WO2001046420A2 - Il-17 and il-17r homologous polypeptides and therapeutic uses thereof - Google Patents
Il-17 and il-17r homologous polypeptides and therapeutic uses thereof Download PDFInfo
- Publication number
- WO2001046420A2 WO2001046420A2 PCT/US2000/034956 US0034956W WO0146420A2 WO 2001046420 A2 WO2001046420 A2 WO 2001046420A2 US 0034956 W US0034956 W US 0034956W WO 0146420 A2 WO0146420 A2 WO 0146420A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- seq
- designated
- acid sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/02—Nutrients, e.g. vitamins, minerals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
Definitions
- the present invention relates generally to the identification and isolation of novel DNA and to the recombinant production of novel polypeptides having sequence similarity to interleukin-17 and to interleukin-17 receptor protein, designated herein as "PRO" polypeptides.
- Extracellular proteins play important roles in, among other things, the formation, differentiation and maintenance of multicellular organisms.
- secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment.
- Secreted proteins have various industrial applications, including as pharmaceuticals, diagnostics, biosensors and bioreactors.
- Membrane-bound proteins and receptors can play important roles in, among other things , the formation, differentiation and maintenance of multicellular organisms. The fate of many individual cells, e.g. , proliferation, migration, differentiation, or interaction with other cells, is typically governed by information received from other cells and/or the immediate environment.
- This information is often transmitted by secreted polypeptides (for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones) which are, in turn, received and interpreted by diverse cell receptors or membrane-bound proteins.
- membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins.
- transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins .
- Protein tyrosine kinases enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.
- membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents.
- Receptor immunoadhesins for instance, can be employed as therapeutic agents to block receptor-ligand interactions .
- the membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction.
- the present invention relates to identifying novel secreted polypeptides and receptors of the interleukin-17 (IL-17) family which have been shown to be related to immune-mediated and inflammatory disease.
- Immune related and inflammatory diseases are the manifestation or consequence of fairly complex, often multiple interconnected biological pathways which in normal physiology are critical to respond to insult or injury, initiate repair from insult or injury, and mount innate and acquired defense against foreign organisms. Disease or pathology occurs when these normal physiological pathways cause additional insult or injury either as directly related to the intensity of the response, as a consequence of abnormal regulation or excessive stimulation, as a reaction to self, or as a combination of these.
- therapeutic intervention can occur by either antagonism of a detrimental process/pathway or stimulation of a beneficial process/pathway.
- immune-mediated inflammatory diseases such as rheumatoid arthritis, immune mediated renal disease, hepatobiliary diseases, inflammatory bowel disease (IBD), psoriasis, and asthma
- non-immune-mediated inflammatory diseases infectious diseases, immunodeficiency diseases, neoplasia, etc.
- T lymphocytes are an important component of a mammalian immune response. T cells recognize antigens which are associated with a self-molecule encoded by genes within the major histocompatibility complex (MHC) . The antigen may be displayed together with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer cells, grafts, etc. The T cell system eliminates these altered cells which pose a health threat to the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells proliferate extensively following recognition of an antigen-MHC complex on an antigen presenting cell. Helper T cells also secrete a variety of cytokines, i.e., lymphokines, which play a central role in the activation of B cells, cytotoxic T cells and a variety of other cells which participate in the immune response.
- MHC major histocompatibility complex
- helper T cell activation is initiated by the interaction of the T cell receptor (TCR)
- activation of T cells involves additional costimulation induced by cytokines released by the antigen presenting cell or through interactions with membrane bound molecules on the antigen presenting cell and the T cell.
- the cytokines IL-1 and IL-6 have been shown to provide a costimulatory signal.
- the interaction between the B7 molecule expressed on the surface of an antigen presenting cell and CD28 and CTLA-4 molecules expressed on the T cell surface effect T cell activation.
- Activated T cells express an increased number of cellular adhesion molecules, such as ICAM-1, integrins, VLA-4, LFA-1, CD56, etc.
- T-cell proliferation in a mixed lymphocyte culture or mixed lymphocyte reaction is an established indication of the ability of a compound to stimulate the immune system.
- MLR mixed lymphocyte reaction
- inflammatory cells infiltrate the site of injury or infection.
- the migrating cells may be neutrophilic, eosinophilic, monocytic or lymphocytic as can be determined by histologic examination of the affected tissues.
- Immune related diseases could be treated by suppressing the immune response. Using neutralizing antibodies that inhibit molecules having immune stimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases. Molecules which inhibit the immune response can be utilized (proteins directly or via the use of antibody agonists) to inhibit the immune response and thus ameliorate immune related disease.
- Interleukin-17 has been identified as a celluler ortholog of a protein encoded by the T lymphotropic Herpes virus Saimiri (HSV) [see, Rouvier et al. , J. Immunol.. 150(12): 5445-5456 (19993); Yao et al, J. Immunol., 122(12):5483-5486 (1995) and Yao gt al. , Immunity, 3(61:811-821 (1995)]. Subsequent characterization has shown that this protein is a potent cytokine that acts to induce proinflammatory responses in a wide variety of peripheral tissues.
- HSV T lymphotropic Herpes virus Saimiri
- IL-17 is a hom ⁇ dimeric cytokine of about 32 kDa which is synthesized and secreted only by CD4 + activated memory T cells (reviewed in Fossiez et ah, Int. Rev. Immunol., 16: 541-551 [1998]).
- IL-17 exhibits pleitropic biological activities on various types of cells. IL-17 has been found to stimulate the production of many cytokines. It induces the secretion of IL-6, IL-8, prostaglandin E2, MCP-1 and G-CSF by adherent cells like fibroblasts, keratinocytes, epithelial and endothelial cells. IL-17 also has the ability to induce ICAM-1 surface expression, proliferation of T cells, and growth and differentiation of CD34 + human progenitors into neutrophils.
- IL-17 has also been implicated in bone metabolism, and has been suggested to play an important role in pathological conditions characterized by the presence of activated T cells and TNF- ⁇ production such as rheumatoid arthritis and loosening of bone implants (Van Bezooijen et al. , J. Bone Miner. Res., 14: 1513-1521 [1999]).
- Activated T cells of synovial tissue derived from rheumatoid arthritis patients were found to secrete higher amounts of IL-17 than those derived from normal individuals or osteoarthritis patients (Chabaud et al., Arthritis Rheum. , 42: 963-970 [1999]).
- IL-17 has been shown to induce the expression of osteoclast differentiation factor (ODF) mRNA in osteoblasts (Kotake et al, J. Clin. Invest., 103: 1345-1352 [1999]). ODF stimulates differentiation of progenitor cells into osteoclasts, the cells involved in bone resorption.
- ODF osteoclast differentiation factor
- IL-17 Since the level of IL-17 is significantly increased in synovial fluid of rheumatoid arthritis patients, it appears that IL-17 induced osteoclast formation plays a crucial role in bone resorption in rheumatoid arthritis .
- IL- 17 is also believed to play a key role in certain other autoimmune disorders such as multiple sclerosis (Matusevicius et al. , Mult. Scler., 5: 101-104 [1999]).
- IL-17 has further been shown, by intracellular signalling, to stimulate Ca 2+ influx and a reduction in [cAMP]j in human macrophages (Jovanovic et al. , J. Immunol.. 160:3513 [1998]).
- Fibroblasts treated with EL- 17 induce the activation of NF- ⁇ B, [Yao et al., Immunity, 3:811 (1995), Jovanovic et al, supra], while macrophages treated with it activate NF- ⁇ B and mitogen-activated protein kinases (Shalom-Barek et al. , J. Biol. Chem., 273:27467 [1998]).
- IL-17 also shares sequence similarity with mammalian cytokine-like factor 7 that is involved in bone and cartilage growth.
- Other proteins with which IL-17 polypeptides share sequence similarity are human embyo-derived interleukin-related factor (EDJJRF) and interleukin-20.
- IL-17 the cell surface receptor for IL-17 has been found to be widely expressed in many tissues and cell types (Yao et al. , Cytokine, 9:794 [1997]). While the amino acid sequence of the human IL-17 receptor (IL-R) (866 amino acids) predicts a protein with a single transmembrane domain and a long, 525 amino acid intracellular domain, the receptor sequence is unique and is not similar to that of any of the receptors from the cytokine/growth factor receptor family. This coupled with the lack of similarity of EL-17 itself to other known proteins indicates that IL-17 and its receptor may be part of a novel family of signalling proteins and receptors.
- IL-17 receptor the amino acid sequence of the human IL-17 receptor
- IL-17 activity is mediated through binding to its unique cell surface receptor, wherein previous studies have shown that contacting T cells with a soluble form of the EL-17 receptor polypeptide inhibited T cell proliferation and IL-2 production induced by PHA, concanavalin A and anti-TCR monoclonal antibody (Yao et al; J. Immunol., 155:5483-5486 [1995]).
- a soluble form of the EL-17 receptor polypeptide inhibited T cell proliferation and IL-2 production induced by PHA, concanavalin A and anti-TCR monoclonal antibody.
- IL-17B and IL-17C are clearly related to IL- 17, establishing that there exists a family of IL-17-like molecules (Li et al., Proc. Natl. Acad. Sci. (USA), 97(2):773-778 [2000]). Interestingly, they do not appear to be ligands for IL-17 receptor, suggesting that there exists other molecules that serve as cognate receptors for these factors.
- IL-17 may contribute to a number of important medical conditions related to immune function: including rheumatoid arthritis, immune mediated renal diseases, hepatobiliary diseases, inflammatory bowel disease, psoriasis, asthma, multiple sclerosis, atherosclerosis, promotion of tumor growth, or degenerative joint disease.
- rheumatoid arthritis immune mediated renal diseases
- hepatobiliary diseases hepatobiliary diseases
- inflammatory bowel disease e.g., asthma
- psoriasis e.g., chronic fibroblast growth
- asthma rheumatoid arthritis
- the present invention describes the cloning and characterization of novel proteins (designated herein as "PRO” polypeptides) that are similar in amino acid sequence to IL-17, and active variants thereof, as well as novel interleukin-receptor molecules which have been shown to interact with the novel EL-17 protein ligands.
- PRO novel proteins
- the present invention concerns compositions and methods useful for the diagnosis and treatment of immune related disease in mammals, including humans.
- the present invention is based on the identification of proteins (including agonist and antagonist antibodies) which either stimulate or inhibit the immune response in mammals.
- Immune related diseases can be treated by suppressing or enhancing the immune response. Molecules that enhance the immune response stimulate or potentiate the immune response to an antigen. Molecules which stimulate the immune response can be used therapeutically where enhancement of the immune • response would be beneficial.
- molecules that suppress the immune response attenuate or reduce the immune response to an antigen e.g. , neutralizing antibodies
- the PRO polypeptides of the present invention and agonists and antagonists thereof are also useful to prepare medicines and medicaments for the treatment of immune-related and inflammatory diseases. In a specific aspect, such medicines and
- medicaments comprise a therapeutically effective amount of a PRO polypeptide, agonist or antagonist thereof with a pharmaceutically acceptable carrier.
- the admixture is sterile.
- the invention concerns a method of identifying agonists of or antagonists to a PRO polypeptide which comprises contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide.
- the PRO polypeptide is a native sequence PRO polypeptide.
- the PRO agonist or antagonist is an anti-PRO antibody.
- the invention concerns a composition of matter comprising a PRO polypeptide or an agonist or antagonist antibody which binds the polypeptide in admixture with a carrier or excipient.
- the composition comprises a therapeutically effective amount of the polypeptide or antibody.
- the composition when the composition comprises an immune stimulating molecule, the composition is useful for: (a) enhancing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) stimulating or enhancing an immune response in a mammal in need thereof, (c) increasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen, (d) stimulating the activity of T-lymphocytes or (e) increasing the vascular permeability.
- the composition when the composition comprises an immune inhibiting molecule, the composition is useful for: (a) decreasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) inhibiting or reducing an immune response in a mammal in need thereof, (c) decreasing the activity of T-lymphocytes or (d) decreasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen.
- the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent.
- the composition is sterile.
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of a PRO polypeptide, an agonist thereof, or an antagonist thereto.
- the immune related disorder is selected form the group consisting of: systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis, idiopathic inflammatory myopathies, Sj ⁇ gren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune-mediated renal disease, demyelinating diseases of the central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy, hepat
- the invention provides an antibody which specifically binds to any of the above or below described polypeptides.
- the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
- the present invention concerns an isolated antibody which binds a PRO polypeptide.
- the antibody mimics the activity of a PRO polypeptide (an agonist antibody) or conversely the antibody inhibits or neutralizes the activity of a PRO polypeptide (an antagonist antibody).
- the antibody is a monoclonal antibody, which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support.
- CDR complementarity determining region
- the antibody is an antibody fragment, a monoclonal antibody, a single-chain antibody, or an anti-idiotypic antibody.
- the present invention provides a composition comprising an anti-PRO antibody in admixture with a pharmaceutically acceptable carrier.
- the composition comprises a therapeutically effective amount of the antibody.
- the composition is sterile.
- the composition may be administered in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability.
- the antibody is a monoclonal antibody, an antibody fragment, a humanized antibody, or a single-chain antibody.
- the invention concerns an article of manufacture, comprising:
- composition of matter comprising a PRO polypeptide or agonist, antagonist, or an antibody that specifically binds to said polypeptide thereof;
- composition may comprise a therapeutically effective amount of the PRO polypeptide or the agonist or antagonist thereof.
- the present invention concerns a method of diagnosing an immune related disease in a mammal, comprising detecting the level of expression of a gene encoding a PRO polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample indicates the presence of immune related disease in the mammal from which the test tissue cells were obtained.
- the present invention concerns a method of diagnosing an immune disease in a mammal, comprising (a) contacting an anti-PRO antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and a PRO polypeptide, in the test sample; wherein the formation of said complex is indicative of the presence or absence of said disease.
- the detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type.
- a larger quantity of complexes formed in the test sample indicates the presence or absence of an immune disease in the mammal from which the test tissue cells were obtained.
- the antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
- the test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system.
- the invention provides a method for determining the presence of a PRO polypeptide in a sample comprising exposing a test sample of cells suspected of containing the PRO polypeptide to an anti-PRO antibody and determining the binding of said antibody to said cell sample.
- the sample comprises a cell suspected of containing the PRO polypeptide and the antibody binds to the cell.
- the antibody is preferably detectably labeled and/or bound to a solid support.
- the present invention concerns an immune-related disease diagnostic kit, comprising an anti-PRO antibody and a carrier in suitable packaging.
- the kit preferably contains instructions for using the antibody to detect the presence of the PRO polypeptide.
- the carrier is pharmaceutically acceptable.
- the present invention concerns a diagnostic kit, containing an anti-PRO antibody in suitable packaging.
- the kit preferably contains instructions for using the antibody to detect the PRO polypeptide.
- the invention provides a method of diagnosing an immune-related disease in a mammal which comprises detecting the presence or absence or a PRO polypeptide in a test sample of tissue cells obtained from said mammal, wherein the presence or absence of the PRO polypeptide in said test sample is indicative of the presence of an immune-related disease in said mammal.
- the present invention concerns a method for identifying an agonist of a PRO polypeptide comprising:
- the invention concerns a method for identifying a compound capable of inhibiting the activity of a' PRO polypeptide comprising contacting a candidate compound with a PRO polypeptide under conditions and for a time sufficient to allow these two components to interact and determining whether the activity of the PRO polypeptide is inhibited.
- either the candidate compound or the PRO polypeptide is immobilized on a solid support.
- the non-immobilized component carries a detectable label. In a preferred aspect, this method comprises the steps of:
- the invention provides a method for identifying a compound that inhibits the expression of a PRO polypeptide in cells that normally express the polypeptide, wherein the, method comprises contacting the cells with a test compound and determining whether the expression of the PRO polypeptide is inhibited.
- this method comprises the steps of: (a) contacting cells and a test compound to be screened under conditions suitable for allowing expression of the PRO polypeptide; and (b) determining the inhibition of expression of said polypeptide.
- the present invention concerns a method for treating an immune-related disorder in a mammal that suffers therefrom comprising administering to the mammal a nucleic acid molecule that codes for either (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide or (c) an antagonist of a PRO polypeptide, wherein said agonist or antagonist may be an anti-PRO antibody.
- the mammal is human.
- the nucleic acid is administered via ex vivo gene therapy.
- the nucleic acid is comprised within a vector, more preferably an adenoviral, adeno-associated viral, lentiviral or retroviral vector.
- the invention provides a recombinant viral particle comprising a viral vector' consisting essentially of a promoter, nucleic acid encoding (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or (c) an antagonist polypeptide of a PRO polypeptide, and a signal sequence for cellular secretion of the polypeptide, wherein the viral vector is in association with viral structural proteins .
- the signal sequence is from a mammal, such as from a native PRO polypeptide.
- the invention concerns an ex vivo producer cell comprising a nucleic acid construct that expresses retroviral structural proteins and also comprises a retroviral vector consisting essentially of a promoter, nucleic acid encoding (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide or (c) an antagonist polypeptide of a PRO polypeptide, and a signal sequence for cellular secretion of the polypeptide, wherein said producer cell packages the retroviral vector in association with the structural proteins to produce recombinant retroviral particles.
- the invention provides a method for enhancing the infiltration of inflammatory cells from the vasculature into a tissue of a mammal comprising administering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the infiltration of inflammatory cells from the vasculature in the mammal is enhanced.
- the invention provides a method for decreasing the infiltration of inflammatory cells from the vasculature into a tissue of a mammal comprising achninistering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the infiltration of inflammatory cells from the vasculature in the mammal is decreased.
- the invention provides a method of increasing the activity of T-lymphocytes in a mammal comprising administering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the activity of T-lymphocytes in the mammal is increased.
- the invention provides a method of decreasing the activity of T-lymphocytes in a mammal comprising actarinistering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the activity of T-lymphocytes in the mammal is decreased.
- the invention provides a method of increasing the proliferation of T-lymphocytes in a mammal comprising adniinistering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the proliferation of T-lymphocytes in the mammal is increased.
- the invention provides a method of decreasing the proliferation of T-lymphocytes in a mammal comprising administering to said mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein the proliferation of T-lymphocytes in the mammal is decreased.
- the invention provides a method of stimulating the proliferation of T-cells comprising contacting said T-cells with a PRO1031 or PRO10272 polypeptide or agonist thereof, wherein said T-cell proliferation is stimulated.
- the invention provides a method of decreasing the proliferation of T-lymphocytes comprising contacting said T-lymphocytes with an antagonist of a PRO1031 or PRO10272 polypeptide, wherein the proliferation of T-lymphocytes is decreased.
- the invention provides a method of enhancing the infiltration of inflammatory cells into a tissue of a mammal comprising administering an effective amount of a PRO1031 polypeptide or agonist thereof, wherein said infiltration is enhanced.
- the invention provides a method of decreasing the infiltration of inflammatory cells into a tissue of a mammal comprising administering an effective amount of an antagonist of a PRO1031 polypeptide, wherein said infiltration is decreased.
- the invention provides a method for inhibiting angiogenesis induced by a PRO1031 polypeptide or an agonist thereof in a mammal comprising aciniissering a therapeutically effective amount of an anti-PRO1031 antibody to the mammal.
- the mammal is a human, and more preferably the mammal has a tumor or a retinal disorder.
- the invention provides a method for stimulating angiogenesis induced by a PRO1031 polypeptide in a mammal comprising administering a therapeutically effective amount of a PRO1031 polypeptide or agonist thereof to the mammal.
- the mammal is a human, and more preferably angiogenesis would promote tissue regeneration or wound healing.
- the invention provides a method for inhibiting angiogenesis in a mammal comprising administering a therapeutically effective amount of an antagonist of a PRO1031 polypeptide to the mammal, wherein said angiogenesis is inhibited.
- the invention concerns the use of a PRO1031 or PR01122 polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-PRO1031 or anti-PR01122 antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the PRO 1031 or PR01122 polypeptide or an agonist or antagonist thereof (e.g., anti-PRO1031 or anti-PR01122).
- the invention concerns the use of a PRO1031 or PR01122 polypeptide, or an agonist or antagonist thereof in a method for treating a degenerative cartilaginous disorder.
- the invention relates to a method of treating a degenerative cartilaginous disorder in a ma mal comprising administering a therapeutically effective amount of a PRO1031 or PR01122 polypeptide, agonist, or antagonist thereof, to said mammal suffering from said disorder.
- the invention relates to a kit comprising a composition comprising a
- the invention relates to a method of detecting a polypeptide designated as A, B, or C in a sample suspected of containing an A, B, or C polypeptide, said method comprising contacting said sample with a polypeptide designated herein as D, E, or F and deterniining the formation of a A/D, BID, C/E or C/F polypeptide conjugate in said sample, wherein the formation of said conjugate is indicative of the presence of an A, B, or C polypeptide in said sample and wherein A is a PRO1031 polypeptide (herein also designated DL-17B), B is a PRO10272 polypeptide (herein also designated EL-17E), C is a PRO20110 polypeptide (herein also designated EL-17F), D is a PRO5801 polypeptide (herein also designated IL-17RH1), E is a PROl polypeptide (herein known as IL-17R), and F is a PRO20040 polypeptide (herein also designated
- said D, E, or F polypeptide is labeled with a detectable label and said D, E, or F polypeptide is attached to a solid support.
- the invention relates to a method of detecting a polypeptide designated as D, E, or F in a sample suspected of containing an D, E, or F polypeptide, said method comprising contacting said sample with a polypeptide designated herein as A, B, or C and determining the formation of a A/D, B/D, C/E, or C/F polypeptide conjugate in said sample, wherein the formation of said conjugate is indicative of the presence of an A, B, or C polypeptide in said sample and wherein A is a PRO1031 polypeptide (herein also designated D -17B), B is aPRO10272 polypeptide (herein also designated EL-17E), C is a PRO20110 polypeptide (herein also designated IL-17F), D is a PRO5801 polypeptide (herein also designated EL-17RH1), E is a PROl polypeptide (herein known as IL-17R), and F is a PRO20040 polypeptide (herein also designated EL-17
- said sample comprises cells suspected of expressing said D, E, or F polypeptide.
- said A, B, or C polypeptide is labeled with a detectable label and said A, B, or C polypeptide is attached to a solid support.
- the invention relates to a method of linking a bioactive molecule to a cell expressing a polypeptide designated as A, B, or C, said method comprising contacting said cell with a polypeptide designated as D, E, or F that is bound to said bioactive molecule and allowing said A, B, or C and said D, E, or F polypeptides to bind to one another, thereby linking said bioactive molecules to said cell, wherein A is a PRO1031 polypeptide (herein also designated IL-17B), B is a PRO10272 polypeptide (herein also designated IL-17E), C is a PRO20110 polypeptide (herein also designated IL-17F), D is a PRO5801 polypeptide (herein also designated EL-17RH1), E is a PROl polypeptide (herein known as EL-17R), and F is a PRO20040 polypeptide (herein also designated JX-17RH2).
- said bioactive molecule is a to
- the invention relates to a method of linking a bioactive molecule to a cell expressing a polypeptide designated as D, E, or F, said method comprising contacting said cell with a polypeptide designated as A, B, or C that is bound to said bioactive molecule and allowing said A, B, or C and said D, E, or F polypeptides to bind to one another, thereby linking said bioactive molecules to said cell, wherein A is a PRO1031 polypeptide (herein also designated IL-17B), B is a PRO10272 polypeptide (herein also designated DL-17E), C is a PRO20110 polypeptide (herein also designated IL-17F), D is a PRO5801 polypeptide (herein also designated IL-17RH1), E is a PROl polypeptide (herein known as EL-17R), and F is a PRO20040 polypeptide (herein also designated IL-17RH2).
- said bioactive molecule is a tox
- the invention relates to a method of modulating at least one biological activity of a cell expressing a polypeptide designated as A, B, or C, said method comprising contacting said cell with a polypeptide designated as D, E, or F or an anti-A, anti-B, or anti-C polypeptide antibody, whereby said D, E, or F polypeptide or anti-A, anti-B, or anti-C polypeptide antibody binds to said A, B, or C polypeptide, thereby modulating at least one biological activity of said cell, wherein A is a PRO1031 polypeptide (herein also designated IL-17B), B is aPRO10272 polypeptide (herein also designated IL-17E), C is a PRO20110 polypeptide (herein also designated IL-17F), D is a PRO5801 polypeptide (herein also designated IL-17RH1), E is a PROl polypeptide (herein known as IL-17R), and F is a PRO20040 polypeptide (herein also designated
- the invention relates to a method of modulating at least one biological activity of a cell expressing a polypeptide designated as D, E, or F, said method comprising contacting said cell with a polypeptide designated as A, B, or C or an anti-D, anti-E, or anti-F polypeptide antibody, whereby said A, B, or C polypeptide or anti-D, anti-E, or anti-F polypeptide antibody binds to said D, E, or F polypeptide, thereby modulating at least one biological activity of said cell, wherein A is a PRO1031 polypeptide (herein also designated IL-17B), B is a PRO10272 polypeptide (herein also designated JL-17E), C is a PRO20110 polypeptide (herein also designated IL-17F), D is a PRO5801 polypeptide (herein also designated IL-17RH1), E is a PROl polypeptide (herein known as EL-17R), and F is a PRO20040 polypeptide
- the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PRO polypeptide.
- the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80 % nucleic acid sequence identity, alternatively at least about 81 % nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83 % nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86 % nucleic acid sequence identity, alternatively at least about 87 % nucleic acid sequence identity, alternatively at least about 88 % nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93 % nucleic acid sequence identity, alternatively at least about 94 % nucleic acid sequence identity, alternatively at least about 95% nucle
- nucleic acid sequence identity alternatively at least about 81 % nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83 % nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86 % nucleic acid sequence identity, alternatively at least about 87 % nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93 % nucleic acid sequence identity, alternatively at least about 94 % nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid
- the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81 % nucleic acid sequence identity, alternatively at least about 82 % nucleic acid sequence identify, alternatively at least about 83 % nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89 % nucleic acid sequence identity, alternatively at least about 90 % nucleic acid sequence identity, alternatively at least' about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93 % nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95%
- Another aspect of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated, or is complementary to such encoding nucleotide sequence, wherein the transmembrane domain(s) of such polypeptide are disclosed herein. Therefore, soluble extracellular domains of the herein described PRO polypeptides are contemplated.
- Another embodiment is directed to fragments of a PRO polypeptide coding sequence, or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of a PRO polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-PRO antibody or as antisense oligonucleotide probes.
- nucleic acid fragments are usually at least about 20 nucleotides in length, alternatively at least about 30 nucleotides in length, alternatively at least about 40 nucleotides in length, alternatively at least about 50 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 70 nucleotides in length, alternatively at least about 80 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 100 nucleotides in length, alternatively at least about 110 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 130 nucleotides in length, alternatively at least about 140 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 160 nucleotides in length, alternatively at least about 170 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 190 nucle
- novel fragments of a PRO polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs and determining which PRO polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such PRO polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are the PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably those PRO polypeptide fragments that comprise a binding site for an anti-PRO antibody.
- the invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified.
- the invention concerns an isolated PRO polypeptide, comprising an amino acid sequence having at least about 80% amino acid sequence identity,.
- amino acid sequence identity alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83 % amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91 % amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96 % amino acid sequence identity, alternatively at least about 97 % amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively at least about 99% amino acid sequence identity to a PRO polypeptide having a full-length amino acid sequence
- the invention concerns an isolated PRO polypeptide comprising an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83 % amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89 % amino acid sequence identity, alternatively at least about 90 % amino acid sequence identity, alternatively at least about 91 % amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96 % amino acid sequence identity, alternatively at least about 97 % amino acid sequence identity, alternatively at least about 98% amino
- the invention concerns an isolated PRO polypeptide comprising an amino acid sequence scoring at least about 80% positives, alternatively at least about 81% positives, alternatively at least about 82% positives, alternatively at least about 83% positives, alternatively at least about 84% positives, alternatively at least about 85% positives, alternatively at least about 86% positives, alternatively at least about 87% positives, alternatively at least about 88% positives, alternatively at least about 89% positives, alternatively at least about 90 % positives , alternatively at least about 91 % positives , alternatively at least about 92 % positives , alternatively at least about 93% positives, alternatively at least about 94% positives, alternatively at least about 95 % positives, alternatively at least about 96% positives, alternatively at least about 97% positives, alternatively at least about 98% positives and alternatively at least about 99% positives when compared with the amino acid sequence of a PRO polypeptide having a full-length amino acid sequence as disclosed here
- the invention provides an isolated PRO polypeptide without the N-terminal signal sequence and/ r the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described.
- Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture.
- Another aspect of the invention provides an isolated PRO polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated.
- Processes for 'producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture.
- the invention concerns agonists and antagonists of a native PRO polypeptide as defined herein.
- the agonist or antagonist is an anti-PRO antibody or a small molecule.
- the invention concerns a method of identifying agonists or antagonists to a PRO polypeptide which comprise contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide.
- the PRO polypeptide is a native PRO polypeptide.
- the invention concerns a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide as herein described, or an anti-PRO antibody, in combination with a carrier.
- the carrier is a pharmaceutically acceptable carrier.
- Another embodiment of the present invention is directed to the use of a PRO polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-PRO antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody.
- the invention provides vectors comprising DNA encoding any of the herein described polypeptides.
- Host cell comprising any such vector are also provided.
- the host cells may be CHO cells, E. coli, yeast, or Baculovirus-infected insect cells.
- a process for producing any of the herein described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.
- the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence.
- Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin.
- the invention provides an antibody which specifically binds to any of the above or below described polypeptides.
- the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
- the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences.
- Figure 1 shows a nucleotide sequence (SEQ ID NO: 1) of a native sequence PRO1031 cDNA, wherein
- SEQ ID NO:l is a clone designated herein as "DNA59294-1381-1".
- Figure 2 shows the amino acid sequence (SEQ ID NO:2) derived from the coding sequence of SEQ ED NO:l shown in Figure 1.
- Figure 3 shows a nucleotide sequence (SEQ ID NO:3) of a native sequence PROl 122 cDNA, wherein SEQ ID NO:3 is a clone designated herein as "DNA62377-1381-1".
- Figure 4 shows the amino acid sequence (SEQ ED NO:4) derived from the coding sequence of SEQ ID NO: 3 shown in Figure 3.
- Figure 5 shows a nucleotide sequence (SEQ ED NO:5) of a native sequence PRO10272 cDNA, wherein SEQ ED NO:5 is a clone designated herein as "DNA147531-2821".
- Figure 6 shows the amino acid sequence (SEQ ED NO:6) derived from the coding sequence of SEQ ED
- Figure 7 shows a nucleotide sequence (SEQ ED NO:7) of a native sequence PR021175 cDNA, wherein SEQ ID NO:7 is a clone designated herein as "DNA173894-2947".
- Figure 8 shows the amino acid sequence (SEQ ED NO: 8) derived from the coding sequence of SEQ ED NO:7 shown in Figure 7.
- Figure 9 shows a nucleotide sequence (SEQ ED NO:9) of a native sequence PRO20110 cDNA, wherein SEQ ED NO:9 is a clone designated herein as "DNA166819".
- Figure 10 shows the amino acid sequence (SEQ ED NO: 10) derived from the coding sequence of SEQ ED NO:9 shown in Figure 9.
- Figure 11 shows a nucleotide sequence (SEQ ED NO: 11) of a native sequence PRO5801 cDNA, wherein SEQ ID NO: 11 is a clone designated herein as "DNA115291-2681".
- Figure 12 shows the amino acid sequence (SEQ ED NO: 12) derived from the coding sequence of SEQ ED NO:ll shown in Figure 11.
- Figure 13 shows a nucleotide sequence (SEQ ED NO: 13) of a native sequence PRO20040 cDNA, wherein SEQ ED NO: 13 is a clone designated herein as "DNA164625-2890" .
- Figure 14 shows the amino acid sequence (SEQ ED NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in Figure 13.
- Figure 15 shows a nucleotide sequence (SEQ ED NO : 15) of a native sequence PR09877 cDNA, wherein
- SEQ ID NO:15 is a clone designated herein as "DNA119502-2789".
- Figure 16 shows the amino acid sequence (SEQ ED NO: 16) derived from the coding sequence of SEQ ED NO: 15 shown in Figure 15.
- Figure 17 shows a nucleotide sequence (SEQ ID NO: 17) of a native sequence PRO20026 cDNA, wherein SEQ ED NO:17 is a clone designated herein as "DNA154095-2998".
- Figure 18 shows the amino acid sequence (SEQ ED NO: 18) derived from the coding sequence of SEQ ID NO: 17 shown in Figure 17.
- Figure 19 shows the alignment of the human EL-17 family members: h-IL17 [SEQ ID NO:40] ; h-lL17B [PRO1031; SEQ ID NO:2]; h-EL17C [PR01122; SEQED NO:4]; h-IL17D [PR021175; SEQ ED NO: 8]; h-ILE [PRO10272; SEQ ID NO:6]; andh-IL17F [PRO20110; SEQ ID NO:10].
- Figure 20 shows the relative tissue expression distribution of the IL-17B ligand (PRO1031).
- Figure 21 shows the relative tissue expression distribution of the EL-17C ligand (PROl 122).
- Figure 22 shows the relative tissue expression distribution of the EL-17D ligand (PR021175).
- Figure 23 shows mRNA expression of IL-17E (PRO10272) by RT-PCR analysis.
- RNA from the indicated tissues was subjected to RT-PCR with primers that were designed to amplify the entire coding sequence of EL-17E.
- the PCR product was resolved by agarose gel electrophoresis, transfered to nylon membrane and probed with a 32 P-labeled IL-17E cDNA probe.
- Figure 24 shows the relative tissue expression distribution of the EL-17F ligand (PRO20110).
- Figure 25 shows the relative tissue expression distribution of the EL-17RH1 receptor (PRO5801).
- Figure 26 shows the relative tissue expression distribution of the EL-17RH2 receptor (PRO20040).
- Figure 27 shows the relative tissue expression distribution of the EL-17RH3 receptor (PR09877).
- Figure 28 shows the relative tissue expression distribution of the EL-17RH4 receptor (PRO20026).
- Figure 29 shows immunoprecipitation of EL-17R extracellular domain (ECD) with IL-17, EL-17B
- IL-17R ECD His-tagged IL-17R ECD was expressed in 293 cells and metabolically labeled with 35 S as described in EXAMPLE 21. The supernatant was recovered and Ni-NTA beads were used to affinity precipitate the His-tagged EL-17R ECD in the supemantant (lane 1). In part A., EL-17, EL-17B.Fc and EL-17C.Fc, or control Fc fusion proteins were incubated with the supernatant and protein-A-agarose beads were added to precipitate the Fc fusion proteins. For the EL-17 immu ⁇ oprecipitation reaction, anti-EL17 antibodies were included. Part B.
- NuPAGE (4-12% Bis-Tris) gels are indicated on the left of each panel.
- Figure 30 shows the alignment of the human EL-17 family members (h-EL17; h-EL17B; h-EL17C; and h-ELE). The predicted signal sequences are underlined. conserveed cysteines are indicated by bullet, and potential N-linked glycosylation sites are boxed.
- Figure 31 shows mRNA expression of IL-17RH1 receptor. (PRO5801).
- Figure 31A shows Northern blot analysis of EL-17RH1 receptor in selected tissues.
- Figure 31B shows the quantitative PCR analysis of IL- 17RH1 mRNA expression in selected tissues.
- Figure 32 shows EL-17E (PRO10272) ligand binding to EL-17RH1 receptor (PRO5801).
- Figure 32A shows a comparison of IL-17 and IL-17E (PRO10272) ligand binding to EL-17R receptor (herein designated PROl) and EL-17RH1 receptor (PRO5801).
- GCP green fluorescent protein
- EL-17R or EL-17RH1 receptors 293 cells were transiently co-transfected with expression vectors for green fluorescent protein (GCP) and EL-17R or EL-17RH1 receptors as indicated. Cells were incubated with EL-17-Fc or EL-17E-Fc protein as indicated and binding was revealed with PE conjugated anti-human Fc antibody .
- FACS curves show PE staining within the co-transfected GFP positive cell population.
- FIG 32B His-epitope tagged EL-17RH1 receptor extracellular domain was incubated with ligand-Fc fusion protein for members of the human IL-17 family depicted as follows: lane 1, EL-17RH1-His direct load; lane 2, EL-17; lane 3, IL-17B (PRO1031); lane 4, IL-17C (PROH22); and lane 5, IL-17E (PRO10272).
- Ligand immunoadhesins were immunoprecipitated with Protein A beads and bound EL-17RH1 receptor was analyzed by Western Blot analysis with antibody to the His-epitope tag. The positions of molecular weight markers (kDa) are indicated on the left.
- Figure 33 shows the induction of NF- ⁇ B by EL-17E (PRO10272).
- Figure 33 (part A) shows the results of transiently transfecting human 293 and TK-10 cells with the NF- ⁇ B responsive luciferase reporter pGL3.ELAM.tk and expression vector for EL-17E as indicated. Luciferase activity was determined as indicated in EXAMPLE 22.
- Figure 33 (part B) depicts titration of NF- ⁇ B induction by IL-17E. Human 293 cells were transfected with the NF- ⁇ B responsive luciferase reporter pGL3. ELAM.tk and the indicated expression vector for EL-17E as indicated.
- Figure 34 shows the effect of EL-17E (PROl 0272) on EL-8 production.
- Human TK-10 kidney derived cells lines were incubated by Elisa. Shown is the level of EL-8 measured minus the level of EL-8 production observed in the absence of cytokine addition. The experiments were repeated several times with similar results.
- Figure 35 depicts the EL-17 family of cytokines and the complex pattern of overlapping receptor-ligand specificities. From left to right, Figure 35 demonstrates that EL-17 ligand binds to the EL-17 receptor (EL-17R; herein designated PROl); EL-17B ligand (PRO1031) binds to the EL-17RH1 receptor (PRO5801); EL-17E ligand (PRO10272) binds to the EL-17RH1 receptor (PRO5801); EL-17F ligand (PRO20110) binds to both the EL-17 receptor (EL-17R, herein designated PROl) as well as to the EL-17RH2 receptor (PRO20040); IL-17C ligand (PROl 122) and EL-17D ligand (PR021175) do not interact with EL-17R, EL-17RH1 or IL-17RH2 receptors.
- EL-17R EL-17R
- PROl EL-17B ligand
- PRO1031 binds to the EL-17
- Figure 36 depicts bar graphs representing the biological activities of IL-17, EL-17B (PRO1031), and EL-17C (PROl 122).
- Figure 36 shows human foreskin fibroblast (HFF) cells cultured with control Fc fusion protein, EL-17, EL-17B.Fc or EL-17C.Fc at 100 ng/ml for 18 hours and the conditioned media were assayed for EL-6 as described in EXAMPLE 28.
- Figure 36 (part B.) shows the human leukemic cell line, THP-1 , which was treated with the same cytokines (100 ng/ml) as above under the same conditions wherein the supernatants were assayed for the level of TNF- ⁇ release. Results are expressed as the mean +/- SE of triplicate determinations from one representative experiment.
- Figure 37 shows a time course representing the dependence of EL-17B (PRO1031) and EL-17C (PROl 122) activated TNF- ⁇ release from THP-1 cells.
- THP-1 cells were incubated with 100 ng/ml (2.2 nM) of EL-17B.Fc or EL-17C.Fc for 0.5 to 32 hours, the conditioned media harvested, and the TNF- ⁇ concentration quantitated as described in EXAMPLE 28.
- Figure 37 (part B.) THP-1 cells were treated with the EL-17B.Fc and IL-17C.Fc at a. concentration range from 0 to 120 nM for 18 hours and the TNF- ⁇ release determined.
- Figure 38 shows FACS analysis of the binding of IL-17B.Fc and IL-17C.Fc to THP-1 cells as described in EXAMPLE 29.
- THP-1 cells were incubated with EL-17B.Fc ( Figure 38 partA.) or IL-17C.Fc ( Figure 38 parfB.) or control Fc fusion proteins in PBS (5 % horse serum) and followed by addition of FITC conjugated anti- Fc secondary antibodies.
- Figure 39 shows the effect of IL-17 on articular cartilage.
- Cartilage explants were cultured with the indicated concentration of EL-17 alone (solid) or in the presence of EL-l ⁇ at the indicated concentration (hatched) or EL-lra (EL-1 receptor antagonist, R & D Systems, 1 g/ml, for 72 hours). Release of proteoglycans (PG) into the media (top panel) indicates matrix breakdown. Matrix synthesis was determined by incorporation of
- Figure 40 shows the effect of IL-17 on the release of nitric oxide. Explants were treated with EL-17 (10 ng/ml) alone (left columns) or in the presence of EL-1 ⁇ (10 ng/ml) (right columns). After 48 hours, media was assayed for nitrite concentration.
- Figure 41 shows the effect of nitric oxide (NO) on IL-17 induced changes in matrix metabolism.
- Explants were treated with EL-17 (5 ng/ml) alone (+) or with an irreversible inhibitor of nitric oxide synthase, NOS (L-NIO, Caymen Chemical, 0.5 mM). After 72 hours of treatment, media was assayed for nitrite ( Figure 41 part A.) and proteoglycans (Pgs) ( Figure 41 part B.).
- Figure 41 part C. shows proteoglycan synthesis as determined by incorporation of 35 S-sulphate into the tissue.
- Figure 42 shows the effect of the inhibition of nitric oxide (NO) on EL-17 induced changes in proteoglycan (PG) metabolism.
- Figure 43 shows the effect of EL-17C (PROl 122) on articular cartilage. Explants were treated with EL- 17C at 1 % or 0.1 % in the absence (leftmost 3 columns) or presence (rightmost 3 columns) of EL-l ⁇ (-t-) (10 ng/ml. Proteoglycan (PG) release and synthesis are shown as amount above control.
- EL-17C PROl 122
- Figure 44 shows the relative expression of the human EL-17 family in the mouse model of inflammatory bowel disease [E3D] as demonstrated by -delta Ct values relative to GAPDH.
- EL-17 shows enhanced expression in this mouse model during mild and severe stages of inflammatory bowel disease.
- EL-17E shows enhanced expression in this mouse model during mild and severe stages of inflammatory bowel disease.
- Figure 45 shows a time course study which measures the relative expression of IL-17D (PR021175) in a mouse model of stroke over the first 72 hours.
- EL-17D expression in the brain dramatically decreases from the time stroke is induced to the endpoint of 72 hours.
- PRO polypeptide and "PRO” as used herein and when immediately followed by a
- PRO/number polypeptide refers to specific polypeptide sequences as described herein.
- PRO/number polypeptide and “PRO/number” wherein the term “number” is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein).
- the PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
- PRO polypeptide refers to each individual PRO/number polypeptide disclosed herein.
- PRO polypeptide refers to each of the polypeptides individually as well as jointly. For example, descriptions of the preparation of, purification of, derivation of, formation of antibodies to or against, administration of, compositions containing, treatment of a disease with, etc., pertain to each polypeptide of the invention individually.
- PRO polypeptide also includes variants of the PRO/number polypeptides disclosed herein.
- a "native sequence PRO polypeptide” comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means.
- native sequence PRO polypeptide specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e.g. , an extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide.
- the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acids sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlined in the figures.
- PRO polypeptide refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains .
- ECD extracellular domain
- a PRO polypeptide ECD will have less than 1% of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0.5% of such domains.
- transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain.
- the exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified herein.
- an extracellular domain of a PRO polypeptide may contain from about 5 or fewer amino acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them, are comtemplated by the present invention.
- cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species.
- These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention.
- PRO polypeptide variant means an active PRO polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein.
- Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C- terminus of the full-length native amino acid sequence.
- a PRO polypeptide variant will have at least about 80% amino acid sequence identity, alternatively at least about 81% arnino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91 % amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93 % amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98 % amino acid sequence identity and alternatively at least about 99 %
- PRO variant polypeptides are at least about 10 amino acids in length, alternatively at least about 20 amino acids in length, alternatively at least about 30 amino acids in length, alternatively at least about 40 amino acids in length, alternatively at least about 50 amino acids in length, alternatively at least about 60 amino acids in length, alternatively at least about 70 amino acids in length, alternatively at least about 80 amino acids in length, alternatively at least about 90 amino acids in length, alternatively at least about 100 amino acids in length, alternatively at least about 150 amino acids in length, alternatively at least about 200 amino acids in length, alternatively at least about 300 amino acids in length, or more.
- Percent (%) amino acid sequence identity with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific PRO polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
- % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 below.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1 below.
- the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- Tables 2 and 3 demonstrate how to calculate the % amino acid sequence identity of the amino acid sequence designated "Comparison Protein” to the amino acid sequence designated "PRO", wherein “PRO” represents the amino acid sequence of a hypothetical PRO polypeptide of interest, “Comparison Protein” represents the amino acid sequence of a polypeptide against which the "PRO” polypeptide of interest is being compared, and "X, "Y” and “Z” each represent different hypothetical amino acid residues. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
- a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (i. e. , the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest.
- amino acid sequence A is the comparison amino acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest.
- Percent amino acid sequence identity may also be determined using the sequence comparison program
- NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).
- the NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- PRO variant polynucleotide or "PRO variant nucleic acid sequence” means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein.
- a PRO variant polynucleotide will have at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83 % nucleic acid sequence identity, alternatively at least about 84 % nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid
- PRO variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 210 nucleotides in length, alternatively at least about 240 nucleotides in length, alternatively at least about 270 nucleotides in length, alternatively at least about 300 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 900 nucleotides in length, or more.
- Percent (%) nucleic acid sequence identity with respect to PRO-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the PRO nucleic acid sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
- % nucleic acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 below.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1 below.
- the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
- Tables 4 and 5 demonstrate how to calculate the % nucleic acid sequence identity of the nucleic acid sequence designated "Comparison DNA” to the nucleic acid sequence designated "PRO-DNA”, wherein "PRO-DNA” represents a hypothetical PRO-encoding nucleic acid sequence of interest, “Comparison DNA” represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA” nucleic acid molecule of interest is being compared, and "N", “L” and “V” each represent different hypothetical nucleotides.
- a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (i. e. , the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the total number of nucleotides of the PRO polypeptide-encoding nucleic acid molecule of interest.
- nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide- encoding nucleic acid molecule of interest.
- Percent nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997)).
- NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD.
- % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
- PRO variant polynucleotides are nucleic acid molecules that encode an active PRO polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding a full-length PRO polypeptide as disclosed herein.
- PRO variant polypeptides may be those that are encoded by a PRO variant polynucleotide.
- Isolated, when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
- the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
- An "isolated" PRO polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the polypeptide-encoding nucleic acid.
- An isolated polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated polypeptide-encoding nucleic acid molecules therefore are distinguished from the specific polypeptide- encoding nucleic acid molecule as it exists in natural cells.
- an isolated polypeptide-encoding nucleic acid molecule includes polypeptide-encoding nucleic acid molecules contained in cells that ordinarily express the polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
- control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
- the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site.
- Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
- Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
- a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- "operably linked” means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase.
- antibody is used in the broadest sense and specifically covers, for example, single anti-PRO monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies), anti-PRO antibody compositions with polyepitopic specificity, single chain anti-PRO antibodies, and fragments of anti-PRO antibodies (see below).
- monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies , i. e. , the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.
- “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
- “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/50mM sodium phosphate buffer atpH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1 % SDS, and
- Modely stringent conditions may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above.
- washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
- moderately stringent conditions is overnight incubation at 37 °C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
- the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
- epitope tagged when used herein refers to a chimeric polypeptide comprising a PRO polypeptide fused to a "tag polypeptide" .
- the tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused.
- the tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes.
- Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues).
- immunoadhesin designates antibody-like molecules which combine the binding specificity of a heterologous protein (an “adhesin”) with the effector functions of immunoglobulin constant domains.
- the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e. , is “heterologous”), and an immunoglobulin constant domain sequence.
- the adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand.
- the immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
- immunoglobulin such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
- agonist is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PRO polypeptide disclosed herein: m a similar manner, the term "agonist” is used in the broadest sense and includes any molecule that ⁇ iimics a biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO polypeptides, peptides, antisense oligonucleotides, small organic molecules, etc. Methods for identifying agonists or antagonists of a PRO polypeptide may comprise contacting a PRO polypeptide with a candidate agonist or antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PRO polypeptide.
- Treatment refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder.
- Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented.
- Chronic administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
- Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
- “Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is human.
- Administration "in combination with” one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
- Carriers as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution.
- physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt- forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM.
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including ascorbic acid
- proteins such as serum albumin
- Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies (Zapata et al., Protein Eng.. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual "Fc” fragment, a designation reflecting the ability to crystallize readily.
- Pepsin treatment yields an F(ab') 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
- Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This region consists of a drrner of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen- binding site on the surface of the V H -V L dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- the Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain.
- Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region.
- Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
- the "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains.
- immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g. , IgGl, IgG2, IgG3, IgG4, IgA, and IgA2.
- Single-chain Fv or “sFv” antibody fragments comprise the V H and V L domains of antibody, wherein these domains are present in a single polypeptide chain.
- the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding.
- diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) in the same polypeptide chain (V H -V L ).
- V H heavy-chain variable domain
- V L light-chain variable domain
- the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
- Diabodies are described more fully in, for example, EP 404,097; WO 93/11161 ; and Hollinger et al, Proc. Natl. Acad. Sci. USA. 90:6444-6448 (1993).
- an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
- An antibody that "specifically binds to” or is “specific for” a particular polypeptide or an epitope on a particular polypeptide is one that binds to that particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.
- label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody.
- the label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
- solid phase is meant a non-aqueous matrix to which the antibody of the present invention can adhere.
- solid phases encompassed herein include those formed partially or entirely of glass (e.g. , controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, poly vinyl alcohol and silicones.
- the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.
- a “liposome” is a small vesicle composed of various types of. lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as a PRO polypeptide or antibody thereto) to a mammal.
- a drug such as a PRO polypeptide or antibody thereto
- the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
- a "small molecule” is defined herein to have a molecular weight below about 500 Daltons.
- modulate means to affect (e.g. , either upregulate, downregulate or otherwise control) the level of a signaling pathway.
- Cellular processes under the control of signal transduction include, but are not limited to, transcription of specific genes, normal cellular functions, such as metabolism, proliferation, differentiatiation, adhesion, apoptosis and survival, as well as abnormal processes, such as transformation, blocking of differentiation and metastasis.
- Active or “activity” for the purposes herein refers to form(s) of a PRO polypeptide which retain a biological and/or an immunological activity of native or naturally-occurring PRO polypeptides, wherein "biological” activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally-occurring PRO polypeptide other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO polypeptide and an "immunological” activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO polypeptide .
- One preferred biological activity includes inducing activation of NF- ⁇ B and stimulation of the production of the proinflammatory chemokine EL-8. Another preferred biological activity includes stimulation of peripheral blood mononucear cells or CD4 + cells . Another preferred biological activity includes stimulation of the proliferation of T-lymphocytes. Another preferred biological activity includes, for example, the release of TNF- ⁇ from THP1 cells.
- An alternative activity is the reduction in EL-la induced NO (nitric oxide) production from articular cartilage. Another activity includes an enhancement of matrix synthesis in articular cartilage. Alternatively, another activity includes promoting breakdown of articular cartilage matrix as well as inhibiting matrix synthesis . Another preferred biological activity includes modulating the level of the interleukin-17. signalling pathway during mild to severe stages of inflammatory bowel disease or during stroke.
- An "immunological" activity refers only to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO polypeptide.
- Degenerative cartilagenous disorder describes a host of disorders that is characterized principally by the destruction of the cartilage matrix. Additional pathologies includes nitric oxide production, and elevated proteoglycan breakdown. Exemplary disorders encompassed within this definition, include, for example, arthritis (e.g., osteoarfhritis, rheumatoid arthritis, psoriatic arthritis).
- arthritis e.g., osteoarfhritis, rheumatoid arthritis, psoriatic arthritis.
- arthritis e.g., osteoarfhritis, rheumatoid arthritis, psoriatic arthritis.
- immune related disease means a disease in which a component of the immune system of a mammal causes, mediates or otherwise contributes to a morbidity in the mammal. Also included are diseases in which stimulation or intervention of the immune response has an ameliorative effect on progression of the disease.
- T cell mediated disease means a disease in which T cells directly or indirectly mediate or otherwise contribute to a morbidity in a mammal.
- the T cell mediated disease may be associated with cell mediated effects, lymphokine mediated effects, etc., and even effects associated with B cells if the B cells are stimulated, for example, by the lymphokines secreted by T cells.
- immune-related and inflammatory diseases examples include systemic lupus erythematosis, rheumatoid arthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, polymyositis), Sj ⁇ gren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial
- an “effective amount” is a concentration or amount of a PRO polypeptide and/or agonist/antagonist which results in achieving a particular stated purpose.
- An “effective amount” of a PRO polypeptide or agonist or antagonist thereof may be determined empirically.
- a “therapeutically effective amount” is a concentration or amount of a PRO polypeptide and/or agonist/antagonist which is effective for achieving a stated therapeutic effect. This amount may also be determined empirically.
- cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
- the term is intended to include radioactive isotopes (e.g., I 131 , 1 125 , Y 90 and Re 186 ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof.
- chemotherapeutic agent is a chemical compound useful in the treatment of cancer.
- chemotherapeutic agents include adriamycin, doxorubicin, epirubicrn, 5-fluorouracil, cytosine arabinoside ("Ara-C”), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g.
- paclitaxel Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ
- doxetaxel Tetraxotere, Rh ⁇ ne-Poulenc Rorer, Antony, France
- toxotere methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbrne, carboplatin, teniposide, daunomycin, carminomycin, amrnopterin, dactinomycin, mitomycrns, esperamicins (see U.S. Pat. No. 4,675, 187), melphalan and other related nitrogen mustards.
- hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone.
- a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo.
- the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase.
- growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M phase arrest.
- Classical M-phase blockers include the vrncas (vincristine and vinblastine), taxol, and topo U inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin.
- DNA alkylating agents such as tamoxifen, predhisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled “Cell cycle regulation, oncogens, and antineoplastic drugs” by Murakami et al, (WB Saunders: Philadelphia, 1995), especially p. 13.
- cytokine is a generic term for proteins released by one cell population which act on another cell as intercellular mediators.
- cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF- ⁇ ; platelet-growth factor;
- filel and file2 are two dna or two protein sequences.
- Max file length is 65535 (limited by unsigned short x in the jmp struct)
- a sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
- the program may create a tmp file in /tmp to hold info about traceback.
- static nm matches in core — for checking */ static Imax; /* lengths of stripped file names */ static iJPl; /* jmp index for a path */ static nc[2]; /* number at start of current line */ static Di[2]; /* current elem number — for gapping */ static siz[2]; static char *ps[2]; /* ptr to current element */ static char *po[2]; /* ptr to next output char slot */ static char oouutt[[22]][[lP_LINE] ; /* output line */ static char starfP ] i]; /* set by stars() *//
- *po[i] *ps[i]; if (islower(*ps[i]))
- *ps[i] toupper(*ps[i]); po[i] + + ; ps[i] + + ;
- *py+ + *px; else if (islower(*px))
- the present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO polypeptides.
- cDNAs encoding various PRO polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed.
- PRO/number the protein encoded by the full length native nucleic acid molecules disclosed herein as well as all further native homologues and variants included in the foregoing definition of PRO, will be referred to as "PRO/number", regardless of their origin or mode of preparation.
- PRO variants can be prepared.
- PRO variants can be prepared by introducing appropriate nucleotide changes into the PRO DNA, and/or by synthesis of the desired PRO polypeptide.
- amino acid changes may alter post-translational processes of the PRO, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
- Variations in the native full-length sequence PRO or in various domains of the PRO described herein can be made, for example, using any of the techniques and guidelines for conservative and non- conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934.
- Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO that results in a change in the amino acid sequence of the PRO as compared with the native sequence PRO.
- the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the PRO.
- Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PRO with that of homologous known protein molecules and ⁇ unimizing the number of amino acid sequence changes made in regions of high homology.
- Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e. , conservative amino acid replacements. Insertions or deletions may optionally be in the range of about
- the variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence.
- PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N- terminus or C-terminus, or may lack internal residues, for example, when compared with a full length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the PRO polypeptide.
- PRO fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative approach involves generating PRO fragments by enzymatic digestion, e.g. , by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5 ' and 3 ' primers in the PCR. Preferably, PRO polypeptide fragments share at least one biological and/or immunological activity with the native PRO polypeptide disclosed herein.
- PCR polymerase chain reaction
- Substantial modifications in function or immunological identity of the PRO polypeptide are accomplished by selecting substitutions that differ significantly in their effect on mamtaining (a) the structure of (he polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- Naturally occurring residues are divided into groups based on common side-chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr;
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.
- the variations can be made using methods known in the art such as oligonucleotide-mediated (site- directed) mutagenesis, alanine scanning, and PCR mutagenesis.
- Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13:4331 (1986); ZoUer et al, Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis (Wells et al., Gene, 34:315 [1985]), restriction selection mutagenesis (Wells et al, Philos. Trans. R. Soc. London SerA, 317:415 [1986]) or other known techniques can be performed on the cloned DNA to produce the PRO variant DNA.
- Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence.
- preferred scanning amino acids are relatively small, neutral amino acids.
- Such amino acids include alanine, glycine, serine, and cysteine.
- Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant (Cunningham and Wells, Science, 244: 1081-1085 [1989]).
- Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 [1976]). If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.
- Covalent modifications of PRO are included within the scope of this invention.
- One type of covalent modification includes reacting targeted amino acid residues of a PRO polypeptide with an organic derivatizing i agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO.
- Derivatization with bifunctional agents is useful, for instance, for crosslinking PRO to a water-insoluble support matrix or surface for use in the method for purifying anti-PRO antibodies, and vice-versa.
- crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N- hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional i idoesters, including disuccinimidyl esters such as 3,3 '-di iobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido-l,8-octane and agents such as memyl-3-[ -azidophenyl)dimio]propioimidate.
- l,l-bis(diazoacetyl)-2-phenylethane glutaraldehyde
- N- hydroxysuccinimide esters for example, esters with 4-azidosalicylic acid, homobifunctional i idoesters, including disuccinimidyl est
- Another type of covalent modification of the PRO polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
- "Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PRO (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PRO.
- the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
- Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence.
- the alteration may be made, for example, by the addition of, or substitution by, one or more serine or (hreonine residues to the native sequence PRO (for 0-linked glycosylation sites).
- the PRO amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
- Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g. , in WO 87/05330 published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981). Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al, Arch. Biochem.
- Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al, Meth. Enzymol.,
- PRO polypeptide
- nonproteinaceous polymers e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes
- PEG polyethylene glycol
- polypropylene glycol polypropylene glycol
- polyoxyalkylenes in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
- the PRO of the present invention may also be modified in a way to form a chimeric molecule comprising PRO fused to another, heterologous polypeptide or amino acid sequence.
- such a chimeric molecule comprises a fusion of the PRO with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
- the epitope tag is generally placed at the amino- or carboxyl- terminus of the PRO. The presence of such epitope-tagged forms of the
- PRO can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
- tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al , Mol. Cell. Biol..
- tag polypeptides include the Flag-peptide [Hopp et al, BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al, Science, 255:192-194 (1992)1: an K-tobulin epitope peptide [Skinner etal. . Biol. Chem..266:15163-15166 (1991)1; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al. , Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].
- the chimeric molecule may comprise a fusion of the PRO with an immunoglobulin or a particular region of an immunoglobulin.
- an immunoglobulin also referred to as an "immunoadhesin”
- a fusion could be to the Fc region of an IgG molecule.
- the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a PRO polypeptide in place of at least one variable region within an Ig molecule.
- the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
- the PRO polypeptides of the present invention may also be modified in a way to form a chimeric molecule comprising a PRO polypeptide fused to a leucine zipper.
- leucine zipper polypeptides have been described in the art. See, e.g. , Landschulz et al , Science, 240: 1759 (1988); WO 94/10308; Hoppe et al, FEBS Letters. 344:1991 (1994); Maniatis et al, Nature. 341:24 (1989). It is believed that use of a leucine zipper fused to a PRO polypeptide may be desirable to assist in dimerizing or trimerizing soluble PRO polypeptide in solution. Those skilled in the art will appreciate that the leucine zipper may be fused at either the N- or C-terminal end of the PRO molecule.
- PRO sequence or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g. , Stewart et al, Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969);
- In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO.
- DNA encoding PRO may be obtained from a cDNA library prepared from tissue believed to possess the PRO mRNA and to express it at a detectable level. Accordingly, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples.
- the PRO- encoding gene may also be obtained from a genomic library or by known synthetic procedures (e.g., automated nucleic acid synthesis). Libraries can be screened with probes (such as antibodies to the PRO or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al.
- oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are ininimized.
- the oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened.
- Methods of labeling are well known in the art, and include the use of radiolabels like 32 P-labeled ATP, biotinylation or enzyme labeling.
- Hybridization conditions including moderate stringency and high stringency, are provided in Sambrook et al., supra.
- Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein. Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al. , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
- Host cells are transfected or transformed with expression or cloning vectors described herein for PRO production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al, supra.
- Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl 2 , CaP0 , liposome-mediated and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride, as described in Sambrook et al. , supra, or electroporation is generally used for prokaryotes.
- Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989.
- DNA into cells such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene, polyornithine, may also be used.
- polycations e.g., polybrene, polyornithine.
- Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells.
- Suitable prokaryotes include but are not limited to eubacteria, such as Gram- negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
- Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31,537); £. coli strain W3110 (ATCC 27,325) and K5772 (ATCC 53, 635).
- suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g. , Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g. , B. licheniformis 41P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting.
- Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations.
- the host cell secretes minimal amounts of proteolytic enzymes.
- strain W3110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W3110 strain 1A2, which has the complete genotype tonA ; E. coli W3110 strain 9E4, which has the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3phoA E15 (argF-lac)169 degP ompTkan ; E.
- coli W3110 strain 37D6 which has the complete gen tyx ⁇ e tonAptr3phoA E15 (argF-lac)169 degP ompT rbs7ilvGkan r ; E. coli ⁇ 3U0 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990.
- in vitro methods of cloning e.g. , PCR or other nucleic acid polymerase reactions, are suitable.
- eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO-encoding vectors.
- Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism.
- Others include Schizosaccharomyces pombe [Beach and Nurse, Nature, 290: 140 (1981); EP 139,383 published 2 May 1985]; Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al, Bio/Technology. 9:968-975 [1991]).
- K. lactis MW98-8C, CBS683, CBS4574;
- Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g. , Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as A. nidulans (Ballance et al, Biochem. Biophvs.
- Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces,
- Torulopsis, and Rhodotorula A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
- Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms .
- invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9 or Spodoptera High 5 cells, as well as plant cells.
- useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells . More specific examples include monkey kidney CV 1 line transformed by S V40
- COS-7 ATCC CRL 1651
- human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al. , J. Gen Virol., 36:59 (1977)
- Chinese hamster ovary cells/-DHFR (CHO,
- mouse mammary tumor (MMT 060562, ATCC CCL51).
- MMT 060562, ATCC CCL51 mouse mammary tumor
- the nucleic acid (e.g. , cDNA or genomic DNA) encoding PRO may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression.
- a replicable vector for cloning (amplification of the DNA) or for expression.
- Various vectors are publicly available.
- the vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage.
- the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art.
- Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.
- the PRO may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
- a heterologous polypeptide which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
- the signal sequence may be a component of the vector, or it may be a part of the PRO-encoding DNA that is inserted into the vector.
- the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders.
- yeast secretion the signal sequence may be, e.g.
- yeast invertase leader including Saccharomyces and Kluyveromyces ⁇ -factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362, 179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990.
- mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.
- Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells .
- Such sequences are well known for a variety of bacteria, yeast, and viruses.
- the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
- BPV BPV
- Selection genes will typically contain a selection gene, also termed a selectable marker.
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g. , ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g. , the gene encoding D-alanine racemase for Bacilli.
- suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or fhymidine kinase.
- An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al, Proc. Natl. Acad. Sci. USA, 77:4216 (1980).
- a suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al. , Nature, 282:39 (1979); Kingsman et al. , Gene, 7: 141 (1979); Tschemper et al.
- the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85: 12 (1977)].
- Expression and cloning vectors usually contain a promoter operably linked to the PRO-encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang et al, Nature, 275:615 (1978); Goeddel et al.
- Suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman et al, J. Biol. Chem., 255:2073 (1980)] or other glycolytic enzymes
- yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
- PRO transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211 ,504 published 5 July
- adenovirus such as Adenovirus 2
- bovine papilloma virus such as Adenovirus 2
- bovine papilloma virus such as avian sarcoma virus
- cytomegalovirus such as a retrovirus
- SV40 Simian Virus 40
- heterologous mammalian promoters e.g. , the actin promoter or an immunoglobulin promoter
- heat-shock promoters e.g., heat-shock promoters, provided such promoters are compatible with the host cell systems.
- Transcription of a DNA encoding the PRO by higher eukaryotes may be increased by inserting an enhancer sequence into the vector.
- Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the PRO coding sequence, but is preferably located at a site 5' from the promoter.
- Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as pdlyadenylated fragments in the untranslated portion of the mRNA encoding PRO.
- Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc.
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
- the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
- Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
- Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to PRO
- Forms of PRO may be recovered from culture medium or from host cell lysates. If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells employed in expression of PRO can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
- a suitable detergent solution e.g., Triton-X 100
- Cells employed in expression of PRO can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
- PRO may be desired to purify PRO from recombinant cell proteins or polypeptides.
- the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as
- PRO Nucleotide sequences (or their complement) encoding PRO have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of anti-sense RNA and DNA.
- PRO nucleic acid will also be useful for the preparation of PRO polypeptides by the recombinant techniques described herein.
- the full-length native sequence PRO gene, or portions thereof, may be used as hybridization probes for a cDNA library to isolate the full-length PRO cDNA or to isolate still other cDNAs (for instance, those encoding naturally-occurring variants of PRO or PRO from other species) which have a desired sequence identity to the native PRO sequence disclosed herein.
- the length of the probes will be about 20 to about 50 bases.
- the hybridization probes may be derived from at least partially novel regions of the full length native nucleotide sequence wherein those regions may be determined without-undue experimentation or from genomic sequences including promoters, enhancer elements and introns of native sequence PRO.
- a screening method will comprise isolating the coding region of the PRO gene using the known DNA sequence to synthesize a selected probe of about 40 bases .
- Hybridization probes may be labeled by a variety of labels, including radionucleotides such as 32 P or 35 S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems. Labeled probes having a sequence complementary to that of the PRO gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to. Hybridization techniques are described in further detail in the Examples below.
- antisense or sense oligonucleotides comprising a singe-stranded nucleic acid sequence (either RNA or DNA) capable of binding to target PRO mRNA (sense) or PRO DNA (antisense) sequences.
- Antisense or sense oligonucleotides comprise a fragment of the coding region of PRO DNA. Such. a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.
- Stein and Cohen Cancer Res. 48:2659, [1988]
- van der Krol et al. BioTechniques, 6:958, [1988]
- binding of antisense or sense oligonucleotides to target nucleic acid sequences results in the formation of duplexes that block transcription or translation of the target sequence by one of several means, including enhanced degradation of the duplexes, premature termination of transcription or translation, or by other means.
- the antisense oligonucleotides thus may be used to block expression of PRO proteins.
- Antisense or sense oligonucleotides further comprise oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629) and wherein such sugar linkages are resistant to endogenous nucleases .
- Such oligonucleotides with resistant sugar linkages are stable in vivo (i.e.
- sense or antisense oligonucleotides include those oligonucleotides which are covalently linked to organic moieties, such as those described in WO 90/10048, and other moieties that increases affinity of the oligonucleotide for a target nucleic acid sequence, such as poly-(L-lysine).
- intercalating agents such as ellipticine, and alkylating agents or metal complexes may be attached to sense or antisense oligonucleotides to modify binding specificities of the antisense or sense oligonucleotide for the target nucleotide sequence.
- Antisense or sense oligonucleotides may be introduced into a cell containing the target nucleic acid sequence by any gene transfer method, including, for example, CaP0 4 -mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus.
- an antisense or sense oligonucleotide is inserted into a suitable retroviral vector.
- a cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo.
- Suitable retroviral vectors include, but are not limited to, those derived from the murfne retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or the double copy vectors designated DCT5A, DCT5B and DCT5C (see WO 90/13641).
- Sense or antisense oligonucleotides also may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753.
- Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors.
- conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.
- a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/ 10448.
- the sense or antisense oligonucleotide-lipid complex is preferably dissociated within the cell by an endogenous lipase.
- Antisense or sense RNA or DNA molecules are generally at least about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length, about 40 bases in length, about 45 bases in length, about 50 bases in length, about 55 bases in length, about 60 bases in length, about 65 bases in length, about 70 bases in length, about 75 bases in length, about 80 bases in length, about 85 bases in length, about 90 bases in length, about 95 bases in length, about 100 bases in length, or more.
- the probes may also be employed in PCR techniques to generate a pool of sequences for identification of closely related PRO coding sequences. ⁇
- Nucleotide sequences encoding a PRO can also be used to construct hybridization probes for mapping the gene which encodes that PRO and for the genetic analysis of individuals with genetic disorders.
- nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a chromosome using known techniques, such as in situ hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries.
- the PRO can be used in assays to identify the other proteins or molecules involved in the binding interaction. By such methods, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Also, the receptor PRO can be used to isolate correlative ligand(s). Screening assays can be designed to find lead compounds that mimic the biological activity of a native PRO or a receptor for PRO. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- Small molecules contemplated include synthetic organic or inorganic compounds.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art.
- Nucleic acids which encode PRO or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents.
- a transgenic animal e.g. , a mouse or rat
- a transgenic animal is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g. , an embryonic stage.
- a transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops.
- cDNA encoding PRO can be used to clone genomic DNA encoding PRO in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding PRO.
- Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted for PRO transgene incorporation with tissue-specific enhancers .
- PRO introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding PRO.
- Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
- reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
- an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
- non-human homologues of PRO can be used to construct a PRO "knock out" animal which has a defective or altered gene encoding PRO as a result of homologous recombination between the endogenous gene encoding PRO and altered genomic DNA encoding PRO introduced into an embryonic stem cell of the animal.
- cDNA encoding PRO can be used to clone genomic DNA encoding PRO in accordance with established techniques. A portion of the genomic DNA encoding PRO can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
- flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5 ' and 3 ' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 5J.:503 (1987) for a description of homologous recombination vectors].
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see, e.g., Li et al, Cell, 69 : 915 ( 1992)] .
- the selected cells are then injected into a blastocyst of an animal (e.g.
- a mouse or rat to form aggregation chimeras [see, e.g. , Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152].
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
- Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the PRO polypeptide.
- Nucleic acid encoding the PRO polypeptides may also be used in gene therapy. In gene therapy
- genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene.
- Gene therapy includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
- Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short antisense oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al. , Proc. Natl. Acad. Sci.
- the oligonucleotides can be modified to enhance their uptake, e.g., by substituting their negatively charged phosphodiester groups by uncharged groups.
- nucleic acid source in some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- an agent that targets the target cells such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g. , capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
- PRO polypeptides described herein may also be employed as molecular weight markers for protein electrophoresis purposes and the isolated nucleic acid sequences may be used for recombinantly expressing those markers.
- nucleic acid molecules encoding the PRO polypeptides or fragments thereof described herein are useful for chromosome identification.
- there exists an ongoing need to identify new chromosome markers since relatively few chromosome marking reagents, based upon actual sequence data are presently available.
- Each PRO nucleic acid molecule of the present invention can be used as a chromosome marker.
- PRO polypeptides and nucleic acid molecules of the present invention may also be used diagnostically for tissue typing, wherein the PRO polypeptides of the present invention may be differentially expressed in one tissue as compared to another, preferably in a diseased tissue as compared to a normal tissue of the same tissue type.
- PRO nucleic acid molecules will find use for generating probes for PCR, Northern analysis, Southern analysis and Western analysis.
- the PRO polypeptides described herein may also be employed as therapeutic agents.
- the PRO polypeptides of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the PRO product hereof is combined in admixture with a pharmaceutically acceptable carrier vehicle .
- Therapeutic formulations are prepared for storage by mixing the active ingredient having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
- Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about
- polypeptides polypeptides
- proteins such as serum albumin, gelatin or immunoglobulins
- hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, PLURONICSTM or PEG.
- the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution.
- compositions herein generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
- the route of administration is in accord with known methods, e.g., injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional routes, topical a ⁇ 1 rninistration, or by sustained release systems.
- Dosages and desired drug concentrations of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned. The determination of the appropriate dosage or route of administration is well within the skill of an ordinary physician. Animal experiments provide reliable guidance for the determination of effective doses for human therapy. Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al, Eds., Pergamon Press, New York 1989, pp. 42-96.
- normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal body weight or more per day, preferably about 1 ⁇ g/kg/day to 10 mg/kg/day, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344; or 5,225,212. It is anticipated that different formulations will be effective for different treatment compounds and different disorders,' that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue.
- microencapsulation of the PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhIFN- ), interleukin-2, andMNrgpl20. Johnson et al, Nat MecL, 2:795-799 (1996);
- the sustained-release formulations of these proteins were developed using poly-lactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties.
- PLGA poly-lactic-coglycolic acid
- the degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body.
- the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer, " in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.
- This invention encompasses methods of screening compounds to identify those that mimic the PRO polypeptide (agonists) or prevent the effect of the PRO polypeptide (antagonists).
- Screening assays for antagonist drug candidates are designed to identify compounds that bind or complex with the PRO polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins.
- Such screening assays will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art.
- All assays for antagonists are common in that they call for contacting the drug candidate with a PRO polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact.
- binding assays the interaction is binding and the complex formed can be isolated or detected in the reaction mixture.
- the PRO polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g. , on a microtiter plate, by covalent or non-covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the PRO polypeptide and drying.
- an immobilized antibody e.g.
- a monoclonal antibody, specific for the PRO polypeptide to be immobilized can be used to anchor it to a solid surface.
- the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component.
- the non-reacted components are removed, e.g. , by washing, and complexes anchored on the solid surface are detected.
- the detection of label immobilized on the surface indicates that complexing occurred.
- complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.
- candidate compound interacts with but does not bind to a particular PRO polypeptide encoded by a gene identified herein
- its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions.
- assays include traditional approaches, such as, e.g., cross- linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns.
- protein-protein interactions can be monitored by using a yeast-based genetic system described by
- yeast GAL4 Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, the other one functioning as the transcription-activation domain.
- two-hybrid system takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain.
- the expression of a GALl-/ ⁇ cZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for ⁇ -galactosidase.
- a complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech.
- This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial fpr these interactions.
- Compounds that interfere with the interaction of a gene encoding a PRO polypeptide identified herein and other intra- or extracellular components can be tested as follows: usually a reaction mixture is prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products. To test the ability of a candidate compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound. In addition, a placebo may be added to a third reaction mixture, to serve as positive control. The binding
- the PRO polypeptide may be added to a cell along with the compound to be screened for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PRO polypeptide indicates that the compound is an antagonist to the PRO polypeptide.
- antagonists may be detected by combining the PRO polypeptide and a potential antagonist with membrane-bound PRO polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay.
- the PRO polypeptide can be labeled, such as by radioactivity, such that the number of PRO polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist.
- the gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Coligan et al. , Current Protocols in lmmun., 1(2): Chapter 5 (1991).
- expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PRO polypeptide and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the PRO polypeptide. Transfected cells that are grown on glass slides are exposed to labeled PRO polypeptide.
- PRO polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
- labeled PRO polypeptide can be photoaf finity- linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE and exposed to X-ray film. The labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing. The amino acid sequence obtained from micro- sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
- mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled PRO polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction could then be measured.
- potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with PRO polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
- a potential antagonist may be a closely related protein, for example, a mutated form of the PRO polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the PRO polypeptide.
- Another potential PRO polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g. , an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
- Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion of the polynucleotide sequence which encodes the mature PRO polypeptides herein, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
- a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al. ,
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PRO
- polypeptide antisense - Okano , Neurochem., 56 : 560 ( 1991 ) ; Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988).
- the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the PRO polypeptide.
- antisense DNA oligodeoxyribonucleotides derived from the translation- initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
- Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide.
- small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds!
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g., Rossi, Current Biology, 4:469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).
- Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single- stranded and composed of deoxynucleotides.
- the base composition of these oligonucleotides is designed such that it promotes triple-helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines or pyrirnidines on one strand of a duplex.
- tissue expressing the PRO can be identified by determuiing mRNA expression in various human tissues.
- the location of such genes provides information about which tissues are most likely to be affected by the stimulating and inhibiting activities of the PRO polypeptides.
- the location of a gene in a specific tissue also provides sample tissue for the activity blocking assays discussed below.
- gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
- Gene expression in various tissues may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
- Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence of a PRO polypeptide or against a synthetic peptide based on the DNA sequences encoding the PRO polypeptide or against an exogenous sequence fused to a DNA encoding a PRO polypeptide and encoding a specific antibody epitope.
- General techniques for generating antibodies, and special protocols for Northern blotting and in situ hybridization are provided below.
- the activity of the PRO polypeptides can be further verified by antibody binding studies, in which the ability of anti-PRO antibodies to inhibit the effect of the PRO polypeptides, respectively, on tissue cells is tested.
- Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, andheteroconjugate antibodies, the preparation of which will be described hereinbelow.
- Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
- ком ⁇ онентs rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody.
- the amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies.
- the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
- Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected.
- the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex.
- the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay).
- sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
- the tissue sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.
- Cell-based assays and animal models for immune related diseases can be used to further understand the relationship between the genes and polypeptides identified herein and the development and pathogenesis of immune related disease.
- cells of a cell type known to be involved in a particular immune related disease are transfected with the cDNAs described herein, and the ability of these cDNAs to stimulate or inhibit immune function is analyzed. Suitable cells can be transfected with the desired gene, and monitored for immune function activity. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit or stimulate immune function, for example to modulate T-cell proliferation or inflammatory cell infiltration. Cells transfected with the coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment of immune related diseases.
- transgenic animals in addition, primary cultures derived from transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques to derive continuous cell lines from transgenic animals are well known in the art (see, e.g., Small etal, Mol. Cell. Biol.. 5 : 642-648 [1985]).
- MLR mixed lymphocyte reaction
- a proliferative T cell response in an MLR assay may be due to direct mitogenic properties of an assayed molecule or to external antigen induced activation. Additional verification of the T cell stimulatory activity of the PRO polypeptides can be obtained by a costimulation assay.
- T cell activation requires an antigen specific signal mediated through the T-cell receptor (TCR) and a costimulatory signal mediated through a second ligand binding interaction, for example, the B7 (CD80, CD86)/CD28 binding interaction.
- CD28 crosslinking increases lymphokine secretion by activated T cells.
- T cell activation has both negative and positive controls through the binding of ligands which have a negative or positive effect.
- CD28 and CTLA-4 are related glycoproteins in the Ig superfamily which bind to B7.
- CD28 binding to B7 has a positive costimulation effect of T cell activation; conversely, CTLA-4 binding to B7 has a negative T cell deactivating effect.
- the PRO polypeptides are assayed for T cell costimulatory or inhibitory activity.
- PRO polypeptides as well as other compounds of the invention, which are stimulators (costimulators) of T cell proliferation and agonists, e.g. , agonist antibodies, thereto as determined by MLR and costimulation assays, for example, are useful in treating immune related diseases characterized by poor, suboptimal or inadequate immune function. These diseases are treated by stimulating the proliferation and activation of T cells (and T cell mediated immunity) and enhancing the immune response in a mammal through a ⁇ ninistration of a stimulatory compound, such as the stimulating PRO polypeptides.
- the stimulating polypeptide may, for example, be a PRO polypeptide or an agonist antibody thereof.
- a stimulating compound as in the invention has been validated in experiments with 4-lBB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4-1BBL) expressed on primed T cells and signals T cell activation and growth. Alderson, M. E. et al, Immunol.. 24:2219 (1994). The use of an agonist stimulating compound has also been validated experimentally. Activation of 4-lBB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4-1BBL) expressed on primed T cells and signals T cell activation and growth. Alderson, M. E. et al, Immunol.. 24:2219 (1994). The use of an agonist stimulating compound has also been validated experimentally. Activation of
- Immunoadjuvant therapy for treatment of tumors is another example of the use of the stimulating compounds of the invention.
- An immune stimulating or enhancing effect can also be achieved by antagonizing or blocking the activity of a PRO which has been found to be inhibiting in the MLR assay. Negating the inhibitory activity of the compound produces a net stimulatory effect.
- Suitable antagonists/blocking compounds are antibodies or fragments thereof which recognize and bind to the inhibitory protein, thereby blocking the effective interaction of the protein with its receptor and inhibiting signaling through the receptor. This effect has been validated in experiments using anti-CTLA-4 antibodies which enhance T cell proliferation, presumably by removal of the inhibitory signal caused by CTLA-4 binding. Walunas, T. L. et al, Immunity, 1_:405
- an immune stimulating or enhancing effect can also be achieved by administration of a PRO polypeptide which has vascular permeability enhancing properties.
- Enhanced vacuolar permeability would be beneficial to disorders which can be attenuated by local infiltration of immune cells (e.g., monocytes, eosinophils, PMNs) and inflammation.
- PRO polypeptides as well as other compounds of the invention, which are direct inhibitors of T cell proliferation/activation, lymphokine secretion, and/or vascular permeability can be directly used to suppress the immune response. These compounds are useful to reduce the degree of the immune response and to treat immune related diseases characterized by a hyperactive, superoptimal, or autoimmune response.
- This use of the compounds of the invention has been validated by the experiments described above in which CTLA-4 binding to receptor B7 deactivates T cells.
- the direct inhibitory compounds of the invention function in an analogous manner.
- the use of compound which suppress vascular permeability would be expected to reduce inflammation. Such uses would be beneficial in treating conditions associated with excessive inflammation.
- compounds e.g., antibodies, which bind to stimulating PRO polypeptides and block the stimulating effect of these molecules produce a net inhibitory effect and can be used to suppress the T cell mediated immune response by inhibiting T cell proliferation/activation and/or lymphokine secretion.
- Blocking the stimulating effect of the polypeptides suppresses the immune response of the mammal. This use has been validated in experiments using an anti-IL2 antibody. In these experiments, the antibody binds to EL2 and blocks binding of IL2 to its receptor thereby achieving a T cell inhibitory effect.
- the results of the cell based in vitro assays can be further verified using in vivo animal models and assays for T-cell function.
- a variety of well known animal models can be used to further understand the role of the genes identified herein in the development and pathogenesis of immune related disease, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides , including small molecule antagonists .
- the in vivo nature of such models makes them predictive of responses in human patients.
- Animal models of immune related diseases include both non-recombinant and recombinant (transgenic) animals.
- Non-recombinant animal models include, for example, rodent, e.g., murine models.
- Such models can be generated by introducing cells into syngeneic mice using standard techniques, e.g., subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule, etc.
- Graft-versus-host disease occurs when immunocompetent cells are transplanted into immunosuppressed or tolerant patients.
- the donor cells recognize and respond to host antigens. The response can vary from life threatening severe inflammation to mild cases of diarrhea and weight loss.
- Graft-versus-host disease models provide a means of assessing T cell reactivity against MHC antigens and minor transplant antigens. A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.3.
- An animal model for skin allograft rejection is a means of testing the ability of T cells to mediate in vivo tissue destruction and a measure of their role in transplant rejection.
- the most common and accepted models use murine tail-skin grafts .
- Repeated experiments have shown that skin allograft rejection is mediated by T cells, helper T cells and killer-effector T cells, and not antibodies.
- Delayed type hypersensitivity reactions are a T cell mediated in vivo immune response characterized by inflammation which does not reach a peak until after a period of time has elapsed after challenge with an antigen. These reactions also occur in tissue specific autoimmune diseases such as multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE, a model for MS). A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.5.
- EAE is a T cell mediated autoimmune disease characterized by T cell and mononuclear cell inflammation and subsequent demyelination of axons in the central nervous system.
- EAE is generally considered to be a relevant animal model for MS in humans. Bolton, C. , Multiple Sclerosis, 1_ : 143 (1995). Both acute and relapsing-remitting models have been developed.
- the compounds of the invention can be tested for T cell stimulatory or inhibitory activity against immune mediated demyelinating disease using the protocol described in Current Protocols in Immunology, above, units 15.1 and 15.2. See also the models for myelin disease in which oligodendrocytes or Schwann cells are grafted into the central nervous system as described in Duncan, I. D. et al, Molec. Med. Today, 554-561 (1997).
- Contact hypersensitivity is a simple delayed type hypersensitivity in vivo assay of cell mediated immune function.
- cutaneous exposure to exogenous haptens which gives rise to a delayed type hypersensitivity reaction which is measured and quantitated.
- Contact sensitivity involves an initial sensitizing phase followed by an elicitation phase.
- the elicitation phase occurs when the T lymphocytes encounter an antigen to which they have had previous contact. Swelling and inflammation occur, making this an excellent model of human allergic contact dermatitis.
- a suitable procedure is described in detail in Current Protocols in Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, John Wiley & Sons, Inc., unit 4.2 (1994). I also Grabbe, S. and Schwarz, T, Immun.
- An animal model for arthritis is collagen-induced arthritis. This model shares clinical, histological and immunological characteristics of human autoimmune rheumatoid arthritis and is an acceptable model for human autoimmune arthritis.
- Mouse and rat models are characterized by synovitis, erosion of cartilage and subchondral bone.
- the compounds of the invention can be tested for activity against autoimmune arthritis using the protocols described in Current Protocols in Immunology, above, units 15.5. See also the model using a monoclonal antibody to CD18 and VLA-4 integrfns described in Issekutz, A.C. et al. , hnmunologv, 88:569 (1996).
- a model of asthma has been described in which antigen-induced airway hyper-reactivity, pulmonary eosinophilia and inflammation are induced by sensitizing an animal with ovalbumin and then challenging the animal with the same protein delivered by aerosol.
- Several animal models (guinea pig, rat, non-human primate) show symptoms similar to atopic asthma in humans upon challenge with aerosol antigens.
- Murine models have many of the features of human asthma. Suitable procedures to test the compounds of the invention for activity and effectiveness in the treatment of asthma are described by Wolyniec, W. W. et al , Am. J. Respir. Cell Mol. Biol., 18:777 (1998) and the references cited therein.
- the compounds of the invention can be tested on animal models for psoriasis like diseases. Evidence suggests a T cell pathogenesis for psoriasis.
- the compounds of the invention can be tested in the scid/scid mouse model described by Schon, M. P. et al, Nat. Med., 3:183 (1997), in which the mice demonstrate histopathologic skin lesions resembling psoriasis.
- Another suitable model is the human skin scid mouse chimera prepared as described by Nickoloff, B. J. et al., Am. J. Path., 146:580 (1995).
- Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals.
- Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees and monkeys.
- Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines (e.g., Van der Putten et al, Proc. Natl.
- transgenic animals include those that carry the transgene only in part of their cells ("mosaic animals").
- the transgene can be integrated either as a single transgene, or in concatamers, e.g., head-to-head or head-to-tail tandems. Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al. , Proc. Natl.
- transgene expression in transgenic animals can be monitored by standard techniques . For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene.
- the level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or immunocytochemistry.
- the animals may be further examined for signs of immune disease pathology, for example by histological examination to determine infiltration of immune cells into specific tissues.
- Blocking experiments can also be performed in which the, transgenic animals are treated with the compounds of the invention to determine the extent of the T cell proliferation stimulation or inhibition of the compounds. In these experiments, blocking antibodies which bind to the PRO polypeptide, prepared as described above, are a ⁇ ministered to the animal and the effect on immune function is determined.
- "knock out" animals can be constructed which have a defective or altered gene encoding a polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal.
- cDNA encoding a particular polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques.
- a portion of the genomic DNA encoding a particular polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
- flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors].
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e.g., Li et al., Cell, 69:915 (1992)].
- the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (JJRL, Oxford, 1987), pp. 113-152].
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
- Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the polypeptide.
- the immunostimulating compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer).
- tumors cancer
- T cells recognize human tumor specific antigens.
- DeSmet, C. et al. Proc. Natl. Acad. Sci. USA, 93:7149 (1996). It has been shown that costimulation of T cells induces tumor regression and an antitumor response both in vitro and in vivo. Melero, I. et al, Nature Medicine.
- the stimulatory compounds of the invention can be administered as adjuvants, alone or together with a growth regulating agent, cytotoxic agent or chemotherapeutic agent, to stimulate T cell proliferation/activation and an antitumor response to tumor antigens.
- the growth regulating, cytotoxic, or chemotherapeutic agent may be administered in conventional amounts using known administration regimes. Immunostimulating activity by the compounds of the invention allows reduced amounts of the growth regulating, cytotoxic, or chemotherapeutic agents thereby potentially lowering the toxicity to the patient.
- Screening assays for drug candidates are designed to identify compounds that bind to or complex with the polypeptides encoded by the genes identified herein or a biologically active fragment thereof, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins.
- Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)peptide- ⁇ nmunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art. 5. All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact.
- the interaction is binding and the complex formed can be isolated or detected in the reaction mixture.
- the polypeptide encoded by the gene identified herein or0 the drug candidate is immobilized on a solid phase, e.g. , on a microtiter plate, by covalent or non-covalent attachments.
- Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying.
- an immobilized antibody e.g. , a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface.
- the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized5 component, e.g. , the coated surface containing the anchored component.
- the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected.
- the detection of label immobilized on the surface indicates that complexing occurred.
- complexing can be detected, for example, by using a labelled antibody0 specifically binding the immobilized complex.
- the candidate compound interacts with but does not bind to a particular protein encoded by a gene identified herein, its interaction with that protein can be assayed by methods well known for detecting protein-protein interactions.
- assays include traditional approaches, such as, cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns.
- 5 protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature (London). 340, 245-246 (1989); Chien et al, Proc. Natl. Acad. Sci. USA, 88, 9578-9582 (1991)] as disclosed by Chevray and Nathans, Proc. Natl.
- yeast GAL4 Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, ' one acting as the DNA-binding domain, while the other one functioning as the0 transcription activation domain.
- two-hybrid system takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain.
- the expression of a GALl-lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via5 protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for b-galactosidase.
- a complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.
- a reaction mixture is usually prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products.
- the reaction is run in the absence and in the presence of the test compound.
- a placebo may be added to a third reaction mixture, to serve as positive control.
- the binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described above. The formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
- compositions and Methods for the Treatment of Immune Related Diseases include, without limitation, proteins, antibodies, small organic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, triple helix molecules, etc. that inhibit or stimulate immune function, for example, T cell proliferation/activation, lymphokine release, or immune cell infiltration.
- antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
- antisense DNA oligodeoxyribonucleotides derived from the translation initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g., Rossi, Current Biology, 4, 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).
- Nucleic acid molecules in triple helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides.
- the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of purines or pyrirnidines on one strand of a duplex.
- Hoogsteen base pairing rules which generally require sizeable stretches of purines or pyrirnidines on one strand of a duplex.
- the present invention further provides anti-PRO antibodies.
- Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
- the anti-PRO antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
- the immunizing agent may include the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
- immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobuliri, and soybean trypsin inhibitor.
- adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
- the immunization protocol may be selected by one skilled in the art without undue experimentation.
- the anti-PRO antibodies may, alternatively, be monoclonal antibodies.
- Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kobler and Milstein, Nature, 256:495 (1975).
- a hybridoma method a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro.
- the immunizing agent will typically include the PRO polypeptide or a fusion protein thereof.
- PBLs peripheral blood lymphocytes
- spleen cells or lymph node cells are used if non-human mammalian sources are desired.
- the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103].
- immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
- the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
- HAT medium hypoxanthine, aminopterin, and thymidine
- Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium.
- More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol. , 133:3001 (1984); Brodeur et al. , Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63].
- the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PRO.
- the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
- RIA radioimmunoassay
- ELISA enzyme-linked immunoabsorbent assay
- the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220 (1980).
- the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra] .
- Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
- the hybridoma cells may be grown in vivo as ascites in a mammal.
- the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
- the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567.
- DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g. , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- the hybridoma cells of the invention serve as a preferred source of such DNA.
- the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells .
- host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein.
- the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No.
- non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
- the antibodies may be monovalent antibodies.
- Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain.
- the heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking.
- the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
- In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments , can be accomplished using routine techniques known in the art.
- the anti-PRO antibodies of the invention may further comprise humanized antibodies or human antibodies.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain niinimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- CDR complementary determining region
- donor antibody non-human species
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al, Nature, 321:522-525 (1986); Riechmann et al, Nature, 332:323-327 (1988); Verhoeyen et al, Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
- humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al, J. Mol. Biol.,
- human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent
- the antibodies may also be affinity matured using known selection and/or mutagenesis methods as described above.
- Preferred affinity matured antibodies have an affinity which is five times, more preferably 10 times, even more preferably 20 or 30 times greater than the starting antibody (generally murine, humanized or human) from which the matured antibody is prepared.
- Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
- one of the binding specificities is for the PRO, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
- bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities [Milstein and Cuello, Nature, 305:537-539 (1983)] . Because of the random assortment of immunoglobulin heavy and light chains , these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules , of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al, EMBO J., 10:3655-3659 (1991).
- Antibody variable domains with the desired binding specificities can be fused to immunoglobulin constant domain sequences.
- the fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions . It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light-chain binding present in at least one of the fusions .
- DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors, and are co-transfected into a suitable host organism.
- the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture.
- the preferred interface comprises at least a part of the CH3 region of an antibody constant domain.
- one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan).
- Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
- Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g. , F(ab')2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments have been described in the literature. For example, bispecific antibodies can be prepared can be prepared using chemical linkage . Brennan et al.. Science, 229: 81 ( 1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives.
- TAB thionitrobenzoate
- One of the Fab' -TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoemylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody.
- the bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.
- Fab' fragments may be directly recovered from E. coli and chemically coupled to form bispecific antibodies.
- Shalaby et al. J. Exp. Med., 175:217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab')2 molecule.
- Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody.
- the bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.
- Various technique for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described.
- bispecific antibodies have been produced using leucine zippers.
- the leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion.
- the antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers.
- This method can also be utilized for the production of antibody homodimers.
- the "diabody" technology described by HoUinger et al, Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments.
- the fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the VH and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites.
- VH and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites.
- sFv single-chain Fv
- Antibodies with more than two valencies are contemplated.
- trispecific antibodies can be prepared. Tutt et al. , J. Immunol., 147:60 (1991).
- bispecific antibodies may bind to two different epitopes on a given PRO polypeptide herein.
- an anti-PRO polypeptide arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD2, CD3, CD28, or B7), or
- Fc receptors for IgG FcgR
- FcgR FcgRI
- CD64 FcgRII
- CD32 FcgRII
- FcgRIJI CD16
- Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular PRO polypeptide. These antibodies possess a PRO-binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOTA, or TETA.
- Another bispecific antibody of interest binds the PRO polypeptide and further binds tissue factor (TF).
- Heteroconjugate antibodies are also within the scope of the present invention.
- Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089].
- the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. .
- immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
- cysteine residue(s) may be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region.
- the homodimeric antibody thus generated may have improved intemalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al , J. Exp Med.. 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922 (1992).
- Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al, Cancer Research, 53: 2560-2565 (1993).
- an antibody can be engineered that has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al, Anti-Cancer Drug Design, 3: 219-230 (1989).
- the invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g. , an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
- a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g. , an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
- Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudonwnas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins,
- Phytolaca americana proteins PAPI, PAPIJ, and PAP-S
- momordica charantia inhibitor curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
- radionuclides are available for the production of radioconjugated antibodies. Examples include 212 Bi, 131 I, 131 In, 90 Y, and 186 Re.
- Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminofhiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HC1), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine) , bis-diazonium derivatives (such as bis- ⁇ -diazomumbenzoyl)-e ylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2,4-dinitrobenzene).
- SPDP N-s
- a ricin immunotoxin can be prepared as described in Vitetta et al , Science, 23_ ⁇ l098 (1987).
- Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See W094/11026.
- the antibody may be conjugated to a "receptor" (such streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then adh inistration of a "ligand” (e.g. , avidin) that is conjugated to a cytotoxic agent (e.g., a radionucleotide).
- a ligand e.g. , avidin
- the antibodies disclosed herein may also be formulated as immunoliposomes.
- Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al. , Proc. Natl. Acad. Sci. USA. 82:3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA. 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.
- Particularly useful liposomes can be generated by the reverse-phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
- Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al. , J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange reaction.
- a chemotherapeutic agent such as Doxorubicin is optionally contained within the liposome. See Gabizon et al, J. National Cancer hist.. 81(19):1484 (1989).
- anti-PRO antibodies of the invention have various utilities.
- anti-PRO antibodies may be used in diagnostic assays for PRO, e.g. , detecting its expression (and in some cases, differential expression) in specific cells, tissues, or serum.
- diagnostic assay techniques known in the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp. 147-158].
- the antibodies used in the diagnostic assays can be labeled with a detectable moiety.
- the detectable moiety should be capable of producing, either directly or indirectly, a detectable signal.
- the detectable moiety may be a radioisotope, such as 3 H, 14 C,
- a fluorescent or chen ⁇ luminescent compound such as fluorescein isothiocyanate, rhodamine, or luciferin
- an enzyme such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
- Any method known in the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al, Nature, 144:945 (1962); David et al, Biochemistry, 13:1014 (1974); Pain et al, J. Immunol. Meth., 40:219 (1981); and Nygren, J. Histochem. and Cvtochem. , 30:407
- Anti-PRO antibodies also are useful for the affinity purification of PRO from recombinant cell culture or natural sources.
- the antibodies against PRO are immobilized on a suitable support, such a Sephadex resin or filter paper, using methods well known in the art.
- the immobilized antibody then is contacted with a sample containing the PRO to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the PRO, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the PRO from the antibody.
- compositions The active PRO molecules of the invention (e.g., PRO polypeptides, anti-PRO antibodies, and/or variants of each) as well as other molecules identified by the screening assays disclosed above, can be ao ⁇ mrnistered for the treatment of immune related diseases, in the form of pharmaceutical compositions.
- Therapeutic formulations of the active PRO molecule, preferably a polypeptide or antibody of the invention, are prepared for storage by mixing the active molecule having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form of lyophilized formulations or aqueous solutions.
- Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine,
- Lipofections or liposomes can also be used to deliver the PRO molecule into cells. Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e.g. , Marasco et al. , Proc. Natl. Acad. Sci. USA. 90:7889-7893 [1993]). The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
- the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent.
- cytotoxic agent cytokine or growth inhibitory agent.
- Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
- the active PRO molecules may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- the formulations to be used for in vivo adrninistration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
- sustained-release preparations or the PRO molecules may be prepared.
- suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules.
- sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
- copolymers of L-glutamic acid and ⁇ -ethyl-L-glutamate non-degradable ethylene-vinyl acetate
- degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
- poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
- encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37 °C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizihg from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
- polypeptides, antibodies and other active compounds of the present invention may be used to treat various immune related diseases and conditions, such as T cell mediated diseases, including those characterized by infiltration of inflammatory cells into a tissue, stimulation of T-cell proliferation, inhibition of T-cell proliferation, increased or decreased vascular permeability or the inhibition thereof.
- T cell mediated diseases including those characterized by infiltration of inflammatory cells into a tissue, stimulation of T-cell proliferation, inhibition of T-cell proliferation, increased or decreased vascular permeability or the inhibition thereof.
- Exemplary conditions or disorders to be treated with the polypeptides, antibodies and other compounds of the invention include, but are not limited to systemic lupus erythematosis, rheumatoid arthritis, juvenile chronic arthritis, osteoarihritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, polymyositis), Sj ⁇ gren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated renal disease (glomerulonephritis,
- T lymphocytes have not been shown to be directly involved in tissue damage, T lymphocytes are required for the development of auto-reactive antibodies. The genesis of the disease is thus T lymphocyte dependent. Multiple organs and systems are affected clinically including kidney, lung, musculoskeletal system, mucocutaneous, eye, central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood.
- Rheumatoid arthritis is a chronic systemic autoimmune inflammatory disease that mainly involves the synovial membrane of multiple joints with resultant injury to the articular cartilage.
- the pathogenesis is T lymphocyte dependent and is associated with the production of rheumatoid factors, auto-antibodies directed against self IgG, with the resultant formation of immune complexes that attain high levels in joint fluid and blood.
- These complexes in the joint may induce the marked infiltrate of lymphocytes and monocytes into the synovium and subsequent marked synovial changes; the joint space/fluid if infiltrated by similar cells.with the addition of numerous neutrophils.
- Tissues affected are primarily the joints, often in symmetrical pattern.
- extra-articular disease also occurs in two major forms.
- One form is the development of extra-articular lesions with ongoing progressive joint disease and typical lesions of pulmonary fibrosis, vasculitis, and cutaneous ulcers.
- the second form of extra-articular disease is the so called Felty 's syndrome which occurs late in the RA disease course, sometimes after joint disease has become quiescent, and involves the presence of neutropenia, thrombocytopenia and splenomegaly. This can be accompanied by vasculitis in multiple organs with formations of infarcts, skin ulcers and gangrene.
- RA rheumatoid nodules
- pericarditis pleuritis
- coronary arteritis intestinal pneumonitis with pulmonary fibrosis
- keratoconjunctivitis sicca and rhematoid nodules.
- Juvenile chronic arthritis is a chronic idiopathic inflammatory disease which begins often at less than 16 years of age. Its phenotype has some similarities to RA; some patients which are rhematoid factor positive are classified as juvenile rheumatoid arthritis. The disease is sub-classified into three major categories: pauciarticular, polyarticular, and systemic. The arthritis can be severe and is typically destructive and leads to joint ankylosis and retarded growth. Other manifestations can include chronic anterior uveitis and systemic amyloidosis. Spondyloarthropathies are a group of disorders with some common clinical features and the common association with the expression of HLA-B27 gene product.
- the disorders include: ankylosing sponylitis, Reiter's syndrome (reactive arthritis), arthritis associated with inflammatory bowel disease, spondylitis associated with psoriasis, juvenile onset spondyloarthropathy and undifferentiated spondyloarthropathy.
- Distinguishing features include sacroileitis with or without spondylitis; inflammatory asymmetric arthritis; association with HLA-B27 (a serologically defined allele of the HLA-B locus of class I MHC); ocular inflammation, and absence of autoantibodies associated with other rheumatoid disease.
- CD8 + T lymphocyte a cell which targets antigen presented by class I MHC molecules.
- CD8 + T cells may react against the class I MHC allele HLA-B27 as if it were a foreign peptide expressed by MHC class I molecules. It has been hypothesized that an epitope of HLA-B27 may rnimic a bacterial or other microbial antigenic epitope and thus induce a CD8 + T cells response.
- Systemic sclerosis (scleroderma) has an unknown etiology. A hallmark of the disease is induration of the skin; likely this is induced by an active inflammatory process.
- Scleroderma can be localized or systemic; vascular lesions are common and endothelial cell injury in the microvasculature is an early and important event in the development of systemic sclerosis; the vascular injury may be immune mediated.
- An immunologic basis is implied by the presence of mononuclear cell infiltrates in the cutaneous lesions and the presence of anti-nuclear antibodies in many patients.
- ICAM-1 is, often upregulated on the cell surface of fibroblasts in skin lesions suggesting that T cell interaction with these cells may have a role in the pathogenesis of the disease.
- organs involved include: the gastrointestinal tract: smooth muscle atrophy and fibrosis resulting in abnormal peristalsis/motility; kidney: concentric subendothelial intimal proliferation affecting small arcuate and interlobular arteries with resultant reduced renal cortical blood flow, results in proteinuria, azotemia and hypertension; skeletal muscle: atrophy, interstitial fibrosis; inflammation; lung: interstitial pneumonitis and interstitial fibrosis; and heart: contraction band necrosis, scarring/fibrosis.
- Idiopathic inflammatory myopathies including dermato ⁇ yyositis, polymyositis and others are disorders of chronic muscle inflammation of unknown etiology resulting in muscle weakness. Muscle injury /inflammation is often symmetric and progressive. Autoantibodies are associated with most forms. These myositis-specific autoantibodies are directed against and inhibit the function of components, proteins and RNA's, involved in protein synthesis.
- Sj ⁇ gren's syndrome is due to immune-mediated inflammation and subsequent functional destruction of the tear glands and salivary glands.
- the disease can be associated with or accompanied by inflammatory connective tissue diseases.
- the disease is associated with autoantibody production against Ro and La antigens, both of which are small RNA-protein complexes. Lesions result in keratoconjunctivitis sicca, xerostomia, with other manifestations or associations including bilary cirrhosis, peripheral or sensory neuropathy, and palpable purpura.
- Systemic vasculitis are diseases in which the primary lesion is inflammation and subsequent damage to blood vessels which results in ischemia/necrosis/degeneration to tissues supplied by the affected vessels and eventual end-organ dysfunction in some cases.
- Vasculitides can also occur as a secondary lesion or sequelae to other immune-inflammatory mediated diseases such as rheumatoid arthritis, systemic sclerosis, etc., particularly in diseases also associated with the formation of immune complexes.
- MLNS mucocutaneous lymph node syndrome
- Sarcoidosis is a condition of unknown etiology which is characterized by the presence of epithelioid granulomas in nearly any tissue in the body; involvement of the lung is most common.
- the pathogenesis involves the persistence of activated macrophages and lymphoid cells at sites of the disease with subsequent chronic sequelae resultant from the release of locally and systemically active products released by these cell types.
- Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune pancytopenia, and paroxysmal noctural hemoglobinuria is a result of production of antibodies that react with antigens expressed on the surface of red blood cells (and in some cases other blood cells including platelets as well) and is a reflection of the removal of those antibody coated cells via complement mediated lysis and/or ADCC/Fc-receptor-mediated mechanisms .
- platelet destruction/removal occurs as a result of either antibody or complement attaching to platelets and subsequent removal by complement lysis, ADCC or FC-receptor mediated mechanisms.
- Thyroiditis including Grave' s disease, Hashimoto ' s thyroiditis , juvenile lymphocytic thyroiditis , and atrophic thyroiditis, are the result of an autoimmune response against thyroid antigens with production of antibodies that react with proteins present in and often specific for the thyroid gland.
- Experimental models exist including spontaneous models: rats (BUF and BB rats) and chickens (obese chicken strain); inducible models : immunization of animals with either thyroglobulin, thyroid microsomal antigen (thyroid peroxidase) .
- Type I diabetes mellitus or insulin-dependent diabetes is the autoimmune destruction of pancreatic islet cells; this destruction is mediated by auto-antibodies and auto-reactive T cells. Antibodies to insulin or the insulin receptor can also produce the phenotype of insulin-non-responsiveness.
- Immune mediated renal diseases including glomerulonephritis and tubulointerstitial nephritis, are the result of antibody or T lymphocyte mediated injury to renal tissue either directly as a result of the production of autoreactive antibodies or T cells against renal antigens or indirectly as a result of the deposition of antibodies and/or immune complexes in the kidney that are reactive against other, non-renal antigens.
- immune-mediated diseases that result in the formation of immune-complexes can also induce immune mediated renal disease as an indirect sequelae.
- Both direct and indirect immune mechanisms result in inflammatory response that produces/induces lesion development in renal tissues with resultant organ function impairment and in some cases progression to renal failure.
- Both humoral and cellular immune mechanisms can be involved in the pathogenesis of lesions.
- Demyelinating diseases of the central and peripheral nervous systems including Multiple Sclerosis; idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome; and Chronic Inflammatory
- Demyelinating Polyneuropathy are believed to have an autoimmune basis and result in nerve demyelination as a result of damage caused to oligodendrocytes or to myelin directly.
- MS there is evidence to suggest -that disease induction and progression is dependent on T lymphocytes.
- Multiple Sclerosis is a demyelinating disease that is T lymphocyte-dependent and has either a relapsing-remitting course or a chronic progressive course. The etiology is unknown; however, viral infections, genetic predisposition, environment, and autoimmunity all contribute.
- T lymphocyte mediated, microglial cells and infiltrating macrophages are the predominant cell type at lesions.
- the mechanism of oligodendrocyte cell death and subsequent demyelination is not known but is likely T lymphocyte driven.
- Inflammatory and Fibrotic Lung Disease, mcluding Eosinophilic Pneumonias; Idiopathic Pulmonary Fibrosis, and Hypersensitivity Pneumonitis may involve a disregulated immune-inflammatory response. Inhibition of that response would be of therapeutic benefit.
- Autoimmune or Immune-mediated Skin Disease including Bullous Skin Diseases, Erythema Multiforme, and Contact Dermatitis are mediated by auto-antibodies, the genesis of which is T lymphocyte-dependent.
- Psoriasis is a T lymphocyte-mediated inflammatory disease. Lesions contain infiltrates of T lymphocytes, macrophages and antigen processing cells, and some neutrophils.
- Allergic diseases including asthma; allergic rhinitis; atopic dermatitis; food hypersensitivity; and urticaria are T lymphocyte dependent. These diseases are predominantly mediated by T lymphocyte induced inflammation, IgE mediated-inflammation or a combination of both.
- Transplantation associated diseases including Graft rejection and Graft- Versus-Host-Disease (GVHD) are T lymphocyte-dependent; inhibition of T lymphocyte function is ameliorative.
- GVHD Graft rejection and Graft- Versus-Host-Disease
- infectious disease including but not limited to viral infection (including but not limited to AIDS, hepatitis A, B, C, D, E and herpes) bacterial infection, fungal infections, and protozoal and parasitic infections (molecules (or derivatives/agonists) which stimulate the MLR can be utilized therapeutically to enhance the immune response to infectious agents)
- diseases of immunodeficiency molecules/derivatives/agonists which stimulate the MLR can be utilized therapeutically to enhance the immune response for conditions of inherited, .acquired, infectious induced (as in HIV infection), or iatrogenic (i.e., as from chemotherapy) immunodeficiency, and neoplasia.
- Molecules that inhibit the lymphocyte response in the MLR also function in vivo during neoplasia to suppress the immune response to a neoplasm; such molecules can either be expressed by the neoplastic cells themselves or their expression can be induced by the neoplasm in other cells. Antagonism of such inhibitory molecules (either with antibody, small molecule antagonists or other means) enhances immune-mediated tumor rejection.
- inhibition of molecules with proinflammatory properties may have therapeutic benefit in reperfusion injury; stroke; myocardial infarction; atherosclerosis; acute lung injury; hemorrhagic shock; burn; sepsis/septic shock; acute tubular necrosis; endometriosis; degenerative joint disease and pancreatis.
- the compounds of the present invention are administered to a mammal, preferably a human, in accord with known methods, such as intravenous aclministration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation (intranasal, intrapulmonary) routes.
- Intravenous or inhaled administration of polypeptides and antibodies is preferred.
- an anti-cancer agent may be combined with the administration of the proteins, antibodies or compounds of the instant invention.
- the patient to be treated with a the immunoadjuvant of the invention may also receive an anti-cancer agent (chemotherapeutic agent) or radiation therapy.
- chemotherapeutic agent chemotherapeutic agent
- Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992).
- the chemotherapeutic agent may precede, or follow administration of the immunoadjuvant or may be given simultaneously therewith.
- an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) may be given in dosages known for such molecules.
- the PRO polypeptides are coadministered with a growth inhibitory agent.
- the growth inhibitory agent may be administered first, followed by a PRO polypeptide.
- simultaneous administration or administration first is also contemplated.
- Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the PRO polypeptide.
- the appropriate dosage of an a compound of the invention will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is aciministered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the compound, and the discretion of the attending physician.
- the compound is suitably administered to the patient at one time or over a series of treatments. For example, depending on the type and severity of the disease, about 1 mg/kg to 15 mg/kg (e.g. ,
- polypeptide or antibody is an initial candidate dosage for administration to the patient, whether, for example,, by one or more separate administrations, or.by continuous infusion.
- a typical daily dosage might range from about 1 mg/kg to 100 mg/kg or more, depending on the factors mentioned above.
- the treatment is sustained until a desired suppression of disease symptoms occurs.
- other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
- an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above.
- the article of manufacture comprises a container and an instruction.
- Suitable containers include, for example, bottles, vials, syringes, and test tubes.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container holds a composition which, is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the active agent in the composition is usually a polypeptide or an antibody of the invention.
- the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- a pharmaceutically-acceptable buffer such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- Cell surface proteins such as proteins which are overexpressed in certain immune related diseases, are excellent targets for drug candidates or disease treatment.
- the same proteins along with secreted proteins encoded by the genes amplified in immune related disease states find additional use in the diagnosis and prognosis of these diseases.
- antibodies directed against the protein products of genes amplified in multiple sclerosis, rheumatoid arthritis, inflammatory bowel disorder, or another immune related disease, can be used as diagnostics or prognostics.
- antibodies can be used to qualitatively or quantitatively detect the expression of proteins encoded by amplified or overexpressed genes ("marker gene products").
- the antibody preferably is equipped with a detectable, e.g. , fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. These techniques are particularly suitable, if the overexpressed gene encodes a cell surface protein Such binding assays are performed essentially as described above.
- In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or irnmunoelectron microscopy.
- a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample.
- This procedure also allows for determining the distribution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection.
- the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases.
- the EST databases included public EST databases (e.g. , GenBank, Merck/ Wash U.) and a proprietary EST DNA database (LIFESEQ ® , lhcyte Pharmaceuticals, Palo Alto, CA).
- the search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzvmology,
- DNA59294-1381 (SEQ ID NO:l) and the derived PRO1031 protein sequence (UNQ516)(SEQ ID NO: 2).
- the predicted polypeptide precursor is 180 amino acids long (Figure 2; SEQ ID NO:2).
- the full-length PRO1031 (UNQ516) protein shown in Figure 2 (SEQ ID NO:2) has an estimated molecular weight of about 20,437 daltons and a pi of about 9.58.
- Clone DNA59294-1381 has been deposited with the ATCC, and has been assigned deposit number 209866. In the event of any sequencing irregularities or errors with the sequences provided herein, it is understood that the deposited clone contains the correct sequence for DNA59624-1381 (SEQ ID NO: 1). Furthermore, the sequences provided herein are the result of known sequencing techniques.
- amino acid sequence of SEQ ID NO:2 reveals that the putative signal peptide is at about amino acids 1-20 of SEQ ID NO:2.
- An N-glycosylation site is at about amino acids 75-78 of SEQ ID NO:2.
- a region having sequence identity with IL-17 is at about amino acids 96-180.
- the corresponding nucleotides can be routinely determined given the sequences provided herein.
- the EST was Incyte 1347523 also called DNA49665. Based on DNA49665, oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolated a clone of the full-length coding sequence for the PROl 122. [e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989); Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probes sequences are typically 40-55 bp in length.
- additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kpb.
- DNA from the libraries was screened by PCR amplification, as per Ausuble et al. , Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
- PCR primers forward, reverse and hybridization
- forward PCR primer 5'-ATCCACAGAAGCTGGCCTTCGCCG-3'
- reverse PCR primer 5'-GGGACGTGGATGAACTCGGTGTGG-3'
- hybridization probe 5'-TATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAG-3' (SEQ ID NO:21).
- RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue.
- the cDNA libraries used to isolate the cDNA clones were constructed using standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. , Science. 235:
- a suitable cloning vector such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. , Science. 235:
- Clone DNA62377-1381-1 (SEQ ID NO:3) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 50-52 and ending at the stop codon at nucleotide positions 641-643 of SEQ ID NO:3 ( Figure 3).
- the predicted polypeptide precursor is 197 amino acids long ( Figure 4; SEQ ID NO:4).
- the full-length PROl 122 protein shown in Figure 4 (UNQ561)(SEQ ID NO:4) has an estimated molecular weight of about 21765 daltons and a pi of about 8.53.
- Clone DNA62377-1381-1 has been deposited with the ATCC on December 22, 1998 and has been assigned deposit number 203552.
- ECD extracellular domain
- PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO10272.
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probe sequences are typically 40-55 bp in length.
- additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp.
- DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
- DNA146646 sequence which had the following nucleotide sequence: hybridization probe 5'- CAGCAGCTCCTCAGAGGTGTCCTGCCCTTTGCTGGGGCAGCAGCT -3 ' (SEQ ID NO: 24)
- RNA for construction of the cDNA libraries was isolated from human testis tissue.
- the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
- a suitable cloning vector such as pRKB or pRKD; pRK5B is a precursor of pRK5D
- the full length clone identified above contained a single open reading frame with an apparent translational initiation site at nucleotide positions 259-261 and a stop signal at nucleotide positions 790-792 (Figure 5, SEQ ID NO: 5).
- the predicted polypeptide precursor is 177 amino acids long, has a calculated molecular weight of approximately 20,330 daltons and an estimated pi of approximately 8.78.
- Analysis of the full-length PRO10272 sequence shown in Figure 6 (SEQ ID NO:6) evidences the presence of a variety of important polypeptide domains as shown in Figure 6, wherein the locations given for those important polypeptide domains are approximate as described above.
- Clone DNA147531-2821 has been deposited with ATCC on January 11, 2000 and is assigned ATCC deposit no. PTA-1185.
- PRO10272 may be a novel cytokine and is herein designated IL-17E.
- IL-17E an analysis of the Dayhoff database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 6 (SEQ ID NO:6), evidenced sequence identity between the PRO10272 amino acid sequence and the following Dayhoff sequences: P_Y22197, P_W85620, AF18469 , P_Y41762, P_Y28235, P_W97350, P_Y22198, P_Y28236, P_W28514, P_W13651.
- EXAMPLE 4 Isolation of cDNA Clones Encoding a Human PRQ21175
- An expressed sequence tag (EST) DNA database from Merck/Washington University was searched and an EST was identified which showed homology to Interleukin-17.
- a pool of 50 different human cDNA libraries from various tissues was used in cloning.
- the cDNA libraries used to isolate the cDNA clones encoding human PR021175 were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see,
- Oligonucleotides probes based upon the above described EST sequence were then synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR021175.
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probe sequences are typically 40-55 bp in length.
- DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, supra, with the PCR primer pair.
- a positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
- the oligonucleotide probes employed were as follows: forward PCR primer 5'-GCTCAGTGCCTTCCACCACACGC-3' (SEQ ID NO:25) reverse PCR primer 5'-CTGCGTCCTTCTCCGGCTCGG-3' (SEQ ID NO:26) hybridization probe
- PR021175 may be a novel cytokine and is herein designated
- EL-17D Specifically, an analysis of the protein database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 8 (SEQ ID NO: 8), evidenced sequence identity between the PR021175 amino acid sequence and the following sequence: AF152099_1.
- EXAMPLE 5 Isolation of cDNA Clones Encoding a Human PRO5801
- the extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases.
- the EST databases included (1) public EST databases (e.g., GenBank) and (2) a proprietary EST database (LIFESEQ", Incyte Pharmaceuticals, Palo Alto, CA).
- the search was performed using the computer program BLAST or BLAST2 [Altschul etal. , Methods in Enzvmology, 266:460-480 (1996)] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap” (Phil Green, University of Washington, Seattle, Washington).
- a consensus DNA sequence was assembled relative to other EST sequences using phrap as described above. This consensus sequence is herein designated DNA105850. In some cases, the consensus sequence derives from an intermediate consensus DNA sequence which was extended using repeated cycles of BLAST and phrap to extend that intermediate consensus sequence as far as possible using the sources of EST sequences discussed above.
- oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO5801.
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probe sequences are typically 40-55 bp in length.
- additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp.
- DNA from the libraries was screened by PCR amplification, as per Ausubel et al. , Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
- PCR primers (forward and reverse) were synthesized: forward PCR primer 1 5'-ACTCCATATTTTCCTACTTGTGGCA-3' (SEQ ID NO:28) forward PCR primer 2 5'-CCCAAAGTGACCTAAGAAC-3 ' (SEQ ID NO:29) reverse PCR primer 5'-TCACTGAATTTCTTCAAAACCATTGCA-3' (SEQ ID NO:30) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus ,
- DNA105850 sequence which had the following nucleotide sequence hybridization probe 5 ' -TGTGGCAGCGACTGCATCCGACATAAAGGAACAGTTGTGCTCTGCCCAC ⁇ -3 ' (SEQ ID NO:31)
- RNA for construction of the cDNA libraries was isolated from human fetal liver tissue.
- the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
- a suitable cloning vector such as pRKB or pRKD; pRK5B is a precursor of pR
- DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for a full-length PRO5801 polypeptide (designated herein as DNAl 15291-2681 [ Figure 11, SEQ ID NO: 11]) and the derived protein sequence for that PRO5801 polypeptide.
- the full length clone identified above contained a single open reading frame with an apparent translational initiation site at nucleotide positions 7-9 and a stop signal at nucleotide positions 1513-1515
- Figure 12 SEQ ED NO: 12
- the predicted polypeptide precursor is 502 amino acids long, has a calculated molecular weight of approximately 55,884 daltons and an estimated pi of approximately 8.52.
- Analysis of the full-length PRO5801 sequence shown in Figure 12 evidences the presence of a variety of important polypeptide domains as shown in Figure 12, wherein the locations given for those important polypeptide domains are approximate as described above.
- Clone DNAl 15291-2681 has been deposited with
- PRO5801 has sequence similarity to an IL-17 receptor protein and PRO5801 is also designated herein as EL-17RH1 as described in Example 22 of the present application.
- an analysis of the Dayhoff database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 12 (SEQ ID NO: 12), evidenced sequence identity between the PRO5801 amino acid sequence and the following Dayhoff sequences: HSU58917 , P_W92409, P_W61272, P_W04185, P__W61271, P_W04184, P_W92408, GEN13979, MMU31993_1 and YS02_CAEEL.
- EXAMPLE 6 Isolation of cDNA Clones Encoding a Human PRO20040 An expressed sequence tag (EST) DNA database ( Merck/Washington University) was searched and an EST was identified which showed homology to lhterleukin 17 receptor.
- EST expressed sequence tag
- RNA for construction of cDNA libraries was then isolated from a pool of 50 different human cDNA libraries.
- the cDNA libraries used to isolate the cDNA clones encoding human PRO20040 were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. , Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl.
- a suitable cloning vector such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. , Science, 253: 1278-1280 (1991)
- Oligonucleotides probes based upon the above described EST sequence were then synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO20040.
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probe sequences are typically 40-55 bp in length.
- DNA from the libraries was screened by PCR amplification, as per Ausubel et al. , Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
- the oligonucleotide probes employed were as follows: forward PCR primer 5'-CCGACTTCTTGCAGGGCCGG-3' (SEQ ID NO:32) reverse PCR primer 5'-GCAGCACGCAGCTGAGCGAG-3' (SEQ ID NO:33) hybridization probe 5'-AGCGAGTGGCTACAGGATGGGGTGTCCGGGCCC-3' (SEQ ID NO:34)
- the signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5 '-end of the sequence or sequence fragment under consideration.
- the nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored.
- the EST sequence contains an authentic signal sequence
- DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals.
- GenBank GenBank
- LEFSEQ ® Incyte Pharmaceuticals Palo Alto, CA
- the homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzvmology, 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap " (Phil Green, University of Washington,
- DNAFROM DNAFROM
- clone no. 700536 was purchased and the cDNA insert was obtained and sequenced. It was found herein that that cDNA insert encoded a full-length protein. The sequence of this cDNA insert is shown in Figure 15 and is herein designated as
- Clone DNAl 19502-2789 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 106-108 and ending at the stop codon at nucleotide positions 2107-2109 ( Figure 15; SEQ ID NO: 15).
- the predicted polypeptide precursor is 667 amino acids long ( Figure 16).
- the full-length PR09877 protein shown in Figure 16 has an estimated molecular weight of about 74,810 daltons and a pi of about 9.55.
- Analysis of the full-length PR09877 sequence shown in Figure 16 evidences the presence of a variety of important polypeptide domains as shown in Figure 16, wherein the locations given for those important polypeptide domains are approximate as described above.
- Clone DNAl 19502-2789 has been deposited with ATCC on December 22, 1999 and is assigned ATCC deposit no. PTA-1082.
- PR09877 has sequence similarity to an EL-17 receptor protein and PR09877 is also designated herein as IL-17RH3.
- an analysis of -the Dayhoff database (version 35.45 SwissProt 35), using the ALI.GN-2 sequence alignment analysis of the full-length sequence shown in Figure 16 (SEQ ED NO: 16), evidenced sequence identity between the PR09877 amino acid sequence and the following Dayhoff sequences: P_W61272, HSU58917_1, P_W04185, P W92409, GEN13979, P_W04184, P_W92408, MMU31993 , P_W61271, and AF090114_1.
- EXAMPLE 8 Isolation of cDNA Clones Encoding a Human PRO20026
- the extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases.
- the EST databases included a proprietary EST database (LEFESEQ ® , Incyte Pharmaceuticals, Palo Alto,
- DNA149870 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described above. This consensus sequence is herein designated DNA149870. In some cases, the DNA149870 consensus sequence derives from an intermediate consensus DNA sequence which was extended using repeated cycles of BLAST and phrap to extend that intermediate consensus sequence as far as possible using the sources of EST sequences discussed above.
- Oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO20026.
- Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
- the probe sequences are typically 40-55 bp in length.
- additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp.
- a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA149870 sequence which had the following nucleotide sequence hybridization probe 5'-CTATCTCCCTGCCAGGAGGCCGGAGTGGGGGAGGTCAGAC-3' (SEQ ED NO: 37)
- RNA for construction of the cDNA libraries was isolated from human tissue.
- the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
- the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
- a suitable cloning vector such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does
- DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for a full-length PRO20026 polypeptide (designated herein as DNA154095-2998 [ Figure 17, SEQ ED NO: 17J) and the derived protein sequence for that PRO20026 polypeptide.
- the full length clone identified above contained a single open reading frame with an apparent translational initiation site at nucleotide positions 70-72 and a stop signal at nucleotide positions 2254-2256 ( Figure 17, SEQ ED NO: 17).
- the predicted polypeptide precursor is 728 amino acids long, has a calculated molecular weight of approximately 81,310 daltons and an estimated pi of approximately 6.84.
- Analysis of the full-length PRO20026 sequence shown in Figure 18 (SEQ ID NO : 18) evidences the presence of a variety of important polypeptide domains as shown in Figure 18, wherein the locations given for those important polypeptide domains are approximate as described above.
- Clone DNA154095-2998 has been deposited with ATCC on October 10, 2000 and is assigned ATCC Deposit No. PTA-2591.
- EXAMPLE 9 Use of PRO as a hybridization probe The following method describes use of a nucleotide sequence encoding PRO as a hybridization probe.
- DNA comprising the coding sequence of full-length or mature PRO as disclosed herein is employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurring variants of PRO) in human tissue cDNA libraries or human tissue genomic libraries.
- Hybridization and washing of filters containing either library DNAs is performed under the following high stringency conditions.
- Hybridization of radiolabeled PRO-derived probe to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1% SDS, 0.1 % sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at 42°C for 20 hours. Washing of the filters is performed in an aqueous solution of 0. lx SSC and 0.1 % SDS at 42°C.
- DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO can then be identified using standard techniques known in the art.
- EXAMPLE 10 In situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis and aid in chromosome mapping.
- In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision, 1; 169-176 (1994), using PCR-generated 33 P-labeled riboprobes. Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in proteinase K (20 g/ml) for 15 minutes at 37°C, and further processed for in situ hybridization as described by Lu and Gillett, supra.
- a [ 33 -P] UTP-labeled antisense riboprobe was generated from a PCR product and hybridized at 55 °C overnight. The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks. 33 P-Riboprobe synthesis
- the tubes were incubated at 37°C for one hour. 1.0 ⁇ l RQ1 DNase were added, followed by incubation at 37°C for 15 minutes. 90 ⁇ l TE (10 mM Tris pH 7.6/lmM EDTA pH 8.0) were added, and the mixture ' was pipetted onto DE81 paper. The remaining solution was loaded in a Microcon-50 ultrafiltration unit, and spun using program 10 (6 minutes). The filtration unit was inverted over a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 ⁇ l TE were added. 1 ⁇ l of the final product was pipetted on DE81 paper and counted in 6 ml of Biofluor EL The probe was run on a TBE/urea gel. 1-3 ⁇ l of the probe or 5 ⁇ l of RNA Mrk UI were added to
- the slides were deparaffinized, placed in SQ H z O, and rinsed twice in 2 x SSC at room temperature, for 5 minutes each time.
- the sections were deproteinated in 20 ⁇ g/ml proteinase K (500 ⁇ l of 10 mg/ml in 250 ml RNase-free RNase buffer; 37°C, 15 minutes) - human embryo, or 8 x proteinase K (100 ⁇ l in 250 ml Rnase buffer, 37°C, 30 minutes) - formalin tissues. Subsequent rinsing in 0.5 x SSC and dehydration were performed as described above.
- the slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper.
- Box buffer (4 x SSC, 50% formamide) - saturated filter paper.
- the tissue was covered with 50 ⁇ l of hybridization buffer (3.75g Dextran Sulfate + 6 ml SQ
- the slides were cooled on ice, and 48 ⁇ l hybridization buffer were added per slide. After vortexing, 50 ⁇ l 3 3 P mix were added to 50 ⁇ l prehybridization on slide. The slides were incubated overnight at 55 °C.
- DNA59294-1381 (PRO1031 The expression of this EL17 homologue was evaluated in a panel consisting of normal adult and fetal tissues and tissues with inflammation, predominantly chronic lymphocytic inflammation. This panel is designed to specifically evaluate the expression pattern in immune mediated inflammatory disease of novel proteins that modulate T lymphocyte function (stimulatory or inhibitory). This protein when expressed as an Ig-fusion protein was immunostimulatory in a dose dependent fashion in the human mixed lymphocyte reaction (MLR); it caused a 285% and 147% increase above the baseline stimulation index when utilized at two different concentrations (1.0% and 0.1% of a 560 nM stock) [see EXAMPLE 25 below].
- MLR human mixed lymphocyte reaction
- Human tissues with expression include: Colon: there was low level diffuse expression in the smooth muscle (tunica muscularis) in 5 specimens with chronic inflammatory bowel disease; Gall bladder: there was weak to low level expression in the smooth muscle of the gall bladder; /Fetal human tissues with expression: there was moderate diffuse expression in skeletal muscle and weak tolow expression in smooth muscle, there was no expression in fetal heart or any other fetal organ including liver, spleen, CNS, kidney, gut, lung; Human tissues with no expression: lung with chronic granulomatous inflammation and chronic bronchitis (5 patients), peripheral nerve, prostate, heart, placenta, liver (disease multiblock), brain (cerbrum and cerebellum), tonsil (reactive hyperplasia), peripheral lymph node, thymus.
- EXAMPLE 11 Expression of PRO in E. coli This example illustrates preparation of anunglycosylated form of PRO polypeptides by recombinant expression in E. coli.
- the DNA sequence encoding a PRO polypeptide is initially amplified using selected PCR primers.
- the primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector.
- restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector.
- a variety of expression vectors may be employed.
- An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al, Gene, 2:95 (1977)) which contains genes for ampicillin and tetracycline resistance.
- the vector is digested with restriction enzyme and dephosphorylated.
- the PCR amplified sequences are then ligated into the vector.
- the vector will preferably include sequences which encode for an antibiotic resistance gene, a trp promoter, a polyHis leader (including the first six STIJ codons, polyHis sequence, and enterokinase cleavage site), the PRO polypeptide coding region, lambda transcriptional terminator, and an argU gene.
- the ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al. , supra. Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and
- Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics.
- the overnight culture may subsequently be used to inoculate a larger scale culture.
- the cells are then grown to a desired optical density, during which the expression promoter is turned on. After culturing the cells for several more hours, the cells can be harvested by centrifugation.
- the cell pellet obtained by the centrifugation can be solubilized using various agents known in the art, and the solubilized PRO protein can then be purified using a metal chelating column under conditions that allow tight binding of the protein.
- PRO polypeptides may be expressed in E. coli in a poly-His tagged form, using the following procedure.
- the DNA encoding a PRO polypeptide is initially amplified using selected PCR primers.
- the primers will contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector, and other useful sequences providing for efficient and reliable translation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokinase.
- the PCR-amplified, poly-His tagged sequences are then ligated into an expression vector, which is used to transform an E.
- Cultures are then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NH 4 ) 2 S0 4 , 0.71 g sodium citrate»2H20, 1.07 g KC1, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose and 7 mM MgS0 4 ) and grown for approximately 20-30 hours at 30°C with shaking. Samples are removed to verify expression by SDS-PAGE analysis, and the bulk culture is centrifuged to pellet the cells. Cell pellets are frozen until purification and refolding.
- CRAP media prepared by mixing 3.57 g (NH 4 ) 2 S0 4 , 0.71 g sodium citrate»2H20, 1.07 g KC1, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS,
- E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer.
- Solid sodium sulfite and sodium tetrathionate is added to make final concentrations of 0.1M and 0.02 M, respectively, and the solution is stirred overnight at 4°C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization.
- the solution is centrifuged at 40,000 rpm in a Beckman Ultracentifuge for 30 min.
- the supernatant is diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM.Tris, pH 7.4) and filtered through 0.22 micron filters to clarify.
- the clarified extract is loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated in the metal chelate column buffer.
- the column is washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4.
- the protein is eluted with buffer containing 250 mM imidazole. Fractions containing the desired protein are pooled and stored at 4°C. Protein concentration is estimated by- its absorbance at 280 nm using the calculated extinction coefficient based on its amino acid sequence.
- the proteins are refolded by diluting the sample slowly into freshly prepared refolding buffer consisting of: 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. Refolding volumes are chosen so that the final protein concentration is between 50 to 100 micrograms/ml.
- the refolding solution is stirred gently at 4°C for 12-36 hours.
- the refolding reaction is quenched by the addition of TFA to a final concentration of 0.4% (pH of approximately 3).
- the solution is filtered through a 0.22 micron filter and acetonitrile is added to 2-10% final concentration.
- the refolded protein is chromatographed on a Poros Rl/H reversed phase column using a mobile buffer of 0. % TFA with elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with A280 absorbance are analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein are pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitrile since those species are the most compact with their hydrophobic interiors shielded from interaction with the reversed phase resin. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to resolving misfolded forms of proteins from the desired form, the reversed phase step also removes endotoxin from the samples.
- Fractions containing the desired folded PRO polypeptide are pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins are formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia) resins equilibrated in the formulation buffer and sterile filtered. Many of the PRO polypeptides disclosed herein were successfully expressed as described above.
- EXAMPLE 12 Expression of PRO in mammalian cells This example illustrates preparation of a potentially glycosylated form of PRO polypeptides by recombinant expression in mammalian cells.
- the vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector.
- the PRO DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PRO DNA using ligation methods such as described in Sambrook et al. , supra.
- the resulting vector is called pRK5-PRO.
- the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics.
- About 10 ⁇ g pRK5-PRO DNA is mixed with about 1 ⁇ g DNA encoding the VA RNA gene [Thimmappaya et al, Cell, 31:543 (1982)] and dissolved in 500 ⁇ l of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl 2 . To this mixture is added, dropwise, 500 ⁇ l of 50 mM HEPES (pH 7 ⁇ 35), 280 mM NaCl, 1.5 mM NaP0 4 , and a precipitate is allowed to form for 10 minutes at 25°C. The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37°C. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days.
- the -culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 ⁇ Ci/ml 35 S-cysteine and 200 ⁇ Ci/ml 35 S- methionine.
- culture medium alone
- culture medium containing 200 ⁇ Ci/ml 35 S-cysteine and 200 ⁇ Ci/ml 35 S- methionine After a 12 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of the PRO polypeptide.
- the cultures containing transfected cells may undergo further incubation (in serum free medium) and the medium is tested in selected bioassays.
- PRO may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al. , Proc. Natl. Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 ⁇ g pRK5-PRO DNA is added. The cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate is incubated on the cell pellet for four hours.
- the cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 ⁇ g/ml bovine insulin and 0.1 ⁇ g/ml bovine transferrin. After about four days, the conditioned media is centrifuged and filtered to remove cells and debris. The sample containing the expressed PRO polypeptide can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography.
- PRO polypeptides can be expressed in CHO cells.
- the pRK5-PRO can be transfected into CHO cells using known reagents such as CaP0 4 or DEAE-dextran.
- the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 35 S-methionine.
- the culture medium may be replaced with serum free medium.
- the cultures are incubated for about 6 days, and then the conditioned medium is harvested.
- the medium containing the expressed PRO polypeptide can then be concentrated and purified by any selected method.
- Epitope-tagged PRO may also be expressed in host CHO cells.
- the PRO may be subcloned out of the pRK5 vector.
- the subclone insert can undergo PCR to fuse in frame with a selected epitope tag such as a poly-His tag into a Baculovirus expression vector.
- the poly-His tagged PRO insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones.
- the CHO cells can be transfected (as described above) with the SV40 driven vector. Labeling may be performed, as described above, to verify expression.
- the culture medium containing the expressed poly-His tagged PRO can then be concentrated and purified by any selected method, such as by Ni 2+ -chelate affinity chromatography.
- PRO polypeptides may also be expressed in CHO and/or COS cells by a transient expression procedure or in CHO cells by another stable expression procedure. Stable expression in CHO cells is performed using the following procedure.
- the proteins are expressed as an IgG construct (immunoadhesin), in which the coding sequences for the soluble forms (e.g. , extracellular domains) of the respective proteins are fused to an IgGl constant region sequence containing the hinge, CH2 and CH2 domains, and/or as a poly-His tagged form.
- CHO expression vectors are constructed to have compatible restriction sites 5' and 3' of the DNA of interest to allow the convenient shuttling of cDNA's.
- CHO cells is as described in Lucas et al., Nucl. Acids Res., 24:9 (1774-1779 (1996), and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR).
- DHFR expression permits selection for stable maintenance of the plasmid following transfection.
- the cells are grown as described in Lucas etal, supra. Approximately 3 x IO 7 cells are frozen in an ampule for further growth and production as described below.
- the ampules containing the plasmid DNA are thawed by placement into water bath and mixed by vortexing.
- the contents are pipetted into a centrifuge tabe containing 10 mLs of media and centrifuged at 1000 rpm for 5 minutes.
- the supernatant is aspirated and the cells are resuspended in 10 mL of selective media (0.2 ⁇ m filtered PS20 with 5% 0.2 ⁇ m diafiltered fetal bovine serum).
- the cells are then aliquoted into a 100 mL spinner containing 90 mL of selective media. After 1-2 days, the cells are transferred into a 250 mL spinner filled with 150 mL selective growth medium and incubated at 37°C.
- CHO media may be employed, a production medium described in U.S. Patent No. 5,122,469, issued June 16, 1992 may actually be used.
- a 3L production spinner is seeded at 1.2 x 10 6 cells/mL. On day 0, the cell number pH ie determined. On day 1 , the spinner is sampled and sparging with filtered air is commenced. On day 2, the spinner is sampled, the temperature shifted to 33°C, and 30 mL of 500 g/L glucose and 0.6 mL of 10 % antifoam (e.g. , 35 % polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) taken. Throughout the production, the pH is adjusted as necessary to keep it at around 7.2. After 10 days, or until the viability dropped below 70% , the cell culture is harvested by centrifugation and filtering through a 0.22 ⁇ m filter. The filtrate was either stored at 4°C or immediately loaded onto columns for purification.
- the proteins are purified using a Ni-NTA column (Qiagen). Before purification, imidazole is added to the conditioned media to a concentration of 5 mM. The conditioned media is pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4°C. After loading, the column is washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole.
- the highly purified protein is subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C.
- Immunoadhesin (Fc-containing) constructs are purified from the conditioned media as follows .
- the conditioned medium is pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column is washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5.
- the eluted protein is immediately neutralized by collecting 1 ml fractions into tubes containing 275 ⁇ L of 1 M Tris buffer, pH 9.
- the highly purified protein is subsequently desalted into storage buffer as described above for the poly-His tagged proteins.
- the homogeneity is assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Pulmonology (AREA)
- Dermatology (AREA)
- Physical Education & Sports Medicine (AREA)
- Neurosurgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Obesity (AREA)
- Endocrinology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Rheumatology (AREA)
- Communicable Diseases (AREA)
- Pain & Pain Management (AREA)
- Cardiology (AREA)
Priority Applications (759)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU6802801A AU6802801A (en) | 2000-03-01 | 2000-11-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP00989401A EP1240325B1 (en) | 1999-12-23 | 2000-12-20 | Il-17 and il-17r homologous polypeptides and therapeutic uses thereof |
| AU25909/01A AU2590901A (en) | 1999-12-23 | 2000-12-20 | Il-17 homologous polypeptides and therapeutic uses thereof |
| DK00989401.5T DK1240325T3 (da) | 1999-12-23 | 2000-12-20 | IL-17 og IL-17R homologe polypeptider og terapeutisk anvendelse deraf |
| JP2001546918A JP2003527104A (ja) | 1999-12-23 | 2000-12-20 | Il−17相同的ポリペプチドとその治療上の用途 |
| CA002391374A CA2391374A1 (en) | 1999-12-23 | 2000-12-20 | Il-17 homologous polypeptides and therapeutic uses thereof |
| DE60043069T DE60043069D1 (de) | 1999-12-23 | 2000-12-20 | Il-17 und il-17r homologe polypeptide und deren therapeutische verwendungen |
| AT00989401T ATE444361T1 (de) | 1999-12-23 | 2000-12-20 | Il-17 und il-17r homologe polypeptide und deren therapeutische verwendungen |
| JP2001567332A JP2004508805A (ja) | 2000-03-01 | 2001-02-28 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| CA002531917A CA2531917A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002534186A CA2534186A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002534018A CA2534018A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002534391A CA2534391A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002534030A CA2534030A1 (en) | 2000-03-01 | 2001-02-28 | Screted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002533831A CA2533831A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002533903A CA2533903A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP01945919A EP1259614A2 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| PCT/US2001/006520 WO2001068848A2 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002533991A CA2533991A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002401448A CA2401448A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002539214A CA2539214A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU2001268028A AU2001268028A1 (en) | 2000-03-01 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/816,744 US6579520B2 (en) | 1998-05-15 | 2001-03-22 | IL-17 related mammalian cytokine polypeptides (IL-17E) |
| AU6531101A AU6531101A (en) | 2000-06-02 | 2001-05-31 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591590A CA2591590A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024028A EP1686174A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591656A CA2591656A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591929A CA2591929A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002410162A CA2410162A1 (en) | 2000-06-02 | 2001-06-01 | Breast, rectal, colon and lung tumor marker pro 4332 polypeptide and encoding nucleic acid |
| EP01939834A EP1286749A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002585822A CA2585822A1 (en) | 2000-06-02 | 2001-06-01 | Breast, rectal, colon and lung tumour marker pro19628 polypeptide and encoding nucleic acid |
| EP05024031A EP1666492A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024027A EP1666596A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| PCT/US2001/017800 WO2001093983A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024030A EP1666491A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024025A EP1666597A3 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024035A EP1666594A3 (en) | 2000-06-02 | 2001-06-01 | Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer |
| CA002594659A CA2594659A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP04005726A EP1489095A1 (en) | 2000-06-02 | 2001-06-01 | Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer |
| EP05024038A EP1702928A3 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591630A CA2591630A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591814A CA2591814A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024032A EP1659177A3 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids ancoding the same |
| CA002591583A CA2591583A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024033A EP1666493A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids ancoding the same |
| EP05024034A EP1666497A3 (en) | 2000-06-02 | 2001-06-01 | Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer |
| JP2002501551A JP2004510409A (ja) | 2000-06-02 | 2001-06-01 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| CA002591930A CA2591930A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024023A EP1683864A3 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU2001265311A AU2001265311A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CA002591841A CA2591841A1 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| EP05024037A EP1700867A3 (en) | 2000-06-02 | 2001-06-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/874,503 US20020177188A1 (en) | 1998-05-15 | 2001-06-05 | IL-17 homologous polypeptides and therapeutic uses thereof |
| EP08019420.2A EP2042597B1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| CA002412211A CA2412211A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| PCT/US2001/019692 WO2002000690A2 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| EP14166919.2A EP2792747A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| JP2002505812A JP2004506413A (ja) | 2000-06-23 | 2001-06-20 | 血管形成に関与する疾患の診断と治療のための組成物と方法 |
| EP09004415A EP2168980A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogensis |
| EP01957073A EP1309620A2 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| DK08019420.2T DK2042597T3 (da) | 2000-06-23 | 2001-06-20 | Sammensætninger og fremgangsmåder til diagnose og behandling af sygdomme, der involverer angiogenese |
| CA002648051A CA2648051A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| EP09004417A EP2077276A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogensis |
| CA2709771A CA2709771A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| EP10182597A EP2275549A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| EP09004418A EP2075253A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methds for the diagnosis and treatment of disorders involving angiogensis |
| CA002648046A CA2648046A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| CA002648048A CA2648048A1 (en) | 2000-06-23 | 2001-06-20 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| CA002416456A CA2416456A1 (en) | 2000-07-20 | 2001-06-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| PCT/US2001/021066 WO2002008288A2 (en) | 2000-07-20 | 2001-06-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| JP2002514192A JP2004514420A (ja) | 2000-07-20 | 2001-06-29 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| EP01952391A EP1354040A2 (en) | 2000-07-20 | 2001-06-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU2001273150A AU2001273150A1 (en) | 2000-07-20 | 2001-06-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| AU7315001A AU7315001A (en) | 2000-07-20 | 2001-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| JP2002514188A JP2004516013A (ja) | 2000-07-20 | 2001-07-09 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| EP01951036A EP1309685A2 (en) | 2000-07-20 | 2001-07-09 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| CA002416538A CA2416538A1 (en) | 2000-07-20 | 2001-07-09 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| PCT/US2001/021735 WO2002008284A2 (en) | 2000-07-20 | 2001-07-09 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| AU2001271973A AU2001271973A1 (en) | 2000-07-20 | 2001-07-09 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
| US09/908,827 US20030054442A1 (en) | 1998-05-15 | 2001-07-18 | IL-17 homologous polypeptides and therapeutic uses thereof |
| US09/918,585 US20030060406A1 (en) | 1997-10-17 | 2001-07-30 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/931,836 US7435793B2 (en) | 1998-05-15 | 2001-08-16 | Peptides that induce chondrocyte redifferentiation |
| US09/978,295 US20020156006A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,189 US6972325B2 (en) | 1997-10-17 | 2001-10-15 | PRO273 polypeptides |
| US09/978,298 US20030134785A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,194 US20030195333A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,188 US20030139328A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,193 US20030073624A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,192 US20020177553A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,191 US20030050239A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,299 US20030199435A1 (en) | 1997-10-17 | 2001-10-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,757 US20030083248A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,697 US20020169284A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/981,915 US20030054986A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,665 US7294700B2 (en) | 1997-10-17 | 2001-10-16 | Anti-PRO846 antibodies |
| US09/978,544 US20030199436A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,824 US20050124789A9 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,802 US20030199674A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,608 US20030045462A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,403 US20030050240A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,564 US7195760B2 (en) | 1997-10-17 | 2001-10-16 | Anti-pro363 antibodies |
| US09/981,915 US7285623B2 (en) | 1997-10-17 | 2001-10-16 | PRO337 polypeptides |
| US09/978,643 US20030104998A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,423 US20030069178A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,375 US7196165B2 (en) | 1997-10-17 | 2001-10-16 | PRO363 polypeptides |
| US09/978,681 US20030195148A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,585 US20030049633A1 (en) | 1997-10-17 | 2001-10-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,824 US20030055216A1 (en) | 1997-10-17 | 2001-10-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/210,028 US20030203446A1 (en) | 1998-10-07 | 2001-10-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/152,388 US20040223964A1 (en) | 1998-03-17 | 2001-10-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/165,036 US20050227342A1 (en) | 1998-10-07 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/164,829 US20030194780A1 (en) | 1998-04-29 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/162,521 US7067628B2 (en) | 1998-03-17 | 2001-10-19 | PRO788 polypeptides |
| US10/145,089 US7208575B2 (en) | 1998-10-07 | 2001-10-19 | PRO531 polypeptides |
| US10/160,502 US7220835B2 (en) | 1998-07-30 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/145,124 US20030190701A1 (en) | 1998-04-30 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/164,929 US20030194781A1 (en) | 1998-03-30 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/145,017 US20030186365A1 (en) | 1998-03-26 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/164,728 US20030186368A1 (en) | 1998-05-13 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/165,247 US7112657B2 (en) | 1998-10-07 | 2001-10-19 | PRO697 polypeptides |
| US10/165,067 US7279553B2 (en) | 1998-05-13 | 2001-10-19 | PRO1083 polypeptides |
| US10/143,029 US7105640B2 (en) | 1997-10-17 | 2001-10-19 | Anti-pro792 antibodies |
| US10/166,709 US20030104536A1 (en) | 1998-10-07 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/164,749 US20040029218A1 (en) | 1998-10-07 | 2001-10-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,922 US20030195345A1 (en) | 1997-10-17 | 2001-10-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/017,086 US7122375B2 (en) | 1997-10-17 | 2001-10-24 | PRO274 nucleic acids |
| US09/999,829 US20030195344A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/999,833 US6916648B2 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/017,084 US20030203402A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/999,830 US20030077700A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/999,832 US20020192706A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/017,081 US20030049684A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/017,083 US20030148376A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/999,832 US7132283B2 (en) | 1997-10-17 | 2001-10-24 | PRO273 polypeptides |
| US10/017,085 US6974696B2 (en) | 1997-10-17 | 2001-10-24 | PRO853 nucleic acids |
| US09/999,834 US20030064407A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/002,967 US20030148373A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/020,445 US20030198994A1 (en) | 1997-10-17 | 2001-10-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,927 US7189529B2 (en) | 1997-10-17 | 2001-10-25 | PRO792 nucleic acids |
| US10/013,918 US20030211091A1 (en) | 1997-10-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/016,177 US20030073131A1 (en) | 1997-10-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,929 US7019124B2 (en) | 1997-10-17 | 2001-10-25 | PRO788 nucleic acids |
| US10/013,920 US20040006219A1 (en) | 1997-10-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,926 US7074593B2 (en) | 1998-04-01 | 2001-10-25 | PRO 703 nucleic acids |
| US10/013,917 US7029874B2 (en) | 1998-03-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,925 US7037710B2 (en) | 1997-10-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,923 US7169912B2 (en) | 1997-10-17 | 2001-10-25 | PRO1017 nucleic acids |
| US10/013,921 US20030068648A1 (en) | 1997-10-17 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/013,928 US20030215905A1 (en) | 1998-10-07 | 2001-10-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/000,157 US20020182673A1 (en) | 1998-05-15 | 2001-10-30 | IL-17 homologous polypedies and therapeutic uses thereof |
| US09/990,456 US20020137890A1 (en) | 1997-03-31 | 2001-11-14 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/006,867 US7160985B2 (en) | 1997-10-29 | 2001-12-06 | Pro180 polypeptide |
| US10/035,855 US7105639B2 (en) | 1998-05-15 | 2001-12-26 | Anti-PRO 4405 antibodies |
| US10/036,041 US20020192751A1 (en) | 1998-05-15 | 2001-12-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/036,160 US7125959B2 (en) | 1998-05-15 | 2001-12-26 | PRO4405 polypeptides |
| US10/035,958 US7241862B2 (en) | 1998-05-15 | 2001-12-26 | Polypeptides that induce cell proliferation or induce fetal hemoglobin |
| US10/036,342 US7193045B2 (en) | 1998-05-15 | 2001-12-26 | Polypeptides that induce cell proliferation |
| US10/035,719 US20030036114A1 (en) | 1998-05-15 | 2001-12-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/036,214 US20030032061A1 (en) | 1998-05-15 | 2001-12-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/036,063 US20030092063A1 (en) | 1998-05-15 | 2001-12-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/035,977 US20030134327A1 (en) | 1998-05-15 | 2001-12-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/036,150 US7256039B2 (en) | 1998-05-15 | 2001-12-26 | PRO4405 nucleic acids |
| US10/052,586 US20020127584A1 (en) | 1997-09-18 | 2002-01-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/978,187 US20030096744A1 (en) | 1997-10-17 | 2002-01-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/119,480 US20040087769A1 (en) | 1998-09-10 | 2002-04-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,045 US20030073210A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,040 US20030082759A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,046 US20030194791A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,047 US20030077778A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,059 US20030190721A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,044 US20030190717A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,041 US20030077776A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,042 US20030096386A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,051 US20030092147A1 (en) | 1997-03-31 | 2002-04-11 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,061 US20030082761A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,057 US20030190719A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,050 US20030054516A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,049 US20030022239A1 (en) | 1997-06-18 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,052 US20030199052A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,043 US7220831B2 (en) | 1997-03-31 | 2002-04-12 | PRO235 polypeptides |
| US10/121,058 US20030190720A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,053 US20030199053A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,048 US20030199051A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,055 US20030190718A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,056 US20030082760A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,063 US20030199055A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,054 US20030199054A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,062 US20030077779A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/121,060 US20030190722A1 (en) | 1997-03-31 | 2002-04-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,322 US20030199059A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,109 US20030190723A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,154 US20030190724A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,235 US20030082762A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,291 US20030199058A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,213 US7193048B2 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,214 US7343721B2 (en) | 1997-03-31 | 2002-04-15 | PRO4406 polypeptide |
| US10/123,771 US20030199060A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,261 US20030068796A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,156 US20030194792A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,215 US7291329B2 (en) | 1997-03-31 | 2002-04-15 | Antibodies against PRO4406 |
| US10/123,157 US20030190725A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,236 US20030068795A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,212 US7276577B2 (en) | 1997-03-31 | 2002-04-15 | PRO1866 polypeptides |
| US10/123,292 US20030073211A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,213 US20030199057A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,155 US20030068794A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,262 US20030049816A1 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,108 US7635478B2 (en) | 1997-03-31 | 2002-04-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,910 US7329404B2 (en) | 1997-03-31 | 2002-04-16 | Antibodies against PRO1310 |
| US10/123,908 US7335728B2 (en) | 1997-03-31 | 2002-04-16 | PRO1310 polypeptides |
| US10/123,905 US7285625B2 (en) | 1997-06-18 | 2002-04-16 | PRO536 polypeptides |
| US10/123,906 US20030190726A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,905 US20030087344A1 (en) | 1997-06-18 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,902 US20030077781A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,909 US7193049B2 (en) | 1997-03-31 | 2002-04-16 | PRO862 polypeptides |
| US10/123,903 US20030073212A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,907 US7084258B2 (en) | 1997-03-31 | 2002-04-16 | Antibodies against the PRO862 polypeptides |
| US10/123,912 US20030100087A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,913 US20030203462A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,904 US20030022328A1 (en) | 1997-03-31 | 2002-04-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/123,911 US7408032B2 (en) | 1997-03-31 | 2002-04-16 | PRO1188 polypeptides |
| US10/124,824 US20030077659A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,820 US20030190729A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/125,805 US20030194794A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,822 US7109305B2 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,817 US20030077786A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,814 US7105335B2 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,813 US7312307B2 (en) | 1997-03-31 | 2002-04-17 | PRO1056 polypeptides |
| US10/124,823 US20030199062A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,821 US20030199023A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/124,816 US20030190728A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/125,795 US7304131B2 (en) | 1997-03-31 | 2002-04-17 | PRO1483 polypeptides |
| US10/124,819 US7285626B2 (en) | 1997-03-31 | 2002-04-17 | PRO1076 polypeptides |
| US10/124,818 US20030082763A1 (en) | 1997-03-31 | 2002-04-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/125,704 US7357926B2 (en) | 1997-03-31 | 2002-04-17 | Antibodies against PRO1879 and the use thereof |
| US10/125,922 US7309762B2 (en) | 1997-03-31 | 2002-04-19 | PRO1360 polypeptides |
| US10/125,931 US20030199063A1 (en) | 1997-03-31 | 2002-04-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/125,932 US7317079B2 (en) | 1997-03-31 | 2002-04-19 | PRO812 polypeptides |
| US10/125,924 US7342097B2 (en) | 1997-03-31 | 2002-04-19 | PRO1309 polypeptides |
| US10/125,927 US20030190731A1 (en) | 1997-03-31 | 2002-04-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/127,831 US20030082689A1 (en) | 1997-03-31 | 2002-04-22 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/128,689 US20030087365A1 (en) | 1997-03-31 | 2002-04-23 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/131,825 US7282566B2 (en) | 1997-03-31 | 2002-04-24 | PRO1779 polypeptide |
| US10/131,817 US7291701B2 (en) | 1997-03-31 | 2002-04-24 | PRO1777 polypeptides |
| US10/131,823 US7304132B2 (en) | 1997-03-31 | 2002-04-24 | PRO1693 polypeptides |
| US10/063,510 US7109292B2 (en) | 1999-03-08 | 2002-05-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,517 US7232889B2 (en) | 1999-03-08 | 2002-05-01 | PRO300 antibodies |
| US10/063,521 US20030190669A1 (en) | 1998-12-30 | 2002-05-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,519 US20030009013A1 (en) | 1998-12-30 | 2002-05-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,520 US20030187196A1 (en) | 1998-12-30 | 2002-05-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,518 US7465785B2 (en) | 1999-03-08 | 2002-05-01 | Polypeptide encoded by a nucleic acid over-expressed in melanoma |
| US10/063,551 US7214777B2 (en) | 1999-03-08 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,537 US7276586B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide encoded by a nucleic acid under-expressed in stomach and lung tumor |
| US10/063,553 US7235630B2 (en) | 1999-03-08 | 2002-05-02 | PRO994 polypeptides |
| US10/063,569 US20030018168A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,544 US20030027212A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,523 US7220830B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptide underexpressed in stomach tumors |
| US10/063,562 US20030181697A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,547 US7294690B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptides encoded by a nucleic acid differentially expressed in lung tumor |
| US10/063,524 US7205391B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide suppressed in stomach tumors |
| US10/063,540 US7193061B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide encoded by a nucleic acid underexpressed in esophageal tumor and melanoma |
| US10/063,561 US7271247B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide encoded by a nucleic acid differentially expressed in melanoma |
| US10/063,547 US20020182638A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,534 US7193060B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptides encoded by a nucleic acid overexpressed in kidney tumor and underexpressed in lung tumor |
| US10/063,554 US7223841B2 (en) | 1999-03-08 | 2002-05-02 | PR0994 antibodies |
| US10/063,545 US7256261B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptides encoded by a nucleic acid over expressed in normal stomach normal skin and kidney tumor |
| US10/063,541 US20030060601A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,523 US20030181636A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,564 US20030180794A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,560 US7232882B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptide uder-expressed in melanoma |
| US10/063,545 US20020183505A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,527 US20030181637A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,551 US20020183494A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,566 US20030073821A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,548 US7232892B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide encoded by a nucleic acid differentailly expressed in stomach, lung and melanoma tumor |
| US10/063,569 US7378491B2 (en) | 1999-03-08 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,568 US20030181668A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,549 US7253256B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptides encoded by a nucleic acid are expressed in esophageal and kidney tumor |
| US10/063,528 US20030181666A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,524 US20030027992A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,567 US20030069394A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,525 US20030036634A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,538 US7253255B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptide encoded by a nucleic acid underexpressed in esophageal tumor and melanoma |
| US10/063,540 US20030181667A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,555 US20030065143A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,553 US20030045684A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,565 US20030180904A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,548 US20030187228A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,526 US20030171550A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,546 US7435798B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies to a polypeptide encoded by a nucleic acid overexpressed in normal stomach, normal skin and kidney tumor |
| US10/063,536 US7259238B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptide encoded by a nucleic acid under-expressed in stomach and lung tumor |
| US10/063,536 US20030181696A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,570 US7507404B2 (en) | 1999-03-08 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,563 US20030060602A1 (en) | 1998-12-30 | 2002-05-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,530 US7193059B2 (en) | 1999-03-08 | 2002-05-02 | Antibodies that recognize a polypeptide overexpressed in rectal tumors |
| US10/063,532 US7202336B2 (en) | 1999-03-08 | 2002-05-02 | Polypeptide encoded by a nucleic acid overexpressed in kidney tumor and underexpressed in lung tumor |
| US10/063,616 US7358339B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,612 US7399828B2 (en) | 1998-09-24 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,600 US7230076B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,607 US7345145B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/137,868 US20030082764A1 (en) | 1997-03-31 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,578 US7417125B2 (en) | 1999-03-08 | 2002-05-03 | Antibodies that bind a PRO1158 polypeptide |
| US10/063,615 US7405269B2 (en) | 1998-10-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,611 US20030181677A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,609 US7402661B2 (en) | 1998-10-06 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,593 US7189805B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,611 US7378501B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,610 US7371814B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/137,865 US20030032155A1 (en) | 1997-03-31 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,591 US7196174B2 (en) | 1998-10-27 | 2002-05-03 | PRO1557 polypeptide encoded by a nucleic acid highly expressed in esophageal and kidney tumors |
| US10/063,589 US20030181641A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,614 US7393931B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/137,867 US20030207349A1 (en) | 1997-03-31 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,581 US7189803B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,610 US20030180907A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,602 US7230082B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,587 US7244428B2 (en) | 1998-09-10 | 2002-05-03 | PRO1357 antibodies |
| US10/063,604 US7390876B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,617 US7423119B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,592 US20030181672A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,598 US7223838B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,592 US7220841B2 (en) | 1998-10-27 | 2002-05-03 | Antibody to PRO1557 polypeptide encoded by a nucleic acid highly expressed in esophageal and kidney tumors |
| US10/063,583 US7189804B2 (en) | 1999-03-08 | 2002-05-03 | PRO1335 polypeptides |
| US10/063,579 US20030181638A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,597 US7227000B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,618 US7468424B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,582 US7205389B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,577 US7423130B2 (en) | 1999-03-08 | 2002-05-03 | PRO1158 polypeptides |
| US10/063,591 US20030180906A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,588 US20030130483A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,596 US7285624B2 (en) | 1999-03-08 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,606 US20030181675A1 (en) | 1998-12-30 | 2002-05-03 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,020 US20030207415A1 (en) | 1997-03-31 | 2002-05-06 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,023 US20030207416A1 (en) | 1997-03-31 | 2002-05-06 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/139,963 US7288625B2 (en) | 1997-03-31 | 2002-05-06 | PRO4395 polypeptides |
| US10/139,980 US7247710B2 (en) | 1997-03-31 | 2002-05-06 | PRO4395 antibodies |
| US10/140,470 US20030022331A1 (en) | 1997-03-31 | 2002-05-06 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,474 US20030032156A1 (en) | 1997-03-31 | 2002-05-06 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,024 US20040058424A1 (en) | 1997-03-31 | 2002-05-06 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,662 US20030180795A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,648 US7193062B2 (en) | 1998-10-20 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid over expressed in esoprageal and lung tumor, and under expressed in kidney tumor and melanoma |
| US10/063,660 US7189822B2 (en) | 1999-03-08 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid underexpressed in stomach and lung tumor |
| US10/063,639 US7081520B2 (en) | 1998-10-08 | 2002-05-07 | Anti-pro 1570 antibodies |
| US10/140,864 US20030207419A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,669 US20030180838A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,640 US7354997B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid underexpressed in stomach tumor |
| US10/063,646 US20030181681A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,650 US7217787B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid underexpressed in rectal tumor |
| US10/063,647 US20030187197A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,644 US7196167B2 (en) | 1998-10-20 | 2002-05-07 | Polypeptide underexpressed in lung tumor |
| US10/063,651 US7193057B2 (en) | 1997-10-29 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid underexpressed in rectal tumor |
| US10/140,860 US7307151B2 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,674 US20030180841A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,805 US20030207417A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,928 US20030068798A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,642 US20030181650A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,647 US7193046B2 (en) | 1998-10-20 | 2002-05-07 | Polypeptide encoded by a nucleic acid overexpressed in esophageal and lung tumor, and underexpressesd in kidney tumor and melanoma |
| US10/140,808 US7425621B2 (en) | 1997-03-31 | 2002-05-07 | Antibodies against the PRO4401 polypeptide |
| US10/063,672 US20030181700A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,671 US20030180840A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,653 US7238787B2 (en) | 1999-03-08 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid underexpressed in melanoma |
| US10/140,921 US7317080B2 (en) | 1997-03-31 | 2002-05-07 | PRO4303 polypeptides |
| US10/063,649 US20030181652A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,661 US7193047B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid underexpressed in esophageal tumor |
| US10/063,657 US7193063B2 (en) | 1999-03-08 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid overexpressed in esophageal tumor, normal stomach and melanoma |
| US10/140,925 US20030073215A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,675 US20030180842A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,638 US7101970B2 (en) | 1999-03-08 | 2002-05-07 | PRO1570 polypeptides |
| US10/063,644 US20030181651A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,665 US7427664B2 (en) | 1999-03-08 | 2002-05-07 | Antibodies to polypeptides that stimulate TNF-α release |
| US10/063,676 US20030180843A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,643 US20030181680A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,809 US20030207418A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,670 US20030180839A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,654 US7202337B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid overexpressed in esophageal tumor, normal stomach and melanoma |
| US10/063,646 US7189821B2 (en) | 1998-10-20 | 2002-05-07 | Antibodies to a polypeptide encoded by a nucleic acid underexpressed in lung tumor |
| US10/063,666 US7411037B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptides encoded by a nucleic acid underexpressed in melanoma |
| US10/063,677 US20030187242A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,659 US7186801B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid underexpressed in stomach tumor and lung tumor |
| US10/063,652 US7230077B2 (en) | 1999-03-08 | 2002-05-07 | Polypeptide encoded by a nucleic acid underexpressed in melanoma |
| US10/063,664 US7256262B2 (en) | 1999-03-08 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/140,865 US20030207420A1 (en) | 1997-03-31 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,673 US20030180908A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,668 US20030191290A1 (en) | 1998-12-30 | 2002-05-07 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/141,755 US7297764B2 (en) | 1997-03-31 | 2002-05-08 | PRO4318 polypeptides |
| US10/063,720 US20030180917A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,732 US20030180922A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,689 US20030180845A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,728 US20030180920A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,721 US20030181702A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,744 US20030180863A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,735 US20030138882A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,716 US20030180915A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,712 US20030180912A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,736 US20030180860A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,724 US20030180856A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,714 US20030180913A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,715 US20030180914A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,713 US20030180855A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,722 US20030180918A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,693 US20030180847A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,694 US20030180848A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,711 US20030180911A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,731 US20030180921A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/141,754 US7361732B2 (en) | 1997-03-31 | 2002-05-08 | PRO4400 polypeptides |
| US10/063,730 US20030180858A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,717 US20030180916A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,702 US7193074B2 (en) | 1999-03-08 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,718 US20030190698A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,705 US7220850B2 (en) | 1999-03-08 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,692 US20030180846A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,682 US20030181701A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,684 US20030186407A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,688 US20030186408A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,723 US20030181703A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,727 US20030180857A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/141,756 US7488586B2 (en) | 1997-03-31 | 2002-05-08 | PRO4409 polypeptides |
| US10/141,760 US7342104B2 (en) | 1997-03-31 | 2002-05-08 | Antibodies against the PRO4320 polypeptide |
| US10/063,734 US20030180859A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,703 US7189563B2 (en) | 1999-03-08 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,698 US20030180849A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,710 US20030180910A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,707 US20030180853A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,685 US20030180909A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,686 US20030180844A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,699 US20030180850A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,726 US20030180919A1 (en) | 1998-12-30 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,709 US7189564B2 (en) | 1999-03-08 | 2002-05-08 | PRO1335 nucleic acids |
| US10/141,701 US20030207421A1 (en) | 1997-03-31 | 2002-05-08 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/142,425 US20030207424A1 (en) | 1997-03-31 | 2002-05-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,742 US7189532B2 (en) | 1999-03-08 | 2002-05-09 | Nucleic acid underexpressed in stomach tumor and lung tumor |
| US10/143,113 US7329730B2 (en) | 1997-03-31 | 2002-05-09 | PRO4348 polypeptides |
| US10/142,430 US7309766B2 (en) | 1997-03-31 | 2002-05-09 | PRO5774 polypeptides |
| US10/063,745 US20040058411A1 (en) | 1998-12-30 | 2002-05-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/063,741 US7118887B2 (en) | 1999-03-08 | 2002-05-09 | Nucleic acid overexpressed in esophageal tumor, normal stomach and melanoma |
| US10/063,743 US20030180862A1 (en) | 1998-12-30 | 2002-05-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/142,417 US7304133B2 (en) | 1997-03-31 | 2002-05-09 | PRO4389 polypeptides |
| US10/143,114 US20030036180A1 (en) | 1997-03-31 | 2002-05-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/142,423 US20030049817A1 (en) | 1997-03-31 | 2002-05-10 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/142,431 US7285629B2 (en) | 1997-03-31 | 2002-05-10 | Pro5005 polypeptides |
| US10/142,419 US7153941B2 (en) | 1997-03-31 | 2002-05-10 | Antibodies that bind PRO4994 polypeptides |
| US10/143,032 US7408033B2 (en) | 1997-03-31 | 2002-05-10 | PRO5995 polypeptides |
| US10/146,730 US20030207427A1 (en) | 1997-03-31 | 2002-05-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/146,792 US20030207428A1 (en) | 1997-03-31 | 2002-05-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/147,528 US20030219885A1 (en) | 1997-03-31 | 2002-05-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/147,536 US20040077064A1 (en) | 1997-03-31 | 2002-05-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/147,492 US20030082765A1 (en) | 1997-03-31 | 2002-05-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/147,519 US20030077791A1 (en) | 1997-03-31 | 2002-05-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/152,395 US7189534B2 (en) | 1997-03-31 | 2002-05-21 | PRO4320 polynucleotide |
| US10/153,934 US20030129695A1 (en) | 1997-03-31 | 2002-05-22 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/156,843 US20030207805A1 (en) | 1997-06-18 | 2002-05-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/157,786 US20030208055A1 (en) | 1997-03-31 | 2002-05-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/157,782 US20030077792A1 (en) | 1997-03-31 | 2002-05-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/158,791 US20030207429A1 (en) | 1997-03-31 | 2002-05-30 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/158,782 US20030082766A1 (en) | 1997-03-31 | 2002-05-30 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/160,498 US20030073216A1 (en) | 1997-03-31 | 2002-05-30 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,699 US20030166109A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,700 US20030027262A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,696 US20030082767A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,701 US20030104538A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,695 US20030032101A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,693 US20030073169A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,690 US20030166105A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,691 US20030166106A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,707 US20030166110A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,694 US20030166107A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,705 US20030032103A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,698 US20030166108A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,704 US20030170795A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,689 US20030166104A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,708 US20030040053A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,692 US20030166188A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,706 US20030022293A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,697 US20030032102A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,703 US20030170794A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/173,702 US20030170793A1 (en) | 1997-09-18 | 2002-06-17 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,582 US20030027265A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,576 US7125962B2 (en) | 1997-09-18 | 2002-06-18 | Anti-Pro268 antibodies |
| US10/174,589 US20030166114A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,579 US20030027264A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,574 US20030170796A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,572 US20030027263A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,585 US20030032105A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,581 US7153939B2 (en) | 1997-09-18 | 2002-06-18 | PRO354 antibodies |
| US10/174,583 US7211645B2 (en) | 1997-09-18 | 2002-06-18 | PRO268 polypeptides |
| US10/174,570 US20030211572A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,740 US20030027268A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,569 US20030166111A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,590 US20030008352A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,586 US20030032106A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,587 US20030166113A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,591 US20030166115A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,588 US20030027266A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/174,578 US20030073170A1 (en) | 1997-09-18 | 2002-06-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,751 US20030166122A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,753 US20030077732A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,739 US20030027267A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,748 US20030166121A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,747 US20030032107A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,752 US20030022295A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,749 US20050196832A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,735 US20030082715A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,744 US20030166119A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,736 US20030166117A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,741 US20030073171A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,750 US20030073172A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,746 US20030027270A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,743 US20030027269A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,754 US20030166123A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,737 US20030013153A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,745 US20030166120A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,738 US20030022294A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/175,742 US20030166118A1 (en) | 1997-09-18 | 2002-06-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,747 US20030027273A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,918 US7495083B2 (en) | 1997-09-18 | 2002-06-20 | PRO940 antibodies |
| US10/176,990 US20030036119A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,490 US20030170798A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,482 US20030022296A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,483 US20030017541A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,989 US20030170803A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,487 US20030032110A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,988 US20030170802A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,749 US20030017542A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,993 US20030027280A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,746 US20030068680A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,757 US7317082B2 (en) | 1997-09-18 | 2002-06-20 | PRO1018 polypeptides |
| US10/176,921 US20030027276A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,491 US20030087373A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,753 US20030044917A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,981 US20030170800A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,479 US20030040054A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,485 US20030032109A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,759 US20030166128A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,920 US20030166129A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,917 US20030044918A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,493 US20030032111A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,914 US20030017543A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,484 US20030059876A9 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,913 US20030022298A1 (en) | 1997-09-15 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,911 US20030032113A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,919 US20030032114A1 (en) | 1997-09-18 | 2002-06-20 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,754 US7709602B2 (en) | 1997-09-18 | 2002-06-20 | PRO1078 polypeptides |
| US10/176,979 US20030087374A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,760 US7339033B2 (en) | 1998-06-26 | 2002-06-21 | Pro1481 |
| US10/176,915 US20030017544A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,978 US20030032116A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,923 US20030068681A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,756 US20030032112A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,922 US20030166130A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,751 US20030036117A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,480 US20030166124A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,992 US20030027279A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,750 US20030027274A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,924 US20030166131A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,982 US20030044919A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,492 US20030027272A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,986 US20030073173A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,916 US20030040056A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,489 US20030166125A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,755 US20030166127A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,752 US20030170799A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,481 US20030032108A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,987 US20030027278A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,925 US20030032115A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,748 US20030040055A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,486 US7354999B2 (en) | 1997-09-18 | 2002-06-21 | PRO1481 polypeptides |
| US10/176,488 US20030027271A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,991 US20030027324A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,983 US20030170801A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,985 US20030027277A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/176,758 US20030008353A1 (en) | 1997-09-18 | 2002-06-21 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,521 US20030170806A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,525 US20030040060A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,523 US20030215909A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,510 US20030032117A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,508 US20030166133A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,507 US20030040057A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,512 US20030166134A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,516 US20030040058A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,515 US20030166135A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,519 US7339024B2 (en) | 1997-09-18 | 2002-06-24 | PRO1772 polypeptides |
| US10/179,518 US20030104540A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,513 US20030044921A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,509 US20030207392A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,520 US20030096353A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,522 US20030044923A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,526 US20030100061A1 (en) | 1998-06-26 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,506 US20030044920A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,511 US20030104539A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,514 US20030044922A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/179,517 US20030170805A1 (en) | 1997-09-18 | 2002-06-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,540 US20030040061A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,545 US20030040062A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,557 US20030022301A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,553 US7365156B2 (en) | 1997-09-18 | 2002-06-25 | PRO1316 polypeptides |
| US10/180,547 US20030032121A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,548 US7696319B2 (en) | 1997-09-18 | 2002-06-25 | PRO1772 antibodies |
| US10/180,556 US7355000B2 (en) | 1997-09-18 | 2002-06-25 | PRO1380 polypeptides |
| US10/180,551 US20030036123A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,541 US20030036120A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,549 US20030032122A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,560 US20030044925A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,542 US20030036121A1 (en) | 1998-06-26 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,546 US20030032120A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,555 US20030032123A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,559 US20030032124A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,550 US20030064440A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,543 US20030032118A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,544 US20030032119A1 (en) | 1998-06-26 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,552 US7348415B2 (en) | 1997-09-18 | 2002-06-25 | PRO1316 antibodies |
| US10/180,554 US20050202526A1 (en) | 1997-09-18 | 2002-06-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,011 US20030068682A1 (en) | 1998-06-26 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,013 US7309769B2 (en) | 1997-09-18 | 2002-06-26 | PRO1487 polypeptides |
| US10/183,012 US7718770B2 (en) | 1997-09-18 | 2002-06-26 | PRO1305-polypeptides |
| US10/181,000 US7319137B2 (en) | 1997-09-18 | 2002-06-26 | PRO1339 polypeptides |
| US10/183,006 US7297776B2 (en) | 1997-09-18 | 2002-06-26 | PRO1374 antibodies |
| US10/183,005 US7317093B2 (en) | 1997-09-18 | 2002-06-26 | PRO1339 antibodies |
| US10/180,999 US7297767B2 (en) | 1997-09-18 | 2002-06-26 | PRO1374 polypeptides |
| US10/183,014 US20030064441A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,001 US7084255B2 (en) | 1997-09-18 | 2002-06-26 | PRO1278 polypeptides |
| US10/183,018 US20030104541A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,003 US20030082716A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,016 US20030082717A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,019 US7425605B2 (en) | 1997-09-18 | 2002-06-26 | PRO1486 polypeptides |
| US10/183,008 US20030040064A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,010 US20030032126A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/180,998 US7087421B2 (en) | 1997-09-18 | 2002-06-26 | Pro1278 polypeptides |
| US10/183,015 US20030044926A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,017 US20030040065A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,002 US20030054454A1 (en) | 1997-09-18 | 2002-06-26 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/183,009 US7339034B2 (en) | 1997-09-18 | 2002-06-26 | PRO1305 antibodies |
| US10/184,640 US7271250B2 (en) | 1998-06-26 | 2002-06-27 | PRO1757 antibodies |
| US10/184,614 US20030032128A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,638 US20030054456A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,616 US20030036128A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,633 US20030068683A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,652 US20030032134A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,627 US20030040070A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,641 US20030073174A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,642 US7332573B2 (en) | 1997-09-18 | 2002-06-27 | PRO1571 polypeptides |
| US10/184,628 US7309770B2 (en) | 1997-09-18 | 2002-06-27 | PRO1757 polypeptides |
| US10/184,630 US7304143B2 (en) | 1997-09-18 | 2002-06-27 | PRO1571 antibodies |
| US10/184,654 US7378486B2 (en) | 1997-09-18 | 2002-06-27 | PRO1482 antibodies |
| US10/184,631 US20030036134A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,618 US7393917B2 (en) | 1997-09-18 | 2002-06-27 | PRO1482 polypeptides |
| US10/184,619 US20030049738A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,630 US20030036133A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,613 US20030119105A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,627 US7282569B2 (en) | 1997-09-18 | 2002-06-27 | PRO1508 antibodies |
| US10/184,612 US20030036127A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,651 US7291704B2 (en) | 1997-09-18 | 2002-06-27 | PRO1758 polypeptides |
| US10/184,615 US20030044927A1 (en) | 1997-09-18 | 2002-06-27 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,621 US20030054455A1 (en) | 1998-06-26 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,620 US20030044928A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,632 US20030036135A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,637 US20030032131A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,646 US20030032132A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,655 US20030040073A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,644 US20030044930A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,626 US20030040069A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,635 US20030032130A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,656 US20030044931A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,629 US20030036132A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,634 US20030068684A1 (en) | 1998-06-26 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,636 US20030036136A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,658 US20030027281A1 (en) | 1998-06-26 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,617 US20030036129A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,625 US20030040068A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,624 US20030104542A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,645 US7291718B2 (en) | 1998-06-26 | 2002-06-28 | PRO1758 antibodies |
| US10/184,643 US20030044929A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,647 US20030032133A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,650 US20030036138A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,623 US20030032129A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,657 US20030104543A1 (en) | 1997-09-18 | 2002-06-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/184,622 US20030036130A1 (en) | 1997-09-18 | 2002-06-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,747 US7291707B2 (en) | 1997-09-18 | 2002-07-01 | PRO1337 polypeptides |
| US10/187,598 US20030036142A1 (en) | 1997-09-18 | 2002-07-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,739 US7291706B2 (en) | 1998-06-26 | 2002-07-01 | PRO4352 polypeptides |
| US10/187,597 US20030036141A1 (en) | 1997-09-18 | 2002-07-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,886 US7291708B2 (en) | 1997-09-18 | 2002-07-01 | PRO1785 polypeptides |
| US10/187,887 US7285645B2 (en) | 1997-09-18 | 2002-07-01 | PRO4356 antibodies |
| US10/187,601 US7291705B2 (en) | 1997-09-18 | 2002-07-01 | PRO19645 polypeptides |
| US10/187,588 US7351795B2 (en) | 1998-06-26 | 2002-07-01 | PRO19563 polypeptides |
| US10/187,884 US20030036155A1 (en) | 1997-09-18 | 2002-07-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,594 US7294335B2 (en) | 1998-06-26 | 2002-07-01 | PRO19645 antibodies |
| US10/188,775 US20030040075A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/188,781 US20030036160A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,753 US20030036152A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,743 US20030036148A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,885 US20030032138A1 (en) | 1998-06-24 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/188,774 US20030040074A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,602 US20030036145A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/188,770 US7358340B2 (en) | 1997-09-18 | 2002-07-02 | PRO19563 antibodies |
| US10/188,780 US7268217B2 (en) | 1998-06-26 | 2002-07-02 | PRO4421 polypeptides |
| US10/187,751 US20030036151A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,757 US7276578B2 (en) | 1997-09-18 | 2002-07-02 | PRO4334 polypeptides |
| US10/187,745 US7250490B2 (en) | 1997-09-18 | 2002-07-02 | PRO1480 polypeptides |
| US10/187,754 US20030036153A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/188,773 US20030036159A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,600 US20030036143A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,747 US20030036150A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,746 US20030036149A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,603 US20030036146A1 (en) | 1998-06-26 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,596 US20030032136A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/188,766 US7351804B2 (en) | 1998-06-26 | 2002-07-02 | Antibodies against PRO4421 |
| US10/188,767 US7312310B2 (en) | 1997-09-18 | 2002-07-02 | PRO6015 polypeptides |
| US10/188,769 US20030036157A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/187,741 US20030036147A1 (en) | 1997-09-18 | 2002-07-02 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/192,010 US20030044932A1 (en) | 1997-09-18 | 2002-07-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/194,361 US20030036161A1 (en) | 1998-06-26 | 2002-07-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/194,365 US7381791B2 (en) | 1998-06-26 | 2002-07-12 | PRO9739 polypeptides |
| US10/194,461 US20030054459A1 (en) | 1998-06-26 | 2002-07-12 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/194,423 US7339025B2 (en) | 1998-06-26 | 2002-07-12 | PRO6246 polypeptides |
| US10/194,462 US7388073B2 (en) | 1998-06-26 | 2002-07-12 | PRO9835 polypeptides |
| US10/195,883 US20060073544A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,892 US7385033B2 (en) | 1998-06-26 | 2002-07-15 | PRO12970 polypeptides |
| US10/195,888 US20060073545A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,889 US7534856B2 (en) | 1998-06-26 | 2002-07-15 | PRO19624 antibodies |
| US10/195,894 US20030043176A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,901 US20030036165A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,893 US20030206188A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,902 US20030038826A1 (en) | 1998-06-26 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/195,897 US20030036164A1 (en) | 1997-09-18 | 2002-07-15 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/196,760 US7408034B2 (en) | 1998-06-26 | 2002-07-16 | PRO20025 polypeptides |
| US10/196,743 US20030038827A1 (en) | 1998-06-26 | 2002-07-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/196,759 US20030071835A1 (en) | 1998-06-26 | 2002-07-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/196,756 US7304145B2 (en) | 1998-06-26 | 2002-07-16 | PRO19646 antibodies |
| US10/196,745 US7423120B2 (en) | 1997-09-18 | 2002-07-16 | PRO19814 polypeptides |
| US10/196,762 US20030040078A1 (en) | 1998-06-26 | 2002-07-16 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/199,464 US20030032140A1 (en) | 1997-09-18 | 2002-07-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/199,462 US20030054468A1 (en) | 1998-06-26 | 2002-07-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/198,768 US20030049756A1 (en) | 1998-06-26 | 2002-07-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/199,316 US20030068726A1 (en) | 1998-06-26 | 2002-07-19 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/205,904 US20030073813A1 (en) | 1998-06-26 | 2002-07-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/232,225 US20030096969A1 (en) | 2000-06-02 | 2002-08-29 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US10/617,573 US7771719B1 (en) | 2000-01-11 | 2003-07-11 | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| US10/884,091 US20040265966A1 (en) | 2000-03-01 | 2004-07-01 | Secreted and transmebrane polypeptides and nucleic acids encoding the same |
| US10/972,317 US7208321B2 (en) | 1998-06-02 | 2004-10-22 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US11/189,442 US20060246465A1 (en) | 1998-06-04 | 2005-07-25 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| JP2005264294A JP2006081548A (ja) | 2000-03-01 | 2005-08-15 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| US11/263,278 US20080286821A1 (en) | 1999-05-14 | 2005-10-31 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US11/323,117 US20070092941A1 (en) | 1998-09-16 | 2005-12-29 | PRO1298 polypeptides |
| US11/341,175 US7468427B2 (en) | 1997-03-31 | 2006-01-27 | Antibodies to PRO1275 polypeptide |
| JP2006266069A JP2007049999A (ja) | 2000-06-02 | 2006-09-28 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| US11/529,324 US8273703B2 (en) | 1998-05-15 | 2006-09-29 | IL-17 receptor-like polypeptides and therapeutic uses thereof |
| US11/949,633 US20080160021A1 (en) | 2000-01-11 | 2007-12-03 | Il-17 homologous polypeptides and therapeutic uses thereof |
| JP2008153789A JP2008301822A (ja) | 2000-03-01 | 2008-06-12 | 分泌及び膜貫通ポリペプチドとそれをコードする核酸 |
| JP2008194764A JP2009039119A (ja) | 2000-07-20 | 2008-07-29 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| JP2008194678A JP2009039117A (ja) | 2000-07-20 | 2008-07-29 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| JP2008194721A JP2009039118A (ja) | 2000-07-20 | 2008-07-29 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| US12/549,497 US8034342B2 (en) | 2000-01-11 | 2009-08-28 | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| JP2011173336A JP6033531B2 (ja) | 2000-07-20 | 2011-08-08 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| US13/269,984 US20120058909A1 (en) | 2000-01-11 | 2011-10-10 | Il-17 homologous polypeptides and therapeutic uses thereof |
| US13/270,006 US20120064073A1 (en) | 2000-01-11 | 2011-10-10 | Il-17 homologous polypeptides and therapeutic uses thereof |
| US13/593,362 US20130064827A1 (en) | 1998-05-15 | 2012-08-23 | Il-17 homologous polypeptides and thereapeutic uses thereof |
| JP2014187275A JP2015037408A (ja) | 2000-07-20 | 2014-09-16 | 血管形成に関連する障害を診断及び治療するための組成物と方法 |
| US14/489,167 US20150141283A1 (en) | 2000-01-11 | 2014-09-17 | Il-17 homologous polypeptides and therapeutic uses thereof |
| US14/581,971 US20150266953A1 (en) | 1998-05-15 | 2014-12-23 | Il-17 homologous polypeptides and therapeutic uses thereof |
Applications Claiming Priority (30)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17209699P | 1999-12-23 | 1999-12-23 | |
| US60/172,096 | 1999-12-23 | ||
| PCT/US1999/031274 WO2000053752A2 (en) | 1999-03-08 | 1999-12-30 | Promotion or inhibition of angiogenesis and cardiovascularization |
| USPCT/US99/31274 | 1999-12-30 | ||
| US17548100P | 2000-01-11 | 2000-01-11 | |
| US60/175,481 | 2000-01-11 | ||
| USPCT/US00/04341 | 2000-02-18 | ||
| PCT/US2000/004341 WO2000053756A2 (en) | 1999-03-08 | 2000-02-18 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| USPCT/US00/05841 | 2000-03-02 | ||
| PCT/US2000/005841 WO2000053758A2 (en) | 1999-03-08 | 2000-03-02 | Compositions and methods for the treatment of immune related diseases |
| US19100700P | 2000-03-21 | 2000-03-21 | |
| USPCT/US00/07532 | 2000-03-21 | ||
| PCT/US2000/007532 WO2000070050A1 (en) | 1999-05-14 | 2000-03-21 | Compositions and methods for the treatment of immune related diseases |
| US60/191,007 | 2000-03-21 | ||
| USPCT/US00/15264 | 2000-06-02 | ||
| PCT/US2000/015264 WO2000073452A2 (en) | 1999-06-02 | 2000-06-02 | Compositions and methods for the treatment of immune related diseases |
| US60/213,087 | 2000-06-20 | ||
| US21380700P | 2000-06-22 | 2000-06-22 | |
| US64484800A | 2000-08-22 | 2000-08-22 | |
| US09/644,848 | 2000-08-22 | ||
| PCT/US2000/023328 WO2001016318A2 (en) | 1999-09-01 | 2000-08-24 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| USPCT/US00/23328 | 2000-08-24 | ||
| US24283700P | 2000-10-24 | 2000-10-24 | |
| US60/242,837 | 2000-10-24 | ||
| USPCT/US00/30873 | 2000-11-10 | ||
| PCT/US2000/030873 WO2001040465A2 (en) | 1999-11-30 | 2000-11-10 | Compositions and methods for the treatment of immune related diseases |
| US25364600P | 2000-11-28 | 2000-11-28 | |
| US60/253,646 | 2000-11-28 | ||
| USPCT/US00/32678 | 2000-12-01 | ||
| PCT/US2000/032678 WO2001040466A2 (en) | 1999-12-01 | 2000-12-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
Related Parent Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/030873 Continuation-In-Part WO2001040465A2 (en) | 1997-03-31 | 2000-11-10 | Compositions and methods for the treatment of immune related diseases |
| PCT/US2000/032678 Continuation-In-Part WO2001040466A2 (en) | 1996-11-06 | 2000-12-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| PCT/US2000/032678 Continuation WO2001040466A2 (en) | 1996-11-06 | 2000-12-01 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/747,259 Continuation-In-Part US6569645B2 (en) | 1997-03-31 | 2000-12-20 | IL-17 homologous polypeptides and therapeutic uses thereof |
| PCT/US2001/021735 Continuation-In-Part WO2002008284A2 (en) | 1996-11-06 | 2001-07-09 | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
Related Child Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/747,259 Continuation-In-Part US6569645B2 (en) | 1997-03-31 | 2000-12-20 | IL-17 homologous polypeptides and therapeutic uses thereof |
| US09/747,259 Continuation US6569645B2 (en) | 1997-03-31 | 2000-12-20 | IL-17 homologous polypeptides and therapeutic uses thereof |
| PCT/US2001/006520 Continuation-In-Part WO2001068848A2 (en) | 1996-11-06 | 2001-02-28 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| US09/908,827 Continuation US20030054442A1 (en) | 1997-03-31 | 2001-07-18 | IL-17 homologous polypeptides and therapeutic uses thereof |
| US10/119,480 Continuation US20040087769A1 (en) | 1998-09-10 | 2002-04-09 | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2001046420A2 true WO2001046420A2 (en) | 2001-06-28 |
| WO2001046420A3 WO2001046420A3 (en) | 2002-05-10 |
| WO2001046420A8 WO2001046420A8 (en) | 2002-07-04 |
Family
ID=40140243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/034956 Ceased WO2001046420A2 (en) | 1997-03-31 | 2000-12-20 | Il-17 and il-17r homologous polypeptides and therapeutic uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP1240325B1 (enExample) |
| JP (10) | JP5070117B2 (enExample) |
| AT (5) | ATE519847T1 (enExample) |
| AU (1) | AU2590901A (enExample) |
| CA (1) | CA2391374A1 (enExample) |
| CY (1) | CY1112334T1 (enExample) |
| DK (1) | DK1240325T3 (enExample) |
| ES (7) | ES2506665T3 (enExample) |
| PT (4) | PT1897944E (enExample) |
| WO (1) | WO2001046420A2 (enExample) |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001064240A3 (en) * | 2000-02-29 | 2002-02-21 | Zymogenetics Inc | Methods for promoting production of myelin by schwann cells |
| WO2001090358A3 (en) * | 2000-05-24 | 2003-01-23 | Schering Corp | Mammalian receptor proteins; related reagents and methods |
| WO2002033083A3 (en) * | 2000-10-13 | 2003-03-06 | Lilly Co Eli | Methods of using a human il-17-related polypeptide to treat disease |
| WO2002008259A3 (en) * | 2000-07-26 | 2003-03-27 | Zymogenetics Inc | Human cytokine receptor |
| WO2002038764A3 (en) * | 2000-11-10 | 2003-07-10 | Univ California | Il-17 receptor-like protein, uses thereof, and modulation of catabolic activity of il-17 cytokines on bone and cartilage |
| EP1529843A3 (en) * | 2000-08-11 | 2005-06-08 | Eli Lilly & Company | Novel secreted proteins and their uses |
| WO2005010044A3 (en) * | 2003-07-08 | 2005-08-18 | Genentech Inc | Il-17 a/f heterologous polypeptides and therapeutic uses thereof |
| WO2005108616A1 (en) * | 2004-05-03 | 2005-11-17 | Schering Corporation | Use of il-17 expression to predict skin inflammation; methods of treatment |
| WO2006032673A1 (en) * | 2004-09-21 | 2006-03-30 | Applied Research Systems Ars Holding N.V. | Use of il-17f for the treatment and/or prevention of neurologic diseases |
| WO2007019453A3 (en) * | 2005-08-04 | 2007-05-24 | Zymogenetics Inc | Treatment of wounds using il-17b |
| WO2008073653A3 (en) * | 2006-11-08 | 2008-08-07 | Zymogenetics Inc | Il- 17b for use in wound healing |
| US7427402B2 (en) | 2004-05-03 | 2008-09-23 | Schering Corporation | Method of evaluating inflammatory skin disorders using IL-17 and/or IL-19 |
| US7544482B2 (en) | 2000-08-24 | 2009-06-09 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof |
| JP2009159949A (ja) * | 2001-10-19 | 2009-07-23 | Genentech Inc | 炎症性腸疾患の診断と治療のための組成物と方法 |
| US7622116B2 (en) | 2006-02-10 | 2009-11-24 | Zymogenetics, Inc. | Method of treating inflammation using soluble IL-17RCX4 |
| US7718397B2 (en) | 2000-03-21 | 2010-05-18 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof |
| US7749500B2 (en) | 1998-05-15 | 2010-07-06 | Genentech, Inc. | Antibodies to IL-17 polypeptides and therapeutic uses thereof |
| US7771719B1 (en) | 2000-01-11 | 2010-08-10 | Genentech, Inc. | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| US7790676B2 (en) | 2007-03-28 | 2010-09-07 | Zymogenetics, Inc. | Soluble IL-17RA/RC fusion proteins |
| WO2010103038A1 (en) | 2009-03-11 | 2010-09-16 | Novo Nordisk A/S | Interleukin-21 variants having antagonistic binding to the il-21 receptor |
| JP2010207229A (ja) * | 2003-03-03 | 2010-09-24 | Genentech Inc | 全身性エリテマトーデスの治療のための組成物と方法 |
| WO2010114859A1 (en) | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
| JP2010227106A (ja) * | 2002-09-11 | 2010-10-14 | Genentech Inc | 免疫関連疾患の治療のための新規組成物と方法 |
| WO2010116123A1 (en) * | 2009-04-06 | 2010-10-14 | Medical Research Council | Antibodies against il-17br |
| US7842665B2 (en) | 2005-09-28 | 2010-11-30 | Zymogenetics, Inc. | IL-17A and IL-17F antagonists |
| US7910540B2 (en) | 2004-06-10 | 2011-03-22 | Zymogenetics, Inc. | Soluble ZcytoR14, anti-ZcytoR14 antibodies and binding partners and methods of using in inflammation |
| EP2311870A1 (en) * | 2002-11-26 | 2011-04-20 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
| US7931900B2 (en) | 2003-11-21 | 2011-04-26 | Ucb Pharma S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
| WO2010142551A3 (en) * | 2009-06-12 | 2011-06-16 | Ablynx N.V. | Single variable domain (vhh) antibodies to cytokines of the il-17 receptor family |
| EP2389943A1 (en) * | 2000-04-18 | 2011-11-30 | Schering Corporation | Use of IL-174 antagonists for treating Th2-related diseases |
| WO2012098113A1 (en) | 2011-01-17 | 2012-07-26 | Novo Nordisk A/S | Il-21 ligands |
| US8475784B2 (en) | 2006-10-26 | 2013-07-02 | Novo Nordisk A/S | IL-21 variants |
| US8790642B2 (en) | 2008-08-29 | 2014-07-29 | Genentech, Inc. | Cross-reactive and bispecific anti-IL-17A/F antibodies |
| CN103974976A (zh) * | 2011-10-19 | 2014-08-06 | 莫佛塞斯公司 | 用于治疗炎性病症的il17c拮抗剂 |
| WO2016070062A2 (en) | 2014-10-31 | 2016-05-06 | Genentech, Inc. | Anti-il-17a and il-17f cross reactive antibody variants and compositions comprising and methods of making and using same |
| WO2016123329A2 (en) | 2015-01-28 | 2016-08-04 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
| US9650437B2 (en) | 2008-05-05 | 2017-05-16 | Novimmune S.A. | Nucleic acid encoding and method of producing anti-IL-17A/IL-17F cross-reactive antibodies |
| EP3181147A1 (en) | 2006-11-29 | 2017-06-21 | Genentech, Inc. | Il-17a/f heterodimeric polypeptides and therapeutic thereof |
| US10017568B2 (en) | 2011-05-05 | 2018-07-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6562578B1 (en) | 1999-01-11 | 2003-05-13 | Schering Corporation | IL-17-like cytokine binding compounds and antibodies |
| US8137671B2 (en) | 2009-05-05 | 2012-03-20 | Genentech, Inc. | Anti-IL-17F antibodies |
| JP6236948B2 (ja) * | 2013-07-17 | 2017-11-29 | 東ソー株式会社 | 抗体精製用溶出液および当該溶出液を用いた抗体精製方法 |
| KR20150050921A (ko) * | 2013-11-01 | 2015-05-11 | 현대중공업 주식회사 | 폐열 회수용 연관식 보일러 |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000073452A2 (en) * | 1999-06-02 | 2000-12-07 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
| JP4373495B2 (ja) * | 1995-03-23 | 2009-11-25 | イミュネックス・コーポレーション | Il−17受容体 |
| WO2000070050A1 (en) * | 1999-05-14 | 2000-11-23 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
| BR9809778A (pt) * | 1997-04-25 | 2000-06-20 | Zymogenetics Inc | Polinucleotìdeo isolado, vetor de expressão, peptìdeo ou polipetìdeo isolado, anticorpo, processo para produzir o mesmo, fragmentos de anticorpos, anticorpos de cadeia única ou anticorpos humanizados, e, anticorpo anti-idiotìpico. |
| WO1999003982A1 (en) * | 1997-07-16 | 1999-01-28 | Human Genome Sciences, Inc. | Interleukin-20 |
| AU9482498A (en) * | 1997-09-17 | 1999-04-05 | Human Genome Sciences, Inc. | Interleukin-17 receptor-like protein |
| US6482923B1 (en) * | 1997-09-17 | 2002-11-19 | Human Genome Sciences, Inc. | Interleukin 17-like receptor protein |
| WO1999032632A1 (en) * | 1997-12-19 | 1999-07-01 | Millennium Pharmaceuticals, Inc. | Novel embryo-derived interleukin related factor molecules and uses therefor |
| EP1490386B1 (en) * | 1998-03-10 | 2008-08-13 | Genentech, Inc. | Novel polypeptide and nucleic acids encoding the same |
| JP3577586B2 (ja) * | 1998-05-15 | 2004-10-13 | ジェネンテック・インコーポレーテッド | Il−17相同的ポリペプチドとその治療用途 |
| AU3207000A (en) * | 1999-01-11 | 2000-08-01 | Schering Corporation | Interleukin-17 related mammalian cytokine (il-171). polynucleotides encoding them. uses |
| PT1141297E (pt) * | 1999-01-11 | 2010-01-06 | Schering Corp | Citoquinas de mamíferos relacionadas com a interleucina-17. polinucleótidos que as codificam. utilizações |
| AU2596700A (en) * | 1999-03-08 | 2000-09-28 | Genentech Inc. | Promotion or inhibition of angiogenesis and cardiovascularization |
| ES2286029T3 (es) * | 1999-07-07 | 2007-12-01 | Zymogenetics Inc | Receptor de citocina humano. |
| JP2003527104A (ja) * | 1999-12-23 | 2003-09-16 | ジェネンテック・インコーポレーテッド | Il−17相同的ポリペプチドとその治療上の用途 |
-
2000
- 2000-12-20 ES ES09009972.2T patent/ES2506665T3/es not_active Expired - Lifetime
- 2000-12-20 PT PT07016900T patent/PT1897944E/pt unknown
- 2000-12-20 PT PT07016903T patent/PT1897947E/pt unknown
- 2000-12-20 DK DK00989401.5T patent/DK1240325T3/da active
- 2000-12-20 AT AT07016900T patent/ATE519847T1/de active
- 2000-12-20 PT PT00989401T patent/PT1240325E/pt unknown
- 2000-12-20 AT AT07016903T patent/ATE541931T1/de active
- 2000-12-20 AT AT00989401T patent/ATE444361T1/de active
- 2000-12-20 ES ES07016903T patent/ES2380812T3/es not_active Expired - Lifetime
- 2000-12-20 AT AT07016901T patent/ATE541930T1/de active
- 2000-12-20 PT PT07016901T patent/PT1897945E/pt unknown
- 2000-12-20 ES ES07016901T patent/ES2380958T3/es not_active Expired - Lifetime
- 2000-12-20 ES ES10009491.1T patent/ES2458349T3/es not_active Expired - Lifetime
- 2000-12-20 CA CA002391374A patent/CA2391374A1/en not_active Withdrawn
- 2000-12-20 ES ES07016902T patent/ES2388748T3/es not_active Expired - Lifetime
- 2000-12-20 AU AU25909/01A patent/AU2590901A/en not_active Abandoned
- 2000-12-20 EP EP00989401A patent/EP1240325B1/en not_active Expired - Lifetime
- 2000-12-20 WO PCT/US2000/034956 patent/WO2001046420A2/en not_active Ceased
- 2000-12-20 AT AT07016899T patent/ATE537258T1/de active
- 2000-12-20 ES ES00989401T patent/ES2333772T3/es not_active Expired - Lifetime
- 2000-12-20 ES ES07016899T patent/ES2379101T3/es not_active Expired - Lifetime
-
2008
- 2008-04-21 JP JP2008109843A patent/JP5070117B2/ja not_active Expired - Fee Related
-
2009
- 2009-02-04 JP JP2009023863A patent/JP2009159968A/ja active Pending
- 2009-07-22 JP JP2009171169A patent/JP5258691B2/ja not_active Expired - Lifetime
-
2010
- 2010-07-05 JP JP2010152694A patent/JP2010266454A/ja active Pending
-
2011
- 2011-10-04 CY CY20111100948T patent/CY1112334T1/el unknown
-
2012
- 2012-01-25 JP JP2012012914A patent/JP2012115275A/ja active Pending
- 2012-03-21 JP JP2012063772A patent/JP2012152218A/ja active Pending
-
2013
- 2013-02-28 JP JP2013038690A patent/JP2013165712A/ja not_active Withdrawn
-
2014
- 2014-07-04 JP JP2014138440A patent/JP2014239685A/ja active Pending
- 2014-08-18 JP JP2014166220A patent/JP2015007091A/ja active Pending
- 2014-12-01 JP JP2014243369A patent/JP2015077137A/ja not_active Withdrawn
Cited By (74)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8273703B2 (en) | 1998-05-15 | 2012-09-25 | Genentech, Inc. | IL-17 receptor-like polypeptides and therapeutic uses thereof |
| US7749500B2 (en) | 1998-05-15 | 2010-07-06 | Genentech, Inc. | Antibodies to IL-17 polypeptides and therapeutic uses thereof |
| US8075888B2 (en) | 1998-05-15 | 2011-12-13 | Genentech, Inc. | Methods of treatment using antibodies to IL-17 homologous polypeptides |
| US8034342B2 (en) | 2000-01-11 | 2011-10-11 | Genentech, Inc. | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| US7771719B1 (en) | 2000-01-11 | 2010-08-10 | Genentech, Inc. | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| WO2001064240A3 (en) * | 2000-02-29 | 2002-02-21 | Zymogenetics Inc | Methods for promoting production of myelin by schwann cells |
| US7718397B2 (en) | 2000-03-21 | 2010-05-18 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof |
| US8338132B2 (en) | 2000-03-21 | 2012-12-25 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and therapeutic uses thereof |
| EP2389943A1 (en) * | 2000-04-18 | 2011-11-30 | Schering Corporation | Use of IL-174 antagonists for treating Th2-related diseases |
| WO2001090358A3 (en) * | 2000-05-24 | 2003-01-23 | Schering Corp | Mammalian receptor proteins; related reagents and methods |
| WO2002008259A3 (en) * | 2000-07-26 | 2003-03-27 | Zymogenetics Inc | Human cytokine receptor |
| EP1529843A3 (en) * | 2000-08-11 | 2005-06-08 | Eli Lilly & Company | Novel secreted proteins and their uses |
| US7544482B2 (en) | 2000-08-24 | 2009-06-09 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof |
| WO2002033083A3 (en) * | 2000-10-13 | 2003-03-06 | Lilly Co Eli | Methods of using a human il-17-related polypeptide to treat disease |
| US8455217B2 (en) | 2000-10-24 | 2013-06-04 | Genentech, Inc. | Nucleic acids encoding IL-17 homologous receptor-like polypeptides and therapeutic uses thereof |
| WO2002038764A3 (en) * | 2000-11-10 | 2003-07-10 | Univ California | Il-17 receptor-like protein, uses thereof, and modulation of catabolic activity of il-17 cytokines on bone and cartilage |
| JP2009159949A (ja) * | 2001-10-19 | 2009-07-23 | Genentech Inc | 炎症性腸疾患の診断と治療のための組成物と方法 |
| JP2010227106A (ja) * | 2002-09-11 | 2010-10-14 | Genentech Inc | 免疫関連疾患の治療のための新規組成物と方法 |
| EP2311870A1 (en) * | 2002-11-26 | 2011-04-20 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
| JP2010207229A (ja) * | 2003-03-03 | 2010-09-24 | Genentech Inc | 全身性エリテマトーデスの治療のための組成物と方法 |
| EP3594228A1 (en) | 2003-07-08 | 2020-01-15 | Genentech, Inc. | Il-17a/f heterologous polypedtides and therapeutic uses thereof |
| EP2784084A1 (en) * | 2003-07-08 | 2014-10-01 | Genentech, Inc. | IL-17 A/F heterologous polypeptides and therapeutics uses thereof |
| US10011654B2 (en) | 2003-07-08 | 2018-07-03 | Genentech, Inc. | Antibodies directed to IL-17A/IL-17F heterodimers |
| AU2008229758B2 (en) * | 2003-07-08 | 2012-07-26 | Genentech, Inc. | IL-17 A/F heterologous polypeptides and therapeutic uses thereof |
| EP2277908A3 (en) * | 2003-07-08 | 2011-12-14 | Genentech, Inc. | IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof |
| JP2010207228A (ja) * | 2003-07-08 | 2010-09-24 | Genentech Inc | Il−17異種ポリペプチドとその治療上の用途 |
| KR100835786B1 (ko) * | 2003-07-08 | 2008-06-09 | 제넨테크, 인크. | Il-17a/f 이종 폴리펩티드 및 그의 치료 용도 |
| JP2008500803A (ja) * | 2003-07-08 | 2008-01-17 | ジェネンテック・インコーポレーテッド | Il−17異種ポリペプチドとその治療上の用途 |
| EP2784084B1 (en) | 2003-07-08 | 2019-07-24 | Genentech, Inc. | Antagonist antibodies to IL-17A/F heterologous polypeptides |
| EP2784084B2 (en) † | 2003-07-08 | 2023-10-04 | Novartis Pharma AG | Antagonist antibodies to IL-17A/F heterologous polypeptides |
| WO2005010044A3 (en) * | 2003-07-08 | 2005-08-18 | Genentech Inc | Il-17 a/f heterologous polypeptides and therapeutic uses thereof |
| EP2277908A2 (en) | 2003-07-08 | 2011-01-26 | Genentech, Inc. | IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof |
| US7931900B2 (en) | 2003-11-21 | 2011-04-26 | Ucb Pharma S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
| US7740848B2 (en) | 2004-05-03 | 2010-06-22 | Schering Corporation | Method of treatment of skin inflammation |
| US7427402B2 (en) | 2004-05-03 | 2008-09-23 | Schering Corporation | Method of evaluating inflammatory skin disorders using IL-17 and/or IL-19 |
| WO2005108616A1 (en) * | 2004-05-03 | 2005-11-17 | Schering Corporation | Use of il-17 expression to predict skin inflammation; methods of treatment |
| US7501247B2 (en) | 2004-05-03 | 2009-03-10 | Schering Corporation | Method of treating skin inflammation |
| US7776540B2 (en) | 2004-05-03 | 2010-08-17 | Schering Corporation | Method of treating skin inflammation |
| US8178095B2 (en) | 2004-05-03 | 2012-05-15 | Schering Corporation | Method of treating skin inflammation |
| US7910540B2 (en) | 2004-06-10 | 2011-03-22 | Zymogenetics, Inc. | Soluble ZcytoR14, anti-ZcytoR14 antibodies and binding partners and methods of using in inflammation |
| US8268773B2 (en) | 2004-06-10 | 2012-09-18 | Zymogenetics, Inc. | Methods of treating multiple sclerosis (MS) using an IL-17A and IL-17F antagonist |
| WO2006032673A1 (en) * | 2004-09-21 | 2006-03-30 | Applied Research Systems Ars Holding N.V. | Use of il-17f for the treatment and/or prevention of neurologic diseases |
| WO2007019453A3 (en) * | 2005-08-04 | 2007-05-24 | Zymogenetics Inc | Treatment of wounds using il-17b |
| US7842665B2 (en) | 2005-09-28 | 2010-11-30 | Zymogenetics, Inc. | IL-17A and IL-17F antagonists |
| US8093355B2 (en) | 2006-02-10 | 2012-01-10 | Zymogenetics, Inc. | Soluble IL-17RCx4 and fusion proteins thereof |
| US7622116B2 (en) | 2006-02-10 | 2009-11-24 | Zymogenetics, Inc. | Method of treating inflammation using soluble IL-17RCX4 |
| US8475784B2 (en) | 2006-10-26 | 2013-07-02 | Novo Nordisk A/S | IL-21 variants |
| WO2008073653A3 (en) * | 2006-11-08 | 2008-08-07 | Zymogenetics Inc | Il- 17b for use in wound healing |
| EP3181147A1 (en) | 2006-11-29 | 2017-06-21 | Genentech, Inc. | Il-17a/f heterodimeric polypeptides and therapeutic thereof |
| US7790676B2 (en) | 2007-03-28 | 2010-09-07 | Zymogenetics, Inc. | Soluble IL-17RA/RC fusion proteins |
| US8084231B2 (en) | 2007-03-28 | 2011-12-27 | Zymogenetics, Inc. | Soluble IL-17RA/RC fusion proteins and related methods |
| US9650437B2 (en) | 2008-05-05 | 2017-05-16 | Novimmune S.A. | Nucleic acid encoding and method of producing anti-IL-17A/IL-17F cross-reactive antibodies |
| US8790642B2 (en) | 2008-08-29 | 2014-07-29 | Genentech, Inc. | Cross-reactive and bispecific anti-IL-17A/F antibodies |
| US9512217B2 (en) | 2008-08-29 | 2016-12-06 | Genentech, Inc. | Antibodies binding to IL-17A |
| EP3211008A1 (en) | 2008-08-29 | 2017-08-30 | F. Hoffmann-La Roche AG | Cross-reactive and bispecific anti-il-17a/f antibodies |
| WO2010103038A1 (en) | 2009-03-11 | 2010-09-16 | Novo Nordisk A/S | Interleukin-21 variants having antagonistic binding to the il-21 receptor |
| WO2010114859A1 (en) | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
| AU2010233535B2 (en) * | 2009-04-06 | 2014-02-27 | United Kingdom Research And Innovation | Antibodies against IL-17BR |
| US8852589B2 (en) | 2009-04-06 | 2014-10-07 | Medical Research Council | Antibodies against IL-17BR |
| CN102482352B (zh) * | 2009-04-06 | 2015-06-10 | 医学研究委员会 | 抗il-17br的抗体 |
| WO2010116123A1 (en) * | 2009-04-06 | 2010-10-14 | Medical Research Council | Antibodies against il-17br |
| US8586037B2 (en) | 2009-04-06 | 2013-11-19 | Medical Research Council | Antibodies against IL-17BR |
| CN102482352A (zh) * | 2009-04-06 | 2012-05-30 | 医学研究委员会 | 抗il-17br的抗体 |
| WO2010142551A3 (en) * | 2009-06-12 | 2011-06-16 | Ablynx N.V. | Single variable domain (vhh) antibodies to cytokines of the il-17 receptor family |
| WO2012098113A1 (en) | 2011-01-17 | 2012-07-26 | Novo Nordisk A/S | Il-21 ligands |
| US10017568B2 (en) | 2011-05-05 | 2018-07-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same |
| US10829552B2 (en) | 2011-05-05 | 2020-11-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same |
| US11773159B2 (en) | 2011-05-05 | 2023-10-03 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same |
| US10815297B2 (en) | 2011-10-19 | 2020-10-27 | Morphosys Ag | Antagonists of IL17C for the treatment of inflammatory disorders |
| CN103974976A (zh) * | 2011-10-19 | 2014-08-06 | 莫佛塞斯公司 | 用于治疗炎性病症的il17c拮抗剂 |
| WO2016070062A2 (en) | 2014-10-31 | 2016-05-06 | Genentech, Inc. | Anti-il-17a and il-17f cross reactive antibody variants and compositions comprising and methods of making and using same |
| WO2016123329A2 (en) | 2015-01-28 | 2016-08-04 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
| US11236391B2 (en) | 2015-01-28 | 2022-02-01 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
| US12098426B2 (en) | 2015-01-28 | 2024-09-24 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8455217B2 (en) | Nucleic acids encoding IL-17 homologous receptor-like polypeptides and therapeutic uses thereof | |
| US8034342B2 (en) | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E | |
| US20030003546A1 (en) | lL-17 homologous polypeptides and therapeutic uses thereof | |
| WO2001046420A2 (en) | Il-17 and il-17r homologous polypeptides and therapeutic uses thereof | |
| US20090291097A1 (en) | IL-17 homologous polypeptides and therapeutic uses thereof | |
| US20110064728A1 (en) | IL-17 Homologous Polypeptides and Therapeutic Uses Thereof | |
| US20020177188A1 (en) | IL-17 homologous polypeptides and therapeutic uses thereof | |
| US7491512B2 (en) | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof | |
| US20020182673A1 (en) | IL-17 homologous polypedies and therapeutic uses thereof | |
| US8338132B2 (en) | Nucleic acids encoding receptor for IL-17 homologous polypeptides and therapeutic uses thereof | |
| EP1897943B1 (en) | IL-17 homologous polypeptides and therapeutic uses thereof | |
| US20090035261A1 (en) | IL-17 homologous polypeptides and therapeutic uses thereof | |
| HK1114636B (en) | 1l-17 homologous polypeptides and therapeutic uses thereof | |
| HK1154040A (en) | Il-17 homologous polypeptide and therapeutic uses thereof | |
| HK1114638B (en) | Il-17 homologous polypeptides and therapeutic uses thereof | |
| HK1114637B (en) | Il-17 homologous polypeptides and therapeutic uses thereof | |
| HK1114634B (en) | Il-17 homologous polypeptides and therapeutic uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref country code: US Ref document number: 2001 816920 Date of ref document: 20010322 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: US Ref document number: 2001 828366 Date of ref document: 20010405 Kind code of ref document: A Format of ref document f/p: F |
|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2391374 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000989401 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 546918 Kind code of ref document: A Format of ref document f/p: F |
|
| AK | Designated states |
Kind code of ref document: C1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| CFP | Corrected version of a pamphlet front page | ||
| WWP | Wipo information: published in national office |
Ref document number: 2000989401 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |