WO2001072294A2 - Method of treating hepatitis delta viral infection - Google Patents

Method of treating hepatitis delta viral infection Download PDF

Info

Publication number
WO2001072294A2
WO2001072294A2 PCT/US2001/009987 US0109987W WO0172294A2 WO 2001072294 A2 WO2001072294 A2 WO 2001072294A2 US 0109987 W US0109987 W US 0109987W WO 0172294 A2 WO0172294 A2 WO 0172294A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
hepatitis
compound
nucleoside
host
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/009987
Other languages
English (en)
French (fr)
Other versions
WO2001072294A3 (en
Inventor
John L. Casey
Brent E. Korba
Paul J. Cote
John L. Gerin
Bud C. Tennant
Chung K. Chu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Georgia Research Foundation Inc
Cornell Research Foundation Inc
Georgetown University
Original Assignee
University of Georgia Research Foundation Inc
Cornell Research Foundation Inc
Georgetown University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IL15198101A priority Critical patent/IL151981A0/xx
Application filed by University of Georgia Research Foundation Inc, Cornell Research Foundation Inc, Georgetown University filed Critical University of Georgia Research Foundation Inc
Priority to AU2001249564A priority patent/AU2001249564A1/en
Priority to EP01922803A priority patent/EP1284720B1/en
Priority to BR0109716-4A priority patent/BR0109716A/pt
Priority to KR1020027012957A priority patent/KR100893549B1/ko
Priority to JP2001570255A priority patent/JP2003528138A/ja
Priority to DE60123042T priority patent/DE60123042T2/de
Priority to CA002405502A priority patent/CA2405502A1/en
Publication of WO2001072294A2 publication Critical patent/WO2001072294A2/en
Publication of WO2001072294A3 publication Critical patent/WO2001072294A3/en
Anticipated expiration legal-status Critical
Priority to CY20061101613T priority patent/CY1105768T1/el
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/576Immunoassay; Biospecific binding assay; Materials therefor for hepatitis
    • G01N33/5765Hepatitis delta antigen
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A61K31/7072Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid having two oxo groups directly attached to the pyrimidine ring, e.g. uridine, uridylic acid, thymidine, zidovudine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • C12N2310/3125Methylphosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates

Definitions

  • This invention is in the area of methods and compositions for the treatment of a host infected with hepatitis delta virus (also referred to as "HDN”) that includes administering an effective amount of a compound, in particular a nucleoside or nucleoside analog, that substantially reduces the level of hepatitis B surface antigen.
  • a compound in particular a nucleoside or nucleoside analog
  • the nucleoside analog is 2'-fluoro-5-methyl- ⁇ -L- arabinofuranosyl-uridine (also referred to as "L-FMAU”) or a pharmaceutically acceptable salt or prodrug thereof.
  • Type D hepatitis the most severe form of viral hepatitis, is caused by infection with hepatitis D (delta) virus (HDN), a sub-viral satellite of hepatitis B virus (HBN) (Smedile, A., et al. (1994) Prog Liver Dis 12, 157-75).
  • HDN hepatitis D
  • HBN hepatitis B virus
  • Chronic type D hepatitis is typically characterized by necroinflammatory lesions, similar to chronic HBN infection, but is more severe, and frequently progresses rapidly to cirrhosis and liver failure, accounting for the disproportionate association of chronic HDN infection with terminal liver disease (Smedile, A., et al. (1994) Prog Liver Dis 12, 157-75; Rizzetto, M., et al. (1983) Ann Intern Med 98, 437-41).
  • HDN infection affects fewer individuals than HBN alone, the resulting acute or chronic liver failure is a common indication for liver transplantation in Europe as well as North America (Smedile, A. & Rizzetto, M. (1992) bit J Clin Lab Res 22, 211-215; Wright, T.
  • liver transplantation is the only option for the associated end-stage liver disease.
  • interferon alpha has been moderately successful in treating some cases of type D hepatitis, the need for better treatment options is indicated by the very high doses required, variable responses, frequent relapse after cessation of treatment, and difficulties in drug administration (Thomas, H. C. et al. (1987) Prog Clin Biol Res 234, 277-90; Hoofnagle, J. et al. (1987) Prog Clin Biol Res 234, 291-8; Rosina, F.et al. (1987) Prog Clin Biol Res 234, 299-303; Rosina, F. et al.
  • Lamivudine ( ⁇ -L-2',3'-dideoxy-3'-thiacytidine, 3TC) is a synthetic nucleoside shown to be effective in treating HIN and HBN infection. See U.S. Patent No. 5,539,116 to Liotta et al. Lamivudine is known to cause sustained suppression of HBN replication during treatment ( ⁇ evens, F. et al. (1997) Gastroenterology 113:1258-1263). However, lamivudine does not improve disease activity or lower HDN-R ⁇ A levels in patients with chronic delta hepatitis (Lau, D. T.et al. (1999) Hepatology 30, 546-9). Lamivudine was recently approved in the U.S.
  • the HDN virion is composed of a ribonucleoprotein core and an envelope.
  • the core contains HDN-R ⁇ A, and hepatitis delta antigen (HDAg), which is the only protein encoded by this virus. (Wang, K. S. et al. (1986) Nature 323, 508-14).
  • the envelope is formed by the surface antigen protein (hepatitis B surface antigen, or
  • HBsAg of the helper virus, hepatitis B.
  • the envelope is the sole helper function provided by HBN.
  • HDN is able to replicate its R ⁇ A within cells in the absence of HBN (Kuo, M. Y. et al. (1989) J Virol 63, 1945-50), but requires HBsAg for packaging and release of HDN virions (Wu, J. C. et al.
  • WHN can support HDN particle formation and infection, and the eastern woodchuck has been a useful model for HDN infection (Negro, F. et al. (1989) J Virol 63, 1612-8; Parana, R., Gerard, F., Lesbordes, J. L., Pichoud, C, Nitvitski, L., Lyra, L. G.
  • HBN and other representatives of this family of viruses are unique in that the process of replicating genomic copies of the virus and the production of viral proteins (for example, HBN or WHN surface antigens) are differentially regulated (Ganem, D. 1996. Hepadnaviridae. In “Fields Virology", Fields B ⁇ , Knipe DM, Howley P, ed. Lippincott-Raven, Philadelphia, p. 2703-2737).
  • antiviral agents such as synthetic nucleosides (for example, lamivudine) which target viral polymerases, may significantly inhibit HBN replication (for example, as measured by a reduction in viremia), but not affect the level of viral rnR ⁇ A or viral protein production (for example, as measured by the levels of HBN surface antigen in plasma or serum).
  • synthetic nucleosides for example, lamivudine
  • viral protein production for example, as measured by the levels of HBN surface antigen in plasma or serum.
  • U.S. Pat. No. 5,747,044 discloses recombinanfly produced immunogenic HDN polypeptides useful as vaccines.
  • U.S. Pat. No. 5,932,219 to Chiron discloses the entire genome of the hepatitis D virus, a family of cDNA replicas of the entire HDN genome, and teaches that portions of these cD ⁇ A sequences are useful as probes to diagnose the presence of virus in clinical samples.
  • the patent also discloses proteins encoded by the cD ⁇ A that are useful in the production of vaccines.
  • the '219 patent discloses a vaccine for hepatitis D which incorporates the p24 and p27 viral polypeptides.
  • U.S. Patent No. 5,750,350 to Chiron claims a kit useful in the analysis of hepatitis D virus which includes a peptide encoded by ORF 5 of the HDN genome.
  • U.S. Patent No. 5,747,044 claims a recombinanfly produced immunogenic particle which raises antibodies against HDN, wherein the particle includes an immunogenic polypeptide encoded within ORF 5 of the HDN nucleotide
  • U.S. Pat. No. 6,020,167 assigned to Medeva Holdings B.V. discloses a method for treating chronic hepatitis, and in particular, hepatitis B, that includes administering a composition containing antiHBsAg.
  • U.S. Pat. No. 5,770,584 discloses a method for treating hepatitis virus infection by administering alkyl lipids or alkyl lipid derivatives.
  • U.S. Patent No. 4,619,896 discloses a process for unmasking delta antigen in the blood of an animal, that includes treating serum with a surfactant and optionally with an antibody-antigen dissociating agent.
  • the blood derived delta antigen is used as a diagnostic agent in the detection and determination of different classes of antibodies to hepatitis D virus.
  • United States statutory invention registration HI, 345 discloses a method for preventing or treating hepatitis virus by administering a protein-prenyl transferase inhibitor.
  • HDV particles produced in vitro are infectious and that (i) infectious particles are coated with HBV envelope proteins that contain the pre-Sl and pre-S2 regions, (ii) epitopes of the pre-Sl and pre-S2 domains of HBV envelope proteins are exposed at the surface of HDV particles, and (iii) that antibodies directed against those epitopes have neutralizing activity against HDV.
  • L-FMAU [2'-fluoro-5-methyl- ⁇ -L-arabinofuranosyl- uridine] is a known compound and has been shown to have significant antiviral activity against HBV replication in cell culture, and against the related duck hepatitis B virus in both cell culture and infected ducks
  • U.S. Pat. Nos. 5,587,362 and WO 95/20595 to Chu et al. disclose and claim L-FMAU and its pharmaceutical compositions for the treatment of HBV, and provides a detailed description of the synthesis of the compound.
  • U.S. Patent No. 5,567,688 to Chu et al. claims a method for the treatment of HBV using L-nucleosides including L- FMAU.
  • U.S. Patent No. 5,565,438 to Chu et al. claims a method to treat humans infected with Epstein-Barr virus (EBV) with L-FMAU.
  • EBV Epstein-Barr virus
  • L-FMAU discloses the use of L-FMAU to stabilize an oligonucleotide by including the compound at the 5 '-terminus, 3 '-terminus, or the interior of the oligonucleotide.
  • WO 98/15375 discloses a method for the manufacture of L-FMAU.
  • L-FMAU has been shown to be a remarkably potent and fast-acting antiviral agent against WHV replication in chronically-infected woodchucks (Korba, B. et al. (1999) Antivir. Res. 41, A54; Chu, C. et al. (1998) in Therapies for viral hepatitis, eds. Schinazi, R.
  • L-FMAU has been shown to have a favorable pharmacokinetic profile and sufficient oral bioavailability in rats and woodchucks that make it suitable for once daily administration (Wright, J. D. et al. (1995) Pharm Res 12, 1350-3; Wright, L D. et al. (1996) Biopharm DrugDispos 17, 197-207; Witcher, 1 W. et al. (1997) Antimicrob Agents Chemother 41, 2184-7).
  • hepatitis delta virus infection Because of the large number of persons infected with hepatitis delta virus, the devastating effects of hepatitis delta virus infection on the individual, and the lack of effective treatments, there is a critical need for new and effective methods and compositions for the treatment of hepatitis delta virus infection. Therefore, it is an object of the present invention to provide methods and compositions for the treatment of a host, including a human, infected with hepatitis delta virus.
  • HBsAg hepatitis B surface antigen
  • nucleoside or nucleoside analog reduces the hepatitis B surface antigen at least approximately 100- fold or more, and preferably, 200- or 500-fold relative to pretreatment values in vivo or in vitro, or to not more than 1, and preferably, 0.5 or 0.1 microgram per milliliter in vivo, as measured in serum or plasma using any appropriate standard immunoassays for example the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P. J., C. Roneker, K. Cass, F. Schodel, D. Peterson, B. Tennant, F. DeNoronha, and J. Germ. 1993.)
  • nucleoside or nucleoside analog does not significantly reduce the level of HBsAg in a hepatitis delta infected host, for example, 3TC ( ⁇ -L-2',3'-dideoxy-3'-thiacytidine), then that nucleoside is not effective in the treatment of hepatitis delta virus.
  • 3TC ⁇ -L-2',3'-dideoxy-3'-thiacytidine
  • a method for the treatment of HDN infected host in particular a human, includes the administration of an effective amount of a nucleoside or nucleoside analog that reduces HBsAg in the infected host at least approximately 100-fold, and preferably 200- or 500- fold, or more relative to pretreatment values in vivo or in vitro; or to not more than approximately 1 microgram, or preferably 0.5 or 0.1 microgram, per milliliter, as measured in serum or plasma using standard immunoassays (such as the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories) or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P. J., C. Roneker, K. Cass, F. Schodel, D. Peterson, B. Tennant, F. De ⁇ oronha, and J. Germ. 1993.
  • standard immunoassays such as the commercial assay for human HBsA
  • nucleoside or nucleoside analog that substantially reduces the level of preSl antigen in a host is useful in the treatment of hepatitis delta viral infection in that host.
  • substantial reduction of preSl antigen in a host it is meant that the nucleoside or nucleoside analog reduces the hepatitis B surface antigen at least approximately 100-fold or more, and preferably, 200- or 500-fold relative to pretreatment values in vivo or in vitro, using any appropriate assay, including that in: Deepen R, Heermann KH, Uy A, Thomssen R, Gerlich WH. "Assay of preS epitopes and preS 1 antibody in hepatitis B virus carriers and immune persons.” Med Microbiol Immunol (Berl). 1990;179(l):49-60.
  • a method for the treatment of an HDN infected host in particular a human, includes the administration of an effective amount of an organic non-nucleoside small molecule (i.e., a molecule of molecular weight less than 500, which is other than a biologic material found in nature or a derivative or analog thereof retaining the desired activity, such as a peptide, protein, antibody, hormone, ribozyme, nucleic acid, or cytokine), and which is not a protein-prenyl transferase inhibitor or thymosin-alpha-1, that reduces HBsAg in the infected host to at least approximately 100-fold or more, and preferably at least 200- or 500-fold, relative to pretreatment values in vivo or in vitro; or to not more than 1 microgram, preferably 0.5 or 0.1 microgram per milliliter, as measured in serum or plasma using any appropriate assay, including standard immunoassays (such as the commercial assay for human HBsA
  • an effective amount of L-FMAU or a pharmaceutically acceptable salt or prodrug thereof is administered to a host in need thereof to treat a hepatitis delta viral infection.
  • L-FMAU is administered to a host in need thereof in the absence of its corresponding ⁇ -D enantiomer (i.e., in an enantiomerically enriched or enantiomerically pure form).
  • L-FMAU is administered in combination with at least one other HBsAg or preS 1 antigen lowering agent, which can be another nucleoside, a nucleoside analog or a non-nucleoside for the treatment of a hepatitis delta infected host.
  • the hepatitis delta treating agent is administered in combination with a agent that has activity against hepatitis B, whether or not the anti- hepatitis B agent lowers the hepatitis B surface antigen.
  • a method for treating hepatitis delta includes administering a compound, including a nucleoside, nucleoside analog or other small molecule as defined herein, that reduces the surface antigen of a hepadnavirus other than hepatitis B that supports HDN infection.
  • a method for screening a compound, including a nucleoside or a nucleoside analog, that is effective in the treatment of HDN infection includes assessing whether the compound suppresses the expression of hepatitis B surface antigen 100-fold or more (and preferably 200- or 500-fold) relative to pretreatment values in vivo or in vitro; and preferably, to not more than 1 microgram (and preferably 0.5 or 0.1 microgram) per milliliter, as measured in serum or plasma using standard immunoassays (such as the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories) or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P. J., C. Roneker, K. Cass, F. Schodel, D. Peterson, B. Tennant, F. De ⁇ oronha, and J. Gerin. 1993, using methods provided herein or otherwise available.
  • standard immunoassays such
  • a method for screening a compound, including a nucleoside or a nucleoside analog, that is effective in the treatment of HDN infection includes assessing whether the compound suppresses the expression of hepatitis B surface antigen 100-fold or more (and preferably 200- or 500-fold) relative to pretreatment values in vivo or in vitro; or to not more than 1 microgram (and preferably 0.5 or 0.1 microgram) per milliliter, as measured in serum or plasma using standard immunoassays (such as the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories) or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P.
  • standard immunoassays such as the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories) or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P.
  • a method for screening a compound, including a nucleoside or a nucleoside analog, that is effective in the treatment of HDN infection includes assessing whether the compound suppresses the expression of preSl surface antigen 100-fold or more (and preferably 200- or 500-fold) relative to pretreatment values as measured in serum or plasma using standard immunoassays.
  • the invention is based on the fundamental discovery that L-FMAU, as the model active compound, suppresses the expression of hepatitis B surface antigen by a sufficient amount that it effectively inhibits the packaging and release of HDN virions.
  • L-FMAU causes a substantial decrease in levels of HDN viremia by suppressing the expression of hepatitis B surface antigen.
  • HDN infection can be treated in a host by administering at least one antisense oligonucleotide targeted to the R ⁇ A transcript of the hepatitis B surface antigen or preSl antigen either alone or in combination with L- FMAU, or another HBsAg or preSl antigen lowering nucleoside or nucleoside analog.
  • oligonucleotide encompasses both oligomeric nucleic acid moieties of the type found in nature, such as the deoxyribonucleotide and ribonucleoti.de structures of D ⁇ A and R ⁇ A, and man-made analogues which are capable of binding to nucleic acids found in nature.
  • oligonucleotides of the present invention can be based upon ribonucleotide or deoxyribonucleotide monomers linked by phosphodiester bonds, or by analogues linked by methyl phosphonate, phosphorothioate, phosphoroamidate, phosphorodithioate, or other oligonucleotide stabilizing bonds. They may also comprise monomer moieties which have altered base structures or other modifications, but which still retain the ability to bind to naturally occurring D ⁇ A and R ⁇ A structures. Such oligonucleotides may be prepared by methods well-known in the art, for instance using commercially available machines and reagents available from Perkin-Elmer/ Applied Biosystems (Foster City, Calif.).
  • an antisense oligonucleotide targeting the HBN surface antigen or preS 1 gene sequence be chosen such that the oligonucleotide hybridizes within approximately 25 bases of the AUG start codon of the gene.
  • antisense oligonucleotides directed to the HBN surface antigen and preSl gene are described in U.S. Pat. No. 5,646,262 to Korba et al. and include (SEQ ID NO.: 1) CTTAGGACTACACTACAAGAG; (SEQ ID NO.: 2) GACTACACTACAAGAG; (SEQ ID NO.: 3) AGGACTACACTACAAGAGGTA; (SEQ LD NO.: 4)
  • TACACTACAAGAGGTA (SEQ LD NO.: 5) TCTTCCCCAGGATCCT; (SEQ ID NO.: 6) TTTGGGGCGGACATTG; (SEQ ID NO.: 7) CCTAAGAACAGTTGTT; (SEQ ID NO.: 8) GTACAAGTCGCGTCCCAGG; (SEQ ID NO.: 9) TAGGAGCTCTTCTAAC; (SEQ LD NO.: 10) TATTCCCTAGTCTTGT; (SEQ ID NO.: 11) CAAGAGGTACAAGTC; (SEQ LD NO.: 12)
  • FIG. 1 is an illustration of L-FMAU (2'-fluoro-5-methyl- ⁇ -L- arabinofuranosyl-uridine).
  • FIG. 2 is a schematic illustration of the preparation of l-O-acetyl-2,3,5-tri-O- benzoyl- ⁇ -L-ribofuranose (compound 10).
  • FIG. 3 is a schematic illustration of an alternative preparation of 1-O-acetyl- 2,3,5-tri-O-benzoyl- ⁇ -L-ribofuranose (compound 10).
  • FIG. 4 is a schematic illustration of a method for the preparation of 1,3,5-tri- O-benzoyl-2-deoxy-2-fluoro- ⁇ -L-arabinofuranose (compound 13).
  • FIG. 5 is an illustration of a method for the preparation of 5'-benzoyl protected and unprotected 2 , -deoxy-2'-fluoro- ⁇ -L-arabinofuranosyl]-5-methyl uridine (compounds 17-18).
  • FIG. 6 A is a line graph of weeks of treatment of L-FMAU in woodchucks versus genomic equivalents per ml of HDN R ⁇ A in serum and demonstrates the decrease in HDN R ⁇ A in HDN-infected woodchucks treated with L-FMAU over twenty weeks.
  • Woodchucks chronically infected with WHN were infected with a woodchuck-adapted HDN inoculum derived from a laboratory infectious clone. Chronicity was established by detectable HDN viremia for at least 74% of bleed dates for at least 11 months prior to the initiation of treatment. The results indicate that treatment with L-FMAU causes a significant decrease in serum HDN-R ⁇ A.
  • FIG. 6B is a line graph of weeks of treatment of L-FMAU in woodchucks versus woodchuck serum WHN-D ⁇ A in genomic equivalents per ml. Woodchucks chronically infected with WHN were infected with a woodchuck-adapted HDN inoculum derived from a laboratory infectious clone. Chronicity was established by detectable HDN viremia for at least 74% of bleed dates for at least 11 months prior to the initiation of treatment. The results indicate that treatment with L-FMAU causes a significant decrease in serum WHN-D ⁇ A.
  • FIG. 6C is a line graph of weeks of treatment of L-FMAU in woodchucks versus woodchuck serum WHsAg in ⁇ g/ml. Woodchucks chronically infected with WHN were infected with a woodchuck-adapted HDN inoculum derived from a laboratory infectious clone. Chronicity was established by detectable HDN viremia for at least 74% of bleed dates for at least 11 months prior to the initiation of treatment. The results indicate that treatment with L-FMAU causes a significant decrease in serum WHsAg.
  • FIG. 7 A is a line graph showing the presence of HDN R ⁇ A in the serum of HDN-infected woodchucks over twenty weeks in the absence of L-FMAU.
  • FIG. 7B is a line graph showing serum levels of WHN-D ⁇ A in woodchucks over twenty weeks in the absence of L-FMAU.
  • FIG. 7C is a line graph showing serum levels of WHsAg in woodchucks over twenty weeks in the absence of L-FMAU.
  • FIG. 8 is a line graph of mean serum HDN R ⁇ A in genomic equivalents per ml versus weeks. The graph compares the mean serum HDN level in the five untreated woodchucks (circle data points) with that of the L-FMAU treated woodchucks 4878, 4879, and 4883 (square data points), in which WHsAg levels dropped more than 100-fold during treatment (see Figure 6B). The graph shows a dramatic decline in HDN R ⁇ A in these three treated animals by 8 weeks of the treatment compared with the level in these same animals at the start of treatment and compared with levels in the five untreated animals at any time.
  • the present invention is a method for the treatment of hepatitis delta virus (HDN) infection in a host, in particular a human, by administration of an effective amount of a nucleoside or nucleoside analog or a prodrug or pharmaceutically acceptable salt thereof that provides a substantial and sustained reduction in the expression of hepatitis B surface antigen (HBsAg) or preSl antigen.
  • HBsAg hepatitis B surface antigen
  • preSl antigen preSl antigen
  • the present invention is based on the surprising discovery that compounds that provide a substantial and sustained reduction in the expression of hepatitis B surface antigen (HBsAg) or preSl antigen, including L-FMAU, are potent inhibitors of HDN replication.
  • L-FMAU is a particularly strong suppressor of hepatitis B surface antigen expression.
  • a host infected with hepatitis delta along with a hepadnavirus other than hepatitis B that supports HDN infection can be treated by substantially inhibiting the expression of surface antigen of that hepadnavirus.
  • a method of treating a host infected with HDN comprising the step of administering an effective amount of a nucleoside or nucleoside analog, or a pharmaceutical acceptable prodrug or salt thereof, optionally with pharmaceutically acceptable carrier, that substantially suppresses the expression of hepatitis B surface antigen or preSl antigen.
  • a method of treating a host infected with HDN comprising the step of administering an effective amount of L-FMAU, or a pharmaceutical acceptable prodrug or salt, optionally in a pharmaceutically acceptable carrier.
  • L-FMAU or another nucleoside or nucleoside analog acting in like manner, or a pharmaceutical acceptable prodrug or salt thereof, optionally in pharmaceutically acceptable carrier, is administered to a host in need thereof, in combination with at least one other compound that reduces the level of hepatitis B surface antigen or preS 1 antigen.
  • a method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDN infection comprising the steps of: a) administering a test compound to an animal model of hepatitis B virus, for example, the eastern woodchuck; b) monitoring the levels of hepatitis surface antigen or preSl antigen, as appropriate, expressed in the animal treated with the test compound; c) comparing the levels of hepatitis surface antigen or preSl antigen in animals treated with the test compound to control animals not treated with the test compound; d) selecting the compound in step (c) wherein the levels of hepatitis surface antigen or preSl antigen are significantly lower that the levels of hepatitis surface antigen in animals not treated with the test compound, and in a preferred embodiment, 100-fold or more relative to pretreatment values in vivo or in vitro; or to not more than 1 microgram per milliliter, as measured in serum or
  • a method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDN infection comprising the steps of: a) administering a test compound to a woodchuck chronically infected with woodchuck hepatitis virus and also infected with a woodchuck-adapted HDN inoculum; b) monitoring the levels of hepatitis surface antigen or preSl antigen expressed in the animal treated with the test compound; c) comparing the levels of hepatitis surface antigen or preSl antigen in animals treated with the test compound to control animals not treated with the test compound; d) selecting the compound in step (c) wherein the levels of hepatitis surface antigen or preSl antigen are significantly lower than the levels of hepatitis surface antigen in animals not treated with the test compound, and in a preferred embodiment, 100-fold or more relative to pretreatment values in vivo or in vitro, or to not more than
  • a compound should be selected in which there is a concurrent reduction in the levels of hepatitis surface antigen or preS 1 antigen and hepatitis D R ⁇ A in animals treated with the test compound.
  • a method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDN infection comprising the steps of: a) administering a test compound to an in vitro cell that has been transfected with human hepatitis B virus, such as 2.2.15 cells (see Sells MA, et al. (1988) J. Nirol. 62:2836-2844. Korba BE and Gerin JL (1992) Antiviral Res. 19:55-70.
  • HB611 Ueda K, et al.
  • Virology 169:213-216 b) monitoring the levels of hepatitis surface antigen or preSl antigen expressed in the animal treated with the test compound; c) comparing the levels of hepatitis surface antigen or preSl antigen in the cells treated with the test compound to control animals not treated with the test compound; d) selecting the compound in step (c) wherein the levels of hepatitis surface antigen or preSl antigen are significantly lower that the levels of hepatitis surface antigen in animals not treated with the test compound, and in a preferred embodiment, 100-fold, and preferably 200 or 500-fold or more relative to pretreatment values in vivo or in vitro.
  • a method of identifying a compound, including a nucleoside or nucleoside analog, that is effective in the treatment of HDV infection comprising the steps of : a) administering a test compound to an in vitro cell that has been transfected to express both hepatitis B surface antigen or preSl antigen and hepatitis delta virus (e.g. Casey, J.L., A.G. Poison, B.L. Bass, J.L. Gerin; p290-294: Viral Hepatitis and Liver Disease; M. Rizzetto et al., eds.
  • HBsAg and "hepatitis B surface antigen” refer to the surface antigen protein of any member of the hepadnavirus family, in particular including human hepatitis B virus (HBV) and woodchuck hepatitis virus (WHV).
  • enantiomerically pure refers to a nucleoside composition that includes at least approximately 95%, and preferably approximately 97%, 98%, 99% or 100% of a single enantiomer of that nucleoside.
  • the term "host” refers to any animal capable of infection the with hepatitis delta virus including but not limited to humans and other mammals.
  • pharmaceutical salt refers to a salt that retains the biological activity of the parent compound and does not impart undesired toxicological effects thereto.
  • Pharmaceutically acceptable salts include those derived from pharmaceutically acceptable inorganic or organic bases and acids. Suitable salts include those derived from alkali metals such as potassium and sodium, alkaline earth metals such as calcium, magnesium and ammonium salts, among numerous other acids well known in the pharmaceutical art.
  • nucleoside refers to heterocyclic nitrogenous base, preferably a purine or pyrimidine, in N-glycosidic or carbocyclic linkage with a carbohydrate or pseudo carbohydrate, preferably a pentose, or a sugar analog or a modified carbon ring system that can include one or more heteroatoms, and to which can be linked any desired substituent, and wherein the compound can be natural or synthetic, and wherein the nucleoside can exhibit any desired stereochemistry that achieves the desired result.
  • nucleoside analog refers to a heterocyclic nitrogenous base, preferably a purine or pyrimidine, in N-glycosidic or carbocyclic linkage with an acyclic carbon chain that can include heteroatoms, and which can include substituents on the cyclic or acyclic chain, including a hydroxyl group.
  • prodrug is used throughout the specification to describe any derivative of the active compound, nucleoside or nucleoside analog that, upon administration to a patient, provides the parent active compound.
  • purine or pyrimidine base includes, but is not limited to, 6-alkylpurine and N6-alkylpurines, N6-acylpurines, N6-benzylpurine, 6- halopurine, N6-vinylpurine, N6-acetylenic purine, N6-acyl purine, N6-hydroxyalkyl purine, N6-thioalkyl purine, N2-alkylpurines, N4-alkylpyrimidines, N4- acylpyrimidines, 4-benzylpyrimidine, N4-halopyrimidines, N4-acetylenic pyrimidines, 4-acyl and N4-acyl pyrimidines, 4-hydroxyalkyl pyrimidines, 4-thioalkyl pyrimidines, thymine, cytosine, 6-azapyrimidine, including 6-azacytosine, 2- and/or 4-mercaptopyrimidine, uracil, C5
  • Suitable protecting groups are well known to those skilled in the art, and include trimethylsilyl, dimethylhexylsilyl, t-butyldimethylsilyl, and t-butyldiphenylsilyl, trityl, alkyl groups, acyl groups such as acetyl and propionyl, methanesulfonyl, and p-toluenesulfonyl.
  • bases include cytosine, 5- fluorocytosine, 5-bromocytosine, 5-iodocytosine, uracil, 5-fluorouracil, 5- bromouracil, 5-iodouracil, 5-methyluracil, thymine, adenine, guanine, inosine, xanthine, 2,6-diaminopurine, 6-aminopurine, 6-chloropurine and 2,6-dichloropurine, 6-bromopurine, 2,6-dibromopurine, 6-iodopurine, 2,6-di-iodopurine, 5- bromovinylcytosine, 5-bromovinyluracil, 5-bromoethenylcytosine, 5- bromoethenyluracil, 5-trifluoromethylcytosine, 5-trifluoromethyluracil.
  • protected refers to a group that is added to an oxygen or nitrogen atom to prevent its further reaction during the course of derivatization of other moieties in the molecule in which the oxygen or nitrogen is located.
  • oxygen and nitrogen protecting groups are known to those skilled in the art of organic synthesis.
  • alkyl refers to a saturated straight, branched, or cycline, primary, secondary, or tertiary hydrocarbon, typically of C t to C 18 , and specifically includes methyl, ethyl, propyl, isopropyl, butyl, isobutyl, t-butyl, pentyl, cyclopentyl, isopentyl, neopentyl, hexyl, isohexyl, cyclohexyl, cyclohexylmethyl, 3-methylpentyl, 2,2-dimethylbutyl, and 2,3-dimethylbutyl.
  • the alkyl group can be optionally substituted with one or more moieties selected from the group consisting of hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phophonic acid, phosphate, or phosphonate, either unprotected, or protected as necessary, as known to those skilled in the art, for example, as taught in Greene, et al, "Protective Groups in Organic Synthesis," John Wiley and Sons, Second Edition, 1991, hereby incorporated by reference.
  • lower alkyl refers to a C, to C 4 saturated straight or branched alkyl group.
  • aryl refers to phenyl, biphenyl, or naphthyl, and preferably phenyl.
  • the aryl group can be optionally substituted with one or more moieties selected from the group consisting of hydroxyl, amino, alkylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate, or phosphonate, either unprotected, or protected as necessary, as known to those skilled in the art, for example, as taught in Greene, et al, "Protective Groups in Organic Synthesis," John Wiley and Sons, Second Edition, 1991.
  • alkaryl or alkylaryl refers to an alkyl group with an aryl substituent.
  • aralkyl or arylalkyl refers to an aryl group with an alkyl substituent.
  • halo as used herein, includes chloro, bromo, iodo, and fluoro.
  • acyl refers to a moiety of the formula -C(O)R', wherein R' is alkyl; aryl, alkaryl, aralkyl, heterocyclic, alkoxyalkyl including methoxymethyl; arylalkyl including benzyl; aryloxyalkyl such as phenoxymethyl; aryl including phenyl optionally substituted with halogen, to C 4 alkyl or C 1 to C 4 alkoxy, or the residue of an amino acid.
  • amino acid includes naturally occurring and synthetic amino acids, and includes but is not limited to, alanyl, valinyl, leucinyl, isoleuccinyl, prolinyl, phenylalaninyl, tryptophanyl, methioninyl, glycinyl, serinyl, threoninyl, cysteinyl, tyrosinyl, asparaginyl, glutaminyl, aspartoyl, glutaroyl, lysinyl, argininyl, and histidinyl.
  • heterocyclic refers to a ringed moiety that includes at least one sulfur, oxygen, or nitrogen in the ring system.
  • Nonlimiting examples are furyl, pyridyl, pyrimidyl, thienyl, isothiazolyl, imidazolyl, tetrazolyl, pyrazinyl, benzofuranyl, benzothiophenyl, quinolyl, isoquinolyl, benzothienyl, isobenzofuryl, pyrazolyl, indolyl, isoindolyl, benzimidazolyl, purinyl, carbazolyl, oxazolyl, thiazolyl, isothiazolyl, 1,2,4-thiadiazolyl, isooxazolyl, pyrrolyl, quinazolinyl, pyridazinyl, pyrazinyl, cinnolinyl, phthalazinyl, qui
  • Suitable protecting groups are well known to those skilled in the art, and include trimethylsilyl, dimethylhexylsilyl, t-butyldimethylsilyl, and t-butyldiphenylsilyl, trityl or substituted trityl, alkyl groups, acyl groups such as acetyl and propionyl, methanesulfonyl, and p-toluenelsulfonyl.
  • the heterocyclic group can be substituted with any appropriate substituent, including but not limited to fluoro, iodo, bromo, chloro, and lower alkyl, including cyclopropyl.
  • lipophilic prodrug refers to a nucleoside that contains a covalent substituent at the 5 '-hydroxyl position that renders the nucleoside more lipophilic than the parent nucleoside with a 5 '-hydroxyl group.
  • HBsAg hepatitis B surface antigen
  • the ability of a nucleoside to reduce the level of HBsAg to the required minimum level can be easily assessed by the methods described in detail herein, or other known methods.
  • nucleoside nucleoside analog, or certain non-nucleosides, or a prodrug or pharmaceutically acceptable salt thereof that reduces the level of preSl antigen in a host to at least approximately 100- fold or more, and preferably, 200- or 500-fold relative to pretreatment values in vivo or in vitro.
  • the ability of a nucleoside to reduce the level of preSl antigen to the required minimum level can be easily assessed by known methods.
  • nucleoside or nucleoside analog does not significantly reduce the level of HBsAg in a hepatitis delta infected host, for example, 3TC (2',3 '-dideoxy-3 '-thiacytidine), then that nucleoside is not effective in the treatment of hepatitis delta virus.
  • nucleoside or nucleoside analog reduces the level of 100-fold or more relative to pretreatment values in vivo or in vitro, or to not more than 1 microgram per milliliter, as measured in serum or plasma using standard immunoassays (such as the commercial assay for human HBsAg (AUSZYME TM, Abbott Laboratories) or that described for woodchuck hepatitis B surface antigen in: Viral Immunology 6:161.169; Cote, P. J., C. Roneker, K. Cass, F. Schodel, D. Peterson, B. Tennant, F. DeNoronha, and J. Gerin. 1993, it is useful in the treatment of hepatitis delta virus. This has now been established for the first time through the paradigm nucleoside analog, and a nonlimiting embodiment, L-FMAU.
  • an effective amount of a compound of Formula I, or a pharmaceutically acceptable prodrug or salt thereof, is administered of the structure:
  • R is 5 -methyl uracil (also referred to as thymine) and R' is hydrogen, acyl, alkyl, monophosphate, diphosphate, triphosphate, or a stabilized phosphate derivative, including a 5'-ether lipid or a 5'-phospholipid, or a pharmaceutically acceptable salt thereof.
  • the active compound can be administered as any derivative that upon administration to the recipient, is capable of providing directly or indirectly, the parent compound.
  • Nonlimiting examples are the pharmaceutically acceptable salts, and the 5' and purine or pyrimidine acylated or alkylated derivatives of the active compound (if a nucleoside or nucleoside analog).
  • the acyl group of the active compound is a carboxylic acid ester in which the non-carbonyl moiety of the ester group is selected from straight, branched, or cyclic alkyl, alkoxyalkyl including methoxymethyl, aralkyl including benzyl, aryloxyatkyl such as phenoxymethyl, aryl including phenyl optionally substituted with halogen, to C 4 alkyl or C, to C 4 alkoxy, sulfonate esters such as alkyl or aralkyl sulphonyl including methanesulfonyl, the mono, di or triphosphate ester, trityl or monomethoxytrityl, substituted benzyl, trialkylsilyl (e.g., dimethyl-t-butylsilyl) or diphenylmethylsilyl.
  • Aryl groups in the esters optimally comprise a phenyl group.
  • the alkyl group can be straight,
  • the active compound can be administered as a prodrug, including a nucleotide prodrug (if a nucleoside or nucleoside analog), to increase the activity, bioavailability, stability or otherwise alter the properties of the nucleoside.
  • a "prodrug” is a therapeutic agent that is converted to an active form within the host by the action of endogenous enzymes or other chemicals and/or conditions.
  • a number of nucleotide prodrug ligands are known. In general, alkylation, acylation or other lipophilic modification of the mono, di or triphosphate of the nucleoside will increase the stability of the nucleotide.
  • substituent groups that can replace one or more hydrogens on the phosphate moiety are alkyl, aryl, steroids, carbohydrates, including sugars, 1,2-diacylglycerol and alcohols. Many are described in R. Jones and N. Bischofberger, Antiviral Research, 27 (1995) 1-17. Any of these can be used in combination with the disclosed nucleosides to achieve a desired effect.
  • substituent groups that can replace one or more hydrogens on the phosphate moiety or hydroxyl are alkyl, aryl, steroids, carbohydrates, including sugars, 1,2-diacylglycerol and alcohols. Many are described in R. Jones and N. Bischofberger, Antiviral Research, 27 (1995) 1-17. Any of these can be used in combination with the disclosed nucleosides or other compounds to achieve a desire effect.
  • the active nucleoside or other hydroxyl containing compound can also be provided as an ether lipid (and particularly a 5 '-ether lipid for a nucleoside), as disclosed in the following references, which are incorporated by reference herein: Kucera, L.S., N. Iyer, E. Leake, A. Raben, Modest E.K., D.L.W., and C. Piantadosi. 1990. "Novel membrane-interactive ether lipid analogs that inhibit infectious HIV-1 production and induce defective virus formation.” DS Res. Hum. Retro Viruses. 6:491-501; Piantadosi, C, J. Marasco C.J., S.L. Morris-Natschke, K.L. Meyer, F.
  • lipophilic substituents that can be attached to the nucleosides of the present invention, or lipophilic preparations, include WO 89/02733, W0 90/00555, W0 91/16920, W0 91/18914, W0 93/00910, W0 94/26273, W0 96/15132, EP 0 350287, EP 93917054.4, and W0 91/19721.
  • nucleotide prodrugs are described in the following references: Ho, D.H.W. (1973) "Distribution of Kinase and deaminase of 1 ⁇ -D-arabinofuranosylcytosine in tissues of man and mouse.” Cancer Res. 33, 2816- 2820; Holy, A. (1993) Isopolar phosphorous-modified nucleotide analogues," In: De Clercq (Ed.), Advances in Antiviral Drug Design, Vol. I, JAI Press, pp. 179-231; Hong, C.I., Nechaev, A., and West, C.R.
  • Alkyl hydrogen phosphate derivatives of the anti-HIN agent AZT may be less toxic than the parent nucleoside analogue.
  • treatment of HDN infection may be accomplished using L-FMAU or other nucleoside or nucleoside analog or organic small molecule meeting the requirements specified herein in combination or alternation with other agents that reduce the level of hepatitis B surface or preS 1 antigen in the host, or which are known to otherwise treat hepatitis delta infection, including but not limited to a ribozyme (see U.S. Patent No.
  • cytokine including interleukins, interferon (including ⁇ , ⁇ , or ⁇ ), an antibody to hepatitis B surface or preSl antigen or a transcriptional factor or other mediator of hepatitis B surface or preSl antigen expression (to impart passive immunity); hepatitis B surface antigen or preSl antigen or a transcriptional factor or other mediator of hepatitis B surface antigen expression (to impart active immunity), a protein-prenyl transferase inhibitor (Statutory Invention No. HI-345) or peptide hormone (for example, thymosin-alpha- 1).
  • cytokine including interleukins, interferon (including ⁇ , ⁇ , or ⁇ ), an antibody to hepatitis B surface or preSl antigen or a transcriptional factor or other mediator of hepatitis B surface or preSl antigen expression (to impart passive immunity); hepatitis B surface antigen or preSl antigen or a transcriptional factor
  • an effective dosage of each agent is administered serially, whereas in combination therapy, an effective dosage of two or more agents are administered together.
  • the dosages will depend on such factors as absorption, biodistribution, metabolism and excretion rates for each drug as well as other factors known to those of skill in the art. It is to be noted that dosage values will also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens and schedules should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
  • the disclosed combination and alternation regiments are useful in the prevention and treatment of HDN infections and other related conditions.
  • these compounds or formulations can be used prophylactically to prevent or retard the progression of clinical illness in individuals have been exposed to HDN.
  • HDV infection can be treated in a host by administering at least one antisense oligonucleotide targeted to the R ⁇ A transcript of the hepatitis B surface antigen either alone or in combination with L-FMAU.
  • oligonucleotide encompasses both oligomeric nucleic acid moieties of the type found in nature, such as the deoxyribonucleotide and ribonucleotide structures of D ⁇ A and R ⁇ A, and man-made analogues which are capable of binding to nucleic acids found in nature.
  • oligonucleotides of the present invention can be based upon ribonucleotide or deoxyribonucleotide monomers linked by phosphodiester bonds, or by analogues linked by methyl phosphonate, phosphorothioate, or other bonds. They may also comprise monomer moieties which have altered base structures or other modifications, but which still retain the ability to bind to naturally occurring D ⁇ A and R ⁇ A structures.
  • Such oligonucleotides may be prepared by methods well-known in the art, for instance using commercially available machines and reagents available from Perkin-Elmer/ Applied Biosystems (Foster City, Calif).
  • Phosphodiester-linked oligonucleotides are particularly susceptible to the action of nucleases in serum or inside cells, and therefore in a preferred embodiment the oligonucleotides of the present invention are phosphorothioate or methyl phosphonate-linked analogues, which have been shown to be nuclease-resistant. Persons knowledgeable of this field will be able to select other linkages for use in the present invention.
  • antisense oligonucleotides directed against a specific gene is generally inversely proportional to its location relative to the AUG start codon of the target gene.
  • antisense oligonucleotides targeting sequences more than 60 bases downstream from the AUG start codon of chromosomally integrated HBN surface antigen (HBsAg) gene (S gene) sequences in HBsAg-producing PLC/PRF/5 cells are ineffective in inhibiting HBsAg production, while oligonucleotides placed within 20 bases of the AUG inhibit HBsAg production by 50% to 90%.
  • an antisense oligonucleotide targeted the HBN surface antigen gene sequence be chosen such that the oligonucleotide hybridizes within approximately 25 bases of the AUG start codon of the gene.
  • Preferred oligonucleotides directed to the HBN surface antigen gene are described in U.S. Pat. No. 5,646,262 to Korba et al.
  • oligonucleotides approximately 14 to 25 nucleotides long.
  • L-nucleosides disclosed herein can be prepared as described in detail below, or by other assays known to those skilled in the art.
  • reaction mixture was poured into 500 ml of ice- water, extracted with CHC1 3 (150 mlX4), washed with 1.5M H 2 SO 4 (150 mlX4), sat.NaHCO 3 (200 mlX2), dried (MgSO 4 ). Removing solvent gave a brown syrup, which upon crystallization from EtOH, gave 4 as a white solid (103.8 g, 99%).
  • the syrup 6 (60 g, 127 mmol) was dissolved in 200 ml of pyridine and stirred at 0° C, while benzoyl chloride (40 ml, 345 mmol) was added dropwise, the resulting solution was stirred at r.t. for 17 hrs. It was concentrated to about 50 ml, then poured into 300 ml of ice-water, extracted with CHC1 3 , washed with 3N H 2 SO 4 and sat. NaHCO 3 , dried (MgSO 4 ). After evaporation of the solvent, gave 7 as a syrup (71 g, 97%).
  • the crude 9 was dissolved in 80 ml of HBr/AcOH (45%, w/v) and stirred at r.t. for 1.5 hrs. To this mixture, was added glacial acetic acid (50 ml) and the resulting solution stirred at 0° C, while 34 ml of water was added slowly to keep the temperature below 7° C, then it was stirred at r.t. for 1 hr, poured into 200 ml of ice- water, extracted with chloroform (50 mlX5), the combined extracts were washed with sat. NaHCO 3 , dried (MgSO 4 ).
  • Removing solvent gave a syrup (13 g), which was dissolved in 40 ml of anhydrous pyridine, stirred at 0° C, when acetic anhydride (14 ml, 148.4 mmol) was added dropwise. After the reaction completed, it was poured into 150 ml of ice-water, extracted with chloroform (50 mlX4), washed successively with 3N H 2 SO 4 (30 mlX2), sat. NaHCO 3 (50 mlX2), dried (MgSO 4 ). Removing solvent and treating with methanol, gave 10 as a white solid (9.2 g, 53.7% from L- ribose).
  • thymine (215 mg, 1.72 mmol) was refiuxed in HMDS (25 ml) under nitrogen for 17 hrs, to get a homogeneous solution. After evaporation of the solvent, gave a silylated thymine.
  • the derivative of L-FMAU wherein there is an alkyl group in the 5 '-position can be prepared via protection of the thymine base using sodium hydride and t-butyl- di-phenyl silo protecting group. Benzoylation of the 5'-hydroxyl group can be achieved with benzoyl hydride. The resulting compound can be desilylated using tetrabutylammonium fluoride. Introduction of alkyl groups to the 5'-position is accomplished using sodium hydride and alkyl bromide, the benzoyl group can be removed with a base.
  • the mono, di, and triphosphate derivative of L-FMAU can be prepared as described below.
  • the monophosphate can be prepared according to the procedure of Imai et al., J. Org. Chem., 34(6), 1547-1550 (June 1969). For example, about 100 mg of L-FMAU and about 280 ⁇ l of phosphoryl chloride are reacted with stirring in about 8 ml of dry ethyl acetate at about 0 °C for about four hours. The reaction is quenched with ice. The aqueous phase is purified on an activated charcoal column, eluting with 5% ammonium hydroxide in a 1 :1 mixture of ethanol and water. Evaporation of the eluant gives ammonium L-FMAU-5'-monophosphate.
  • the diphosphate can be prepared according to the procedure of Davisson et al., J. Org. Chem., 52(9), 1794-1801 (1987).
  • L-FMAU diphosphate can be prepared from the corresponding tosylate, that can be prepared, for example, by reacting the nucleoside with tosyl chloride in pyridine at room temperature for about 24 hours, working up the product in the usual manner (e.g., by washing, drying, and crystallizing it).
  • the triphosphate can be prepared according to the procedure of Hoard et al., J Am. Chem. Soc, 87(8), 1785-1788 (1965).
  • L-FMAU is activated (by making a imidazolide, according to methods known to those skilled in the art) and treating with tributyl ammonium pyrophosphate in DMF.
  • the reaction gives primarily the triphosphate of the nucleoside, with some unreacted monophosphate and some diphosphate. Purification by anion exchange chromatography of a DEAE column is followed by isolation of the triphosphate, e.g., as the tetrasodium salt.
  • the woodchuck was used as an experimental model of chronic HDV infection to assess the effect of L-FMAU treatment on HDV replication. Woodchucks chronically infected with WHV were infected with a woodchuck-adapted HDV inoculum derived from a laboratory infectious clone. Nine of eleven infected animals were determined to have chronic HDV infection, as defined by RT/PCR-detectable HDV viremia (Niro et al. (1997) Hepatology 25, 728-734) for at least 74% of bleed dates for at least 11 months prior to the initiation of treatment. The range of duration of viremia prior to the start of the study was 11.4 - 20 months; the range of positive bleed dates was 74% to 100%.
  • mice in the treatment group (4) were given lOmg/kg L-FMAU daily; animals in the control group (5) were given placebo.
  • Serum samples were obtained before the initiation of treatment, and at weeks 2, 4, 8, 12, 16 and 20. Serum samples were analyzed for WHV DNA, WHN surface antigen, and HDV R ⁇ A.
  • HDV virema became undetectable following reduction of hepatitis B surface antigen concentrations by 100-fold or more and notably, after reduction to less than lmicrogram/ml. This effect was sustained for the remainder of the treatment period.
  • HDV RNA became undetectable in all animals exhibiting decreased levels of surface antigen.
  • L-FMAU is a potent inhibitor of HDV in chronically infected animals, in part due to its strong suppression of surface antigen expression.
  • Previous studies have shown a close correlation between levels of chronic HDV viremia and disease severity (Smedile, A. et al. (1986) Hepatology 6, 1297-302; Smedile, A. et al. (1987) Prog Clin Biol Res 234, 235-41; Niro, G. A. et al. (1997) Hepatology 25, 728-734; Shakil, A. O. et al. (1997) Virology 234, 160-7).
  • HDV-infected cells may be as short as two weeks (Netter, H. J. et al. (1993) J Virol 61, 3357-62.), based on these results, L-FMAU and other nucleosides, nonnucleosides, and nucleoside analogs could be used to eliminate HDV infection altogether in treated patients by prolonged reduction of viremia to low levels.
  • Humans suffering from diseases caused by HDV infection can be treated by administering to the patient an effective amount of a nucleoside or nucleoside analog or a pharmaceutically acceptable salt or prodrug thereof, in the presence of a pharmaceutically acceptable carrier or diluent, that reduces the level of hepatitis B surface or preS 1 antigen in the host to not more than approximately 100-fold or more, and preferably, 200- or 500-fold relative to pretreatment values in vivo or in vitro, or with respect to HBsAg, to not more than 1, and preferably, 0.5 or 0.1 microgram per milliliter in vivo, as measured in serum or plasma using standard immunoassays.
  • a pharmaceutically acceptable carrier or diluent that reduces the level of hepatitis B surface or preS 1 antigen in the host to not more than approximately 100-fold or more, and preferably, 200- or 500-fold relative to pretreatment values in vivo or in vitro, or with respect to HBsAg, to not
  • the nucleoside is 2'-fluoro-5-methyl- ⁇ -L- arabmofuranosyluridme or a pharmaceutically acceptable prodrug or salt thereof.
  • the active compound (or prodrug form thereof) can be administered by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid or solid form.
  • the active compound (or prodrug thereof) is included in the pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount of compound to reduce HDV viremia or the symptoms thereof in vivo without causing serious toxic effects in the patient treated.
  • a "reducing amount” is meant as an amount of active ingredient sufficient to decrease levels of HDV viremia as measured by, for example, an assay such as the ones described herein or other known methods.
  • a preferred dose of the compound for all of the above-mentioned conditions will be in the range from about 1 to 50 mg/kg, preferably 1 to 20 mg/kg, of body weight per day, more generally 0.1 to about 100 mg per kilogram body weight of the recipient per day.
  • the effective dosage range of the pharmaceutically acceptable derivatives can be calculated based on the weight of the parent nucleoside to be delivered. If the derivative exhibits activity in itself, the effective dosage can be estimated as above using weight of the derivative, or by other means known to those skilled in the art.
  • the compound is conveniently administered in units of any suitable dosage form, including but not limited to one containing 7 to 3000 mg, preferably 70 to 1400 mg of active ingredient per unit dosage form.
  • An oral dosage of 50-1000 mg is usually convenient.
  • the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0.2 to 70 ⁇ M, preferably about 1.0 to 10 ⁇ M. This may be achieved, for example, by the intravenous injection of a 0.1 to 5% solution of the active ingredient, optionally in saline, or administered as a bolus of the active ingredient.
  • the concentration of active compound in the drug composition will depend on absorption, inactivation, and excretion rates of the drug as well as other factors known to those of skill in the art. It is to be noted that dosage values will also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.
  • the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at varying intervals of time.
  • Oral compositions will generally include an inert diluent or an edible carrier. They may be enclosed in gelatin capsules or compressed into tablets.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the compound can be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like.
  • a syrup may contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
  • the compound or a pharmaceutically acceptable derivative or salts thereof can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as antibiotics, antifungals, anti-inflammatories, or other anti-virals, including nucleoside anti-HIN compounds.
  • Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the parental preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • preferred carriers are physiological saline or phosphate buffered saline (PBS).
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene v yl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation.
  • Liposomal suspensions are also preferred as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811 (which is incorporated herein by reference in its entirety). For example, liposome formulations may be prepared by dissolving appropriate lipid(s) (such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol) in an inorganic solvent that is then evaporated, leaving behind a thin film of dried lipid on the surface of the container.
  • appropriate lipid(s) such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol
  • aqueous solution of the active compound or its monophosphate, diphosphate, and/or triphosphate derivatives is then introduced into the container.
  • the container is then swirled by hand to free lipid material from the sides of the container and to disperse lipid aggregates, thereby forming the liposomal suspension.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Communicable Diseases (AREA)
  • Urology & Nephrology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
PCT/US2001/009987 2000-03-29 2001-03-29 Method of treating hepatitis delta viral infection Ceased WO2001072294A2 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
CA002405502A CA2405502A1 (en) 2000-03-29 2001-03-29 Method of treating hepatitis delta viral infection
AU2001249564A AU2001249564A1 (en) 2000-03-29 2001-03-29 Method of treating hepatitis delta viral infection
EP01922803A EP1284720B1 (en) 2000-03-29 2001-03-29 L-fmau for the treatment of hepatitis delta viral infection
BR0109716-4A BR0109716A (pt) 2000-03-29 2001-03-29 Uso de um nucleosìdeo ou um análogo de nucleosìdeo no tratamento de infecção viral por hepatite delta
KR1020027012957A KR100893549B1 (ko) 2000-03-29 2001-03-29 델타형 간염 바이러스 감염의 치료방법
IL15198101A IL151981A0 (en) 2000-03-29 2001-03-29 Method of treating hepatitis delta viral infection
DE60123042T DE60123042T2 (de) 2000-03-29 2001-03-29 L-fmau zur behandlung von hepatitis-delta-virus-infizierung
JP2001570255A JP2003528138A (ja) 2000-03-29 2001-03-29 デルタ肝炎ウイルス感染症の治療法
CY20061101613T CY1105768T1 (el) 2000-03-29 2006-11-09 L-fmau για την αντιμετωπιση μολυνσης απο ιο της ηπατιτιδας δελτα

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US19313500P 2000-03-29 2000-03-29
US60/193,135 2000-03-29

Publications (2)

Publication Number Publication Date
WO2001072294A2 true WO2001072294A2 (en) 2001-10-04
WO2001072294A3 WO2001072294A3 (en) 2002-05-23

Family

ID=22712393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/009987 Ceased WO2001072294A2 (en) 2000-03-29 2001-03-29 Method of treating hepatitis delta viral infection

Country Status (16)

Country Link
US (2) US6670342B2 (https=)
EP (1) EP1284720B1 (https=)
JP (1) JP2003528138A (https=)
KR (3) KR100893549B1 (https=)
CN (1) CN1268345C (https=)
AT (1) ATE339211T1 (https=)
AU (1) AU2001249564A1 (https=)
BR (1) BR0109716A (https=)
CA (1) CA2405502A1 (https=)
CY (1) CY1105768T1 (https=)
DE (1) DE60123042T2 (https=)
DK (1) DK1284720T3 (https=)
ES (1) ES2272460T3 (https=)
IL (1) IL151981A0 (https=)
PT (1) PT1284720E (https=)
WO (1) WO2001072294A2 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6787526B1 (en) 2000-05-26 2004-09-07 Idenix Pharmaceuticals, Inc. Methods of treating hepatitis delta virus infection with β-L-2′-deoxy-nucleosides
US7511027B2 (en) 2000-03-29 2009-03-31 Georgetown University Method of treating hepatitis delta virus infection
EP1564291A3 (de) * 2003-10-08 2011-07-06 Universitätsklinikum Schleswig-Holstein Oligonukleotide, diese enthaltende Mittel und deren Verwendung
US9533003B2 (en) 2012-08-30 2017-01-03 Replicor Inc. Methods for the treatment of hepatitis B and hepatitis D infections

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8642602B2 (en) * 2009-02-04 2014-02-04 University Of Georgia Research Foundation, Inc. Method of inhibiting fibrogenesis and treating fibrotic disease
AU2010319999B2 (en) * 2009-11-16 2014-01-16 University Of Georgia Research Foundation, Inc. 2'-Fluoro-6'-methylene carbocyclic nucleosides and methods of treating viral infections
US8816074B2 (en) 2009-11-16 2014-08-26 University of Georgia Foundation, Inc. 2′-fluoro-6′-methylene carbocyclic nucleosides and methods of treating viral infections
EA039949B1 (ru) * 2012-09-21 2022-03-31 Репликор Инк. Способы лечения инфекций вирусом гепатита в и гепатита d
US10076512B2 (en) 2014-05-01 2018-09-18 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
US11311519B2 (en) 2014-05-01 2022-04-26 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
WO2016090107A2 (en) * 2014-12-04 2016-06-09 Eiger Biopharmaceuticals, Inc. Treatment of hepatitis delta virus infection
CN104694544A (zh) * 2015-03-24 2015-06-10 刘红卫 结合丁型肝炎病毒的核酸适配子及其应用
KR20170132327A (ko) * 2015-04-07 2017-12-01 스프링 뱅크 파마슈티칼스, 인크. Hbv 감염의 치료를 위한 조성물 및 방법
WO2016172342A1 (en) 2015-04-21 2016-10-27 Eiger Biopharmaceuticals, Inc. Pharmaceutical compositions comprising lonafarnib and ritonavir
WO2017132332A1 (en) 2016-01-28 2017-08-03 Svenska Vaccinfabriken Produktion Ab Chimeric hepatitis d virus antigen and hepatitis b virus pre s1 genes for use alone or in vaccines contaning hepatitis b virus genes
CN106333960A (zh) * 2016-11-01 2017-01-18 侯建生 臭氧化油在肝病防治中的应用

Family Cites Families (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4211771A (en) 1971-06-01 1980-07-08 Robins Ronald K Treatment of human viral diseases with 1-B-D-ribofuranosyl-1,2,4-triazole-3-carboxamide
US4093714A (en) 1974-03-15 1978-06-06 Icn Pharmaceuticals, Inc. 9β-D-Arabinofuranosylpurine nucleotides and method of use
US4210638A (en) 1978-03-17 1980-07-01 Pcr, Inc. Antiviral composition and method of treating virus diseases
GB2060604B (en) 1979-10-03 1983-11-23 Univ Birmingham And Stichting E15-(2-halogenovinyl)-2'-deoxycytidines
US4468384A (en) 1982-01-05 1984-08-28 The Research Foundation Of State University Of New York Method for the inhibition of the replication of DNA viruses with 5-substituted 2-pyrimidinone nucleosides
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
DE3479158D1 (en) 1983-03-04 1989-08-31 Noctech Ltd Diagnostic agent, a process for its preparation and its use in diagnostic methods
US4666892A (en) 1984-03-06 1987-05-19 Sloan-Kettering Memorial Cancer Center Method and composition for hepatitis treatment with pyrimidine nucleoside compounds
US5223263A (en) 1988-07-07 1993-06-29 Vical, Inc. Liponucleotide-containing liposomes
ES2061500T5 (es) 1986-06-17 2003-05-16 Chiron Corp Diagnosis y vacunas de la hepatitis delta, su preparacion y uso.
US5246924A (en) * 1987-09-03 1993-09-21 Sloan-Kettering Institute For Cancer Research Method for treating hepatitis B virus infections using 1-(2'-deoxy-2'-fluoro-beta-D-arabinofuranosyl)-5-ethyluracil
AU2526188A (en) 1987-09-22 1989-04-18 Regents Of The University Of California, The Liposomal nucleoside analogues for treating aids
US5194654A (en) 1989-11-22 1993-03-16 Vical, Inc. Lipid derivatives of phosphonoacids for liposomal incorporation and method of use
US5411947A (en) 1989-06-28 1995-05-02 Vestar, Inc. Method of converting a drug to an orally available form by covalently bonding a lipid to the drug
US5463092A (en) 1989-11-22 1995-10-31 Vestar, Inc. Lipid derivatives of phosphonacids for liposomal incorporation and method of use
AU7872491A (en) 1990-05-07 1991-11-27 Vical, Inc. Lipid prodrugs of salicylate and nonsteroidal anti-inflammatory drugs
EP0531452A4 (en) 1990-05-29 1993-06-09 Vical, Inc. Synthesis of glycerol di- and triphosphate derivatives
ATE131825T1 (de) 1990-06-13 1996-01-15 Arnold Glazier Phosphorylierte prodrugs
US5543389A (en) 1990-11-01 1996-08-06 State Of Oregon, Acting By And Through The Oregon State Board Of Higher Education On Behalf Of The Oregon Health Sciences University, A Non Profit Organization Covalent polar lipid-peptide conjugates for use in salves
US5543390A (en) 1990-11-01 1996-08-06 State Of Oregon, Acting By And Through The Oregon State Board Of Higher Education, Acting For And On Behalf Of The Oregon Health Sciences University Covalent microparticle-drug conjugates for biological targeting
US5149794A (en) 1990-11-01 1992-09-22 State Of Oregon Covalent lipid-drug conjugates for drug targeting
US5256641A (en) 1990-11-01 1993-10-26 State Of Oregon Covalent polar lipid-peptide conjugates for immunological targeting
EP0491077A1 (en) 1990-12-19 1992-06-24 Medeva Holdings B.V. A composition used as a therapeutic agent against chronic viral hepatic diseases
GB9110874D0 (en) 1991-05-20 1991-07-10 Iaf Biochem Int Medicaments
AU668873B2 (en) 1991-07-12 1996-05-23 Chimerix, Inc. Antiviral liponucleosides: treatment of hepatitis B
US5554728A (en) 1991-07-23 1996-09-10 Nexstar Pharmaceuticals, Inc. Lipid conjugates of therapeutic peptides and protease inhibitors
GB9116601D0 (en) 1991-08-01 1991-09-18 Iaf Biochem Int 1,3-oxathiolane nucleoside analogues
EP0746319A4 (en) 1993-05-12 1997-11-05 Karl Y Hostetler ACYCLOVIR DERIVATIVES FOR TOPICAL USE
EP0702556B1 (en) 1993-06-10 2002-10-23 Wake Forest University (phospho)lipids for combatting hepatitis b virus infection
US5587362A (en) * 1994-01-28 1996-12-24 Univ. Of Ga Research Foundation L-nucleosides
US5639647A (en) 1994-03-29 1997-06-17 Ribozyme Pharmaceuticals, Inc. 2'-deoxy-2'alkylnucleotide containing nucleic acid
US5646262A (en) 1994-07-28 1997-07-08 Georgetown University Antisense oligonucleotides against hepatitis B viral replication
US5696277A (en) 1994-11-15 1997-12-09 Karl Y. Hostetler Antiviral prodrugs
US5808040A (en) 1995-01-30 1998-09-15 Yale University L-nucleosides incorporated into polymeric structure for stabilization of oligonucleotides
GB9505025D0 (en) * 1995-03-13 1995-05-03 Medical Res Council Chemical compounds
US5985662A (en) 1995-07-13 1999-11-16 Isis Pharmaceuticals Inc. Antisense inhibition of hepatitis B virus replication
AU6605196A (en) 1996-02-29 1997-09-16 Duke University Method of treating hepatitis delta virus infection
US5753789A (en) 1996-07-26 1998-05-19 Yale University Oligonucleotides containing L-nucleosides
DE19641034A1 (de) 1996-10-04 1998-04-09 Claussen Nils Pulverförmige Zubereitung von wasserempfindlichen anorganischen Substanzen, ihre Herstellung und Verwendung
IL151981A0 (en) * 2000-03-29 2003-04-10 Univ Georgetown Method of treating hepatitis delta viral infection
US6985662B2 (en) * 2003-10-30 2006-01-10 Corning Incorporated Dispersion compensating fiber for moderate dispersion NZDSF and transmission system utilizing same

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7511027B2 (en) 2000-03-29 2009-03-31 Georgetown University Method of treating hepatitis delta virus infection
US6787526B1 (en) 2000-05-26 2004-09-07 Idenix Pharmaceuticals, Inc. Methods of treating hepatitis delta virus infection with β-L-2′-deoxy-nucleosides
EP1564291A3 (de) * 2003-10-08 2011-07-06 Universitätsklinikum Schleswig-Holstein Oligonukleotide, diese enthaltende Mittel und deren Verwendung
US9533003B2 (en) 2012-08-30 2017-01-03 Replicor Inc. Methods for the treatment of hepatitis B and hepatitis D infections

Also Published As

Publication number Publication date
DE60123042T2 (de) 2007-04-12
DE60123042D1 (de) 2006-10-26
CN1431907A (zh) 2003-07-23
DK1284720T3 (da) 2007-01-15
ATE339211T1 (de) 2006-10-15
CY1105768T1 (el) 2011-02-02
US6670342B2 (en) 2003-12-30
AU2001249564A1 (en) 2001-10-08
IL151981A0 (en) 2003-04-10
JP2003528138A (ja) 2003-09-24
ES2272460T3 (es) 2007-05-01
EP1284720B1 (en) 2006-09-13
KR20030031472A (ko) 2003-04-21
BR0109716A (pt) 2003-06-17
KR20080059679A (ko) 2008-06-30
CN1268345C (zh) 2006-08-09
WO2001072294A3 (en) 2002-05-23
CA2405502A1 (en) 2001-10-04
KR100893549B1 (ko) 2009-04-17
PT1284720E (pt) 2006-12-29
KR20090006230A (ko) 2009-01-14
US20030158149A1 (en) 2003-08-21
EP1284720A2 (en) 2003-02-26
US20020160980A1 (en) 2002-10-31
US7511027B2 (en) 2009-03-31

Similar Documents

Publication Publication Date Title
EP1292313B1 (en) Methods for treating hepatitis delta virus infection with beta-l-2' deoxy-nucleosides
US6787526B1 (en) Methods of treating hepatitis delta virus infection with β-L-2′-deoxy-nucleosides
US7795238B2 (en) β-L-2′-deoxy-nucleosides for the treatment of hepatitis B
DK2415776T3 (en) Beta-L-2'-deoxy nucleosides for the treatment of Hepatitis B
EP0831852B1 (en) Nucleosides with anti-hepatitis b virus activity
AU2001263484A1 (en) Methods of treating hepatitis delta virus infection with beta-l-2'- deoxy-nucleosides
US6670342B2 (en) Method of treating hepatitis delta virus infection
HK1050999B (en) Methods for treating hepatitis delta virus infection with beta-l-2' deoxy-nucleosides
EP1431304A2 (en) Beta - L-2'-Deoxy-Nucleosides for the treatment of Hepatitis B
AU2003201382A8 (en) Nucleosides with anti-hepatitis B virus activity

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 570255

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2405502

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1020027012957

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 151981

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2001922803

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 018104134

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2001922803

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020027012957

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 2001922803

Country of ref document: EP