WO2001038543A1 - NOUVEAU POLYPEPTIDE, ACYL-CoA REDUCTASE HUMAINE 55, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE - Google Patents
NOUVEAU POLYPEPTIDE, ACYL-CoA REDUCTASE HUMAINE 55, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE Download PDFInfo
- Publication number
- WO2001038543A1 WO2001038543A1 PCT/CN2000/000435 CN0000435W WO0138543A1 WO 2001038543 A1 WO2001038543 A1 WO 2001038543A1 CN 0000435 W CN0000435 W CN 0000435W WO 0138543 A1 WO0138543 A1 WO 0138543A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- coa reductase
- polynucleotide
- acyl
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human acyl-CoA reductase 55, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- the bioreduction of fatty acids provides fatty aldehydes for the biosynthesis of carbohydrates, and fatty alcohols for the biosynthesis of ether lipids and waxes.
- Ether lipids including phospholipids, are widely distributed in cell lipids, especially in biofilms. Wax is also widely distributed as a surface lipid component in plants and animals, and serves as an important energy reserve.
- Soluble acyl-CoA reductase (acyl-CoA reductase) reduces fatty acyl-CoA to produce free fatty aldehydes and fatty alcohols in wax tissues.
- Fatty acid-CoA is a direct precursor of fatty alcohols.
- the formation of fatty aldehydes and fatty alcohols are closely followed by two steps, both of which are catalyzed by acyl-CoA reducing enzymes.
- NADPH is required for acyl-CoA reductase activity.
- Acyl-CoA reductase is a component of the fatty acid reductase complex, and its active catalytic region is highly similar in eukaryotes and prokaryotes.
- Three amino acids in the amino acid sequence are highly conserved. One of them is necessary for catalytic activity and involves the transfer of fatty acyl groups. All three conserved cysteines can be converted into serine.
- the cysteine on the active domain of acyl-CoA reductase can be covalently bound by cyanin, which prevents the formation of acyl-reductase intermediates, which in turn affects the reduction of acyl-CoA and the production of fatty aldehydes.
- the first step in the reduction of acyl-CoA reductase involves transporting activated acyl groups on acyl synthase to acyl reductase to form acylase intermediates, both enzymes use acyl proteins as their substrate to form acyl groups Enzyme intermediates are used as the first step.
- acyl-CoA is reduced to fatty aldehydes, and decarboxylation of fatty aldehydes produces carbohydrates, suggesting that acyl-CoA reductase passes tissues Special pathways produce end products needed by the organization. (Xing Wang and Pappachan E 1995).
- the human polypeptide gene of the present invention has 28% homology with the bird's acyl-CoA reductase at the protein level, (homologous protein number AF149918, homologous protein acyl-CoA reductase, the protein 497 aa, WKD) Its domain is similar to the characteristic domain of the acyl-CoA reductase family-three amino acids in the amino acid sequence are highly conserved, one of which is necessary for catalytic activity and involves fatty acyl For transport, all three conserved cysteines can be converted to serine: cysteine at the active site can be covalently bound by cyanin.
- the new gene of the present invention is considered to be a gene encoding the human acyl-CoA reductase family and named as human acyl-CoA reductase 55. It is inferred that its domain is similar to the acyl-CoA reductase family domain and has similar biological functions.
- the discovery of the polynucleotide encoding human acyl-CoA reductase 55 and the human acyl-CoA reductase 55 encoded by it has provided a method for studying the physiological and biochemical processes of cell differentiation and proliferation under normal and pathological conditions.
- the method also provides a new approach for the diagnosis, treatment and disorders of cell differentiation and proliferation, including cancer.
- the human acyl-CoA reductase 55 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these In the process of human acyl-CoA reductase 55 protein, especially the amino acid sequence of this protein was identified.
- the isolation of the novel human acyl-CoA reductase 55 protein-encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human acyl-CoA reductase 55.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human acyl-CoA reductase 55.
- Another object of the present invention is to provide a method for producing human acyl-CoA reductase 55.
- Another object of the present invention is to provide an antibody against the polypeptide-human acyl-CoA reductase 55 of the present invention.
- Another object of the present invention is to provide a peptide against human acyl-CoA reductase 5 5 Mimetic compounds, antagonists, agonists, inhibitors.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with abnormality of human acyl-CoA reductase 55.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- (C) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 100-1593 in SEQ ID NO: 1; and (b) a sequence having positions 1-2695 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human acyl-CoA reductase 55 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human acyl-CoA reductase 55 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or The amount or biological activity of a polypeptide of the invention in a biological sample.
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human acyl-CoA reductase 55.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human acyl-CoA reductase 55, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human acyl-CoA reductase 55.
- Antagonist refers to a molecule that, when combined with human acyl-CoA reductase 55, blocks or regulates the biological or immunological activity of human acyl-CoA reductase 55.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human acyl-CoA reductase 55.
- Regular refers to a change in the function of human acyl-CoA reductase 55, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human acyl-CoA reductase 55 change.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human acyl-CoA reductase 55 using standard protein purification techniques.
- the substantially pure human acyl-CoA reductase 55 produces a single main band on a non-reducing polyacrylamide gel.
- Human acyl The purity of the coenzyme A reductase 55 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences be combined with each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percent identity can be determined electronically, such as by the MEGAUGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244).
- the Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. J., (1990) Methods in emzumology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand means "Sense strand” A complementary nucleic acid strand.
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? ⁇ It can specifically bind to the epitope of human acyl-CoA reductase 55.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human acyl-CoA reductase 55 means that human acyl-CoA reductase 55 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human acyl-CoA reductase 55 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human acyl-CoA reductase 55 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human acyl-CoA reductase 55, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human acyl-CoA reductase 55.
- fragment refers to a human acyl group that substantially retains the present invention
- Coenzyme A reductase 55 has the same biological function or activity as a polypeptide.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a type, in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- UV a type in which the additional amino acid sequence is fused into the mature polypeptide and formed by the polypeptide sequence ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence)
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2695 bases in length and its open reading frame (100-1593) encodes 497 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 28% homology with acyl-CoA reductase. It can be inferred that the human acyl-CoA reductase 55 has similar structure and function to acyl-CoA reductase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but differing from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) added during hybridization) Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, it is more preferable that the hybridization occurs at 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human acyl-CoA reductase 55.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- polynucleotide sequence encoding the human acyl-CoA reductase 55 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.
- genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of transcripts of human acyl-CoA reductase 55; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is the same as any part of the polynucleotide of the present invention.
- the source has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human acyl-CoA reductase 55 gene.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DNA / RNA using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE- rapid amplification of cDNA ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be separated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human acyl-CoA reductase 55 coding sequence, and a recombinant technology for producing a polypeptide of the present invention. method.
- a polynucleotide sequence encoding human acyl-CoA reductase 55 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human acyl-CoA reductase 55 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). Said The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human acyl-CoA reductase 55 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- Drosophila S2 or Sf 9 animal cells
- animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.
- the steps used are well known in the art.
- the alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human acyl-CoA reductase 55 by conventional recombinant DNA technology (Scienence, 1984; 224: 1431). Generally there are the following steps:
- step (3) Isolate and purify protein from culture medium or cells.
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ionization Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ionization Exchange chromatography, high performance
- Fig. 1 is a comparison diagram of amino acid sequence homology of human acyl-CoA reductase 55 and acyl-CoA reductase of the present invention.
- the upper sequence is human acyl-CoA reductase 55
- the lower sequence is acyl-CoA reductase.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
- Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human acyl-CoA reductase 55. 55kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1104h09 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the results show that the 1104h09 clone contains a full-length cDNA of 2695bp (as shown in Seq ID NO: 1), and has a 1494bp open reading frame (0RF) from 100bp to 1593bp, encoding a new protein (such as Seq ID N0 : 2)).
- This clone pBS-1104h09 and the encoded protein was named human acyl-CoA reductase 55.
- Example 2 Homologous search of cDNA clones
- the sequence of the human acyl-CoA reductase 55 of the present invention and the protein sequence encoded by the same were performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et a 1. L Mol. Biol. 1990; 215: 403-10 ]
- Blast program Basiclocal Alignment search tool
- the gene with the highest homology to the human acyl-CoA reductase 55 of the present invention is a known acyl-CoA reductase, and the accession number of the encoded protein in Genbank is AF149918.
- the results of protein homology are shown in Figure 1. The two are highly homologous, with an identity of 28% and a similarity of 49%.
- Example 3 Cloning of a gene encoding human acyl-CoA reductase 55 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5,-GGGGAAGGAGCAGGATTTAGAGGA -3, (SEQ ID NO: 3)
- Primer 2 5'- ATCAGCATGGTTGGGGTCTGATC -3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L KC1, 10 ⁇ l / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U Taq DNA polymerase (C 1 on te ch).
- the reaction was performed on a PE 9600 DNA thermal cycler (Pe rki nElmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -actin was set as a positive control and template blank was set as a negative control.
- RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA probe The DNA probe used was the PCR-encoded human acyl-CoA reductase 55 coding region sequence (100bp to 1593bp) shown in Figure 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) hybridized with RNA-transferred nitrocellulose membrane at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 SSC-0.13 ⁇ 4SDS at 55 ° C for 30 min. Then, it was analyzed and quantified by Phosphor Imager.
- Example 5 Recombination Expression, isolation and purification of human acyl-CoA reductase 55 in vitro
- Primer3 5'- CCCCATATGATGTCCACAATTGCAGCTTTCTATG -3, (Seq ID No: 5)
- Primer4 5'- CCCGAATTCCTACATAATGAAGAACCAGACATTCC —3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- PCR was performed using the pBS-1104h09 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing pBS-1104h09 plasmid 10 P g, primers Primer-3 and Primer-4 4 points, and 1 J was 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double-digest the amplified product and plasmid PET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
- coli DH5a using the calcium chloride method. After being cultured overnight in an LB plate containing kanamycin (final concentration 30 ⁇ g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-1104h09) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 ⁇ g / ml), the host strain BL21 (ET-1104h09) was at 37. C.
- a peptide specific to human acyl-CoA reductase 55 was synthesized using a peptide synthesizer (product of PE company): NH 2 -Me t-Ser-Thr-I l eA la-A la-Phe-Tyr-G ly-G l y-Lys-Ser-I l e-Leu-I l e-COOH (SEQ ID NO: 7).
- the peptide was coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For the method, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43 0 4 mg of the above hemocyanin polypeptide complex plus complete Freund's adjuvant Immunization is immune, and after 15 days, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant is used to boost the immunity once.
- a titer plate coated with 15 ⁇ g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
- the peptide was bound to a cyanogen bromide-activated Se P h a rOSe 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to human acyl-CoA reductase 55.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- the bioreduction of fatty acids provides fatty aldehydes for the biosynthesis of carbohydrates, and fatty alcohols for the biosynthesis of ether lipids and waxes.
- Ether lipids including phospholipids, are widely distributed in cell lipids, especially in biofilms. Wax is also widely distributed as a surface lipid component in plants and animals, and serves as an important energy reserve.
- Acyl-CoA reductase can catalyze the production of fatty aldehydes and fatty alcohols, thereby promoting the biosynthesis of carbohydrates and the metabolism of membrane lipids.
- the cysteine on the active domain of acyl-CoA reductase can be covalently bound by cyanin, which prevents the formation of acyl-reductase intermediates, which in turn affects the reduction of acyl-CoA and the production of fatty aldehydes. Mutations in cysteine necessary for catalytic activity on acyl-CoA reductase can result in loss of catalytic activity and hinder the formation of acyl reductase intermediates.
- acyl-CoA reductase In epidermal cells of bowl bean leaves, tail fat glands of some birds, diapause of cabbage fly, and green algae, acyl-CoA is reduced to fatty aldehydes, and decarboxylation of fatty aldehydes produces carbohydrates, suggesting that acyl-CoA reductase passes tissues Special pathways produce end products needed by the organization. It can be seen that the abnormal expression of the human acyl-CoA reductase 55 of the present invention will produce various diseases, especially fatty acid metabolic disorders and nutritional metabolic diseases, and these diseases include, but are not limited to:
- Hereditary lipid metabolism disorders hyperlipoproteinemia, familial hyperalpha-lipoproteinemia, familial alpha-lipoproteinemia deficiency, familial hypo-oc-lipoproteinemia, familial non-beta-lipoproteinemia , Familial hypobeta-lipoproteinemia
- Hereditary Glucose Metabolism Glycogen Storage Disorders, Steroid Metabolism Disorders: Fatty Deposited Diseases such as Fatty Liver, Steatotic Cardiomyopathy, Steatotic Renal Disease; Vascular Diseases such as Coronary Atherosclerotic Heart Disease Alcohol derivatives (such as bile acids, sex hormones (testosterone, estradiol, estriol, progesterone)) Metabolic disorders such as bile acid metabolic disorders, precocious puberty, delayed sexual development, disorders of sexual differentiation, other external genitalia Developmental defects; endocrine and metabolic syndromes such as Cushing syndrome, hyperaldosteronism, acute adrenal insufficiency, chronic adrenal insufficiency; tumors such as lipoma, lipoblastoma, liposarcoma, breast cancer
- the abnormal expression of the human acyl-CoA reductase 55 of the present invention will also produce certain developmental disorders, tumors, hereditary diseases, neurological diseases, blood diseases, and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human acyl-CoA reductase 55.
- Agonists enhance human acyl-CoA reductase 55 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human acyl-CoA reductase 55 can be cultured with labeled human acyl-CoA reductase 55 in the presence of drugs. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human acyl-CoA reductase 55 include screened antibodies, compounds, receptor deletions, and the like.
- An antagonist of human acyl-CoA reductase 55 can bind to human acyl-CoA reductase 55 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human acyl-CoA reductase 55 can be added to bioanalytical assays to determine whether the compound is a compound by measuring its effect on the interaction between human acyl-CoA reductase 55 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human acyl-CoA reductase 55 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 55 molecules of human acyl-CoA reductase should be labeled.
- the present invention provides the use of polypeptides, and fragments, derivatives, analogs or cells thereof as antigens.
- Methods of producing antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human acyl-CoA reductase 55 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human acyl-CoA reductase 55 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies to human acyl-CoA reductase 55 include, but are not limited to, hybridoma technology (Koh ler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
- the chimeric antibody variable region and a human constant region of non-human origin in combination produce the available prior art (Morr i son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human acyl-CoA reductase 55.
- Antibodies against human acyl-CoA reductase 55 can be used in immunohistochemistry to detect human acyl-CoA reductase 55 in biopsy specimens.
- Monoclonal antibodies that bind to human acyl-CoA reductase 55 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human acyl-CoA reductase 55 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human acyl-CoA reductase 55 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to the human acyl-CoA reduction domain 55.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human acyl-CoA reductase 55.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human acyl-CoA reductase 55 levels.
- tests are well known in the art and include FI SH assays and radioimmunoassays.
- the level of human acyl-CoA reductase 55 detected in the test can be used to explain the importance of human acyl-CoA reductase 55 in various diseases and to diagnose diseases in which human acyl-CoA reductase 55 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.
- the polynucleotide encoding human acyl-CoA reductase 55 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human acyl-CoA reductase 55.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express Heterohuman acyl-CoA reductase 55 to inhibit endogenous human acyl-CoA reductase 55 activity.
- a variant human acyl-CoA reductase 55 may be a shortened human acyl-CoA reductase 55 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human acyl-CoA reductase 55.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding human acyl-CoA reductase 55 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human acyl-CoA reductase 55 can be found in existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human acyl-CoA reductase 55 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human acyl-CoA reductase 55 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidation synthesis of oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human acyl-CoA reductase 55 can be used for the diagnosis of diseases related to human acyl-CoA reductase 55.
- the polynucleotide encoding human acyl-CoA reductase 55 can be used to detect the expression of human acyl-CoA reductase 55 or the abnormal expression of human acyl-CoA reductase 55 in a disease state.
- a DNA sequence encoding human acyl-CoA reductase 55 can be used to hybridize biopsy specimens to determine the expression of human acyl-CoA reductase 55.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mi croar ray) or a DM chip (also known as a "gene chip"), and used to analyze differential expression analysis and gene diagnosis of genes in tissues. .
- Human acyl-CoA reductase 55 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human acyl-CoA reductase 55 transcription products.
- Human acyl-CoA reductase 55 mutant forms include the same as normal wild-type human acyl-CoA Reductase 55 DNA sequences compared to point mutations, translocations, deletions, recombinations and any other abnormalities. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- the PCR primers (preferably 15-35b P ) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing diseased and oncoming individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, Glycerin and their combinations.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them.
- the polypeptide of the present invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human acyl-CoA reductase 55 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of human acyl-CoA reductase 55 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
- Phe Ala lie Ser Lys Glu Asp Met Gin Glu Leu Leu Ser Cys Thr
- Ala lie lie lie Tyr Asp Cys Tyr Leu Arg Leu Thr Gly Arg Lys Pro
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU15081/01A AU1508101A (en) | 1999-11-24 | 2000-11-20 | A novel polypeptide, a human acyl coa reductase 55 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99124089.8 | 1999-11-24 | ||
CN 99124089 CN1298001A (zh) | 1999-11-24 | 1999-11-24 | 一种新的多肽——人酰基辅酶a还原酶55和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001038543A1 true WO2001038543A1 (fr) | 2001-05-31 |
Family
ID=5283182
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000435 WO2001038543A1 (fr) | 1999-11-24 | 2000-11-20 | NOUVEAU POLYPEPTIDE, ACYL-CoA REDUCTASE HUMAINE 55, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1298001A (zh) |
AU (1) | AU1508101A (zh) |
WO (1) | WO2001038543A1 (zh) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992014816A1 (en) * | 1991-02-22 | 1992-09-03 | Calgene, Inc. | Seed plant fatty acyl reductase proteins and genes |
US5798235A (en) * | 1987-06-29 | 1998-08-25 | Massachusetts Institute Of Technology | Gene encoding bacterial acetoacetylco a reductase |
-
1999
- 1999-11-24 CN CN 99124089 patent/CN1298001A/zh active Pending
-
2000
- 2000-11-20 AU AU15081/01A patent/AU1508101A/en not_active Abandoned
- 2000-11-20 WO PCT/CN2000/000435 patent/WO2001038543A1/zh active Application Filing
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5798235A (en) * | 1987-06-29 | 1998-08-25 | Massachusetts Institute Of Technology | Gene encoding bacterial acetoacetylco a reductase |
WO1992014816A1 (en) * | 1991-02-22 | 1992-09-03 | Calgene, Inc. | Seed plant fatty acyl reductase proteins and genes |
US5370996A (en) * | 1991-02-22 | 1994-12-06 | Calgene, Inc. | Fatty acyl reductases |
Also Published As
Publication number | Publication date |
---|---|
CN1298001A (zh) | 2001-06-06 |
AU1508101A (en) | 2001-06-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001038377A1 (fr) | Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide | |
WO2001038371A1 (fr) | Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide | |
WO2001038522A1 (fr) | Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide | |
WO2001038543A1 (fr) | NOUVEAU POLYPEPTIDE, ACYL-CoA REDUCTASE HUMAINE 55, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001031030A1 (fr) | Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide | |
WO2001029228A1 (fr) | Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide | |
WO2001032701A1 (fr) | Nouveau polypeptide, sous-unite 15 de la synthase humaine f1f0 atp, et polynucleotide codant pour ce polypeptide | |
WO2001038545A1 (fr) | Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide | |
WO2001038379A1 (fr) | Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine | |
WO2001047983A1 (fr) | Nouveau polypeptide, facteur de liberation de la corticotrophine 13, et polynucleotide codant pour ce polypeptide | |
WO2001038389A1 (fr) | Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine | |
WO2001038540A1 (fr) | Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide | |
WO2001038369A1 (fr) | Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide | |
WO2001031024A1 (fr) | Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide | |
WO2001038381A1 (fr) | Nouveau polypeptide phosphodiesterase 17 humaine inhibee par gmpc et polynucleotide le codant | |
WO2001038386A1 (fr) | Nouveau polypeptide, facteur humain d'epissage sr 52, et polynucleotide codant pour ce polypeptide | |
WO2001032862A1 (fr) | Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide | |
WO2001030840A1 (fr) | Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide | |
WO2002036619A1 (fr) | Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide | |
WO2001075125A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 31, et polynucleotide codant pour ce polypeptide | |
WO2001030833A1 (fr) | Nouveau polypeptide, proteine de regulation d'un nouveau cycle cellulaire 53, et polynucleotide codant pour ce polypeptide | |
WO2001038520A1 (fr) | Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide | |
WO2001083776A1 (fr) | Nouveau polypeptide, hormone de croissance humaine 11, et polynucleotide codant pour ce polypeptide | |
WO2001038363A1 (fr) | Nouvelle proteine 37 a liaison membranaire humaine polypeptidique et polynucleotide codant ce polypeptide | |
WO2001038370A1 (fr) | Nouvelle sous-unite 49 de l'activateur de transcription polypeptidique et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase |