes in the organs, tissues, disease symptoms, etc. of the animal are used as indices.
- the test compound can be tested for its therapeutic and prophylactic effects.
- test compound for example, oral administration, intravenous injection and the like are used, and the method can be appropriately selected according to the symptoms of the test animal, properties of the test compound, and the like.
- the dose of the test compound can be appropriately selected depending on the administration method, the properties of the test compound, and the like.
- a non-human mammal deficient in expressing DNA of the present invention is subjected to glucose tolerance treatment, and a test compound is administered before or after glucose tolerance treatment. After administration, the blood glucose level and body weight change of the animal are measured over time.
- the compound obtained by using the screening method of the present invention is a compound selected from the test compounds described above, and is caused by deficiency or damage of the polypeptide of the present invention.
- Diseases eg metabolic regulation of energy sources such as carbohydrates (sugar metabolism, lipid metabolism, etc.)
- Abnormalities eg, diabetes, obesity, etc.
- tissue growth 'proliferation' differentiation eg, impaired reproductive function, formation of connective tissue Abnormalities (eg, scleroderma), tissue fibrosis (eg, cirrhosis; 'pulmonary fibrosis, -scleroderma or renal fibrosis, etc.)
- circulatory disorders peripheral artery disease, myocardial infarction or heart failure, etc.
- It has therapeutic and preventive effects against arteriosclerosis, endocrine disorders, abnormal fluid balance, central illness, immune system disorders (eg, allergies, inflammation, autoimmune disorders, etc.), angiogenesis disorders, etc. It can be used as a safe and
- the compound obtained by the screening method may form a salt.
- the salt of the compound include physiologically acceptable acids (eg, inorganic acids, organic acids) and bases (eg, alkali metals). Are used, and physiologically acceptable acid addition salts are particularly preferred.
- Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, 'sulfuric acid), or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) , Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid).
- inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, 'sulfuric acid
- organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid
- a drug containing the compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned drug containing the polypeptide of the present invention.
- the preparations obtained in this way are safe and have low toxicity, and are therefore useful, for example, in mammals (eg, humans, rats, mice, guinea pigs, egrets, sheep, higgies, bushus, horses, cats, cats, animals). And monkeys).
- mammals eg, humans, rats, mice, guinea pigs, egrets, sheep, higgies, bushus, horses, cats, cats, animals). And monkeys).
- the dose of the compound or its salt may vary depending on the target disease, the subject of administration, the route of administration, and the like.
- abnormalities in metabolic regulation sugar metabolism, lipid metabolism, etc.
- Tissue growth 'proliferation' inhibition of differentiation impaired reproductive function
- abnormal connective tissue formation eg scleroderma
- tissue fibrosis eg cirrhosis' pulmonary fibrosis, scleroderma or Is renal fibrosis, etc.
- cardiovascular disorders peripheral artery disease, myocardial infarction or heart failure, etc.
- arteriosclerosis endocrine disorders
- fluid balance imbalance central illness
- immune system disorders eg, allergies,
- angiogenesis disorder, etc. generally, in an adult (assuming a body weight of 60 kg), the compound is administered in an amount of about 0.01 to 0.1 kg / day.
- the single dose of the compound varies depending on the administration target, target disease, etc., for example, metabolic regulation (sugar metabolism, lipid metabolism, etc.) abnormal (eg, diabetes, obesity, etc.) ), Tissue growth ⁇ proliferation 'differentiation inhibition, reproductive dysfunction, connective tissue dysplasia (such as scleroderma), tissue fibrosis (eg, cirrhosis' pulmonary fibrosis, scleroderma or renal fibrosis) ), Cardiovascular disorders (peripheral artery disease, myocardial infarction or heart failure, etc.), arteriosclerosis, endocrine disorders, abnormal fluid balance, central illness, immune system diseases (eg, allergies, inflammation, autoimmune diseases, etc.), When the compound is usually administered to an adult (as 60 kg) in the form of an injection for the treatment of an angio
- the present invention relates to a method for administering a test compound to a non-human mammal deficient in expression of a DNA of the present invention, and detecting the expression of a reporter gene, wherein the activity of a promoter for the DNA of the present invention is enhanced or
- the present invention provides a method of screening for a compound or a salt thereof that inhibits.
- the non-human mammal deficient in expression of the DNA of the present invention may be the non-human mammal deficient in expression of the DNA of the present invention in which the DNA of the present invention is inactive by introducing a reporter gene.
- a gene which can be expressed under the control of a promoter for the DNAfc of the present invention is used.
- test compound examples include the same compounds as described above.
- reporter gene the same ones as described above are used, and 3) -galactosidase gene (1acZ), soluble alkaline phosphatase gene, luciferase gene and the like are preferable.
- the reporter gene is under the control of a promoter for the DNA of the present invention, so that the reporter gene is The activity of the promoter can be detected by tracing the expression of a substance that inhibits the expression of, for example, an i3-galactosidase derived from Escherichia coli which partially encodes the DNA region encoding the polypeptide of the present invention.
- an i3-galactosidase derived from Escherichia coli which partially encodes the DNA region encoding the polypeptide of the present invention.
- 3-galactosidase is originally expressed (instead of the polypeptide of the present invention) in the tissue where the polypeptide of the present invention is expressed.
- 5-Bromo 4-1-3-Indolyl 3-D-Galactopyranoside X-gal
- the expression state of the polypeptide of the present invention in an animal body can be observed.
- the polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with daltaraldehyde or the like, and phosphate buffered physiology is obtained.
- phosphate buffered physiology is obtained.
- tissue samples are washed with l mM ED TAZPBS solution.
- the 3-galactosidase reaction can be stopped, and the coloration can be observed.
- MRNA encoding 1acZ may be detected.
- the compound or a salt thereof obtained by the above-mentioned screening method is a compound selected from the above-mentioned test compounds, and is a compound that promotes or inhibits the promoter activity of the DNA of the present invention.
- the compound obtained by the screening method may form a salt.
- the salt of the compound include salts with physiologically acceptable acids (eg, inorganic acids) and bases (eg, organic acids). Are used, and physiologically acceptable acid addition salts are particularly preferable.
- Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, 'sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, 'Salts with succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) are used.
- inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, 'sulfuric acid
- organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid
- the compound of the present invention or a salt thereof which promotes promoter activity on DNA is described in the present invention. It can promote the expression of light polypeptides and promote the function of the polypeptides.
- tissue growth 'proliferation' inhibition of differentiation eg., impaired reproductive function, connective tissue dysplasia (eg, scleroderma), tissue fibrosis (eg, ⁇ cirrhosis, lung fibrosis) Disorders, scleroderma or renal fibrosis, etc., cardiovascular disorders (peripheral artery disease, myocardial infarction or cardiac failure, etc.), arteriosclerosis, endocrine disorders, fluid balance imbalance, central disorders, immune system disorders (eg, allergies) , Inflammation, autoimmune disease, etc.), and useful as various safe and low toxic therapeutic / prophylactic agents for various diseases such as angiogenesis disorders.
- connective tissue dysplasia eg, scleroderma
- tissue fibrosis eg, ⁇ cirrhosis, lung fibrosis
- cardiovascular disorders perpheral artery disease, myocardial infarction or cardiac failure, etc.
- arteriosclerosis endocrine disorders
- fluid balance imbalance
- a medicament containing a compound or a salt thereof obtained by the screening method can be produced in the same manner as the above-mentioned medicament containing the polypeptide of the present invention or a salt thereof.
- the preparations obtained in this way are safe and have low toxicity, and are therefore useful, for example, in mammals (eg, humans, rats, mice, guinea pigs, egrets, sheep, higgies, bushus, horses, cats, cats, animals). Nu, monkey, etc.).
- mammals eg, humans, rats, mice, guinea pigs, egrets, sheep, higgies, bushus, horses, cats, cats, animals). Nu, monkey, etc.).
- the dose of the compound or a salt thereof varies depending on the target disease, the administration subject, the administration route, and the like.
- metabolic regulation sucgar metabolism, lipid metabolism, etc.
- tissue growth 'Proliferation' differentiation inhibition eg., reproductive function decline, connective tissue dysplasia (eg ⁇ ⁇ 3 scleroderma, etc.), tissue fibrosis (eg, cirrhosis ⁇ pulmonary fibrosis, scleroderma or renal fibrosis) '
- Cardiovascular disorders peripheral artery disease, myocardial infarction or heart failure, etc.
- arteriosclerosis endocrine disorders
- abnormal fluid balance eg allergies, inflammation, autoimmune disorders, etc.
- angiogenesis disorders When orally administering a compound of the present invention which promotes one activity of the promoter for DNA for the purpose of treatment or the like, generally, in an adult (assuming a body weight of 60 kg), the compound is used
- a single dose of the compound should be administered to the subject, Depends on the target disease, etc., for example, abnormalities in metabolic regulation (sugar metabolism, lipid metabolism, etc.) (eg, diabetes, obesity, etc.), inhibition of tissue growth, proliferation, differentiation, impaired reproductive function, Dysplasia (such as scleroderma), tissue fibrosis (such as cirrhosis' pulmonary fibrosis, scleroderma or renal fibrosis), circulatory disorders (such as peripheral artery disease, myocardial infarction or heart failure), arteries Promotes promoter activity on the DNA of the present invention for the purpose of mitigating sclerosis, endocrine disorders, abnormal fluid balance, central illness, immune system diseases (eg, allergy, inflammation, autoimmune diseases, etc.), angiogenesis disorders, etc.
- metabolic regulation eg., diabetes, obesity, etc.
- Dysplasia such as scleroderma
- tissue fibrosis such as cirrhosis' pulmonary fibrosis
- the compound When the compound is usually administered to an adult (60 kg) in the form of an injection, the compound is administered in an amount of about 0.01 to 3 Omg per day, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 2 Omg. 0.1-: About L Omg It is conveniently administered by intravenous injection. For other animals, the dose can be administered in terms of 60 kg.
- a compound of the present invention that inhibits promoter activity against DNA is orally administered, generally, in an adult (assuming a body weight of 6 Okg), the compound is preferably used in an amount of about 0.1 to 100 Omg per day, preferably about 0.1 to 100 Omg. Is administered at about 1.0 to 200 mg, more preferably about 1.0 to 5 Omg.
- the single dose of the compound varies depending on the subject to be administered, the target disease, etc., but the compound that inhibits promoter overnight activity against DNA of the present invention is usually in the form of an injection.
- the compound should be about 0.01 to 30 mg, preferably about 0.1 to? Conveniently, about Omg, more preferably about 0.1 to 1 Omg, is administered by intravenous injection. In the case of other animals, the dose can be administered in terms of 6 Okg.
- bases, amino acids, and the like are indicated by abbreviations based on the abbreviations of IUPA. C-I UB Commission on Biochemical Nomenclature or conventional abbreviations in the relevant field. When amino acids may have optical isomers, L-form shall be indicated unless otherwise specified.
- DNA Deoxylipo nucleic acid
- RNA Messenger liponucleic acid dATP Deoxyadenosine triphosphate dTTP Deoxythymidine diphosphate dGTP Deoxyguanosine triphosphate dCTP Deoxycytidine triphosphate ATP Adenosine triphosphate
- H is or H histidine
- HONB trihydroxy-5-norbornene-2,3-dicarboxyimide.
- Example 1 shows the nucleotide sequence of a primer used in Example 1.
- FIG. 1 shows the amino acid sequence of a novel protein precursor (human type) of the present invention.
- FIG. 1 shows the nucleotide sequence of a cDNA fragment encoding the novel protein precursor (human type) of the present invention found in Examples 1 and 2.
- FIG. 6 shows the nucleotide sequence of a primer used in Example 4.
- Example 3 shows the nucleotide sequence of a primer used in Example 2.
- Example 3 shows the nucleotide sequence of a primer used in Example 2.
- [SEQ ID NO: 11] 3 shows the nucleotide sequence of a primer used in Example 2.
- Example 3 shows the nucleotide sequence of an open reading frame (ORF) in the cDNA fragment encoding the novel protein precursor (human type) of the present invention obtained in Example 3.
- Example 3 shows the nucleotide sequence of a primer used in Example 3.
- Example 3 shows the nucleotide sequence of a primer used in Example 3.
- FIG. 1 shows the amino acid sequence of a novel protein precursor (rat type) of the present invention.
- FIG. 1 shows the amino acid sequence of a novel protein precursor (mouse type) of the present invention.
- SEQ ID NO: 24 This shows the base sequence of DNA encoding the amino acid sequence represented by SEQ ID NO: 23.
- 1 shows the nucleotide sequence of DNA encoding the amino acid sequence of A chain (mouse type).
- 1 shows the nucleotide sequence of DNA encoding the amino acid sequence of B chain (mouse type).
- FIG 13 shows the nucleotide sequence of primer R1 used in Example 5 described later.
- FIG 13 shows the nucleotide sequence of primer R8 used in Example 5 described later.
- FIG. 14 shows the nucleotide sequence of primer UP used in Examples 6 and 7 described below.
- Example 7 shows the nucleotide sequence of DNA containing rat ORF obtained in Example 6 described later.
- Example 7 shows the nucleotide sequence of DNA containing mouse ORF obtained in Example 7 described later.
- FIG. 9 shows the nucleotide sequence of the first exon region in the DNA encoding the rat precursor, which was revealed in Example 5 described later.
- FIG. 9 shows the nucleotide sequence of the second exon region of the DNA encoding the mouse precursor, which was revealed in Example 5 described later.
- FIG. 1 shows the amino acid sequence of a novel protein precursor (Busun type) of the present invention.
- 1 shows the amino acid sequence of A chain (porcine type).
- FIG. 1 shows the amino acid sequence of a novel protein precursor (rat variant) of the present invention.
- Example 13 shows the nucleotide sequence of the antisense strand primer exlRl used in Example 8 described later.
- Example 7 shows the nucleotide sequence of DNA encoding from the N-terminus to the B-chain peptide via the signal peptide from the N-terminus of the protein precursor obtained in Example 8 described later.
- Example 13 shows the nucleotide sequence of a PCR product obtained in Example 8 described later.
- FIG. 13 shows the nucleotide sequence of oligo DNA (PORexlFl) used in Example 8 described later.
- FIG 13 shows the nucleotide sequence of Oligo DNA (P0RexlF2) used in Example 8 described later.
- FIG. 9 shows the nucleotide sequence of the first exon region in the DNA encoding the bush type precursor revealed in Example 8 described later.
- FIG. 9 shows the nucleotide sequence of the second exon region of the DNA encoding the bush-type precursor revealed in Example 8 described later.
- FIG. 9 shows the nucleotide sequence of DNA containing an open reading frame (ORF) encoding a rat precursor variant identified in Example 9 described later.
- Fig. 9 shows the nucleotide sequence of DNA encoding a part of the rat precursor variant identified in Example 9 described later.
- Example 19 shows the nucleotide sequence of a sense strand primer used in Example 19 described later.
- Example 19 shows the base sequence of the antisense strand primer used in Example 19 described later.
- Example 19 shows the base sequence of a sense strand primer used in Example 19 described later.
- Example 19 shows the base sequence of the antisense strand primer used in Example 19 described later.
- Example 19 shows the amino acid sequence of the fusion protein obtained in Example 19 described later.
- Example 23 shows the base sequence of an antisense strand primer used in Example 23 described later.
- Example 23 shows the nucleotide sequence of a sense strand primer used in Example 23 described later.
- Example 15 shows the base sequence of the antisense strand primer used in Example 23 described later.
- 15 shows the nucleotide sequence of the oligo DNA portion of the TaqMan probe used in Example 23 described later.
- Example 23 shows the base sequence of a sense strand primer used in Example 23 described later.
- Example 23 shows the base sequence of the antisense strand primer used in Example 23 described later.
- Example 29 shows the nucleotide sequence of a synthetic DNA used in Example 29 described later.
- Example 15 shows the nucleotide sequence of a synthetic DNA used in Example 30 described later.
- [SEQ ID NO: 85] 15 shows the nucleotide sequence of a synthetic DNA used in Example 30 described later.
- the transformant Escherichia coli INV aFzo pVH7U5Lh obtained in Example 1 described below has been used since April 12, 2000, 1-1-11 Higashi, Tsukuba, Ibaraki, Japan, Japan Deposited with the National Institute of Advanced Industrial Science (NI BH) under the deposit number FERM B P-7130. From April 18, 2000, 2-17-85, Jusanhoncho, Osaka City, Osaka, Japan; Fermentation Research Deposit No. (IFO 16 423).
- the transformant Escherichia coli INVa Fzo pVHNC5Lh obtained in Example 3 described below has been used since April 18, 2000, Tsukuba East, Ibaraki Prefecture, Japan, Japan Deposited with the National Institute of Technology (NI BH) under the deposit number FERM BP-7139. From April 18, 2000, 2-17-85, Jusanhoncho, Osaka City, Osaka, Japan. (IFO) and deposit number IFO 16424.
- the plasmid pVHUPTr obtained in Example 6 described below has been used since July 3, 2000, 1-1-1 Higashi, Tsukuba, Ibaraki, Japan 3. NIBH No. FER M BP—7204.
- the transformant Escherichia coli TOPlO / pVHUPTr obtained in Example 6 to be described later was obtained on July 17, 2000 from 2-17-85, Jusanhonmachi, Osaka-shi, Osaka, Japan. Deposited with the Fermentation Research Institute (IFO) under accession number IFO 16455.
- the plasmid pVHUPTm obtained in Example 7, which will be described later, was submitted to the National Institute of Biotechnology and Industrial Technology (NI BH) on July 3, 2000, at Higashi 1-1, Tsukuba, Ibaraki, Japan. Deposit number F ERM BP — deposited as 7205.
- the transformant Escherichia coli TOPlOZpVHUPTm obtained in Example 7 described below has been used since July 17, 2000, 2-17-85, Jusanhoncho, Osaka City, Osaka, Japan; (FOI) under the deposit number IFO 1.6454.
- the transformant Escherichia coli TOPlO / pVHABDr obtained in Example 9 described below was tested on August 10, 2000. 1-11, Higashi, Tsukuba, Ibaraki, Japan, deposited at the National Institute of Advanced Industrial Science and Technology (NI BH), Ministry of International Trade and Industry, under the deposit number FERM BP-7268.
- Plala has been deposited with the Fermentation Research Institute (IF0) under the deposit number IFO 16461 at 2-17-85, Jusanhoncho, Osaka City, Osaka, Japan.
- the hybridoma HK4-144-10 obtained in Example 14 described below has been used since March 26, 2001, 1-1-1-3 Higashi, Tsukuba, Ibaraki Prefecture, Japan Deposited with the National Institute of Technology (NI BH) under the deposit number F ERM BP-7520. '
- CDNA encoding the novel polypeptide of the present invention was obtained by the following PCR method.
- Oligo DNA CTGGGGCATTGGTCCTGGTG
- Oligo DNA A CTGGGGCATTGGTCCTGGTG
- SEQ ID NO: 2 an antisense strand primer
- 5 pmol 10 OmM Tris'HCl Buffer solution (pH 9.0) I
- 500 mM chloride solution 51, 25 mM magnesium chloride solution 3 I 2.5 mM deoxyliponucleotide solution 41
- Human Testiso 1 yA + NA (Clontech 1)
- a mixed solution 501 containing TaKaRa Taq TM 0.51 prepared from the above, and using TaKaRa PGR Thermal Cycler MP (S Shuzo Co., Ltd.).
- the plasmid was introduced into a competent cell of E. coli INVaF 'strain. From the colonies of the ampicillin-resistant transformant appearing on the LB agar medium containing ampicillin, a clone carrying the plasmid containing the foreign DNA fragment was selected, and the plasmid DNA, pVH7U5 Lh was adjusted. In order to determine the nucleotide sequence of the inserted DNA, pVH7U5Lh was used as type I DNA, the oligo DNA represented by SEQ ID NO: 1 above and the oligo DNA represented by SEQ ID NO: 2 as sequence primers.
- a sequence reaction using AB IPRISM TM BigDye Terminator Cycling Sequencing FS Ready Rekit on Kit (PerkinElmer) was performed according to the conditions in the attached document. l After the reaction was performed using Cycler MP (Takara Shuzo Co., Ltd.), the reaction sample was analyzed using a DNA sequencer ABIPRISM TM 377 (PerkinElmer).
- pVH7U5Lh contained the nucleotide sequence corresponding to the 49th to 494th nucleotides shown in SEQ ID NO: 4, that is, the N-terminal of the novel repeptide consisting of 142 amino acids represented by SEQ ID NO: 3. It turned out that it codes for a region corresponding to the amino acid sequence of 133 residues on the C-terminal side excluding 9 amino acid residues.
- the amino acid sequence of the relevant portion includes the primary structure characteristic of the insulin ZIGFZ relaxin family (A-chain having a hydrophobic region at the N-terminal, a basic amino acid residue and having a Cys residue (SEQ ID NO: 7). ) And the B chain (SEQ ID NO: 8)).
- oligo DNA represented by SEQ ID NO: 9 was used as an antisense strand primer, and AP1 attached to Marathon TM -Ready cDNA Human Testis was used as a sense strand primer.
- oligo DNA represented by SEQ ID NO: 10 was used as an antisense strand primer, and AP2 attached to Marathon "TM -Ready cDNA Human Testis was used as a sense strand primer.
- the first PCR was performed 35 times and the subsequent nested PCR was performed 20 times. The amplified PCR fragments were separated using a 2.0% agarose gel and electrophoresed.
- the base sequence of the PCR fragment was directly determined using the synthetic DNA represented by SEQ ID NO: 10 as a primer for sequencing, and as a result, the first to 48 nucleotides represented by SEQ ID NO: 4 were obtained.
- the amino acid sequence corresponding to the 1st to 9th positions shown in SEQ ID NO: 3 and the nucleotide sequence corresponding to the 1st position have been newly clarified.
- 3 ′ RACE PCR was performed as follows.
- the oligo DNA represented by SEQ ID NO: 5 was used as the sense strand primer, and AP1 attached to Marathon TM -Ready cDNA Human Testis was used as the antisense strand primer.
- the reaction was carried out using oligo DNA represented by SEQ ID NO: 11 as a strand primer and AP2 attached to MarathonTM-Ready cDNA Human Testis as an anti-sense strand primer.
- the reaction-completed solution was subjected to electrophoresis using 2.0% agarose gel and stained with ethidium bromide.
- a band was detected as a RACE PCR product at 0.7 kb. Therefore, the DNA fragment was recovered and purified using Qiaquick Gel Extraction Kit (Qiagen), and pCR (registered trademark) was used to determine the nucleotide sequence.
- TA-cloning was performed using 2.1-TOPO (Invitrogen), and the plasmid was introduced into a competent cell of the DH5 ⁇ strain of Otsuki Bacillus. From the colonies of ampicillin-resistant transformants that appeared on the ampicillin-containing LB agar medium, select 4 clones carrying the plasmid containing the foreign DNA fragment and prepare each plasmid DNA.
- the nucleotide sequence of the inserted DNA fragment was determined.
- the base sequence corresponding to positions 413 to 1061 shown in SEQ ID NO: 4 starting from the nested primer represented by SEQ ID NO: 11 was added to the 3 ′ side. It was found that the DNA fragment to which the poly A sequence was added was inserted.
- the open reading frame of SEQ ID NO: 4 was clarified, and the characteristics of the protein represented by SEQ ID NO: 3 encoded in the open reading frame (signal sequence, basic amino acid residue) From the A chain (SEQ ID NO: 7) and the B chain (SEQ ID NO: 8)) having a Cys residue between them, the novel protein of the present invention is a new secretion belonging to the insulin / IGF / relaxin family. (Fig. 1)
- the full-length cDNA encoding the novel polypeptide (precursor polypeptide) of the present invention was obtained by the following 5'-RACE method.
- an oligo DNA (G) represented by SEQ ID NO: 13 prepared based on the imported DNA sequence of pVH7U5Lh obtained in Example 1 GGCAGGGGTCTCTGTGT) was used as a primer, and a cDNA solution was prepared by a reverse transcription reaction using Human Te. Stispo 1 yA + RNA (Clontech) as a rust type.
- a primary PCR reaction was performed using the AAP attached to the 5'-RACE System as a sense strand primer and the oligo DNA represented by SEQ ID NO: 13 above as an antisense strand primer.
- an oligo DNA represented by SEQ ID NO: 14 was prepared as a sense strand primer based on the inserted DNA sequence of pVH7U5Lh obtained in Example 1.
- the oligo represented by SEQ ID NO: 2 was prepared as an antisense strand primer!
- Nested PCR was performed using NA (ACTGGGGCATTGGTCCTGGTG).
- the reaction-terminated liquid was subjected to electrophoresis using a 1.0% agarose gel and stained with ethidium bromide. As a result, a band was detected at a position of 0.5 kb.
- the D-fragment was recovered using GENE CLEAN SP IN KIT (BIO 101) and TA cloned using PCR (registered trademark) 2.1 (Invitrogen) to determine the nucleotide sequence.
- the plasmid was introduced into a competent cell of E. coli I NVaF 'strain. From the colonies of the ampicillin-resistant transformants appearing on the ampicillin-containing LB agar medium, clones containing the plasmid having the foreign DNA fragment inserted therein were selected, and the plasmid DNA, pVHNC 5Lh, was selected. Prepared.
- pVHNC5Lh was used as type I DNA
- the oligo DNA TTCAAAGCATCTCCGTCCAGC
- the oligo DNA ACTGGGGCATTGGTCCTGTGTG
- SEQ ID NO: 2 a sequence primer
- pVHNC5Lh contained an open nucleotide sequence encoding a novel polypeptide consisting of a total of 142 amino acids represented by SEQ ID NO: 3, ie, a nucleotide sequence corresponding to positions 1 to 494 shown in SEQ ID NO: 4. It was found that a reading frame (ORF) was included. ( Figure 1) .
- tissue expressing the novel polypeptide was examined by the following PCR method.
- array number No .: 5 oligo (NA) (CCGGATGCAGATGCTGATGAA) as a sense strand primer; oligo DNA (TGGTCAA AGGGCAGGGTTGG) represented by SEQ ID NO: 6 as an antisense strand primer; 2.5 pmo 1, l O OmM Tris' hydrochloric acid buffer (pH 9.0) 2.5 K 50 OmM potassium chloride solution 2.5 1, 25 mM magnesium chloride solution 1.5 1, 2.5 mM deoxyliponucleotide solution 21, 1, type ⁇ Prepare 25 l of a mixed solution containing Human mu 1 tip 1 etissue cDNA (MTC TM) pan ls (Clontech Co., Ltd.) cDNA solution 11 for each tissue and TaKaRa Taq TM 0.251 as DNA.
- Rat clones of the novel human-derived polypeptide (precursor polypeptide) obtained in Example 3 were used as follows. Analysis was performed by the genome walking method. As test materials, Rat Genoie alker TM Kit (Clontech) was used for rat chromosomal DNA, and Mouse Genome alker TM Kit (Clontech) was used for mouse chromosomal DNA. The method followed the attached material of each kit except that TaKaRa Ex Taq TM (Takara Shuzo) was used as the enzyme for the PCR reaction.
- a human novel polymorphism represented by SEQ ID NO: 12 Using the base sequence of the cDNA encoding the peptide (precursor polypeptide) as a query, a cDNA encoding the rat-counting part 1 of the rat was found from the public EST (Expressed Sequence Tag) database. Based on the nucleotide sequences of EST, AW523625 and AW521175, which are thought to contain a partial region on the 'side, three types of oligo DM (R1 (SEQ ID NO: 27) having a sequence complementary to a part of these nucleotide sequences are used.
- R 2 SEQ ID NO: 28
- L 1 SEQ ID NO: 29
- the reaction system using L1 for 1st PCR for rat chromosomal DNA and R2 for subsequent nested PCR, and R1 for 1st PCR for mouse chromosomal DNA and R2 for subsequent nested PCR Specific amplified DNA fragments were obtained in the respective reaction systems.
- the nucleotide sequence derived from each genome having the adapter primer (AP2) sequence at the end was determined according to the method of the above-described Example, and a second round was performed based on the sequence.
- AP2 adapter primer
- the base sequence of each amplified DNA fragment is determined, and the human novel polypeptide (precursor polypeptide) of the present invention obtained in Example 3 is encoded.
- the structure was analyzed while comparing the homology with the nucleotide sequence of the cDNA.
- the rat counterpart of the novel polypeptide was obtained from the nucleotide sequence of the genome identified in the above experiment and the above-mentioned public EST sequences (AW523625 and AW521175) as SEQ ID NO: 18.
- a polypeptide consisting of 140 amino acid residues represented by SEQ ID NO: 17 which is encoded by a 420-base DNA shown in the following, and said gene is composed of two exons with one intervening sequence on the rat chromosome (Exon), out of 420 bases, the first exon has 184 bases represented by SEQ ID NO: 41 in the second exon, It was clarified that 236 bases represented by SEQ ID NO: 42 were encoded in the protein.
- the polypeptide has a sequence characteristic of the insulin / IGF norilaxin family, ie, a signal sequence, which is flanked by basic amino acid residues and has a Cys residue.
- Chain SEQ ID NO: 19
- B chain SEQ ID NO: 21
- the mouse counterpart of the novel polypeptide is a sequence encoded by a 423-base DNA represented by SEQ ID NO: 24. It is a polypeptide consisting of 141 amino acid residues represented by No.
- the polypeptide includes a novel human polypeptide, Similar to the rat novel polypeptide described above, a sequence characteristic of the insulinino IGFZ relaxin family, ie, a signal sequence, A chain (SEQ ID NO: 19) and B chain flanked by basic amino acid residues and having a Cys residue (SEQ ID NO: 21).
- cDNA encoding the novel polypeptide rat counterpart of the present invention was obtained by performing PCR in the following manner. 'First, as the sense strand primer, oligo DNA (UP (SEQ ID NO: 5) chemically synthesized based on the 5'-side untranslated region base sequence of the novel polypeptide mouse protein fragment obtained in Example 5 36)), and oligo DNA (RL (SEQ ID NO: 37)) chemically synthesized based on the base sequences of public EST, AW523625 and AW521175 described in Example 5, respectively.
- UP SEQ ID NO: 5
- oligo DNA oligo DNA
- RL SEQ ID NO: 37
- reaction solution was electrophoresed on a 1.0% agarose gel, stained with ethidium bromide, and a band corresponding to the DNA amplified by the PCR reaction was found at a position near 0.45 kb in terms of molecular weight marker. confirmed.
- GENE CLEAN SP IN KIT B IO
- the DNA fragment was recovered using PCR (101 companies) and TA-cloning was performed on PCR (registered trademark) 2.1-TOPO (Invitrogen) to determine the nucleotide sequence, and the plasmid was transformed into TOP 10 E. coli.
- the strain was introduced into a competent cell (Invitrogen). From the colonies of the ampicillin-resistant transformed strain that had appeared in the culture on the ampicillin-containing LB agar plate medium, a clone that had retained the plasmid into which the foreign DNA fragment had been inserted was selected from the clones. DNA and pVHUPTr were prepared, and the nucleotide sequence of the inserted DNA fragment was determined.
- pVHUPTr contained an open reading frame consisting of 420 bases represented by SEQ ID NO: 18 encoding a rat counterpart of a novel polypeptide precursor consisting of 140 amino acids represented by SEQ ID NO: 17 It was found that a 470 base pair DNA fragment represented by SEQ ID NO: 39 containing (ORF) was included.
- Plasmid pVHUPTr carrying DNA encoding the novel rat polypeptide (precursor protein) thus obtained was introduced into Escherichia coli (Esche richiaco 1 i) TOP 10 and transformed into Escherichia richiaco 1 i TOP 1 OZpVHUPTr was obtained.
- Example 7 Cloning of full-length cDNA encoding mouse counterpart of novel polypeptide (precursor protein)
- the full-length cDNA encoding one part of the novel polypeptide mouse counter of the present invention was obtained by performing PCR in the following manner.
- oligo DNA (UP (SEQ ID NO: 36)) chemically synthesized based on the 5 ′ untranslated region base sequence of the novel polypeptide mouse DNA fragment obtained in Example 5
- oligo DNA (ML (SEQ ID NO: 38) chemically synthesized based on the mouse cDNA partial sequence obtained in Example 5 as an antisense strand primer at 5 pmo1 and 100 mM Tris'hydrochloride, respectively.
- Buffer pH 8.3 5 ⁇ 1, 50 OmM potassium chloride solution 51, 25 mM magnesium chloride solution 31, 2.5 mM deoxyliponucleotide solution 41 1, Marathon as ⁇ -type DNA
- pVHUPTm has an open reading sequence consisting of 423 bases represented by SEQ ID NO: 24, which encodes a mouse counterpart of a novel polypeptide precursor consisting of 141 amino acids represented by SEQ ID NO: 23.
- a DNA fragment encoding a part of the novel porcine polypeptide (precursor protein) It was obtained by the following PCR method. That is, the oligo DNA represented by SEQ ID NO: 53 (exlFl) is contained as a sense strand primer, and the oligo DNA represented by SEQ ID NO: 54 (exlRl) is contained as an antisense strand primer in an amount of 20 pmol each.
- Premix Taq TM (Ex Taq TM Version) (Takara Shuzo Co., Ltd.) Prepare a mixture 1 containing porcine genomic DNA (Clontech, # 6651-1) 1 ⁇ 1 as 2Qu II type DNA, and use thermal cycler (GeneAmp TM PCR system model 9700 (PE Using BioSystems)), repeat 30 cycles of 94 ° C, 2 minutes, 94 ° C, 10 seconds ⁇ 5 ° 10 seconds ⁇ 72, 30 seconds, and further at 72 ° C, 1 minute 30 seconds. A PCR reaction was performed using a program for an extension reaction.
- ABI PRISMTM BigDye was prepared by using the plasmid prepared from the cloned cells re-cultured in the presence of ampicillin as type III DNA and a commercially available primer DNA (PRM-007, PRM-008 (Toyobo Co., Ltd.)) as the sequence primer.
- the reaction sample was analyzed using a DNA sequencer ABI PRISM 377 (PE Biosystems).
- the PCR product had the above primer sequence at both ends, and contained therein a sequence number coding from the N-terminus of the porcine precursor protein to the B-chain peptide via the signal peptide.
- the DNA fragment was found to be a DNA fragment containing 239 base pairs of: NA represented by SEQ ID NO: 56 containing the nucleotide sequence represented by 55.
- PORexlFl was used during the IstPCR reaction, and P0RexlF2 was used during the nested PCR reaction.
- the nucleotide sequence of the amplified DNA fragment obtained after the nested PCR reaction is determined according to the method described above, and the nucleotide sequence of the cDNA encoding the human, mouse and rat precursor proteins starting from the P0RexlF2 primer sequence site is determined.
- the nucleotide sequence was analyzed while comparing the homology.
- 140 parts of the novel polypeptide (precursor protein) represented by SEQ ID NO: 45 were encoded by 420 bases DNA of SEQ ID NO: 46.
- the gene is composed of two exons with one intervening sequence on the chromosome, and among the 420 bases, the first exon has It was revealed that 193 bases represented by SEQ ID NO: 59 and 227 bases represented by SEQ ID NO: 60 were encoded in the second exon.
- the polypeptide Similar to the novel human polypeptide (precursor protein), the polypeptide has a sequence characteristic of the insulin ZIGF / relaxin family, ie, a signal sequence, an A chain flanked by basic amino acid residues, and having a Cys residue. (SEQ ID NO: 47) and the B chain (SEQ ID NO: 49).
- Novel polypeptide derived from rat mesenteric adipose tissue
- the full-length cDNA to be coded was obtained by the PCR method as follows. First, of the oligo DNAs used in Example 6, UP (SEQ ID NO: 36) was used as a sense strand primer, and RL (SEQ ID NO: 37) was used as an antisense strand primer, 5 pmol and 10 OmM Tris'hydrochloride, respectively.
- Buffer solution (pH 8.3) 5 1 500 mM salt solution of sodium chloride 51 1, 25 mM magnesium chloride solution 3 2.5 mM deoxyliponucleotide solution 4/1, total RNA derived from rat mesenteric adipose tissue as type I DNA
- TaKaRa PC R Thermal Cycler MP (Takara Shuzo Co., Ltd.) for 1 minute at 95 ° C, then 30 seconds at 95 ° C, 1 minute at 67 ° C, 72 ° C.
- the PCR reaction was further performed at 72 ° (:, 10 minutes).
- the reaction completed solution was electrophoresed on a 1.0% agarose gel. After staining with ethidium bromide, a band corresponding to the DNA amplified by the PCR reaction was detected at a position near 0.6 kb in terms of molecular weight marker, and then GENE CLEAN SP IN KIT ( ⁇ I ⁇ 101) was detected.
- the DNA fragment was recovered using the above method, and cloned with pCR TM 2.1-TOPO (Invitrogen) to determine the nucleotide sequence.
- a commercially available primer DNA (PRM-007, PRM008 (Toyobo Co., Ltd.) was used as the sequence primer, and the AB I PR I SM TM Big D Y e T e rm inator Cyc le Se ng nc ng FS Ready Re ac ti on A sequencing reaction using Kit (PE Biosystems) was performed on a thermocycler (Gene Amp TM PCR system mode 9700 (PE Biosystems)) according to the conditions in the attached document. After that, the reaction sample was analyzed using a DNA sequencer AB IPRI S SM 377 (PE Biosystems).
- VHABD r contains a 522-base D represented by SEQ ID NO: 52.
- SEQ ID NO: 61 containing an open reading frame (ORF) encoding a novel polypeptide (precursor polypeptide) variant consisting of 174 amino acid residues represented by SEQ ID NO: 51 encoded by NA It was found that a 572 base pair DNA fragment had been inserted.
- the polypeptide variant has a sequence characteristic of insulin / IGF / relaxin family, that is, a signal identical to that of the novel polypeptide (precursor polypeptide) rat type counterpart described in Examples 5 and 6.
- a novel polypeptide (A) (SEQ ID NO: 19) and B chain (SEQ ID NO: 21) sandwiched between basic amino acids and having a Cys residue, and described in Example 5.
- a DNA consisting of 102 bases represented by SEQ ID NO: 62 derived from a part of the intervening sequence existing between exon 1 and exon 2 of rat-type force receptor. It was found that the polypeptide consisting of 34 amino acid residues represented by SEQ ID NO: 63 had an inserted structure.
- the plasmid pVHABDr thus obtained was introduced into Escherichia coli TOP10, and a transformant Escherichiaciacoli TOP10 / p VHABDr was obtained.
- Example 10 Preparation of AtT20 cell line expressing human novel polypeptide gene
- the thus obtained plasmid was introduced into mouse pituitary tumor cell line AtT20 (Dainippon Pharmaceutical Co., Ltd.) using Lipofectin (GIBC0-BRL) according to the method described in the attached protocol.
- GIBC0-BRL Lipofectin
- An AtT20 cell line expressing the peptide gene was obtained.
- Example 11 Preparation and immunization of an immunogen containing a novel polypeptide (human type) A-chain N-terminal peptide
- AspValLeuAl aGlyLeuSerSerSerCys (N-terminal (1-10) partial sequence of SEQ ID NO: 7) synthesized from A-chain N-terminal peptide of the novel polypeptide (human type) obtained in Example 3 above
- a complex with Mosyanin (KLH) was prepared and used as an immunogen. That is, dissolve 20 mg of KLH in 2.0 ml of 0.1 M phosphate buffer (pH 6.7) and add 0-130 containing N- ( ⁇ -maleidobutyric acid) succinimide (GMBS) 2.8113 ⁇ 4. The mixture was mixed with the solution 200 21 and reacted at room temperature for 30 minutes.
- the antibody titer in the mouse antiserum was measured by the following method.
- goat anti-mouse immunoglobulin antibody IgG fraction, manufactured by Kappel
- pH 9.6 solution was dispensed in 0.1 ml portions into a 96-well microplate and left at 4 ° C for 24 hours.
- the plate is washed with phosphate-buffered saline (PBS, pH 7.4), and 25% Block Ace (Snow Brand Milk Products) and 0.05% NaN are used to block excess binding sites on the wells. 3 including:. PBS, pH 7 aliquoted 2 by 0. 3 ml min and at least 24 hours at 4 ° C.
- the plate was washed with PBS, pH 7.4, and then washed with Buffer-C [0.02 M phosphate buffer containing 1% BSA, 0.4 M NaCK and 2 mM EDTA, PH 7.0] for 1000 hours.
- Buffer-C [0.02 M phosphate buffer containing 1% BSA, 0.4 M NaCK and 2 mM EDTA, PH 7.0] for 1000 hours.
- 0.1 ml of the N-terminal HP-labeled A-chain peptide prepared in Example 12 diluted twice above was added and reacted at 4 ° C for 1 day.
- the plate is washed with PBS, pH 7.4, and the enzymatic activity on the solid phase is measured by adding 0.1 ml of TMB microwell passoxidase substrate system (KIRKEGMRD & PERRY LAB. It was measured by reacting for 1 minute.
- mice No. 1 and No. 7 showing relatively high antibody titers in Example 13 A final immunization was performed. Three days after the final immunization, the spleen was excised from the mouse, pressed with a stainless mesh, and suspended in Eagle's minimum essential medium (MEM) to obtain a spleen cell suspension. As a cell used for cell fusion, BALBZC mouse-derived myeloma cell P3-X63. Ag 8. Ul (P3U1) was used [Current 'Topics' in' Microbiology and Immunology 1, 81, 1 (1978)].
- MEM Eagle's minimum essential medium
- Cell fusion was carried out according to the original method [Nichiya, 256, 495 (1975)]. That is, the spleen cells ⁇ 3 ⁇ are each washed three times with serum-free MEM, mixed with the spleen gun at a ratio of 6.6: 1 to the number, and spun at 750 rpm for 15 minutes. The cells were precipitated by centrifugation. After sufficiently removing the supernatant, the precipitate was loosened gently, and 0.3 inl of 45% polyethylene glycol (PEG) 6000 (manufactured by Kochlight) was added. The mixture was allowed to stand in a 37 ° C hot water bath for 7 minutes to fuse. Done.
- PEG polyethylene glycol
- MEM was gradually added to the cells, and a total of 15 ml of MEM was added, followed by centrifugation at 750 rpm for 15 minutes to remove the supernatant.
- the cell pellet was suspended in GIT medium (Wako Pure Chemical) containing 10% fetal calf serum (GIT-10% FCS) so that P3U1 became 2 x 105 lm / equivalent, and a 24-well multi-dishes ( (Limbrone earth) was seeded in 168-wells in 1 ml-ml. After seeding, the cells were cultured at 37 ° C in a 5% CO 2 incubator.
- HAT medium GIT-10 FCS medium
- HAT hyperxanthine IX 10-4 M, aminopterin 4 ⁇ 10-7 M, thymidine 1.6 ⁇ 10-3 M
- HAT selection culture was started by adding each of the HATs.
- HAT selective culture was continued by discarding 1 ml of the old solution 5 and 8 days after the start of the culture and adding 1 ml of HAT medium, and collecting the supernatant on day 9 after cell fusion.
- the antibody titer in the culture supernatant was determined according to the method described in Example 13. That is, add 0.07 ml of culture supernatant and 07 ml of buffer ECO to each well of the anti-mouse immunoglobulin antibody-bound microplate, react at 4 ° C overnight, and dilute 1000-fold with buffer C. 0.1 ml of HRP-labeled A-chain N-terminal peptide in the presence of 0.002 mM unlabeled A-chain N-terminal peptide or The reaction was carried out at room temperature for 7 hours in the absence. After washing the plate with PBS, the enzyme activity on the solid phase was measured according to the method described in Example 13.
- Hybridoma HK4-144-10 was selected as a hybridoma producing an anti-A chain N-terminal peptide monoclonal antibody.
- Example 15 Mouse Ascites of Hybridoma and Purification of Monoclonal Antibody
- AtT20 expressing the novel polypeptide (human type) precursor described in Example 10 was cultured. Pass 2 L of the culture supernatant through 3.2 ml of HK4-144-10-bound tresyl toyopearl solid phase, wash with PBS, pH 7.4, and add 10 ml of 60% acetonitrile containing 0.1 ⁇ TFA (trifluoroacetic acid). Eluted.
- the HK4-144-10-bound tresyl toyopearl solid phase was prepared by binding 125 mg of the HK4-144-10 antibody to 5 g of AF-Tresyl Toyopear (manufactured by T0S0H) according to the attached guideline. After freeze-drying the eluate, dissolve it in 0.5 ml of 40% acetonitrile containing 0.1% TFA and equilibrate with 40% acetonitrile containing 0.1% TFA (7.8 x 300 mm TSK G3000PW column). , T0S0H). The flow rate was 0.25 ml / min, and 2 minutes were collected as one fraction.
- each fraction was examined by a competition method-EIA using the monoclonal antibody described in Example 15 above, HK4-144-10 and the HRP-labeled A-chain N-terminal peptide described in Example 12 above. That is, HK4-144-10 diluted to 3 ng / ml with Buffer-C (buffer CC) containing 0.05% CHAPS and 0.05mK buffer CC were added stepwise to the anti-mouse immunoglobulin antibody-binding microplate.
- Buffer-C buffer CC
- This molecular weight is almost the same as the molecular weight of 5500, 4 of a novel polypeptide (human type) consisting of the A chain having the amino acid sequence represented by SEQ ID NO: 7 and the B chain having the amino acid sequence represented by SEQ ID NO: 8. From the agreement, it was found that the novel polypeptide (human type) itself was eluted in fraction No. 64. In addition, at least two kinds of components were detected from the mass spectrometry of fraction No. 65, and the molecular weight of the main component was 53343. 7 and the molecular weight of the accessory component was 52272.
- the molecular weights of the novel polypeptide (human type) in which the N-terminal amino acid Arg of the B chain is deleted and those in which Ala is further deleted are 534.2 and 5273.1, respectively, which are almost identical to the observed molecular weights. Therefore, it was presumed that the main component was deficient in the N-terminal amino acid Arg of the B chain, and the minor component was also deficient in Ala.
- the A polypeptide having the amino acid sequence represented by SEQ ID NO: 7 and the amino acid sequence represented by SEQ ID NO: 8 were obtained from the novel polypeptide precursor (human type) in AtT20 cells. It was confirmed that a novel polypeptide consisting of the B chain having In addition, it was revealed that oxidized A chain could be secreted and produced alone.
- Example 17 Effect of Purification of Purified Human New Polypeptide on Intracellular Cyclic Adenosine Monophosphate (cAMP) Production of Human Monocytic Cell Line THP-1 Cells (Dainippon Pharmaceutical) Peptide precursor (human type) Expression
- cAMP Cyclic Adenosine Monophosphate
- THP-1 Cells Human Monocytic Cell Line
- Peptide precursor human type
- Expression A novel polypeptide separately purified from 3.5 L of culture supernatant of AtT20 cells separately from 3.5 L according to the method described in Example 16 above. Fraction containing (human type) is frozen. The solution was dried and added with 2001 buffer A (PBS, 1% BSA, 0.05% CHAPS) and dissolved (at a concentration of 3.8 M). The purified human novel polypeptide was used in the following experiments.
- 2001 buffer A PBS, 1% BSA, 0.05% CHAPS
- DMEM / F12 (1: 1) lOmM HEPES (pH7.5), 0.1% BSA, 0.ImM 3-isobutyl-1) -Methylxanthine (IBMX)
- IBMX 0.ImM 3-isobutyl-1 -Methylxanthine
- each of purified human polypeptide purified standard solutions diluted with buffer A so that the dilution factor per reaction solution is 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 was added to the above cell suspension, and forskolin (Wako Pure Chemical Industries) ⁇ solution (final concentration: 1 M) 251 dissolved in medium ⁇ ⁇ was added to each of the above cell suspensions. Incubated. The cells were precipitated by centrifugation at 3,000 ° C for 5 minutes at 4 ° C, the supernatant was discarded, and the medium A was added with lral to suspend the cells.
- the intracellular cAMP level was measured using the cAMP EIA System (Amersham Pharmacia) according to the protocol attached to the kit. .
- the purified human novel polypeptide showed an activity of increasing the amount of intracellular cAMP production in THP-1 cells in a concentration-dependent manner.
- Figure 6 Example 18 Analysis of the cell stimulating effect of a purified human novel polypeptide sample on the THP-1 cell line using a microphysiometer
- the cell stimulatory effect of the purified human novel polypeptide on the THP-1 cell line was examined by measuring the extracellular acidification rate (Acidificati'on Rate) using the following microphysiome. .
- the growth state of suspension culture in RPMI 1640 medium containing 10% FCS in advance Roh THP- 1 cells in assay medium (low buf fered RPMI (Molecular Devices)) were suspended in IX 10 8 cel ls / ml, further ⁇ moth loin cell E emission traps Medium (Molecular Devices Corporation) and 3: 1
- the mixed solution was dispensed at the center of each capsule cup (Molekiura-Device Co., Ltd.).
- the agarose was solidified, it was immersed in the measurement medium, and in that state, the spacer and the capsule insert were sequentially placed on the cup, and finally the insert was completely submerged in the measurement medium to complete the measurement capsule.
- the capsule was immediately transferred to the sensor and the chamber, and attached to the body of the site sensor and the microphysiometer (Cytosensor TM Microphysiometer, Molecular Devices).
- the measurement of the acidification rate in the chamber and the data analysis were performed using Cytosof U trowel, an application program attached to the apparatus.
- the pump speed was set so that the flow rate of the measurement medium was 100 1 / min during the operation of the pump, and the acidification rate was measured at intervals of 40 seconds during each pump cycle of 2 minutes and 30 seconds.
- Example 16 As a test sample, the purified human novel polypeptide obtained in Example 16 was dissolved in buffer A (PBS, 1% BSA, 0.05% CHAPS) described in Example 17 and measured. What was diluted 500 times with a constant medium was used. The diluted solution is set in one of the two flow paths of the site sensor, and the new polypeptide solution is released for a certain period of time by switching the valve.
- buffer A PBS, 1% BSA, 0.05% CHAPS
- PVHNC5Lh which is a plasmid containing a DNA fragment encoding the novel human polypeptide obtained in Example 3, was designated as type I, and the oligo DNA represented by SEQ ID NO: 64 (CCGGATCCATGCGGGCAGCGCCTTA) was used as a sense strand primer.
- oligo DNA ATCTCGACTGCCCCGAAGAACC
- CAGTCGAATGGATGTCCTGGCTGGC CAGTCGAATGGATGTCCTGGCTGGC
- SEQ ID NO: 66 SEQ ID NO: Oligo DNA indicated by 6 7 (CCGGATCCTAGCAAAGGCTACTGATTTCA) was used as an antisense strand primer
- PCR was performed using LA-Taq polymerase (Takara Shuzo). The reaction completed solution was subjected to electrophoresis using 1.5% agarose gel, and 0.3 kb and 0.1 kb DNA fragments generated by each reaction were recovered from the gel.
- DNA fragments were digested with restriction enzymes BamHI and Taql to form BamHI and Taql sites at the ends.
- the pET-l la (STRATAGENE) expression vector is digested with BamHI, dephosphorylated using Calfinstein phosphatase (Takara Shuzo), and the reaction mixture is treated with 1% agarose gel. After electrophoresis, a 5.5 kb DNA fragment was recovered from the gel. After ligation of these three DNA fragments using DNA Ligation Kit ver. 2 (Takara Shuzo), the reaction solution was added to E. coli JM109 Competent Cel ls (Takara Shuzo) for transformation.
- the plasmid was introduced into Epicurian Coll BL21-Gold (DE3) Competent Cell (STRATAGENE) to obtain a set for expressing a novel human polypeptide fusion protein.
- a recombinant E. coli strain Escherichia coli BL21-Gold (DE 3) / pETVHMMh was obtained.
- the fusion protein is encoded by a total of 39.9 base sequences shown in SEQ ID NO: 68, and comprises a leader consisting of 14 amino acids, a peptide sequence, a Met-B chain, and a processing protein recognition sequence (Arg-T ⁇ -).
- Example 20 Expression of fusion protein by recombinant Escherichia coli strain expressing human novel polypeptide fusion protein
- the Escherichia coli strain Escherichia coli BL21-Gold (DE3) / pETVHMMh obtained in Example 19 was cultured in an LB medium containing 50 g / ml ampicillin at 37 at 37 until 0D600 became 0.5. Isopropyl-jS-D-thiogalactopyranoside (IPTG) was added to a concentration of IfflM, and the cells were further cultured for 3 hours. After completion of the culture, the cells were collected by centrifugation, and the whole cell proteins were extracted and analyzed by SDS-PAGE. As a result, as shown in FIG. 8, a 17 KDa protein band corresponding to the human novel polypeptide fusion protein was observed under IPTG induction.
- IPTG Isopropyl-jS-D-thiogalactopyranoside
- the fusion protein was recovered as an inclusion body from the Escherichia coli strain cells cultured according to the present example, denatured and unwound to form an S--S bond in a correct combination, and then the odor at the C-terminal side of the Met residue C was determined.
- Cleavage by cyanide (CNBr), Arg-T ⁇ -Arg-Arg sequence New degradation of human polypeptide by enzymatic reaction of limited C-terminal cleavage and cleavage of the two resulting Arg You can get your body.
- Example 21 1. Preparation of novel human polypeptide and its derivative from recombinant E. coli strain expressing human novel polypeptide fusion protein
- the E. coli strain Escherichia coli BL21-Gold (DE3) / pETVHMMh obtained in Example 19 was cultured by the method described in Example 20.
- the cells obtained were cultured in a buffer for disruption (50 mM Tris. .8), suspended in 51M EDTA), sonicated (1 minute X 3 times), and centrifuged (15,000 rpm, 20 minutes, 4 ° C).
- the precipitate was suspended in a washing buffer (50 mM Tris. HCl (pH 6.8), 5 mM EDTA, 4% Triton X-100), and centrifuged (15,000 rpm, 20 minutes, 4 ° C).
- the precipitate was suspended again in the washing buffer and centrifuged in the same manner.
- the precipitate was suspended in distilled water and centrifuged twice in the same manner.
- the precipitate thus obtained that is, the inclusion body containing the novel polypeptide fusion protein was solubilized with a buffer for solubilization (50 mM Tris. HCl (pH 6.8), 4 M guanidine hydrochloride, 5 mM 2-mercaptoethanol).
- Example 16 The fraction of the main peak fractionated from the lyophilized product containing the human novel polypeptide fusion protein using a TS gel ODS-80TS column according to the method described in Example 16 was described in Example 16 As a result of performing mass spectrometry according to the method described in (1), the value of the measured molecular weight obtained was one of the N-terminal 1-amino acid of the polypeptide consisting of 133 amino acids shown in SEQ ID NO: 69. (Met) -deleted polypeptide, consistent with the theoretical molecular weight of (2-133) (Mass Spec .: Found: 14156.9, Theoretical: 14157.0).
- the polypeptide (2-133) was chemically degraded by incubating it overnight in the dark at room temperature in the presence of 0.1 N hydrochloric acid and 5% cyanogen bromide (CNBr). . From this digestion reaction product, a mass analysis was performed on the fraction of the main degradation product fractionated using a TSKgel ODS-80Ts column according to the method described in Example 16 according to the method described in Example 16.
- the value of the measured molecular weight at this time is represented by SEQ ID NO: 7 and a peptide having 11 amino acids (ArgArgSerAspI leLeuAl aHisGluAl aHse) added to the C-terminal of the B chain having the amino acid sequence represented by SEQ ID NO: 8. (16-53) I (110-133)), which is the same as the theoretical molecular weight of the polypeptide composed of the A chain having the amino acid sequence (mass spectrometry value: measured value: 6723.9, theoretical value) : 6732. 8).
- the fraction eluted at 681 minutes was subjected to mass spectrometry according to the method described in Example 16 to find that the value of the measured molecular weight was B-chain having the amino acid sequence represented by SEQ ID NO: 8 and the sequence number.
- This fraction was further subjected to amino acid sequence analysis and analysis of the amount of two peptides generated after reduction.
- amino acid sequence analysis of this fraction revealed that the N-terminal sequence of the B chain, ArgAl aAl aProTyr (N-terminal (1-5) partial sequence of SEQ ID NO: 8) and the N-terminal sequence of the A chain, AspValLeuAl aGly (SEQ ID NO: 7) A mixed sequence of N-terminal (1-5) partial sequence was obtained.
- the value of the measured molecular weight obtained by mass spectrometry of the two peptides generated after reduction of this fraction is the theoretical molecular weight of the B chain having the amino acid sequence represented by SEQ ID NO: 8 (mass spectrometry Value: actual value: 3043.1, theoretical value: 3042.6) and the amino acid sequence represented by SEQ ID NO: 7 With the theoretical molecular weight of the A chain having the following formula (mass spectrometry value: measured value: 2463.1, theoretical value: 2463.8).
- the polypeptide (16-41) / (110-133) composed of a ⁇ chain was also obtained as a by-product in the above process.
- Example 22 Inhibition of intracellular cAMP production on THP-1 cells by a novel human polypeptide and its derivative prepared from a recombinant E. coli strain expressing a novel human polypeptide fusion protein
- the effect of the novel human polypeptide and its derivative prepared from the recombinant colon strain expressing the novel human polypeptide fusion protein on the intracellular cAMP production on the THP-1 cell line was examined. Derivatives were examined for (16-53) / (110-133) as well as polypeptide (16-41) / (110-133). As a result, the novel human polypeptide [polypeptide ((16-42) I (110-133))] (Fig. 11) and its derivatives (Fig. 12) were all produced in a concentration-dependent manner in the production of intracellular cAMP. It showed activity to increase the amount.
- Example 2 3 A novel small polypeptide binds matrix metaoral proteinase-1 (MP-1) and vascular endothelial cell growth factor (VEGF) in normal human lung fibroblast cell line CCD-19Lu (ATCC CCL-210) Expression promoting action
- MP-1 matrix metaoral proteinase-1
- VEGF vascular endothelial cell growth factor
- Normal human lung fibroblast cell line CCD-19Lii a 10 6 eel ls / ml in comprising as medium B (Minimum Essent ial Medium wi th Ear le's Sal ts (GIBCO- BRL Co.), 100 ⁇ ⁇ MEM Non- Essent i al Amino Acids (GIBCO-BRL), 10% FCS, lOUOU / ral penicillin, 100 g / ml streptomycin), and the cell suspension is dispensed at 2 ml per 1-well in a 6- ⁇ plate. The cells were cultured overnight at 37 ° C in 5% carbon dioxide.
- medium B Minimum Essent ial Medium wi th Ear le's Sal ts
- GBCO-BRL 100 ⁇ ⁇ MEM Non- Essent i al Amino Acids
- FCS lOUOU / ral penicillin
- 100 g / ml streptomycin 100 g / ml str
- the cells were cultured in a gas incubator for 24 hours. After extracting all RMs from the cells thus treated using Trisol reagent (GIBCO BRL) according to the protocol recommended by the manufacturer, TaKaRa RNA PCR Kit (AMV) Ver.2.1 (AMV) Using Takara Shuzo, cDNA was synthesized by performing a reverse transcription reaction according to the protocol attached to the kit.
- Trisol reagent GEBCO BRL
- RNA was used, and TaqMan PCR was performed using ABI PRISM 7700 (Applied Biosysteins) using TaqMan PCR Core Reagents Kit AmpliTaq Gold (Applied Biosystems) according to the protocol attached to the kit.
- ABI PRISM 7700 Applied Biosysteins
- TaqMan PCR Core Reagents Kit AmpliTaq Gold Applied Biosystems
- the oligo DNA represented by SEQ ID NO: 71 was used as the sense strand primer and the oligo DNA represented by SEQ ID NO: 71 was used as the antisense strand primer.
- the oligo DNA represented by SEQ ID NO: 72 was combined with Fam as the reporter dye at the 5 'end and Tamra as the quencher dye at the 3' end and used as the TaqMan probe.
- the oligo DNA represented by SEQ ID NO: 73 was used as a primer for the sense strand
- the oligo DNA represented by SEQ ID NO: 74 was used as the primer for the antisense strand
- the sequence Oligo DNA represented by the number 75 was conjugated with Fam as a reporter dye at the 5 'end and Tamra as a quencher dye at the 3' end, and used as a TaqMan probe.
- Oligo DNA represented by SEQ ID NO: 76 as a sense strand primer, Oligo DNA represented by SEQ ID NOs: 7 and 7 as an antisense strand primer, and oligo represented by SEQ ID NO: 78 DNA bound to Fam as a reporter dye at the 5 'end and Tamra as a quencher dye at the 3' end was used as a TaqMan probe.
- the PCR reaction was carried out using a program that was first incubated at 50 ° C for 2 minutes, and then repeated for 40 cycles, each cycle consisting of 15 seconds at 95 ° C and 1 minute at 60 ° C.
- the human novel polypeptides purified preparation increased the relative ratio to it of G3PDH gene expression of negation P- 1 and VEGF (Fig. 1 3). From this, it was revealed that a purified human novel polypeptide had an effect of promoting the expression of banded P-1 and VEGF genes in the normal human lung fountain fibroblast cell line CCD-19Lu.
- VEGF vascular endothelial cell growth factor
- THP-1 cells in the growth phase were suspended in RPMI-1640 medium containing 10% FCS at a concentration of 5 ⁇ 10 4 cels / ml, and each 0.4 ml was dispensed into a 24-well culture plate.
- 0.1 ml of the purified human novel polypeptide (same lot as in Example 21) diluted to the predetermined concentration in the same medium was added to each well, mixed, and then mixed in the same culture plate.
- the cells were cultured at 37 ° C for 24 hours.
- RNeasy Mini Kit Qiagen
- reverse transcription reaction was performed using THERMOSCRIPT TM RT-PCR System (Lifetech Oriental).
- cDNA was synthesized.
- Quantification of gene expression was performed by TaqMan TM PCR (Applied Biosystems) using the cDNA as type II DNA according to the method of Example 23, and the generated target-specific signal was analyzed using ABI PRISM TM 7700 Sequence Detector. The detection was performed by using ion systems (Applied Biosystems). '
- the purified human purified polypeptide increased the relative ratio of VEGF gene expression to G3PDH gene expression, Had the activity of promoting. .
- Example 17 A purified human novel polypeptide solution (50 ⁇ 1) prepared with buffer A described in 7 so as to have a concentration 10 times the final concentration during the reaction, and 10-formol dissolved in medium A 50 I of a choline (Wako Pure Chemical Co., Ltd.) solution was added to the above cell suspension and incubated at 37 ° C. for 30 minutes in a 5% carbon dioxide incubator. The cells were washed twice with 1 ml of medium A, and 0.5 ml of medium A was added. Then, 100% of a 20% perchloric acid solution was added, and the mixture was allowed to stand at 4 ° C for 20 minutes. The cell extract was transferred to a 1.5 ml microtube and centrifuged (15,000 rpm, 10 minutes, 4 ° C).
- the supernatant 5001 was transferred to another 1.5 ml microcap tube and neutralized by adding a 60 mM HEPES, 1.5 M K0H solution to obtain a sample for cAMP assay.
- the amount of intracellular cAMP was measured using the cAMP EIA System (Amersham Pharmacia) according to the protocol attached to the kit.
- the purified human novel polypeptide preparation showed an activity of increasing the intracellular cAMP level in a concentration-dependent manner on NHDF cells (FIG. 14).
- Example 26 Promoting cAMP production of primary cultured cells of rat anterior pituitary by purified human purified polypeptide
- Wistar rats (8-week-old, male) 3 Two animals were decapitated without anaesthesia, and the anterior pituitary gland was removed using buffer B (137 mM sodium chloride, 5 mM potassium chloride, 0.7 mM disodium hydrogen phosphate). , 25 mM HEPES (H7.3), 50 / ml gentamicin sulfate) and washed once with buffer B.
- the number of cells was counted, and the cells were suspended in medium D to 1.8 ⁇ 10 5 cells / ml.
- the cell suspension was dispensed in a volume of 1 ml into each well of a 24-well plate and cultured at 37 ° C in a 5% CO 2 incubator for 3 days. Wash the cells twice with 1 ml of medium E (medium A described in Example 17 with IBMX concentration set to ImM), add 0.45 ml of medium E, and add 5% CO 2 at 37 ° C. Incubated for 1 hour in incubator.
- medium E medium A described in Example 17 with IBMX concentration set to ImM
- a purified human purified polypeptide solution 50 ⁇ 1 prepared with buffer A described in Example 17 so as to have a concentration 10 times the final concentration at the time of the reaction was added to the above cell suspension. Incubation was performed at 5 ° C for 30 minutes in a 5% carbon dioxide gas incubator overnight. The cells were washed twice with 1 ml of medium E, and 0.5 ml of medium E was added. Then, 1001 of a 20% perchloric acid solution was added, and the mixture was allowed to stand at 4 ° C for 20 minutes. The cell extract was transferred to a 1.5 ml microtube and centrifuged (15,000 i: pm, 10 minutes, 4 ° C).
- the supernatant 5001 was transferred to another 1.5 ml microtube and neutralized with a 60 mM HEPES, 1.5 M K0H solution to obtain a sample for cAMP assay.
- the amount of intracellular cAMP was measured using the cAMPEIA System (Amersham Pharmacia) according to the protocol attached to the kit.
- the purified human novel polypeptide showed an activity of increasing the intracellular cAMP level in a concentration-dependent manner on the rat primary pituitary primary culture cells (FIG. 15).
- Mouse alveolar macrophages can be collected from BALB / C mice (8-week-old female) under anesthesia with Nembutal (Dainippon Pharmaceutical) by collecting alveolar lavage fluid using Hanks' solution (Lifetech Oriental) by a known method. I got it. The alveolar macrophage cells are seeded at 5 ⁇ 10 4 cells each in a 24-well culture plate, and cultured at 37 ° C. for 2 hours in RPMI-1640 medium containing 10% FCS. Attached.
- Example 16 was exchanged with RPMI-1640 medium containing 10% FCS and 50 M IBMX, and a purified human polypeptide (from a novel polypeptide precursor (human type) expressing AtT20 cells) was used in Example 16 above.
- a purified human polypeptide from a novel polypeptide precursor (human type) expressing AtT20 cells
- the culture was allowed to stand for minutes.
- the intracellular cAMP content of the cells treated in this manner was measured using cAMP EIA System (Amersham Pharmacia) according to the protocol of the kit.
- Example 28 Determination of Class and Subclass of 8 Mouse Monoclonal Antibody, HK4-144-10 Class and Subclass of Mouse Monoclonal Antibody, HK4-144-10 described in Example 15 are commercially available antiserum (Bio- IgGl and ⁇ were determined by EIA using Rad.
- Example 29 Construction of Animal Cell Expression Vector for Novel Human Polypeptide Gene
- An expression vector for expressing a novel polypeptide gene in C0S-7 cells was constructed. Since COS-7 cells do not express the processing enzyme PC1 required for processing of the polypeptide precursor, the PC1 processing recognition sequence (Arg-Xaa-Xaa_Arg) before the polypeptide and before the precursor A chain is used. Then, a sequence (Arg-Xaa-Arg-Xaa-Arg-Arg) recognized and processed by the processing enzyme furin was substituted, and an expression plasmid was constructed to simultaneously express human furin. At this time, the C-terminal part corresponding to the transmembrane region was removed so that the furin expression product could be obtained as a secreted protein, and six amino acids were left at the C-terminal side for easier detection.
- Human furincDNA is by human Katsu ⁇ the cDNA (Cloniec Inc.) ⁇ , synthetic DNA corresponding to the translation initiation portion of the human furin protein (SEQ ID NO: 79) and subsequently to the amino acid sequence of up to 59 5 Ala of furin protein PCR using a His-His-His-His-His-His sequence, synthetic DNA (SEQ ID NO: 80) designed to have a stop codon, and PfuDNA polymerase (Stratagene III) (reaction conditions: 94 ° C for 1 minute) ⁇ (98 ° C 10 seconds ⁇ 68 ° C 3 minutes 30 seconds) X25 times — 72 ° C 10 minutes ⁇ 4 ° C) to obtain DNA fragments.
- This DM fragment was digested with the restriction enzyme B1nI (Takara Shuzo), and then introduced into the B1nI site of PCAN618 to construct a secretory furin / His-tag expression
- a synthetic DM (SEQ ID NO: 2) was designed by converting a cDNA fragment encoding a novel human polypeptide gene into type III and placing the MfeI restriction enzyme site immediately before ATG at the translation start codon.
- a sequence encoding the C-terminus of the human novel polypeptide gene a synthetic DNA (SEQ ID NO: 82) designed to have a stop codon, and PfuDNA polymerase (Stratagene).
- a human novel polypeptide precursor protein / furin-His-tag co-expression vector without amino acid substitution was similarly constructed as a control.
- Synthetic DNA SEQ ID NO: 81
- Synthetic DNA SEQ ID NO: 83
- synthetic DNA SEQ ID NO: 83
- a synthetic DNA (SEQ ID NO: 8) was designed by converting a cDNA fragment encoding a mouse novel polypeptide gene into type III and placing an EcoRI restriction enzyme site immediately before ATG at the translation initiation codon. 4) and a sequence encoding the C-terminus of the mouse novel polypeptide gene, followed by a synthetic DNA (SEQ ID NO: 85) designed to include a stop codon NotI restriction enzyme site, and a Pfu DNA polymerase (PCR (reaction conditions: 95 ° C for 1 minute ⁇ (98 ° C for 10 seconds ⁇ 68 ° C for 35 seconds) X 25 times—72 ° C for 5 minutes ⁇ 4 ° C) using Strat agene) and mice includes ORF of polypeptide precursors, and to obtain a 1 1 ⁇ al- 1 1 2 Arg , 1 1 ⁇ er- 1 1 6 Arg DM fragments with amino acid substitutions.
- This DNA fragment was double-digested with restriction enzymes EcoRI and NotI (New England Biolabs), followed by EcoRI of the secretory fur in / His-tag expression plasmid obtained in Example 29 above. And a mouse polypeptide precursor / furin-His-tag co-expression vector pCAN618 / mVHl, 3 having a sequence (RVRGRR) recognized by furin before the A chain introduced into the NotI site.
- mice polypeptide precursor / furin-His-tag co-expression vector without amino acid substitution was similarly constructed as a control.
- Synthetic DNA designed by transforming a cDNA fragment encoding a mouse novel polypeptide gene into type I, and placing an Ec0RI restriction enzyme site immediately before ATG at the translation initiation codon. And a sequence encoding the C-terminus of the mouse novel polypeptide gene, followed by a synthetic DNA (SEQ ID NO: 86) designed to include a stop codon Not I restriction enzyme site.
- Perform PGR reaction conditions: 95 ° C for 1 minute ⁇ (98 ° C for 10 seconds ⁇ 68 ° C for 35 seconds) X 25 times—72 ° C for 5 minutes to 4 ° C) using Pfu DNA polymerase (Stratagene). A DNA fragment containing the polypeptide precursor ⁇ RF was obtained.
- COS-7 cells were transfected with the human polypeptide precursor expression vector prepared in Examples 29 and 30 described above.
- the mature peptide in the culture supernatant was measured by EIA.
- the day before transfection of the expression vector prepared in Example 29 above the cells were spread on a 6-iel plate at 4 ⁇ 10 5 cells / well, and a DMEM medium containing 10% FBS (Hyclone) (Gibco They were cultured in 24-hour C0 2 incubator at -BRL). After transfection using the expression vector prepared in Example 29 and PCAN618 and FUGENE6 (Roche Diagnostics), 24 hours later, 1 ml of O.
- lniM 4- (2-aminoethyl benzen sul fonyl) was used.
- the medium was replaced with a DMEM (Phenol Red) medium (Gibco-BRL) containing fluolide (pABSF) (Wako Pure Chemical) and 0.05% C-protected S (Dojindo), and the culture was continued for another 48 hours.
- the culture supernatant was transferred to an eppendorf sample tube and centrifuged to remove floating cells, and then this stock solution was used as it was for EIA assay EIA was performed according to the competition method described in Example 16 ( Figure 17).
- Example 31 it was confirmed that the immunoreactive human polypeptide was secreted and expressed in the culture supernatant of COS-7 cells.In order to confirm this biological activity, it was carried out using the undiluted culture supernatant. By the method shown in Example 17, the effect of promoting intracellular cAMP production on THP-1 cells was observed (FIG. 18).
- the polypeptide of the present invention and DNA encoding the same include, for example, metabolic regulation of energy sources such as carbohydrates (sugar metabolism, lipid metabolism, etc.) abnormalities (eg, diabetes, etc.), growth, proliferation, differentiation inhibition, and reproduction of tissues. Functional decline, connective tissue dysplasia (eg scleroderma, etc.), tissue fibrosis (eg, cirrhosis' pulmonary fibrosis, scleroderma or renal fibrosis, etc.), cardiovascular disorders (peripheral artery disease, It can be used for diagnosis, treatment, and prevention of various diseases such as endocrine disorders, abnormal fluid balance, central nervous system diseases and allergic diseases such as allergies, and angiogenesis disorders.
- energy sources such as carbohydrates (sugar metabolism, lipid metabolism, etc.) abnormalities (eg, diabetes, etc.), growth, proliferation, differentiation inhibition, and reproduction of tissues. Functional decline, connective tissue dysplasia (eg scleroderma, etc.), tissue fibrosis (eg,
- polypeptide of the present invention is useful as a reagent for screening a compound that promotes or inhibits the activity of the polypeptide of the present invention or a salt thereof. Furthermore, since the antibody against the polypeptide of the present invention can specifically recognize the polypeptide of the present invention, it may be used for detection, quantification, neutralization, etc. of the polypeptide of the present invention in a test solution. Can be.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Endocrinology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Diabetes (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Heart & Thoracic Surgery (AREA)
- Neurology (AREA)
- Cardiology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP01921950A EP1283260A4 (en) | 2000-04-21 | 2001-04-20 | POLYPEPTIDES OF THE INSULIN / IGF / RELAXIN FAMILY AND THEIR DNA |
| KR1020027014048A KR20020093053A (ko) | 2000-04-21 | 2001-04-20 | 신규 인슐린/igf/릴랙신 패밀리 폴리펩티드 및 그의dna |
| US10/257,848 US7049403B2 (en) | 2000-04-21 | 2001-04-20 | Insulin/IGF/relaxin family polypeptides and DNAS thereof |
| AU4880901A AU4880901A (en) | 2000-04-21 | 2001-04-20 | Novel insulin/igf/relaxin family polypeptides and dnas thereof |
| AU2001248809A AU2001248809B2 (en) | 2000-04-21 | 2001-04-20 | Novel insulin/IGF/relaxin family polypeptides and DNAs thereof |
| CA002406855A CA2406855A1 (en) | 2000-04-21 | 2001-04-20 | Novel insulin/igf/relaxin family polypeptides and dnas thereof |
| US11/284,367 US7410641B2 (en) | 2000-04-21 | 2005-11-21 | Antibodies to insulin/IGF/relaxin family polypeptides |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2000126340 | 2000-04-21 | ||
| JP2000-126340 | 2000-04-21 | ||
| JP2000-205587 | 2000-07-03 | ||
| JP2000205587 | 2000-07-03 | ||
| JP2000247962 | 2000-08-10 | ||
| JP2000-247962 | 2000-08-10 | ||
| JP2000-395050 | 2000-12-22 | ||
| JP2000395050 | 2000-12-22 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10257848 A-371-Of-International | 2001-04-20 | ||
| US11/284,367 Division US7410641B2 (en) | 2000-04-21 | 2005-11-21 | Antibodies to insulin/IGF/relaxin family polypeptides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2001081562A1 true WO2001081562A1 (en) | 2001-11-01 |
Family
ID=27481250
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2001/003399 Ceased WO2001081562A1 (en) | 2000-04-21 | 2001-04-20 | Novel insulin/igf/relaxin family polypeptides and dnas thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US7049403B2 (https=) |
| EP (1) | EP1283260A4 (https=) |
| JP (1) | JP4841054B2 (https=) |
| KR (1) | KR20020093053A (https=) |
| CN (1) | CN1633498A (https=) |
| AU (2) | AU2001248809B2 (https=) |
| CA (1) | CA2406855A1 (https=) |
| WO (1) | WO2001081562A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1434599A4 (en) * | 2001-10-08 | 2006-09-20 | Florey Howard Inst | HUMAN RELAXINE 3 |
| JP2008512091A (ja) * | 2004-08-25 | 2008-04-24 | ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ | リラキシンキメラポリペプチドならびにそれらの製造法および使用 |
| WO2008094437A3 (en) * | 2007-01-30 | 2008-11-06 | Janssen Pharmaceutica Nv | Chimeric peptide antagonist for gpcr135 or gpcr142 |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU9261901A (en) * | 2000-09-13 | 2002-03-26 | Smithkline Beecham Corp | Novel compounds |
| JP2007524371A (ja) * | 2003-03-04 | 2007-08-30 | ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ | レラキシン3−gpcr135複合体ならびにそれらの生産及び使用 |
| US7638490B2 (en) | 2004-02-09 | 2009-12-29 | Eisai R&D Managment Co., Ltd. | Methods of affecting feeding and weight in mammals by administration of relaxin-3 |
| US20100161366A1 (en) * | 2008-12-19 | 2010-06-24 | Achim Clemens | Product requirement specification in production model |
| US9767495B2 (en) * | 2008-12-19 | 2017-09-19 | Sap Se | Different sales and planning product options |
| CN116773828B (zh) | 2023-08-21 | 2023-10-31 | 成都大熊猫繁育研究基地 | 一种大熊猫rln3酶联免疫检测方法及单克隆抗体 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999015664A1 (en) * | 1997-09-24 | 1999-04-01 | Genentech, Inc. | Insulin-like polypeptide and uses therefor |
| WO2000021996A2 (en) * | 1998-10-13 | 2000-04-20 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| WO2000032221A2 (en) * | 1998-12-01 | 2000-06-08 | Genentech, Inc. | Promotion or inhibition of angiogenesis and cardiovascularization |
| WO2000047776A2 (en) * | 1999-02-12 | 2000-08-17 | Zymogenetics, Inc. | Insulin-family homolog localized to chromosome 1 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990013659A1 (en) * | 1989-05-04 | 1990-11-15 | Genentech, Inc. | Processes and compositions for the isolation of human relaxin |
| US20020012967A1 (en) * | 2000-03-10 | 2002-01-31 | Holloway James L. | Insulin homolog polypeptide zins4 |
| AU2001236817A1 (en) * | 2000-03-10 | 2001-09-24 | Zymogenetics Inc. | Insulin homolog polypeptide zins4 |
| AU9261901A (en) | 2000-09-13 | 2002-03-26 | Smithkline Beecham Corp | Novel compounds |
-
2001
- 2001-04-20 AU AU2001248809A patent/AU2001248809B2/en not_active Ceased
- 2001-04-20 CA CA002406855A patent/CA2406855A1/en not_active Abandoned
- 2001-04-20 JP JP2001123210A patent/JP4841054B2/ja not_active Expired - Fee Related
- 2001-04-20 CN CNA018110762A patent/CN1633498A/zh active Pending
- 2001-04-20 AU AU4880901A patent/AU4880901A/xx active Pending
- 2001-04-20 US US10/257,848 patent/US7049403B2/en not_active Expired - Fee Related
- 2001-04-20 KR KR1020027014048A patent/KR20020093053A/ko not_active Withdrawn
- 2001-04-20 WO PCT/JP2001/003399 patent/WO2001081562A1/ja not_active Ceased
- 2001-04-20 EP EP01921950A patent/EP1283260A4/en not_active Ceased
-
2005
- 2005-11-21 US US11/284,367 patent/US7410641B2/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999015664A1 (en) * | 1997-09-24 | 1999-04-01 | Genentech, Inc. | Insulin-like polypeptide and uses therefor |
| WO2000021996A2 (en) * | 1998-10-13 | 2000-04-20 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
| WO2000032221A2 (en) * | 1998-12-01 | 2000-06-08 | Genentech, Inc. | Promotion or inhibition of angiogenesis and cardiovascularization |
| WO2000047776A2 (en) * | 1999-02-12 | 2000-08-17 | Zymogenetics, Inc. | Insulin-family homolog localized to chromosome 1 |
Non-Patent Citations (6)
| Title |
|---|
| ERIKA E. BULLESBACH ET AL.: "Isolation, purification and the sequence of relaxin from spiny dogfish (squalus acanthias)", EUR J. BIOCHEM., vol. 161, 1986, pages 335 - 341, XP002943482 * |
| JOHN HALEY ET AL.: "Porcine relaxin gene structure and expression", J. BIOL. CHEM., vol. 262, no. 26, 1987, pages 11940 - 11946, XP002943484 * |
| L.K. GOWAN ET AL.: "On the primary and tertiary structure of relaxin from the sand tiger shark (odontaspis taurus)", FEBS LETT., vol. 129, no. 1, 1981, pages 80 - 82, XP002943483 * |
| ROBERT JAMES, HUGH NIALL: "Primary structure of porcine relaxin: homology with insulin and related growth factors", NATURE, vol. 267, no. 9, 1977, pages 544 - 546, XP002943485 * |
| S. BERGER ET AL.: "Statistical approach for evolutionary relationship of alpha - conotoxins and members of insulin-superfamily", HORM. METAB. RES., vol. 28, 1996, pages 535 - 540, XP002943486 * |
| See also references of EP1283260A4 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1434599A4 (en) * | 2001-10-08 | 2006-09-20 | Florey Howard Inst | HUMAN RELAXINE 3 |
| JP2008512091A (ja) * | 2004-08-25 | 2008-04-24 | ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ | リラキシンキメラポリペプチドならびにそれらの製造法および使用 |
| WO2008094437A3 (en) * | 2007-01-30 | 2008-11-06 | Janssen Pharmaceutica Nv | Chimeric peptide antagonist for gpcr135 or gpcr142 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1283260A1 (en) | 2003-02-12 |
| EP1283260A4 (en) | 2004-08-18 |
| KR20020093053A (ko) | 2002-12-12 |
| US7410641B2 (en) | 2008-08-12 |
| JP4841054B2 (ja) | 2011-12-21 |
| US20060073567A1 (en) | 2006-04-06 |
| CN1633498A (zh) | 2005-06-29 |
| CA2406855A1 (en) | 2001-11-01 |
| AU2001248809B2 (en) | 2005-05-19 |
| AU4880901A (en) | 2001-11-07 |
| US20030158381A1 (en) | 2003-08-21 |
| JP2002345468A (ja) | 2002-12-03 |
| US7049403B2 (en) | 2006-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2002112772A (ja) | 新規ポリペプチドおよびそのdna | |
| WO2003099331A1 (fr) | Agents renforçateurs de la résistance à l'insuline | |
| WO2002053738A1 (fr) | Nouvelles proteines et adn correspondant | |
| WO2001081562A1 (en) | Novel insulin/igf/relaxin family polypeptides and dnas thereof | |
| WO2001044475A1 (fr) | Nouveau polypeptide et son adn | |
| WO2001002564A1 (fr) | Nouveau polypeptide et adn de ce polypeptide | |
| WO2001046415A1 (en) | Novel tachykinin-like polypeptides and use thereof | |
| WO2001046413A1 (fr) | Nouveau gene et utilisation | |
| WO2000071581A1 (fr) | Nouveau polypeptide | |
| JP4344408B2 (ja) | 新規タンパク質およびそのdna | |
| JP4579378B2 (ja) | 新規ポリペプチドおよびそのdna | |
| WO2002103018A1 (fr) | Nouveau polypeptide et son utilisation | |
| WO2001048203A1 (fr) | Nouvelle proteine et adn associe | |
| JP4320151B2 (ja) | 新規ポリペプチドおよびその用途 | |
| WO2000014226A1 (fr) | Nouvelle proteine et son procede de production | |
| WO2004007711A1 (ja) | 新規蛋白質およびその用途 | |
| JP2001029090A (ja) | 新規ポリペプチド | |
| JP2001299364A (ja) | 新規タンパク質およびそのdna | |
| JP2001149083A (ja) | 新規ポリペプチドおよびそのdna | |
| JP2001299362A (ja) | 新規ポリペプチドおよびそのdna | |
| WO2002016428A1 (fr) | Proteine de liaison a l'irap | |
| WO2003072780A1 (fr) | Nouvelles protéines, leurs adn et leur utilisation | |
| JPWO2000014226A1 (ja) | 新規タンパク質およびその製造法 | |
| JP2000053700A (ja) | 新規タンパク質およびそのdna | |
| JPWO2001002564A1 (ja) | 新規ポリペプチドおよびそのdna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 10257848 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2406855 Country of ref document: CA Ref document number: 1020027014048 Country of ref document: KR Ref document number: 2001248809 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001921950 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020027014048 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 018110762 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2001921950 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: JP |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2001248809 Country of ref document: AU |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 1020027014048 Country of ref document: KR |