WO2001055413A1 - Nouveau polypeptide, proteine humaine 14 recevant l'activine, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 14 recevant l'activine, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001055413A1 WO2001055413A1 PCT/CN2001/000031 CN0100031W WO0155413A1 WO 2001055413 A1 WO2001055413 A1 WO 2001055413A1 CN 0100031 W CN0100031 W CN 0100031W WO 0155413 A1 WO0155413 A1 WO 0155413A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- receptor protein
- activin receptor
- human activin
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human activin receptor protein 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. ' Background technique
- TGF-beta The transforming growth factor-beta (TGF-beta) superfamily is a secreted protein, including TGF-beta, bone morphogenetic proteins (BMPs), and activin, a hormone synthesized by the pituitary gland and secreted by the ovary ) Etc.
- BMPs bone morphogenetic proteins
- BMPs bone morphogenetic proteins
- TGF-beta transmits signals related to embryonic development through type I and ⁇ receptor kinases across cell membranes.
- Activin is an important transforming growth factor.
- Three types of activins have been found, namely type A, type B and type AB, which are respectively composed of two related ⁇ subunits ( ⁇ - ⁇ / ⁇ - A, ⁇ - ⁇ / ⁇ - ⁇ , ⁇ - ⁇ / ⁇ - ⁇ ).
- FSH follicle stimulating hormone
- Activin is an autocrine / paracrine regulator of the human placenta.
- Activin receptor 2 mRNA was found in human trophoblast cells. This gene is also found in the human brain and ovaries.
- activin is also one of the factors responsible for the occurrence and development of human atherosclerosis. Activin and its receptor mRNA can be found in epithelial cells, macrophages, and smooth muscle cells during the early onset of atherosclerosis. [Circ Res 1999 Nov 12; 85 (10): 931-9] In addition, in Huntington's disease, injection of Activin A can also prevent striatum neurons from degenerating.
- Activin receptor is a signal transmission hub that activin transmits extracellular signals into cells and activates corresponding signal pathways to complete corresponding regulatory functions. It consists of a ligand-bound extramembrane region, a transmembrane region, and a serine / threonine-specific kinase region within the membrane. There are two types of activin receptors, a type I receptor with a molecular weight of 65KD and a type II receptor with a molecular weight of 85KD. [Cell 65: 973-982, 1991] The activin receptor type I and type II binding site to activin is a hydrophilic cysteine-rich sequence that contains a half of nine amino acid residues.
- Cystine box the characteristic sequence is CCX (4-5) CN.
- the polypeptide of the present invention contains a characteristic domain of an activin receptor, is a new activin receptor protein, has a similar biological function, and is named human activin receptor protein XX.
- human activin receptor protein 14 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human activin receptors involved in these processes.
- Body protein 14 protein especially the amino acid sequence of this protein.
- the isolation of the new human activin receptor protein 14 protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human activin receptor protein 14.
- Another object of the present invention is to provide a method for producing human activin receptor protein 14.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human activin receptor protein 14.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide-human activin receptor protein 14 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human activin receptor protein 14.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human activin receptor protein 14 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human activin receptor protein 14 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human activin receptor protein 14.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when bound to human activin receptor protein 14, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the human activin receptor protein 14.
- Antagonist refers to a molecule that, when combined with human activin receptor protein 14, can block or regulate the biological or immunological activity of human activin receptor protein 14.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human activin receptor protein 14.
- Regular refers to a change in the function of human activin receptor protein 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human activin receptor protein 14. change.
- substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human activin receptor protein 14 using standard protein purification techniques. Basic The pure human activin receptor protein 14 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human activin receptor protein 14 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou t hern blot or Nor t hern blot, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cl uster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method checks all pairs The distances of each group are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by a method known in the art such as Jotun He in. (He in J., (1990) Methods in emzumo logy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and?, Which can specifically bind to the antigenic determinant of human activin receptor protein 14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human activin receptor protein 14 means that human activin receptor protein 14 is substantially free of other proteins, lipids, sugars, or other substances that are naturally associated with it. Those skilled in the art can purify human activin receptor protein 14 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human activin receptor protein 14 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human activin receptor protein 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human activin receptor protein 14.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human activin receptor protein 14 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1787 bases in length and its open reading frame 769-1143 encodes 124 amino acids.
- the polypeptide has a characteristic sequence of a member of the activin receptor protein family, and it can be deduced that the human activin receptor protein 14 has the structure and function represented by the member of the activin receptor protein family.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60 ° C; or (2) adding a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /.
- hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human activin receptor protein 14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human activin receptor protein 14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) expression The antibodies of the library are screened to detect cloned polynucleotide fragments having common structural characteristics.
- the DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of the transcript of human activin receptor protein 14; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human activin receptor protein 14 gene expression.
- ELISA enzyme-linked immunosorbent assay
- a method of applying a PCR technique to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones to splice into a full-length cDNA. sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human activin receptor protein 14 coding sequence, and a recombinant technology for producing the polypeptide of the present invention method.
- a polynucleotide sequence encoding the human activin receptor protein 14 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human activin receptor protein 14 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, synthesis technology, and in vivo recombination technology (Satnbroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human activin receptor protein 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- E. coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM may be harvested after exponential growth phase, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human activin receptor protein 14 (Scence, 1984; 224: 14 31). Generally, the following steps are taken:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of the amino acid sequences of the functional domains of the human activin receptor protein 14 and members of the activin receptor protein family of the present invention.
- Figure 2 is a polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human activin receptor protein 14.
- 14KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band. The best way to implement the invention
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Qu i k mRNA I solat ion Ki t
- the sequence of the human activin receptor protein 14 of the present invention and the protein sequence encoded by the activin receptor protein 14 of the present invention were analyzed using the profiling program (Basicloca l Al ignment search tool) in GCG [Al tschul, SF et a l. J. Mol Biol. 1990; 215: 403-10], domain analysis was performed in a database such as Prote.
- the human activin receptor protein 14 of the present invention is homologous to members of the domain activin receptor protein family, and the homology results are shown in the figure 1
- Example 3 Cloning of a gene encoding human activin receptor protein 14 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primer 1 5'- TTTGCTTGTTGGTGATTGAAACAA -3 '(SEQ ID NO: 3)
- Primer2 5'- CCCCGGCAGTACATGGAGCCCAGG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l / L KC1, 10 mmol / L Tris-
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human activin receptor protein 14 coding region sequence (769bp to 1143bp) shown in FIG. 1.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt, s solution and 200 g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human activin receptor protein 14 According to SEQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers was designed, and the sequences are as follows:
- Primer3 5'- CCCCATATGATGGAAAGTGTGTGTGCCCACATC -3 '(Seq ID No: 5)
- Primer4 5'- CATGGATCCTCACGATATTTTTAGGACATCTCC -3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the target gene are followed, respectively.
- the Ndel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865.3). Enzyme site.
- PCR was performed using the pBS-0931b01 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ l contains 10 pg of pBS-0931b01 plasmid, primers Primer-3 and Primer-4, and 1 J is 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5cc using the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 30yg / ml), positive colonies were screened by colony PCR method and sequenced. A positive clone (pET-0931b01) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host strain BL21 (pET-0931b01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (Novagen) was used to obtain 6 histidines (6His-Tag). The purified human activin receptor protein 14 was purified.
- NH2-Met-G 1 u-Ser-Va 1-Cys-Ala-His-Il e-Asp-Leu-Val-Arg-Leu-Lys-Cys- C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the total IgG Anti-peptide antibodies were isolated.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human activin receptor protein 14.
- Example 7 Use of a polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% After 15 consecutive bases are identical, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- BAB bromophenol blue indicator
- TGF-beta transforming growth factor P superfamily
- activin is one of the factors for the occurrence and development of human atherosclerosis.
- activin and its receptor mRNA can be found in epithelial cells, macrophages and smooth muscle cells; It is an autocrine / paracrine regulator of the human placenta.
- injecting Activin A can also prevent striatum neurons from degenerating.
- Activin receptor is a signal transmission hub that activin transmits extracellular signals into cells and activates corresponding signal pathways to complete corresponding regulatory functions.
- Activin receptor types I and I have characteristic sequences necessary for their biological activity.
- the polypeptide of the present invention is a polypeptide containing a characteristic sequence of the activin receptor protein family. Abnormal expression of the polypeptide will lead to abnormal activin biological activity, disrupt the embryonic morphological development, make the placental cell function abnormal, and may cause atherosclerosis and Neurodegeneration.
- the abnormal expression of the human activin receptor protein 14 of the present invention will produce various diseases, especially embryonic developmental disorders, placental diseases, cardiovascular diseases, and neurodegenerative diseases. These diseases include, but are not limited to:
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, androgynous Malformation, Atrial septal defect, Ventricular septal defect, Pulmonary stenosis, Arterial duct occlusion, Neural tube defect, Congenital hydrocephalus, Iris defect, Congenital glaucoma or cataract, Congenital deafness
- Placental disease hydatidiform mole, choriocarcinoma
- Cardiovascular diseases atherosclerosis, coronary heart disease, hypertension, thrombophlebitis, hemangiomas, hemangioendothelioma
- Nervous system degenerative diseases Alzheimer's disease, Parkinson's disease, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia, multiple sclerosis, schizophrenia, depression, paranoia Mania, anxiety, obsessive-compulsive, phobia, neurasthenia
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially embryonic developmental disorders, placental diseases, cardiovascular diseases, neurodegenerative diseases and the like.
- the invention also provides screening compounds to identify increasing (agonist) or suppressing (antagonist) human activins.
- Receptor protein 14 method of medicament. Agonists enhance biological functions such as human activin receptor protein 14 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human activin receptor protein 14 can be cultured with labeled human activin receptor protein 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human activin receptor protein 14 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human activin receptor protein 14 can bind to human activin receptor protein 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human activin receptor protein 14 When screening compounds as antagonists, human activin receptor protein 14 can be added to the bioanalytical assay to determine whether the compound is an Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human activin receptor protein 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human activin receptor protein 14 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human activin receptor protein 14 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human activin receptor protein 14 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human activin receptor protein 14 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies US Pa t No. 4946778) can also be used to produce single chain antibodies against human activin receptor protein 14.
- Antibodies against human activin receptor protein 14 can be used in immunohistochemical techniques to detect human activin receptor protein 14 in biopsy specimens.
- Monoclonal antibodies that bind to human activin receptor protein 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method The method is used to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human activin receptor protein 14 high-affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human activin receptor protein 14 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human activin receptor protein 14. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human activin receptor protein 14.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human activin receptor protein 14 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human activin receptor protein 14 detected in the test can be used to explain the importance of human activin receptor protein 14 in various diseases and to diagnose diseases in which human activin receptor protein 14 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- human activin receptor protein 14 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human activin receptor protein 14.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human activin receptor protein 14 to inhibit endogenous human activin receptor protein 14 activity.
- a mutated human activin receptor protein 14 may be a shortened human activin receptor protein 14 lacking a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human activin receptor protein 14.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human activin receptor protein 14 into a cell.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human activin receptor protein 14 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human activin receptor protein 14 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human activin receptor protein 14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human activin receptor protein 14 can be used for the diagnosis of diseases related to human activin receptor protein 14.
- the polynucleotide encoding human activin receptor protein 14 can be used to detect the expression of human activin receptor protein 14 or the abnormal expression of human activin receptor protein 14 in a disease state.
- a DNA sequence encoding human activin receptor protein 14 can be used to hybridize biopsy specimens to determine the expression of human activin receptor protein 14.
- Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mic Roa ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
- Human activin receptor protein 14 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human activin receptor protein 14 transcription products.
- Human activin receptor protein 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human activin receptor protein 14 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, the mutation may affect the expression of the protein, so the Nort Hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35 bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- sublocalization can be achieved by a similar method using a set of fragments from a specific chromosome or a large number of genomic clones.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus ck, Mende l i an Inher i tance in Man (available online with Johns Hopk ins University Wetch Medica l L i brary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human activin receptor protein 14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human activin receptor protein 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001229969A AU2001229969A1 (en) | 2000-01-26 | 2001-01-15 | Novel polypeptide---human activin receptor protein and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00111528.6 | 2000-01-26 | ||
CN 00111528 CN1307028A (zh) | 2000-01-26 | 2000-01-26 | 一种新的多肽——人活化素受体蛋白14和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001055413A1 true WO2001055413A1 (fr) | 2001-08-02 |
Family
ID=4581438
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000031 WO2001055413A1 (fr) | 2000-01-26 | 2001-01-15 | Nouveau polypeptide, proteine humaine 14 recevant l'activine, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1307028A (fr) |
AU (1) | AU2001229969A1 (fr) |
WO (1) | WO2001055413A1 (fr) |
-
2000
- 2000-01-26 CN CN 00111528 patent/CN1307028A/zh active Pending
-
2001
- 2001-01-15 AU AU2001229969A patent/AU2001229969A1/en not_active Abandoned
- 2001-01-15 WO PCT/CN2001/000031 patent/WO2001055413A1/fr active Application Filing
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [online] 2 November 2000 (2000-11-02), WATANABE K., Database accession no. NM017817 * |
DATABASE GENBANK [online] 22 February 2000 (2000-02-22), WATANABE K. ET AL., Database accession no. AK000436 * |
Also Published As
Publication number | Publication date |
---|---|
CN1307028A (zh) | 2001-08-08 |
AU2001229969A1 (en) | 2001-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002020795A1 (fr) | Nouveau polypeptide, hexokinase proteine 9.68, et polynucleotide codant ce polypeptide | |
WO2001055189A1 (fr) | NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001055413A1 (fr) | Nouveau polypeptide, proteine humaine 14 recevant l'activine, et polynucleotide codant pour ce polypeptide | |
WO2002026809A1 (fr) | Nouveau polypeptide, proteine transmembranaire 35.31 possedant un domaine permettant la duplication de facteurs de croissance epidermique, et polynucleotide codant ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001048223A1 (fr) | Nouveau polypeptide, ubiquitine-protease 18, et polynucleotide codant pour ce polypeptide | |
WO2001072832A1 (fr) | Nouveau polypeptide, famille de proteines 11 a laquelle appartiennent des hormones de croissance, et polynucleotide codant pour ce polypeptide | |
WO2001062783A1 (fr) | Nouveau polypeptide, compose de clivage 69, et polynucleotide codant pour ce polypeptide | |
WO2001064744A1 (fr) | Nouveau polypeptide, facteur de croissance du fibroblaste 14, et polynucleotide codant pour ce polypeptide | |
WO2001048000A1 (fr) | Nouveau polypeptide, fibronectine 10 de type ii, et polynucleotide codant pour ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001081594A1 (fr) | Nouveau polypeptide, proteine pax humaine 17, et polynucleotide codant pour ce polypeptide | |
WO2001048004A1 (fr) | Nouveau polypeptide, proteine de liaison de l'heparine 10, et polynucleotide codant pour ce polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2002004500A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc fpm315-17, et polynucleotide codant ce polypeptide | |
WO2001047990A1 (fr) | Nouveau polypeptide, proteine ribosomale l2 11, et polynucleotide codant pour ce polypeptide | |
WO2001072805A1 (fr) | Nouveau polypeptide, sous-unite humaine 14.19 de flavoproteine, et polynucleotide codant pour ce polypeptide | |
WO2001079428A2 (fr) | Nouveau polypeptide, proteine humaine de reparation 8.9 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001075126A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s18-9, et polynucleotide codant pour ce polypeptide | |
WO2001047966A1 (fr) | Nouveau polypeptide, sous-unite de flavoproteine 9, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001075124A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 9, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |