WO2001055424A1 - Nouveau polypeptide, proteine d'oxydoreduction 4fe-4s 9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, proteine d'oxydoreduction 4fe-4s 9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001055424A1
WO2001055424A1 PCT/CN2001/000053 CN0100053W WO0155424A1 WO 2001055424 A1 WO2001055424 A1 WO 2001055424A1 CN 0100053 W CN0100053 W CN 0100053W WO 0155424 A1 WO0155424 A1 WO 0155424A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
redox protein
protein
sequence
Prior art date
Application number
PCT/CN2001/000053
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biodoor Gene Technology Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biodoor Gene Technology Ltd. Shanghai filed Critical Biodoor Gene Technology Ltd. Shanghai
Priority to AU2001229989A priority Critical patent/AU2001229989A1/en
Publication of WO2001055424A1 publication Critical patent/WO2001055424A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, 4Fe-4S redox protein 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Electron transporters mainly include flavin protein, iron sulfur protein, cytochrome, and a quinone compound, except that quinone compounds are all hydrophobic molecules.
  • the best-known iron-sulfur proteins are ferredoxins from bacteria and chloroplasts, as well as mitochondrial electron transfer chains.
  • Ferritin is a family of proteins containing iron and sulfur atoms complexed with the four Cys residues of proteins. It is also called non-heme ferritin.
  • the iron and sulfur of ferritin are usually present in equimolar amounts, usually 2Fe-2S or 4Fe-4S, but some ferritins contain one iron atom and coordinate to the thiol groups of four Cys residues in the form of a tetrahedron.
  • 4Fe-4S redox protein was first found in bacteria, so it is often called bacterial ferredoxin, it contains several segments of about 26 amino acid residues, each segment has four Cy s residues Group that can bind to iron-sulfur centers. Many proteins that are very similar to bacterial ferritin have been found to contain one or more 4Fe-4S binding regions.
  • the iron-sulfur binding region of the 4Fe-4S redox protein family is generally a conserved amino acid sequence: Cys—X (2) —Cys—X (2) —Cys—X (3) —Cys— [PEG].
  • the iron atoms in the binding region can exist in an oxidized state (Fe 3+) or a reduced state (Fe2 +). When iron sulfur protein functions as an electron transporter, iron is actually an acceptor or donor of electrons.
  • the more common iron-sulfur proteins are important members of the tricarboxylic acid (TCA) cycle. They all contain three subunits: flavin Protein, iron-sulfur protein, cytochrome, iron-sulfur protein is involved in the electron transfer process from succinate to coenzyme Q and from coenzyme Q to cytochrome; MDH dehydrogenase is a 2Fe-2S and 4Fe-4S Center for iron sulfur protein.
  • 4Fe-4S redox protein 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more 4Fe-4S oxidations involved in these processes. Reducing protein 9 protein, especially the amino acid sequence of this protein is identified. The isolation of the new 4Fe-4S redox protein 9 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases Code DNA is very important. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding 4Fe-4S redox protein 9.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding 4Fe-4S redox protein 9.
  • Another object of the present invention is to provide a method for producing 4Fe-4S redox protein 9.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, 4Fe-4S redox protein-9.
  • Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, 4Fe-4S redox protein 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of 4Fe-4S redox protein 9.
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 71 1 to 968 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 1514-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a screened protein that simulates, activates, antagonizes or inhibits 4Fe-4S redox protein 9
  • a method of active compounds which comprises utilizing a polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of 4 Fe-4 S redox protein 9 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of 4Fe-4S redox protein 9.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and a fragment or part thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acid or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with 4Fe-4S redox protein 9, can cause the protein to change, thereby regulating the activity of the protein.
  • Agonists can include proteins, nucleic acids, carbohydrates or any Other molecules that can bind 4Fe-4S redox protein 9.
  • Antagonist refers to a molecule that, when combined with 4Fe-4S redox protein 9, can block or regulate the biological or immunological activity of 4Fe-4S redox protein 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind 4Fe-4S redox protein 9.
  • “Regulation” refers to a change in the function of 4Fe-4S redox protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of 4Fe-4S redox protein 9. change.
  • substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify 4Fe-4S redox protein 9 using standard protein purification techniques. Basic The pure 4Fe-4S redox protein 9 can produce a single main band on a non-reducing polyacrylamide gel. The purity of the 4Fe-4S redox protein 9 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of a polynucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cl uster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • Nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein. Percentage of identity (He in J "(1990) Me thods in emzumo l ogy 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the primary biological properties of natural molecules.
  • Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which is capable of specifically binding 4Fe- 4S redox protein antigenic determinants 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated 4Fe-4S redox protein 9 means that 4Fe-4S redox protein 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify 4Fe-4S redox protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the 4Fe-4S redox protein 9 peptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, 4Fe-4S redox protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. Peptide, preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of 4Fe-4S redox protein 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the 4Fe-4S redox protein 9 of the present invention.
  • the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
  • such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide) consisting essentially of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1514 bases in length and its open reading frame 711-968 encodes 85 amino acids.
  • This polypeptide has the characteristic sequence of the 4Fe-4S redox protein family, and it can be deduced that the 4Fe-4S redox protein 9 has the structure and function represented by the 4Fe-4S redox protein family.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include c DNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that encodes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the present invention also relates to a variant of the polynucleotide described above, which encodes the same amino acid sequence as the present invention.
  • Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding 4Fe-4S redox protein 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding 4Fe-4S redox protein 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculiar Cling, A Labora tory Manual, Coldspring Harbor Labora tory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
  • genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to Yu): (1) DM-DM or DNA-RNA hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of the transcript of 4Fe-4S redox protein 9; (4) through immunological techniques Or measure biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the 4Fe-4S redox protein 9 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid amplification of cDNA ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the 4Fe-4S redox protein 9 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding 4Fe-4S redox protein 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that Contains replication origin, promoter, marker genes and translational regulatory elements.
  • Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding 4Fe-4S redox protein 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, etal. Mo l ecu l ar C l on i ng, a Labora tory Manua l, col d Spr i ng Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or p promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding 4Fe-4S redox protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art used alternative is to use MgCl 2..
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant 4Fe-4S redox protein 9 (Scence, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
  • Fig. 1 is a comparison diagram of the amino acid sequences of the functional domains of the 4Fe-4S redox protein 9 and 4Fe-4S redox protein family of the present invention.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated 4Fe-4S redox protein 9.
  • 9KDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • MRNA is formed by reverse transcription cDNA Quik mRNA Isolation Kit (Qiegene Co.) isolated from the total RNA poly (A) mRNA 0 2ug poly ( A) used.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ .
  • the bacteria formed a cDNA library.
  • Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones.
  • the sequence of the 4Fe-4S redox protein 9 of the present invention and the protein sequence encoded by the same were subjected to a profile scan program (Basiclocal Alignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215 : 403-10], performing domain analysis in databases such as prote.
  • the 4Fe-4S redox protein 9 of the present invention is homologous to the domain 4Fe-4S redox protein family, and the homology results are shown in FIG. 1.
  • Example 3 Cloning of a gene encoding 4Fe-4S redox protein 9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primerl 5'- TGACGTCATATTATCTGGACCTGA -3 '(SEQ ID NO: 3)
  • Primer2 5'- GAAGAAAAAGAGGTTTAATTGGCC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 cryptool / L C1, 10ramol / L Tris-Cl, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer , 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -actin was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). D-sequence analysis showed that the DNA of the PCR product The sequence is identical to that of 1-1514bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of 4Fe-4S redox protein 9 gene expression:
  • RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS for 30 min at 55 ° C. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant 4Fe-4S redox protein 9
  • Primer 3 5'- CCCCATATGATGCCCGGCCTGGAGAAGACCGTT -3 '(Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCAGATCCATTTGGTTTCAGGTCT -3 '(Seq ID No: 6)
  • the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3, ends of the target gene, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3).
  • the PCR reaction was performed using pBS- 0545gll plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0545gll plasmid, primers Primer-3 and Prime ⁇ -4, and 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method.
  • IPTG IPTG was added to a final concentration of 1 mmol / L, and the culture was continued for 5 hours.
  • the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation, and the supernatant was collected by centrifugation.
  • the layer was layered with an affinity chromatography column His s. Bind Quick Cartr idge (product of Novagen) capable of binding to 6 histidines (6His-Tag). Analysis, and the purified target protein 4Fe-4S redox protein 9 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 9KDa ( Figure 2).
  • a peptide synthesizer (product of PE company) was used to synthesize the following 4Fe-4S redox protein 9-specific peptides: NH2-Met-Pro-Gly-Leu-Glu-Lys-Thr-Va l-Phe-I le-Leu- Asp-Pro-Asn-Pro-C00H (SEQ ID NO: 7).
  • the peptide was coupled with hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43 0. Use 1 ⁇ 2 g of the above hemocyanin peptide complex with complete Freund's adjuvant.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to keep the probes and targets Nucleic acid hybridization.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30 ° /. -70 ° /. If it exceeds, non-specific hybridization increases;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • Low-intensity washing film 1) Take out the hybridized sample membrane.
  • probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • 4Fe-4S redox protein also known as bacterial ferredoxin, is important for a series of electron transfers during ATP generation under aerobic conditions.
  • Many similar iron-sulfur proteins such as succinate dehydrogenase complex and fumarate reductase complex have been discovered. These enzyme complexes are important members of the tricarboxylic acid (TCA) cycle and are important for material and energy metabolism. effect.
  • the characteristic sequence of the 4Fe-4S redox protein family is necessary for its biological activity.
  • the polypeptide of the present invention is a polypeptide containing a characteristic sequence of the 4Fe-4S redox protein family, and abnormal expression thereof will cause an abnormality of the tricarboxylic acid cycle, affect material and energy metabolism, and cause related diseases.
  • the abnormal expression of the 4Fe-4S redox protein 9 of the present invention will produce various diseases, especially metabolic disorders related to energy and material metabolism, embryonic development disorders, and disorders of growth and development. These diseases include but not limited to:
  • Disorders related to energy and substance metabolism disorders isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, color Aminoemia, Branched Amino Acid Deficiency Disease, Glycineemia, Hypersarcosinemia, Glutamate Metabolism Deficiency, Urea Cycle Metabolism Defect, Histidine Metabolism Defect, Lysine Metabolism Defect, Sticky Polysaccharide disease type I, mucolipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine deaminase deficiency, hyperlipoproteinemia, Congenital lactose intolerance, hereditary fructose intolerance, galactosemia, fructose metabolism deficits, glycogen storage disorders, embryonic developmental disorders: congenital abortion, cleft palate, limb absentness, limb differentiation disorders,
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Poor metabolism, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
  • 4Fe-4S redox protein 9 of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially metabolic disorders related to energy and material metabolism, embryonic development disorders, growth and development. Obstructive diseases, certain tumors, certain hereditary, hematological and immune system diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) 4 Fe-4 S redox protein 9. Agonists enhance biological functions such as 4Fe-4 S redox protein 9 to stimulate cell proliferation, and antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing 4Fe-4S redox protein 9 can be cultured with labeled 4Fe-4S redox protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • 4 Fe- 4 S 9 redox protein selected antibody antagonists include the compound, receptor and deletion analogs thereof and the like.
  • An antagonist of 4 Fe-4 S redox protein 9 can bind to 4 Fe-4 S redox protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • 4Fe-4S redox protein 9 When screening compounds as antagonists, 4Fe-4S redox protein 9 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between 4Fe-4S redox protein 9 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to 4Fe-4S redox protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, 9 molecules of 4Fe-4S redox protein should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the 4Fe-4S redox protein 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting 4 Fe-4S redox protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to 4Fe-4 S redox protein 9 include, but are not limited to, hybridoma technology (Kohler and Milstein n. Nature, 1975, 256: 495-497), triple tumor technology, human beta- Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single-chain antibodies against 4Fe-4S redox protein 9.
  • Antibodies against 4Fe-4S redox protein 9 can be used in immunohistochemistry to detect 4 Fe-4S redox protein 9 in biopsy specimens.
  • Monoclonal antibodies that bind to 4Fe-4S redox protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • 4Fe-4S redox protein 9 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill 4Fe-4S redox protein 9 positive cell.
  • the antibodies in the present invention can be used to treat or prevent 4Fe-4S redox protein 9-related diseases.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of 4Fe-4S redox protein 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of 4Fe-4S redox protein 9 levels.
  • tests are well known in the art and include FI SH assays and radioimmunoassays.
  • the level of 4Fe-4S redox protein 9 detected in the test can be used to explain the importance of 4Fe-4S redox protein 9 in various diseases and to diagnose diseases in which 4Fe-4S redox protein 9 functions.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
  • the polynucleotide encoding 4Fe-4S redox protein 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy The technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of 4Fe-4S redox protein 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated 4Fe-4S redox protein 9 to inhibit endogenous 4Fe-4S redox protein 9 activity.
  • a mutated 4Fe-4S redox protein 9 may be a shortened 4Fe-4S redox protein 9 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of 4Fe-4S redox protein 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding 4Fe-4S redox protein 9 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding 4Fe-4S redox protein 9 can be found in existing literature (Sambrook, eta l.).
  • a recombinant polynucleotide encoding 4Fe-4S redox protein 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit 4Fe-4S redox protein 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding 4Fe-4S redox protein 9 can be used for the diagnosis of diseases related to 4Fe-4S redox protein 9.
  • the polynucleotide encoding 4Fe-4S redox protein 9 can be used to detect the expression of 4Fe-4S redox protein 9 or the abnormal expression of 4Fe-4S redox protein 9 in disease states.
  • the DNA sequence encoding 4Fe-4S redox protein 9 can be used to hybridize biopsy specimens to determine the expression status of 4Fe-4S redox protein 9.
  • Hybridization techniques include Sou thern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microar ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues. diagnosis.
  • the 4Fe-4S redox protein 9 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect the transcription products of 4Fe-4S redox protein 9. Detecting mutations in the 4Fe-4S redox protein 9 gene can also be used to diagnose 4Fe-4S redox protein 9-related diseases.
  • 4Fe-4S redox protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type 4Fe_4S redox protein 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification.
  • the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
  • an important first step is to locate these D sequences on a chromosome.
  • a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. This data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, The cDNA of a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution and one gene per 20 kb).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
  • the polypeptide of the present invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • 4 Fe-4S redox protein 9 is administered in an amount effective to treat and / or prevent a particular indication.
  • the amount and range of 4 Fe-4S redox protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

L'invention concerne un nouveau polypeptide, une protéine d'oxydoréduction 4Fe-4S 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la protéine d'oxydoréduction 4Fe-4S 9.
PCT/CN2001/000053 2000-01-26 2001-01-15 Nouveau polypeptide, proteine d'oxydoreduction 4fe-4s 9, et polynucleotide codant pour ce polypeptide WO2001055424A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001229989A AU2001229989A1 (en) 2000-01-26 2001-01-15 Novel polypeptide---4fe-4s oxidoreduction protein 9 and polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111522.7 2000-01-26
CN 00111522 CN1306981A (zh) 2000-01-26 2000-01-26 一种新的多肽——4Fe－4S氧化还原蛋白9和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001055424A1 true WO2001055424A1 (fr) 2001-08-02

Family

ID=4581432

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000053 WO2001055424A1 (fr) 2000-01-26 2001-01-15 Nouveau polypeptide, proteine d'oxydoreduction 4fe-4s 9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1306981A (fr)
AU (1) AU2001229989A1 (fr)
WO (1) WO2001055424A1 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] 13 July 2000 (2000-07-13), YAMADA T. ET AL., Database accession no. BAA99562 *

Also Published As

Publication number Publication date
CN1306981A (zh) 2001-08-08
AU2001229989A1 (en) 2001-08-07

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001055424A1 (fr) Nouveau polypeptide, proteine d'oxydoreduction 4fe-4s 9, et polynucleotide codant pour ce polypeptide
WO2001047983A1 (fr) Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001048000A1 (fr) Nouveau polypeptide, fibronectine 10 de type ii, et polynucleotide codant pour ce polypeptide
WO2001064733A1 (fr) Nouveau polypeptide, facteur humain 22 lie a la transcription inverse, et polynucleotide codant pour ce polypeptide
WO2001046437A1 (fr) Nouveau polypeptide, region de liaison d'arn-eucaryote rnp-1-21, et polynucleotide codant pour ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001081385A1 (fr) Nouveau polypeptide, nucleotide reductase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001049725A1 (fr) NOUVEAU POLYPEPTIDE, FACTEUR σ-54 13, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001049731A1 (fr) Nouveau polypeptide, proteine de regulation 9 de la protease humaine, et polynucleotide codant pour ce polypeptide
WO2001049860A1 (fr) Nouveau polypeptide, helicase 9, et polynucleotide codant pour ce polypeptide
WO2001081534A2 (fr) Nouveau polypeptide, oxydoreductase 2fe-2s humaine 12, et polynucleotide codant pour ce polypeptide
WO2001049853A1 (fr) Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide
WO2001040283A1 (fr) NOUVEAU POLYPEPTIDE, ACYL-CoA DESHYDROGENASE HUMAINE 11 CONTENANT UN DOMAINE DE LIAISON ATP/GTP, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001046424A1 (fr) Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide
WO2001088153A1 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide
WO2001047971A1 (fr) Nouveau polypeptide, proteine d'echange anionique 9, et polynucleotide codant pour ce polypeptide
WO2001075122A1 (fr) Nouveau polypeptide, proteine humaine 10 de constitution de cytochromes, et polynucleotide codant pour ce polypeptide
WO2001074889A1 (fr) Nouveau polypeptide, proteine humaine 9 de chromatocyte, et polynucleotide codant pour ce polypeptide
WO2001046236A1 (fr) Nouveau polypeptide, protamine 45 humaine, et polynucleotide codant pour ce polypeptide
WO2001047984A1 (fr) Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001066579A1 (fr) Nouveau polypeptide, proteine humaine 14 de constitution de cytochromes, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP