WO2001075007A2 - Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075007A2 WO2001075007A2 PCT/CN2001/000268 CN0100268W WO0175007A2 WO 2001075007 A2 WO2001075007 A2 WO 2001075007A2 CN 0100268 W CN0100268 W CN 0100268W WO 0175007 A2 WO0175007 A2 WO 0175007A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- tyrosinase
- polynucleotide
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
- C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
- C12N9/0059—Catechol oxidase (1.10.3.1), i.e. tyrosinase
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, tyrosinase 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique
- Tyrosinase is a copper monomeric enzyme that catalyzes the hydroxylation of monophenols and the oxidation of o-diphenols. Tyrosine is found in both prokaryotes and eukaryotes, and is related to pigment synthesis, such as melanin and some other polyphenol compounds. Tyrosinase binds two copper atoms (CuA and CuB), and each copper atom is connected to three histidine residues. The sequence near these histidine residues is quite conserved. Such a structure is in serum It has also been found in vegetarians.
- Tyrosinase and some related proteins have two characteristic structures. The first is at the N-terminus and contains two histidine residues bound to a copper atom. Its sequence is HX (4, 5) -F- (LIVMFTP) -X- (FW) -HRX (2)-(LM) -X (3) -E; The second one is located in the center of the entire enzyme and contains a histidine residue bound to a copper atom. Its sequence is DPXF- (LIVMFYW) -X (2)-H-X (3) -I) (All tyrosinase and serotonin contain this sequence).
- the tyrosinase 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes Tyrosinase 15 protein, especially the amino acid sequence of this protein is identified.
- the isolation of the novel tyrosinase 15 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention It is an object of the present invention to provide isolated novel polypeptides-tyrosinase 15 and fragments, analogs and derivatives thereof.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a method for producing tyrosinase 15.
- Another object of the present invention is to provide an antibody against the polypeptide-tyrosinase 15 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide tyrosinase 15 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to tyrosinase 15 abnormalities.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a tyrosinase 15 protein, which comprises utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a tyrosinase 15 protein, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the present invention also relates to a pharmaceutical composition, which contains the polypeptide of the present invention or a mimic, activator, antagonist Antibiotics or inhibitors and pharmaceutically acceptable carriers.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of tyrosinase 15.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with tyrosinase 15, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to tyrosinase 15.
- Antagonist refers to a molecule that, when combined with tyrosinase 15, can block or regulate the biological or immunological activity of tyrosinase 15.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind tyrosinase 15.
- tyrosinase 15 refers to a change in the function of tyrosinase 15, including an increase or decrease in protein activity, Changes in binding properties and any other biological, functional or immune properties of tyrosinase 15.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify tyrosinase 15 using standard protein purification techniques. Essentially pure The tyrosinase 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the tyrosinase 15 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein L, (1990) Methods in emzumology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine Acid and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? It can specifically bind to the epitope of tyrosinase 15.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated tyrosinase 15 means that tyrosinase 15 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify tyrosinase 15 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the tyrosinase 15 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, tyrosinase 15, consisting essentially of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of tyrosinase 15.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the tyrosinase 15 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1092 bases, and its open reading frame 229-621 encodes 130 amino acids.
- this polypeptide has a similar expression profile with tyrosinase 14, and it can be inferred that this tyrosinase 15 has a similar function to tyrosinase 14.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturing agent, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° / »Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences is at least Crosses occur at 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding tyrosinase 15.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the tyrosinase 15 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- isolating the genome is the least common. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DNA or DM-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of tyrosinase 15 transcript levels; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the tyrosinase 15 gene.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a tyrosinase 15 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding a tyrosinase 15 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding tyrosinase 15 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. This Representative examples of these promoters are: l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a tyrosinase 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells such as fly S 2 or Sf 9
- animal cells such as CH0, COS or Bowes melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2
- transformation can also be performed by electroporation.
- the host is a eukaryote
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant tyrosinase 15 through conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of gene chip expression profiles of tyrosinase 15 and tyrosinase 14 of the present invention.
- the upper graph is a histogram of the expression profile of tyrosine 15 and the lower sequence is the histogram of the expression profile of tyrosinase 14.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of tyrosinase 15 isolated. 14kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- a Smart cDM cloning kit (purchased from Clontech) was used to orient the 00 ⁇ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ to form a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0039c07 was a new DM. Insert a cDNA fragment into the clone by synthesizing a series of primers Segments are measured in both directions.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5'- TTTAAGTAAAATTAAAAGTTTACA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of reaction volume containing 50 mraol / L KC1, 10 ⁇ l / L Tris-CI, (pH 8.5), 1.5 ⁇ l / L MgCi 2 , 200 ⁇ mol / L dNTP, lOpmol Primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- set 3-act in as a positive control and template blank as a negative control.
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159].
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, filter was placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant tyrosinase 15
- Priraer3 5,-CCCCATATGATGCTCCCACAGTGCATTTCATTT- 3, (Seq ID No: 5)
- Priraer4 5,-CATGGATCCCTACTCAGGAGGGTGAGGCAGGAG- 3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- the Nde I and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28 b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-0039c07 plasmid containing the full-length target gene as a template.
- PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS-0039c07 plasmid, primers Primer-3 and Primer-4, and 1 J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5CX, after (final concentration of 30 ⁇ 8 / ⁇ 1) grown overnight in LB plates containing kanamycin, positive clones were screened by colony PCR method, and sequenced. A positive clone (pET-0039c07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0039c07) was cultured at 37% 'to logarithmic growth phase, and IPTG was added to a final concentration of 1 leg ol / L. Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by ultrasonication. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain 6 histidine (6His-Tag). Purified the protein of interest tyrosinase 15.
- a peptide synthesizer (product of PE company) was used to synthesize the following tyrosinase 15-specific peptides:
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For the method, see: Avraraeas, et al. Immunocliemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. Titration plate coated with 15 g / ml bovine serum albumin peptide complex ELI SA was performed to determine the antibody titer in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- unhybridized probes are removed by a series of membrane washes.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- pre-hybridization solution 10xDenhardf s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA).
- Seal the bag and shake at 68 ° C in a water bath for 2 hour.
- Gene microarrays or DNA microarrays are currently used in many national laboratories and The companies are starting to develop and develop a new technology. It refers to arranging a large number of target gene fragments in an orderly and high density on a carrier such as glass and silicon, and then using fluorescence detection and computer software to compare and analyze the data. In order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRisi, JL, Lyer, V. & Brown, P.0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic apparatus. After elution, the DNA was fixed on a glass slide to prepare a chip.
- the specific method steps have been variously reported in the literature, and the post-spotting processing steps of this embodiment are:
- Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a wash solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000 The scanner (purchased from General Scanning Company, USA) was used for scanning. The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Tyrosinase is a copper monomeric enzyme that catalyzes the hydroxylation of monophenols and the oxidation of o-diphenols. Tyrosinase is ubiquitous in eukaryotes, and it is related to pigment synthesis, such as melanin and some other polyphenol compounds. In addition, the specific sequence structure of tyrosinase exists in tyrosinase and some related proteins, such as serotonin. Serotonin can raise blood pressure through its receptors to increase blood pressure; Angiotensin can promote platelets to secrete more angiotensin through platelet aggregation; Tryptophan enters the brain and is converted into serotonin with sedative effect, which helps Treatment of depression.
- Tyrosinase is a copper monomeric enzyme that catalyzes the hydroxylation of monophenols and the oxidation of o-diphenols. Tyrosinase is ubiquitous in eukaryotes, and it is related to pigment synthesis, such as melanin and some other polyphenol compounds. In addition, the specific sequence structure of tyrosinase exists in tyrosinase and some related proteins, such as serotonin.
- the abnormal expression of the specific tyrosinase motif will cause the dysfunction of the polypeptide containing the motif of the present invention, resulting in abnormal tyrosine metabolism and related diseases such as tyrosine metabolism deficiency disease, Melanoma, congenital iris abnormalities, etc.
- the abnormal expression of the specific tyrosinase motif will also lead to abnormal serotonin function, which is related to blood pressure, depression, and anxiety.
- tyrosinase 15 of the present invention will produce various diseases, especially tyrosine Metabolic Defects, Melanoma, Congenital Iris Abnormalities, Cardiovascular Diseases, Mental Illnesses
- diseases include but are not limited to: transient neotyrosinemia in newborns, acute tyrosinemia, subacute and chronic tyrosine Acidemia, Albinism, Melanoma, Melanoma, Heterochromia, Hypertension, Coronary Heart Disease, Heart Failure, Depression, Anxiety, Neurodegeneration, Schizophrenia, Paranoia, OCD, Fear disease
- the abnormal expression of the tyrosinase 15 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) tyrosinase 15.
- Agonists enhance biological functions such as tyrosinase 15 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing tyrosinase 15 can be cultured together with labeled tyrosinase 15 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of tyrosinase 15 include antibodies, compounds, receptor deletions, and the like that have been screened.
- An antagonist of tyrosinase 15 can bind to tyrosinase 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform a biological function.
- tyrosinase 15 When screening compounds as antagonists, tyrosinase 15 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between tyrosinase 15 and its receptor. In the same manner as described above for screening compounds, receptor deletions and analogs that act as antagonists can be screened. Polypeptide molecules capable of binding to tyrosinase 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, tyrosine-to-15 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a tyrosinase 15 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting tyrosinase 15 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to tyrosinase 15 include, but are not limited to, hybridoma technology (Kohler and Milstei n. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against tyrosinase 15.
- Anti-tyrosinase 15 antibody can be used in immunohistochemistry to detect tyrosine in biopsy specimens Acidase 15.
- Monoclonal antibodies that bind to tyrosinase 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- tyrosinase 15 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill tyrosinase 15 positive cells .
- the antibodies of the present invention can be used to treat or prevent diseases related to tyrosinase 15. Administration of an appropriate amount of antibody can stimulate or block tyrosinase 15 production or activity.
- the invention also relates to a diagnostic test method for quantitative and localized detection of tyrosinase 15 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of tyrosine 15 measured in the test can be used to explain the importance of tyrosinase 15 in various diseases and to diagnose diseases in which tyrosinase 15 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding tyrosinase 15 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormalities in cell proliferation, development, or metabolism caused by non- or abnormal / inactive expression of tyrosinase 15.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated tyrosinase 15 to inhibit endogenous tyrosinase 15 activity.
- a variant tyrosinase 15 may be a shortened tyrosinase 15 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signal transduction activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of tyrosinase 15.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding tyrosinase 15 into a cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a tyrosinase 15 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding tyrosinase 15 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit tyrosinase 15 raRNA are also present W 1
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter.
- nucleic acid molecule In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- Polynucleotides encoding tyrosinase 15 are useful in the diagnosis of diseases related to tyrosinase 15.
- a polynucleotide encoding tyrosinase 15 can be used to detect the expression of tyrosinase 15 or the abnormal expression of tyrosinase 15 in a disease state.
- a DNA sequence encoding tyrosinase 15 can be used to hybridize biopsy specimens to determine the expression of tyrosinase 15.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Micr oar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis.
- a microarray Merix oar ray
- a DNA chip also known as a "gene chip”
- Tyrosinase 15 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect tyrosinase 15 transcripts.
- Detection of mutations in the tyrosinase 15 gene can also be used to diagnose tyrosinase-related diseases.
- Forms of tyrosinase 15 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type tyrosinase 15 DNA sequences. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35 bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific C wake library.
- Fluorescent in situ hybridization of cDM clones to metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Tyrosinase 15 is administered in an amount effective to treat and / or prevent a particular indication.
- the amount and dose range of tyrosinase 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU46308/01A AU4630801A (en) | 2000-03-02 | 2001-02-26 | A novel polypeptide, a tyrosinase 15 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111823 CN1311303A (zh) | 2000-03-02 | 2000-03-02 | 一种新的多肽——酪氨酸酶15和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075007A2 true WO2001075007A2 (fr) | 2001-10-11 |
WO2001075007A3 WO2001075007A3 (fr) | 2002-02-07 |
Family
ID=4581719
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000268 WO2001075007A2 (fr) | 2000-03-02 | 2001-02-26 | Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1311303A (zh) |
AU (1) | AU4630801A (zh) |
WO (1) | WO2001075007A2 (zh) |
-
2000
- 2000-03-02 CN CN 00111823 patent/CN1311303A/zh active Pending
-
2001
- 2001-02-26 WO PCT/CN2001/000268 patent/WO2001075007A2/zh active Application Filing
- 2001-02-26 AU AU46308/01A patent/AU4630801A/en not_active Abandoned
Non-Patent Citations (3)
Title |
---|
BIOCHEM. BIOPHYS. RES. COMMUN. vol. 164, no. 3, 1989, pages 990 - 996 * |
J. DERMATOL. SCI. vol. 3, no. 3, 1992, pages 181 - 185 * |
PIGMENT CELL RES. vol. 5, 1992, pages 274 - 278 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001075007A3 (fr) | 2002-02-07 |
CN1311303A (zh) | 2001-09-05 |
AU4630801A (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001075007A2 (fr) | Nouveau polypeptide, tyrosinase 15, et polynucléotide codant pour ce polypeptide | |
WO2001073062A1 (fr) | Nouveau polypeptide, antigene prostatique specifique membranaire 18, et polynucleotide codant pour ce polypeptide | |
WO2001048168A1 (fr) | Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide | |
WO2001072815A1 (fr) | Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001075117A1 (fr) | Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001053492A1 (fr) | Nouveau polypeptide, s-adenosylmethionine synthetase 31, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001092541A1 (fr) | Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide | |
WO2001087943A1 (fr) | Protease a serine 13 atp-dependante, polypeptide humain, et polynucleotide le codant | |
WO2001094593A1 (fr) | Nouveau polypeptide, glycero-3-phosphate deshydrogenase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001046431A1 (fr) | Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide | |
WO2001046430A1 (fr) | Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide | |
WO2001070785A1 (fr) | Nouveau polypeptide, serine proteinase humaine atp-dependante 13, et polynucleotide codant pour ce polypeptide | |
WO2001071001A1 (fr) | Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001049732A1 (fr) | Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide | |
WO2001090164A1 (fr) | Nouveau polypeptide, tyrosinase humaine 9, et polynucleotide codant ce polypeptide | |
WO2001087970A1 (fr) | Polypeptide de tyrosinase 12 humaine, et polynucleotide le codant | |
WO2001075030A2 (en) | A novel polypeptide - human tyrosinase 11 and the polynucleotide encoding said polypeptide | |
WO2001079430A2 (en) | A novel polypeptide - human serine protease 9 and the polynucleotide encoding said polypeptide | |
WO2001046253A1 (fr) | Nouveau polypeptide, calcitonine 11, et polynucleotide codant pour ce polypeptide | |
WO2001070795A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001070779A1 (fr) | Nouveau polypeptide, proteine humaine 12 de type cdc4, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |