WO2001038545A1 - Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2001038545A1
WO2001038545A1 PCT/CN2000/000473 CN0000473W WO0138545A1 WO 2001038545 A1 WO2001038545 A1 WO 2001038545A1 CN 0000473 W CN0000473 W CN 0000473W WO 0138545 A1 WO0138545 A1 WO 0138545A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
human
sequence
galnac
Prior art date
Application number
PCT/CN2000/000473
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Bioroad Gene Development Ltd. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioroad Gene Development Ltd. Shanghai filed Critical Bioroad Gene Development Ltd. Shanghai
Priority to AU15117/01A priority Critical patent/AU1511701A/en
Publication of WO2001038545A1 publication Critical patent/WO2001038545A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45—Transferases (2)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human GalNAc-T45, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide. Background technique
  • Sugar is an important biological compound. Carbohydrates are a component of the cell structure, which regulates the viscosity, stores energy, and is also a component of the cell surface. Almost all site-specific intracellular responses involve cell surface sugars. For example, sperm and ovum need to be mediated by sugars on the cell surface when sperm and egg are combined. Some glycoproteins are tumor-associated antibodies and have been used to detect the presence of many types of tumors. Even free oligosaccharides can play a biological role. Oligosaccharides also affect the proteins or lipids bound to them [Rademacher et al., Ann.
  • oligosaccharides can affect Its stability, rate of proteolysis, rate of clearance from blood, thermal stability and solubility. Changes in the oligosaccharide portion of carbohydrates on the cell surface may cause cancer. Changes in certain types of oligosaccharides are also found during cell differentiation [Toone et al., Tetrahedron Report (1989) 45 (17): 5365-5422].
  • Glycoproteins often have 0-linked oligosaccharides, which are OH groups covalently attached to the side chains of the serine, threonine, and tyrosine residues of the protein. All or mainly oligosaccharide glycosylation involving 0-linkage occurs in the Golgi apparatus, and N-acetylgalactosamine is transferred from UDP-N-acetylgalactosamine to serine or threonine.
  • the enzymes that catalyze this reaction are the N-acetylgalactosamine transferase family.
  • GalNAc-T1 / T2 / T3 / T4 Two human N-acetylgalactosamine transferases have been cloned and identified, GalNAc-T1 / T2 / T3 / T4 [Homa et al. 1993; Hagen et al. 1993; White et al. 1995]. They catalyze different receptor substrates, but the structure of these receptor substrates is linked. Correspondingly, the two known glycosaminotransferase genes also have a similarity of 82% in a 61 amino acid sequence [White et al. 1995, EMBL access ion # L16621].
  • the new glycosyltransferase can also be used to treat various immune diseases caused by abnormal glycoprotein synthesis in the body, abnormal secretion of the endocrine system, etc .; the new glycosyltransferase can be used to artificially synthesize glycosylated polypeptides, these polypeptides Can be used in pharmaceutical products or other commercial applications.
  • the present invention has 40% homology with the porcine N-acetylgalactosyltransferase gene at the protein level, and has several amino acid sites conserved by such genes. Based on the above points, the novel gene of the present invention is considered to be a gene encoding human and porcine N-acetylgalactosyltransferase, named human GalNAC-T45, and the protein and porcine N-acetylgalactosyl are deduced from this. Transferases are similar and have similar biological functions.
  • the human GalNAc-T45 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
  • Human GalNAc-T45 protein, especially the amino acid sequence of this protein is identified. Isolation of the newcomer GalNAc-T45 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Disclosure of invention
  • An object of the present invention is to provide an isolated novel polypeptide __human GalNAc-T45 and fragments, analogs and derivatives thereof.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human Gal NAc-T45.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human Gal NAc-T45.
  • Another object of the present invention is to provide a method for producing human GalNAc-T45.
  • Another object of the present invention is to provide an antibody against the polypeptide of the present invention, namely human GalNAc-T45.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human polypeptide GalNAC-T45 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human Gal Mc-T45.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 51-1274 in SEQ ID NO: 1; and (b) a sequence having 1-2466 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human GalNAc-T45 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human GalNAc-T45 protein, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human GalNAc-T45.
  • Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RM, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • a protein or polynucleotide “variant” refers to a protein or polynucleotide that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human Gal NAc-T45, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human GalNAc-T45.
  • Antagonist refers to a molecule that, when combined with human GalNAc-T45, can block or regulate the biological or immunological activity of human GalNAc-T45.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human GalNAc-T45.
  • “Regulation” refers to a change in the function of human GalNAc-T45, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human GalNAc-T45.
  • “Substantially pure” means substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human GalNAc-T45 using standard protein purification techniques. Essentially pure human GalNAc-T45 produces a single main band on a non-reducing polyacrylamide gel. The purity of human GalNAc-T45 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Cl us ter method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Residues
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? It can specifically bind to the epitope of human GalNAc-T45.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is in the same or all of the natural systems. Separation of matter that coexists with it is separation.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and peptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or peptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated human GalNAc-T45 means that human GalNAc-T45 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
  • Those skilled in the art can purify human GalNAc-T45 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of human GalMc-T45 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, Ga1NAc-T45, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of human GalNAc-T45.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the human GalNAc-T45 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2466 bases in length and its open reading frame (51-1274) encodes 407 Amino acid.
  • the polypeptide has 40% homology with the porcine N-acetylgalactosyltransferase gene, and it can be inferred that the human GalNAC-T45 has similar porcine N-acetylgalactosyltransferase gene Structure and function.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human GalNAc-T45.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding human GalMc-T45 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or loss of marker gene function; (3) determination of the level of human GalNAc-T45 transcripts; (4) the Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human GalNAc-T45 gene.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human GalNAc-T45 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
  • a polynucleotide sequence encoding human GalNAc-T45 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human Ga 1NAC-T45 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on the promoter to enhance Gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human GalMc-T45 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human Gal NAc-T45 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
  • FIG. 1 is a comparison diagram of amino acid sequence homology between the inventors GalNAc-T45 and porcine N-acetylgalactosyltransferase gene.
  • the upper sequence is human GalNAc-T45, and the lower sequence is the porcine N-acetylgalactosyltransferase gene.
  • Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human GalNAc-T45. 45kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
  • the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0015B11 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the results show that the full-length cDNA contained in the 0015B11 clone is 2466bp (as shown in Seq IDN0: 1), and there is a 1224bp open reading frame (0RF) from 51bp to 1274bp, which encodes a new protein (such as Seq ID NO: 2).
  • This clone pBS-0015Bll and the encoded protein was named human GalNAc-T45.
  • Example 2 Homologous search of cDNA clones
  • the sequence of the human GalNAc-T45 and the protein sequence encoded by the present invention were performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] in Genbank , Swissport and other databases for homology search.
  • the gene with the highest homology to the human GalNAc-T45 of the present invention is a known porcine N-acetylgalactosyltransferase gene, and the accession number encoded by the protein in Genbank is ⁇ homology protein number ⁇ . Protein homology results are shown in Figure 1. The two are highly homologous, with 75% identity; 88% similarity.
  • Example 3 Cloning of a gene encoding human GalNAc-T45 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.
  • PCR amplification was performed with the following primers:
  • Primer 1 5,-GAGATGACTTCAGTGAGAGAG -3, (SEQ ID NO: 3)
  • Primer2 5'- CGGTGTCAGAAACACTTTATT -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l of KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol in a reaction volume of 50 ⁇ 1 Primer, 1U of Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72. C 2min.
  • RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P- labeled probes (about 2 x l0 0 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH 2 P0 4 (pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation and purification of recombinant human GalNAc-T45
  • Primer 3 5 — CCCCATATGATGGCCCGATTTTCCAAAGTG —3, (Seq ID No: 5)
  • Primer4 5'- CCCGAATTCCTAGGAGTTGGCATGGTGGTT -3, (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
  • the Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
  • a PCR reaction was performed using the P BS-OO Bll plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0015B11 plasmid, primers Primer-3 and Primer-4, and 'J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid P ET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5CC using the calcium chloride method.
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in serum-free serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum.
  • the peptide was bound to a cyanogen bromide-activated Seph arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to human GalNAc-T45.
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Glycosylation of proteins is a physiological process that is common in cells. Glycoproteins are part of the cell membrane and constitute cell surface antigens, and secreted proteins are also commonly glycosylated. N-acetylgalactosidase is an enzyme that catalyzes 0-linked glycosylation. It can be used to treat or prevent various diseases of the immune system, endocrine disorders and even cancer.
  • the polypeptide or a part thereof can be used to treat or prevent various immune system diseases, including but not limited to: rheumatoid arthritis, immune complex glomerulonephritis, Systemic lupus erythematosus, scleroderma, autoimmune hemolytic anemia, autoimmune interstitial nephritis, autoimmune gastritis, insulin autoimmune syndrome, etc.
  • various immune system diseases including but not limited to: rheumatoid arthritis, immune complex glomerulonephritis, Systemic lupus erythematosus, scleroderma, autoimmune hemolytic anemia, autoimmune interstitial nephritis, autoimmune gastritis, insulin autoimmune syndrome, etc.
  • polypeptide of the present invention or a part thereof can also be used to treat or prevent diseases caused by endocrine disorders, including but not limited to: Sheenhan syndrome, Simond syndrome, pituitary dwarfism, stunting, myxedema, and adrenal insufficiency Disease, diabetes, etc.
  • polypeptide of the present invention or a part thereof can also be used to treat or prevent cancer, such as epithelial tumors and the like.
  • the present invention can also be used to artificially synthesize glycosylated polypeptides, and these polypeptides can be used in pharmaceutical products or other commercial applications.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human GalNAc-T45.
  • Agonists enhance human GalNAc-T45 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • a mammalian cell or a membrane preparation expressing human GalNAc-T45 can be cultured with a labeled human GalNAc-T45 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human GalNAc-T45 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human GalNAc-T45 can bind to human GalNAc-T45 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
  • human GalNAc-T45 When screening compounds as antagonists, human GalNAc-T45 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human GalNAc-T45 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to human GalNAc-T45 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase.
  • human Gal NAc-T45 molecules should generally be labeled.
  • the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
  • These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against human Gal c-T45 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human GalNAc-T45 directly into immunized animals (eg rabbits, mice, rats, etc.).
  • immunized animals eg rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
  • Techniques for preparing monoclonal antibodies to human GalNAc-T45 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma Technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human GalNAc-T45.
  • Anti-Human GalMc-T45 antibodies can be used in immunohistochemistry to detect human GalNAc-T45 in biopsy specimens.
  • Monoclonal antibodies that bind to human GalMc-T45 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human GalNAc-T45 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill human GalNAc-T45 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human GalNAc-T45.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of human GalNAc-T45.
  • the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human GalNAc-T45.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human GalNAc-T45 detected in the test can be used to explain the importance of human GalNAc-T45 in various diseases and to diagnose diseases in which human GalNAc-T45 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding human GalMc-T45 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human GalNAc-T45.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variants GalNAc-T45 to inhibit endogenous human GalNAc-T45 activity.
  • a variant of human GalMc- T4 5 can be shortened, the signaling domain deleted human GalNAc- T45, although the substrate may be combined with the downstream, but lack signal transduction activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human GalNAc-T45.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human GalNAc-T45 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human GalNAc-T45 can be found in the existing literature (Sambrook, et al.).
  • recombinant polynucleotide encoding human GalNAc-T45 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit human GalNAc-T45 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
  • This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • the polynucleotide encoding human GalNAc-T45 can be used for the diagnosis of diseases related to human GalNAc-T45.
  • a polynucleotide encoding human GalNAc-T45 can be used to detect the expression of human GalNAc-T45 or the abnormal expression of human GalNAc-T45 in a disease state.
  • the DNA sequence encoding human GalNAc-T45 can be used to hybridize biopsy specimens to determine the expression of human GalNAc-T45.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available.
  • a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
  • Human GalNAc-T45 specific primers can also be used to detect human GalNAc-T45 transcripts by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).
  • Detection of mutations in the human GalNAc-T45 gene can also be used to diagnose human GalNAc-T45 related diseases.
  • Human GalNAc-T45 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human GalNAc-T45 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • the sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it.
  • chromosome Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mende l i an Inher i tance in Man (available online with Johns Hopk ins University Welch Med i cal Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the cDNA or genomic sequence differences between the affected and the affected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers, one or more containers An ingredient of the pharmaceutical composition of the present invention.
  • kit or kit containing one or more containers, one or more containers An ingredient of the pharmaceutical composition of the present invention.
  • containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human GalNAc-T45 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of human GalNAc-T45 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un nouveau polypeptide, GalNAc-T45 humain, le polypeptide codant pour ce polypeptide et le procédé de production de ce polypeptide par la technologie de recombinaison de l'ADN. En outre, cette invention concerne de nombreuses utilisations de ce polypeptide dans des méthodes de traitements de différentes maladies, notamment les tumeurs malignes, l'hémopathie, l'infection par le HIV, les maladies immunitaires et divers états inflammatoires, etc. Par ailleurs, cette invention concerne de nombreuses utilisations de ce polynucléotide codant pour le nouveau GalNAc-T45 humain.
PCT/CN2000/000473 1999-11-24 2000-11-20 Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide WO2001038545A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15117/01A AU1511701A (en) 1999-11-24 2000-11-20 A novel polypeptide, a human acetyl galactosyl transferase 45 and the polynucleotide encoding the polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99124100.2 1999-11-24
CN 99124100 CN1297907A (zh) 1999-11-24 1999-11-24 一种新的多肽——人乙酰半乳糖苷转移酶45和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2001038545A1 true WO2001038545A1 (fr) 2001-05-31

Family

ID=5283193

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000473 WO2001038545A1 (fr) 1999-11-24 2000-11-20 Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1297907A (fr)
AU (1) AU1511701A (fr)
WO (1) WO2001038545A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111041025B (zh) 2019-12-17 2021-06-18 深圳市瑞吉生物科技有限公司 基于结合N-乙酰半乳糖胺多肽的mRNA靶向分子及其制备方法
CN111744019B (zh) 2020-07-01 2023-08-04 深圳瑞吉生物科技有限公司 基于甘露糖的mRNA靶向递送系统及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5360733A (en) * 1992-10-01 1994-11-01 La Jolla Cancer Research Foundation Human β1-6 n-acetylglucosaminyl transferase
GB2288401A (en) * 1994-04-15 1995-10-18 Bay Dev Corp Sa N-acetylgalactosaminyltransferase
WO1996040971A1 (fr) * 1995-06-07 1996-12-19 Neose Technologies, Inc. Procede pour le transfert d'au moins deux motifs saccharide au moyen d'une polyglycosyltransferase

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5360733A (en) * 1992-10-01 1994-11-01 La Jolla Cancer Research Foundation Human β1-6 n-acetylglucosaminyl transferase
GB2288401A (en) * 1994-04-15 1995-10-18 Bay Dev Corp Sa N-acetylgalactosaminyltransferase
WO1996040971A1 (fr) * 1995-06-07 1996-12-19 Neose Technologies, Inc. Procede pour le transfert d'au moins deux motifs saccharide au moyen d'une polyglycosyltransferase

Also Published As

Publication number Publication date
CN1297907A (zh) 2001-06-06
AU1511701A (en) 2001-06-04

Similar Documents

Publication Publication Date Title
WO2001038377A1 (fr) Nouveau polypeptide - la proteine humaine 95 contenant un bromodomaine- et un polynucleotide codant pour ledit polypeptide
WO2001038371A1 (fr) Nouveau polypeptide glutamate arnt synthetase 58 d'origine humaine et polycnucleotide codant pour ce polypeptide
WO2001038522A1 (fr) Nouveau polypeptide, histone humaine h2a.21, et polynucleotide codant pour ce polypeptide
WO2001038545A1 (fr) Nouveau polypeptide, acetyle galactosyle transferase 45 humain et polynucleotide codant ce polypeptide
WO2001031030A1 (fr) Nouveau polypeptide, phosphodiesterase 21 humaine de type acide sphingomyelinase, et polynucleotide codant pour ce polypeptide
WO2001038379A1 (fr) Nouvelle proteine ribosomique humaine l23 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001029228A1 (fr) Nouveau polypeptide, caseine kinase humaine 48, et polynucleotide codant pour ce polypeptide
WO2001032701A1 (fr) Nouveau polypeptide, sous-unite 15 de la synthase humaine f1f0 atp, et polynucleotide codant pour ce polypeptide
WO2001038540A1 (fr) Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide
WO2001031024A1 (fr) Nouveau polypeptide, threonine synthetase 71, et polynucleotide codant pour ce polypeptide
WO2001038375A1 (fr) Nouveau polypeptide, proteine a doigt de zinc 58 et polynucleotide codant pour ce polypeptide
WO2001040294A1 (fr) Nouveau polypeptide, thrombospondine humaine 30, et polynucleotide codant pour ce polypeptide
WO2001038369A1 (fr) Nouveau polypeptide porteur tricarboxylate 39 du rat- et polynucleotide codant ledit polypeptide
WO2001038389A1 (fr) Nouvelle proteine ribosomique l14.22 a base d'un polypeptide et polynucleotide codant cette proteine
WO2001030840A1 (fr) Nouveau polypeptide, une proteine 57 a doigt de zinc, et polynucleotide codant pour ce polypeptide
WO2001030818A1 (fr) Nouveau polypeptide, proteine de liaison 33 a l'arn, et polynucleotide codant pour ce polypeptide
WO2001032863A1 (fr) Nouveau polypeptide, proteine humaine 12 associee a l'apoptose (sag), et polynucleotide codant pour ce polypeptide
WO2001030837A1 (fr) Nouveau polypeptide, galectine 15, et polynucleotide codant pour ce polypeptide
WO2001038386A1 (fr) Nouveau polypeptide, facteur humain d'epissage sr 52, et polynucleotide codant pour ce polypeptide
WO2001032862A1 (fr) Nouveau polypeptide, proteine humaine 20 ribosome s4, et polynucleotide codant pour ce polypeptide
WO2001038520A1 (fr) Nouveau polypeptide, proteine humaine 36 liee au mouvement de la bicouche de phospholipide, et polynucleotide codant pour ce polypeptide
WO2001038390A1 (fr) Nouveau polypeptide - proteine 25 snare humaine et polynucleotide la codant
WO2002036619A1 (fr) Nouveau polypeptide, glucoproteine humaine 42, et polynucleotide codant ce polypeptide
WO2001038543A1 (fr) NOUVEAU POLYPEPTIDE, ACYL-CoA REDUCTASE HUMAINE 55, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001027283A1 (fr) Nouveau polypeptide, proteine 16 de type transcriptase humaine inverse, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase